Preparation for reducing plant growth inhibitor, and method for reducing plant growth inhibitor
A formulation with Rasamsonia emersonii, Thermoascus aurantiacus, and Thermomyces lanuginosus addresses the issue of plant growth inhibitors in organic waste, facilitating efficient compost production by reducing these inhibitors and enabling waste recycling.
Patent Information
- Application Number
- PCT/JP2025/007029
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-28
- Filing Date
- 2025-02-27
- Publication Date
- 2025-09-04
AI Technical Summary
The disposal of organic waste through incineration is costly and generates carbon dioxide, while reusing organic waste as compost is hindered by the presence of plant growth inhibitors, limiting the amount that can be recycled.
A formulation comprising Rasamsonia emersonii, Thermoascus aurantiacus, and Thermomyces lanuginosus is used to reduce plant growth inhibitors in organic waste, allowing for its effective reuse in compost production.
The formulation effectively reduces plant growth inhibitors in organic waste, enabling the recycling of a sufficient amount of organic waste for compost production.
Smart Images

Figure JP2025007029_04092025_PF_FP_ABST
Abstract
Description
Formulation for reducing plant growth inhibitors and method for reducing plant growth inhibitors CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This international application claims priority based on Japanese Patent Application No. 2024-028910, filed with the Japan Patent Office on February 28, 2024, the entire contents of which are incorporated herein by reference.
[0002] The present disclosure relates to a formulation for reducing plant growth inhibitors and a method for reducing plant growth inhibitors.
[0003] Conventionally, most organic waste has been ultimately disposed of by incineration, but various problems have arisen when incinerating organic waste, such as the high cost of transporting the organic waste to incineration facilities and the generation of carbon dioxide during the drying process during incineration.
[0004] In light of these problems, attempts have been made in recent years to reuse organic waste, such as coffee grounds discarded by beverage manufacturers and organic waste such as sake lees and shochu lees discarded by sake breweries, as raw materials for compost.
[0005] When producing compost from organic waste as a raw material, the organic waste may be fermented by mixing microorganisms with the organic waste. Patent Document 1 discloses a method for converting shochu lees into fertilizer, and discloses Thermomyces lanuginosus as a microorganism used in converting shochu lees into fertilizer.
[0006] Japanese Unexamined Patent Publication No. 7-087952
[0007] It is known that organic waste, such as coffee grounds, contains plant growth inhibitors, such as lignin. Therefore, when producing compost using organic waste as a raw material, it is necessary to use an amount of organic waste that does not affect plant growth. Therefore, producing compost using organic waste as a raw material has sometimes been insufficient as a method for reusing a sufficient amount of the organic waste, which is generated in large quantities. In other words, it has been desirable to reduce the plant growth inhibitors contained in organic waste so that a sufficient amount of organic waste can be reused as a raw material for compost.
[0008] In one aspect of the present disclosure, it is desirable to provide a novel formulation for reducing plant growth inhibitors that can reduce plant growth inhibitors contained in targets such as organic waste.
[0009] One aspect of the present disclosure is a formulation for reducing plant growth inhibitors in a target, the formulation comprising Rasamsonia emersonii.
[0010] In one aspect of the present disclosure, the formulation for reducing plant growth inhibitors may further comprise Thermoascus aurantiacus.
[0011] In one aspect of the present disclosure, the formulation for reducing plant growth inhibitors may further comprise Thermomyces lanuginosus.
[0012] In one aspect of the present disclosure, Rasamsonia emersonii may be EUSC-Rem1 (accession number: NITE ABP-04304).
[0013] In one embodiment of the present disclosure, Thermoascus aurantiacus may be EUSC-Tau1 (accession number: NITE ABP-04305).
[0014] In one aspect of the present disclosure, the object may be organic waste.
[0015] In one aspect of the present disclosure, the organic waste may be coffee grounds.
[0016] One aspect of the present disclosure is a method for reducing plant growth inhibitors contained in a target, the method comprising adding to the target a formulation for reducing plant growth inhibitors, the formulation comprising Rasamsonia emersonii.
[0017] In one aspect of the present disclosure, the formulation for reducing plant growth inhibitors may further comprise Thermoascus aurantiacus.
[0018] In one aspect of the present disclosure, the formulation for reducing plant growth inhibitors may further comprise Thermomyces lanuginosus.
[0019] In one aspect of the present disclosure, Rasamsonia emersonii may be EUSC-Rem1 (accession number: NITE ABP-04304).
[0020] In one embodiment of the present disclosure, Thermoascus aurantiacus may be EUSC-Tau1 (accession number: NITE ABP-04305).
[0021] In one aspect of the present disclosure, the object may be organic waste.
[0022] In one aspect of the present disclosure, the organic waste may be coffee grounds.
[0023] One aspect of the present disclosure is EUSC-Rem1 (accession number: NITE ABP-04304), which reduces plant growth inhibitors contained in a target.
[0024] One aspect of the present disclosure is EUSC-Tau1 (accession number: NITE ABP-04305), which reduces plant growth inhibitors contained in a target.
[0025] This configuration allows for the production of a novel formulation for reducing plant growth inhibitors. According to a method for reducing plant growth inhibitors using such a formulation for reducing plant growth inhibitors, simply adding the microorganisms discovered in the present disclosure can easily and effectively reduce plant growth inhibitors contained in a target. Furthermore, when the formulation for reducing plant growth inhibitors disclosed in the present disclosure is added to organic waste that may contain a large amount of water, the plant growth inhibitors in the organic waste can be reduced, allowing for the recycling of a sufficient amount of organic waste.
[0026] Figure 1A shows the results of DNA extraction from coffee grounds undergoing pretreatment and amplification of ITS sequences and 16S rRNA sequences (V3-V4), which are classification marker sequences for filamentous fungi and bacteria, in Example 2. The coffee grounds were sorted in order of increasing whiteness from 1 to 8, but were not collected over time from a single source. Figure 1B shows a graph showing the results of estimating the content ratio of each fungal species in filamentous fungi, obtained by amplicon sequencing analysis using a next-generation sequencer, analyzed with Qiime2 in Example 2. Scanned images show the results of evaluating the plant growth inhibitor reduction activity of each coffee ground when Komatsuna (Brassica napus) was grown using extracts from untreated and pretreated coffee grounds. This demonstrates that pretreatment of coffee grounds reduces plant growth inhibitors in the coffee grounds. Scanned images show the results of the coffee grounds culture medium for each test plot after cultivating at 45°C for 8 days in Example 3. 1 is a scanned image showing the results of komatsuna cultivation in Example 3, where the komatsuna were cultivated using an extract from the coffee grounds medium of each test plot after culturing at 45°C for 8 days. FIG. 2 is a scanned image showing the results of komatsuna cultivation in Example 4, where the komatsuna were cultivated using an extract from the coffee grounds medium of each test plot after culturing at 45°C for 7 days and then culturing at 50°C for a further 7 days. FIG. 3 is a box plot comparing the taproot length (mm) of each test plot after culturing in Example 4. The horizontal line within the box indicates the median, and the cross (x) indicates the mean. Different letters indicate that a statistically significant difference was found by the Tukey method. FIG. 4 is a box plot comparing the taproot length (mm) of each test plot after culturing in Example 5. The horizontal line within the box indicates the median. Different letters indicate that a statistically significant difference was found by ANOVA. Figure 8A is a box plot comparing the tap root length (mm) in each test plot after Komatsuna was grown using an extract obtained from coffee grounds on which the isolates shown in the table were cultured in Experiment 6A of Example 6. Figure 8B is a box plot comparing the tap root length (mm) in each test plot after Komatsuna was grown using an extract obtained from coffee grounds on which the isolates shown in the table were cultured in Experiment 6B of Example 6. The horizontal line within the box indicates the median.Different letters indicate statistically significant differences observed by ANOVA. Figure 10A is a box plot comparing the taproot length (mm) of each test plot after komatsuna plants were grown using extracts obtained from coffee grounds on which the isolates or NBRC strains shown in the table were cultured in Example 7. The horizontal line within the box indicates the median. Different letters indicate statistically significant differences observed by ANOVA. Figure 10B is a graph showing the proportion of each filamentous fungal species in each sample after cultivation, estimated by amplicon sequencing analysis, in Example 8. This is a box plot comparing the taproot length (mm) in each test plot after Komatsuna plants were grown using extracts obtained from coffee grounds cultured with the isolates or NBRC strains shown in the table in Example 9. The horizontal line within the box indicates the median. Different letters indicate statistically significant differences as determined by ANOVA.
