Covalent inhibitors and uses thereof

Abstract

The present disclosure provides compounds and compositions, and methods of use thereof for modulating an RNA transcript, or a precursor, isoform, fragment, or mutant thereof. Such compounds include those of Formula (A): or a pharmaceutically acceptable salt thereof.

Description

COVALENT INHIBITORS AND USES THEREOFTECHNICAL FIELD OF INVENTION

[0001] The present disclosure provides compounds and compositions, and methods of use thereof for modulating an RNA transcript, or a precursor, isoform, fragment, or mutant thereof.CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 558,555, filed February 27, 2024; the entirety of which is hereby incorporated by reference.SEQUENCE LISTING

[0003] This application contains a Sequence Listing which has been submitted in .xml format via Patent Center and is hereby incorporated by reference. The ST.26 copy, created on February 27, 2025, is named 394457-018WO_215700_SL.xml and is 33,264 bytes in size.BACKGROUND OF THE INVENTION

[0004] Ribonucleic acids (RNAs) have been conventionally considered mere transient intermediaries between genes and proteins, whereby a protein-coding section of deoxyribonucleic acid (DNA) is transcribed into RNA that is then translated into a protein. RNA was thought to lack defined tertiary structure, and even where tertiary structure was present it was believed to be largely irrelevant to the RNA’s function as a transient messenger. This understanding has been challenged by the recognition that RNA, including non-coding RNA (ncRNA), plays a multitude of critical regulatory roles in the cell and that RNA can have complex, defined, and functionally- essential tertiary structure.

[0005] All endogenous mammalian diseases are ultimately mediated by the transcriptome. Insofar as messenger mRNA (mRNA) is part of the transcriptome, and all protein expression derives from mRNAs, there is the potential to intervene in protein-mediated diseases by modulating the expression of the relevant protein and by, in turn, modulating the translation of the corresponding upstream mRNA. But mRNA is only a small portion of the transcriptome: othertranscribed RNAs also regulate cellular biology either directly by the structure and function of RNA structures (e.g., ribonucleoproteins) as well as via protein expression and action, including (but not limited to) miRNA, IncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, ceRNA, and pseudo-genes. Drugs that intervene at this level have the potential of modulating any and all cellular processes. Existing therapeutic modalities such as antisense RNA or siRNA, in most cases, have yet to overcome significant challenges such as drug delivery, absorption, distribution to target organs, pharmacokinetics, and cell penetration. In contrast, small molecules have a long history of successfully surmounting these barriers and these qualities, which make them suitable as drugs, are readily optimized through a series of analogues to overcome such challenges. In sharp contrast, there are no validated, general methods of screening small molecules for binding to RNA targets in general, much less inside cells. The application of small molecules as ligands for RNA that yield therapeutic benefit has received little to no attention from the drug discovery community.

[0006] Targeting the mRNA transcriptome with small molecule modulators represents an untapped therapeutic approach to treat a variety of RNA-mediated diseases. There is a need for effective inhibitors of mRNA function, specifically translation, that are based on small molecule scaffolds. However, non-covalent interaction with a folded mRNA segment will often not confer sufficient stabilization of the bound fold to impede the progress of the ribosome. Covalent, irreversible attachment of small molecules to the open reading frame of that mRNA blocks ribosome progress and thereby blocks translation of that mRNA. The present invention meets this need and provides other, related, advantages.BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1 shows the results of a pre-modified cell free translation assay in WT SARS- CoV-2 Stem loop 5 and a mutant (“zippered”) version of the same target RNA.

[0008] FIG. 2 shows the results of a one-pot cell free translation assay in WT SARS-CoV-2 Stem loop 5 and a mutant (“zippered”) version of the same target RNA.

[0009] FIG. 3 shows the results of a pre-modified cell free translation assay in which the target RNA is in the coding sequence downstream of the start codon (AUG-452) or in the 5’UTR upstream of the start codon (452-AUG).

[0010] FIG. 4 shows the results of an intracellular modification of a target RNA sequence by covalent modifiers and photoprobes. FIG. 4 discloses SEQ ID NOS 32, 32, 32, 32, 32, 32, 32, 32, 32, and 32-33, respectively, in order of appearance.

[0011] FIG. 5 shows the results of an intracellular modification of a target RNA sequence by a covalent modifier in a time course experiment. FIG. 5 discloses SEQ ID NOS 34, 34, 34, 34, 34, 34, 32, 32, 32, 32, 32, and 32, respectively, in order of appearance.

[0012] FIG. 6 shows the results of an intracellular modification of a target RNA sequence by a covalent modifier at various concentrations. FIG. 6 discloses SEQ ID NOS 32 and 32, respectively, in order of appearance.

[0013] FIG. 7 shows a detail of an X-ray structure in which a SARS-CoV-2 Stem loop 5 target RNA sequence is covalently modified.

[0014] FIG. 8 shows a detail of an X-ray structure in which a SARS-CoV-2 Stem loop 5 target RNA sequence is covalently modified.

[0015] FIG. 9 shows a detail of an X-ray structure in which a STAT3 target RNA sequence is covalently modified.

[0016] FIG. 10 shows a detail of an X-ray structure in which a STAT3 target RNA sequence is covalently modified.DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS / . General Description of Certain Embodiments of the Disclosure ; Definitions

[0017] In one aspect, the present invention provides a compound of the general Formula A:or a pharmaceutically acceptable salt thereof; wherein: rSM is an RNA-binding small molecule that binds to a target RNA;-L- is a bivalent linker that covalently connects the rSM to Warhead group; andWarhead group is a reactive functional group comprising an epoxide.

[0018] As defined herein, an rSM is an RNA-binding small molecule that binds to a target RNA. As provided herein, the compounds and rSMs provided herein have certain advantages overtraditional agents that target RNA, such as oligonucleotide therapeutics. The advantages are afforded because the compounds and rSMs have properties allowing for better delivery to the target RNA and better biodistribution in general than an oligonucleotide therapeutic. In some embodiments, the rSM is a Lipinski-compliant small molecule, i.e., the rSM portion of the compound of Formula A violates no more than one of the four Lipinski’s rules of five: (1) a molecular weight (MW) less than 500 Da; (2) no more than 5 hydrogen bond donors; (3) no more than 10 hydrogen bond acceptors; and (4) an octanol -water partition coefficient log P not greater than 5 (Lipinski et al., Adv. Drug Deliv. Rev. 2001, 46, 3-26). In some embodiments, the rSM meets at least one of the following conditions: a molecular weight (MW) less than 500 Da; no more than 5 hydrogen bond donors; no more than 10 hydrogen bond acceptors; and an octanolwater partition coefficient log P not greater than 5. In some embodiments, the rSM meets one, two, three, or four of the following conditions: a molecular weight (MW) less than 500 Da; no more than 5 hydrogen bond donors; no more than 10 hydrogen bond acceptors; and an octanolwater partition coefficient log P not greater than 5.

[0019] In some embodiments, the compound of Formula A violates no more than one of the four Lipinski’s rules of five: (1) a molecular weight (MW) less than 500 Da; (2) no more than 5 hydrogen bond donors; (3) no more than 10 hydrogen bond acceptors; and (4) an octanol-water partition coefficient log P not greater than 5 (Lipinski et al., Adv. Drug Deliv. Rev. 2001, 46, 3- 26). In some embodiments, the compound of Formula A meets at least one of the following conditions: a molecular weight (MW) less than 500 Da; no more than 5 hydrogen bond donors; no more than 10 hydrogen bond acceptors; and an octanol -water partition coefficient log P not greater than 5. In some embodiments, the compound of Formula A meets one, two, three, or four of the following conditions: a molecular weight (MW) less than 500 Da; no more than 5 hydrogen bond donors; no more than 10 hydrogen bond acceptors; and an octanol -water partition coefficient log P not greater than 5.

[0020] In some embodiments, the rSM has a molecular weight (MW) of less than 800 Da. In some embodiments, the rSM has a MW between 100 and 800 Da. In some embodiments, the rSM has a MW between 100 and 500 Da. In some embodiments, the rSM has a MW between 120 and 700 Da, between 120 and 600 Da, between 150 and 550 Da, between 150 and 500 Da, between 200 and 500 Da, between 200 and 450 Da, or between 250 and 400 Da.

[0021] In some embodiments, the compound of Formula A has a molecular weight (MW) of less than 800 Da. In some embodiments, the compound of Formula A has a MW between 100 and 800 Da. In some embodiments, the rSM has a MW between 100 and 500 Da. In some embodiments, the compound of Formula A has a MW between 120 and 700 Da, between 120 and 600 Da, between 150 and 550 Da, between 150 and 500 Da, between 200 and 500 Da, between 200 and 450 Da, or between 250 and 400 Da.

[0022] In some embodiments, the rSM binds to a target RNA with a Kd of 1 pM, 500 nM, 100 nM, 50 nM, 10 nM, 1 nM, 500 pM, 10 pM, or 1 pM or lower affinity under biological conditions. In some embodiments, the rSM binds to a target RNA with a Kd of 0.1 nm to 500 nm, 10 nm to 250 nm, 0.001-25 pM, 0.01-25 pM, 0.1-25 pM, 0.1-15 pM, 0.01-10 pM, 0.001-1 pM, 0.001-0.1 pM, or 0.001-0.01 pM.

[0023] In some embodiments, the compound of Formula A binds to a target RNA with a Kd of 1 pM, 500 nM, 100 nM, 50 nM, 10 nM, 1 nM, 500 pM, 10 pM, or 1 pM or lower affinity under biological conditions. In some embodiments, the compound of Formula A binds to a target RNA with a Kd of 0.1 nm to 500 nm, 10 nm to 250 nm, 0.001-25 pM, 0.01-25 pM, 0.1-25 pM, 0.1-15 pM, 0.01-10 pM, 0.001-1 pM, 0.001-0.1 pM, or 0.001-0.01 pM.

[0024] In some embodiments, the rSM binds selectively to a target RNA. In some embodiments, the rSM binds selectively to a target RNA over non-target RNA. In some embodiments, the rSM binds to a target RNA with a Kd that is 10% lower when compared to the Kd of a non-target RNA. In some embodiments, the rSM binds to a target RNA with a Kd that is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or lower when compared to the Kd of a non-target RNA. In some embodiments, the rSM binds to a target RNA with a Kd that is lower by at least 2-fold, at least 5-fold, at least 10-fold, at least 100-fold, at least 1000-fold, or more when compared to the Kd of a non-target RNA.

[0025] In some embodiments, the compound of Formula A binds selectively to a target RNA. In some embodiments, the compound of Formula A binds selectively to a target RNA over non- target RNA. In some embodiments, the compound of Formula A binds to a target RNA with a Kd that is 10% lower when compared to the Kd of a non-target RNA. In some embodiments, the compound of Formula A binds to a target RNA with a Kd that is 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or lower when compared to the Kd of a non-target RNA. In some embodiments, the compound of Formula A binds to a target RNA with a Kd that is lower by atleast 2-fold, at least 5-fold, at least 10-fold, at least 100-fold, at least 1000-fold, or more when compared to the Kd of a non-target RNA.

[0026] In some embodiments, the rSM is not an oligonucleotide. In some embodiments, the rSM does not include a nucleoside or nucleotide. In some embodiments, the rSM is not a peptide, oligopeptide, or polypeptide. In some embodiments, the rSM does not include an amino acid. In some embodiments, the rSM is not an oligonucleotide, peptide, oligopeptide, or polypeptide. In some embodiments, the rSM is not a saccharide, oligosaccharide, or polysaccharide. In some embodiments, the rSM does not include a saccharide (sugar) moiety. In some embodiments, the rSM is not an oligonucleotide, peptide, oligopeptide, polypeptide, saccharide, oligosaccharide, or polysaccharide. In some embodiments, the rSM is an rSM portion of the compounds provided in Table 1 or a compound found in the section below entitled “Exemplary rSMs.” In someembodiments, the rSM is H H in Formula la. In some embodiments,

[0027] In some embodiments, the rSM is R7R8in Formula lb. In someembodiments, the rSM is R7R!in Formula lb. In some embodiments, the rSM is

[0028] In some embodiments, the compound of Formula A is not an oligonucleotide. In some embodiments, the compound of Formula A does not include a nucleoside or nucleotide. In some embodiments, the compound of Formula A is not a peptide, oligopeptide, or polypeptide. In some embodiments, the compound of Formula A does not include an amino acid. In some embodiments, the compound of Formula A is not an oligonucleotide, peptide, oligopeptide, or polypeptide. In some embodiments, the compound of Formula A is not a saccharide, oligosaccharide, or polysaccharide. In some embodiments, the compound of Formula A does not include a saccharide (sugar) moiety. In some embodiments, the compound of Formula A is not an oligonucleotide, peptide, oligopeptide, polypeptide, saccharide, oligosaccharide, or polysaccharide.

[0029] As provided herein, the Warhead of Formula A is a reactive functional group including an epoxide. In one aspect, the disclosure provides Warheads that, when conjugated to a linker- rSM, can react with the RNA targeted by the rSM. In some embodiments, the Warhead group reacts selectively with the target RNA upon contacting of the compound of Formula A with the target RNA. In some embodiments, the Warhead group reacts selectively with the target RNA upon binding of the compound of Formula A to the target RNA. In some embodiments, the Warhead group reacts selectively with the target RNA without significant binding of the compound of Formula A to the target RNA. In some embodiments, the Warhead group reacts selectively with the target RNA without measurable binding of the compound of Formula A to the target RNA. It should be appropriated that “Warhead” and “warhead” can be used interchangeably herein.

[0030] In some embodiments, the Warhead group reacts selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. In some embodiments, the Warhead group reacts selectively with aguanine of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. In some embodiments, the Warhead group reacts selectively with the N7 of the guanine of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof.

[0031] In some embodiments, the Warhead does not react with the sugar backbone. In some embodiments, the Warhead group does not react with the RNA backbone. In some embodiments, the Warhead group does not react with the sugar in the RNA backbone. In some embodiments, the Warhead group does not react with a 2’OH of the RNA backbone. In some embodiments, the Warhead is not an acylating agent or a sulfonylating agent. In some embodiments, the Warhead is not an isatoic anhydride, an acyl imidazole, an aryl ester or a sulfonyl fluoride. In some embodiments, the Warhead is not a photoactivatable group.

[0032] In some embodiments, the Warhead group reacts selectively with a target RNA under physiological conditions inside a cell.

[0033] As provided herein, a Warhead group is a reactive functional group that includes an epoxide.

[0034] In some embodiments, the Warhead group is, wherein:R2, R3, and R4are each independently H, D, C1-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 deuterium, oxygen or halogen atoms, and optionally substituted with one -ORX, -CN, or NHRXgroup; halogen, -CN, -C(O)RX, -C(O)ORX, - OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX; each occurrence of Rxis independently H or a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms; wherein one or more carbon atoms of Warhead group are optionally13C.

[0035] In some embodiments, R2, R3, and R4are each independently H, D, C1-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 deuterium, oxygen or halogen atoms, and optionally substituted with one -ORX, -CN, or NH2 group; halogen, -CN, - C(O)RX, -C(O)ORX, -OC(O)RX, or -ORX.

[0036] In some embodiments, R2, R3, and R4are each independently H, D, C1.4 straight or branched alkyl, C2-4 alkenyl, or C2-4 alkynyl group optionally substituted with 1, 2 or 3 deuteriumor halogen atoms, and optionally substituted with one -ORX, -CN, or NH2 group; halogen, -CN, or -ORX.

[0037] In some embodiments, R2, R3, and R4are each independently H, D, C1-3 straight or branched alkyl, C2-3 alkenyl, or C2-3 alkynyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORX, -CN, or NH2 group; halogen, -CN, or -ORX.

[0038] In some embodiments, R2, R3, and R4are each independently H, D, methyl, ethyl, n- propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

[0039] In some embodiments, R2is H and R3and R4are each independently H, D, methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

[0040] In some embodiments, R3is H and R2and R4are each independently H, D, methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

[0041] In some embodiments, R4is H and R2and R3are each independently H, D, methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

[0042] In some embodiments, R2and R3are H or D and R4is H, D, methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

[0043] In some embodiments, R3and R4are H or D and R2is H, D, methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

[0044] In some embodiments, R2is selected from H, D,, , ,

[0045] In some embodiments, R2is selected from H, D,, , ,

[0046] In some embodiments, R3is selected from H, D,, , ,

[0047] In some embodiments, R3is selected from H, D,, , ,

[0048] In some embodiments, R4is selected from H, D,, , ,

[0049] In some embodiments, R4is selected from H, D,, , ,

[0050] In some embodiments, R3and R4are independently methyl or ethyl. In some embodiments, R3and R4are methyl. In some embodiments, R2is methyl.

[0051] In some embodiments, the Warhead group iwhereinRing B a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1- 2 heteroatoms independently selected from nitrogen, and oxygen, or a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen; or Ring B together with the epoxide ring forms the Warhead group; or Ring B is absent;-L2- is a covalent bond or a Ci-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)- , -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or -(RX)NC(S)N(RX)-; or -L2- is absent if Ring B together with the epoxide ring forms the Warhead group; each occurrence of R5is independently C1-4 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2group; halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, - N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, - S(O)2RX, -S(O)2N(RX)2, or -NRxS(0)2Rx; n is 0, 1, 2, 3, or 4, and R2, R3, and R4, and Rxare as described above.

[0052] In some embodiments, the Warhead group iwhereinRing B is a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen, or a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen; or Ring B together with the epoxide ring forms the Warhead group; or Ring B is absent;-L2- is a covalent bond or a C1-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain areindependently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)- , -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or -(RX)NC(S)N(RX)-; or -L2- is absent if Ring B together with the epoxide ring forms the Warhead group; each occurrence of R5is independently halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, - C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, -NRXS(O)2RX; C1-4 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2group; n is 0, 1, 2, 3, or 4, and R2, R3, and R4, and Rxare as described above.

[0053] In some embodiments, Ring B is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is an 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is absent.

[0054] In some embodiments, Ring B is a 4-6 membered saturated monocyclic carbocyclic ring. In some embodiments, Ring B is a 4-6 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, Ring B is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is an 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is absent.

[0055] In some embodiments, Ring B is selected from

[0056] In some embodiments, Ring B is selected from

[0057] In some embodiments, Ring B is selected from

[0060] In some embodiments, L2is selected from -CH2-, -(CH2)2-, -(CH2)3-, -OCH2-,1-13CH2-, -CHMe-, -CD2-, and -C(O)-.

[0061] In some embodiments, each occurrence of R5is -CH3.

[0062] In some embodiments, R5is selected from -OH, -OC(O)CH3, -F, -CH2OH, -CH2F, and-CH3.

[0063] In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4.

[0064] In some embodiments, Ring B together with the epoxide ring forms a structure selected from, thus forming the Warhead group.

[0065] In some embodiments, the Warhead group is selected from,iNO

[0066] In some embodiments, the Warhead group is selected from,

[0067] In some embodiments, the Warhead group is selected from

[0069] In some embodiments, -L- is -L2-, wherein -L2- is a covalent bond or a C1-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O- , -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(RX)-, -(RX)NC(S)-, or -(RX)NC(S)N(RX)-; and each occurrence of Rxis independently H or a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms.

[0070] In some embodiments, -L2- is a covalent bond. In some embodiments, -L2- is a C1-4 straight hydrocarbon chain. In some embodiments, -L2- is a C1-4 branched hydrocarbon chain. In some embodiments, -L2- is a C1-4 straight hydrocarbon chain substituted with 1, 2 or 3 deuterium atoms. In some embodiments, -L2- is a C1-4 branched hydrocarbon chain substituted with 1, 2 or 3 deuterium atoms. In some embodiments, -L2- is a C1-4 straight hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, - or N(RX)-. In some embodiments, -L2- is a C2-4 branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -or N(RX)-.

[0071] In some embodiments, -L2- is selected from -CH2-, -(CH2)2-, -(CH2)3-, -13CH2-, - CHMe-, -CD2-, and C(O)-.

[0072] In some embodiments, L2is selected from -CH2-, -(CH2)2-, -(CH2)3-, -OCH2-,-13CH2-, -CHMe-, -CD2-, and -C(O)-.

[0073] In some embodiments, -L2- is -CH2-. In some embodiments, -L2- is C(O)-.

[0074] In some embodiments, the linkerwhereinRing B a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1- 2 heteroatoms independently selected from nitrogen, and oxygen, or a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen; or Ring B is absent;-L2- is a covalent bond or a Ci-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)- , -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or -(RX)NC(S)N(RX)-; or -L2- is absent; each occurrence of -L1- is a covalent bond or a Ci-6 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, - (RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, -(RX)NC(S)N(RX)-, or -Cy; each occurrence of R5is independently Ci-4 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2group; halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, - N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, - S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX;each -Cy- is independently a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; n is 0, 1, 2, 3, or 4, and Rxis as described above.

[0075] In some embodiments, the linker, whereinRing B is a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen, or a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen; or Ring B is absent; -L2- is a covalent bond or a Ci-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)- , -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or -(RX)NC(S)N(RX)-; or -L2- is absent; each occurrence of -L1- is a covalent bond or a C1-6 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, - (RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, -(RX)NC(S)N(RX)-, or -Cy; each occurrence of R3is independently halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, - C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, -NRXS(O)2RX; C1-4 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2group; each -Cy- is independently a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; n is 0, 1, 2, 3, or 4, and Rxis as described above.

[0076] In some embodiments, Ring B is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is an 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is absent.

[0077] In some embodiments, Ring B is a 4-6 membered saturated monocyclic carbocyclic ring. In some embodiments, Ring B is a 4-6 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, Ring B is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is an 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is absent.

[0078] In some embodiments, Ring B is selected from

[0082] In some embodiments, L2is selected from -CH2-, -(CH2)2-, -(CH2)3-, -13CH2-, -CHMe-, -CD2-, and -C(O)-. In some embodiments, L2is -CH2-. In some embodiments, L2is -C(O)-. In some embodiments, L2is absent. JW 1 V

[0086] In some embodiments, each occurrence of R5is -CH3.

[0087] In some embodiments, R5is selected from -OH, -OC(O)CH3, -F, -CH2OH, -CH2F, and-CH3.

[0088] In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is2. In some embodiments, n is 3. In some embodiments, n is 4.

[0089] In some embodiments, the linkerwherein the variables L1, L2,R5, Rxand n are as defined above.

[0090] In some embodiments, the linker is a linker described in the exemplary linkers section below.

