Process for producing carotenoids by modified plant cell cultures and products thereof
Metabolic engineering of plant cells using genetically modified polynucleotides enhances ketocarotenoid production, addressing yield and cost issues in natural production, offering a sustainable industrial solution.
Patent Information
- Application Number
- PCT/IB2025/052073
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-26
- Filing Date
- 2025-02-26
- Publication Date
- 2025-09-04
AI Technical Summary
The natural production of ketocarotenoids, such as astaxanthin and canthaxanthin, is limited by low yield efficiency, complexity in isolation, and high costs, making large-scale production economically unfeasible and environmentally unsustainable.
Metabolic engineering of plant cells using genetically modified polynucleotides encoding carotenoid-related genes (ZmPSY1, PacrtI, and crtW) under the Cauliflower Mosaic Virus 35S promoter, combined with Agrobacterium-mediated transformation, to enhance carotenoid biosynthesis and yield.
This method optimizes carotenoid production, achieving yields between 50 µg/g and 7000 µg/g of genetically modified plant cell biomass, providing a sustainable and cost-effective alternative for industrial applications in nutraceuticals, cosmetics, and animal feed.
Smart Images

Figure 00000045_0000 
Figure 00000045_0001 
Figure 00000045_0002
Abstract
Description
[0001] D E S C R I P T I O NPROCESS FOR PRODUCING CAROTENOIDS BY MODIFIED PLANT CELL CULTURES AND PRODUCTS THEREOFTECHNICAL F IELDThe present disclosure relates to plant gene engineering, particularly biotechnological production of carotenoids such as astaxanthin and canthaxanthin through metabolic engineering of plant cells, and uses thereof, e.g. nutraceutical, cosmetic, pharmaceutical and animal feed industry. BACKGROUND The market demand for carotenoids has surged due to their applications in nutraceuticals, cosmetics, pharmaceuticals, and animal feed. In nutraceuticals and functional foods, consumers seek natural sources of these valuable antioxidants for improved health and wellness. Cosmetics and skincare industries take advantage of carotenoids for their anti-aging and UV-protective properties, meeting growing preferences for natural and sustainable ingredients. Additionally, pharmaceutical companies apply carotenoids in formulations for their potential therapeutic benefits. This rising demand aligns with consumer preference for plant-derived, health-promoting compounds, driving the need for reliable and sustainable sources of carotenoids. Plants produce a variety of secondary metabolites with diverse applications for humans and animals. Among these compounds, pink-to-red ketocarotenoids such as canthaxanthin and astaxanthin are important pigments widely used in nutraceutical, cosmetic and animal feed industries. These secondary metabolites are also relevant for living systems due to their antioxidant properties and a protective action against photooxidative damage. Ketocarotenoids constitute a subgroup of carotenoids characterized by the presence of one or more ketone groups. Despite their value, the natural production of ketocarotenoids is limited due to the scarcity of natural ketocarotenoid-producing organisms. Low yield efficiency and the complexity of isolating ketocarotenoids make large-scale production economically unfeasible. Moreover, the high costs and environmental concerns associated with natural extraction further set back industrial applications. Overall, there is a need to improve and increase carotenoid productivity from natural sources or via heterologous production, aiming to overcome the drawbacks of natural production. These facts are disclosed in order to illustrate the technical problem addressed by the present disclosure.GENERAL DESCRIPTION The present disclosure relates to plant gene engineering, particularly biotechnological production of ketocarotenoids such as astaxanthin and canthaxanthin through metabolic engineering of plant cells, and uses thereof, including applications in nutraceutical, cosmetic, pharmaceutical, and animal feed industries. An aspect of the present disclosure relates to a polynucleotide for obtaining ketocarotenoids from genetically modified plant cells, comprising a nucleic acid sequence encoding a polypeptide comprising at least one carotenoid-related gene selected from the group consisting of: a ZmPSY1 gene from Zea mays, a PacrtI gene from Pantoea ananatis, a crtW gene from Brevundimonas, or any combination thereof. In some embodiments, the nucleic acid has a sequence at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence selected from a list consisting of: SEQ. ID No. 15, SEQ. ID No.16, SEQ. ID No. 17, or any combination thereof. Each possibility represents a separate embodiment of the disclosure. An aspect of the present disclosure relates to a polynucleotide for obtaining carotenoids from a genetically modified plant cell, comprising a nucleic acid sequence encoding a polypeptide comprising at least one carotenoid-related gene selected from the group consisting of: a ZmPSY1 gene from Zea mays, a PacrtI gene from Pantoea ananatis, a crtW gene from Brevundimonas, or any combination thereof; wherein the nucleic acid has a sequence at least 90% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof. In an embodiment, the nucleic acid has a sequence at least 95% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof. In an embodiment, the nucleic acid has a sequence identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof. In an embodiment, the carotenoid is a ketocarotenoid. In an embodiment, the polynucleotide comprises at least two of the following sequences SEQ. ID No.15, SEQ. ID No.16, and SEQ. ID No.17. In an embodiment, the polynucleotide comprises at least one of the following sequences SEQ. ID No.15 and SEQ. ID No.16; or SEQ. ID No.15 and SEQ. ID No.17; or SEQ. ID No.16 and SEQ. ID No.17; or SEQ. ID No.15, SEQ. ID No.16 and SEQ. ID No.17. In an embodiment, the polynucleotide is linked to a regulatory element. In an embodiment, the regulatory element is a CaMV 35S promoter. In an embodiment, the carotenoid is a ketocarotenoid and / or β-carotene. An aspect of the present disclosure relates to an artificial vector for obtaining carotenoids from a genetically modified plant cells comprising the polynucleotide according to the present disclosure. In an embodiment, the artificial vector is an expression vector or a plasmid. An aspect of the present disclosure relates to a cell for obtaining carotenoids from a genetically modified plant cell comprising the polynucleotide, the artificial vector, or both, according to the present disclosure. In an embodiment, the cell is a prokaryotic cell. In an embodiment, the cell is an Agrobacterium cell. In an embodiment, the cell is Agrobacterium tumefaciens strain GV3101::pMP90 or Agrobacterium tumefaciens strain GV3101::pMP90RK. An aspect of the present disclosure relates to a genetically modified plant cell for obtaining carotenoids comprising a polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising at least one carotenoid-related gene; wherein the nucleic acid has a sequence at least 90% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof. In an embodiment, in the genetically modified plant cell according to the present disclosure, the polynucleotide is the polynucleotide as described herein. In an embodiment, the genetically modified plant cell according to the present disclosure, the plant cell is selected from Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum. An aspect of the present disclosure relates to a composition comprising: i) the polynucleotide according to the present disclosure; ii) the artificial vector according to the present disclosure; iii) the cell according to the present disclosure; iv) the genetically modified plant cell according to the present disclosure; or v) any combination of i) to iv). In an embodiment, in the composition according to the present disclosure, the plant is selected from Nicotiana tabacum, Medicago truncatula. An aspect of the present disclosure relates to a process for producing a genetically modified plant cell comprising: providing a plant cell culture at an exponential phase of growth; introducing the plant cell culture with a cell according to the present disclosure, thereby obtaining genetically modified plant cell. In an embodiment, the genetically modified plant cell biomass comprises a carotenoid content between 50 µg / g and 7000 µg / g; wherein the plant cell is selected from the following list: Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum. In an embodiment, the genetically modified plant cell biomass comprises a carotenoid content between 50 µg / g and 5000 µg / g; wherein the plant cell is selected from the following list: Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum. An aspect of the present disclosure relates to a process for obtaining carotenoids from genetically modified plant cell, comprising the steps of: obtaining a recombinant Agrobacteria cell; obtaining a plant cell selected from the following list: Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum; transforming the plant cell with the recombinant Agrobacteria cell to obtain a transformed plant cell expressing a carotenoid-related gene; culturing the transformed plant cells to obtain a biomass of transformed plant cells; extracting carotenoids, from the biomass of transformed plant cells; wherein the recombinant Agrobacteria cell comprises a genetic construct comprising a sequence at least 90% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof. In an embodiment, in the process of the present disclosure, the carotenoids are astaxanthin or canthaxanthin, β-carotene or combinations thereof. In an embodiment, in the process of the present disclosure, the recombinant Agrobacteria cell comprises a genetic construct comprising a sequence at least 95% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination. In an embodiment, in the process of the present disclosure, the Agrobacteria cell is recombinant Agrobacterium tumefaciens cell. In an embodiment, in the process of the present disclosure, the process run under conditions suitable for carotenoid biosynthesis. In an embodiment, in the process of the present disclosure, the conditions comprise a) a Gamborg B5 medium or a Murashige and Skoog medium; b) during a period from 7 days to 15 days; c) at a temperature from 20 °C to 30 °C; or combination thereof. In an embodiment, the process of the present disclosure further comprising a step of carotenoids extraction. In an embodiment, in the process of the present disclosure, the biomass of transformed plant cells has a carotenoid content between 50 µg / g and 7000 µg / g. In an embodiment, in the process of the present disclosure, the step of transforming the plant cell comprises co‐cultivation the plant cell and the recombinant Agrobacteria cell in a suspension culture medium for a period of 2 to 3 days. In an embodiment, in the process of the present disclosure, the step of culturing the transformed plant cells comprises: transferring the transformed plant cells to a solid culture medium comprising 0.4% (w / v) gelrite supplemented with 500 mg / L Timentin and an appropriate selection marker antibiotic; or culturing the transformed plant cells in an adequate liquid culture medium for a period of 7 to 15 days under a photoperiod. In some embodiments, a photoperiod is of 16h of light and 8h of darkness, at a temperature of 20 °C to 30 °C. In an embodiment, in the process of the present disclosure, the Agrobacteria is Agrobacterium tumefaciens, Agrobacterium tumefaciens strain GV3101::pMP90 or Agrobacterium tumefaciens strain GV3101::pMP90RK. In an embodiment, in the process of the present disclosure, the plant cell is N. tabacum BY-2 cell or Medicago truncatula A17 cell. In an embodiment, in the process of the present disclosure, the carotenoid-related gene is selected from: ZmPSY1 gene from Zea mays, PacrtI gene from Pantoea ananatis, crtW gene from Brevundimonas. An aspect of the present disclosure relates to Carotenoids obtainable by the process according to the present disclosure as, wherein the carotenoids comprises a combination of astaxanthin and canthaxanthin, and wherein the weight ratio between astaxanthin and canthaxanthin is ranging from 10- 1 to 1:10. An aspect of the present disclosure relates to the use of the polynucleotide according to the present disclosure as an improver of carotenoids production from a genetically modified plant cell. In an embodiment, the present disclosure relates to use of the carotenoids according to the present disclosure as, in nutraceutical, cosmetics, pharmaceutics, or animal feed. An aspect of the present disclosure relates to a genetic construct comprising: SEQ. ID No.15 