[0027] Exemplary embodiments of the present disclosure will now be described.
[0028] [First embodiment: Formulation for reducing plant growth inhibitors and method for reducing plant growth inhibitors] 1. Formulation for reducing plant growth inhibitors The formulation for reducing plant growth inhibitors of the present disclosure can be added to a target plant to reduce plant growth inhibitors contained therein.
[0029] Here, "target" refers to a target for which the formulation for reducing plant growth inhibitors of the present disclosure is used. The "addition" of the formulation for reducing plant growth inhibitors of the present disclosure includes spraying and mixing of the formulation for reducing plant growth inhibitors of the present disclosure. The "target" may be, for example, organic waste. Examples of organic waste include coffee grounds, used tea leaves, fruit and vegetable lees, sake lees and shochu lees, livestock manure, and bedding, with coffee grounds being preferred.
[0030] The coffee grounds are preferably coffee grounds discarded after coffee extraction, but may also be coffee beans (seeds of coffee trees such as Arabica, Robusta, and Liberica) themselves, or roasted, ground, dried, or powdered coffee beans. Roasted coffee beans may be coffee beans roasted by various methods, such as home roasting, hot air roasting, infrared roasting, microwave roasting, superheated steam roasting, or low-temperature roasting. Ground coffee beans may be coffee beans ground using various devices, such as a coffee mill, grinder, or stone mill, and may also include coarsely ground or powdered coffee beans. The moisture content of the coffee grounds is preferably within the range of approximately 30 to 80%.
[0031] In the present disclosure, a "plant growth inhibitor" refers to a substance that inhibits or suppresses plant growth or germination, and examples thereof include phenolic acids such as salicylic acid, lignin, glucosinolates, phytic acid, alkaloids such as caffeine and sinapine, and fiber.
[0032] In the present disclosure, the term "plant" refers to any of bryophytes, microphytes, macrophytes, and spermatophytes. Bryophytes may be any of mosses, liverworts, and hornworts. Spermatophytes may be any of gymnosperms and angiosperms.
[0033] In the present disclosure, "reduction of plant growth inhibitors" means that the plant growth inhibitors are reduced in a target to which a formulation for reducing plant growth inhibitors of the present disclosure has been added, compared to a target to which the formulation has not been added. For example, the reduction of plant growth inhibitors may mean that the plant growth inhibitors contained in the target are reduced (i.e., removed) by 100%. However, the reduction of plant growth inhibitors does not necessarily mean that the plant growth inhibitors are reduced by 100%. For example, the reduction of plant growth inhibitors may mean that the plant growth inhibitors are reduced by 90%, 80%, or 70% in a target to which a formulation for reducing plant growth inhibitors of the present disclosure has been added, compared to a target to which the formulation has not been added.
[0034] The formulation for reducing plant growth inhibitors according to the present disclosure contains Rasamsonia emersonii (hereinafter referred to as Microorganism 1), a type of filamentous fungus.
[0035] Microorganism 1 can be isolated from nature by a known isolation method. For example, Rasamsonia emersonii isolated from pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.) as shown in Example 1 described below can be used as microorganism 1. Note that, as an example, pretreatment may be a process in which untreated coffee grounds and coffee grounds that no longer have a foul odor (coffee grounds that have been left or aged at Shikoku Cage Co., Ltd.) are mixed in a ratio of 8:2 and aged for approximately 60 days to reduce the moisture content to approximately 20% or less. Furthermore, commercially available Rasamsonia emersonii or Rasamsonia emersonii stored at a depository institution may be used as microorganism 1. In the following explanation, examples of depository institutions include the Patent Microorganisms Depositary Center of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan).
[0036] Furthermore, the Rasamsonia emersonii of the present disclosure may be a strain designated EUSC-Rem1. EUSC-Rem1 was isolated from pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.). EUSC-Rem1 was received for international deposit under the Budapest Treaty at the International Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on February 10, 2025, under the accession number NITE ABP-04304.
[0037] Therefore, another aspect of the present disclosure relates to EUSC-Rem1 for reducing plant growth inhibitors contained in a target.
[0038] Furthermore, in addition to the above-mentioned Microorganism 1, the formulation for reducing plant growth inhibitors according to the present disclosure may further contain Thermoascus aurantiacus (hereinafter, Microorganism 2), which is a type of filamentous fungus.
[0039] Microorganism 2 can be isolated from nature by a known isolation method. For example, Thermoascus aurantiacus isolated from pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.) as shown in Example 1 described below can be used as microorganism 2. Alternatively, commercially available Thermoascus aurantiacus or Thermoascus aurantiacus stored at a depository institution may be used as microorganism 2.
[0040] The Thermoascus aurantiacus of the present disclosure may also be a strain designated EUSC-Tau1. EUSC-Tau1 was isolated from pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.). EUSC-Tau1 was received for international deposit under the Budapest Treaty at the International Patent Microorganisms Depositary of the National Institute of Technology and Evaluation (Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on February 10, 2025, under the accession number NITE ABP-04305.
[0041] Therefore, another aspect of the present disclosure relates to EUSC-Tau1 for reducing plant growth inhibitors contained in a target.
[0042] In addition to the above-mentioned Microorganism 1 and Microorganism 2, the formulation for reducing plant growth inhibitors according to the present disclosure may further contain Thermomyces lanuginosus (hereinafter, Microorganism 3), which is a type of filamentous fungus.
[0043] The microorganism 3 can be isolated from nature by a known isolation method. For example, Thermomyces lanuginosus isolated from pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.) as shown in Example 1 described below can be used as the microorganism 3. Alternatively, commercially available Thermomyces lanuginosus or Thermomyces lanuginosus stored at a depository institution may be used as the microorganism 3.
[0044] The above-mentioned microorganisms 1 to 3 can be cultured in a medium suitable for culturing filamentous fungi at a culture temperature of 30 to 50°C (preferably 35 to 55°C), a culture pH of 4.5 to 8.0 (preferably 6.0 to 7.0), and a culture time of 6 to 30 hours. For example, microorganisms 1 to 3 can be inoculated into potato dextrose agar medium (hereinafter referred to as PDA medium) or malt extract agar medium (hereinafter referred to as MEA medium), and cultured at 37 to 55°C for 24 to 72 hours.
[0045] In the present disclosure, the above-described formulation for reducing plant growth inhibitors may be used as is, or, if necessary, may be used in a liquid form dispersed in a liquid such as water, or in a solid form mixed with any material (e.g., wood chips, sawdust, etc.). Furthermore, any excipient may be added to the formulation for reducing plant growth inhibitors in the present disclosure. For example, glucose, glycerin, etc. may be added to the formulation for reducing plant growth inhibitors to stabilize the contained microorganisms.