[0091] In some embodiments,is a compound ofFormula la:la or a pharmaceutically acceptable salt thereof, wherein:Ring A is phenyl, or an 8-10 membered bicyclic aromatic carbocyclic ring;Ring B a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1 - 2 heteroatoms independently selected from nitrogen, and oxygen, or a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen; or Ring B together with the epoxide ring forms the Warhead group; or Ring B is absent; each occurrence of R1is independently C1-7 straight or branched alkyl, alkenyl, or alkynyl group with -O- optionally replacing a methylene unit, optionally substituted with 1, 2, or 3 halogen atoms, and optionally substituted with one -OH, -CN, NH2 or N3 group; 3-6 membered saturated monocyclic carbocyclic ring; a 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; halogen, -CN, - C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, - OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX;R2, R3, and R4are each independently H, D, C1-6 straight or branched alkyl, alkenyl, or alkynyl group with -O- optionally replacing a methylene unit, optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORX, -CN, or NHRXgroup; halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, - N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, - S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX; or the carbon atom bound to -L2- and R2is part of Ring B and both -L2- and R2are absent; or the carbon atoms bound to -L2- and R3are part of Ring B and both -L2- and R3are absent; each occurrence of R5is independently C1-4 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2group; halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, - N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, - SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX; each occurrence of -L1- is a covalent bond or a C1-6 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, - (RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O- , -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, -(RX)NC(S)N(RX)-, or -Cy;-L2- is a covalent bond or a Ci-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, - C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX>, -S-, -SO-, - SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or - (RX)NC(S)N(RX)-; or -L2- is absent if Ring B together with the epoxide ring forms the Warhead group; each occurrence of Rxis independently H or a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms; each -Cy- is independently a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; wherein the compound of Formula la optionally contains 1, 2 or 313C atoms.rSM

[0092] In some embodiments,is a compound ofFormula lb:or a pharmaceutically acceptable salt thereof, wherein:Ring B is a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen, or a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen; or Ring B together with the epoxide ring forms the Warhead group; or Ring B is absent;R2, R3, and R4are each independently H, D, halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, -NRXS(O)2RX, CI-6 straight or branched alkyl, alkenyl, or alkynyl group with -O- optionally replacing a methylene unit, optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one - ORX, -CN, or NHRXgroup; or the carbon atom bound to -L2- and R2is part of Ring B and both -L2- and R2are absent; or the carbon atoms bound to -L2- and R3are part of Ring B and both - L2- and R3are absent;R6is an optionally substituted Ci-6 straight or branched alkyl, orR7is hydrogen or an optionally substituted Ci-6 straight or branched alkyl;R8is hydrogen or an optionally substituted Ci-6 straight or branched alkyl;Ring A is phenyl, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic aromatic carbocyclic ring; each occurrence of R1is independently halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, - C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, - N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, -NRXS(O)2RX; C1.12 straight or branched alkyl, alkenyl, or alkynyl group with 1, 2, 3 or 4 -O-, -NH- or C=O optionally replacing methylene units, optionally substituted with 1, 2, or 3 halogen atoms, and optionally substituted with one -OH, -CN, NH2or N3 group; an optionally substituted 3-6 membered saturated monocyclic carbocyclic ring; an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; an optionally substituted 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; or an optionally substituted 7-8 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each occurrence of R5is independently halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, - C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, - N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, -NRXS(O)2RX; C straight or branchedalkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2 group; each occurrence of -L1- is a covalent bond or a C1-6 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, - (RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O- , -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, -(RX)NC(S)N(RX)-, or -Cy;-L2- is a covalent bond or a C1-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, - C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, - SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or - (RX)NC(S)N(RX)-; or -L2- is absent if Ring B together with the epoxide ring forms the Warhead group; each occurrence of Rxis independently H or a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms; each -Cy- is independently a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, or a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; m is 0, 1, 2, 3, or 4; and n is 0, 1, 2, 3, or 4; wherein the compound of Formula lb optionally contains 1, 2 or 313C atoms.

[0093] As defined generally above, Ring A is selected from phenyl and an 8-10 membered bicyclic aromatic carbocyclic ring.

[0094] As defined generally above, Ring A is selected from phenyl, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic aromatic carbocyclic ring.

[0095] In some embodiments, Ring A is phenyl. In some embodiments, Ring A is an 8-10 membered bicyclic aromatic carbocyclic ring.

[0096] In some embodiments, Ring A is phenyl. In some embodiments, Ring A is a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments,Ring A is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, Ring A is a 5-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, Ring A is an 8- 10 membered bicyclic aromatic carbocyclic ring.

[0101] In some embodiments, Ring A is selected from those depicted in Table 1, below.

[0102] As defined generally above, Ring B is selected from a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen, and a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen; or Ring B together with the epoxide ring forms the Warhead group; or Ring B is absent.

[0103] As defined generally above, Ring B is selected from a 4-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen, or a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independentlyselected from nitrogen, and oxygen; or Ring B together with the epoxide ring forms the Warhead group; or Ring B is absent.

[0104] In some embodiments, Ring B is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is an 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is absent.

[0105] In some embodiments, Ring B is a 4-6 membered saturated monocyclic carbocyclic ring. In some embodiments, Ring B is a 4-6 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, Ring B is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is an 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, Ring B is absent.

[0107] In some embodiments, Ring B is selected from

[0108] In some embodiments, Ring B is selected from

[0110] In some embodiments, Ring B together with the epoxide ring forms a structure selectedthe Warhead group.

[0111] In some embodiments, Ring B together with the epoxide ring forms a structure selected, thus forming the Warhead group.

[0112] In some embodiments, Ring B is selected from those depicted in Table 1, below.

[0113] As defined generally above, each occurrence of R1is independently C1-7 straight or branched alkyl, alkenyl, or alkynyl group with -O- optionally replacing a methylene unit, optionally substituted with 1, 2, or 3 halogen atoms, and optionally substituted with one -OH, - CN, NH2 or N3 group; 3-6 membered saturated monocyclic carbocyclic ring; a 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, - N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, - S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX.

[0114] As defined generally above, each occurrence of R1is independently halogen, -CN, - C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, -NRXS(O)2RX; CI- 12 straight or branched alkyl, alkenyl, or alkynyl group with 1, 2, 3 or 4 -O-, -NH- or C=O optionally replacing methylene units, optionally substituted with 1, 2, or 3 halogen atoms, and optionally substituted with one -OH, -CN, NH2or N3 group; an optionally substituted 3-6 membered saturated monocyclic carbocyclic ring; an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen; an optionally substituted 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; or an optionally substituted 7-8 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0115] In some embodiments, R1is a C1-7 straight or branched alkyl, alkenyl, or alkynyl group. In some embodiments, R1is a C1-7 straight or branched alkyl, alkenyl, or alkynyl group with -O- replacing a methylene unit. In some embodiments, R1is a C1-7 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2, or 3 halogen atoms. In some embodiments, R1is a C1-7 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2, or 3 halogen atoms, andoptionally substituted with one -OH, -CN, NH2 or N3 group. In some embodiments, R1is a 3-6 membered saturated monocyclic carbocyclic ring. In some embodiments, R1is a 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, R1is halogen. In some embodiments, R1is -CN. In some embodiments, R1is -C(O)RX. In some embodiments, R1is -C(O)ORX. In some embodiments, R1is -OC(O)RX. In some embodiments, R1is -C(0)N(Rx)2. In some embodiments, R1is -N(RX)C(O)RX. In some embodiments, R1is -N(Rx)C(0)N(Rx)2. In some embodiments, R1is -OC(O)N(RX)2. In some embodiments, R1is -N(RX)C(O)ORX. In some embodiments, R1is -ORX. In some embodiments, R1is -N(RX)2. In some embodiments, R1is -NO2. In some embodiments, R1is -SRX. In some embodiments, R1is -S(O)RX. In some embodiments, R1is -S(O)2RX. In some embodiments, R1is -S(O)2N(RX)2. In some embodiments, R1is -NRXS(O)2RX.

[0116] In some embodiments, R1is halogen. In some embodiments, R1is -CN. In some embodiments, R1is -C(O)RX. In some embodiments, R1is -C(O)ORX. In some embodiments, R1is -OC(O)RX. In some embodiments, R1is -C(O)N(RX)2. In some embodiments, R1is -N(RX)C(O)RX. In some embodiments, R1is -N(RX)C(O)N(RX)2. In some embodiments, R1is -OC(O)N(RX)2. In some embodiments, R1is -N(RX)C(O)ORX. In some embodiments, R1is -ORX. In some embodiments, R1is -N(RX)2. In some embodiments, R1is -NO2. In some embodiments, R1is -SRX. In some embodiments, R1is -S(O)RX. In some embodiments, R1is -S(O)2RX. In some embodiments, R1is -S(O)2N(RX)2. In some embodiments, R1is-NRxS(O)2Rx. In some embodiments, R1is an optionally substituted C1-12 straight or branched alkyl, alkenyl, or alkynyl group. In some embodiments, R1is C1-12 straight or branched alkyl, alkenyl, or alkynyl group with 1, 2, 3 or 4 -O-, -NH- or C=O optionally replacing methylene units. In some embodiments, R1is C1-12 straight or branched alkyl, alkenyl, or alkynyl group with 1, 2, 3 or 4 -O-, -NH- or C=O optionally replacing methylene units, optionally substituted with 1, 2, or 3 halogen atoms, and optionally substituted with one -OH, -CN, NH2 or N3 group. In some embodiments, R1is an optionally substituted 3-6 membered saturated monocyclic carbocyclic ring. In some embodiments, R1is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, R1is an optionally substituted 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, andsulfur. In some embodiments, R1is an optionally substituted 7-8 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0117] In some embodiments, each occurrence of R1is independently selected from -CN,

[0118] In some embodiments, each occurrence of R1is independently selected from -CN,

[0119] In some embodiments, R1is selected from those depicted in Table 1, below.

[0120] As defined generally above, R2, R3, and R4are each independently selected from H, D, Ci-6 straight or branched alkyl, alkenyl, or alkynyl group with -O- optionally replacing a methylene unit, optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORX, -CN, or NHRXgroup; halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, - S(O)RX, -S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX.

[0121] As defined generally above, R2, R3, and R4are each independently selected from H, D, halogen, -CN, -C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, - NRXS(O)2RX, CI-6 straight or branched alkyl, alkenyl, or alkynyl group with -O- optionallyreplacing a methylene unit, optionally substituted with 1 , 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORX, -CN, or NHRXgroup.

[0122] In some embodiments, R2is H. In some embodiments, R2is D. In some embodiments, R2is a C1-6 straight or branched alkyl, alkenyl, or alkynyl group. In some embodiments, R2is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group with -O- replacing a methylene unit. In some embodiments, R2is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 deuterium atoms. In some embodiments, R2is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 halogen atoms. In some embodiments, R2is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with one -ORX, -CN, or NHRXgroup. In some embodiments, R2is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 deuterium or halogen atoms, and substituted with one -ORX, -CN, or NHRXgroup. In some embodiments, R2is halogen. In some embodiments, R2is -CN. In some embodiments, R2is -C(O)RX. In some embodiments, R2is -C(O)ORX. In some embodiments, R2is -OC(O)RX. In some embodiments, R2is -C(0)N(Rx)2. In some embodiments, R2is -N(RX)C(O)RX. In some embodiments, R2is -N(Rx)C(0)N(Rx)2. In some embodiments, R2is -0C(0)N(Rx)2. In some embodiments, R2is -N(RX)C(O)ORX. In some embodiments, R2is -ORX. In some embodiments, R2is -N(RX)2. In some embodiments, R2is -NO2. In some embodiments, R2is -SRX. In some embodiments, R2is -S(O)RX. In some embodiments, R2is -S(O)2RX. In some embodiments, R2is -S(O)2N(RX)2. In some embodiments, R2is -NRXS(O)2RX.

[0123] In some embodiments, R2is selected from H, D,, ,

[0125] In some embodiments, R2is selected from those depicted in Table 1, below.

[0126] In some embodiments, R3is H. In some embodiments, R3is D. In some embodiments, R3is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group. In some embodiments, R3is a Ci- 6 straight or branched alkyl, alkenyl, or alkynyl group with -O- replacing a methylene unit. In someembodiments, R3is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1 , 2 or 3 deuterium atoms. In some embodiments, R3is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 halogen atoms. In some embodiments, R3is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with one -ORX, -CN, or NHRXgroup. In some embodiments, R3is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 deuterium or halogen atoms, and substituted with one -ORX, -CN, or NHRXgroup. In some embodiments, R3is halogen. In some embodiments, R3is -CN. In some embodiments, R3is -C(O)RX. In some embodiments, R3is -C(O)ORX. In some embodiments, R3is -OC(O)RX. In some embodiments, R3is -C(0)N(Rx)2. In some embodiments, R3is -N(RX)C(O)RX. In some embodiments, R3is -N(Rx)C(0)N(Rx)2. In some embodiments, R3is -0C(0)N(Rx)2. In some embodiments, R3is -N(RX)C(O)ORX. In some embodiments, R3is -ORX. In some embodiments, R3is -N(RX)2. In some embodiments, R3is -NO2. In some embodiments, R3is -SRX. In some embodiments, R3is -S(O)RX. In some embodiments, R3is -S(O)2RX. In some embodiments, R3is -S(O)2N(RX)2. In some embodiments, R3is -NRXS(O)2RX.

[0127] In some embodiments, R3is selected from H, D,, , ,

[0129] In some embodiments, R3is selected from those depicted in Table 1, below.

[0130] In some embodiments, R4is H. In some embodiments, R4is D. In some embodiments, R4is a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group. In some embodiments, R4is a Ci- 6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 deuterium atoms. In some embodiments, R4is a C1-6 straight or branched alkyl, alkenyl, or alkynyl group with -O- replacing a methylene unit. In some embodiments, R4is a C1-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 halogen atoms. In some embodiments, R4is a C1-6 straight or branched alkyl, alkenyl, or alkynyl group substituted with one -ORX, -CN, or NHRXgroup. In some embodiments, R4is a C1-6 straight or branched alkyl, alkenyl, or alkynyl groupsubstituted with 1 , 2 or 3 deuterium or halogen atoms, and substituted with one -ORX, -CN, or NHRXgroup. In some embodiments, R4is halogen. In some embodiments, R4is -CN. In some embodiments, R4is -C(O)RX. In some embodiments, R4is -C(O)ORX. In some embodiments, R4is -OC(O)RX. In some embodiments, R4is -C(0)N(Rx)2. In some embodiments, R4is -N(RX)C(O)RX. In some embodiments, R4is -N(Rx)C(0)N(Rx)2. In some embodiments, R4is -0C(0)N(Rx)2. In some embodiments, R4is -N(RX)C(O)ORX. In some embodiments, R4is -ORX. In some embodiments, R4is -N(RX)2. In some embodiments, R4is -NO2. In some embodiments, R4is -SRX. In some embodiments, R4is -S(O)RX. In some embodiments, R4is -S(O)2RX. In some embodiments, R4is -S(O)2N(RX)2. In some embodiments,

[0131] In some embodiments, R4is selected from H,

[0133] In some embodiments, R4is selected from those depicted in Table 1, below.

[0134] As defined generally above, each occurrence of R5is independently C1-4 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2 group; halogen, -CN, -C(O)RX, -C(O)ORX, - OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, - ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX.

[0135] As defined generally above, each occurrence of R is independently halogen, -CN, - C(O)RX, -C(O)ORX, -OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, -NRXS(O)2RX; Ci- 4 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms, and optionally substituted with one -OH, -CN, or NH2 group.

[0136] In some embodiments, R5is a Ci -4 straight or branched alkyl, alkenyl, or alkynyl group. In some embodiments, R5is a C1-4 straight or branched alkyl, alkenyl, or alkynyl group substituted with 1, 2, or 3 halogen atoms. In some embodiments, R5is a C1-4 straight or branched alkyl, alkenyl,or alkynyl group substituted with 1, 2, or 3 halogen atoms, and substituted with one -OH, -CN, or NH2 group. In some embodiments, R5is halogen. In some embodiments, R5is -CN. In some embodiments, R3is -C(O)RX. In some embodiments, R3is -C(O)ORX. In some embodiments, R5is -OC(O)RX. In some embodiments, R5is -C(0)N(Rx)2. In some embodiments, R3is -N(RX)C(O)RX. In some embodiments, R5is -N(Rx)C(0)N(Rx)2. In some embodiments, R5is -0C(0)N(Rx)2. In some embodiments, R5is -N(RX)C(O)ORX. In some embodiments, R5is -ORX. In some embodiments, R5is -N(RX)2. In some embodiments, R5is -NO2. In some embodiments, R5is -SRX. In some embodiments, R5is -S(O)RX. In some embodiments, R5is -S(O)2RX. In some embodiments, R5is -S(O)2N(RX)2. In some embodiments, R5is -NRXS(O)2RX.

[0137] In some embodiments, each occurrence of R5is -CH3.

[0138] In some embodiments, R5is selected from -OH, -OC(O)CH3, -F, -CH2OH, -CH2F, and -CH3.

[0139] In some embodiments, R5is selected from those depicted in Table 1, below.

[0140] As defined generally above, R6is optionally substituted Ci-6 straight or branched alkyl,

[0141] In some embodiments, R6is C1-6 straight or branched alkyl. In some embodiments, R6is substituted C1-6 straight or branched alkyl. In some embodiments, R6is

[0142] In some embodiments, R6is selected from -CH3, CH2CH3,

[0143] In some embodiments, R6is selected from those depicted in Table 1, below.

[0144] As defined generally above, R7is hydrogen or an optionally substituted Ci-6 straight or branched alkyl.

[0145] In some embodiments, R7is hydrogen. In some embodiments, R7is Ci-6 straight alkyl.In some embodiments, R7is Ci-6 branched alkyl.

[0146] In some embodiments, R7is -CH3.

[0147] In some embodiments, R7is selected from those depicted in Table 1, below.

[0148] As defined generally above, R8is hydrogen or an optionally substituted C1-6 straight or branched alkyl.

[0149] In some embodiments, R8is hydrogen. In some embodiments, R8is Ci-6 straight alkyl.In some embodiments, R8is Ci-6 branched alkyl.

[0150] In some embodiments, R8is -CH3.

[0151] In some embodiments, R8is selected from those depicted in Table 1, below.

[0152] As defined generally above, -L1- is a covalent bond or a Ci-6 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, - C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, -(RX)NC(S)N(RX)-, or -Cy.

[0153] In some embodiments, -L1- is a covalent bond. In some embodiments, -L1- is a C1-6 straight hydrocarbon chain. In some embodiments, -L1- is a C1-6 branched hydrocarbon chain. In some embodiments, -L1- is a C1-6 straight hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, - (RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, -(RX)NC(S)N(RX)-, or -Cy. In some embodiments, -L1- is a C2.6 branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)- , -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, -(RX)NC(S)N(RX)-, or -Cy.

[0156] In some embodiments, L1is selected from those depicted in Table 1, below.

[0157] As defined generally above, -L2- is a covalent bond or a C1.4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, - N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(RX)-, -(RX)NC(S)-, or -(RX)NC(S)N(RX)-; or -L2- is absent if Ring B together with the epoxide ring forms the Warhead group.

[0158] In some embodiments, -L2- is a covalent bond. In some embodiments, -L2- is a C1-4 straight hydrocarbon chain. In some embodiments, -L2- is a C1-4 branched hydrocarbon chain. In some embodiments, -L2- is a C1-4 straight hydrocarbon chain substituted with 1, 2 or 3 deuterium atoms. In some embodiments, -L2- is a C1-4 branched hydrocarbon chain substituted with 1, 2 or 3 deuterium atoms. In some embodiments, -L2- is a C1-4 straight hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, - N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or - (RX)NC(S)N(RX)-. In some embodiments, -L2- is a C2-4 branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently replaced with -O-, -C(O)-, -C(O)O-, -OC(O)- , -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)-, -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, - SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or - (RX)NC(S)N(RX)-. In some embodiments, -L2- is absent and Ring B together with the epoxide ring forms the Warhead group, wherein the carbon atom bound to -L2- and R2is part of Ring B and both -L2- and R2are absent.

[0159] In some embodiments, L2is selected from -CH2-, -(CH2)2-, -(CH2)3-, -13CH2-, -CHMe- , -CD2-, and -C(O)-. « 1 / W

[0160] In some embodiments, L2is selected from -CH2-, -(CH2)2-, -(CH2)3-, -OCH2-, 1 ,-13CH2-, -CHMe-, -CD2-, and -C(O)-.

[0161] In some embodiments, L2is -CH2- In some embodiments, L2is -C(O)-.

[0162] In some embodiments, L2is selected from those depicted in Table 1, below.

[0163] As defined generally above, each occurrence of Rxis independently H or a C1-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms.

[0164] In some embodiments, Rxis H. In some embodiments, Rxis Ci-6 straight alkyl, alkenyl, or alkynyl group. In some embodiments, Rxis Ci-6 branched alkyl, alkenyl, or alkynyl group. In some embodiments, Rxis Ci-6 straight alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 halogen atoms. In some embodiments, Rxis C2-6 branched alkyl, alkenyl, or alkynyl group substituted with 1, 2 or 3 halogen atoms.

[0165] As defined generally above, m is 0, 1, 2, 3, or 4. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4.

[0166] In some embodiments, m is selected from those depicted in Table 1, below.

[0167] As defined generally above, n is 0, 1, 2, 3, or 4. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4.

[0168] In some embodiments, n is selected from those depicted in Table 1, below.

[0169] In some embodiments, the compound of Formula la contains 113C atom. In some embodiments, the compound of Formula la contains 213C atoms. In some embodiments, the compound of Formula la contains 313C atoms.

[0170] In some embodiments, the compound of Formula lb contains 113C atom. In some embodiments, the compound of Formula lb contains 213C atoms. In some embodiments, the compound of Formula lb contains 313C atoms.

[0171] In some embodiments, the rSM is H H In some embodiments, the rSM is. In some embodiments, the rSM is

[0172] In some embodiments, the rSM is R7R8in Formula lb. In someembodiments, the rSM is R7R8in Formula lb. In some embodiments, the rSM is

[0174] In some embodiments, the Warhead group is selected from,13c

[0175] In some embodiments, the Warhead group is an epoxide selected from 13c-'o13C13c-'o

[0176] In some embodiments, the Warhead group is an epoxide selected from

[0177] In some embodiments, the present disclosure provides a compound of Formula II:or a pharmaceutically acceptable salt thereof, wherein: each of Ring B, R2, R3, R4, R5, L1, L2, and n are as defined above and described in embodiments herein, both singly and in combination.