having the ZmPSY1 gene from Zea mays with ID No. AY324431, or SEQ. ID No.16 having the PacrtI gene from Pantoea ananatis with ID No. D90087, alone or in combination with SEQ. ID No.17 having the crtW gene from Brevundimonas sp. NBRC 101024 strain SD212 with ID No. AB181388, which are expressible under the Cauliflower Mosaic Virus 35S promoter (CaMV 35S) and 35S terminator. In an embodiment, the genetic construct comprises: a combination of SEQ. ID No.15 and SEQ. ID No.16; a combination of SEQ. ID No.15 and SEQ. ID No.17; or a combination of SEQ. ID No.16 and SEQ. ID No.17. In an embodiment, the genetic construct comprises a combination of SEQ. ID No.15, SEQ. ID No.16 and SEQ. ID No.17. An aspect of the present disclosure relates to recombinant Agrobacteria cells comprising a genetic construct as described herein. In an embodiment, the recombinant Agrobacteria cell is Agrobacterium tumefaciens. In an embodiment, the recombinant Agrobacteria cell is Agrobacterium tumefaciens strain GV3101:pMP90 or Agrobacterium tumefaciens strain GV3101:pMP90RK. In an embodiment, the recombinant Agrobacteria cell is Agrobacterium tumefaciens strain GV3101:pMP90 comprising a genetic construct having SEQ. ID No.15 or SEQ. ID No.16 as described in the present disclosure. In an embodiment, the recombinant Agrobacteria is Agrobacterium tumefaciens strain GV3101::pMP90RK comprising a genetic construct having SEQ. ID No.17 as described in the present disclosure. An aspect of the present disclosure relates to a transformed plant cell comprising a genetic construct as disclosed herein, with the following sequences and corresponding phenotypes: SEQ. ID No.15 having the ZmPSY1 gene from Zea mays with ID No. AY324431, presenting phenotype Y; or SEQ. ID No.16 having the PacrtI gene from Pantoea ananatis with ID No. D90087, presenting phenotype I; or SEQ. ID No.17 having the crtW gene from Brevundimonas sp. NBRC 101024 strain SD212 with ID No. AB181388, presenting the phenotype W; or SEQ. ID No.15 and SEQ. ID No.16 presenting the phenotype YI; or SEQ. ID No.15 and SEQ. ID No.17, presenting the phenotype YW; or SEQ. ID No.16 and SEQ. ID No.17 presenting the phenotype IW; or SEQ. ID No.15, SEQ. ID No.16 and SEQ. ID No.17 presenting the phenotype YIW. In an embodiment, the transformed plant cell is Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, or Solanum lycopersicum plant cell. In an embodiment, the transformed plant cell is Nicotiana tabacum, Medicago truncatula, N. tabacum BY-2 cells, or Medicago truncatula A17 cells. Another aspect of the present disclosure relates to a process for producing a transformed plant cell comprising the following steps: (a) providing a plant cell, as defined in the present disclosure, collected at the exponential phase of the growth curve in the respective suspension culture; (b) providing a recombinant Agrobacteria cell as defined in the present disclosure; (c) transforming the plant cell of step (a) with the recombinant bacteria of step (b) by co‐ cultivation in an adequate suspension culture medium during a period of 2 to 3 days; (d) transferring the transformed plant cells of step (c) to a solid culture medium comprising 0.4%(w / v) gelrite supplemented with 500 mg / L Timentin and appropriate selection marker antibiotic. In an embodiment, the present disclosure provides a process for producing carotenoids by metabolic engineering of cultured plant cells comprising the steps of: (e) Providing a transformed plant cell as described in the present disclosure; (f) Culturing the plant cells in an adequate liquid culture medium for a period of 7 to 15 days under a photoperiod, of 16h of light and 8h of darkness, at a temperature of 20 to 30 °C. In an embodiment, culturing the plant cells in an adequate liquid culture medium is at a temperature of 23 °C to 28 °C. In an embodiment, in the process for producing carotenoids, the carotenoids are extracted from the plant cell cultures obtained from step (b) by separation of the plant cells from the respective culture medium, followed by lyophilization and grinding of the separated plant cells with liquid nitrogen, and incubation of a resulting plant cell biomass with an organic solvent. In some embodiments, the organic solvent consists of a mixture of hexane:ethyl acetate (1:1) (v / v). In some embodiments, the amount of plant cell biomass is of 10 mg for 0.500 mL. In an embodiment, the process for producing carotenoids further comprises a step of concentration and collection of the carotenoids colored fraction. Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the disclosure, exemplary methods and / or materials are described below. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.BRIEF DESCRIPTION OF THE DRAWINGSSome embodiments of the disclosure are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the disclosure. In this regard, the description taken with the drawings make apparent to those skilled in the art how embodiments of the disclosure may be practiced. Figures 1A-C are schematic representations of T-DNA cassettes according to the present disclosure: T-DNA cassette of plasmid 1 (Figure 1A) used for the transformation of BY-2 cells; regions are represented as follow: left border (LB), nopaline synthase terminator (tNOS), kanamycin resistance marker (NeoR / KanR), nopaline synthase promoter (pNOS), Cauliflower Mosaic Virus 35S promoter (CaMV 35S), site-specific recombination site (attB1), phytoene synthase coding sequence (GenBank: AY324431), site-specific recombination site (attB2), 35S terminator (T35S), right border (RB); all dark lines are nucleotide sequences without relevant features. T-DNA cassette of plasmid 2 (Figure 1B) used for the transformation of BY-2 cells; regions are represented as follow: left border (LB), nopaline synthase terminator (tNOS), kanamycin resistance marker (NeoR / KanR), nopaline synthase promoter (pNOS), Cauliflower Mosaic Virus 35S promoter (CaMV35S), site-specific recombination site (attB1), transit peptide (TP), phytoene desaturase coding sequence (GenBank: D90087), site-specific recombination site (attB2), 35S terminator (T35S), right border (RB); all dark lines are nucleotide sequences without relevant features. T-DNA cassette of plasmid 3 (Figure 1C) used for the transformation of BY-2 and A17 cells; regions are represented as follow: left border (LB), nopaline synthase terminator (tNOS), kanamycin resistance marker (NeoR / KanR), nopaline synthase promoter (pNOS), matrix attachment regions (MAR), Cauliflower Mosaic Virus 35S promoter (CaMV35S), transit peptide (TP), β-carotene ketolase coding sequence (SEQ. ID No.5), 35S terminator (TS35), matrix attachment regions (MAR), right border (RB); all dark lines are nucleotides sequences without relevant features. Figures 2A-V are chromatograms of carotenoid profiles of tobacco BY-2 cell lines acquired by High performance liquid chromatography (HPLC). Each peak within the chromatograms corresponds to a distinct carotenoid compound. All chromatograms were recorded at 445 nm, with the y-axis scaled to the highest peak to ensure clarity, wherein: profile of tobacco BY-2 WT cell line (Figure 2A); tobacco BY-2 Y01 cell line (Figure 2B); tobacco BY-2 Y06 cell line (Figure 2AC); tobacco BY-2 Y07 cell line (Figure 2D); tobacco BY-2 I1 cell line (Figure 2E); tobacco BY-2 I11 cell line (Figure 2F); tobacco BY-2 I18 cell line (Figure 2G); tobacco BY-2 W04 cell line (Figure 2H); tobacco BY-2 W15 cell line (Figure 2I); tobacco BY-2 W29 cell line (Figure 2J); tobacco BY-2 YI1 cell line (Figure 2K); tobacco BY-2 YI17 cell line (Figure 2L); tobacco BY-2 YI30 cell line (Figure 2M); tobacco BY-2 YW02 cell line (Figure 2N); tobacco BY-2 YW08 cell line (Figure 2O); tobacco BY-2 YW015 cell line (Figure 2P); tobacco BY-2 IW05 cell line (Figure 2Q); tobacco BY-2 IW09 cell line (Figure 2R); tobacco BY-2 IW014 cell line (Figure 2S); tobacco BY-2 YIW6 cell line (Figure 2T); tobacco BY-2 YIW135 cell line (Figure 2U); and tobacco BY-2 YIW141 cell line (Figure 2V). Figures 3A-H are chromatograms of carotenoid profiles of Medicago A17 cell lines acquired by HPLC. Each peak within the chromatograms corresponds to a distinct carotenoid compound. All chromatograms were recorded at 445 nm, with the y-axis scaled to the highest peak to ensure clarity, wherein: carotenoid profile of Medicago A17 WT cell line (Figure 3A); Medicago A171.1 cell line (Figure 3B); Medicago A171.3 cell line (Figure 3C); Medicago A171.4 cell line (Figure 3D); Medicago A171.6 cell line (Figure 3E); Medicago A177 cell line (Figure 3F); Medicago A1715 cell line (Figure 3G); Medicago A17 27 cell line (Figure 3H). Figures 4A-F are graphs of ketocarotenoids and β-carotene content in tobacco BY-2 and Medicago A17 cell lines. Each data point represents the mean result derived from three biological replicates from the HPLC run, with error bars indicating the standard deviation (SD) for each measurement; Figure 4A is a graph of astaxanthin content in tobacco BY-2 cell lines; Figure 4B is a graph of canthaxanthin content in tobacco BY-2 cell lines; Figure 4C is a graph of β-carotene content in tobacco BY-2 cell lines; Figure 4D is a graph of astaxanthin content in Medicago A17 cell lines; Figure 4E is a graph of canthaxanthin content in Medicago A17 cell lines; and Figure 4F is a graph of β-carotene content in Medicago A17 cell lines. In all graphs quantification is shown as µg / g DW.DETAILED DESCRIPTION The present disclosure relates to a method of production of carotenoids, particularly ketocarotenoids through metabolic engineering of plant cells. In some embodiments, a method as described herein is of production of carotenes, xanthophylls, ketocarotenoids, or any combination thereof. According to the present disclosure, “plant cell” and “plant cells” refers to isolated plant cells in a culture medium. Plant cells according to the present disclosure are cells grown in suspension. A plant cell according to the present disclosure is an undifferentiated, non-photosynthetic cell. The terms “plant cell”, “cultured plant cell” and “plant cultured cell” are used herein interchangeably to refer to plant cells according to the present disclosure. The present disclosure is based, in part, on the finding that a method as described herein leads to the production of carotenoids, through metabolic engineering of plant cells (transformed plant cells) grown in suspension, instead of cells directly from a plant. The present disclosure provides a method for producing carotenoids from recombinant Agrobacteria cells comprising a genetic construct including at least one of SEQ. ID No.16, SEQ. ID No.17, or combinations thereof. The method optimizes carotenoid biosynthesis, leading to increased yield and enhanced color intensity. Surprisingly the present solution optimizes gene expression and metabolic pathways to maximize production efficiency, and color intensity offering a sustainable alternative for carotenoid production, particularly ketocarotenoid production. An aspect of the present disclosure relates to the method of producing modified (genetically modified) plant cell cultures, and to the method of producing carotenoids. The method of the present disclosure allows the production of carotenoids in a continuous (a non-stop working system), reliable, affordable, and environmentally sustainable manner. Another aspect of the present disclosure relates to engineering of cell lines of model plants to produce specific carotenoid pigments in a continuous sustainable and inexpensive manner. In an embodiment, the cell lines obtained by the method of the present disclosure exhibit distinct colors which correspond to different combinations of carotenoid pigments. In an embodiment, the methods disclosed herein provide a sustainable alternative to natural extraction of carotenoids, which is constrained by low yields and ecological impact. Plant cell cultures according to the present disclosure are a versatile biotechnological platform for carotenoid production, with applications in the nutraceutical, cosmetic, and animal feed industries. In an embodiment, the method of the present disclosure of transformation of plant cells using one or more carotenoid-related genes, either individually or in combination, results in colored plant cell- lines, such as white, yellow, pink-orange, brown-orange color and transition-colors thereof, in function of pigments expressed in each culture by the different carotenoid-related genes, allowing a correlation between the observed coloration and a carotenoid profile. Another aspect of the present disclosure relates to a polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising at least one carotenoid-related gene. In some embodiments, the polynucleotide comprises a nucleic acid sequence encoding a polypeptide comprising at least two carotenoid-related genes. In some embodiments, the