[0046] In the formulation for reducing plant growth inhibitors of the present disclosure, the plurality of microorganisms that can be contained may be added at any content as long as they can reduce the plant growth inhibitors contained in the target. For example, in the formulation for reducing plant growth inhibitors of the present disclosure, each of the plurality of microorganisms that can be contained may be added at 10 3 cfu / g to 10 10 cfu / g, preferably 10 5 cfu / g to 10 10 The microorganisms may be contained in an amount of cfu / g. The amount may be different for each microorganism or may be the same for each microorganism. Generally, the greater the amount of each microorganism, the stronger the effect of reducing plant growth inhibitors.
[0047] The content of the plurality of microorganisms that can be contained in the formulation for reducing plant growth inhibitors according to the present disclosure may be adjusted using the area of the mat-like region formed by the growth of mycelia on the medium as an indicator. 2 / g, preferably 1 to 100 mm 2 / g, more preferably 10 to 100 mm 2 / g.
[0048] 2. Method for Reducing Plant Growth Inhibitors The method for reducing plant growth inhibitors contained in a target according to the present disclosure includes adding to the target a formulation for reducing plant growth inhibitors obtained by the above-described method. That is, the formulation for reducing plant growth inhibitors used in the method for reducing plant growth inhibitors according to the present disclosure includes the above-described Microorganism 1. Furthermore, in addition to the above-described Microorganism 1, the formulation for reducing plant growth inhibitors used in the method for reducing plant growth inhibitors according to the present disclosure may include the above-described Microorganism 2. Furthermore, in addition to the above-described Microorganism 1 and Microorganism 2, the formulation for reducing plant growth inhibitors used in the method for reducing plant growth inhibitors according to the present disclosure may include the above-described Microorganism 3.
[0049] In the method for reducing plant growth inhibitors disclosed herein, the number of times the above-mentioned formulation for reducing plant growth inhibitors is added to the target may be one, two, three, four, or five or more times.
[0050] Furthermore, the method for reducing plant growth inhibitors according to the present disclosure may be carried out at a temperature of 40 to 60°C (preferably 50 to 60°C), thereby more suitably reducing the plant growth inhibitors contained in the target.
[0051] The period during which the above-mentioned formulation for reducing plant growth inhibitors is added to the target, i.e., the period during which the above-mentioned formulation for reducing plant growth inhibitors is in contact with the target, may be, for example, several hours, one day, several days, or one week or more.
[0052] Organic waste may be reused for the production of compost. For example, Japanese Patent No. 7030372 may be referenced for a method for producing compost from organic waste, such as coffee grounds. When organic waste is reused for the production of compost, the method for reducing plant growth inhibitors according to the present disclosure may be applied during the process of producing compost from the organic waste. In other words, the method for reducing plant growth inhibitors according to the present disclosure may be included as one step in a method for producing compost using organic waste as a raw material.
[0053] Alternatively, when the organic waste is reused as compost, the organic waste may be subjected to the method for reducing plant growth inhibitors according to the present disclosure in advance. That is, as another aspect of the present disclosure, the method for reducing plant growth inhibitors according to the present disclosure may be a method for pretreating organic waste in a method for producing compost using organic waste as a raw material.
[0054] [Effects of each formulation of the present disclosure] Furthermore, the above-mentioned microorganisms 1 to 3 each contribute individually or by interacting with other microorganisms to reduce plant growth inhibitors contained in the target. When the target is organic waste, the mechanism by which plant growth inhibitors in the organic waste are reduced is presumed to be due to the action shown below.
[0055] (1) By activating the microorganisms 1 in the organic waste, the organic waste can be decomposed and plant growth inhibitors in the organic waste can be reduced.
[0056] (2) When microorganism 2 is activated in the organic waste, the organic waste is decomposed, and together with microorganism 1, it can contribute to reducing plant growth inhibitors in the organic waste.
[0057] (3) When microorganism 3 is activated in the organic waste, the organic waste is decomposed, and together with microorganism 1 and microorganism 2, microorganism 3 can contribute to reducing plant growth inhibitors in the organic waste.
[0058] [Examples] The present disclosure will be described in more detail below using examples, but these are not intended to limit the scope of the present disclosure.
[0059] Example 1: Isolation, selection, and identification of microbial strains Microorganism 1 (Rasamsonia emersonii) Approximately 1 g of a sample of pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.) was suspended in 10 mL of 0.1% tryptone (Nacalai Tesque) aqueous solution and heated at 75°C for 30 minutes. The suspension was serially diluted 10-fold, smeared on PDA plates, and cultured at 55°C for 5 days. After culture, a strain (EUSC-Rem1) was isolated from the colonies that appeared. The mycological properties of the strain (EUSC-Rem1) are as follows:
[0060] Visual observation of growth: After 5 days of cultivation at 45°C, the fungus grew to a diameter of 75-90 mm. Spores were produced vigorously, forming small colonies on the periphery. The mycelium was very light brown, and the spore-forming area was pale brown.
[0061] The rRNA ITS base sequence (SEQ ID NO: 1) of the strain (EUSC-Rem1) is as follows: AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGTCCCCTTTGCGGGCCCGACCTCCCACCCGTGTCTACCGTACCGTGTTGCTTCGGCGGGCCCGCCAGGGGGGCTCCTGTCCCTGGCCGCCGGGGGGCCATCTCCCGTGCCTCCGGGCCCGTGCCCGCCGGAGACCCTCGTGAACGCTGTCTTGAACAAAGGTTGCGGTCTGAGTGGAAAACACAATCGTCAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCG ATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCCTCAAGCACGGCTTGTGTGTTGGGCCGCCGTCCCTTCCCGCGGGGAGGGACGGGCCCGAAAGGCAGCGGCGGTGCCGCGTTTCCGGTCCCTGAGCGTATGGGGCTCTGTCACCCGCTCTGGAGGTGCCGGCCGGTGCCCGCCTACCCGTCAGACATCTTCCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCA PCR was performed using primers targeting this region, and the resulting sequence was compared for homology by BLAST search for identification.The strain (EUSC-Rem1) was found to be highly homologous to Rasamsonia emersonii (100% homology). Therefore, the above-mentioned strain (EUSC-Rem1) was presumed to be Rasamsonia emersonii.
[0062] Microorganism 2 (Thermoascus aurantiacus) Approximately 1 g of a sample of pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.) was suspended in 10 mL of sterilized 0.1% tryptone (Nacalai Tesque) aqueous solution and heated at 75°C for 30 minutes. The suspension was serially diluted 10-fold, smeared on PDA plates, and cultured at 55°C for 3 days. After culture, a strain (EUSC-Tau1) was isolated from the colonies that appeared. The bacteriological properties of the strain (EUSC-Tau1) are as follows:
[0063] Macroscopic observation of growth status: When cultured at 45°C, cotton-like hyphae were observed to elongate within 24 hours, and after 3 days of culture, they had grown over the entire 90 mm diameter plate medium. The hyphae changed from cotton-like to densely tangled scab-like. The colony was white overall until about 7 days of culture, after which it turned reddish-brown in spots, and the entire colony turned reddish-brown. The overall reddish-brown color was also observed after transferring to room temperature at the white stage. In colonies cultured for 2 weeks, the membranes of most of the asci in the ascocarp (cleistothecia) had disappeared, and ascospores were observed to be forming in the ascocarp.
[0064] The rRNA ITS base sequence (SEQ ID NO: 2) of the strain (EUSC-Tau1) is as follows: AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTCCGGGGCCCAACCTCCCACCCGTGTGTACCGTACCCTGTTGCTTCGGCGGGCCCGCCGCAAGGCCGCCGGGGGGCGTGTCCTGCCCCCGGGCCCGCGCCCGCCGGAGGCCCTTCGAACGCTGAGCTTTTGAAGGCGTGCCGTCTGAGTCGCGTGAGAAATCGTGAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTG AATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCGCCGTCCCCGCCCGCCGCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTTGCAGGCCCGGCCGGAGCCTCAGCCCGACCCCGCGTCAACATCTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT PCR was performed using primers targeting this region, and the resulting sequences were compared for homology by BLAST search and identified. The strain (EUSC-Tau1) was found to be highly homologous to Thermoascus aurantiacus (homology 99.83%). Therefore, the above-mentioned strain (EUSC-Tau1) was presumed to be Thermoascus aurantiacus.