[0178] In some embodiments, the present disclosure provides a compound of Formula Illa,Illb or IIIc:or a pharmaceutically acceptable salt thereof, wherein: each of Ring B, R5, and n are as defined above and described in embodiments herein, both singly and in combination.

[0179] In some embodiments, the present disclosure provides a compound of Formula IVa,IVb, IVc, IVd or IVeor a pharmaceutically acceptable salt thereof, wherein:R5is as defined above and described in embodiments herein, both singly and in combination.

[0180] In some embodiments, the present disclosure provides a compound of Formula Va,Vb, Vc, Vd or Ve:Ve or a pharmaceutically acceptable salt thereof, wherein:R5is as defined above and described in embodiments herein, both singly and in combination.

[0181] In some embodiments, the present disclosure provides a compound of Formula Via,VIb or VicVic or a pharmaceutically acceptable salt thereof, wherein:R5is as defined above and described in embodiments herein, both singly and in combination.

[0182] In some embodiments, the present disclosure provides a compound of Formula VII:VII or a pharmaceutically acceptable salt thereof, wherein: each of ring B, L1, L2, R2, R3, R4, R5and n are as defined above and described in embodiments herein, both singly and in combination.

[0183] In some embodiments, the present disclosure provides a compound of Formula Villa,VUIb or VIIIcVilla VUIbVIIIc or a pharmaceutically acceptable salt thereof, wherein: each of R4and R5are as defined above and described in embodiments herein, both singly and in combination.

[0184] In some embodiments, the compound is selected from one of those depicted in Table 1, below.Table 1. Exemplary Compounds2. Compounds and Related Definitions

[0185] As described generally above, the present invention provides a compound of the general Formula A:A or a pharmaceutically acceptable salt thereof; wherein: rSM is an RNA-binding small molecule that binds to a target RNA;-L- is a bivalent linker that covalently connects the rSM to Warhead group; and Warhead group is a reactive functional group comprising an epoxide.Exemplary rSMs

[0186] In some embodiments, the rSM is a G-quadruplex binder, such as one of those described in Peng, W. etal., J. Med. Chem. 2018, 61, 6629-6646, which is hereby incorporated by reference.

[0187] In some embodiments, the rSM is a compound disclosed in Shi, Y. et al., Cell Chem. Biol. 2019, 26, 319-330, which is hereby incorporated by reference.

[0188] In some embodiments, the rSM is a compound disclosed in Velagapudi, S.P. et al. (2014), “Sequence-based design of bioactive small molecules that target precursor microRNAs,” Nat. Chem. Biol. 10, 291, hereby incorporated by reference, for example the following:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, or O atom.

[0189] In some embodiments, the rSM is a MALAT-1 binder such as the following:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, or O atom.

[0190] In some embodiments, the rSM is a G-quadruplex binder such as the following:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C orN atom.

[0191] In some embodiments, the rSM is selected from one of those described in J. Med. Chem. 2018, 61(15), 6501-6517, or U.S. 8,729,263, each of which is hereby incorporated by reference. For example, the rSM is selected from a compound according to Formula I from U.S. 8,729,263:or a pharmaceutically acceptable salt thereof, wherein each variable is as defined therein; and wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom.

[0192] In some embodiments, the rSM is selected from one of those described in U.S. 9,040,712, which is hereby incorporated by reference. For example, in some embodiments, the rSM is selected from a compound according to Formula X from U.S. 9,040,712:or a pharmaceutically acceptable salt thereof, wherein each variable is as defined therein; and wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom.

[0193] In some embodiments, the rSM is selected from one of those described in Angelbello,A. J., et al. , “Small molecule targeting of RNA structures in neurological disorders, ” Annals of theNew York Academy ofp ;rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom. In some embodiments, the rSM is one of the following:or or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom.

[0194] In some embodiments, the rSM is selected from one of those depicted in Table 2A, below; or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom.

[0195] In some embodiments, the rSM is a compound according to Formula A-IX:A-IX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 9,150,612, the entirety of which is hereby incorporated by reference.

[0196] In some embodiments, the rSM is a compound according to Formula A-X or A-X-a:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 9,550,769, the entirety of which is hereby incorporated by reference. In some embodiments, variable L above iswherein each variable is as defined in U.S. 9,550,769.

[0197] In some embodiments, the rSM is selected from one of those disclosed in U.S. 10,157,261, the entirety of which is hereby incorporated by reference; and wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom.

[0198] In some embodiments, the rSM is a compound according to Formula A-XI:A-XI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 9,586,944, the entirety of which is hereby incorporated by reference.

[0199] In some embodiments, the rSM is a compound according to Formula A-XII:H-Y-HA-XII wherein H is a group of the structureor a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 9,795,687, the entirety of which is hereby incorporated by reference.

[0200] In some embodiments, the rSM is a compound selected from one of the following:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; or another compound disclosed in WO 2018 / 151810, the entirety of which is hereby incorporated by reference.

[0201] In some embodiments, the rSM is a compound of the following structure:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; or another compound disclosed in in WO 2018 / 152414, the entirety of which is hereby incorporated by reference.

[0202] In some embodiments, the rSM is a compound of the following structure:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; or another compound disclosed in US 2018 / 0334678, the entirety of which is hereby incorporated by reference.

[0203] In some embodiments, the rSM is a compound according to Formula A-XIII:A-XIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2018 / 0296532, the entirety of which is hereby incorporated by reference.

[0204] In some embodiments, the rSM is a compound according to Formula A-XIV:A-XIV or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018 / 098297, the entirety of which is hereby incorporated by reference.

[0205] In some embodiments, the rSM is a compound according to Formula A-XV, A-XVI, or A-XVII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019 / 0152924, the entirety of which is hereby incorporated by reference.

[0206] In some embodiments, the rSM is a compound according to Formula A-XVIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 005993, the entirety of which is herebyincorporated by reference.

[0207] In some embodiments, the rSM is a compound according to Formula A-XIX:A-XIX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018 / 232039, the entirety of which is hereby incorporated by reference.

[0208] In some embodiments, the rSM is a compound according to Formula A-XX:A-XX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 005980, the entirety of which is hereby incorporated by reference.

[0209] In some embodiments, the rSM is a compound according to Formula A-XXI:A-XXI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018 / 226622, the entirety of which is hereby incorporated by reference.

[0210] In some embodiments, the rSM is a compound according to Formula A-XXII:A-XXII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018 / 098446, the entirety of which is hereby incorporated by reference.

[0211] In some embodiments, the rSM is a compound according to Formula A-XXIII:A-XXIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2017 / 087364, the entirety of which is hereby incorporated by reference.

[0212] In some embodiments, the rSM is ataluren:or a deuterated analog thereof or pharmaceutically acceptable salt thereof, disclosed in US 2018 / 0333397 or WO 2017 / 087364, each of which is hereby incorporated by reference.

[0213] In some embodiments, the rSM is a compound of the following structure:or a pharmaceutically acceptable salt thereof, wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; as described in US 2018 / 147228, the entirety of which is hereby incorporated by reference.

[0214] In some embodiments, the rSM is a compound according to Formula A-XXIV:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 9,969,754, the entirety of which is hereby incorporated by reference.

[0215] In some embodiments, the rSM is a compound according to Formula A-XXV-i:A-XXV-i or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 9,371,336, the entirety of which is hereby incorporatedby reference. In some embodiments, the rSM is a compound disclosed in U.S. 9,371 ,336, or a pharmaceutically acceptable salt thereof.

[0216] In some embodiments, the rSM is a compound according to Formula A-XXV-ii:A-XXV-ii or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 9,617,268, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in U.S. 9,617,268, or a pharmaceutically acceptable salt thereof.

[0217] In some embodiments, the rSM is a compound according to Formula A-XXVI:A-XXVI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019 / 0000844, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in US 2019 / 0000844, or a pharmaceutically acceptable salt thereof.

[0218] In some embodiments, the rSM is a compound according to Formula A-XXVII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2018 / 0161456, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in US 2018 / 0161456, or a pharmaceutically acceptable salt thereof.

[0219] In some embodiments, the rSM is a compound according to Formula A-XXVIII:A-XXVIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S. 10,195,202, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in U.S. 10,195,202, or a pharmaceutically acceptable salt thereof.

[0220] In some embodiments, the rSM is a compound according to one of Formulae A-XXIX- A-XXXIII:A-XXXIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 028440, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in WO 2019 / 028440, or a pharmaceutically acceptable salt thereof.[00221J In some embodiments, the rSM is a compound according to one of Formulae A- XXXIV-A-XLXI:903Z.OZIIIATX-VITX-VA-XLXI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 060917, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in WO 2019 / 060917, or a pharmaceutically acceptable salt thereof.

[0222] In some embodiments, the rSM is a compound according to Formula A-XLXII or A- XLXIII:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 9,879,007, the entirety of which is hereby incorporated by reference.

[0223] In some embodiments, the rSM is a compound according to Formula A-XLXIV or A-XLXV:A-XLXIV A-XLXV or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 191229, the entirety of which is hereby incorporated by reference.

[0224] In some embodiments, the rSM is a compound according to Formula A-XLXVI:A-XLXVI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 191092, the entirety of which is hereby incorporated by reference.

[0225] In some embodiments, the rSM is a compound according to Formula A-XLXVII:A-XLXVII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at anyavailable modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019 / 315773, the entirety of which is hereby incorporated by reference.

[0226] In some embodiments, the rSM is a compound according to Formula A-LVIII, A-LIX, or A-LX:A-LX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019 / 199972, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in modulating splicing of the F0XM1 gene for use in the treatment of cancer.

[0227] In some embodiments, the rSM is a compound according to Formula A-LXI:or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined for Formula (I) in WO 2020 / 005873, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in modulating RNA targets that mediate Huntington’s disease. In some embodiments, the compound is of formula (Ibbl) described therein:wherein or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined therein.

[0228] In some embodiments, the rSM is a compound according to Formula A-LXII or A- LXIII:A-LXIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; andwherein each variable is as defined in WO 2020 / 005877, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in binding to HTT RNA transcripts for use in the treatment of diseases such as Huntington’s.

[0229] In some embodiments, the rSM is a compound according to Formula A-LXIV, A-LXV, A-LXVI, or A-LXVILA-LXVI A-LXVII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2020 / 005882, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in binding to HTT RNA transcripts for use in the treatment of diseases such as Huntington’s.

[0230] In some embodiments, the rSM is selected from one of those depicted in US Patents 8,729,263, 9,545,404, 9,856,474, or 7,838,657, each of which is hereby incorporated by reference.

[0231] In some embodiments, the rSM is selected from one of those depicted in Patent applications WO2023 / 034811, WO2023 / 034836, WO2023 / 133225, W02023 / 064880,WO2023 / 034833, WO2023 / 034812, or WO2023 / 245091, each of which is hereby incorporated by reference.

[0232] In some embodiments, the rSM is selected from one of those depicted in Table 2A, below; or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom.Table 2A: Additional rSMsLinkers

[0233] As defined generally above, the linker, -L-, in the formula described herein is a bivalent group that connects the rSM, or RNA Binder to the Warhead (It should be appreciated that “Warhead” and “warhead” can be used interchangeably). In some embodiments, e g., for compounds of Formula A and embodiments thereof, -L- is a covalent bond or a bivalent C1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, - (R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH2CH2O-.

[0234] In some embodiments, -L- is a covalent bond. In some embodiments, -L- is a C1-20 straight or branched hydrocarbon chain. In some embodiments, -L- is a C1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, -L- is a C1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, - (R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH2CH2O-.

[0235] In some embodiments, -L- is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, -L- is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, and oxygen. In some embodiments, -L- is a 7-12 membered bicyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, and oxygen.

[0236] In some embodiments, -L- is selected from

[0237] In some embodiments, -L- is a Ci-is, C1-16, C1-14, C1-12, C1-10, C1-8, C1-6, C1-4, C1-2, C2-18, C2-I6, C2-14, C2-12, C2-IO, C2-8, C2-6, C2-4, C3-I8, C3-I6, C3-14, C3-I2, C3-IO, C3-8, C3-6, C3-4, C4-I8, C4-I6, C4-14, C4-12, C4-10, C4-8, C4-6, C4-5, C5-18, C5-16, C5-14, C5-12, C5-10, C5-8, C5-6, or Cis, C17, Ci6, C15, C14,C13, C12, Cn, Cio, C9, Cs, CT, Ce, C5, C4, C3, or C2 straight or branched hydrocarbon chain. In some embodiments, -L- is a Ci-is, C1-16, C1-14, C1-12, C1-10, C1-8, C1-6, C1-4, C1-2, C2-18, C2-16, C2-14, C2-12, C2-10, C2-8, C2-6, C2-4, C3-18, C3-16, C3-14, C3-12, C3-10, C3-8, C3-6, C3-4, C4-18, C4-16, C4-14, C4-12, C4-10, C4-8, C4-6, C4-5, C5-I8, C5-I6, C5-I4, C5-I2, C5-I0, C5-8, C5-6, Or C18, C17, C16, C15, C14, C13, C12, Cll, C10, C9, Cs, C7, Ce, C5, C4, C3, or C2 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O- , -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, - (R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH2CH2O-.

[0238] In some embodiments, one methylene unit of -L- is replaced with -CH2CH2O-. In some embodiments, two methylene units of -L- are replaced with -CH2CH2O-. In some embodiments, three methylene units of -L- are replaced with -CH2CH2O-. In some embodiments, four, five, six, seven, eight, nine, or ten methylene units of -L- are replaced with -CH2CH2O-.

[0239] In some embodiments, -L- is a covalent bond or a C1-8 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO2-, -SO2N(R)-, -(R)NSO2-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-. In some embodiments, -L- is a covalent bond or a bivalent, saturated or unsaturated, straight or branched, optionally substituted Ci-50 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L- are independently replaced by -Cy2-, -O-, -N(R)-,-S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, -each -Cy2- is independently an optionally substituted bivalent ring selected from phenylenyl, an 8-12 membered bicyclic arylenyl, a 3-8 membered saturated or partially unsaturated carbocyclylenyl, an 8-12 membered bicyclic saturated or partially unsaturated carbocyclylenyl, a 3-8 membered saturated or partially unsaturated heterocyclylenyl having 1- 3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8-12 membered bicyclic saturated or partially unsaturated heterocyclylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered heteroaryl enyl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroarylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; wherein each q is independently 1, 2, or 3.

[0240] In some embodiments, -L- is a covalent bond. In some embodiments, -L- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1-50 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L- are independently replaced by -Cy2- , -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, - amino acid,

[0241] In some embodiments, -L- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1-50, C1-40, C1-30, Ci-2o, C1-15, C1-10, C1-5, C2-so, C2-4o, C2-3o, C2.2o, C2-i5, C2. 10, C3-50, C3-40, C3-30, C3-2o, C3-15, C3-10, C4-50, C4-40, C4-30, C4-2o, C4-15, C4-10, C5-50, C5-40, C5-30, Cs-2o, C5-15, C5-10, Ce-50, Ce-40, C6-30, C6-2o, Ce-i5, C7-50, C7-40, C7-30, C?-2o, C7-15, Cs-so, Cs-40, Cs-30, Cs-2o, Cs- 15, C10-50, C10-40, C10-30, C10-20, C10-15, Cl2-50, Cl2-40, C l2-30, Cl2-20, C15-50, C15-40, C15-30, C15-20, C20-50, C2o-4O, or C2o-3O hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of L are independently replaced by -Cy2-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, - N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, -Si(OH)(R)-, -Si(OH)2-, -P(O)(OR)-, -P(O)(R)-, -

[0242] In some embodiments, -L- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1-50, C1-40, C1-30, C1-20, C1-15, C1-10, C1-5, C2-50, C2-40, C2-30, C2-20, C2-15, C2- 10, C3-50, C3-40, C3-30, C3-20, C3-15, C3-10, C4-50, C4-40, C4-30, C4-20, C4-15, C4-10, C5-50, C5-40, C5-30, C5-20,C5-15, C5-10, Ce-50, Ce-40, Ce-30, Ce-20, Ce-is, C7-50, C7-40, C7-30, C7-20, C7-15, Cs-so, Cs-4o, Cs-3o, Cs-20, Cs- 15, C10-50, C10-40, C10-30, C10-20, C10-15, C12-50, C12-40, C12-30, C12-20, C15-50, C15-40, C15-30, C15-20, C20-50, C20-40, or C 20-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L- are independently replaced by -Cy2-, -O-, -N(R)-,-S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)S(O)2-, -S(O)2N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)2-, -

[0243] In some embodiments, -L- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1-50, C1-40, C1-30, C1-20, C1-15, C1-10, C1-5, C2-50, C2-40, C2-30, C2-20, C2-15, C2- 10, C3-50, C3-40, C3-30, C3-20, C3-15, C3-10, C4-50, C4-40, C4-30, C4-20, C4-15, C4-10, C5-50, C5-40, C5-30, C5-20,C5-15, C5-10, Ce-50, Ce-40, Ce-30, C6-20, Ce-is, C7-50, C7-40, C7-30, C7-20, C7-15, Cs-so, C8-40, Cs-30, Cs-20, Cs- 15, C10-50, C10-40, C10-30, C10-20, C10-15, C12-50, C12-40, C12-30, C12-20, C15-50, C15-40, C15-30, C15-20, C20-50,C20-40, or C 20-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, or 8 methylene units of -L- are independently replaced by -Cy2-, -O-, -N(R)-,-S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)2-, -N(R)C(O)-,

[0245] In some embodiments, -L- is a saturated chain. In some embodiments, -L- comprises at least one unsaturated pair of carbon atoms, i .e., at least one double or triple carbon-carbon bond. In some embodiments, -L- comprises 1, 2, 3, 4, or 5 double or triple carbon-carbon bonds. In some embodiments, -L- is a straight hydrocarbon chain wherein methylene units of -L- are optionally replaced or substituted as described above. In some embodiments, -L- is a saturated, straight hydrocarbon chain wherein methylene units of -L- are optionally replaced or substituted as described above.

[0246] In some embodiments, -L- is substituted with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 “optional substituents” as defined herein. In some embodiments, each substituent is independently selectedfrom deuterium, halogen, -CN, -OR, -N(R)2, -SR, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl optionally substituted with one or more C1-4 alkyl, -CO2R, -OR, -C0N(R)2, -N(R)2, or halogen, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or a C1-6 aliphatic group optionally substituted with -CN, -OR, -N(R)2, -SR, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl optionally substituted with one or more C1-4 alkyl, -CO2R, - OR, -CON(R)2, -N(R)2, or halogen, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or the C1-6 aliphatic is optionally substituted with 1, 2, 3, 4, 5, or 6 deuterium or halogen atoms; or two substituents attached to the same carbon atom, taken together with the carbon atom to which they are attached, form a 3-6 membered saturated monocyclic carbocyclic ring or 3-6 membered saturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0247] As described above, in some embodiments, a methylene unit of -L- is replaced with an amino acid. The amino acid may be naturally occurring or non-naturally occurring. In some embodiments, the amino acid is selected from a non-polar or branched chain amino acid (BCAA). In some embodiments, the amino acid is selected from valine, isoleucine, leucine, methionine, alanine, proline, glycine, phenylalanine, tyrosine, tryptophan, histidine, asparagine, glutamine, serine threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, cysteine, selenocysteine, or tyrosine. In some embodiments, the amino acid is an L-amino acid. In some embodiments, the amino acid is a D-amino acid.

[0248] In some embodiments, -L- is selected from one of those depicted in Table 2B, below.Table 2B: Exemplary LinkersMethods and RNA conjugates

[0249] In one aspect, the disclosure provides Warheads that, when conjugated to a linker- rSM moiety (resulting in Formula A), can react with (covalently modify) a target RNA. In some embodiments, the target RNA sequence is the same as the RNA sequence targeted by the rSM. However, it should be appreciated that the RNA sequence targeted by the compounds and compositions provided herein is not limited to the RNA sequence targeted by the rSM. For instance, in some embodiments, the compounds and compositions disclosed herein that include a Warhead-linker-rSM, target an RNA sequence that differs from the sequence targeted by the rSM if it were not conjugated to a linker and / or Warhead. In that scenario, the linker and / or Warhead may interact with the RNA resulting in different binding and / or contacting parameters of the Warhead-linker-rSM compound or composition as compared to the rSM only.

[0250] In some embodiments, the disclosure provides Warheads that, when conjugated to a linker-rSM moiety, can react with the RNA sequence targeted by the Warhead-linker-rSM. In some embodiments, the disclosure provides compounds of Formula A that can react with the RNA sequence targeted by the rSM. It should be appreciated that both an RNA sequence targeted by the rSM and an RNA sequence targeted by the Warhead-linker-rSM are “target RNA” sequences, as used herein. In some embodiments, the disclosure provides compounds of Formula A, wherein the Warhead of the compound can react with an RNA target sequence. It should be appreciated that the Warhead can react within the specific target RNA sequence (Say a stretch of 5 to 10 nucleotides) or outside of the specific target RNA sequence. Thus, in some embodiments, the Warhead can react (covalently modify) RNA within the target RNA sequence or upstream ordownstream thereof. In addition, the warhead can react with an RNA sequence that is further removed from the RNA target sequence, for instance, an RNA sequence further upstream or downstream of the target sequence. In some embodiments, the warhead can react with an RNA sequence that is removed from the target RNA sequence (e.g., upstream or downstream), but that is in the vicinity of the target RNA sequence, for instance, because of a specific RNA three- dimensional fold that brings the RNA sequence with which the Warhead reacts in close proximity to the RNA target sequence. It should be appreciated that the compounds and compositions provided herein may interact with e.g., bind or contact) a target sequence on a first RNA, while the Warhead reacts with a second copy of the RNA sequence. This is likely to occur, for instance, if multiple copies of the same RNA are in close vicinity, for instance when multiple copies of the RNA are newly transcribed.