carotenoid-related gene is selected from the group consisting of: a ZmPSY1 gene from Zea mays, a PacrtI gene from Pantoea ananatis, a crtW gene from Brevundimonas. In some embodiments, the polynucleotide is operably linked to a regulatory element. In some embodiments, the regulatory element is a CaMV 35S promoter. In some embodiments, the polynucleotide comprises a nucleic acid sequence as set forth in SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof. In some embodiments, the polynucleotide comprises SEQ. ID No.15, SEQ. ID No.16, and SEQ. ID No.17. According to the present disclosure, a polynucleotide as described herein refers to a genetic construct. As used herein “genetic construct” refers to engineered DNA or RNA sequences, including one or more genes of interest (such as the ZmPSY1, PacrtI, and crtW genes), along with regulatory elements (such as promoters, terminators, and selection markers). Genetic construct can be inserted into a vector (e.g., plasmids), which can be used to introduce the construct into host cells. Another aspect of the present disclosure relates to an artificial vector comprising the polynucleotide as described hereinabove. In some embodiments, the artificial vector is an expression vector or a plasmid. Another aspect of the present disclosure relates to a cell comprising: a) the polynucleotide as described hereinabove; b) the artificial vector as described hereinabove, or c) both. In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is an Agrobacterium cell. The Agrobacterium cell comprises any type, strain, or line of Agrobacterium that is sufficient to express the polypeptide of the present disclosure. Non-limiting examples of such cell, include, but are not limited to Agrobacterium tumefaciens strain GV3101::pMP90 and Agrobacterium tumefaciens strain GV3101::pMP90RK. It should be understood that genetically modified plant cell can be obtained by methods known in the art. Non-limiting examples of suitable methods according to the present disclosure, include Agrobacterium-mediated transformation, gene gun (biolistic transformation), and microinjection. Another aspect of the present disclosure relates to a genetically modified plant cell comprising the polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising at least one carotenoid-related gene. In some embodiments, the polynucleotide is as described hereinabove. In some embodiments, the plant is selected from Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum. It should be understood that according to the present disclosure, a plant refers to any suitable plant which their cells can divide and grow efficiently in a liquid medium and therefore are suitable for cell suspension cultures. Another aspect of the present disclosure relates to a composition comprising: i) the polynucleotide as described herein; ii) the artificial vector as described herein; iii) the cell as described herein; iv) the genetically modified plant cell as described herein; or v) any combination of i) to iv). In some embodiments, the plant is selected from Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum. According to some embodiments, the present disclosure relates to an extract obtained or derived from the cell disclosed herein. In some embodiments, the extract comprises: a) the polynucleotide disclosed herein; b) the expression vector or the plasmid disclosed herein; or c) both. According to some embodiments, the present disclosure relates to a composition comprising: a) the polynucleotide disclosed herein; b) the expression vector or the plasmid disclosed herein; c) the cell disclosed herein; d) the genetically modified plant cell disclosed herein; e) the extract disclosed herein; or f) any combination thereof. In some embodiments, the composition further comprises an acceptable carrier. According to some embodiments, the present disclosure relates to use of a genetically modified plant cell as described herein, in nutraceutical, cosmetic, pharmaceutical and animal feed industry. According to some embodiments, the present disclosure relates to a method for producing a genetically modified plant cell comprising: a) providing a plant cell culture at an exponential phase; b) contacting the plant cell culture with a bacteria cell as described herein, thereby obtaining genetically modified plant cell. In some embodiments, the bacteria cell is in contact with the plant cell culture for period of time ranging from 1 day to 4 days, or 2 to 3 days. Each possibility represents a separate embodiment of the disclosure. According to some embodiments, the present disclosure provides a process for producing carotenoids, comprising culturing a genetically modified plant cell as described herein, under conditions suitable for carotenoid biosynthesis. In some embodiments, the carotenoid comprises astaxanthin, canthaxanthin, β-carotene or any combination thereof. In some embodiments, the method of culturing the genetically modified plant cell comprises: a) obtaining a Gamborg B5 medium or a Murashige and Skoog medium; b) incubating the genetically modified plant cell in the medium for a period of time ranging from 7 days to 15 days at a temperature from 20 °C to 30 °C. In some embodiments, the method of culturing the genetically modified plant cell further comprises a step of extracting the carotenoids from the genetically modified plant cell. According to some embodiments, the method of the present disclosure allows genetically modified plant cell biomass comprising a carotenoid content between 50 µg / g and 5000 µg / g to be obtained. Another aspect of the present disclosure relates to carotenoids obtainable by the process as described in the process of the present disclosure, wherein the carotenoid is a ketocarotenoid and / or β- carotene. Another aspect of the present disclosure relates to a composition comprising carotenoids obtainable by the process as described hereinabove. In some embodiments, the carotenoids comprise at least one ketocarotenoid. In some embodiments, the carotenoids comprise a combination of astaxanthin and canthaxanthin. In some embodiments, the carotenoids comprise astaxanthin and canthaxanthin, wherein the weight ratio between astaxanthin and canthaxanthin is ranging from 10:1 to 1:10. In some embodiments, the carotenoids comprise astaxanthin and canthaxanthin, wherein the weight ratio between astaxanthin and canthaxanthin is ranging from 10:1 to 1:5, from 10:1 to 1:2, from 7:1 to 1:5, from 5:1 to 1:5, from 3:1 to 1:5, from 2:1 to 1:5, from 7:1 to 1:2, from 5:1 to 1:2, from 3:1 to 1:2, from 2:1 to 1:2, or from 1:1 to 1:5. Each possibility represents a separate embodiment of the disclosure. Non-limiting examples of a use of the carotenoids as described hereinabove include use in nutraceutical, cosmetics, pharmaceutics, or animal feed. According to the present disclosure, carotenoids obtainable by the process as disclosed herein and compositions comprising carotenoids obtainable by the process disclosed herein, are used as a mixture of carotenoids. In some embodiments, mixtures of carotenoids disclosed herein are separated according to methods known in the art, and each carotenoid used individually. The present disclosure is based, in part, on the finding that a ratio of astaxanthin and canthaxanthin can be controlled by choosing appropriate phenotype. The terms “polynucleotide” and “nucleic acid” as used interchangeably herein, refer to polymers of nucleotides of any length. The term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence. In general, and throughout this specification, the term “vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors”. Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. The term "expression vector" as used herein, refers to a nucleic acid molecule (e.g., a plasmid, phage, autonomously replicating sequence (ARS), artificial chromosome, yeast artificial chromosome (e.g., YAC)) that can be replicated in a host cell and be utilized to introduce a gene or genes into a host cell. EXAMPLES Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the disclosure in a non-limiting fashion. In the scope of the present disclosure, the following expressions: “ACN” means “acetonitrile”, “Agrobacteria” means "Agrobacterium tumefaciens”, “A. tumefaciens”, “ANOVA” means “One-way analysis of variance”, “BY-2 cells” means “tobacco BY-2 cells”, “Nicotiana tabacum BY-2 cells” or “N. tabacum BY-2 cells”, “CaMV 35S” means “Cauliflower Mosaic Virus 35S”, “G5” means “G5 medium”, “Gamborg B5 medium” or “G5 solidified medium”, “HPLC” means “high-performance liquid chromatography”, “LSD” means “Uncorrected Fisher's Least Significant Difference”, “Medicago cells” means “Medicago A17 cells”, “A17 cells", “Medicago truncatula A17 cells” or “Medicago truncatula A17 cultured cells”, “MeOH” means “methanol”, “MS” means “Murashige and Skoog medium”, “MS medium”, “MS solidified medium” or “solidified MS medium”, and “WT” means "wild-type”. Materials and methods MS medium: Murashige and Skoog basal mixture 1x, 30 g / L sucrose, 0.2 g / L KH2PO4, 0.1 g / L myo- inositol, 0.2 mg / L 2,4-Dichlorophenoxyacetic acid (2,4-D) and 1 mg / L thiamine, pH adjusted to pH 5.8. G5 medium: Gamborg B5 including vitamins mixture 1x, 20 g / L sucrose, 0.1 mg / L 6- Benzylaminopurine (BAP), 1 mg / L 2,4-D, 5 mg / L citric acid, 5 mg / L ascorbic acid, pH adjusted to pH 5.5. Carotenoid-related genes The genetic elements used in the present disclosure include: ZmPSY1 gene (GenBank: AY324431) from Zea mays, sourced from Plasmid Y, PacrtI gene (GenBank: D90087) from Pantoea ananatis, sourced from Plasmid I, and crtW gene (GenBank: AB181388) from Brevundimonas sp. NBRC 101024 strain SD212, which was codon-optimized for expression in Nicotiana tabacum and commercially synthesized. Gene amplification For the construction of plasmid 1 and plasmid 2, the ZmPSY1 and PacrtI genes were amplified by PCR using specific primers for each gene. SEQ. ID No.1 and SEQ. ID No.2 were constructed as primers for ZmPSY1, and SEQ. ID No.3 and SEQ. ID No.4 were constructed as primers for PacrtI. Vector construction The above-mentioned amplified gene fragments were individually subcloned into the pDONR221 vector utilizing Gateway recombination techniques. Subsequently, the fragments were transferred to the binary vector via GATEWAY recombination. This process yielded plasmids 1 (SEQ. ID No.15) and 2 (SEQ. ID No.16), both under control of the Cauliflower Mosaic Virus 35S promoter (CaMV 35S) and featuring a kanamycin selection marker. The coding sequence SEQ. ID No.5 for crtW from Brevundimonas sp. NBRC 101024 strain SD212 (GenBank: AB181388) was synthesized with the addition of EcoRI and BamHI restriction sites at the 5´and 3´ends, respectively. It includes a fused sequence SEQ. ID No.6 encoding the plastid-transit peptide from pea (Pisum sativum) ribulose 1,5-biphosphate carboxylase small subunit (GenBank: X00806). The gene was cloned into plasmid 3 by using the EcoRI and BamHI sites (SEQ. ID No.17). The genes in plasmid constructs 1, 2 and 3, with respectively SEQ. ID No.15, SEQ. ID No.16 and SEQ. ID No.17 and Figure1A, Figure1B and Figure1C, were expressed under the Cauliflower Mosaic Virus 35S promoter (CaMV 35S) and 35S terminator, using kanamycin antibiotic as selection marker. Bacterial transformation The constructs plasmid 1 and 2 were transferred into Agrobacterium tumefaciens (A. tumefaciens) strain GV3101::pMP90. Plasmid 3 was transferred into A. tumefaciens strain GV3101::pMP90RK. Transformed A. tumefaciens as described below was collected by centrifugation and resuspended in infiltration medium Murashige and Skoog medium supplemented with 50 g / L sucrose, 2 g / L glucose, pH 5.3, and 200 µM of acetosyringone. Transformation of tobacco BY-2 and Medicago A17 cell suspension cultures Cell cultures Plant cell cultures were established and maintained according to the specific conditions described in the literature for each type of plant. Cell suspension cultures were kept under light conditions and calli were grown in the same medium with micro agar at 0.7%(w / v) under light conditions. Plant cultured cells were transformed by co‐cultivation with the recombinant A. tumefaciens of the present disclosure. The manipulation of a carotenoid pathway of plant cells was achieved through combinatorial transformation with carotenogenic genes under the control of the strong promoter, such as CaMV 35S and 35S terminator. Single-gene transformation of cultured cells with either ZmPSY1 gene from Zea mays, PacrtI gene from Pantoea ananatis or crtW gene from Brevundimonas was conducted. Transformations were performed using combinations of the ZmPSY1 and PacrtI genes; ZmPSY1 and crtW genes; and PacrtI and crtW genes as described hereinabove. Multi-gene transformation was carried out by incorporation of all ZmPSY1, PacrtI