[0065] Microorganism 3 (Thermomyces lanuginosus) Approximately 1 g of a sample of pretreated coffee grounds (provided by Shikoku Cage Co., Ltd.) was suspended in 10 mL of 0.1% tryptone (Nacalai Tesque) aqueous solution and heated at 45°C for 30 minutes. The suspension was serially diluted 10-fold, smeared on PDA plates, and cultured at 45°C or 55°C for 7 days. After culture, five strains (EUSC-Tla_a1 to EUSC-Tla_e1) were obtained from the colonies that appeared. The mycological properties of the strain (EUSC-Tla_a1) are as follows:
[0066] Visual observation of growth status: After 5 days of cultivation at 45°C, the hyphae grew to a diameter of 40-60 mm. The tips of the hyphae were white, but as they grew, they turned brown and fluffy. Brown or wine-red pigments diffused into the medium. There was little spore formation on the PDA medium. A pale wine-red color was observed on the bottom. There was almost no growth at 28°C, slight growth at 37°C, and slower growth at 55°C than at 45°C.
[0067] The rRNA ITS base sequence (SEQ ID NO: 3) of the strain (EUSC-Tla_a1) is as follows: CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGAACCCAGTCGGGTCCCAATCTCCCACCCGTGTCTACCACACCTAGTGTTGCTTTGGCGGGCCCACTCCTCCGGTGTTCCGCCGGGGGGGTCGTCCCGGGGCGCGGTGTGCCCCCGGGGCCCGTGCCCGCCAGAGGCACTCACTGTGAACGCTTTTGTGAATGCGAGGATTGTCTGAGTGACGAAATGCAATCGTTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC The mycological characteristics of the strain (EUSC-Tla_b1) are as follows: GAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCGAACCCTCAAGCACGGCTTGTGTGTTGGGCCGCCGTCCCCTCGTTTGGAGGGGACGGGCCTGAAAGGCAGCGGCGGCGTCGCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACGCGCTCAAGGAGGGGTCCGGCCGGGGCCATAGCCTCTGAAGGTCAATTCTTCCAAGGTTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCA
[0068] Visual observation of growth: After 3 days of cultivation at 45°C, the fungus grew to a diameter of 20-40 mm, vigorously produced spores, and formed numerous colonies around it. The mycelium was white, but the spores were gray-green. Growth was slow at 28°C, vigorous at 37°C, and extremely slow at 55°C.
[0069] The rRNA ITS2 base sequence (SEQ ID NO: 4) of the strain (EUSC-Tla_b1) is as follows: GTGATTCATCTAATCTTTTAACGCACATTGCGCCGTGTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCGAACCCTCAAGCACGGCTTGTGTGTTGGGCGGCCGTCCCCTCGTTTGGAGGGGACGGGCCTGAAAGGCAGCGGCGGCGTCGCGTCCTGTCCTCGAGGGTATGGGGCTCTGTCACGCGCTCAAGGAGGGGTCCGGCCGGGGCCATAGCCTCTGAAGGTCAATTCTTCCAAGGTTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGG The mycological properties of the strain (EUSC-Tla_c1) are as follows:
[0070] Visual observation of growth: After 3 days of cultivation at 45°C, the fungus grew to a diameter of 20-40 mm, vigorously produced spores, and numerous colonies were formed around it. The mycelium was white, but the spores were gray-green. There was almost no growth at 28°C, and growth at 37°C and 55°C was slower than at 45°C.
[0071] The rRNA ITS2 base sequence (SEQ ID NO: 5) of the strain (EUSC-Tla_c1) is as follows: GATTCTTGAACGCACATTGCGCCCTGTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCGAACCCTCAAGCACGGCTTGTGTGTTGGGCCGCCGTCCCCTCGTTTGGAGGGGACGGGCCTGAAAGGCAGCGGCGGCGTCGCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACGCGCTCAAGGAGGGGTCCGGCCGGGGCCATAGCCTCTGAAGGTCAATTCTTCCAAGGTTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAAA The mycological properties of the strain (EUSC-Tla_d1) are as follows:
[0072] Visual observation of growth status: After 5 days of cultivation at 45°C, the mycelium grew to a diameter of 50-70 mm. The tips of the mycelium were white, but as it grew, it turned brown and fluffy. A wine-red pigment was produced, which also diffused into the medium. When viewed from the bottom, the entire mycelium was observed to be wine-red. There was little spore formation on the PDA medium. There was almost no growth at 28°C, slight growth at 37°C, and growth at 55°C was slower than at 45°C.
[0073] The rRNA ITS base sequence (SEQ ID NO: 6) of the strain (EUSC-Tla_d1) is as follows: GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGAACCCAGTCGGGTCCCAATCTCCCACCCGTGTCTACCACACCTAGTGTTGCTTTGGCGGGCCCACTCCTCCGGTGTTCCGCCGGGGGGGTCGTCCCGGGGCGCGGTGTGCCCCCGGGGCCCGTGCCCGCCAGAGGCACTCACTGTGAACGCTTTTGTGAATGCGAGGATTGTCTGAGTGACGAAATGCAATCGTTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATG The mycological characteristics of the strain (EUSC-Tla_e1) are as follows: CGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCGAACCCTCAAGCACGGCTTGTGTGTTGGGCCGCCGTCCCCTCGTTTGGAGGGGACGGGCCTGAAAGGCAGCGGCGGCGTCGCGTCCGGTCCTCGAGCGTATGGGGCTCTGTCACGCGCTCAAGGAGGGGTCCGGCCGGGGCCATAGCCTCTGAAGGTCAATTCTTCCAAGGTTGACCTCGGATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCA
[0074] Visual observation of growth status: After 5 days of cultivation at 45°C, the mycelium grew to a diameter of 60-80 mm. The tips of the mycelium were white, but as it grew, it turned brown and fluffy. Brown or wine-red pigments also diffused into the medium. A flesh-colored or pale wine-red color was observed from the bottom. There was little spore formation on the PDA medium. It grew vigorously even at 55°C.
[0075] The rRNA ITS base sequence (SEQ ID NO: 7) of the strain (EUSC-Tla_e1) is as follows: GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGAACCCAGTCGGGTCCCAATCTCCCACCCGTGTCTACCACACCTAGTGTTGCTTTGGCGGGCCCACTCCTCCGGTGTTCCGCCGGGGGGGTCGTCCCGGGGCGCGGTGTGCCCCCGGGGCCCGTGCCCGCCAGAGGCACTCACTGTGAACGCTTTTGTGAATGCGAGGATTGTCTGAGTGACGAAATGCAATCGTTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGC PCR was performed using primers targeting these regions, and the resulting sequences were compared for homology by BLAST search to identify the strains (EUSC-Tla_a1 to EUSC-Tla_e1). The strains (EUSC-Tla_a1 to EUSC-Tla_e1) showed high homology to Thermomyces lanuginosus. The homology between the strain (EUSC-Tla_a1) and Thermomyces lanuginosus was 100%. The homology between the strain (EUSC-Tla_b1) and Thermomyces lanuginosus was 97.32%, but no sequences more similar than this were found in the database.The homology between the strain (EUSC-Tla_c1) and Thermomyces lanuginosus was 99.64%. The homology between the strain (EUSC-Tla_d1) and Thermomyces lanuginosus was 100%. The homology between the strain (EUSC-Tla_e1) and Thermomyces lanuginosus was 100%. Therefore, the above-mentioned strains (EUSC-Tla_a1 to EUSC-Tla_e1) were presumed to be Thermomyces lanuginosus.