[0251] While not being limited to a specific mechanism, it is thought that the Warhead can react with a specific RNA sequence because the rSM or the Warhead-linker-rSM brings the Warhead in vicinity of that specific RNA sequence. In some embodiments, the specific RNA sequence target by the Warhead is within the RNA target sequence. In some embodiments, the Warhead group reacts selectively with the target RNA upon contacting of the compound of Formula A with the target RNA. In some embodiments, the Warhead group reacts selectively with the target RNA upon binding of the compound of Formula A to the target RNA. In some embodiments, the Warhead group reacts selectively with the target RNA without significant binding of the compound of Formula A to the target RNA. In some embodiments, the Warhead group reacts selectively with the target RNA without measurable binding of the compound of Formula A to the target RNA.

[0252] While not being limited to a specific mechanism, it is thought that the Warhead can react with a specific RNA sequence because the rSM, or the Warhead-linker-rSM combination, brings the Warhead in vicinity of that specific RNA sequence. In some embodiments, the specific RNA sequence targeted by the Warhead is close to the RNA target sequence. In some embodiments, the Warhead group reacts selectively with a specific RNA sequence upon contacting of the compound of Formula A with the target RNA. It should be appreciated that for the compositions and methods provided herein, “contacting RNA” includes a variety of contacts, ranging from binding the RNA to bringing the Warheads in vicinity to the RNA to allow for Warhead to react with (covalently modify) the RNA. In some embodiments, the Warhead groupreacts selectively with the specific RNA sequence upon binding of the compound of Formula A to the target RNA. In some embodiments, the Warhead group reacts selectively with a specific RNA sequence without significant binding of the compound of Formula A to the target RNA. In some embodiments, the Warhead group reacts selectively with a specific RNA sequence without measurable binding of the compound of Formula A to the target RNA.

[0253] In some embodiments, the Warhead group reacts selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. While not being limited to a specific mechanism, it is thought that the compounds of Formula A can specifically target a nucleobase within a target RNA sequence because of the reactivity of the Warhead, the location and freedom of rotation of the Warhead in relationship to the linker-rSM, or a combination of the reactivity of the Warhead and the location and freedom of rotation of the Warhead in relationship to the linker-rSM. In some embodiments, the compounds, compositions and Warheads provided herein covalently modify one or more nucleobases, but show no significant reactivity to the RNA backbone. In some embodiments, the compounds, compositions and Warheads provided herein covalently modify one or more nucleobases, but show no significant reactivity to the sugar moiety in the RNA backbone. In some embodiments, the compounds, compositions and Warheads provided herein covalently modify one or more nucleobases, but show no significant reactivity to the 2’OH group of the RNA backbone. While not being limited to a specific mechanism, the relative lower level of reactivity of the compounds, compositions and epoxide-based Warheads provided herein, towards the RNA backbone, including the 2’OH group of the RNA backbone, is what allows the compounds, compositions and Warheads to react selectively with one or more RNA nucleobases.

[0254] In some embodiments, the compounds, compositions and Warheads provided herein react selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. In some embodiments, the Warhead group reacts selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. In some embodiments, the Warhead group reacts selectively with a nucleobase of the target RNA over a non-target sequence of the RNA. In some embodiments, the Warhead group reacts selectively with a nucleobase of the target RNA over the nucleobase of a DNA. In some embodiments, the Warhead group reacts selectively with a nucleobase of the target RNA over an amino acid.

[0255] In some embodiments, the compounds, compositions and Warheads provided herein react selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. In some embodiments, the Warhead group reacts selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. In some embodiments, the Warhead group reacts selectively with a guanine of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof. In some embodiments, the Warhead group reacts with an N7 nitrogen of the guanine of the target RNA.

[0256] While not being limited to a specific mechanism, it is thought that the compounds, compositions and Warheads provided herein, including the compounds of Formula A, can specifically target a guanine in an RNA target sequence because of the reactivity of the Warhead, the location and freedom of rotation of the Warhead in relationship to the linker-rSM, or a combination of the reactivity of the Warhead and the location and freedom of rotation of the Warhead in relationship to the linker-rSM. While not being limited to a specific mechanism, it is thought that the compounds, compositions and Warheads provided herein, including the compounds of Formula A, can specifically target an N7 nitrogen of the guanine because of the reactivity of the Warhead, the location and freedom of rotation of the Warhead in relationship to the linker-rSM, or a combination of the reactivity of the Warhead and the location and freedom of rotation of the Warhead in relationship to the linker-rSM.

[0257] In one aspect, the disclosure provides compounds, compositions and Warheads that can react with (covalently modify) a target RNA sequence in a cellular environment. In some embodiments, the Warhead group reacts selectively with a target RNA sequence under physiological conditions inside a cell. In one aspect, the compounds, compositions and methods provided herein allow for the modification of a target RNA sequence within the cellular environment. As shown herein, in some embodiments, the compounds and compositions provided herein can cross the cellular membrane and react with a target RNA sequence under physiological conditions inside a cell. While not being limited to a specific mechanism, it is thought that the compounds, compositions and warheads disclosed herein, including the compounds of Formula A, can react with (covalently modify), a target RNA sequence intracellularly because of the level reactivity of the epoxide-based Warhead, the stability of the warhead in a cellular environment, or a combination of the reactivity and stability of the warhead.

[0258] In one aspect, the compounds, compositions and warheads provided herein are reactive enough to specifically react with (covalently modify) a target RNA sequence but are not that reactive that they react with other components in the cell in significant amounts. Thus, in some embodiments, in a cellular environment, the compounds, compositions and warheads provided react with a target RNA sequence, but do not react in significant amounts with a non-target RNA sequence. In some embodiments, in a cellular environment, the compounds, compositions and warheads provided herein react with a target RNA sequence, but do not react in significant amounts with DNA. In some embodiments, in a cellular environment, the compounds, compositions and warheads provided herein react with a target RNA sequence, but do not react in significant amounts with a protein or polypeptide. In some embodiments, in a cellular environment, the compounds, compositions and warheads provided herein react with a target RNA sequence, but do not react in significant amounts with a non-target RNA moiety found in the cellular environment.

[0259] In one aspect, the compounds and compositions and warheads provided herein are stable enough that they can survive in a cellular environment to allow the compounds and compositions and warheads to react with (covalently modify) a target RNA sequence within the cell. In some embodiments, the compounds and compositions and warheads provided herein are stable enough for a sufficient length of time to in a cellular environment to allow the compounds and compositions and warheads to react with (covalently modify) a target RNA sequence within the cell. In some embodiments, the compounds and compositions and warheads provided herein are sufficient resistant to active chemical moi eties found to in a cellular environment to allow the compounds and compositions and warheads to react with (covalently modify) a target RNA sequence within the cell. As provided herein the ability to covalently modify RNA intracellularly provides many new therapeutic options.

[0260] It should be appreciated that in one aspect the disclosure also provides covalently modified RNA. The disclosure provides compounds, compositions and methods for the modification of RNA intracellularly. Accordingly, in some embodiments, the disclosure provides covalently modified RNA that is in an intracellular environment. In some embodiments, the compounds, compositions and methods provided herein allow for the modification of a target RNA intracellularly. Accordingly, in some embodiments, the disclosure provides RNA that is covalently modified at a specific sequence and that is in an intracellular environment. Assays that can confirm if an intracellular RNA is modified are known in the art and include NMR. Analternative assay is provided herein and includes removing the covalently modified RNA from the cell and evaluating the RNA in a cell free translation assay.

[0261] It should be appreciated that, in one aspect, the disclosure also provides RNA with a modified nucleobase. In some embodiments, the compounds, compositions and methods provided herein allow for the modification of a nucleobase of an RNA intracellularly. Thus, in some embodiments, the disclosure provides RNA that is covalently modified at nucleobase that is in an intracellular environment. In some embodiments, the compounds, compositions and methods provided herein allow for the modification of a nucleobase of a target RNA sequence intracellularly. Thus, in some embodiments, the disclosure provides RNA that is covalently modified at nucleobase at a specific position that is in an intracellular environment.

[0262] It should be appreciated that, in one aspect, the disclosure also provides RNA with a modified guanine. In some embodiments, the compounds, compositions and methods provided herein allow for the modification of a guanine of an RNA intracellularly. Thus, in some embodiments, the disclosure provides RNA that is covalently modified at a guanine that is in an intracellular environment. In some embodiments, the compounds, compositions and methods provided herein allow for the modification of a guanine of a target RNA sequence intracellularly. Thus, in some embodiments, the disclosure provides RNA that is covalently modified at guanine at a specific position that is in an intracellular environment.

[0263] It should be appreciated that in one aspect the disclosure also provides RNA with a modified at the N7 of a guanine. In some embodiments, the compounds, compositions and methods provided herein allow for the modification of the N7 nitrogen of a guanine of an RNA intracellularly. Thus, in some embodiments, the disclosure provides RNA that is covalently modified at the N7 nitrogen of a guanine that is in an intracellular environment. In some embodiments, the compounds, compositions and methods provided herein allow for the modification of the N7 nitrogen of a guanine of a target RNA sequence intracellularly. Thus, in some embodiments, the disclosure provides RNA that is covalently modified at Ny nitrogen of guanine at a specific position that is in an intracellular environment.

[0264] It should be appreciated that the cell has machinery that can detect and process RNA that has been modified. The machinery can detect various modifications of the RNA, including RNA that has been modified at a nucleobase. Accordingly, the RNA modified intracellularly (e.g., at a nucleobase) by the compounds, compositions and methods provided herein can be furtherprocessed by the intracellular machinery. While the cell has multiple pathways to detect and / or process a modified RNA, almost all pathways that act on RNA that has been modified at a nucleobase, will include the step of removing the modified nucleobase in the RNA resulting in an abasic site. Thus, in some embodiments, the disclosure provides RNA with an abasic site that is in an intracellular environment. In some embodiments, the disclosure provides RNA with an abasic site at specific position in the RNA that is in an intracellular environment. In some embodiments the RNA with an abasic site is generated intracellularly by removal of a modified nucleobase. In some embodiments the RNA with an abasic site is generated intracellularly by removal of a modified guanine. In some embodiments the RNA with an abasic site is generated intracellularly by removal of a guanine that is modified at the N7 position.Treatment of RNA-mediated diseases

[0265] In one aspect, the disclosure provides compositions and methods for the treatment of any disease mediated by aberrant RNA function and / or aberrant protein expression. While most molecular targets that have been addressed therapeutically are proteins, a variety of RNA molecules play important regulatory roles in both healthy and diseased cells. In some embodiments, the disclosure provides compounds, compositions and methods for targeting RNA thereby targeting diseases mediated by aberrant RNA function. In some embodiments, the disclosure provides compounds, compositions and methods for targeting RNA, which allows for targeting diseases associated with aberrant expression of the corresponding protein. While not being limited to a specific mechanism, in some embodiments, the compounds and compositions provided here can covalently modify target RNA, thereby suppressing or inhibiting the function of the RNA. In some embodiments, the compounds and compositions provided here can covalently modify target RNA, thereby suppressing or inhibiting the translation of the RNA. In some embodiments, the compounds and compositions provided here can covalently modify a target RNA, thereby suppressing or inhibiting the expression (e.g., overexpression) of a functional protein corresponding to the target RNA. In some embodiments, the compounds and compositions provided here can covalently modify a target RNA, thereby suppressing or inhibiting the expression of an aberrant protein corresponding to the target RNA.

[0266] RNA targeted by the compositions and compounds provided herein includes mRNA, non-messenger RNA, coding RNA and non-coding RNA. Targeting coding RNA may preventthe targeted RNA from being translated thereby suppressing the production of the corresponding protein. Noncoding transcripts (the noncoding transcriptome) represent a large group of new therapeutic targets. While only 1-2% of the human genome codes for proteins, most of the genome is transcribed (Carninci et al., Science 309: 1559-1563; 2005). Noncoding RNAs such as microRNA (miRNA) and long noncoding RNA (IncRNA) regulate transcription, splicing, mRNA stability / decay, and translation. In addition, the noncoding regions of mRNA such as the 5' untranslated regions (5' UTR), the 3' UTR, and introns can play regulatory roles in affecting mRNA expression levels, alternative splicing, translational efficiency, and mRNA and protein subcellular localization. RNA secondary and tertiary structures are critical for these regulatory activities. In some embodiments, the compounds and compositions provided herein can covalently modify non-coding target RNA, thereby suppressing or inhibiting the function (e.g., regulatory function) of the noncoding target RNA.

[0267] Therapeutic approaches to interdict mRNA include methods such as gene therapy (Naldini, Nature 2015, 526, 351-360), genome editing (Cox et al., Nature Medicine 2015, 21, 121- 131), or a wide range of oligonucleotide technologies (antisense, RNAi, etc.) (Bennett & Swayze, Annu. Rev. Pharmacol. Toxicol. 2010, 50, 259-293). Oligonucleotides modulate the action of RNA via canonical base / base hybridization. The appeal of this approach is that the basic pharmacophore of an oligonucleotide can be defined in a straightforward fashion from the sequence subject to interdiction. However, each of these therapeutic modalities suffers from substantial technical, clinical, and regulatory challenges. Some limitations of oligonucleotides as therapeutics (e.g., antisense, RNAi) include unfavorable pharmacokinetics, lack of oral bioavailability, and lack of blood-brain-barrier penetration, with the latter precluding delivery to the brain or spinal cord after parenteral drug administration for the treatment of neurological diseases. In addition, oligonucleotides are not taken up effectively into solid tumors without a complex delivery system such as lipid nanoparticles. Lastly, a vast majority of the oligonucleotides that are taken up into cells and tissues remain in a non-functional compartment such as endosomes, and only a small fraction of the material escapes to gain access to the cytosol and / or nucleus where the target is located. In contrast, the compounds and compositions provided herein are “traditional” small molecules, which can be optimized to exhibit excellent absorption from the gut, excellent distribution to target organs, and excellent cell penetration.T argeti ng mRN A

[0268] In some embodiments, the disclosure provides methods and compositions that target the coding region of the mRNA and interfere with mRNA function (e.g., protein translation), thereby modulating the function of the corresponding protein. Targeting the coding region of the mRNA is expected to directly impact the function of the corresponding protein. In some embodiments, targeting the coding region of the mRNA results in suppression of translation of the corresponding protein. In some embodiments, targeting the coding region of the mRNA results in inhibition of translation of the corresponding protein. In some embodiments, targeting the coding region of the mRNA results in translation of a modified version of protein, (e.g., a protein that is prematurely terminated). In some embodiments, targeting the coding region of the mRNA results in a lowering of the levels of the corresponding protein in the cell. In some embodiments, the disclosure provides method and compositions that target the noncoding region of the mRNA and interfere with mRNA function (e.g., protein translation), thereby modulating the function of the corresponding protein.

[0269] Within mRNAs, noncoding regions can affect the level of mRNA and protein expression. Briefly, these include IRES and upstream open reading frames (uORF) that affect translation efficiency, intronic sequences that affect splicing efficiency and alternative splicing patterns, 3' UTR sequences that affect mRNA and protein localization, and elements that control mRNA decay and half-life. It should be appreciated that the compounds, compositions and methods provided herein can target the noncoding regions in the mRNA as well and are therefore useful in the treatment of any disease that is associated with the noncoding regions in the mRNA. While not being limited to a specific mechanism, in some embodiments, the compounds and compositions provided here can covalently modify noncoding mRNA, thereby suppressing or inhibiting the function of the noncoding mRNA.Targeting non-coding RNA

[0270] The largest set of RNA targets is RNA that is transcribed but not translated into protein, termed “non-coding RNA”. It should be appreciated that “non-coding RNA” and “noncoding RNA” can be used interchangeably herein. In some embodiments, the disclosure provides compounds, compositions and methods that target non-coding RNA. Non-coding RNA is highly conserved, and the many varieties of non-coding RNA play a wide range of regulatory functions.The term “non-coding RNA,” as used herein, includes but is not limited to micro-RNA (miRNA), long non-coding RNA (IncRNA), long intergenic non-coding RNA (lincRNA), Piwi-interacting RNA (piRNA), competing endogenous RNA (ceRNA), and pseudo-genes. Each of these subcategories of non-coding RNA offers RNA targets with significant therapeutic potential. Accordingly, in some embodiments, the present invention provides methods of treating a disease mediated by non-coding RNA. In some embodiments, the disease is caused by a miRNA, IncRNA, lincRNA, piRNA, ceRNA, or a pseudo-gene. While not being limited to a specific mechanism, in some embodiments, the compounds and compositions according to the methods provided herein can covalently modify non-coding target RNA, thereby suppressing or inhibiting the function of the noncoding target RNA.

[0271] miRNA are short double-strand RNAs that regulate gene expression (see Elliott & Ladomeiy, Molecular Biology of RNA, 2nd Ed.). Each miRNA can affect the expression of many human genes. There are nearly 2,000 miRNAs in humans. These RNAs regulate many biological processes, including cell differentiation, cell fate, motility, survival, and function. miRNA expression levels vary between different tissues, cell types, and disease settings. They are frequently aberrantly expressed in tumors versus normal tissue, and their activity may play significant roles in cancer (for reviews, see Croce, Nature Rev. Genet. 10:704-714, 2009; Dykxhoorn Cancer Res. 70:6401-6406, 2010). miRNAs have been shown to regulate oncogenes and tumor suppressors and themselves can act as oncogenes or tumor suppressors. Some have been shown to promote epitheli al -mesenchymal transition (EMT) and cancer cell invasiveness and metastasis. In the case of oncogenic miRNAs, their inhibition could be an effective anti-cancer treatment. Accordingly, in one aspect, the present invention provides compounds and compositions that according to the methods provided herein can modulate the activity of a target miRNA to treat a disease or disorder. In some embodiments, the miRNA regulates an oncogene or tumor suppressor, or acts as an oncogene or tumor suppressor. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor.

[0272] There are multiple oncogenic miRNAs that can be therapeutically targeted including miR-155, miR-17~92, miR-19, miR-21, and miR-lOb (see Stahlhut & Slack, Genome Med. 2013, 5, 111). For example, miR-155 plays pathological roles in inflammation, hypertension, heart failure, and cancer. In cancer, miR-155 triggers oncogenic cascades and apoptosis resistance, as well as increasing cancer cell invasiveness. Altered expression of miR-155 has been described inmultiple cancers, reflecting staging, progress and treatment outcomes. Cancers in which miR-155 over-expression have been reported are breast cancer, thyroid carcinoma, colon cancer, cervical cancer, and lung cancer. In addition, miR-155 is reported to play a role in drug resistance in breast cancer. miR-17~92 (also called Oncomir-1) is a polycistronic 1 kb primary transcript comprising miR-17, 20a, 18a, 19a, 92-1 and 19b- 1 that is activated by MYC. Other examples of miRNAs that can be modified by the compounds and compositions provided herein include miR-19 and miR- 21. miR-19 alters the gene expression and signal transduction pathways in multiple hematopoietic cells, and it triggers leukemogenesis and lymphomagenesis. miR-19 is implicated in a wide variety of human solid tumors and hematological cancers. miR-21 is an oncogenic miRNA that reduces the expression of multiple tumor suppressors. It stimulates cancer cell invasion and is associated with a wide variety of human cancers including breast, ovarian, cervix, colon, lung, liver, brain, esophagus, prostate, pancreas, and thyroid cancers. Any and all of the miRNAs described herein can be targeted by the compositions and methods provided herein, thereby targeting the disease associated with the (aberrant) function of the miRNA. In some embodiments, the disease or disorder is a cancer selected from breast cancer, ovarian cancer, cervical cancer, thyroid carcinoma, colon cancer, liver cancer, brain cancer, esophageal cancer, prostate cancer, lung cancer, leukemia, or lymph node cancer. Beyond oncology, miRNAs play roles in many other diseases including cardiovascular and metabolic diseases (See e.g., Quiant and Olson, J. Clin. Invest. 123: 11-18, 2013; Olson, Science Trans. Med. 6: 239ps3, 2014; Baffy, J. Clin. Med. 4: 1977- 1988, 2015).

[0273] In addition to mature miRNAs, the compounds and compositions provided herein can modify the activity of such miRNA by targeting the primary transcript or the pre-miRNA to block the functionality of the mature miRNA. Accordingly, in some embodiments of the compounds, compositions and methods provided herein, the target miRNA is a primary transcript or pre- miRNA.

[0274] IncRNA are RNAs of over 200 nucleotides (nt) that do not encode proteins (see Rinn & Chang, Ann. Rev. Biochem. 2012, 81, 145-166; (for reviews, see e.g., Morris and Mattick, Nature Reviews Genetics 15:423-437, 2014; Mattick and Rinn, Nature Structural & Mol. Biol. 22:5-7, 2015; Iyer et al., Nature Genetics 47: 199-208, 2015). However, these IncRNAs can affect the expression of the protein-encoding mRNAs at the level of transcription, splicing and mRNA decay. For instance, IncRNA can regulate transcription by recruiting epigenetic regulators thatincrease or decrease transcription by altering chromatin structure (e.g., Holoch and Moazed, Nature Reviews Genetics 16:71-84, 2015) and IncRNAs are associated with human diseases including cancer, inflammatory diseases, neurological diseases and cardiovascular disease (for instance, Presner and Chinnaiyan, Cancer Discovery 1 :391-407, 2011; Johnson, Neurobiology of Disease 46:245-254, 2012; Gutscher and Diederichs, RNA Biology 9:703-719, 2012; Kumar et al., PLOS Genetics 9:el003201, 2013; van de Vondervoort et al., Frontiers in Molecular Neuroscience, 2013; Li et al., Int. J. Mol. Sci. 14:18790-18808, 2013). The targeting of IncRNA can up-regulate or down-regulate the expression of specific genes and proteins for therapeutic benefit (e.g., Wahlestedt, Nature Reviews Drug Discovery 12:433-446, 2013; Guil and Esteller, Nature Structural & Mol. Biol. 19: 1068-1075, 2012). In general, IncRNA are expressed at a lower level relative to mRNAs. Many IncRNAs are physically associated with chromatin (Werner et al., Cell Reports 12, 1-10, 2015) and are transcribed in close proximity to protein-encoding genes. They often remain physically associated at their site of transcription and act locally, in cis, to regulate the expression of a neighboring mRNA. The mutation and dysregulation of IncRNA is associated with human diseases, and there are a multitude of IncRNAs that are therapeutic targets. Accordingly, in some embodiments the disclosure provides compositions and methods that target non-coding RNA, wherein the non-coding RNA is a IncRNA. In some embodiments, the IncRNA is associated with cancer, inflammatory disease, neurological disease, or cardiovascular disease.Targeting Toxic RNA (Repeat RNA)

[0275] In some embodiments, the compounds and compositions provided here can covalently modify repeat RNA, thereby suppressing or inhibiting the function of the repeat RNA. As the repeat RNA is associated with pathogenic function, targeting the repeat RNA by the methods provided herein can inhibit or suppress the pathogenic function of the repeat RNA. In some embodiments the pathogenic function of the repeat RNA is suppressed by covalently modifying the repeat RNA. Simple repeats in mRNA often are associated with human disease. These are often, but not exclusively, repeats of three nucleotides, (“triplet repeats”) such as CAG (for reviews, see e.g., Gatchel and Zoghbi, Nature Reviews Genetics 6:743-755, 2005; Krzyzosiak et al., Nucleic Acids Res. 40: 11-26, 2012; Budworth and McMurray, Methods Mol. Biol. 1010:3-17, 2013). Triplet repeats are abundant in the human genome, and they tend to undergo expansion over generations. Approximately 40 human diseases are associated with the expansion of repeatsequences. Diseases caused by triplet expansions are also known as Triplet Repeat Expansion Diseases (TRED). Healthy individuals have a variable number of triplet repeats, but there is a threshold beyond which a higher repeat number of triplets causes disease. The threshold varies in different disorders. The triplet repeat can be unstable. As the gene is inherited, the number of repeats may increase, and the condition may be more severe or have an earlier onset from generation to generation. When an individual has a few repeats in the normal range, it is not expected to expand when passed to the next generation. When the repeat number is in the premutation range (a normal, but unstable repeat number), then the repeats may or may not expand upon transmission to the next generation. Normal individuals who carry a premutation do not have the condition but are at risk of having a child who has inherited a triplet repeat in the full mutation range and who will be affected. TREDs can be autosomal dominant, autosomal recessive or X- linked. The more common triplet repeat disorders are autosomal dominant.