and crtW genes. The transformation of plant cells as described hereinabove, generated 7 distinct phenotypes: Y, I, W, YI, YW, IW and YIW corresponding respectively to single or combinatorial transformations with the following genes, which are summarized in Table 1. Table 1. Plant cell phenotypes obtained by single and combinatorial transformation with recombinant A. tumefaciens. LINE PHENOTYPE GENOTYPE SOURCE SEQ.ID. No. a Y ZmPSY1 Zea mays 15 b I PacrtI Pantoea ananatis 16 c W crtW Brevundimonas sp. 17 d YI ZmPSY1 Zea mays 15 PacrtI Pantoea ananatis 16 e YW ZmPSY1 Zea mays 15 crtW Brevundimonas sp. 17 f IW PacrtI Pantoea ananatis 16 crtW Brevundimonas sp. 17 ZmPSY1 Zea mays 15 g YIW PacrtI Pantoea ananatis 16 crtW Brevundimonas sp. 17 Selection of the desired recombinant cells Following a two-day co-culture period, plant cells were transferred to solidified medium supplemented with 500 mg / L ticarcillin disodium / clavulanate potassium (Timentin) to eliminate Agrobacteria and 100 mg / L kanamycin to select transformants. After 2 to 4 weeks, the resulting micro- calli were transferred to fresh medium containing 50% decrease of Timentin. Untransformed plant cells (wild-type) presented a white to yellowish pale color, depending on cell density, whereas the transformed cells expressing carotenoids, according to the present disclosure, presented colored phenotypes. PacrtI (I) transformants showed a similar color to the wild-type (WT), whereas ZmPSY1 (Y) transformants displayed pale / light to strong yellow pigmentation. In contrast, crtW (W) transformants presented a light brownish, light pink or a mixed pink-orange coloration. In cases when two or more genes were co-expressed, double and triple transformants, a wider variety of colors was observed: white or yellow from transformation with plasmid 1 and 2 (YI); white, pink- orange or orange from transformation with plasmid 1 and 3 (YW) or from transformation with plasmid 2 and 3 (IW); and white, yellow or pink-orange colored calli from transformation with plasmid 1, 2 and 3 (YIW). It was further observed that all the transgenic calli exhibit normal development and morphology, comparable to the WT. Moreover, the color intensity of the transgenic calli increases after three weeks of growth under controlled light. Several calli from each transformation can be selected through color- based screening for further analysis and testing. Phenotypic observations of Nicotiana tabacum BY-2 and Medicago truncatula A17 cell lines grown in supplemented solid Murashige and Skoog (MS) and Gamborg B5 (G5) medium, were performed. Table 2 presents the phenotype of Nicotiana tabacum BY-2 cell lines, grown in supplemented solid MS medium, with the following reference numbers, respective color-codes, wherein letters C = Callus. Table 2. Hexadecimal color code for each tobacco BY-2 cell line. Descriptor C1 C2 C3 C4 C5 C6 Ref # Y01 Y06 Y07 I1 I11 I18 Hexadecimal Color code #e5cf42 #fae560 #fee345 #faea85 #fef6a8 #f6efad Descriptor C7 C8 C9 C10 C11 C12 Ref # W04 W15 W29 YI1 YI17 YI30 Hexadecimal Color code #f0b979 #ed8a31 #fa974a #f6e069 #fef088 #eddf7f Descriptor C13 C14 C15 C16 C17 C18 Ref # IW05 IW09 IW014 YW02 YW08 YW015 Hexadecimal Color code #d2c365 #e5903e #edbb67 #f99a3e #fda253 #e9a34b Descriptor C19 C20 C21 C22 Ref # YIW6 YIW135 YIW141 WT Hexadecimal Color code #e1cb4a #e89254 #f6944d #eae3a3 Table 3 presents the phenotype of Medicago truncatula A17 cell lines, grown in supplemented solid G5 medium with the following reference numbers, respective color-codes, wherein letters C = Callus. Table 3. Hexadecimal color code for each Medicago cell line. Descriptor C1 C2 C3 C4 Ref # 1.1 1.3 1.4 1.6 Hexadecimal Color code #cfd0ad #f2c28c #d1b895 #eeb996 Descriptor C5 C6 C7 C8 Ref # 7 15 27 WT Hexadecimal Color code #e1c295 #c3c8b8 #e4b479 #ecdbac Analysis of the transformed plant cell suspension cultures The presence of transgenes in plant cell lines was confirmed by PCR as known in the art, using specific primers with SEQ. ID No.7 and SEQ. ID No.8 primers for the ZmPSY1 gene, SEQ. ID No.9 and SEQ. ID No.10 primers for the PacrtI gene, and SEQ. ID No.11 and SEQ. ID No.12 or SEQ. ID No.13 and SEQ. ID No.14 for the crtW gene. Total carotenoid extraction Carotenoid extraction from plant cell cultures was performed by methods known in the art. Plant cells underwent lyophilization followed by grinding with liquid nitrogen. The plant biomass was incubated with an organic solvent solution, such as a mixture of hexane:ethyl acetate, and the colored organic fraction was collected. These extraction steps were repeated until color exhaustion. The organic phase was concentrated by evaporation, and the resulting dry extract was then re-suspended in a determined volume of methanol (MeOH) to achieve a final concentration of 5 mg / mL. The analysis of total carotenoid extracts was performed by reverse phase chromatography, such as by using a C18 reverse phase column. Carotenoid production without substrate feeding was possible by the plant cell cultures generated via expression of various combinations of carotenoid-related genes. This combinatorial transformation resulted in colored plant cells. EXAMPLE 1 PLANT CELL SUSPENSION CULTURES Nicotiana tabacum cv. Bright Yellow 2 (BY-2) Nicotiana tabacum BY-2 cell suspension cultures were maintained in liquid culture and stocks were maintained as calli, in the same medium containing micro agar at 0.7% (w / v). Liquid cultures were kept in an orbital shaker (125 rpm) at 28 °C, under a photoperiod of 16 hours of light and 8 hours of darkness with an illumination intensity of 80-100 μmol / m2 / s1. Calli were maintained under identical temperature and photoperiod conditions, with an illumination intensity set at 50 μmol / m2 / s1. Liquid cultures were subcultured into fresh medium weekly, while calli were subcultured every three to four weeks. BY-2 cell lines were grown in MS basal medium, containing 30 g / L sucrose, 0.2 g / L KH2PO4, 0.1 g / L myo-inositol, 0.2 mg / L 2,4-D and 1 mg / L thiamine, pH adjusted to pH 5.8. Medicago truncatula A17 Medicago A17 cell line was generated in-house, according to Ferreira et al.2023, using the starting material reference genotype A17. Both calli and liquid cultures were maintained as previously described in the literature. A17 cell suspension cultures were grown under a photoperiod of 16h of light and 8h of darkness, with an illumination intensity of 30-40 μmol / m2 / s1, in an orbital shaker at 130 rpm and at a temperature of 23 °C. Calli were grown under a 12h / 12h photoperiod, with an illumination intensity of 50 μmol / m2 / s1. Liquid cultures were subcultured into fresh medium every two weeks, while calli were subcultured monthly. Medicago cell lines were grown in G5 medium including vitamins supplemented with 20 g / L sucrose, 0.1 mg / L 6-BAP, 1 mg / L 2,4-D, 5 mg / L citric acid, 5 mg / L ascorbic acid, pH adjusted to pH 5.5. EXAMPLE 2 VECTOR CONSTRUCTION Plasmid 1 – ZmPSY1 gene from Zea mays (GenBank: AY324431). The gene was taken from plasmid p326-ZmPSY1. The gene was amplified by PCR using 5’-attB1-ATGGCCATCATACTCGTAC-3’ and 5’-attB2- CTAGGTCTGGCCATTTCTCA-3’ primers. The fragment was subcloned into pDONR221 via Gateway recombination with BP Clonase™ II enzyme mix and then cloned into a pK2GW7 vector via GATEWAY recombination with LR Clonase™ II enzyme mix (Invitrogen). Plasmid 2 – PacrtI gene from Pantoea ananatis (GenBank: D90087). The gene was taken from plasmid pHORP-PacrtI 5’-attB1-ATGGCTTCTATGATATCCT-3’ and 5’-attB2-TCATATCAGATCCTCCAGCA-3’ primers for PacrtI. The fragment was subcloned into pDONR221 via Gateway recombination with BP Clonase™ II enzyme mix and then cloned into a pK2GW7 vector via GATEWAY recombination with LR Clonase™ II enzyme mix (Invitrogen). Plasmid 3 – crtW gene from Brevundimonas (GenBank: AB181388). The coding sequence for crtW from Brevundimonas sp. NBRC 101024 strain SD212, fused to a sequence encoding the plastid-transit peptide from pea (Pisum sativum) ribulose 1,5-biphosphate carboxylase small subunit (GenBank: X00806), was synthesized by a commercial supplier with the addition of EcoRI and BamHI restriction sites at the 5´and 3´ends, respectively. The gene fusion was cloned into a backbone vector containing the MARs regions flanking the 35S promoter and 35S terminator, using the EcoRI and BamHI sites. Plasmids 1 and 2 were transferred into Agrobacterium tumefaciens strain GV3101::pMP90 by the freeze-thaw method known in the art. Plasmid 3 was transferred into A. tumefaciens strain GV3101::pMP90RK competent cells by the freeze-thaw method known in the art. EXAMPLE 3 TRANSFORMATION OF BY-2 AND A17 CELL SUSPENSION CULTURES For transformation, cell cultures were collected at the exponential phase, to be used for co- culture with Agrobacterium. The exponential phase was identified at the time point where the cells proliferate and divide exponentially before reaching the stationary phase. Tobacco BY-2 Cells were collected on day 4 of the growth curve. Single gene transformation was carried out as described by Ferreira et al.2023. For multiple gene transformation, recombinant Agrobacterium carrying individual genes were incubated together prior to co-culture. Following a two-day co-culture period, the cells were transferred to 0.4%(w / v) gelrite MS solidified medium supplemented with 500 mg / L Timentin, to eliminate Agrobacteria, and 100 mg / L kanamycin to select transformants. After two to four weeks, micro-calli were transferred to fresh 0.7%(w / v) micro agar MS solidified medium for BY-2 micro-calli. Timentin was reduced by half in each passage, until complete elimination. In parallel, a wild-type culture was maintained along with the transgenic cultures. Liquid cultures were established, by methods known in the art, from portions of the selected calli. Both wild-type and transgenic BY-2 calli were subcultured every three to four weeks, and cell suspensions were subcultured on the 7thday of the growth curve. Medicago A17 Cells were collected on day 7 of the growth curve for transformation. Following a two-day co- culture period, the cells were transferred to 0.4% (w / v) gelrite G5 solidified medium supplemented with 500 mg / L Timentin to eliminate Agrobacteria, and 100 mg / L kanamycin to select transformants. After two to four weeks, micro-calli were transferred to fresh 0.7% (w / v) micro agar G5 solidified medium for Medicago micro-calli. Timentin was reduced by half in each passage, until complete elimination. In parallel, a wild-type culture was maintained along with the transgenic cultures. Liquid cultures were established, by methods known in the art, from portions of the selected calli. Both wild-type and transgenic A17 calli were subcultured monthly, and cell suspensions were subcultured at intervals of 11-15 days. EXAMPLE 4 SCREENING FOR POSITIVE TRANSFORMATS Tobacco BY-2 Genomic DNA was extracted from tobacco BY-2 wild-type and transgenic cell lines by known methods in the art. PCR reactions were performed using primers designed for each construct. For plasmid 1 the primers were SEQ. ID No.7 and SEQ. ID No.8. For plasmid 2 primers were SEQ. ID No.9 and SEQ. ID No.10. For plasmid 3 the primers were SEQ. ID No.11 and SEQ. ID No.12. The thermocycling conditions contained an initial denaturation at 95 °C for 10 min followed by 35 cycles of denaturation (94 °C, 30s), annealing (65-69 °C for 30s), extension (72 °C, 15s) followed by a final extension (72 °C, 10 min). Medicago A17 From Medicago wild-type and transgenic cell lines, the genomic DNA was extracted. PCR reactions were performed using the below-mentioned primers SEQ. ID No.13 and SEQ. ID No.14 for plasmid 3. The thermocycling conditions contained an initial denaturation at 95 °C for 2 min followed by 35 cycles of denaturation (95 °C, 30s), annealing (69 °C for 30s), extension (72 °C, 15s) followed by a final extension (72 °C, 5 min). EXAMPLE 5 CARATENOID EXTRACTION AND QUANTIFICATION For carotenoid extraction, the plant cells were collected by filtration, lyophilized for 72h, followed by grinding with liquid nitrogen. For each 10 mg of biomass, 0.5 mL of a 1:1 hexane:ethyl acetate solution was added. The mixture was incubated at 45 °C for 2 hours, with vortexing performed every 20 minutes for a total of six rounds. The colored organic fraction was collected by centrifugation, wherein these extraction steps were repeated until color exhaustion. The total organic phase was evaporated in a vacuum concentrator and the dry extract resuspended in MeOH, to a final concentration of 5 mg / mL. The samples were filtered through a 0.22 µm nylon syringe filter. The analysis of the samples, by high performance liquid chromatography (HPLC), was employed utilizing a Waters Alliance System equipped with diode array detector with a detection range of 190 to 800 nm. A C18 reverse