[0076] Example 2: Analysis of the microbial flora in coffee grounds during pretreatment As a starting point for isolating, culturing, and identifying microorganisms that play an important role in pretreatment, the following test was conducted to extract DNA from the coffee grounds during the pretreatment process and identify the microorganisms contained in these materials by amplicon sequencing.
[0077] DNA was extracted from coffee grounds in the pretreatment process, i.e., four black samples in the middle of pretreatment and four white samples after almost and completely pretreated, all collected by Shikoku Cage Co., Ltd., using ISOSPIN Soil DNA (Nippon Gene Co., Ltd.) according to the protocol.
[0078] The ITS sequence and 16S rRNA sequence (V3-V4), which are taxonomic marker sequences for filamentous fungi and bacteria, were amplified by PCR using the following primers: PCR reactions were performed using 2xKAPA HiFi HotStart ReadyMix (KAPA BIOSYSTEMS) according to the Illumina protocol (16S Metagenomic Sequencing Library Preparation: Preparation of 16S ribosomal RNA gene amplicons for the Illumina MiSeq system).
[0079] Primer sequences (filamentous fungal ITS) N_gITS7v2_F1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNGTGARTCATCGARTCTTTG (SEQ ID NO: 8) N_ITS4_R1 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNTCCTCCGCTTATTGATATGC (SEQ ID NO: 9) Primer sequences (16S rRNA V3-4 region) N_16S_V3-4_1st_F1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNACTCCTACGGGAGGCAGCAG (SEQ ID NO: 10) N_16S_V3-4_1st_R1 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNGGACTACHVGGGTWTCTAAT (SEQ ID NO: 11) Amplification of the target sequence by PCR was confirmed by agarose gel electrophoresis (see FIG. 1A).
[0080] Genome Read Co., Ltd. was commissioned to perform next-generation sequence analysis and determine the base sequence.
[0081] Using qime2, we performed data quality checks, paired-end read assembly and filtering, clustering using reference sequences, taxonomic group (species level) linkage, and data export. A graph was created for the detected filamentous fungal species (see Figure 1B).
[0082] Regarding the amplification of the ITS sequence, the amount of amplification was small in one of the black samples, but clear amplification was observed in the other samples. The amount of amplification was particularly large in the white sample, suggesting that filamentous fungi were actively growing in the later stages of pretreatment, when whitening was progressing. On the other hand, the amount of amplification of the 16S rRNA sequence was large in the black sample and small in the whitened sample. This suggests that bacteria were growing as the dominant microorganism in the early stages of pretreatment, and that filamentous fungi were replacing bacteria as they progressed to whitening.
[0083] Amplicon sequencing analysis showed that EUSC-Tla and other filamentous fungi dominated the black samples, but then, as the samples whitened, EUSC-Tau1 and EUSC-Rem1, especially EUSC-Rem1, replaced them, and in the pre-treated samples, EUSC-Rem1 became the overwhelmingly dominant species.
[0084] Example 3: Evaluation of plant growth inhibitor-reducing activity in coffee grounds cultured with isolated strains (1) Experiments conducted by the inventors so far have shown that pretreatment of coffee grounds reduces the plant growth inhibitor-reducing activity in coffee grounds by approximately one-third (see Figure 2). Note that the plant growth inhibitor-reducing activity refers to the activity of reducing plant growth inhibitors.
[0085] To identify the microorganisms that contribute to this reduction, the isolated strains were cultured on a medium containing coffee grounds as the sole nutrient source at an optimum temperature for growth, and the plant growth inhibitor reduction activity of the extract obtained from the culture medium was evaluated.
[0086] 200 g of untreated coffee grounds (provided by Shikoku Cage Co., Ltd.; moisture content approximately 30%) were mixed with 200 mL of sterilized deionized water and sterilized in an autoclave (121°C, 20 minutes). 25 g of this mixture was placed in each sterilized plastic dish (diameter 90 mm, height 20 mm) and flattened with the back of a medicine spoon to prepare a coffee grounds culture medium.
[0087] Each of the microorganisms isolated in Example 1 was cultured in PDA medium (Nissui Pharmaceutical Co., Ltd.). 10 mL of sterilized deionized water was added to the bacterial cells spread over the entire surface of the PDA medium, and the bacterial cells were scraped off with a cotton swab to prepare a suspension.
[0088] The coffee grounds medium inoculated in the center with the inoculum indicated in the following test plots (1) to (10) was placed in a sealable vinyl bag and cultured at 45°C for 8 days. (1): Untreated group: no inoculum; (2): Positive control group: 2 g of pretreated coffee grounds + 2 mL of sterile deionized water; (3): EUSC-Bad1, EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1; (4): EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1; (5): EUSC-Bad1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1. (6): EUSC-Bad1, EUSC-Tau1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (7): EUSC-Bad1, EUSC-Tau1, EUSC-Rem1, and EUSC-Tla_a1 (8): EUSC-Bad1, EUSC-Tau1, EUSC-Rem1, and EUSC-Tla_b1 (9): EUSC-Bad1, EUSC-Tau1, EUSC-Rem1, and EUSC-Tla_c1 (10): EUSC-Bad1, EUSC-Tau1, EUSC-Rem1, and EUSC-Tla_d1 The EUSC-Bad1 mentioned above is the yeast Blastobotrys adeninivorans. During the pretreatment of coffee grounds (provided by Shikoku Cage Co., Ltd.), approximately 1 g of sample was collected from the surface of the coffee grounds, suspended in 10 mL of sterilized 0.1% tryptone (Nacalai Tesque) aqueous solution, and heated at 45°C for 30 minutes. The suspension was serially diluted 10-fold, smeared on PDA plates, and cultured at 45°C for 24 hours. After culture, a strain (EUSC-Bad1) was isolated from the colonies that appeared. The bacteriological properties of the strain (EUSC-Bad1) are as follows:
[0089] Colony formation: Round, entire, cushion-shaped with a flattened margin, opaque, white to cream in color, and non-glossy.
[0090] After each culture, a photograph of each coffee grounds medium was taken, and the entire volume was transferred to a plastic bag. The clumped coffee grounds were then homogenized by hand, and 4 g was weighed and transferred to a 50 mL conical tube. 40 mL of sterile deionized water was added to disperse the coffee grounds, and the tube was heated in a constant-temperature water bath at 60°C for 3 hours. During this time, the tube was inverted upside down every 30 minutes to mix the contents. Insoluble matter was precipitated by centrifugation at 3,000 rpm for 15 minutes at room temperature, and the supernatant was transferred to a new tube. This was used as the extract from the coffee medium.
[0091] To conduct the bioassay, a paper towel was first cut into a semicircular shape approximately 60% of the height of a filter paper (80 mm diameter), placed in a Petri dish, and the filter paper was then placed on top of it. 0.1% (v / v, final concentration) Hyponex stock solution (Hyponex Japan) was added to the extract, and 10 mL was added to the Petri dish to moisten the paper towel and filter paper. The top of the filter paper was pressed against the bottom of the Petri dish, creating a step with the edge of the paper towel. Sterile deionized water containing 0.1% Hyponex was used as a control. Komatsuna seeds were placed in the step, and the Petri dish lid was secured with tape. The seeds were placed at an angle to prevent them from falling, and grown in a climate chamber (Tomy Seiko) at 24°C with a 16-hour photoperiod. One week after sowing, images were captured using a flatbed scanner to record seedling and root growth.