[0276] The repeats can be in the coding or noncoding portions of the mRNA. In the case of repeats within noncoding regions, the repeats may lie in the 5' UTR, introns, or 3' UTR sequences.

[0277] Some examples of diseases caused by repeat sequences within coding regions are shown in Table DI.Table D-l: Repeat Expansion Diseases with the repeat in the Coding Regions of mRNA

[0278] Some examples of diseases caused by repeat sequences within noncoding regions of mRNA are shown in Table D2.Table D2: Repeat Expansion Diseases with the repeat in the Noncoding Regions of mRNA

[0279] The toxicity that results from the repeat sequences can be a direct consequence of the action of the toxic RNA itself, or, in cases in which the repeat expansion is in the coding sequence, due to the toxicity of the RNA and / or the aberrant protein. In addition, the repeat expansion RNA can act by sequestering critical RNA-binding proteins (RBP) into foci. One example of a sequestered RBP is the Muscleblind family protein MBNL1. Sequestration of RBPs leads to defects in splicing as well as defects in nuclear-cytoplasmic transport of RNA and proteins. Sequestration of RBPs also can affect miRNA biogenesis. These perturbations in RNA biology can profoundly affect neuronal function and survival, leading to a variety of neurological diseases.

[0280] Repeat sequences in RNA can form secondary and tertiary structures that bind RBPs and affect normal RNA biology. One specific example disease is myotonic dystrophy (DM1; dystrophia myotonica), a common inherited form of muscle disease characterized by muscle weakness and slow relaxation of the muscles after contraction (Machuca-Tzili et al., Muscle Nerve 32: 1-18, 2005). It is caused by a CUG expansion in the 3' UTR of the dystrophia myotonica protein kinase (DMPK) gene. This repeat-containing RNA causes the misregulation of alternative splicing of several developmentally regulated transcripts through effects on the splicing regulators MBNL1 and the CUG repeat binding protein (CELF1) (Wheeler et al., Science 325:336-339, 2009). Small molecules that bind the CUG repeat within the DMPK transcript would alter the RNA structure, prevent focus formation and alleviate the effects on these spicing regulators. In one embodiment, the current disclosure provides methods and compositions for the treatment of triplet diseases by binding the RNA of the triplet disease. Fragile X Syndrome (FXS), the most common inherited form of mental retardation, is the consequence of a CGG repeat expansion within the 5' UTR of the FMRI gene (Lozano et al., Intractable Rare Dis. Res. 3: 134-146, 2014).FMRP is critical for the regulation of translation of many mRNAs and for protein trafficking, and it is an essential protein for synaptic development and neural plasticity. Thus, its deficiency leads to neuropathology. Another TRED having a very high unmet medical need is Huntington’ s disease (HD). HD is a progressive neurological disorder with motor, cognitive, and psychiatric changes (Zuccato et al., Physiol Rev. 90:905-981, 2010). It is characterized as a poly-glutamine or polyQ disorder since the CAG repeat within the coding sequence of the HTT gene leads to a protein having a poly-glutamine repeat that appears to have detrimental effects on transcription, vesicle trafficking, mitochondrial function, and proteasome activity. However, the HTT CAG repeat RNA itself also demonstrates toxicity, including the sequestration of MBNL1 protein into nuclear inclusions. One other specific example is the GGGGCC repeat expansion in the C9orf72 (chromosome 9 open reading frame 72) gene that is prevalent in both familial frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS) (Ling et al., Neuron 79:416-438, 2013; Haeusler et al., Nature 507: 195-200, 2014). The repeat RNA structures form nuclear foci that sequester critical RNA binding proteins. The GGGGCC repeat RNA also binds and sequesters RanGAPl to impair nucleocytoplasmic transport of RNA and proteins (Zhang et al., Nature 525:56-61, 2015).

[0281] The present invention also includes methods of treating a disease or disorder wherein aberrant RNAs themselves cause pathogenic effects, rather than acting through the agency of protein expression or regulation of protein expression. In some embodiments, the disease or disorder is mediated by repeat RNA, such as those described above or in Table DI and Table D2. In some embodiments, the disease or disorder is a repeat expansion disease in which the repeat resides in the coding regions of mRNA. In some embodiments, the disease or disorder is a repeat expansion disease in which the repeat resides in the noncoding regions of mRNA. In some embodiments, the disease or disorder is selected from Huntington’s disease (HD), dentatorubral- pallidoluysian atrophy (DRPLA), spinal-bulbar muscular atrophy (SBMA), or a spinocerebellar ataxia (SCA) selected from SC Al, SCA2, SC A3, SCA6, SCA7, or SCA17. In some embodiments, the disease or disorder is selected from Fragile X Syndrome, myotonic dystrophy (DM1 or dystrophia myotonica), Friedreich’s Ataxia (FRDA), a spinocerebellar ataxia (SCA) selected from SCA8, SCAIO, or SCA12, or C9FTD (amyotrophic lateral sclerosis or ALS). In some embodiments, the disease is amyotrophic lateral sclerosis (ALS), Huntington’s disease (HD),frontotemporal dementia (FTD), myotonic dystrophy (DM1 or dystrophia myotonica), or Fragile X Syndrome.

[0282] In some embodiments, the present invention provides a method of treating a disease or disorder mediated by repeat RNA, comprising the step of administering to a subject in need thereof a compound or composition provided herein. In some embodiments, the compounds, compositions and methods provided herein can covalently modify repeat RNA. Accordingly, it should be appreciated that the compounds, compositions and methods provided herein are useful in the treatment of any disease associated with repeat RNA, including, without limitation, diseases in which the pathology is associated with the repeat RNA itself, or in diseases associated with proteins expressed by repeat RNA.Other Target RNAs and Diseases / Conditions

[0283] In some embodiments, the compounds and compositions provided here can covalently modify a target RNA, thereby suppressing or inhibiting the function of the target RNA. In some embodiments, the compounds and compositions provided here can covalently modify target RNA, thereby suppressing or inhibiting the translation of the target RNA. In some embodiments, the compounds and compositions provided here can covalently modify target RNA, thereby suppressing or inhibiting the expression of a functional protein corresponding to the target RNA. In some embodiments, the compounds and compositions provided here can covalently modify target RNA, thereby suppressing or inhibiting the expression of an aberrant protein. Thus, in one aspect, the compounds and compositions provided herein are useful in treatment of any disease that is characterized by, or associated with, the functionality of a protein. In some embodiments, the compositions provided herein are useful in treatment of any disease that is characterized by, or associated with, the overexpression of a protein. In some embodiments, the compositions provided herein are useful in the treatment of any disease that is characterized by, or associated with, the expression of a protein with a pathogenic functionality. Accordingly, in some embodiments of the methods described above, the target RNA is selected from the genes listed in Table D3 and Table D4 In some embodiments, the disease or disorder that can be treated by compounds, compositions and methods provided herein is selected from those in Table D3 and Table D4.Table D3: Target RNAs and Associated Diseases / ConditionsTable D4: Additional Target RNAsTreatment of SARS-CoV-2

[0284] In one aspect the disclosure provides compounds, compositions and methods for the treatment of a SARS-CoV-2 infection. In one aspect the disclosure provides compositions and methods for the treatment of COVID-19. Since the first patient with a pneumonia of unknown origin in late December 2019 in Wuhan City, China, a new coronavirus, designated severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has resulted in a rapidly spreading worldwide pandemic of respiratory illness termed coronavirus disease 2019 (COVID-19). Due to its novelty and the lack of population or group immunity, COVID-19 has been spreading rapidly, causing great harm to human health, economic activity, and disrupting the social fabric on many levels.

[0285] COVID- 19 begins with SARS-CoV-2 infection of the upper respiratory tract. Upon infection, the virus replicates rapidly, and after several days the infection extends to the lungs where the pathology becomes manifold and includes pneumonia, immune hyper-reactivity, pulmonary infiltration, and fibrosis leading to permanent lung damage and in some cases death. COVID- 19 is considered to have two critical elements: uncontrolled SARS-CoV-2 replication, and overreactive immune-inflammatory response. The clinical features of COVID- 19 are varied, ranging from an asymptomatic state to acute respiratory distress syndrome (ARDS), multi-organ dysfunction syndrome, and death. Most cases resolve with at-home care and supporting therapy;however, a significant portion require hospitalization, of which 25% to 30% develop severe respiratory complications. The overall risk of fatality from COVID- 19 is considerably higher in the elderly and persons with underlying co-morbidities.

[0286] The common clinical features of COVID-19 include fever, cough, sore throat, headache, fatigue, myalgia, and shortness of breath. In a subset of patients, by the end of the first week, the disease can progress to pneumonia, respiratory failure, organ failure, and death. SARS- CoV-2 targets ciliated cells which are subsequently shed. The disease progression is also associated with an extreme rise in the level of inflammatory cytokines including interleukin (IL)- 2, IL-7, IL-10, granulocyte-colony stimulating factor (GCSF), interferon gamma-induced protein 10 (IP- 10), monocyte chemoattractant protein (MCP) 1, macrophage inflammatory protein (MIP)IA, and tumor necrosis factor alpha (TNFa), and vascular endothelial growth factor (VEGF). Both IF-6 and IF- 17 have been implicated in acute respiratory distress syndrome (ARDS). Levels of IF-6 appear to play an important role in COVID-19 disease severity as there is strong evidence that IF-6 peak levels are associated with severity of pulmonary complications. The hyper induction of pro-inflammatory cytokines, also referred to as a “cytokine storm” or cytokine release syndrome (CRS), is common in acute viral infections and can lead to tissue damage and pulmonary pathology. VEGF, which plays a role in the pathogenesis of ARDS, has also been found to be increased in patients with COVID-19.

[0287] New therapeutics for SARS-CoV-2 are needed. While the severity of SARS-CoV-2 infection can be suppressed with vaccination, vaccination does not always prevent SARS-CoV-2 infection or disease. In addition, not every individual is, or will be, vaccinated. Recently, additional therapeutics have become available for the treatment of SARS-CoV-2 infection, namely nirmatrelvir / ritonavir, sold under the brand name Paxlovid. However, SARS-CoV-2 infections are still prevalent, and mutations of the virus can evade vaccinations and currently available therapeutics. New therapeutics are needed therefore, and the current disclosure addresses this issue by providing therapeutics that can treat SARS-CoV-2 by targeting the RNA of SARS-CoV-2

[0288] In one aspect the disclosure provides compounds, compositions and methods for the treatment of a SARS-CoV-2 infection. In one aspect the disclosure provides compounds, compositions and methods for the treatment of COVID-19. The compounds and compositions described herein, and pharmaceutically acceptable salts, solvates, and hydrates thereof, are useful in modulating expression and function of one or more coronavirus, e.g., SARS-CoV-2, RNAtranscripts, such as those described herein. The compounds and compositions provided herein are useful in treating one or more diseases, disorders, and conditions, such a SARS-CoV-2 infection or a sequela or an associated condition, such as ARDS (Acute Respiratory Distress Syndrome). In some embodiments, the compounds and compositions described herein target SARS-CoV-2 by binding a target SARS-CoV-2 sequence. In some embodiments, the compounds and compositions described herein target SARS-CoV-2 by covalently modifying a target SARS-CoV-2 sequence. In some embodiments, the compositions described herein target SARS-CoV-2 by binding and covalently modifying a target SARS-CoV-2 sequence.

[0289] In one aspect the disclosure provides compounds, compositions and methods for the treatment of a SARS-CoV-2 infection. In one aspect the disclosure provides compounds, compositions and methods for the treatment of CO VID-19. In some embodiments, the compounds and compositions include an RNA-binding small molecule (referred to herein as “rSM”) and pharmaceutically acceptable salts, solvates, and hydrates thereof, which are useful in modulating expression and function of one or more coronavirus RNA transcripts, e.g., SARS-CoV-2, such as those described herein. In some embodiments, a compound for the treatment of SARS-CoV-2 infection is an rSM. In some embodiments, the compounds and compositions that include an rSM do not include a Warhead. In some embodiments, the compounds and compositions described herein that include an rSM and that do not include a Warhead, target SARS-CoV-2 by binding a target SARS-CoV-2 RNA sequence. In some embodiments, the compounds and compositions described herein that include an rSM and that do not include a warhead, target SARS-CoV-2 by binding a target SARS-CoV-2 RNA sequence but do not covalently modify the target RNA sequence. In some embodiments, the compounds and compositions described herein that include an rSM and that do not include a warhead, target SARS-CoV-2 by binding a target SARS-CoV-2 RNA sequence thereby suppressing the function of the target RNA.

[0290] SARS-CoV-2 is an enveloped positive-strand RNA virus of the coronavirus family. Coronaviruses have the largest viral genomes known to date (ranging from 26 to 32 kB); SARS- CoV-2 has a genome of ~30 kB). Most of the biophysical and structural studies being conducted on coronaviruses focus on the viral proteins, such as the virion constituents and components of the replication-transcription machinery. However, RNA motifs within positive strand RNA viruses guide many processes that are critical for the virus life cycle. SARS-CoV-2 is unlikely to be an exception to this rule, particularly given that it has the most elaborately structured RNA genomethat has ever been reported to date, and many of its structures are found across coronavirus families. The vast genome of SARS-CoV-2 and its complex transcriptome present new challenges to RNA science, immunology, and medicine, but also opportunities to selectively inhibit viral reproduction in the host.

[0291] In some embodiments, the compounds and compositions provided herein target an RNA sequence of a viral genome. In some embodiments, the compounds and compositions provided herein target a SARS-CoV-2 RNA sequence. In some embodiments, the compounds and compositions provided herein target a “target viral RNA transcript” or a “SARS-CoV-2 RNA transcript”. The term “target viral RNA transcript” or the more specific term “SARS-CoV-2 RNA transcript” includes any RNA transcript or portion or mutant thereof that is transcribed from a coronavirus (or, more specifically, the SARS-CoV-2 genome). The term includes both coding and non-coding regions, and includes unspliced isoforms, splicing intermediates, isoforms, fragments, and mutants of RNA transcripts from a coronavirus genome (or SARS-CoV-2 genome). In some embodiments, the target viral RNA transcript includes a 5’UTR. In some embodiments, the target viral RNA transcript includes the 5’UTR of SARS-CoV-2. In some embodiments, the target viral RNA transcript includes Stem Loop 5 (SL5) of the 5’UTR of SARS-CoV-2. The SL5 region of the 5’UTR of SARS-CoV-2 is described for instance in Miao et al., RNA Biology 18: 447-456, 2021). In some embodiments, the target viral RNA transcript includes AST-625 (SEQ ID NO: 1). AST-625 = SEQ ID NO: 1GGGAUGGAGAGCCUUGUCCCUGUUCGCAGGACACGAGUAACUCGUCUAUCCC.

[0292] In some embodiments, the compounds and compositions provided herein target a SARS-CoV-2 RNA sequence. In some embodiments, the SARS-CoV-2 RNA sequence includes a 5’UTR. In some embodiments, the SARS-CoV-2 RNA sequence includes Stem Loop 5. In some embodiments, the SARS-CoV-2 RNA sequence includes AST-625 (SEQ ID NO: 1).

[0293] In some embodiments, the compounds and compositions provided herein bind a SARS- CoV-2 RNA sequence. In some embodiments, the SARS-CoV-2 RNA sequence includes a 5’UTR. In some embodiments, the SARS-CoV-2 RNA sequence includes Stem Loop 5. In some embodiments, the SARS-CoV-2 RNA sequence includes AST-625 (SEQ ID NO: 1).

[0294] In some embodiments, the compounds and compositions provided herein bind a SARS- CoV-2 RNA sequence. In some embodiments, the SARS-CoV-2 RNA sequence includes a 5’UTR. In some embodiments, the SARS-CoV-2 RNA sequence includes Stem Loop 5. Insome embodiments, the SARS-CoV-2 RNA sequence includes AST-625 (SEQ ID NO: 1). In some embodiments, the compounds and compositions that bind a SARS-CoV-2 RNA sequence do not include a Warhead and do not covalently modify the target RNA.

[0295] In some embodiments, the compounds and compositions provided herein covalently modify a SARS-CoV-2 RNA sequence. In some embodiments, the SARS-CoV-2 RNA sequence includes a 5’UTR. In some embodiments, the SARS-CoV-2 RNA sequence includes Stem Loop 5. In some embodiments, the SARS-CoV-2 RNA sequence includes AST-625 (SEQ ID NO: 1).

[0296] In one aspect, the present invention provides a method of modulating the activity of a target viral RNA transcript (e.g., SARS-CoV-2) or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, including contacting the RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, with a compound or composition provided herein or a pharmaceutically acceptable salt thereof.

[0297] In one aspect, the present invention provides a method of modulating the activity of a target viral RNA transcript (e.g., SARS-CoV-2) or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, including contacting the RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, with a compound or composition provided herein or a pharmaceutically acceptable salt thereof, wherein the compound or composition that binds to the RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof does not include a Warhead.

[0298] In one aspect, the present invention provides a method of modulating the activity of a target viral RNA transcript (e.g., SARS-CoV-2) or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, including contacting the RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof with an compounds or composition, or a pharmaceutically acceptable salt thereof that binds to the RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof.

[0299] In another aspect, the present invention provides a method of modulating the activity (e.g., expression level) of a viral protein or mutant thereof, including contacting a corresponding viral RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, with a compound or composition provided herein or a pharmaceutically acceptable salt thereof that binds to the viral RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof.

[0300] In another aspect, the present invention provides a method of modulating the activity (e.g., expression level) of a viral protein or mutant thereof, including contacting a corresponding viral RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, with a compound or composition provided herein or a pharmaceutically acceptable salt thereof, wherein the compound or composition does not include a warhead, that binds to the viral RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof.

[0301] In another aspect, the present invention provides a method of modulating the activity (e.g., expression level) of a viral protein or mutant thereof, including contacting a corresponding viral RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, with a compound or composition provided herein or a pharmaceutically acceptable salt thereof that covalently modifies the viral RNA transcript or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof.

[0302] In another aspect, the present invention provides a method of treating a viral infection in a subject, including administering to the subject an effective amount of a compound or composition described herein, or a pharmaceutically acceptable salt thereof.

[0303] In another aspect, the present invention provides a method of treating a viral infection in a subject, including administering to the subject an effective amount of a compound or composition described herein, or a pharmaceutically acceptable salt thereof, wherein the compound or composition does not have a warhead.

[0304] In some embodiments, the viral infection is a coronavirus infection. In some embodiments, the coronavirus is SARS-CoV-2. In some embodiments, the subject is asymptomatic or is at an early stage of the infection. In some embodiments, the subject is symptomatic. In some embodiments, the subject has multi-organ failure or ARDS.

[0305] In another aspect, the present invention provides a method of inhibiting replication of a virus in a subject, including administering to the subject an effective amount of a compound or composition described herein, or a pharmaceutically acceptable salt thereof.

[0306] In another aspect, the present invention provides a method of inhibiting replication of a virus in a subject, including administering to the subject an effective amount of a compound or composition described herein, or a pharmaceutically acceptable salt thereof, wherein the compound or composition does not have a warhead.

[0307] In some embodiments, the vims is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2. In some embodiments, the subject is asymptomatic or is at an early stage of the infection. In some embodiments, the subject is symptomatic. In some embodiments, the subject has multi-organ failure or ARDS.

[0308] In some embodiments, translation of the target RNA transcript is inhibited. In some embodiments, the target RNA transcript contains multiple reading frames. In some embodiments, administration of the compounds or compositions provided herein suppresses the ability of a ribosome to read one or more of the reading frames. In some embodiments, administration of the compounds or compositions provided herein suppresses production of a protein encoded by the targeted RNA transcript.

[0309] In some embodiments, the target RNA transcript is an unspliced isoform, splicing intermediate, pre-mRNA, mature mRNA, or partially processed mRNA. In some embodiments, the target RNA transcript is a mature mRNA.

[0310] In some embodiments, the target RNA transcript includes a 5' untranslated region (UTR) of the mRNA. In some embodiments, the target RNA transcript includes Stem Loop 5. In some embodiments, the target RNA transcript includes an open reading frame (ORF) of the mRNA. In some embodiments, the target RNA transcript includes a 5' cap. In some embodiments, the target RNA transcript includes a 3' polyA tail (polyadenylated tail).

[0311] In some embodiments, the compounds or compositions provided herein covalently modify the target RNA transcript (e.g., SARS-CoV-2), or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, under biological conditions. In some embodiments, the compositions or compounds provided herein bind to the target RNA transcript (e.g., SARS-CoV-2), or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, with a Kd of 1 pM, 500 nM, 100 nM, 50 nM, 10 nM, 1 nM, 500 pM, 10 pM, or 1 pM or lower affinity under biological conditions. In some embodiments, the compositions or compounds provided herein bind to the target RNA transcript, or an unspliced isoform, splicing intermediate, isoform, fragment, or mutant thereof, with a Kd of 0.1 nm to 500 nm, 10 nm to 250 nm, 0.001-25 pM, 0.01-25 pM, 0.1-25 pM, 0.1-15 pM, 0.01-10 pM, 0.001-1 pM, 0.001-0.1 pM, or 0.001-0.01 pM. In some embodiments, the compounds and compositions that bind the target RNA do not include a warhead.