phase column (DeltaPaK 5µm particle size, 3.9 x 150 mm) was used for the separation of total carotenoid extracts. The mobile phase was a linear gradient of acetonitrile (ACN) and water with a flow rate of 0.5 mL / min (70% to 100% ACN in 20 min, maintained at 100% for 5 min, reduced back to 70% ACN over 2 min, and held at 70% ACN for 10 min). The chromatograms were recorded at 445 nm and the carotenoids were identified according to reference standards, retention time and UV absorption spectral properties, as shown in Figures 2A-V and Figures 3A-H. Quantitative analysis was carried out on the basis of peak areas in the chromatogram (Figures 4A- F) of three biological replicates for each cell line. Standards for astaxanthin, canthaxanthin and β-carotene several concentrations of each standard were prepared. Calibration curves for each standard were prepared, with each concentration (µg mL-1) corresponding to an integrated peak area. Using these calibration curves, corresponding peaks for astaxanthin, canthaxanthin and β-carotene were identified in all samples and integrated those peaks. From the integrated areas, the amounts of these three carotenoids were calculated (µg mL-1). By knowing the amount of extract for each sample and the biomass produced by an extract, the concentrations of astaxanthin, canthaxanthin and β-carotene in the biomass were determined (µg g DW-1). One-way analysis of variance (ANOVA) Uncorrected Fisher's Least Significant Difference (LSD) was used to determine significant differences between pairwise comparisons among the transgenic lines and their controls. The calculations involving one-way ANOVA Uncorrected Fisher’s LSD, means, and standard deviations were performed using GraphPad Prism software (GraphPad Software) and are presented in Table 4 and Table 5. Table 4 shows the quantification of carotenoid content in wild-type (WT) and three samples of transgenic cell lines for each transformation event, wherein the letters Y, I, W, YI, YW, IW and YIW represent the phenotypes of the tobacco BY-2 transgenic cell lines, and the numbering there associated represent the identification of each one of the 3 samples. Table 4. Carotenoid content in wild-type and three independent transgenic tobacco BY-2 cell lines for each transformation event. Astaxanthin Canthaxanthin β-carotene µg / g DW µg / g DW µg / g DW WT nd nd 83.6 ± 53.4.Y01 nd nd 3128.5 ± 3001.2bY06 nd nd 1624.2 ± 315.5.Y07 nd nd 5035.8 ± 578.8dI1 nd nd 891.6 ± 408.1. I11 nd nd 395.7 ± 309.7.I18 nd nd 496.1 ± 42.1.W04 90.8 ± 32.4.20.0 ± 26.3.124.2 ± 45.2.W15 112.6 ± 15.8.55.1 ± 24.7.460.9 ± 249.5.W29 126.5 ± 64.8.44.5 ± 49.1.289.2 ± 25.0.YI1 nd nd 4675.9 ± 2624.0dYI17 nd nd 4685.5 ± 642.2dYI30 nd nd 3872.9 ± 797.3dYW02 171.3 ± 21.2 38.4 ±. .a32.7 611.5 ± 227.9 YW08 93.5 ± 55.5.48.5 ± 22.7.570.6 ± 431.7.YW015 106.3 ± 40.3.30.4 ± 7.9.326.8 ± 323.9.IW05 46.7 ± 11.4.2.8 ± 3.3.199.7 ± 53.3.IW09 75.4 ± 71.9.16.7 ± 13.9.455.1 ± 421.9.IW014 55.0 ± 36.6.7.8 ± 4.1.199.0 ± 122.1.YIW6 0.5 ± 0.8a6.2 ± 5.3.4584.0 ± 3517.8dYIW135 139.3 ± 24.3.787.9 ± 213.3d2878.4 ± 413.8aYIW141 67.8 ± 49.3.279.0 ± 56.9d2578.9 ± 551.9aCarotenoid levels are represented as µg / g DW. Each value in carotenoids is the mean result from three biological replicates (samples) ± standard deviation (SD). The P-Values, as determined by Uncorrected Fisher's LSD, are indicated as follows: a0.05, b0.005, c0.0005 and d0.0001. nd: not detected. Table 5 shows the quantification of carotenoid content in WT and seven samples of transgenic cell lines for the single transformation event. Table 5. Carotenoid content in wild-type and seven independent transgenic Medicago A17 cell lines for W phenotype. Astaxanthin Canthaxanthin β-carotene µg / g DW µg / g DW µg / g DW WT nd nd 109.8 ± 15.9.1.1 113.1 ± 13.7d4.6 ± 0.6.175.8 ± 17.0.1.3 45.5 ± 9.4.1.9 ± 0.3.357.2 ± 72.4b1.4 98.1 ± 13.6c28.8 ± 3.1d594.9 ± 22.4d1.6 178.3 ± 23.3d37.7 ± 13.2d729.3 ± 232.5d 7 91.8 ± 13.0c11.8 ± 3.3a304.9 ± 21.7a15 50.7 ± 1.1.3.0 ± 0.7.261.1 ± 66.2.27 87.4 ± 10.4c8.8 ± 2.5.283.9 ± 15.7aCarotenoid levels are represented as µg / g DW. Each value in carotenoids is the mean result from three biological replicates ± SD. The P-Values, as determined by Uncorrected Fisher's LSD, are indicated as follows:a0.05,b0.01,c0.001 andd0.0001. nd: not detected. Although the disclosure has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
[0002] agttt gggtttactc ccttttgtggacactgtggtttttcgtatgtcattttccagcggctta ttgctcattttttggtggtcggtctttttggt cgattttatgccgta tggcgta gtc agtccttccctgactttt gtacaaattagtatcttctctcatgtgtcgtt gtattttcct gattagtgaaa gggtt gtcag ctttacctattt gcga aatcgtgt cggtgtcttcgtactacg ggtttatctccgt ca ggtcgcaagcacgggtcga aattggaatctatgg ggccttatctcactttc agccagtctataagaaa cgaaggt gatcagtatctggggcggacgtta tgt cc acggtcgtcttgtggatcat tgac ccttcctacta tggg gt ag gt gac tcttggattagtcaa acg ctagactcctcattat tt ata cc ttcggtaat gtcacctttctg gatcat gcc gt c tgtcataactcgctatcg ct ct aacttcct ccggtttgg gt gggtcgg ct a cagt acta ccacac tcttag aacatt cgacgag cttagcgtat tcttaccc gtggac gttcggt ggacga ttaac gatctacgggct tctttct tg gttca cgag gag cttg agt ctttt tagtaccaaattcttgt acaactcgct tcctttgaac gaa ctcgcacaggggag ggggaacagtaatt aattcggtcagtgactatgtct tctc gtatac attgtgaagcgcgaa aaaaaaa cttc aaacacgtgtt gct tagaggac acatcagaccc gtaagaaagataa a agt tggttaatgaca ctccgatatatt gcc ctactcagcc gca aat cgaca cac aagg g cgctcttggttttcgt acg caag ctc gattgatcgctttttgttgtgtttttgttgtt ggt tcat ttttggattttttttacggtatagcgcttaaggtgtctctgatccgtcga32s c cgtgeaca tgga tgaacatcacctccguaaccaaaccacacaca gacac tttgtgcattt g c ga gg a gatttgaat tcc gdiseggggggggaggtttgttt gtcactttctt t c c ttccggggcttaccgcttaRggggggggtagaggtgcgtcgtcttaaaca attat.er rA A A A A A A A A N N N N N N NuseielfiD D D D DN N u olcl e_ _ _ _ _D_D_D_D_l erererererererererec asuopiQ MyThtohtohtohtohtohtohtohtohtodtneseluer cpel eAeop A A A A A A A A MytN D N D N D N N N N N Nh D D D D D Dtnisd aemsnouusmc t t tmvitecsi itcneu citceu citcucit tciudCcitccitccitnR4as t u t u tcuenaehrttshrtts ehrtts ehrttsuvB N20 me ruhtts ehrtts ehrttsugqrmanyneO nson n n n n n cysocysocysocer .Bp1s01sin Pyn n n n n socysocysocsfotecy ysinspsLe.ue -1p-1 - - 1Fte6q_-1R_dit isditF_RFeleSmaBtntaF_BttaR_BttaItrcBttaItrcWt srcalnpartpepy-spy_sItprcbaTDI.DIQ.D Q1.I.D Q2.I.D D D D D D Q3.I.Q4.I.Q5.I.6.I.7.I.8.I.9.ESESo o o o o Qo Qo Qo Qo NESNESNESNESNESNESNESNESN
[0003] gt ctacggt g ggg atgaactaggagtaaaaagggcggg tagtaccacggagctcaga 4tc g ga2tccga acgttgaaggt ggct gt ctcgcgtgaa gcataatA A A A A N D N D N D N N __ _D Dr r r_r_e e e erh h h hetotototohto A A A A A N D N D N D N D N Dcit tcucit tct t tu citcucitccitce r e r e r eueuhttnsh t h t hrtrtyntnsntnsntnsnhtnsnsocysocysocysocysocFFR __R__ R _ ItrcWtrcWtWtrcrcWtrBcB DI.0 DI1 D2 D3 D4 Q1. .Q1.I.IQ1. .1.I.1.ESo NESo NESo Q NESo Qo NESN aa tctgtcttcgct aatagtcttt ga cggac ctacgga g tcg ctgggtagcgtgt tcgtctcaat gag accag ggta taagcaactac actactgtactctgcgtgtaaagtgc cgcct ggagggga ttg gc ccctttaagtcgaacctg cagaccaaacg g ata ctctaattccaccac gcg aa atccg gtccacaatt ctttaatttgtcgaaaatcctca gataatc gccccgggtc ag cgtt gc ac agc ta acgaaa ctgagtataacgcgt ta a gtcatacttta ccgac g gg atagttacgccgggcag cccgctagcgcg gaaggtg aagaaggc ggccttatacgggg attg gtg cactacaacttgtcccgcgccatgctagttc t ata at a g tg aaacgctg tag g ac gga gcccgagtgaaataggg attg cga ttcag actcaggaaacgcccta caggccacccggacgtacccttcgg gtg tcgtg aag cca ctccag atagta aaca a a aac cccc aa caggcg tt gagc gtgtg aac ca aa gaccaatcag ca tcg acaccttc gg gctagt ttacataattttgatacatg ctta ggttcgg aacgcatcttaagc agcacctgagaggctgggacttg ctctaacgaagacaagaaacgt ccaggtaaa cc atttca atcacaaatccacg aa c ggctc gc taatgcggcaga ctaacggtatgaccttaaggtaagtgcag aaa agcg attactata cat ctcatt gct gt agccccaagccaa gaagctccct ccggct gtcgcgttgcctga ccagat g tt ttt agcgca tta cac gat a aaa cggcataat ccg ggggctt acgagag tga acta a acgcgaacgtaa cgg tc ttttgtcccctttgtggagacaactaaggg a aaccggaaat ttc gtca ccgtgccagaggttcag tctc agttgactcc aaggtcgagctgctcgcgagtcatt ctcaagtaa g a gggttgtagagtt gcacgca aaatacttggg gagagac gat at ta a aattaaaccgggcgcgagcc attcgcgcataagtggggacgcg aaggacggaatgtaaaatcagaagggcat aacggaggcagtc gcacacc ga caa ctttgacc gc t agc aa tcccgtttctgtg ctc g tg agatt cttaagaccagga ccacccg agtgggataaggtttttac cctagcctgcgagtaatg atacac ggca cgcaagactcgat a aaccaacagtttgcagccaa a g ctatagacttgaaaaatgaaacacattgatacccagataacaagta ga ctc acaagcggaccgtt tgaggtagggccgtagagct agtcttaccgcatttcaaacctacc cac ag cctcct gcccgtgactcctgcacggtgttcatcacaaccacaacgttata ccgcatgagtgccaacgtagtgtactctat g tgcaaacctg taa aagcgagatg tattcgaatcaccggata actcacgtcagg acctccacgt cagtc ag a ccttggtgtttcgaagcg tactct gaataaaggtcatt agaagatgag ggt gaac agcttcgc aactgg aagagaa caagcgcgaccgctacc cct ga ggcattata cgt gctcggtgtc ctttaaa a a a tgaccttctcactc a gctacatagagc acgcctgcacggcttcaactaaa ccttgtgcg accct cct tttaagta a atg tcgtaa ctaccttaaggctttgatgcttcgcgtt gg gtgccgcgtct ct ccgc ccgcaactcgg gca cagcagac gcttaccgttccctt cc ctcgtttcgttcttttaaagacg gtatacacca ac gta tccggtagg cgcgct ggaatttgtgaa tgta acacccagctggc ggcta ctgga ggaccgt atgcgctc a gcctagctacctt gaat tagtgt tctgctttac ccttcccgcccctgttatt tagccgc cgacagg aaac catcct taaacaccgaagtct ggccaa ctacccgagagataagccgct agaccgctgtcagcataaag caagtcaggtcctatatgatt atg aactctagcgacttccacggtaggagaggaacg agg acccacactg ct c aaa gct cgaaa at at gaaaga ggggactacaactatgggcgta cactctgaccta ccg ag gagactcactgtgca gacaa aat cc tt ta gaactcca ata ta accacttacagctgagc tggggcct cgttc tt ag ac act cta cg ttgtct aac aatagagcgttgat cgccgc g agcg a tt aaaa gcgta gt cctttc ctt gaga ggacga t gcct cctgggctgggttgaactaaagatctg cccgagagtcat ccg cc ggcgcactt aaaagg agaaggcagggt gt actcactatcgcattattatgcgcgccccgacgttgttgaattctgaga catccctacct cgagctgcaccactacgattggag gg gctcaac tcatacagg tcctat gg ccaatcagtacc gg aaagcg agtatga ctcaaaaatcag ggtcggactaatccagaaagcgggactccggcc acatctaaag aagatcatggaaacctctctgaagcg cgtgcggt52agctttcg atct ag ggcgagttg ga agcgtaggctcgtcgagact ca aa gt gcgcgaatatgcgct ctacgcgttgttccacca ccgcctgccgtagaatttgaca catttcgatagcccctgccgcccag gcactcctgttcctgttccaagaactatg cgcctc ctacaacacaattatgctga ctacccaggagt ggtcgttc gaa tcgtatgcgcggccc a cagccttgaccttactg gtgcac gtaccaa gt ccgaggtgtccacct caaaacctt cagatatcccagaccaaat g g c c g c g cgaa aagcaa a agacactaaag cgacagagcA N D_rehto A N Dcitetchturtnsyn soc1dimsalp DI.5 Q1.ESo Nact tctctc ggc cat t t aatttgaggtaccaggc ac a gagacatc gcgatga gtgg g ac aggacacta caagcaa g a ag cgcaccg a at a acggcgcgacacgtgt ttagatgtagtgtattgtgtaaaag atg ga g atcgcc acggc gacgtttggggaccg gc gacatgaactaag gggctaggccggtcgaac actc a agcgtgactgtt cggtggta tgattcttaaaactgaacgaaccttagtcgggagacgca cca agagtgccac cg gt cagcatc gcggttaatcgacag gtt ata tcgaaa gt gtgta ttt cta aacatccgg cgt ag agtagcaggaaagtcctcag att ac g gtt ggccatcctgacgagt cggagcgttgac cca c ggcct agca aatgttattcgcgggaccaaggtctgagtcgcctgcccgacgaggcca cggcgcgggcc ctg tgtacctgccatat caatttatagcgaatgttaagtttga aggcatcgctcgtcaggcat cccgggacac gaga cgaca ttgtgttacccg tcaaa tctttgccgaccgtaattgataaaggggtgactgtattcatcgaacc gtatcgagcccca gcacccgc gcc caagttgcaggt agggttgc cgaccgctgcgtttct cact cgatagtaa t cgtctgaacgtcataaagcttgca taaaccgaccgcgggccggacgtgc gc a agatcctacaaggcgcg ggt cg aggcccacg ctac aaggattaaagca c actga tgcctttgaccacgagggcaagagcaggccccccggga caaggcagggggtcggcaacg g gcccgcaa ttcgtggtcagacgag tgtg cacgtattcg acggtcacaaatgaagccgcac cacgcgaagaagcccc g c cgggtcggcgggctcatttcgcaccctct ca aaacaa tggaagtatc at ga ctccactca cgc a ca t a c ggc atacga accagccat cgcgctag cagcgctcgct act cttatgacgtggcc agcttaaaaggagttccg ctcct atc agc aatgagtg cctcacggacc gccccag g acgcctggaagcctg gggc gagcgg cgcgaagtcgggaatcaa cgacggaatggtctcgatcgg agata aatcggg gttg cctacac tgg g cgaggaagt aggtaa cagtgggtcgggagataggct gt gaag ag cac aaatgt ccaggagacctctaattaccggtccggaat c ggtctcgtgcccccgg ccc ga gaa ga gtacacgg tg acc gtgtcggca ctcca tcatatactaccgggagac aggcgat aa c gggatatgtacgct tg cagct gc ggt ccagc cgcgccggacaccgaacgctacaagccca gcggaactgctg a accg g gaaccgacttcaacaaca atgtcgtatatg gactg t acc atga aggccggccga gccggcgttcagccgcgcggtaggccgactacacaaccagggctctgtcaga ctctgttctctaggtatt gcg ct gag atccgcac cga gc ttcggagtagtacaactttcacacgagggtcaaagctcaagactttg gt ggagtacgttatctgtagtaccc caggtgtgtcaggcg gagcctacaccgctag agct a tcagcgtgtatatacgcgttggtt aa ctaag ggacaaact ctgctgcaacgttt gcttc cttgt cttaccaggacgtcggc tccaggtatattgtgttg a cagctagcgg cttgg ctagtggacgggaaatcgattc gtaac g cccttatgtgttcttcggc ctgttgc a ctgtcgattagccacgaaggag cgtctgaggcgaacggcccgaac ttcggctcttccttgcggagcc actttgaatgcacctagcgg gtccggaatccgatgcaggcccctgttatatcttccgccct g cagt aacgagtttca aggtattaagcactcaa ggaacctattttgtacctgca cca agtgccgtt cgatcccc a gccgtttctgttggggtccgt atttggaccagtt tgagtacccaaaggaccgagtcaata aatcaggcagttt gccc tcacgtcccg ggcaggaacttcttgt aaaa gcaggtcgggtagtggcgcctatggg caatggacaggacaaatacctgt a acctatataagatcccgcgttgcggagcccctgcccttataagtgt cca gg tacgt cgagg cgcgacaagt gcact tagggc gtctcttgccttttgagttatcgtgacgg agg gc c tcg tg acg a g gtctgtcctagg cagcggggtcagggcggcgcagg agggagcagtgactag agaaagagggataa act gcggtccca cgaccggg cat gg gccactacaacgtaaaaccgcttg gc ggcccttagtggcagacga tataccctgagtagg gtaagatctatctttccggcgccccaagc ccccccccgt agtt gcgccagc c aga ggat g c tgtctgggccccgcaag ttttagacg tag gg ggttgt gtta taaggta gccaatcgtcgtgacagcggataccgggg ggacgctggcaaaaccaggagccgc caggĶttgcttag ggc tcgtactgccta ccgga aactatactt ccggc cacggtatcggcagggctctcagcctgccgcgcgta a cctcccgccg acIJcgaggtatg c tagttc agagtatgacgggtgactaatatagcta ataccacacta caaccc c c gtcgcctctgccgg ccc aa ccgat ccgccccgcagacagt agggaa gagcagaaccggtgcgcaccttgtatggctgtgttcgagg gtccacgtaggcccca acctt ggatcggacctcgttcagctccgaagcgaacgccatc agatcctgtta cctatctagca gtctataggggttgccggttgttgcc g t a aggtacgcgccc cacctaggggtaaggt