[0092] Figure 3 shows the coffee grounds medium after 8 days of incubation at 45°C, and Figure 4 shows a scanned image of the bioassay. Even in test plot (2), which contained pretreated coffee grounds as a positive control, no reduction in plant growth inhibitors was observed. This suggests that treatment at 45°C for 8 days is insufficient to reduce plant growth inhibitors. However, reduced root elongation inhibition was observed in test plots (7) and (8) containing EUSC-Tla_a1 or EUSC-Tla_b1. This suggests that plant growth inhibitors are reduced when these fungi are present in large quantities. On the other hand, no reduction in root elongation inhibition was observed in test plots (3) to (6), which contained more strains. This is likely due to competition between the fungal strains.
[0093] Example 4: Evaluation of plant growth inhibitor reduction activity in coffee grounds cultured with isolated strains (2) A coffee grounds medium was prepared in the same manner as in Example 3.
[0094] Each microorganism isolated in Example 1 was cultured in PDA medium. The edge of a filamentous fungal colony formed on the PDA medium (the tip of mycelial growth) was removed along with the medium using a straw. This was used as a fungal plug. 2 g of sterilized untreated coffee grounds and the fungal plug of the inoculum indicated in the following test plots (1) to (9) were placed in 5 mL of sterilized deionized water and thoroughly mixed with a spoon. (1) Untreated group: no inoculum source (2) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (3) EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (4) EUSC-Tau1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (5) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (6) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (7) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_d1, and EUSC-Tla_e1 (8) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_e1 (9) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 Coffee grounds medium inoculated with the above inoculum in the center was placed in a sealable plastic bag and cultured at 45°C for 7 days, followed by an additional 7 days at 50°C. The lid of the coffee grounds medium dish was secured with breathable adhesive tape, and a dehumidifying agent was placed inside the plastic bag for the first 7 days and the last day.
[0095] After incubation, the entire coffee grounds medium for each sample was transferred to a plastic bag, and any clumps of coffee grounds were homogenized by hand. Six grams of the medium was weighed and transferred to a 100 mL bottle. 60 mL of 0.1% Hyponex was added to disperse the coffee grounds, followed by autoclaving at 121°C for 20 minutes. The mixture was filtered through a sterilized nylon mesh, and the filtrate was transferred to a new 50 mL conical tube. This was used as the extract from the coffee medium. The extract was diluted 50- or 100-fold and the absorbance at 230 nm was measured. Each sample was diluted with 0.1% Hyponex to an absorbance of 30.
[0096] To conduct the bioassay, two sheets of absorbent paper (90 mm x 96 mm, 0.8 mm thick) were placed in a square Petri dish (100 mm x 140 mm), and one sheet of filter paper (90 mm x 110 mm) was placed on top. A total of three sheets of paper were aligned with the walls of the Petri dish, and 20 mL of the above-mentioned extract was added to moisten the absorbent paper and filter paper. The top of the filter paper was attached to the bottom of the Petri dish, creating a step at the edge of the absorbent paper. 0.1% Hyponex was used as a control. Komatsuna seeds were placed in the step, and tracing paper was placed on top to cover the seeds and adhere to the filter paper and the side wall of the Petri dish. The Petri dish lid was secured with tape, and the seeds were placed at an angle to prevent them from falling. The seeds were grown in a culture room at 24°C with a 16-hour photoperiod. One week after sowing, images were captured using a flatbed scanner to record seedling and root growth, and taproot length was measured with a ruler.
[0097] Figure 5 shows a scanned image of the bioassay, and Figure 6 shows a boxplot comparing taproot length in each test plot. In the test plots containing coffee grounds extract, the growth of komatsuna plants was statistically significantly suppressed compared to the control plots grown with 0.1% Hyponex alone. However, when calculating the inhibition rate based on the average taproot length (the percentage of inhibition of taproot growth in each test plot, with the control plot grown with 0.1% Hyponex alone set at 100), the coffee grounds in test plot (1), which were cultured without any isolated strains, showed a 40% inhibition, while the inhibition in test plot (2), which was cultured with all strains, was reduced to 24.2%. This difference is statistically significant. This indicates that the mixture of seven strains is effective in reducing plant growth inhibitors contained in coffee grounds. Furthermore, different results were obtained in test plots (3) through (9), in which each strain was removed from the seven strains. In test plot (3) that did not contain EUSC-Tau1, the growth inhibition of primary root length was 35.7%, and in test plots (5) to (9) that did not contain any of EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1, the growth inhibition was 35.0 to 43.8%, which is equivalent to that in test plot (1). These results suggest that EUSC-Tau1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 all contribute to reducing plant growth inhibitors from coffee grounds. Statistical testing showed that test plots (3) and (9) had a significantly higher inhibitory effect on taproot growth compared to test plot (2), which contained all seven strains, supporting their contribution to the reduction of plant growth inhibitors. Meanwhile, test plots (5) to (8) showed a large deviation in taproot length, with no significant difference from test plots (1) and (2). This is consistent with the high rate of inhibition of taproot growth based on the average taproot length values in test plots (5) to (8), supporting the idea that EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 also play a role in reducing plant growth inhibitors.
[0098] Example 5: Evaluation of plant growth inhibitor reduction activity in coffee grounds cultured with isolated strains (3) 200 g of untreated coffee grounds (provided by Shikoku Cage Co., Ltd.; moisture content approximately 45%) were mixed with 200 mL of sterilized deionized water and sterilized in an autoclave (121°C, 20 minutes). 25 g of this mixture was placed in deep, sterilized plastic Petri dishes (diameter 90 mm, height 40 mm) and pressed flat with the back of a medicine spoon to prepare a coffee grounds culture medium.
[0099] Each microorganism isolated in Example 1 was cultured in MEA medium. The edge of a filamentous fungal colony formed in the MEA medium (the tip of mycelial growth) was excised together with the medium using a straw. This was used as a fungal plug. One fungal plug from each of the inocula (three replicates each) indicated in the following test plots (1) to (9) was placed on a coffee grounds medium. (1) Untreated group: no inoculum source (2) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (3) EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (4) EUSC-Tau1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (5) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (6) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 (7) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_d1, and EUSC-Tla_e1 (8) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_e1 (9) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 The inoculated coffee grounds medium was cultured at 45°C for 1 week, followed by 3 weeks at 50°C. The petri dishes for the coffee grounds medium used had frosted lids that allowed for minimal gas exchange.
[0100] After incubation, the entire coffee grounds medium for each sample was transferred to a plastic bag, and any clumps of coffee grounds were homogenized by hand. The entire volume was weighed and transferred to a 100 mL medium bottle. 60 mL of 0.1% Hyponex was added to disperse the coffee grounds, followed by autoclaving at 121°C for 20 minutes. The mixture was filtered through sterilized Miracloth, and the filtrate was transferred to a new 50 mL conical tube. A small amount was transferred to a microcentrifuge tube, and the supernatant, after removing insoluble components by centrifugation, was diluted 200-fold. The ultraviolet absorption (230 nm, 260 nm, 280 nm, and 320 nm) of the resulting mixture was measured.
[0101] To perform the bioassay, two sheets of absorbent paper (90 mm x 96 mm, 0.8 mm thick) were placed in a square Petri dish (100 mm x 140 mm), and one sheet of filter paper (90 mm x 110 mm) was placed on top. A total of three sheets of paper were aligned with the walls of the Petri dish, and 20 mL of extract diluted to an absorbency of 20 at 230 nm was added to moisten the absorbent paper and filter paper. The top of the filter paper was attached to the bottom of the Petri dish, and a step was created at the edge of the absorbent paper. 0.1% Hyponex was used as a control. After washing with 70% ethanol, air-dried komatsuna seeds were placed on the step, and tracing paper was placed on top to cover the seeds and adhere to the filter paper and the side wall of the Petri dish. The Petri dish lid was secured with tape, tilted to prevent the seeds from falling, and grown in a culture room at 24°C with a 16-hour photoperiod. One week after sowing, images were captured using a flatbed scanner, and the growth of seedlings and roots was recorded, and the length of the taproot was measured using a ruler.