[0312] In some embodiments, the target RNA transcript has at least 70%, 80%, 90%, 95%, or 99% sequence homology with SEQ ID NO: 1.

[0313] In some embodiments, the target RNA transcript includes at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the contiguous nucleotide sequence of SEQ ID NO: 1.

[0314] In some embodiments, the target RNA transcript includes at least 10, 20, 30, 40, 50, 60, 70, or 80 contiguous nucleotides of the sequence of SEQ ID NO: 1.Uses, Formulation and AdministrationPharmaceutically acceptable compositions

[0315] In some embodiments, the invention provides compositions including a compound described herein or a pharmaceutically acceptable derivative thereof and a pharmaceutically acceptable carrier, adjuvant, or vehicle. The amount of compound in compositions of this invention is such that is effective to measurably suppress the functionality of a protein, lower the expression level of a protein, and / or modulate an RNA sequence to treat a disease, disorder, or condition.

[0316] In certain embodiments, the amount of compound in compositions of this invention is such that it is effective to measurably suppress the functionality of a SARS-CoV-2 protein, lower the expression level of a SARS-CoV-2 protein, and / or modulate a SARS-CoV-2 RNA sequence, in a biological sample or in a patient. In certain embodiments, a composition of this invention is formulated for administration to a patient in need of such composition. In some embodiments, a composition of this invention is formulated for oral administration to a patient.

[0317] The term “patient” or “subject,” as used herein, means an animal, such as a mammal, and, for example, a human.

[0318] The term “pharmaceutically acceptable carrier, adjuvant, or vehicle” refers to a nontoxic carrier, adjuvant, or vehicle that does not destroy the pharmacological activity of the compound with which it is formulated. Pharmaceutically acceptable carriers, adjuvants or vehicles that may be used in the compositions of this invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, di sodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts,colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene- polyoxypropylene-block polymers, polyethylene glycol and wool fat.

[0319] A “pharmaceutically acceptable derivative” means any non-toxic salt, ester, salt of an ester or other derivative of a compound of this invention that, upon administration to a recipient, is capable of providing, either directly or indirectly, a compound of this invention or an inhibitory active metabolite or residue thereof.

[0320] Compositions of the present invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. The term “parenteral” as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, intraperitoneally or intravenously. Sterile injectable forms of the compositions of this invention may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium.

[0321] For this purpose, any bland fixed oil may be employed including synthetic mono- or di -glycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant, such as carboxymethyl cellulose or similar dispersing agents that are commonly used in the formulation of pharmaceutically acceptable dosage forms including emulsions and suspensions. Other commonly used surfactants, such as Tweens, Spans and other emulsifying agents or bioavailability enhancers which are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for the purposes of formulation.

[0322] Pharmaceutically acceptable compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions. In the case of tablets for oral use, carriers commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried cornstarch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added.

[0323] Alternatively, pharmaceutically acceptable compositions of this invention may be administered in the form of suppositories for rectal administration. These can be prepared by mixing the agent with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature and therefore will melt in the rectum to release the drug. Such materials include cocoa butter, beeswax and polyethylene glycols.

[0324] Pharmaceutically acceptable compositions of this invention may also be administered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

[0325] Topical application for the lower intestinal tract can be effected in a rectal suppository formulation (see above) or in a suitable enema formulation. Topically transdermal patches may also be used.

[0326] For topical applications, provided pharmaceutically acceptable compositions may be formulated in a suitable ointment containing the active component suspended or dissolved in one or more carriers. Carriers for topical administration of compounds of this invention include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compound, emulsifying wax and water. Alternatively, provided pharmaceutically acceptable compositions can be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

[0327] For ophthalmic use, provided pharmaceutically acceptable compositions may be formulated as micronized suspensions in isotonic, pH adjusted sterile saline, or, preferably, as solutions in isotonic, pH adjusted sterile saline, either with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic uses, the pharmaceutically acceptable compositions may be formulated in an ointment such as petrolatum.

[0328] Pharmaceutically acceptable compositions of this invention may also be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well- known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and / or other conventional solubilizing or dispersing agents.

[0329] Most preferably, pharmaceutically acceptable compositions of this invention are formulated for oral administration. Such formulations may be administered with or without food. In some embodiments, pharmaceutically acceptable compositions of this invention are administered without food. In other embodiments, pharmaceutically acceptable compositions of this invention are administered with food.

[0330] The amount of any of the compounds of the present invention that may be combined with the carrier materials to produce a composition in a single dosage form will vary depending upon the host treated, the particular mode of administration. Preferably, provided compositions should be formulated so that a dosage of between 0.01 - 100 mg / kg body weight / day of the inhibitor can be administered to a patient receiving these compositions.

[0331] It should also be understood that a specific dosage and treatment regimen for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, rate of excretion, drug combination, and the judgment of the treating physician and the severity of the particular disease being treated. The amount of a compound of the present invention in the composition will also depend upon the particular compound in the composition.Uses of Compounds and Pharmaceutically Acceptable Compositions

[0332] Compounds and compositions described herein are generally useful to treat a disease, disorder, or condition, including a viral infection.

[0333] As used herein, the terms “treatment,” “treat,” and “treating” refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.

[0334] As described below, the present invention also provides methods for the treatment or prevention of a variety of diseases, including an infectious disease (e.g., a viral disease) in a subject. Such methods comprise the step of administering to the subject in need thereof an effective amount of a disclosed compound, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer, or a pharmaceutical composition thereof.

[0335] In certain embodiments, the subject being treated is a mammal. In certain embodiments, the subject is a human. In certain embodiments, the subject is a domesticated animal, such as a dog, cat, cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a companion animal such as a dog or cat. In certain embodiments, the subject is a livestock animal such as a cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a zoo animal. In another embodiment, the subject is a research animal such as a rodent, dog, or non-human primate. In certain embodiments, the subject is a non-human transgenic animal such as a transgenic mouse or transgenic pig.

[0336] In one aspect, the compounds and compositions described herein are generally useful for the modulation of a target RNA to treat an RNA-mediated disease or condition. In one aspect, the compounds and compositions described herein are generally useful for the modulation of a target RNA to treat a disease characterized by aberrant protein expression.

[0337] The activity of a compound utilized in this invention to modulate a target RNA may be assayed in vitro, in vivo or in a cell line. In vitro assays include assays that determine modulation of the target RNA. Alternate in vitro assays quantitate the ability of the compound to bind to the target RNA. Detailed conditions for assaying a compound utilized in this invention to modulate a target RNA are set forth in the Examples below.

[0338] Provided compounds are modulators of a target RNA and are therefore useful for treating one or more disorders associated with or affected by (e.g., downstream of) the target RNA. Thus, in certain embodiments, the present invention provides a method for treating an RNA- mediated disorder comprising the step of administering to a patient in need thereof a compound of the present invention, or pharmaceutically acceptable composition thereof.

[0339] As used herein, the terms “RNA-mediated” disorders, diseases, and / or conditions as used herein means any disease or other deleterious condition in which RNA, such as an overexpressed, underexpressed, mutant, misfolded, pathogenic, viral, or oncogenic RNA, is known to play a role. Accordingly, another embodiment of the present invention relates to treating or lessening the severity of one or more diseases in which RNA, such as an overexpressed, underexpressed, mutant, misfolded, pathogenic, viral or oncogenic RNA, is known to play a role.

[0340] In one aspect, the present invention relates to treating or lessening the severity of one or more diseases by targeting an RNA of which the corresponding protein is overexpressed, underexpressed, mutated, misfolded, pathogenic, viral or oncogenic.

[0341] In some embodiments, the present invention provides a method for treating one or more disorders, diseases, and / or conditions wherein the disorder, disease, or condition includes, but is not limited to, a cellular proliferative disorder, inflammatory disorder, metabolic disease or infectious disease.Cellular Proliferative Disorders

[0342] The present invention features methods and compositions for the diagnosis and prognosis of cellular proliferative disorders (e.g., cancer) and the treatment of these disorders by modulating a target RNA. Cellular proliferative disorders described herein include, e.g., cancer, obesity, and proliferation-dependent diseases. Such disorders may be diagnosed using methods known in the art. In some embodiments the cellular proliferative disease is cancer. Cancer includes, in one embodiment, without limitation, leukemias (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease or non-Hodgkin's disease), Waldenstrom's macroglobulinemia, multiple myeloma, heavy chain disease, and solid tumors such as sarcomasand carcinomas (e g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing’s tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma). In some embodiments, the cancer is melanoma or breast cancer.

[0343] Cancers includes, in another embodiment, without limitation, mesothelioma, hepatobilliary (hepatic and billiary duct), bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, ovarian cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, gastrointestinal (gastric, colorectal, and duodenal), uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin’s Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, prostate cancer, testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, lymphocytic lymphomas, cancer of the bladder, cancer of the kidney or ureter, renal cell carcinoma, carcinoma of the renal pelvis, non-Hodgkins’ s lymphoma, spinal axis tumors, brain stem glioma, pituitary adenoma, adrenocortical cancer, gall bladder cancer, multiple myeloma, cholangiocarcinoma, fibrosarcoma, neuroblastoma, retinoblastoma, or a combination of one or more of the foregoing cancers.

[0344] In some embodiments, the present invention provides a method for treating a tumor in a patient in need thereof, including administering to the patient any of the compounds, salts or pharmaceutical compositions described herein. In some embodiments, the tumor includes any of the cancers described herein. In some embodiments, the tumor is a melanoma cancer. In someembodiments, the tumor is breast cancer. In some embodiments, the tumor is lung cancer. In some embodiments the tumor is small cell lung cancer (SCLC). In some embodiments the tumor is non-small cell lung cancer (NSCLC).

[0345] In some embodiments, the tumor is treated by arresting further growth of the tumor. In some embodiments, the tumor is treated by reducing the size (e.g., volume or mass) of the tumor by at least 5%, 10%, 25%, 50 %, 75%, 90% or 99% relative to the size of the tumor prior to treatment. In some embodiments, tumors are treated by reducing the quantity of the tumors in the patient by at least 5%, 10%, 25%, 50 %, 75%, 90% or 99% relative to the quantity of tumors prior to treatment.Other Proliferative Diseases

[0346] Other proliferative diseases include obesity, benign prostatic hyperplasia, psoriasis, abnormal keratinization, lymphoproliferative disorders (e.g., a disorder in which there is abnormal proliferation of cells of the lymphatic system), chronic rheumatoid arthritis, arteriosclerosis, restenosis, and diabetic retinopathy. Proliferative diseases that are hereby incorporated by reference include those described in U.S. Pat. Nos. 5,639,600 and 7,087,648.Inflammatory Disorders and Diseases

[0347] Compounds of the invention are also useful in the treatment of inflammatory or allergic conditions of the skin, for example psoriasis, contact dermatitis, atopic dermatitis, alopecia areata, erythema multiforma, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, lupus erythematosus, systemic lupus erythematosus, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, epidermolysis bullosa acquisita, acne vulgaris, and other inflammatory or allergic conditions of the skin.

[0348] Compounds of the invention may also be used for the treatment of other diseases or conditions, such as diseases or conditions having an inflammatory component, for example, treatment of diseases and conditions of the eye such as ocular allergy, conjunctivitis, keratoconjunctivitis sicca, and vernal conjunctivitis, diseases affecting the nose including allergic rhinitis, and inflammatory disease in which autoimmune reactions are implicated or having an autoimmune component or etiology, including autoimmune hematological disorders (e.g. hemolytic anemia, aplastic anemia, pure red cell anemia and idiopathic thrombocytopenia),systemic lupus erythematosus, rheumatoid arthritis, polychondritis, scleroderma, Wegener granulamatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, Steven -Johnson syndrome, idiopathic sprue, autoimmune inflammatory bowel disease (e.g. ulcerative colitis and Crohn’s disease), irritable bowel syndrome, celiac disease, periodontitis, hyaline membrane disease, kidney disease, glomerular disease, alcoholic liver disease, multiple sclerosis, endocrine opthalmopathy, Grave’s disease, sarcoidosis, alveolitis, chronic hypersensitivity pneumonitis, multiple sclerosis, primary biliary cirrhosis, uveitis (anterior and posterior), Sjogren’s syndrome, keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial lung fibrosis, psoriatic arthritis, systemic juvenile idiopathic arthritis, cryopyrin-associated periodic syndrome, nephritis, vasculitis, diverticulitis, interstitial cystitis, glomerulonephritis (with and without nephrotic syndrome, e.g. including idiopathic nephrotic syndrome or minal change nephropathy), chronic granulomatous disease, endometriosis, leptospiriosis renal disease, glaucoma, retinal disease, ageing, headache, pain, complex regional pain syndrome, cardiac hypertrophy, musclewasting, catabolic disorders, obesity, fetal growth retardation, hyperchlolesterolemia, heart disease, chronic heart failure, mesothelioma, anhidrotic ecodermal dysplasia, Behcet’s disease, incontinentia pigmenti, Paget’s disease, pancreatitis, hereditary periodic fever syndrome, asthma (allergic and non-allergic, mild, moderate, severe, bronchitic, and exercise-induced), acute lung injury, acute respiratory distress syndrome, eosinophilia, hypersensitivities, anaphylaxis, nasal sinusitis, ocular allergy, silica induced diseases, COPD (reduction of damage, airways inflammation, bronchial hyperreactivity, remodeling or disease progression), pulmonary disease, cystic fibrosis, acid- induced lung injury, pulmonary hypertension, polyneuropathy, cataracts, muscle inflammation in conjunction with systemic sclerosis, inclusion body myositis, myasthenia gravis, thyroiditis, Addison’s disease, lichen planus, Type 1 diabetes, or Type 2 diabetes, appendicitis, atopic dermatitis, asthma, allergy, blepharitis, bronchiolitis, bronchitis, bursitis, cervicitis, cholangitis, cholecystitis, chronic graft rejection, colitis, conjunctivitis, Crohn’s disease, cystitis, dacryoadenitis, dermatitis, dermatomyositis, encephalitis, endocarditis, endometritis, enteritis, enterocolitis, epicondylitis, epididymitis, fasciitis, fibrositis, gastritis, gastroenteritis, Henoch- Schonlein purpura, hepatitis, hi dradenitis suppurativa, immunoglobulin A nephropathy, interstitial lung disease, laryngitis, mastitis, meningitis, myelitis myocarditis, myositis, nephritis, oophoritis, orchitis, osteitis, otitis, pancreatitis, parotitis, pericarditis, peritonitis, pharyngitis, pleuritis, phlebitis, pneumonitis, pneumonia, polymyositis, proctitis, prostatitis, pyelonephritis, rhinitis,salpingitis, sinusitis, stomatitis, synovitis, tendonitis, tonsillitis, ulcerative colitis, uveitis, vaginitis, vasculitis, or vulvitis.

[0349] In some embodiments the inflammatory disease which can be treated according to the methods of this invention is a disease of the skin. In some embodiments, the inflammatory disease of the skin is selected from contact dermatitits, atompic dermatitis, alopecia areata, erythema multiforma, dermatitis herpetiformis, scleroderma, vitiligo, hypersensitivity angiitis, urticaria, bullous pemphigoid, pemphigus vulgaris, pemphigus foliaceus, paraneoplastic pemphigus, epidermolysis bullosa acquisita, and other inflammatory or allergic conditions of the skin.

[0350] In some embodiments the inflammatory disease which can be treated according to the methods of this invention is selected from acute and chronic gout, chronic gouty arthritis, psoriasis, psoriatic arthritis, rheumatoid arthritis, Juvenile rheumatoid arthritis, Systemic jubenile idiopathic arthritis (SJIA), Cryopyrin Associated Periodic Syndrome (CAPS), and osteoarthritis.

[0351] In some embodiments the inflammatory disease which can be treated according to the methods of this invention is a TH 17 mediated disease. In some embodiments the TH17 mediated disease is selected from Systemic lupus erythematosus, Multiple sclerosis, and inflammatory bowel disease (including Crohn’s disease or ulcerative colitis).

[0352] In some embodiments the inflammatory disease which can be treated according to the methods of this invention is selected from Sjogren’s syndrome, allergic disorders, osteoarthritis, conditions of the eye such as ocular allergy, conjunctivitis, keratoconjunctivitis sicca and vernal conjunctivitis, and diseases affecting the nose such as allergic rhinitis.Metabolic Disease

[0353] In some embodiments the invention provides a method of treating a metabolic disease. In some embodiments the metabolic disease is selected from Type 1 diabetes, Type 2 diabetes, metabolic syndrome or obesity.Infectious disease

[0354] In some embodiments, the present invention provides methods for treating and / or preventing an infectious disease (e.g., a viral infection). In some embodiments, the infectious disease is a viral infection. In some embodiments, the viral infection is an infection by a coronavirus. In some embodiments, the viral infection is an infection by SARS-CoV-2.

[0355] In some embodiments, the viral infection is an infection by a coronavirus, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, hepatitis E virus, cytomegalovirus, dengue virus, yellow fever virus, Zika virus, influenza virus, respiratory syncytial virus (RSV), norovirus, herpesvirus, rotavirus, astrovirus, adenovirus, human papillomavirus (HPV), human immunodeficiency virus (HIV), Ebola virus, human T-lymphotropic virus (HTLV)-l and -2, Epstein-Barr virus, Lassa virus, Marburg virus, West Nile virus, or Crimean-Congo hemorrhagic fever virus.

[0356] In some embodiments, the viral infection is an infection by measles, mumps, rubella, echovirus, coxsackievirus, rubeola, chickenpox / shingles, roseola, smallpox, fifth disease, or chikungunya virus infection. In some embodiments, the viral infection is viral meningitis, viral encephalitis, or rabies.

[0357] In some embodiments, the viral infection is an infection by a respiratory virus. Respiratory viruses include the epidemic influenza viruses (A and B), H5N1 and H7N9 avian influenza A viruses, parainfluenza viruses 1 through 4, adenoviruses, respiratory syncytial virus A and B and human metapneumovirus, rhinoviruses, and coronaviruses. Several coronaviruses cause a respiratory infection that can be severe. In 2002 and 2003, an outbreak of severe acute respiratory syndrome (SARS) caused a number of deaths mostly in China and Hong Kong. There have been no cases of SARS reported since 2004. In 2012, a novel coronavirus Middle East respiratory syndrome coronavirus (MERS-CoV) appeared in Saudi Arabia; it can cause severe acute respiratory illness and is often fatal (case fatality rate of 34%). In 2019, another coronavirus (SARS-CoV2) that can cause an acute, sometimes fatal respiratory illness (COVID-19) emerged in Wuhan, China and spread in a worldwide pandemic that has killed millions of people.

[0358] In some embodiments, the viral infection is caused by a coronavirus. In some embodiments, the coronavirus is an alpha, beta, gamma, or delta coronavirus. In some embodiments, the coronavirus is one associated with severe respiratory symptoms such as SARS.

[0359] In some embodiments, the viral infection is caused by a coronavirus, wherein the coronavirus is 229E (alpha coronavirus), NL63 (alpha coronavirus), OC43 (beta coronavirus), HKU1 (beta coronavirus), MERS-CoV (the beta coronavirus that causes Middle East Respiratory Syndrome, or MERS), SARS-CoV (the beta coronavirus that causes severe acute respiratory syndrome, or SARS), or SARS-CoV-2 (coronavirus disease 2019, or COVID-19).

[0360] In some embodiments, the viral infection is caused by SARS-CoV-2.

[0361] In some embodiments, the viral infection is caused by an influenza virus.

[0362] In some embodiments, the viral infection is caused by an influenza virus, wherein the viral infection is selected from influenza type A and influenza type B. In some embodiments, the influenza virus is B / Yamagata or B / Victoria.

[0363] In some embodiments, the viral infection is caused by an influenza virus selected from H5N1, H1N1 and H3N2.

[0364] In some embodiments, the viral infection is caused by a Zika virus.

[0365] In some embodiments, the viral infection is by an influenza virus.

[0366] In some embodiments, the influenza virus is influenza type A or influenza type B.

[0367] In some embodiments, the influenza virus is B / Yamagata or B / Victoria.

[0368] In some embodiments, the influenza virus is H5N1, H1N1 or H3N2.

[0369] The term “biological sample” refers to any sample including tissue samples (such as tissue sections and needle biopsies of a tissue); cell samples (e.g., cytological smears (such as Pap or blood smears) or samples of cells obtained by microdissection); samples of whole organisms (such as samples of yeasts or bacteria); or cell fractions, fragments or organelles (such as obtained by lysing cells and separating the components thereof by centrifugation or otherwise). Other examples of biological samples include blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucus, tears, sweat, pus, biopsied tissue (e.g., obtained by a surgical biopsy or needle biopsy), nipple aspirates, milk, vaginal fluid, saliva, swabs (such as buccal swabs), or any material containing biomolecules that is derived from a first biological sample. Biological samples also include those biological samples that are transgenic, such as transgenic oocyte, sperm cell, blastocyst, embryo, fetus, donor cell, or cell nucleus.

[0370] As used herein, the term “responsiveness” is interchangeable with terms “responsive,” “sensitive,” and “sensitivity,” and it is meant that a subject is showing a therapeutic response when administered a composition of the disclosure, e.g., treatment of a viral infection. In some embodiments, a “response” also means that a subject will have or has a higher probability, relative to the population at large, of showing therapeutic responses when administered a disclosed compound.

[0371] In some embodiments, the compounds provided herein modulate the activity of a target. In some embodiments, modulating a target is suppressing the functionality of a protein, lowering the expression level of a protein, and / or modulating an RNA sequence to treat a disease, disorder,or condition. In some embodiments, a compound of the present disclosure, or a pharmaceutically acceptable salt or solvate or hydrate thereof, modulates the activity of a target if it stimulates or inhibits the activity of the target by at least 2-fold relative to the activity of the target under the same conditions but lacking only the presence of the compound. In some embodiments, a compound of the present disclosure, or a pharmaceutically acceptable salt or solvate thereof, modulates the activity of a target if it stimulates or inhibits the activity of the target by at least 5- fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold relative to the activity of the target under the same conditions but lacking only the presence of the compound. The activity of a target may be measured by any reproducible means. The activity of a target may be measured in vitro or in vivo, by methods such as those described herein.