[0004] gatgat acgag gtg aagaa a t t gccgcacgaggtagttgagtggatgggggtcgcgccgccc gc tcggc c catccaacgc gtt gtgat gcggccttaat ggca atgg gccccagttcgtatggaggcgcaatgcaagagctgacgtctacc cta a ccgc gacgct cggcagt gaaggct ataa ggaccgaccggacggcaccac gaccgtccatgctcgattgacgctgg ccggag ctg aactggaagccgagt gtgtgacg acaa cggtccgtctgtgattggcggcggccgacacgag aaagtggtgggca cacag cacaaatcgagtctgtttatact aaccccaacgg gcc ag tcgacctc ggg ca ctct atgaccagcctggtattagc cgagt ggaa ctctcttttcgtcccacca acaagcgcg ac c gaac taatcactggag ggttc agtcgccccaagctcatct ga gttaagc gcgatacgggagtcttta a ccaagcgctga tcaacacggc acgaagcaacgccgctctctgatgtca aac g ctgcgtatcggc agtaccactgtgcccgttccgcgaagatcc agctacgctc gca ttttc gaccgtgcccgacctgaattg gtgatcggcaggtactcgagctccccaccggagcggac aaaaca acc gt gcgccctaaggtgg ggc atag cgca tcg aggaacttgct acaacggacctgcg ggctctc atc gactttgccgtcaaaaactca aagtcag caga g gac tggtgc ttg ta aac ccgctttcgaacccaaggccaatc gt ac g cgt aagttcttattgtcgcaatt gccgacggta gacgcagaacctggagcagcggt cc gtag ccg gt tctacagttactaaaa agatttta ggc gcgaccgaacc ctctgggggc aggtgcttttgg tcctgg gagataaaacctcgggct cgaa gcatggct agcc ccccacgga aa acgctggcgg gttccttggaatcgggtt ctccaactg aggt cagtacg ccgttgattctcatgactcgccacggaacaattgtgttaagt a gtg ctg gcgagtcc actac a a cacgt ggcc cccgtaa ct at ttttactc aagtgggctggtcgaa ggtactggtaacgat gggccagcgcaaaggacatgaacgccgggactggt gcgtagtga atgg gcgcgtatggtacccgtatggcggttgaa g acgc accgag gggtatg atccttcctccccccatcgcaagccatttccatcagattcgggttaat gccctctagcacggaacc gccggcgc ggtc gct cc c tgttgcag ccgctaactg tcgta gggtgtctaagcaa tccgccgca at tacagc atcttccccca cgag gaagccatgagggaacc ctg cg gccggggcgca gcat gtt ttt agcg aagctaagctt cggggc atg ca c ctg gc agaccgagct agcacgaatggaactaaccagcgca cacaaggcagggagggacggtc ggcc cc accgcatt tta cg cgcgtcga gtcca tgt ggga actcttacgacaggatcga gaaa gcag aaaattgggcgaggtat ggcggaaa a gagtgaggcc ggg gg gag gag cg gtacgctgaataataacgaa agcccggt tggctgtcacgg aac c agtaacag gggtc t ag at gg aaaa c gg a gaaaccg caca atg atc g cg aagggcg act g accg ccgtt agca ccgg t ga tg cct tc t ccatccgtcggg gggcagcg cgc gg ct tact ggc agt cc acggc ggtggataacaaaacg actacgccgaagg aag ctcc aagtccg c cggcggaaaaaaacac gac ctggtaaggccctatcggataagcctaccctgacgggaactgacagaccg ggatagcg aatcaaca gcc ggattctatttca caatcgc tgagt g tt ttcgccatagcggaagagcggggccgcaag ag gcagggagcgagaccgc a gcggctgcatgc tcgggacgtaggacatcaaacgttgcata g a c tgagctgacgcggcgactgcaagt caagtactagagaagcaaaaagatcacg aaa gcgtaact cggggacaccactgcatcggctcagactagggcaacc tgaacgtca agccaacat ttcagttat caacttgtcctaccggcccccatgg g atatactgga gacttcg cacgggctatccgtgcgaatagcatgcggggactagg cctgaccggttgagtctaagcaaaata gtgcgcgcctgcacgcaaactgcgcct tctgaagggttacg tgtagaggcac ggggagc cggcaaagcaagcatgtcaatgtcgct gggtctgt gcgggcttcactggcgcaag ga actgtcttgtgg ctcaagaacgta at cta a gg g ccg ccc gacgcgcgaccgacg a gggcaaagtg ttaagt ctaa catcgcgaac ata cggccc cgg cgcgacaatccgtgatacaaga aaagttatgctgcggccccca accgtat atgt g ccggccctgcgccccat gatacgcacacct caaacg gcaa aggcgtaatc gtgtķtcgcgag gtatagagcg ggctgactcttatggccatcgtt gtg gccccaatgtcgt gcgtctcgg gtagttgt c agacatactggccttgtgIJtaa a tacagacaacca a gcggcgccgcgcaccgcaacgca tatgggc tta accgac gtc gcgaccacgcggg gctcgaatgcttctg agaggaagagc c a c a c cta a ccc ggta ag g ta gttcttt ctaccgaggccaaggtagaataaccagcgtctgcagaccgttga act gtacctcact ttccataaaggccacagacaccccgag atgccg acgcttgacga gta a a g ccccacgcgttt c t g ggccgcgccccagtagggta acttccgtt cagcgtag
[0005] actt ttctcct a gca tcatgactacgaa ttccgtat tt cgcgga ta aca a t c gact ag aatcctg ttg gg tcttccattacacgaa aac gaggtc aatgcgtcgcagcttatggacgaa taa ctctt actcctcatggcaacatcgggcgtgatcgc atgagtttt gtgctacttcaga t gca agtc cgctgcactacttggtcttt aaaggatccttcatc cgactgt c caccggag catgtgag ttaagatatttccc ttgcagcctca cctaacccgcgcggttcgtaccg atagttgac ggcata tt ggctt acggtcgagag at gttc aga gaca a gcgtcgaacagcttgattcttgcagcgacggc gccag gt g ca cg a gtactttctgcctccgtt caaacaa ccttgcttaggc acg actgctggcggcttagtgtatgaagttctagcacg atctg acgagctgattatgcggttca aa cgttcgctcttacggcgggcct atgaatctatatgtctgtgctc actgctgcgtcaag aaa gc a acccgga gtgcaaca ccgca ttcgtagggccagttcgggg ctggaaagca gt ggccagtcgc gcc ggcggttcggaaacgat ct a atctgtct tttctggccgagtgttcgagaattcacacccca aac c ggtcatt ggg tcgcaaggcgcgccc tgg ct aca ctatt ggtacc cac gt gt gcgtcc ggagtactgtccg ttactatctggaaa ggcatt atgac tcgcacacaa ccccataggtcgagatacct tcaggactcggcgtacccgtccgccc caacttgtttgtcggt cgc ctt acagtgg cacatcgc tt aattgtatttgctcgcgccgaagccaaggta ccttacggcct actgcgccgcccgccg gccagatcactctggg cctacgatcgggtt cttggtgccaaag acgggc gt at tgaccgctacctct gctgtccac cacatagtac agtgagaca c tcccc aaagcctt caataaaagggaatgggcatatgagtcgggca cgcgcagtctc ggtttcttacgtg atcagcactgtgacatgtcactgtctacacacggtcggcgcgga gcg gtgttaaa tgtacccct cgct catcaaaaagccatccagtta ag ta gttcgagtcagg cagccttaggc ga a agaaa ccg atattccaccat ggtgtctttg g gcga aggcgacc at aa gccctcgtacccgaatcgtctgaataaat actcagttagaaggcc a cgtctgggtaa a ctaccctt a attacgtccgtc atcgtaaaa taacatgca tg tg ctgta gataca c aagtggĸIJacgtccgc t c ttgcgaac ccaattaa tcgatcactaccca gtt ct ctgggatagatc atactga t gc cgacggccggt gtcgtatcaagt ac aactgatat ttcagaa gttttccgggcgattctcggt gtctata ttg gt ccc cgaatctcgattacttggtc g g gaccagt g gatgt att g g a c c aatct ggt
[0006] aa tctgtcttcgct aatag gtcgcttgac ctacgga g tcg ctgggtagcgtgt tcgtctcaat gag accag ggta taagcaatcta gtatgt t gcctgttcgcgtgtaaagtgctcga t gccgagggga ttg gc ccctttaagtcgaacctg cagaccaaacg gact actaattccactacggaccgccatc taggaatt cattttgtcgaaaatctttaca gatgccccgaatg gtc ag cgtt gc ac agc ta acgaaatctgagtataacgcgt ta atcata taataaca ataagaaaatagtctttaacgctccaggagcag c ccctgta ctaggt cagccg ggagaggtg aagcgagt aaat ggc gaggccttgatagctgggg atagtatg gtg cgacatacacaacgccatcactcacgctagggagcttgagtg aaacgctgag ggaccg aag attg c a cctca g agct a ggcga a acctca ctggcttcgt gttgggg tacggtcggaag cca ctgtg aacccata ccaaag gaatc a caagttcagacaacaata a acggacacacgc agatcacggatagtt acataattttgatacatgt gagct acgt c gacgatcttaagcgcacctgagaggctgggacttg ctctaacaagacaagaagagctacagttggaggtatt tca ataat caccgggcttaacgcaa ccggttgccttggtagatgc g aaa cg atc aa ct ctctt gcgagccaacaatagtgt cacgcctgtttcagccctg aagcaacagat gct ctt tt g ggt ataagcgcaataaataacacag gatta ttaaa aaatc tgcgccg cataataccctcaatcttt acgag aatggtcag tga acta a acgcgaacgtaa cgg tc ttttgtcccctttctg gggagacaactaaggg a aaccggaaatcgtggtg t catccacggttcag tctc agttcgtcc aaggtcgagctgctcgcgagtcatttcaa taa g a gggttgtagagtt gcacgca aaa actttgg gta aa gcctccatt at ta a agatta aaaccgggcgcgagcc attcgcgcataagtggggacgcg aaggacggaatgtaaaatcagaagtggcat aaccgcgg cccattgttta cactgaagtc ttt tg ct g tcaaac aga ccag taagtta c tgtaggcattcc gc tc aacc gtc gcg tg a a tttg c gacccggtgg ag t tt c ggtgcccag atacac ggca cgcaagactcgat a aaccaacagtttgcagccaa a g ctatagacttgaaaaatgaaacacattgactc gagataaaggccgcata ga ctc acaagc gagagcc tttctgaggtagggccaacc gtag gctgt ttaccgcatttcaaactctacc cac ag cccct gcccgtaccgcgcgattgtcatcaccac acgttatacgcatgagtg caacgta ttgtgtactctat g tgcaaacctgaa aagcgagatg tattcgaat gcgagatccggacgcca aacgtcagg acctccacgt cagtc ag a ccttgg gttcgaagcg tactctcgaataaaag gtcatt agaagatgag gtgaac ggaatt aac gt cagtcagagaa caagcgcgaccgctacc cct ga ggcattata cgt gctcggtgtactttaaa a a tag accttctc ctc a gctacatagagcctcacctatcgtt gttcaactaaa ccttgtgcaccc cgg gcac gggcc t cctt ttttactc aact gta acgctcggtatcatcgtttacctttaattggcttaaatggagtgctactcgcgctgt gag gtcttgccgtc tgttat cctt ccaatagg aa tcag aacc c gtc tctcttcta g ctataca actcggtagg gtaa ttctgtgattaa tgtta acatctaccaacgctgggc gccggcta ctgccg ga gac g agc cggtaatgcaagctc a gcctac ca gcctt acctcctttgaaat taacagtgatctctcgctgaattacccagtgaca agtcgggggtgata ct cacgac caccctt agctacgat atcc atg tt atataccccctct ggacagag tag ag aggc gatcccgaagc gacctgacata gac aa aga gc gt ctgaaat aaatgaacttcag ga gattagaagga acc ca aaccgtagaaactatgggcgta cactctgaccta ccg ag gagactcactgtgca gacaa aat cc tt ta gca aa tccata ta accacttacagctgaaacact gtggaaagtcctt aga tt aaaacaacgcct cgtta cagtgcttctgtttct aac ct c a ttgagaagggacgagcagttgt gcct atct ag ggaccagg tctggggttgaactaaagatctgccgagagtcat ccg cc ggcgcactt aaaagg agaaggcagggt gt a ttc ccac atcgcatattattgtcag gtg atcacattgttgaattctgaga catccctacct cgagctgcaccactacgattggag gg gctcaac t atacaggatcctat gg ccaatc acat gc agcttgtaaaatga ctcaaaaatcag ggtcggactaatccagaaagcgggactccggcc acatctaaagagatcatggaaac tctctactgtt t acgacgttgg92agctttcg atct ag ggcgagtttg ga agcgtgaggctcgtcgagact ca aa gt gcgcgaatatgcgct ctacgcgttgttccactacccgacggacgaatttgaca catttcga agctc cctgcc cccag gcactcctgttcctgttccaagaactatg cgcctc ctacaacaca ttactatctt cagtgct gtcgagt ggtcgttc gaa tcgatgcgcggccc a cagccttgaccttactg gtgcac gtaccaa gt ccgaggtgtccacct caaaacctt cagatatcccagaccaaat ggaa ag c aagcaa a ggacact gga gtcgtgtgac acggtA N D_rehto A N Dcitetchturtnsyn soc2dimsalp DI.6 Q1.ESo N ttagtct ga tcg gtgca acgttttatc tgatatcccgtct atatagtacgcgg a t g cttcccctccccgggcgc ga t agaa gacgctg gaaccg ctgaggtccg atc gggg tggtttttaacgc cag gt tcttactta cggggtttgtatagt gt cgatct gaccgcgt ccgcgcg gccggaacgag ctacagtaca tcatgtc c ta gttggt agc ag g tcttaactgagaaaaccgaactatgga g a accgtcgagagc acgcccgagcccgcgctgttcgaccgc cgctttcccctgcacccta tctca gtttttattcg atg gcgtatttgttcatgtttatgctggagtccgacccg gctt ggagcagac aatcttacagtaacctcttgtg t ga acgcagttagggcacatcgcttctgt caggaccccagttcgtcagggcgagaac gcatcgca ct tc gg a ctgaatacgcgttagcttctgtgtctgtaatgat cagt acgacgatacacgtctgtactgagtggcttcttttttc ctt ccaggaccg gctcgagtttaatttggt gagca gttcggccgt aa cg ga agt g t cgcta ccgcgcaa tcgtgtcactctttgtgtcgccgtgtgtgttctcacat gca cc cga gcaggcagcg ttgagggcttg caggccctgcacggcgcatttt aa gaagccccttaatgccgtggact g ttcgcggacgat gtccacatagcccgttcttaattcctt ccac cagtcggggcagc cggaccggctc a tta ag agcgaact tgaaactattt ga cctccaa acgtgcctt acgtccccagtt gtctgtggt gccgcatccgtg atga at gcatatt ac aacttt gcca aagagcacta tc ggcagtttt gccccgacgtgttcgccgggcca gaact ctatggtaaaagcagt aa gtc gtg a tatg g cct ga a ggcgtgctcg gcccagcgaaaaataaaac ga agaatcccggt gcaggag cccgctgcccttttaagt gtcag ctgacgcaccacg gcttac acgccctaggggcatacaacgtcctttc ta ac tt gttgctccagcgggcgcctgtgact gcagttgcgtgc ac gcagggggctagacg tgggagcatc ggcgg aac gt tttgcac ctggg ttaga g gccgtccgaa cgcg ccacgtcggag ctcc acagacaggt acaaccctaa g gtt cta tagacgag gac tc aactt att ct gggtcaggggctaggattat tgc tcgg cccgtaggcccccccgtattggccacg g cgatggtctgaatttttttagcg ggtcttggaattgt c g cgaggcttcgatcaa tttcga cttcacccg agcagccgagataccccggaggggg cgtctgcgaaacccagttctcacccaaccagggaccttg tgccgtcatggtgc gttaggaa caa ct attccgaccgt gcgtccg caggcc ttc agtaccggccgacggtactcgactattagtctcg gaccaccgcacgg acc ccct cggaaattattgtaataccacg at aaaccc ccgcccgtcgccc gc aaccc catccgccctgttggtacaatt agctgggaaccgcc aatcctgcggc gcgagac ctg agcgtcagctacgccc atgt acct g a tat gtcgtc gtcgcgaaagcgaacgatc gggcgcta accaatttacgcgcagg agt ggatcccactatcttacagtttat atgaggtc gcggtgttgtccggtatcgac gc c cacctacggc ttga ttttgg ggccgtcatgccgaccctcttcacttttt gacataca gaagggcgtaagagcc agag g c agcggcaccgca aatgagtaac tg ca ggatatagtacggatgcct actt gccctcatatcgaggactatata atggaa tcccaaccgaccaggttttggagcgccgaagaa cta ggga ag ac atgcct aattcagtgtccacacacggagctgatgggtagaaggtttt acat acgagaaacctagtcgggaggccacaccaatgaggaccccgtctcatc aactat cagtcctatc gagttca gcga t ccgcgatgatgcgattttaactcccgagtccagggtaaa g aagcgtgagtcctc atg gtac gcgtccttcccg agtagcacggttatccatttatccg ggcaatgttattagttgcggagcaggcgttga gtccgccgcccacgga cag cg g ccgcggcggc caa g cgggcgaacctagg cggcgtagccctat atgatgtcgga cgc gatctgttcagggcatcccgggacagcgaaaccttgt gtt ta accgaa aag acgctgtg agtgaccaagcgccgtgt acgttaat ag ttattcaacccttacatg c c g a g gaaccgagccccccccaagtgcgagt cagggttagaaag cccactttaagttcgtaactgc gggtcacctttcacttt aactcgtgaagtgcagcagcacccggggccggacgg catccatatcaagc ttgatttaagaaat actcagtttccgatc ct tc g gt aacttagcacggagaa aa tggcaagccccccggga ccaga agca ggggcgcgacagc0ag c c tttgggggacaacagtgcggtcg accggaaccctctt atctga cgtcacaa aagcgcca cgcgacgcggaaagccgcccgggtccgcgcg3aggccaccggcag cgtag g gcttaggttg c ggactccgagtatccccgcctac gt ataact aacgaa c gcc acc cgcatgagc gtgagc ccctacttgatcgttg cagggtgcactat tatacttgg g gta gtcatgt tc aag aaac tg cctcctggct accgac c gcccacg gctagaggctggggcggcgacaacag c a cagtacgcc tactcaa atcgttc acg atgtt tactcgaagcgggtgaccgtagcggggacgga gagtatgaa cagtgggtgacggga