[0102] To confirm the results of Example 4, all seven strains, or only one strain removed, were inoculated into coffee grounds medium, and the reduction of plant growth inhibitors was evaluated by taproot length in a komatsuna bioassay. Figure 7 shows a boxplot comparing taproot lengths in each test plot. As in Example 4, significant reductions in plant growth inhibitors were observed in all test plots, but no significant differences were observed when specific strains were removed. Statistically significant differences were observed in the test plots (test plots (7) to (9)) where EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1 were removed, but it is unclear whether these differences directly contributed to the reduction of plant growth inhibitors. Therefore, it was deemed necessary to evaluate each strain individually.
[0103] Example 6: Evaluation of plant growth inhibitor reduction activity in coffee grounds cultured with isolated strains (4) In an experiment in which one strain was removed from a group of seven strains, the contribution of each strain to the plant growth inhibitor reduction activity could not be clarified. Therefore, the following test was conducted to clarify the plant growth inhibitor reduction effect of each strain when inoculated alone.
[0104] The coffee grounds medium was prepared in the same manner as in Example 4.
[0105] For each of the microorganisms isolated in Example 1, the following test plots were set up and inoculated according to the method of Example 5 (each with three repetitions).
[0106] Experiment 6A (1) Untreated group: no inoculum (2) EUSC-Tau1 (3) EUSC-Rem1 (4) EUSC-Tla_a1 (5) EUSC-Tla_d1 (6) EUSC-Tla_e1 Experiment 6B (1) Untreated group: no inoculum (2) EUSC-Tla_a1 (3) EUSC-Tla_b1 (4) EUSC-Tla_c1 Culturing and preparation of extracts were carried out in the same manner as in Example 5. Bioassays were carried out using extracts diluted to an absorbance of 30 at 230 nm.
[0107] Each strain was inoculated singly into a coffee grounds medium. When mycelia had spread throughout the medium, an extract was prepared, and the reduction of plant growth inhibitors was evaluated by taproot length in a bioassay. Figures 8A and 8B show boxplots comparing the taproot lengths of each test plot in Experiments 6A and 6B, respectively. As a result, a significant and pronounced reduction in plant growth inhibitors was observed in the EUSC-Rem1-inoculated plot (Test plot (3) in Experiment 6A) compared to the uninoculated control plot. A slight reduction in plant growth inhibitors was also observed in the EUSC-Tla_b1-inoculated plot (Test plot (3) in Experiment 6B). On the other hand, an increase in plant growth inhibitors was suggested in the EUSC-Tau1-inoculated plot (Test plot (2) in Experiment 6A). These results indicate that EUSC-Rem1 is highly effective in reducing plant growth inhibitors. Furthermore, it was presumed that EUSC-Tau1 has the effect of decomposing coffee grounds and promoting the elution of plant growth inhibitors, but its reducing effect is low.
[0108] Example 7: Evaluation of the activity of reducing plant growth inhibitors in coffee grounds cultured with isolated strains (5) For the same purpose as in Example 6, tests were conducted using strains isolated from pretreated coffee grounds, as well as Thermoascus aurantiacus (NBRC9748, NBRC9862, NBRC31693, NBRC31910), Thermoascus crustaceus (NBRC31853), Thermoascus thermophilus (NBRC9643), and Thermomyces lanuginosus (NBRC9738, NBRC9863, NBRC31854) obtained from the National Institute of Technology and Evaluation (NBRC) Biotechnology Center.
[0109] The coffee grounds medium was prepared in the same manner as in Example 5.
[0110] Each of the microorganisms isolated in Example 1 and the strains obtained from NBRC were cultured in MEA medium and inoculated in the following test plots by the method of Example 5 (each replicated twice). (1) Untreated group: no inoculum (2) EUSC-Rem1 (3) EUSC-Tau1 (4) NBRC9748 (5) NBRC9862 (6) NBRC31693 (7) NBRC31910 (8) NBRC31853 (9) NBRC9643 (10) EUSC-Tla_b1 (11) NBRC9738 (12) NBRC9863 (13) NBRC31854. Since the recommended incubation temperature for many of the NBRC strains was 37°C and growth in the coffee grounds medium was limited after one week at 45°C and two weeks at 50°C, the incubation temperature was then lowered to 40°C for one week. The preparation of the extract and the bioassay were carried out in the same manner as in Example 5.
[0111] Each strain was inoculated singly into a coffee grounds medium and cultured as described above, followed by preparation of an extract. The reduction of plant growth inhibitors was evaluated by taproot length in a bioassay. Figure 9 shows a boxplot comparing the taproot lengths in each test plot. Significant reduction of plant growth inhibitors was observed in EUSC-Rem1, confirming the results of Example 6 (Experiment 6A). This demonstrates that this bacterium has a stable effect of reducing plant growth inhibitors. Reduction of plant growth inhibitors was also observed in the EUSC-Tau1-inoculated plot (Test plot (3)). While these results differed from those in Example 6, it is possible that the optimum temperature for the bacterium's activity in reducing plant growth inhibitors is approximately 40°C, and that lowering the culture temperature may have suppressed fungal growth and reduced the plant growth inhibitors derived from the fungus. Similarly, EUSC-Tla_b1, which showed results different from those in Example 6, may have an optimum temperature for the activity in reducing plant growth inhibitors of approximately 50°C. The strain obtained from NBRC had low growth ability in coffee grounds medium, and no effect on reducing plant growth inhibitors was observed.
[0112] Example 8: Evaluation of the activity of reducing plant growth inhibitors in coffee grounds cultured with isolated strains (6) Among the filamentous fungi involved in the pretreatment of coffee grounds, Thermoascus aurantiacus (NBRC9748, NBRC9862, NBRC31693, NBRC31910), Thermoascus crustaceus (NBRC31853), Thermoascus thermophilus (NBRC9643), and Thermomyces obtained from the National Institute of Technology and Evaluation (NBRC) were used. To determine whether S. lanuginosus (NBRC9738, NBRC9863, NBRC31854) can replace strains EUSC-Tau1, EUSC-Tla_a1, EUSC-Tla_b1, EUSC-Tla_c1, EUSC-Tla_d1, and EUSC-Tla_e1, the following test was performed.
[0113] The coffee grounds medium was prepared in the same manner as in Example 5.
[0114] Each of the microorganisms isolated in Example 1 and the strains obtained from NBRC were cultured in MEA medium and inoculated in the following test plots by the method of Example 5 (each replicated three times). (1) Untreated group: no inoculum source (2) EUSC-Tau1, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (3) EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (4) NBRC9748, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (5) NBRC9862, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (6) NBRC31693, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (7) NBRC31910, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (8) NBRC31853, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (9) NBRC9643, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 (10) EUSC-Tau1 and EUSC-Rem1 (11) NBRC9738, NBRC9863, NBRC31854, EUSC-Tau1, and EUSC-Rem1. Coffee grounds medium inoculated with the strains of each test group was cultured at 45°C for 1 week, and then at 50°C for 4 weeks.
[0115] The preparation of the extract and the bioassay were carried out in the same manner as in Example 5. After the cultivation, DNA was extracted from the coffee grounds in the same manner as in Example 2, and ITS amplicon sequence analysis was carried out.