[0372] One skilled in the art may refer to general reference texts for detailed descriptions of known techniques discussed herein or equivalent techniques. These texts include Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (2005); Sambrook et al., Molecular Cloning, A Laboratory Manual (3rd edition), Cold Spring Harbor Press, Cold Spring Harbor, New York (2000); Coligan et al., Current Protocols in Immunology, John Wiley & Sons, N.Y.; Enna et al., Current Protocols in Pharmacology, John Wiley & Sons, N.Y.; Fingl et al., The Pharmacological Basis of Therapeutics (1975), and Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 18th edition (1990); each of which is hereby incorporated by reference in its entirety. These texts can, of course, also be referred to in making or using an aspect of the disclosure.Combination Therapies

[0373] The disclosure also provides pharmaceutical compositions including a compound of the disclosure or pharmaceutically acceptable salts thereof, and one or more other therapeutic agents disclosed herein, mixed with pharmaceutically suitable carriers or excipient(s) at doses to treat or prevent a disease or condition as described herein. The pharmaceutical compositions of the disclosure can also be administered in combination with other therapeutic agents or therapeutic modalities simultaneously, sequentially, or in alternation.

[0374] Mixtures of compositions of the disclosure can also be administered to the patient as a simple mixture or in suitable formulated pharmaceutical compositions. For example, some aspects of the disclosure relate to a pharmaceutical composition including a therapeutically effective doseof a compound of the disclosure, or a pharmaceutically acceptable salt, hydrate, enantiomer or stereoisomer thereof; one or more other therapeutic agents, and a pharmaceutically acceptable diluent or carrier.

[0375] A “pharmaceutical composition” is a formulation containing the compounds of the disclosure in a form suitable for administration to a subject. A compound of the disclosure and one or more other therapeutic agents described herein each can be formulated individually or in multiple pharmaceutical compositions in any combinations of the active ingredients.

[0376] Accordingly, one or more administration routes can be properly elected based on the dosage form of each pharmaceutical composition. Alternatively, a compound of the disclosure and one or more other therapeutic agents described herein can be formulated as one pharmaceutical composition.

[0377] In some embodiments, the pharmaceutical composition is in bulk or in unit dosage form. The unit dosage form is any of a variety of forms, including, for example, a capsule, an IV bag, a tablet, a single pump on an aerosol inhaler or a vial. The quantity of active ingredient (e.g., a formulation of the disclosed compound or salt, hydrate, solvate or isomer thereof) in a unit dose of composition is an effective amount and is varied according to the particular treatment involved. One skilled in the art will appreciate that it is sometimes necessary to make routine variations to the dosage depending on the age and condition of the patient. The dosage will also depend on the route of administration. A variety of routes are contemplated, including oral, pulmonary, rectal, parenteral, transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal, inhalational, buccal, sublingual, intrapleural, intrathecal, intranasal, and the like. Dosage forms for the topical or transdermal administration of a compound of this disclosure include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. In some embodiments, the active compound is mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants that are required.

[0378] A pharmaceutical composition of the disclosure is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral e.g., inhalation), transdermal (topical), and transmucosal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or othersynthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates, and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.

[0379] A composition of the disclosure can be administered to a subject in many of the well- known methods currently used for chemotherapeutic treatment. For example, for treatment of cancers, a compound of the disclosure may be injected directly into tumors, injected into the blood stream or body cavities or taken orally or applied through the skin with patches. The dose chosen should be sufficient to constitute effective treatment but not so high as to cause unacceptable side effects. The state of the disease condition (e g., cancer, precancer, and the like) and the health of the patient should preferably be closely monitored during and for a reasonable period after treatment.

[0380] The term “therapeutically effective amount,” as used herein, refers to an amount of a pharmaceutical agent to treat, ameliorate, or prevent an identified disease or condition, or to exhibit a detectable therapeutic or inhibitory effect. The effect can be detected by any assay method known in the art. The precise effective amount for a subject will depend upon the subject's body weight, size, and health; the nature and extent of the condition; and the therapeutic or combination of therapeutics selected for administration. Therapeutically effective amounts for a given situation can be determined by routine experimentation that is within the skill and judgment of the clinician. In some aspects, the disease or condition to be treated is a viral infection. In some aspects, the disease or condition to be treated is a SARS-CoV-2 infection

[0381] In certain embodiments the therapeutically effective amount of each pharmaceutical agent used in combination will be lower when used in combination in comparison to monotherapy with each agent alone. Such lower therapeutically effective amount could afford for lower toxicity of the therapeutic regimen.

[0382] For any compound, the therapeutically effective amount can be estimated initially either in cell culture assays, e.g., of neoplastic cells, or in animal models, usually rats, mice, rabbits, dogs, or pigs. The animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful dosesand routes for administration in humans. Th erapeutic / prophy lactic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50 / ED50. Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The dosage may vary within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

[0383] In one aspect, additional pharmaceutical agent(s) may synergistically therapeutically augment the inventive compounds or compositions of this invention in a subject. In certain embodiments, the additional pharmaceutical agent is an anti-cancer agent, an anti-inflammatory agent on an anti-viral agent.

[0384] In one aspect, pharmaceutical agent(s) may synergistically augment suppression of the functionality of a SARS-CoV-2 protein, lower the expression level of a SARS-CoV-2 protein, and / or the modulate a SARS-CoV-2 RNA sequence, induced by the inventive compounds or compositions of this invention in the biological sample or subject. In some embodiments, one or more pharmaceutical agent(s) may synergistically augment treatment of a SARS-CoV-2 infection by the compositions disclosed herein.

[0385] In certain embodiments, the one or more additional pharmaceutical agent(s) is an antiviral compound. In certain embodiments, the one or more additional pharmaceutical agent(s) is an antiviral agent selected from the group consisting of PTC299, acyclovir, adefoir, amantadine, ampligen, amprevanir, umifenovir, atazanavir, atripla, baloxavir, marboxil, biktarvy, boceprevir, bulevirtide, cidofovir, cobicistat, combivir, caclastavir, darunavir, delavirdine, descovoy, didanosine, docosanol, delaviridine, descovoy, didanosine, docosanol, dolutegravir, doravirine, edoxudine, efarirenz, elvitegravir, emtricitabine, enfuvirtide, entecavir, etravirine, famcilovir, fomivirsen, fosambrenavir, foscamet, ganciclovir, ibacitabine, ibalizumab, idoxuridine, imiquimod, imuvonir, indinavir, lamivudine, letermovir, lopinavir, loviride, maraviroc, methisazone, moroxydine, nelfinavir, maraviroc, methisazone, moroxydine, nelfmavir, nefvirapine, nexavir, nitazozanide, norvir, oseltamivir, penciclovir, peramivir, penciclovir, peramivir, pleconaril, podophyllotoxin, raltegravir, remdesivir, ribavirin, rilpiririne, pipivirine, rimantadine, ritonavir, saquinavir, simeprevir, sofosfuvir, stavudine, taribavirin, telaprevir, telbivudine, tenfovir alafenamide, tenofir disoproxil, tipranavir, trifluridine, trizivir, tromantadine,Truvada, umifenovir, valaciclovir, val anciclovir, vicriviroc, vidarbanine, zalcitabine, zanamivir, and zidovudine. In another aspect the one or more additional pharmaceutical agent(s) is remdesivir or ribavirin. In another aspect the one or more additional pharmaceutical agent(s) is nirmatrelvir or ritonavir.

[0386] It should further be appreciated that compositions provided herein can be administered in conjunction with a vaccination regimen. Thus, the composition can be administered after an individual has received one or more doses of a vaccine, after an individual has received one or more doses of a vaccine, or in between doses. In some embodiments, the vaccination regimen is directed towards protection, suppression of infection, or suppression of severity of SARS-CoV-2. In some embodiments, the vaccine is a SARS-CoV-2 vaccine. In some embodiments, the vaccine is an mRNA SARS-CoV-2 vaccine.Formulations and Routes of Administration

[0387] The compounds and compositions, according to a method of the present invention, may be administered using any amount and any route of administration effective for treating or lessening the severity of a cancer or other disease, disorder, or condition disclosed herein. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the infection, the particular agent, its mode of administration, and the like. Compounds of the invention are preferably formulated in dosage unit form for ease of administration and uniformity of dosage. The expression “unit dosage form” as used herein refers to a physically discrete unit of agent appropriate for the patient to be treated. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific effective dose level for any particular patient or organism will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed, and like factors well known in the medical arts.

[0388] Pharmaceutically acceptable compositions of this invention can be administered to humans and other animals orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as by powders, ointments, or drops), bucally, as an oral or nasal spray, or the like, depending on the severity of the infection being treated. In certain embodiments, the compounds of the invention may be administered orally or parenterally at dosage levels of about 0.01 mg / kg to about 50 mg / kg and preferably from about 1 mg / kg to about 25 mg / kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect.

[0389] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, com, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0390] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.

[0391] Injectable formulations can be sterilized, for example, by filtration through a bacterial- retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0392] In order to prolong the effect of a compound of the present invention, it is often desirable to slow the absorption of the compound from subcutaneous or intramuscular injection.This may be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the compound then depends upon its rate of dissolution that, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered compound form is accomplished by dissolving or suspending the compound in an oil vehicle. Injectable depot forms are made by forming microencapsule matrices of the compound in biodegradable polymers such as polylactidepolyglycolide. Depending upon the ratio of compound to polymer and the nature of the particular polymer employed, the rate of compound release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the compound in liposomes or microemulsions that are compatible with body tissues.

[0393] Compositions for rectal or vaginal administration are preferably suppositories which can be prepared by mixing the compounds of this invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.

[0394] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents.

[0395] Solid compositions of a similar type may also be employed as fdlers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecularweight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polethylene glycols and the like.

[0396] The active compounds can also be in micro-encapsulated form with one or more excipients as noted above. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. In such solid dosage forms the active compound may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

[0397] Dosage forms for topical or transdermal administration of a compound of this invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or patches. The active component is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. Ophthalmic formulation, ear drops, and eye drops are also contemplated as being within the scope of this invention. Additionally, the present invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of a compound to the body. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can becontrolled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.Definitions

[0398] Compounds of the present invention include those described generally herein, and are further illustrated by the classes, subclasses, and species disclosed herein. As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this invention, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd. Additionally, general principles of organic chemistry are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito: 1999, and March ’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7thEdition, John Wiley & Sons: 2013; the entire contents of each of which are hereby incorporated by reference.

[0399] The term “aliphatic” or “aliphatic group,” as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “carbocycle,” “cycloaliphatic” or “cycloalkyl”), that has a single point of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic C3-C6 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

[0400] As used herein, the term “bicyclic ring” or “bicyclic ring system” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated, or having one or more units of unsaturation,having one or more atoms in common between the two rings of the ring system. Thus, the term includes any permissible ring fusion, such as wz / w-fuscd or spirocyclic. As used herein, the term “spirocyclic” refers to organic compounds that contain at least two rings with one common atom, generally a quaternary carbon. Generally, the number of carbon atoms linked to the spiro atom in each ring is indicated in ascending order in brackets placed between the spiro prefix and the hydrocarbon name. For example,can be represented as spiro[4.5]decane.

[0401] As used herein, the term “heterobicyclic” is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfones and sulfonates), phosphorus (including oxidized forms such as phosphates), boron, etc. In some embodiments, a bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, the term “bridged bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated, or partially unsaturated, having at least one bridge. As defined by IUPAC, a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, a bridged bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Such bridged bicyclic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups. Additionally, or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. Exemplary bicyclic rings include:

[0402] Exemplary bridged bicyclics include:

[0403] The term “lower alkyl” refers to a C1-4 straight or branched alkyl group. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0404] The term “lower haloalkyl” refers to a Ci-4 straight or branched alkyl group that is substituted with one or more halogen atoms.

[0405] The term “heteroatom” means one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring, for example N (as in 3,4-dihydro-lff-pyrrolyl), NH (as in pyrrolidinyl) or NR (as in N-substituted pyrrolidinyl)).

[0406] The term “unsaturated,” as used herein, means that a moiety has one or more units of unsaturation.

[0407] As used herein, the term “bivalent Ci-8 (or Ci-e) saturated or unsaturated, straight or branched, hydrocarbon chain,” refers to bivalent alkylene, alkenylene, and alkynylene chains that are straight or branched as defined herein.

[0408] The term “alkylene” refers to a bivalent alkyl group. An “alkylene chain” is a polymethylene group, i.e., -(CH2)n-, wherein n is a positive integer, preferably from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3. A substituted alkylene chain is a polymethylenegroup in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.

[0409] The term “alkenylene” refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.

[0410] The term “halogen” means F, Cl, Br, or I.

[0411] The term “aryl” used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic or bicyclic ring systems having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 7 ring members. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present invention, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like. The term “phenylene” refers to a multivalent phenyl group having the appropriate number of open valences to account for groups attached to it. For example, “phenylene” is a bivalent phenyl grouparyl group.

[0412] The terms “heteroaryl” and “heteroar-,” used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, andpteridinyl. The terms “heteroaryl” and “heteroar- ” as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4 / 7 quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-Z>]-l,4-oxazin-3(4 7)-one. A heteroaryl group may be mono- or bicyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted with a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted.

[0413] The term “heteroarylene” refers to a multivalent heteroaryl group having the appropriate number of open valences to account for groups attached to it. For example, “heteroarylene” is a bivalent heteroaryl group when it has two groups attached to it; “heteroarylene” is a trivalent heteroaryl group when it has three groups attached to it. The term “pyridinylene” refers to a multivalent pyridine radical having the appropriate number of open valences to account for groups attached to it. For example, “pyridinylene” is a bivalent pyridine radical when it has two groups attached to it (e.g.,“pyridinylene” is a trivalent pyridine radical when it has three groups attached t.

[0414] As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring” are used interchangeably and refer to a stable 5- to 7-membered monocyclic or 7-10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term “nitrogen” includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4- dihydro-2 / 7 pyrrolyl), NH (as in pyrrolidinyl), or+NR (as in TV substituted pyrrolidinyl).

[0415] A heterocyclic ring can be atached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothiophenyl pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, 2-oxa-6- azaspiro[3.3]heptane, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be mono- or bicyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted. The term “oxo-heterocyclyl” refers to a heterocyclyl substituted by an oxo group. The term “heterocyclylene” refers to a multivalent heterocyclyl group having the appropriate number of open valences to account for groups attached to it. For example, “heterocyclylene” is a bivalent heterocyclyl group when it has two groups attached to it; “heterocyclylene” is a trivalent heterocyclyl group when it has three groups attached to it.

[0416] As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation but is not intended to include aryl or heteroaryl moieties, as herein defined.

[0417] As described herein, compounds of the invention may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent (“optional substituent”) at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this invention are preferably those that result in the formation of stable or chemically feasible compounds. The term “stable,” as used herein, refers to compoundsthat are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.

[0418] Suitable monovalent substituents on a substitutable carbon atom of an “optionally substituted” group are independently halogen; -(CH2)o4R°; -(CH2)o4OR°; -0(CH2)o-4R°, -O- (CH2)O4C(O)ORO; -(CH2)O4CH(ORO)2; -(CH2)O4SRO; -(CH2)O4Ph, which may be substituted with R°; -(CH2)4 40(CH2)o ,Ph which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)O-40(CH2)O-I -pyridyl which may be substituted with R°; -NO2; -CN; -N3; -(CH2)O-4N(R°)2; -(CH2)O 4N(RO)C(O)R°; -N(R°)C(S)R°; -(CH2)O-4N(RO)C(O)NR°2; -N(RO)C(S)NR°2; -(CH2)O4N(RO)C(O)OR°;N(R°)N(R°)C(O)R°; -N(RO)N(RO)C(O)NRO2; -N(R°)N(R°)C(O)OR°; -(CH2)0 4C(O)R°; - C(S)R°; -(CH2)O4C(O)ORO; -(CH2)O4C(O)SR°; -(CH2)o-4C(0)OSiR°3; -(CH2)o4OC(O)R°; - OC(0)(CH2)O4SR- SC(S)SR°; -(CH2)O4SC(O)RO; -(CI I2)o4C(O)NR&2; -C(S)NRO2; -C(S)SR°; -SC(S)SR°, -(CH2)O4OC(O)NRO2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)RO; - C(NOR°)R°; -(CH2)0 4SSRO; -(CH2)O 4S(O)2RO; -(CH2)O 4S(O)2ORO; -(CH2)O^OS(0)2R°; - S(O)2NR°2; -(CH2)O 4S(O)RO; -N(RO)S(O)2NRO2; -N(RO)S(O)2R°; -N(OR°)R°; -C(NH)NRO2; - P(O)2R°; -P(0)RO2; -OP(O)R°2; -OP(O)(ORO)2; SiR°3; - (Ci^i straight or branched alkylene)O- N(R°)2; or -(Ci^4 straight or branched alkylene)C(O)O-N(R°)2, wherein each R° may be substituted as defined below and is independently hydrogen, C1-6 aliphatic, -CH2Ph, -0(CH2)o iPh, -CH2-(5-6 membered heteroaryl ring), or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, which may be substituted as defined below.

[0419] Suitable monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen, -(CH2)o-2R*, -(haloR*), -(CH2)0 2OH, -(CH2)O 2OR*, -(CH2)O2CH(OR’)2; -O(haloR’), -CN, -N3, -(CH2)02C(O)R’, -(CH2)O 2C(O)OH, -(CH2)O 2C(O)OR*, -(CH2)O2SR’, -(CH2)O 2SH, -(CH2)O2NH2, - (CH2)o-2NHR*, -(CH2)O2NR*2, -NO2, -SiR\ -OSiR*3, -C(O)SR* -(Ci^i straight or branchedalkylene)C(O)OR*, or -SSR* wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently selected from C1-4 aliphatic, - CH2PI1, -0(CH2)o-iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0- 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.

[0420] Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: =0, =S, ~NNR’2, ~NNHC(O)R\ ~NNHC(O)OR’, =NNHS(O)2R*,wherein each independent occurrence of R* is selected from hydrogen, Ci 6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: -O(CR*2)23O-, wherein each independent occurrence of R* is selected from hydrogen, Ci-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0421] Suitable substituents on the aliphatic group of R* include halogen, -R*, -(haloR*), -OH, -OR*, -O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1-4 aliphatic, -CH2Ph, -0(CH2)o iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0422] Suitable substituents on a substitutable nitrogen of an “optionally substituted” group include -Rt, -NRt2, -C(O)Rt, -C(O)ORt, -C(O)C(O)Rt, C(O)CH2C(OM -S(O)2Rt, -S(O)2NRt2, -C(S)NRt2, -C(NH)NRt2, or -N(Rt)S(O)2R^; wherein each R’:is independently hydrogen, C1-6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R1', taken together with their intervening atom(s) form an unsubstituted 3-12-membered saturated, partially unsaturated, or arylmono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0423] Suitable substituents on the aliphatic group of R1' are independently halogen, - R*, -(haloR*), -OH, -OR*, -O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1-4 aliphatic, -CH2Ph, -0(CH2)o-iPh, or a 5-6- membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0424] As used herein, the term “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2- naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like.

[0425] Further, acids which are generally considered suitable for the formation of pharmaceutically useful salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl et al., Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection andUse. (2002) Zurich: Wiley-VCH; S. Berge e1-19; P. Gould, International J. of Pharmaceutics (1986) 33 201-217; Anderson et al., The Practice of Medicinal Chemistry (1996), Academic Press, New York; and in The Orange Book (Food & Drug Administration, Washington, D.C. on their website). These disclosures are incorporated herein by reference.

[0426] Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N+(C i-4alkyl)4 salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, loweralkyl sulfonate and aryl sulfonate.

[0427] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a13C- or14C-enriched carbon are within the scope of this invention. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present invention.

[0428] Compounds containing one or more stereocenters are a mixture of stereoisomers, unless otherwise stated or described (for example, with use of dashed or wedged bonds denoting stereochemistry). Generally, enhanced stereochemical representation introduces three types of identifiers that can be attached to a stereogenic center. A stereochemical group label is composed from an identifier and a group number. Each stereogenic center marked with wedge bonds belongs to one (and only one) stereochemical group. Grouping allows to specify relative relationships among stereogenic centers.

[0429] “R” or “S” without any other notation indicates absolute stereochemistry at the indicated position. “Ror(n)” or “Sor(n)” indicate single stereoisomers of unknown configuration. In these cases, the compound will correspond to either the structure as drawn or its epimer at the indicated position. If a compound has multiple stereocenters, then all such stereocenters with matching indices are epimerized in tandem (i.e. multiple “Rorl” annotations indicate known relative stereochemistry). For example, if a compound has two stereocenters annotated as “Rorl” and “Sori,” then the compound is a single stereoisomer that corresponds to either the R,S or S,R isomer. “Rand(n)” or “Sand(n)” indicate mixtures of epimers at the indicated position. If a compound has multiple such annotations with matching indices (e.g. “Randi” and “Sandl”), this corresponds to a mixture of compounds with known relative stereochemistry at the indicated positions. Compounds that possess stereocenters but are drawn with “flat” bonds only do not have associated stereochemical data. Such compounds may be single compounds or mixtures of stereoisomers.

[0430] ABS denotes a stereogenic center where the absolute configuration is known. As used herein, “or” denotes a stereogenic center where the relative configuration is known, but the absolute configuration is not known. The structure represents one stereoisomer that is either the structure as drawn (R,S) or the epimer in which the stereogenic centers have the opposite configuration (S,R). One of skill in the art would understand that if a single stereogenic center is present, the designation “or” represents a single isomer for which the absolute configuration is not known. As used herein, “orl”, “or2” denote stereogenic centers where the relative configuration is known, but the absolute configuration is not known when applied to a multi -stereocenter containing compound. The designationsare used interchangeably and denote a mixture of stereoisomers. It can be a pair of enantiomers or all the diastereomers.

[0431] Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods known to those skilled in the art, such as, for example, by chromatography and / or fractional crystallization. Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher’s acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. Alternatively, a particular enantiomer of a compound of the present invention may be prepared by asymmetric synthesis. Still further, wherethe molecule contains a basic functional group (such as amino) or an acidic functional group (such as carboxylic acid) diastereomeric salts are formed with an appropriate optically-active acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic means known in the art, and subsequent recovery of the pure enantiomers.