[0007] ttcgcaggcatcgcgac gcagtgagccaacgc ggggg gtgcg tgcccccc ccg tttgga g cgagtat cc ggctatcctc cagtct tcgccgccgca cctccgggt caagccatgtct tccatcgatcgatgtca gtaag tgcc acg a accccgg a ccctg cgga t gtttag gt gtagatg gactgctg attatg ccg acgacaagcggaaattggaa gc accgcgaccggcga gcaatgtattag cgtga aca gg ctataccc cggacacattcacatcgtccacctgagtgttaga cagac gcgaga atg acgaggg cat gg gggagcgtgcccgc agc accgcctttagt gctcgct aggggcacat cc gggggacttactacgacgttgat a ac agaaaatgcgccaagatgtcaga gaaaaaggtggatggccgggggaa ggg gcag gtccgactgcaattagcaaca tccacg gcgacttatgggttccacg gg cgggacagggcgtccgg acggtcgtaacacggcgatcggtggaa aaatc acggataaggaaagcccgcgc ggcacgc gccgacggg gcgacccc ggct aagcctttgtccaaccggcggtgc gtgggatataacaagccaa cagtcgcagg aaa atcgcaactgtctgacgttaagctaacacaccattgtatgtccgccgac ggaataag ccgagccgt ac gga a a gcc tgaaac tcggcg atggggatccaagcccgtatgttggg aca gcgttgtgctatgaataccggtacgagcgcgc gg caag agctgc caagggagccgaac gccaa ac ac gg gat ctcag gagttagggtaggt gc atggatagggtcggac gcg gagccttgcaagta agaacta agagacaggcgaagacggg ttaccgatagcggtgagaccgggcgtctg gcca gc g tcttcaag accggaggcctgaccgga atcgtagccacatgtttatttt at agcc aaa ctccgcacaact cgag tatggagcattagggtgg cgcactcgtcatatgaggcggaccgagcggcctgaagcggagttct a tgc aggcaacaatggcgcc ggctcatgacggaaactgcggcgggctagtc ccgaacgggt aagtagaag gtagcccgccagagcgga aaccttcaattcacgaggttcgctg ctg gg gtcatac cgccgaacaaccgcgcagctcacaa aacgaaagg gtcgccg cgc c aaccccgc ggc aa gacgcgagagt ggtgttagtc ctaccc t ag gct tgg gcacgaccgccgagcgcctc a ggaagaagtta gtggc cct ca cgacggttacatgctcgc ggcacgccttccgcactagaccg caat tccccaacaacctcac ca gc gca accccggacatcg caggatata acaggagggt gagtattagtgccact gtt gtccgct a a gcgctgcggcgc ctgag agtgtgcaagcgtcctca cctaaca accgccgcc cc a caa t g ct act tgt tcgctagg a atg ac aata gc c accgac c aactacgaa gggtag a atga ctgcacaa gtgacgact cg agtaccaccgagtgc g t gcccaatatcgctttccgtgcgcaagtacggaacta ccg cag cggacacgctcga gac ttggaaa cctggggcataaggctcagt cggc aagg gcc g ct gt aaagcggggatcgtgat agtacctc gcccagccaca actgcggctgttccct gggccg gta ctggtgtcactc gcgatggcagaa gtagacaaagacgtag gtgtaggtagtatg gaaggggtggtg cgc gc cccgcgccctgtgacgcct gtacaccgacaggcgcgtcctgatggacccgc tctg gccag gac ga ggtcggcatcagc aggagcgta c cgctaacccccg cgg c cagcacgcaagatggt cgaacttgacggcgc g g c ccg c cgacagaaaata cttgc catttgcgta gcccg a ctg gtta tctggaacaccgcgcgtgt gtgtgagacctacctgtctctcg g gcc acacgcgccaccgggaagggctcgt t cgtt gtcggc ctacagcaca aaccggtctgttatt caatactacgggacgg acgtggtcctc agtttattgctcggcgtgtgtt cgactgc gatgagtt ctgaca accaccacatagaggaacccgag aacactccccag acg aacggtcaaccc gagga g cgttc tg g t a caac g a atg a tgcgtgtcagtgccc aa acccccca aa acgacggc ag c c g a gcgcgcgaac aacgg t t c a cggggcgccgacgg t gcgtcctttcgcata cgacgcgacagactt ccattatctcggagccgtgccgc cgaatt cg ccgt g g a agcctgttcttacctccgcgtcggagtccgccacactacacaacgttagcca caaggggt ggacttagcgccaattg atcccggaaattgcgaaaggagcgcggtcgccccgggaac tcgccctgtccaaactagtggatg ccga cgatggtgcgctta aagtcctacgttt cgaaccccatgccaaacggaacgtccgg gta at tt 1tattc tacgcacggaa aaccg gagt cggccggatgtcc cggtccta cagtctc actaa aaaagacttct tgcgtaggatt ctaac gcg3tagccag gc aac gaccc gttggct agccgacg gctgag acgcgagcc g g tccaa agg tgg ga g g t tgggttccaac cca gcctcgaccagctttgag tg cgaggtcg aagggaagatcaatc gcgtagggtgctcgcgaaaggtctggccaatgccgtacttcatccga agt gtaggcgtta tcc tcgcaataggctaagaa tgacac gtgctgt gtc atgcgtacatggta gaacatgcgcgaccaaaggcaatacaca ggcctg ggacctgc agccctgtgag
[0008] ccgct atgt ggg agt c c g t acgt agttgggtccggt a gct agagacgtcggcta ttt ctacagcac aaacgcagc g atg gaacata cgcgcccccgct cattaaac cttcgtg ccgtt gttc ggggtccgcac gtg ctgagagccctgc gtc cttact agcaaatggc agtcgttgc gtc cc aaggacgaacaggt c tcagaagcgta ccccttcgagagcattgatcgtacc caacgcc ccacaccgt ggtgattc gcctct aaggctat ggcgctaactccgggtggcaa ccccgcat tgtcttttgcctccaacaac gggattgcaatccgttgccacact gtctcgact cattt atc at gccattcgtgcggg ttc ccgaaagcgcgcaaga acg cccggcgatgggttgcggc gccgcggcgggcctagtcta gcgacaatctacgt gccttcattcatgcc ccgctaaacagaac ggt ctacaagacc ctgcaccatca tg aaactgtcatttagctaacg gaaaaggaa attggagt cggcaata ggaggt cggt ccccc aaagcagc ggcaccgtctgct ctcgc attttc tcc actg gtg gg cc c cgtcgacacgctgtttcgga aggat aactttgacaacc ct acct c aactctaaa aggcctggccgcttggacagtaggtt ttccgtgatgtt tgagtcag tcc ctcagcggtaatcaag catcc agatccggg gtgct aggca gct acg agtgtgcattagcgggggtaccgg gaaacc aaataa ccaa cggaccattct aac tcccgaatcatt gtctga c agc tagttactatag gccgga cgacagtc tctagagttcggaaaaatctttagcct ct tgctaaaaa ata gtctttggagtatat agttac gaccgat tttgtcgtctccctaccgtgccctcgagaaacttg acatccaaacgatctgtgct ggg ga aagaagaagctgtgctac gtcttc ct aat cac gtgc cttgcggcggagtccaattcaaga gctaaagaaat aat ct tttatgtccgga actcgcgtagtcgtatatgtccgacc cgat aaggat g tg c ctgtaa aca ag gt tggacgatgtttgctagtctttgggtccatttg tct cagc gcacgatggg actaata gtagttcctgatct tttcacggacttcgactaacatttga gttacgtcga cgtcgacgt tttaa catctcg tggggttcgtt ac a actacccaaa acctggtcaagc atgggaccg tactt gcct acgtcag cgaacgaatc aatactacgcatagagcctactcgcgtac gctaga gcaggttagcctattttttttgt ct cgtcccttcaaagtcgtaacagtgcgactgtcagttgcctttttgtcgtttgaaggaattctg a atctcggccg cat t cc gcgacactttatcgagac gaagagacca a g ggatctcgtcaccgcacctaactc cag cc tgtttgagatagtcgtc ggatccggcaaattttac gt ggc accttac gtaca ccgat ga gggtcagaccggg ag gttttcgagtcctcgtt g atcgatgattttgagggcgtggctacagcga ctaagcacc gttagggcccgcgaaatcg accacagt tcctctcgcactagagctt cgc gca agg acgtcctctct2gtgctacg gtttc ccgaat taca gcc agatct gcatggcttga ggtatgagtttgactg3tgcccggtctg a ta gatt aagt ctttgtcggcgggccgt c gaatcaggttttgcgaaa cgtccagaa ccta tgtt agc a a actaca a a c gggagctt ttctcccgcgtctcagt ct gct gcg tcggtagtggttttttgag gaacccacg a tggccccagacaggaatacaag cggcgtattcgg
[0009] tctcctttttcgct aat atg ggttgtaatcggac ctacgga g tcg ctgggtagcgtagttg caaaa gta atcc a t t attaag aagac gctgcgt tc tgg aaaacccagtac agtgccgctgaggggga tgctcccttt agtcatctttcgttttattattcttctattaaaagtacagg ctacg a ggt actt g caccattttaatttgtccgaaaatct gca gatgccccggg atc ag cgtt gccccacaaaatat at aatat aggg ataa aggtat gctc agagaatcaaaagcattataat ttgtaacg ccgcggcag c cccgctagcgcg gaaggtg aagacctaggctt a atg a atttt tc tctgatctggatcgccacaa gcgggagtagacggccaattg ttac agcatgttagggtac gcga gcccgagtgagaatttacat gttttt gtaaataa ctgattagtaat gtgtcgtgcgttgtctcagtgacaatgg gagtca cggtcggaagt ggccaa acccatagcaatcgtttctaaaataatatttt aatc actttcttatttactatgacccagacaggttattac tataaacta ggtttcgg aacgcatctaac agg ac a gta gt at tc ccttagggtctgtatttaatatacat cttc a ag cctggccga atgatgaattattcgaattaccat a cggcttaacgcaatcgcg cgttgccttcgtaaaattattacttaaatttt gg gaagata caagg aaaaagaaggtttttt cctcgaa cagcacctgctttg gagtaagcgc ataaaa gacgtaaactt ataa gaattcatagaattacagtggt gctagccttactcctagacgcaattagttctgagggatttagatagcgaaacgtaatcgg tc ttttgtcagt at atca gt aaat gac atatgtata aattataccgtc aagctgct atcgccg ataactc cacgactc ca tctt ta a aaagt aaatagg a caagaccg aa ctcg tc ca gtg g tggcg gatacca c tt tttattg aa a ataa atac attttaaaag t ta aactcggg gccgagcctc agcgcatagtgcgggcctaatttattcttat tttagccat gttg ccgaaaaaacagatgcgaag gtcctccc aaag aa ctttgagcaaagt ttc cg ttctgtgagctagtaggatt taagtttaagtgttgaa aaaatagtgaa caa ggtattgctaaaaatacgtccagactaatg cg tcaccgcaa cgactcc at a aaa caac gtttcgccactttt aaata at aacactcct gtaagacgg gg ctttactaaagct tc aag gaac tctgaac c agcggacgt cttgag cgagggcc ggagag actagtacc cttgacttatat aat ac cttct atc ca tcacctaaac gtcgtgta accactatccaac aaag c ac acgttc catacgca ttagtgcc tagtagtgtacctct cgtta gttgaa catcata gacttct gt tcgggtactaagc ttagt gcat ccagaagg acga cc tcccaggcgtacg gccagtaactcccc tgcgtgtg tt tct gaagctgcgcgtccgta aactgaagtatttatattaat gtcacatgta agcaataaatc tgagtaaataaccaaa taccatctaccttca aaaat gc a gcta cga g a ggcg gct t ta aatataac a c caatcatcggt ggtt ac cat c caacaaccttggtggcgtacacg ccctccct ac tcttt ttc aacgta a a t acgctcggtatcattaccttta ttacaaat acaacaa gcgatttt gaa aa tttacaacttc gaaattt gagatcacatgggacatagata gcaagctcgtcttctctt gcat ct atcaagag a gtttgtcc ct cgctaggttatat tga ctctaaa cc agca cactggc ggcta ctgga ggaccggt at cgc tcctgctgttacagtc cccta tgca atata aaaccaagaca ctc ctcgaa ata ccgcgagcccgcacgccacgt gaagctaaacccatgtttatacagcaaatttaaaaaa gtaattgttga acctttgtggc accaa aataagccatggatagaagc gcatcccgagccgtacctgacaa gaaaa tagctatctaat ata ct taaatgccgctcggtacct taacaca gcaagggcgagaggctc gttagcactctgacctaacagcggacttcacctgtgca gacaaatgtac aatga attt tcgcaggatttca tga tttcggaaggt cggtctagctg ta attgaaaacgaagctacgtta cta gtgc tcgt tgtttcttactactgcta taaaataacagtattatc acagagc ga atagg aagtgat ctagatcatgg ataagatctg c cac cgag gtcat ccccgggcacttcaaa gggg gtctaaaataa aaaaagtatcttctaag ggtgacacat a caggatcgttttcgtag cagaatccctacctgcgagcctgcaccactacgagatt ggttaattagcc aaac ctggaaatgaaaaa caaggcgct gct acgtgaatgat aaa cta aa ctcag ggtcg agctaatccagaaagcgggactcctataa acggcacataactgctt agcct atgtc gaaaaa aaagg ataaaaac33a ct tgagttactct ag ggcgagttc ga agcgtaggctcgtcgagactta gc ttg gc actgaatt acaaaa gtattagat tcactc gc gagt acaatctaacgtgcaatttcgatagctcgcctgccgcccag gcactcctgttcctggttctg tt a aatatgtaaaaccaa aaatacctgtgaccgataac tga t cggc ggtcactac gta tcgatgccagct ct ggacctgctact cggctgacac gctaccaa gt c agaggtg tacca aca tata gcagtata a acaaagca aagcc ca ccgt gaccttcc ttgcaccccgctt tgacata ttggctaagA N D_rehto A N Dcitetchturtnsyn soc3dimsalp DI.7 Q1.ESo N aggtcaggattt tgtc gt aacgtc gatctatcgta acttcgt aga c aattattaaatagatattt ctgg gatata ttaatactacgtcaagt gga ataatgggac gg tc gt gccttgtggtttgca gtagtattact acttgacttatacaat ag acaataaaaaa aatt ggaaggacccgtccggcatgacggcaagcgt taa aagtcatttgattcggcgctgaaccg c a aac ctaacttt attgtatgtcttagggt accaaaacgatgtcg aag ctcg gcgagc gtacccg ct ttac gtctgttttgca c attg atgttgga c c tat ggactt atatattcttaat t c ttaaaatagggaaaaccgttagt tatcccgc gtgtcgcggcaatccccgga attgtc cctcg tgt a acacgtctattagggaact tcttaagt gtgaaactatggt aa aaatgtgtaatct gt tgggtttacctggacttacg ggc agtttgtttt gtactttttccggaca attta taaaacaatatataact ctaaaaccgc gagtcttagtt ccgtcgcgtaagactttcgcatcaggac gaaaggtttgctgactgcttgtt acgttcaat ctctgtctct aattt accttt tc ctg at c c gaa ccac cctgcaaacgcgaggg gcccagcactgtgggta tcgagt c ggggttct gcgtttgtatcgagtccttctc tttgtg cgctcggtatgatgtacggaacaatttata agcta aatc tt ggagtatcacgtagttgcgtg attcggacgtggcggtcgggtagccgctaag ct aa gttt t t atg a aattataac t aacaattggcgg gg agttttgcgctagggtgtaggcg ctc att tttgg ttgcatattaatctgtatttaata a ttattaaacgaattcggcattat tgctgtct gcccagtacatgggttaggtgtttgagatcgttcatttttagtt ttcttatt ctcagttataa aa ccttaaacaacat tta atctaaa aact at gattccattagacagggatcct agac c agg gg gt acggggttcca ctttt ctagg aaaaattcctataactc agagacataagg a t t gtg a gtc ggcagggt aca tccctc acgcgaattc tccgtg gttacg aa ctccg t aacct gtacattctctgg atatatgtcttgtacat cgcacact at aaaagaaacagaaaataccgt agtctctattctgtcat ttaag tgt gt gttgttttctc atacatttgaact ttttact acattttaaaat at aatgtttt tttt agctgttgctgttgg aacgcgggagcaaaa atccgagcgt at gtagtt actgctgcttgctcc aac tc tgaaaactta acttaag cgt cc ttc gtaat cctgactgctg gcggtgcg gccgacgagggaagt tgtcgtcgttctgctcacaca tgtgttcatgaacaagaattcagtca gtc gt cgaatttgtcgggcgcg cgcgcgagcgtaccaaagcaaggcactt gtttatcgtcatgtagt agagggatgtatactttttggca a aaaa gttat taaccg atcta acccaaggccggg ttt agtaattactagcataattcacctac ga a gttgaaacttttaag agtaaga gt t aaaaaaaaaatgatc cc taaggggt ctatctcagcctaccccagtaggattctgac cttccttacttcctctcgccgtacgtttaacgggtgt tgtctataca ttt agaa a catcctgga ataaa atat tggcattcacctccacaggttact cctgct gttgatcagtgatcgaaggtc gtcgtgtaattattc atc aatcaa ga gt a catctaatt gacaaatga gtg caagcaaggc gatcccaaaccac cctagcgtttatctcgcgtagatctcttggtagtagactt ag ctattagt a caaaagtg tatat tgc ag ctg g c aacccgcgaaatccct atgcgaag a acgtaggtt gatagct g ccttcag agaggtatag gtttcgctttcaat aaacctaaaaaca tccacattttctgt gggc aggctcatttatgaaagacagacagcttcctgaggtacttgtactcgtg cctgttataaaaatgt agctaacaa a cag acct gctccttaagagcg gccgaggt gcgcggataactca aaacagattc cc cagt gttcggtagtacctatttgaaactaat gtgaagaaa ctcagtattacg acg agggttcgagatc taagggggaaccagtc catgac tta tc cggtacagttcttta cgttattgattcttaaagtta cta taaa tta aaaaagaagaattgtccagaccta ac gaggttaatct gggcaa gttga aaaatctagct actc ctcga tctccccacctcgttttc tttctttataaaatatacagagt gcaggc gttgctctttcacattttacatc ggaaccggtgctttcgttattcgtgagtactctaacgact aaaatta attatagtggtcatgt a ggg ttgg aagaccggccacg acaagttccacc ca ctctgtgt ggtaggtcttatatt gctcccctgacc aggcgct ggagattattactctta aacttgcg aagga gaaagcaccgttagttcccĴgaatcgta tctagatacgaaat tgt aa tttacatact gtatccat tttttt aa aaagtatagt attattgtg atgtatagacgagggttgcaaa ijgacga cct ccc ctagcaa gcttagt ctt tt cgtcattcaaacgggttc atatc tgtaaatc ttt a cca ggctat c tattataggaccgggcggccgtctttagaccttaagacca g ctttcccggtgtgggaccc ataacacga gggtt tatcct gattt gtt ttaagaatcat at a gc cagacat a gcta gggtcgggctg tta gtcaa attaagttaacacgttaacatgctttg agcctat aattttacttaatg gggtcaatgaaagacgcgaccaagt cagcctggacc