[0116] Figure 10A shows a boxplot comparing the taproot lengths in each test plot. The proportion of each filamentous fungal species in each sample after cultivation was estimated by amplicon sequencing analysis, and the results are shown in Figure 10B. The results of Examples 6 and 7 indicated that EUSC-Rem1, EUSC-Tau1, and EUSC-Tla_b1 have the effect of reducing certain plant growth inhibitors. However, in the pretreatment of coffee grounds, sterilized materials are not used, and pretreated coffee grounds containing isolated strains are used as the inoculum. Therefore, in order to clarify whether EUSC-Tau1, EUSC-Rem1, and EUSC-Tla_b1 have the activity of reducing plant growth inhibitors that cannot be replaced by other strains of the same species, we investigated whether Thermoascus aurantiacus and Thermomyces lanuginosus, which were available from NBRC, could replace EUSC-Tau1, EUSC-Tla_a1, and EUSC-Tla_b1. As a result, when all Thermoascus aurantiacus strains were replaced with EUSC-Tau1, the effect of reducing plant growth inhibitors was comparable to that of the EUSC-Tau1, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 inoculated plot (test plot (2)) and the EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 inoculated plot (test plot (3)). These results suggest that Thermoascus aurantiacus, like EUSC-Tau1, is not necessarily required for reducing plant growth inhibitors in coffee grounds.
[0117] Similarly, when EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 were replaced with three strains of Thermomyces lanuginosus obtained from NBRC, the effect of reducing plant growth inhibitors was observed to be similar to that of the EUSC-Tau1, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 inoculated area (test area (2)). However, in test area (10) inoculated with only EUSC-Tau1 and EUSC-Rem1, a higher effect of reducing plant growth inhibitors was observed compared to the EUSC-Tau1, EUSC-Rem1, EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 inoculated area (test area (2)). This, combined with the results of Examples 6 and 7, suggests that EUSC-Rem1 has the effect of reducing high levels of plant growth inhibitors, with other fungi playing a supporting role. Fragments of filamentous fungal cell walls (chitin oligosaccharides) are known to be recognized by plants and induce growth inhibition, potentially offsetting the effects of fungal strains other than EUSC-Rem1 in reducing plant growth inhibitors. However, it is possible that this property is weaker in the cell wall of EUSC-Rem1. Therefore, the effect of EUSC-Rem1 in reducing plant growth inhibitors appears to be significant and stable. The results of ITS amplicon sequencing analysis also suggested that in the culture experiment of isolated fungi in coffee grounds, when EUSC-Tla_b1, EUSC-Tla_c1, and EUSC-Tla_d1 coexisted (Test Areas (3) to (8)), the growth of EUSC-Rem1 was restricted. Furthermore, as shown in Example 2, in targeted metagenomic analysis of pretreated coffee grounds, EUSC-Rem1 was found to be the overwhelmingly dominant species, suggesting that this bacterium is the most important microorganism for reducing plant growth inhibitors during coffee grounds pretreatment.
[0118] Example 9: Evaluation of plant growth inhibitor reduction activity in coffee grounds cultured with isolated strains (7) In Example 8, it was found that plant growth inhibitors were significantly reduced when EUSC-Tau1 and EUSC-Rem1 were cultured. Therefore, the following test was conducted to determine whether Thermoascus aurantiacus (NBRC9748, NBRC9862, NBRC31693, NBRC31910), Thermoascus crustaceus (NBRC31853), and Thermoascus thermophilus (NBRC9643), all obtained from the National Institute of Technology and Evaluation (NBRC), could replace EUSC-Tau1.
[0119] The microorganisms isolated in Example 1 and the strains obtained from NBRC were cultured in MEA medium and inoculated in the following test groups (three replicates each) using the method of Example 5: (1) Untreated group: no inoculum (2) EUSC-Rem1 (3) EUSC-Tau1 and EUSC-Rem1 (4) NBRC9748 and EUSC-Rem1 (5) NBRC9862 and EUSC-Rem1 (6) NBRC31693 and EUSC-Rem1 (7) NBRC31910 and EUSC-Rem1 (8) NBRC31853 and EUSC-Rem1 (9) NBRC9643 and EUSC-Rem1 The coffee grounds medium inoculated with the strains of each test group was cultured at 45°C for one week, and then at 50°C for three weeks.
[0120] The preparation of the extract and the bioassay were carried out in the same manner as in Example 5.
[0121] A box-and-whisker plot comparing the taproot length in each test plot is shown in Figure 11. In this example, the culture period was 4 weeks, and therefore the growth of each fungus was lower compared to Examples 6 to 8. As in Examples 6 and 7, a clear reduction in plant growth inhibitors was observed in the EUSC-Rem1 single-inoculation plot (test plot (2)), again confirming its usefulness in reducing plant growth inhibitors. In the EUSC-Tau1 and EUSC-Rem1 inoculation plot (test plot (3)), plant growth inhibitors were efficiently reduced, although this was inferior to the EUSC-Rem1 single-inoculation plot (test plot (2)). For the NBRC strains, NBRC9862, NBRC31693, and NBRC31853 showed statistically significant differences compared to the uninoculated plot, and the effect of EUSC-Rem1 on the reduction of plant growth inhibitors was negligible. On the other hand, NBRC9648, NBRC31693, NBRC31910, and NBRC9643 showed significant differences compared to the EUSC-Rem1-only inoculation group, suggesting that they attenuate the reduction of plant growth inhibitors by EUSC-Rem1. In Example 7, the effect of EUSC-Tau1 alone in reducing plant growth inhibitors was observed, indicating that EUSC-Tau1, like EUSC-Rem1, is useful for reducing plant growth inhibitors.
Claims
1. A formulation for reducing plant growth inhibitors contained in a target, comprising Rasamsonia emersonii.
2. The formulation for reducing plant growth inhibitors according to claim 1, further comprising Thermoascus aurantiacus.
3. The formulation for reducing plant growth inhibitors according to claim 2, further comprising Thermomyces lanuginosus.
4. The formulation for reducing plant growth inhibitors according to claim 1, wherein the Rasamsonia emersonii is EUSC-Rem1 (accession number: NITE ABP-04304).
5. The formulation for reducing plant growth inhibitors according to claim 2, wherein the Thermoascus aurantiacus is EUSC-Tau1 (accession number: NITE ABP-04305).
6. A formulation for reducing plant growth inhibitors described in any one of claims 1 to 5, wherein the target is organic waste.
7. A formulation for reducing plant growth inhibitors according to claim 6, wherein the organic waste is coffee grounds.
8. A method for reducing a plant growth inhibitor contained in a target, the method comprising adding to the target a formulation for reducing plant growth inhibitors, the formulation containing Rasamsonia emersonii.
9. The method for reducing plant growth inhibitors according to claim 8, wherein the formulation for reducing plant growth inhibitors further comprises Thermoascus aurantiacus.
10. The method for reducing plant growth inhibitors according to claim 9, wherein the formulation for reducing plant growth inhibitors further contains Thermomyces lanuginosus.
11. The method for reducing plant growth inhibitors according to claim 8, wherein the Rasamsonia emersonii is EUSC-Rem1 (accession number: NITE ABP-04304).
12. The method for reducing plant growth inhibitors according to claim 9, wherein the Thermoascus aurantiacus is EUSC-Tau1 (accession number: NITE ABP-04305).
13. A method for reducing plant growth inhibitors according to any one of claims 8 to 12, wherein the target is organic waste.
14. The method for reducing plant growth inhibitors according to claim 13, wherein the organic waste is coffee grounds.
15. EUSC-Rem1 for reducing plant growth inhibitors contained in the target (Accession number: NITE ABP-04304).
16. EUSC-Tau1 for reducing plant growth inhibitors contained in the target plant (Accession number: NITE ABP-04305).
Citation Information
Patent Citations
Culture treatment of 'Shochu' lees and organic fertilizer
JP1995087952A
Method for transforming plant using plant growth inhibiting hormone
JP2014003976A
Plants with increased herbicide tolerance
JP2017514472A
Bacillus thuringiensis RTI545 compositions and methods of use for benefiting plant growth and controlling plant pests
JP2019532956A
Enzyme composition
US20220340943A1