[0010] actatcat tag aa gcgtgcat gtgtgggacccaa acatatg cc cttacc c gtagtta t t c c cactggacggcccagaatagagcccagcagt caccc cggggcgc a catgaatccc gttcgcggaatagactagttcgc caaatacg aggc aaacc ctgatgcggctagt tttagagtccgttgaatgtta gt g gggcacctac ttatcttgggcc cacgggcgccgtcgctgtcaaat gcg atcgtt agtt aagggagttcc cgt gtt caatc gcgc aac cag aa ggtg gctt cc c agtg t aaagtccgctcacgt gcgtagttcgaaaaacgaggccggcaaagcgct tgtcgatgcgaat caagca gag atat c agcattttaacaccaata cga aac ag gagt a a tccgttccctccgaataaaaagag gaacattcgcatatgaccatttgaaatagtgt tc cgcgg at gacataagtgcgctat gtat accccgag gaggagatgtccggg aatagtca a cga cgct ggccga ggaccggg agcgtgagatccagcgggtcctaggtacggaca aaccagtgtagcc ata cgcgaat tgaagcc aattgg cactgtag gtcacgtacccatgcgtaggccaaagtctagca attttacg cgac acgtg gtcgcg cta ctt ctaggtagtaaagtggagag c acg agac ggggttcc gct aatacaag tgcttcgac cgcgggggggctcgtccggtccgcat ttatcgttactatgacat ccat caagaaaagtctct gtcctcg gaggg gaa ga gagtttcgccaa ggttaccacagc tcgtgcatt gtcccgtccaccaaacc aagg cgaaatg gcactgg cg attcgttg cccacttct cct acgaggaatgtccactatg ccacagtgtcc t tca acag gaccg ctcat tctcgggtccgtgaactccgtta atgtaaacaagcttcaatttattgt ta gcagtgatcgcatcgaggtcaacagtcgcg aattgct ctagttcgaaagcaaagtttg t ccg gtaaacttct ga cgccattccaa ag gtggggtgccaggga agcg agac a ggcatctccgattccgtgtgaa tttatgccaga tg tt ag a tta ctcacagccgggcgagt gc gcctggctttcaag aagtcctatgtt taagt ccg attcttatgcagcaatactaacctacc acatgttgctttactggtacctt gccgc ggcgccgttcttttta tcgtag caggcgcctgctt gtttccgtacgttatttg actcac aacaaggtcctctctcaa ttcc gagtcctcaa agctg gcgttgctggccccccctccaccgggttcggta cggggtaa ccccc tagtagttaacactcagcacaggaag cgcagct gtcgctctgtttt agct tta tggagcgtgttatgggatacaacattcataaggcatcttcggcatcact gcccct attatc gcaaagt tct ca tacactctgc ggtctgtacgcattcttgcacggtgttt agacctc gcgaccccgaa cgcgattgtgtca gttaa gccgtacggtagtgagaaac ggcgcaaacttcctccgctcgtaagtct ctcc tatg gtgggtctacatccagacgggccgtcgtttt accgcgcataaagccttcaagccca attgg gcgcacctcggtgcggcc ctcgagtggctaccgc ttg tatgtc aggta g aggctga ct ccaccgtta ta cttga acgtagagaagtcaccagggaaagagaccgatgtggatct tct ggttgg at atgttcccgcgaatta tcta cttcaagagactacgtaca ggtcgatacatata tttggacttgcgacggca ctgt ccgtcĵa aatatactc ataactac acc gggactta gattgtttgcaaacaggct ttttac gccga ijcca tt ccatattgt ccctatt aca gg tggtta ag cg g tga tt ct c t ccg g a cggc ggtctcacagtgcggt ag aac tt tggtgctg a atttacccggcat ggtgaaacgtca ttgat acca tt ccgttgac ag atggc a gggctcg c at gct tgggtacag g a gaa c a a gctgccttgt a a a g a a a aattt a g a g a gtagccaaagg
[0011] Methods for the alignment of sequences for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) to find the global (over the whole the sequence) alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. The BLAST algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10) calculates percent sequence identity and performs a statistical analysis of the similarity between the two sequences. The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information (NCBI). Global percentages of similarity and identity may also be determined using one of the methods available in the MatGAT software package (Campanella et al., BMC Bioinformatics. 2003 Jul 10; 4:29. MatGAT: an application that generates similarity / identity matrices using protein or DNA sequences). Minor manual editing may be performed to optimize alignment between conserved motifs, as would be apparent to a person skilled in the art. The sequence identity values, which are indicated in the present subject matter as a percentage were determined over the entire nucleic acid or amino acid sequence, using BLAST with the default parameters. The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to". The word "exemplary" is used herein to mean "serving as an example, instance or illustration". Any embodiment described as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments and / or to exclude the incorporation of features from other embodiments. The word "optionally" is used herein to mean "is provided in some embodiments and not provided in other embodiments". Any particular embodiment of the disclosure may include a plurality of “optional” features unless such features conflict. As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. Throughout this application, various embodiments of this disclosure may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range. Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases “ranging / ranges between” a first indicate number and a second indicate number and “ranging / ranges from” a first indicate number “to” a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween. As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts. It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the disclosure. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements. The disclosure should not be seen in any way restricted to the embodiments described and a person with ordinary skill in the art will foresee many possibilities to modifications thereof. The above-described embodiments are combinable. The following claims further set out particular embodiments of the disclosure.
Claims
1. C L A I M S1. Polynucleotide for obtaining carotenoids from a genetically modified plant cell, comprising a nucleic acid sequence encoding a polypeptide comprising at least one carotenoid-related gene selected from the group consisting of: a ZmPSY1 gene from Zea mays, a PacrtI gene from Pantoea ananatis, a crtW gene from Brevundimonas, or any combination thereof; wherein the nucleic acid has a sequence at least 90% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof.
2. Polynucleotide according to claim 1, wherein the nucleic acid has a sequence at least 95% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof.
3. Polynucleotide according to claim 1, wherein the nucleic acid comprises at least a sequence identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof.
4. Polynucleotide according to any of the previous claims, comprising at least two of the following sequences SEQ. ID No.15, SEQ. ID No.16, and SEQ. ID No.
17.
5. Polynucleotide according to any of the previous claims, comprising at least one of the following sequences SEQ. ID No.15 and SEQ. ID No.16; or SEQ. ID No.15 and SEQ. ID No.17; or SEQ. ID No.16 and SEQ. ID No.17; or SEQ. ID No.15, SEQ. ID No.16 and SEQ. ID No.
17.
6. Polynucleotide according to any of the previous claims, wherein said polynucleotide is linked to a regulatory element.
7. Polynucleotide according to any of the previous claims, wherein said regulatory element is a CaMV 35S promoter.
8. Polynucleotide according to any of the previous claims wherein the carotenoid is a ketocarotenoid and / or β-carotene.
9. Artificial vector for obtaining carotenoids from a genetically modified plant cell comprising the polynucleotide according to any of the previous claims.
10. Artificial vector according to the previous claim, wherein said artificial vector is an expression vector or a plasmid.
11. Cell for obtaining carotenoids from a genetically modified plant cell comprising the polynucleotide according to any one of claims 1 to 8, the artificial vector according to any one of claims 9 to10, or both.
12. Cell according to previous claim, wherein said cell is a prokaryotic cell.
13. Cell according to any one of claims 11 to 12, wherein said cell is an Agrobacterium cell.
14. Cell according to the previous claim, wherein said cell is Agrobacterium tumefaciens strain GV3101::pMP90 or Agrobacterium tumefaciens strain GV3101::pMP90RK.
15. Genetically modified plant cell for obtaining carotenoids comprising a polynucleotide comprising a nucleic acid sequence encoding a polypeptide comprising at least one carotenoid-related gene; wherein the nucleic acid has a sequence at least 90% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof.
16. Genetically modified plant cell according to the previous claim, wherein said polynucleotide is the polynucleotide according to any one of claims 1 to 8.
17. Genetically modified plant cell according to any one of claims 15 to 16, wherein said plant cell is selected from Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum.
18. Composition comprising: i) the polynucleotide according to any one of claims 1 to 8; ii) the artificial vector according to any one of claims 9 to 10; iii) the cell according to any one of claims 11 to 14; iv) the genetically modified plant cell according to any one of claims 15 to 16to; or v) any combination of i) to iv).
19. Composition according to the previous claim, wherein said plant is selected from Nicotiana tabacum, Medicago truncatula.
20. Process for producing a genetically modified plant cell comprising: providing a plant cell culture at an exponential phase of growth; introducing said plant cell culture with a cell according to any one of claims 11 to 14, thereby obtaining genetically modified plant cell.
21. Genetically modified plant cell biomass comprising a carotenoid content between 50 µg / g and 7000 µg / g; wherein the plant cell is selected from the following list: Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum.
22. Process for obtaining carotenoids from genetically modified plant cell, comprising the steps of: obtaining a recombinant Agrobacteria cell; obtaining a plant cell selected from the following list: Nicotiana tabacum, Medicago truncatula, Arabidopsis thaliana, Daucus carota, Solanum lycopersicum; transforming the plant cell with the recombinant Agrobacteria cell to obtain a transformed plant cell expressing a carotenoid-related gene; culturing the transformed plant cells to obtain a biomass of transformed plant cells;extracting carotenoids, from the biomass of transformed plant cells; wherein the recombinant Agrobacteria cell comprises a genetic construct comprising a sequence at least 90% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination thereof.
23. Process according to the previous claim, wherein the carotenoids are astaxanthin, canthaxanthin, β- carotene or combinations thereof.
24. Process according to any of the previous claims 22 to23, wherein the recombinant Agrobacteria cell comprises a genetic construct comprising a sequence at least 95% identical to a sequence selected from a list consisting of: SEQ. ID No.15, SEQ. ID No.16, SEQ. ID No.17, or any combination.
25. Process according to any of the previous claims 22 to 24, wherein the Agrobacteria cell is recombinant Agrobacterium tumefaciens cell.
26. Process according to any one of claims 22 to 25, wherein the process run under conditions suitable for carotenoid biosynthesis.
27. Process according to the previous claim, wherein said conditions comprise a) a Gamborg B5 medium or a Murashige and Skoog medium; b) during a period from 7 days to 15 days; c) at a temperature from 20 °C to 30 °C; or combination thereof.
28. Process according to any one of claims 22 to 27, further comprising a step of carotenoids extraction.
29. Process according to any one of claims 22 to 28, wherein the biomass of transformed plant cells has a carotenoid content between 50 µg / g and 7000 µg / g.
30. Process according to any one of claims 22 to 29, wherein the step of transforming the plant cell comprises co‐cultivation the plant cell and the recombinant Agrobacteria cell in a suspension culture medium for a period of 2 to 3 days.
31. Process according to any one of claims 22 to 30, wherein the step of culturing the transformed plant cells comprises: transferring the transformed plant cells to a solid culture medium comprising 0.4%(w / v) gelrite supplemented with 500 mg / L Timentin and an appropriate selection marker antibiotic; or culturing the transformed plant cells in an adequate liquid culture medium for a period of 7 to 15 days under a photoperiod, of 16h of light and 8h of darkness, at a temperature of 20 °C to 30 °C.
32. Process according to any one of claims 22 to 31, wherein the Agrobacteria is Agrobacterium tumefaciens, Agrobacterium tumefaciens strain GV3101::pMP90 or Agrobacterium tumefaciens strain GV3101::pMP90RK.
33. Process according to any one of claims 22 to 32, wherein the plant cell is N. tabacum BY-2 cell or Medicago truncatula A17 cell.
34. Process according to any one of claims 20 to 33, wherein the carotenoid-related gene is selected from: ZmPSY1 gene from Zea mays, PacrtI gene from Pantoea ananatis, crtW gene from Brevundimonas.
35. Carotenoids obtainable by the process according to any of the claim 22-34, wherein the carotenoids comprise a combination of astaxanthin and canthaxanthin, and wherein the weight ratio between astaxanthin and canthaxanthin is ranging from 10:1 to 1:
10.
36. Use of the polynucleotide according to claim 1-8 as an improver of carotenoids production from a genetically modified plant cell.
37. Use of the carotenoids according to claim 35, in nutraceutical, cosmetics, pharmaceutics, or animal feed.
Citation Information
Patent Citations
Plant produced human papillomavirus pseudovirion
WO2015011676A1
Method of increasing resistance against soybean rust in transgenic plants by increasing the scopoletin content
WO2016124515A1