[0432] Individual stereoisomers of the compounds of the invention may, for example, be substantially free of other isomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers. Chiral center(s) in a compound of the present invention can have the S or R configuration as defined by the IUPAC 1974 Recommendations. Further, to the extent a compound described herein may exist as an atropisomer (e.g., substituted biaryls), all forms of such atropisomers are considered part of this invention.

[0433] Chemical names, common names, and chemical structures may be used interchangeably to describe the same structure. If a chemical compound is referred to using both a chemical structure and a chemical name, and an ambiguity exists between the structure and the name, the structure predominates. It should also be noted that any carbon as well as heteroatom with unsatisfied valences in the text, schemes, examples, and tables herein is assumed to have the sufficient number of hydrogen atom(s) to satisfy the valences.

[0434] The terms “a” and “an” as used herein mean “one or more” and include the plural unless the context is inappropriate.

[0435] The term “alkyl” refers to a saturated straight or branched hydrocarbon, such as a straight or branched group of 1-12, 1-10, or 1-6 carbon atoms, referred to herein as C1-C12 alkyl, C1-C10 alkyl, and Ci-Ce alkyl, respectively. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2-methyl-l -propyl, 2-methyl-2-propyl, 2-methyl-l -butyl, 3- methyl-1 -butyl, 2-methyl-3-butyl, 2,2-dimethyl-l -propyl, 2-methyl-l -pentyl, 3 -methyl -1 -pentyl, 4-methyl-l -pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-l- butyl, 3,3-dimethyl-l -butyl, 2-ethyl-l -butyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, etc.

[0436] The term “cycloalkyl” refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon group of 3-12, 3-8, 4-8, or 4-6 carbons, referred to herein, e.g., as “C3-C6 cycloalkyl,” derived from a cycloalkane. Exemplary cycloalkyl groups include cyclohexyl, cyclopentyl, cyclobutyl, and cyclopropyl. The term “cycloalkylene” refers to a bivalent cycloalkyl group.

[0437] The term “haloalkyl” refers to an alkyl group that is substituted with at least one halogen. Exemplary haloalkyl groups include -CH2F, -CHF2, -CF3, -CH2CF3, -CF2CF3, and the like. The term “haloalkylene” refers to a bivalent haloalkyl group.

[0438] The term “hydroxyalkyl” refers to an alkyl group that is substituted with at least one hydroxyl. Exemplary hydroxyalkyl groups include -CH2CH2OH, -C(H)(0H)CH3, -CH2C(H)(OH)CH2CH2OH, and the like.

[0439] The terms “alkenyl” and “alkynyl” are art-recognized and refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond, respectively.

[0440] The term “carbocyclylene” refers to a multivalent carbocyclyl group having the appropriate number of open valences to account for groups attached to it. For example, “carbocyclylene” is a bivalent carbocyclyl group when it has two groups attached to it; “carbocyclylene” is a trivalent carbocyclyl group when it has three groups attached to it.

[0441] The terms “alkoxyl” or “alkoxy” are art-recognized and refer to an alkyl group, as defined above, having an oxygen radical attached thereto. Representative alkoxyl groups include methoxy, ethoxy, propyloxy, te / 7-butoxy and the like. The term “haloalkoxyl” refers to an alkoxyl group that is substituted with at least one halogen. Exemplary haloalkoxyl groups include -OCH2F, -OCHF2, -OCF3, -OCH2CF3, -OCF2CF3, and the like. The term “hydroxyalkoxyl” refers to an alkoxyl group that is substituted with at least one hydroxyl. Exemplary hydroxyalkoxyl groups include -OCH2CH2OH, -OCH2C(H)(OH)CH2CH2OH, and the like. The term “alkoxylene” refers to a bivalent alkoxyl group.

[0442] The term “oxo” is art-recognized and refers to a “=O” substituent. For example, a cyclopentane substituted with an oxo group is cyclopentanone.

[0443] The symbol “ ” indicates a point of attachment. The point of attachment can be drawn at the end of the bond in a chemical structure, for example,or at the center of the bond in a chemical structure, for example,

[0444] When a chemical structure containing a ring is depicted with a substituent having a bond that crosses a ring bond, the substituent may be attached at any available position on the ring.r example, the chemical structureRX"Fo N encompassesIn the context of a polycyclic fused ring, when a chemical structure containing a polycyclic fused ring is depicted with one or more substituent(s) having a bond that crosses multiple rings, the one or more substituent(s) may be independently attached to any of the rings crossed by the bond. To illustrate, the chemical structureencompasses, for

[0445] When any substituent or variable occurs more than one time in any constituent or the compound of the invention, its definition on each occurrence is independent of its definition at every other occurrence, unless otherwise indicated.

[0446] One or more compounds of the invention may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms. “Solvate” means a physical association of a compound of this invention with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances, the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. “Solvate” encompasses both solution-phase and isolatable solvates. Non-limiting examples of suitable solvates include ethanolates, methanolates, and the like. “Hydrate” is a solvate wherein the solvent molecule is H2O.

[0447] As used herein, the terms “subject” and “patient” are used interchangeably and refer to organisms to be treated by the methods of the present invention. Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and, most preferably, includes humans.

[0448] The term “IC50” is art-recognized and refers to the concentration of a compound that is required to achieve 50% inhibition of the target. The potency of an inhibitor is usually defined by its IC50 value. The lower the IC50 value the greater the potency of the antagonist and the lower the concentration that is required to inhibit the maximum biological response. In certain embodiments, an inhibitor has an IC50 and / or binding constant of less than about 100 pM, less than about 50 pM, less than about 1 pM, less than about 500 nM, less than about 100 nM, less than about 10 nM, or less than about 1 nM.

[0449] As used herein, the term “inhibitor” is defined as a compound that binds to and / or inhibits the target with measurable affinity. In some embodiments, inhibition in the presence of the inhibitor is observed in a dose-dependent manner. In some embodiments, the measured signal (e. ., signaling activity or biological activity) is at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about99%, or at least about 100% lower than the signal measured with a negative control under comparable conditions.

[0450] The terms “measurable affinity” and “measurably inhibit,” as used herein, means a measurable change or inhibition in target activity between a sample comprising a compound of the present invention, or composition thereof an equivalent sample comprising target, in the absence of said compound, or composition thereof.

[0451] As used herein, the term “effective amount” refers to the amount of a compound sufficient to effect beneficial or desired results (e.g., a therapeutic, ameliorative, inhibitory, or preventative result). An effective amount can be administered in one or more administrations, applications, or dosages and is not intended to be limited to a particular formulation or administration route.

[0452] As used herein, the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating, or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof. In some embodiments, treatment can be administered after one or more symptoms have developed. In other embodiments, treatment can be administered in the absence of symptoms. For example, treatment can be administered to asusceptible individual prior to the onset of symptoms (e g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment can also be continued after symptoms have resolved, for example, to prevent or delay their recurrence.

[0453] As used herein, the term “pharmaceutical composition” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.

[0454] As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions (e.g, such as an oil / water or water / oil emulsions), and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers, and adjuvants, see e.g., Martin, Remington’s Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA

[1975] ,

[0455] For therapeutic use, salts of the compounds of the present invention are contemplated as being pharmaceutically acceptable. However, salts of acids and bases that are non- pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.

[0456] In addition, when a compound of the invention contains both a basic moiety (such as, but not limited to, a pyridine or imidazole) and an acidic moiety (such as, but not limited to, a carboxylic acid) zwitterions (“inner salts”) may be formed. Such acidic and basic salts used within the scope of the invention are pharmaceutically acceptable (i.e., non-toxic, physiologically acceptable) salts. Such salts of the compounds of the invention may be formed, for example, by reacting a compound of the invention with an amount of acid or base, such as an equivalent amount, in a medium such as one in which the salt precipitates or in an aqueous medium followed by lyophilization.

[0457] Throughout the description, where compositions are described as having, including, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions of the present invention that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present invention that consist essentially of, or consist of, the recited processing steps.

[0458] As a general matter, compositions specifying a percentage are by weight unless otherwise specified.General Methods of Providing the Present Compounds

[0459] The compounds of this invention may be prepared or isolated in general by synthetic and / or semi-synthetic methods known to those skilled in the art for analogous compounds and by methods described in detail in the Examples and Figures, herein.

[0460] In the schemes and chemical reactions depicted in the detailed description, Examples, and Figures, where a particular protecting group (“PG”), leaving group (“LG”), or transformation condition is depicted, one of ordinary skill in the art will appreciate that other protecting groups, leaving groups, and transformation conditions are also suitable and are contemplated. Such groups and transformations are described in detail in March ’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7thEdition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3rdEdition, John Wiley & Sons, 2018, and Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014, the entirety of each of which is hereby incorporated herein by reference.

[0461] As used herein, the phrase “leaving group” (LG) includes, but is not limited to, halogens (e.g., fluoride, chloride, bromide, iodide), sulfonates (e.g., mesylate, tosylate, benzenesulfonate, brosylate, nosylate, triflate), diazonium, and the like.

[0462] As used herein, the phrase “oxygen protecting group” includes, for example, carbonyl protecting groups, hydroxyl protecting groups, etc. Hydroxyl protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014, and Philip Kocienski, in Protecting Groups, Georg Thieme Verlag Stuttgart, New York, 1994, the entireties of which are incorporated herein by reference. Examples of suitable hydroxyl protecting groups include, but are not limited to, esters, allyl ethers, ethers, silyl ethers, alkyl ethers, arylalkyl ethers, and alkoxyalkyl ethers. Examples of such esters include formates, acetates, carbonates, and sulfonates. Specific examples include formate, benzoyl formate, chloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, p-chlorophenoxyacetate, 3 -phenylpropionate, 4-oxopentanoate, 4,4- (ethylenedithio)pentanoate, pivaloate (trimethylacetyl), crotonate, 4-methoxy-crotonate, benzoate, p-benzylbenzoate, 2,4,6-trimethylbenzoate, carbonates such as methyl, 9-fluorenylmethyl, ethyl,2,2,2-trichloroethyl, 2-(trimethylsilyl)ethyl, 2-(phenylsulfonyl)ethyl, vinyl, allyl, and p- nitrobenzyl. Examples of such silyl ethers include trimethylsilyl, triethylsilyl, t- butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and other trialkylsilyl ethers. Alkyl ethers include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, allyl, and allyloxy carbonyl ethers or derivatives. Alkoxyalkyl ethers include acetals such as methoxymethyl, methylthiomethyl, (2-methoxyethoxy)methyl, benzyloxymethyl, beta-(trimethylsilyl)ethoxymethyl, and tetrahydropyranyl ethers. Examples of arylalkyl ethers include benzyl, p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, and 2- and 4-picolyl.

[0463] Amino protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014, and Philip Kocienski, in Protecting Groups, Georg Thieme Verlag Stuttgart, New York, 1994, the entireties of which are incorporated herein by reference. Suitable amino protecting groups include, but are not limited to, aralkylamines, carbamates, cyclic imides, allyl amines, amides, and the like. Examples of such groups include t-butyloxycarbonyl (Boc), ethyloxycarbonyl, methyloxycarbonyl, trichloroethyloxycarbonyl, allyl oxy carbonyl (Alloc), benzyloxocarbonyl (Cbz), allyl, phthalimide, benzyl (Bn), fluorenylmethylcarbonyl (Fmoc), formyl, acetyl, chloroacetyl, di chloroacetyl, trichloroacetyl, phenylacetyl, trifluoroacetyl, benzoyl, and the like.

[0464] One of skill in the art will appreciate that various functional groups present in compounds of the invention such as aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens, and nitriles can be interconverted by techniques well known in the art including, but not limited to reduction, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration. See, for example, March ’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B . Smith, and J. March, 7thEdition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3rdEdition, John Wiley & Sons, 2018, the entirety of each of which is incorporated herein by reference. Such interconversions may require one or more of the aforementioned techniques, and certain methods for synthesizing compounds of the invention are described below.

[0465] One of skill in the art will appreciate that various functional groups present in compounds of the invention such as aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens, and nitriles can be interconverted by techniques well known in the artincluding, but not limited to reduction, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration. Such groups and transformations are described in detail in March 's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7thEdition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3rdEdition, John Wiley & Sons, 2018, and Protective Groups in Organic Synthesis, P. G. M. Wuts, 5thedition, John Wiley & Sons, 2014, the entirety of each of which is hereby incorporated herein by reference. Such interconversions may require one or more of the aforementioned techniques, and certain methods for synthesizing compounds of the invention are described below in the Exemplification and Figures.EXEMPLIFICATION

[0466] As depicted in the Examples below, exemplary compounds are prepared according to the following general procedures and used in biological assays and other procedures described generally herein. It will be appreciated that, although the general methods depict the synthesis of certain compounds of the present invention, the following general methods, and other methods known to one of ordinary skill in the art, can be applied to all compounds and subclasses and species of each of these compounds, as described herein. Similarly, assays and other analyses can be adapted according to the knowledge of one of ordinary skilled in the art.Example 1: Synthesis of Compound 1-193Step 1:General procedure for preparation of intermediate B-3

[0467] To a solution of 5-amino-l,3,4-thiadiazole-2-thiol (450 mg, 3.38 mmol, 1 eq.) and tertbutyl 4-(3-chloropropyl)piperazine-l -carboxylate (887.79 mg, 3.38 mmol, 1 eq.) in DMF (3 mL) was added K2CO3 (933.85 mg, 6.76 mmol, 2 eq.) and the mixture was stirred at 50 °C for 16 h.LCMS indicated 5-amino-l,3,4-thiadiazole-2-thiol was consumed and one peak with desired mass was detected. The mixture was filtered and the filtrate was concentrated directly. The mixture was used for next step directly without further purification. Compound tert-butyl 4-[3-[(5-amino-l,3,4- thiadiazol-2-yl)sulfanyl]propyl]piperazine-l -carboxylate (1.2 g, crude) was obtained as a yellow solid. LCMS: 360.3 [M+H]+.Step 2:General procedure for preparation of intermediate B-5[00468J A mixture of tert-butyl 4-[3-[(5-amino-l,3,4-thiadiazol-2- yl)sulfanyl]propyl]piperazine-l -carboxylate (300 mg, 834.47 pmol, 1 eq.) and 4- isocyanatobenzonitrile (120.27 mg, 834.47 pmol, 1 eq.) in DCM (3 mL) was stirred at 25 °C for 16 h. LCMS indicated tert-butyl 4-[3-[(5-amino-l,3,4-thiadiazol-2-yl)sulfanyl]propyl]piperazine- 1 -carboxylate was consumed and one peak with desired mass was detected. The mixture was concentrated and used for next step directly without further purification. Compound tert-butyl 4- [3-[[5-[(4-cyanophenyl)carbamoylamino]-l,3,4-thiadiazol-2-yl]sulfanyl]propyl]piperazine-l- carboxylate (400 mg, 794.22 pmol, 95.18% yield) was obtained as a white solid. LCMS: 504.3 [M+H]+.Step 3:General procedure for preparation of intermediate B-6

[0469] To a solution of tert-butyl 4-[3-[[5-[(4-cyanophenyl)carbamoylamino]-l,3,4- thiadiazol-2-yl]sulfanyl]propyl]piperazine-l -carboxylate (400 mg, 794.22 pmol, 1 eq.) in DCM (5mL) was added HCl / dioxane (4 M, 1 .59 mL, 8 eq.) and the mixture was stirred at 25 °C for 16 h. LCMS indicated tert-butyl 4-[3-[[5-[(4-cyanophenyl)carbamoylamino]-l,3,4-thiadiazol-2- yl]sulfanyl]propyl]piperazine-l -carboxylate was consumed and one peak with desired mass was detected. The mixture was filtered and the filter cake was obtained. The filter cake was used for next step without further purification. Compound l-(4-cyanophenyl)-3-[5-(3-piperazin-l- ylpropylsulfanyl)-l,3,4-thiadiazol-2-yl]urea (320 mg, 727.30 pmol, 91.57% yield, HC1) was obtained as a white solid. LCMS: 404.1 [M+H]+.Step 4:General procedure for preparation of final compound 1-193

[0470] To a solution of l-(4-cyanophenyl)-3-[5-(3-piperazin-l-ylpropylsulfanyl)-l,3,4- thiadiazol-2-yl]urea (150 mg, 371.73 pmol, 1 eq.) and 2-(bromomethyl)oxirane (50.92 mg, 371.73 pmol, 30.67 pL, 1 eq.) in DMF (2 mL) was added K2CO3 (154.12 mg, 1.12 mmol, 3 eq.). The mixture was stirred at 25 °C for 16 h. LCMS indicated l-(4-cyanophenyl)-3-[5-(3-piperazin-l- ylpropylsulfanyl)-l,3,4-thiadiazol-2-yl]urea was consumed and one peak with desired mass was detected. The mixture was filtered and the filtrate was purified by prep-HPLC (column: Waters Xbridge BEH C18 100*25mm*10pm;mobile phase: [EhO OmM NH4HCO3)- ACN];gradient: 10%-40% B over 8.0 min). Compound l-(4-cyanophenyl)-3-[5-[3-[4-(oxiran-2- ylmethyl)piperazin-l-yl]propylsulfanyl]-l,3,4-thiadiazol-2-yl]urea (42.6 mg, 84.66 pmol, 22.78% yield, 91.34% purity) was obtained as a white solid which was confirmed by1HNMR and QC LCMS. LCMS: 460.3 [M+H]+. QC LCMS: 460.1 [M+H]+.

[0471] ’H NMR: (400MHz, DMSO-d6): 8 10.51 - 9.95 (m, 1H), 7.83 - 7.68 (m, 4H), 3.19 (br t, J = 7.0 Hz, 2H), 2.99 (qd, J = 3.5, 6.6 Hz, 1H), 2.68 (t, J = 4.6 Hz, 1H), 2.60 (dd, J = 3.5, 13.2 Hz, 1H), 2.42 (br dd, J = 2.6, 4.9 Hz, 11H), 2.20 (dd, J = 6.6, 13.3 Hz, 1H), 1.91 - 1.81 (m, 2H).Example 2: Synthesis of Compounds 1-99, 1-100, 1-134 and 1-135Synthetic schemes for Compounds 1-99, 1- 100, 1-134 and 1-135Experimental Details for I- 100Step 1:General procedure for preparation of intermediate E-3

[0472] To a solution of tert-butyl (3R)-3-[(5-amino-l,3,4-thiadiazol-2-yl)sulfanyl]pyrrolidine- 1-carboxylate (500 mg, 1.65 mmol, 1 eq.) in DCM (5 mL) was added 4-isocyanatobenzonitrile (285.96 mg, 1.98 mmol, 1.2 eq.). The reaction mixture was stirred at 25 °C for 12hr. LCMS showed tert-butyl (3R)-3-[(5-amino-l,3,4-thiadiazol-2-yl)sulfanyl]pyrrolidine-l-carboxylate was consumed and one main peak with desired mass was detected. The reaction mixture was concentrated under reduced pressure to give a product. Compound tert-butyl (3R)-3-[[5-[(4- cyanophenyl)carbamoylamino]-l, 3, 4-thiadiazol-2-yl]sulfanyl]pyrrolidine-l -carboxylate (500 mg, 1.12 mmol, 67.72% yield) was obtained as a white solid. LCMS: 391.0 [M-55]+.Step 2:General procedure for preparation of intermediate E-4

[0473] To a solution of tert-butyl (3R)-3-[[5-[(4-cyanophenyl)carbamoylamino]-l,3,4- thiadiazol-2-yl]sulfanyl]pyrrolidine-l -carboxylate (500 mg, 1.12 mmol, 1 eq.) in DCM (5 mL) was added HCI / dioxane (4 M, 2.80 mL, 10 eq.). The reaction mixture was stirred at 25 °C for 12hr. LCMS showed tert-butyl (3R)-3-[[5-[(4-cyanophenyl)carbamoylamino]-l,3,4-thiadiazol-2- yl]sulfanyl]pyrrolidine-l -carboxylate was consumed and one main peak with desired mass was detected. The reaction mixture was concentrated under reduced pressure to remove DCM (5 mL). The crude product was purified by prep-HPLC (column: Waters Xbridge BEH C18 250*50mm*10pm;mobile phase: [H2O(10mM NH4HCC>3)-ACN];gradient:20%-50% B over 10.0 min). Compound l-(4-cyanophenyl)-3-[5-[(3R)-pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2- yl]urea (300 mg, 865.98 pmol, 77.34% yield) was obtained as a white solid. LCMS: 347.1 [M+H]+.Step 3:General procedure for preparation of compound I- 100[00474J To a solution of l-(4-cyanophenyl)-3-[5-[(3R)-pyrrolidin-3-yl]sulfanyl-l,3,4- thiadiazol-2-yl]urea (200 mg, 519.59 pmol, 1 eq.) in THF (2 mL) was added KOH (87.45 mg, 1.56 mmol, 3 eq.) and 2-[chloro(dideuterio)methyl]-2,3,3-trideuterio-oxirane (65.89 mg, 675.46 pmol, 1.3 eq.). The mixture was stirred at 25 °C for 24hr. LCMS showed l-(4-cyanophenyl)-3-[5-[(3R)- pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-yl]urea was consumed and one main peak with desired mass was detected. The reaction mixture was concentrated under reduced pressure to remove THF (2 mL). The crude product was purified by prep-HPLC (column: Phenomenex Luna C18 75*30mm*3pm;mobile phase: [H20(0.1%TFA)-ACN];gradient: 10%-30% B over 8.0 min). Compound l-(4-cyanophenyl)-3-[5-[(3R)-l-[dideuterio-(2,3,3-trideuteriooxiran-2- yl)methyl]pyrrolidin-3-yl] sulfanyl- 1, 3, 4-thiadiazol-2-yl]urea (11.4 mg, 21.86 pmol, 4.21% yield, 100% purity, TFA) was obtained as a white solid and confirmed by LCMS, Deuterated ratio, SFC and1HNMR. LCMS: 408.1 [M+H]+.

[0475] ‘HNMR: (400MHz, DMSO-d6): 8 12.08 - 11.19 (m, 1H), 10.82 - 10.15 (m, 1H), 9.86 (br s, 1H), 7.81 - 7.76 (m, 2H), 7.69 (br d, J = 8.6 Hz, 2H), 4.47 - 4.19 (m, 1H), 3.83 - 3.59 (m, 2H), 3.18 (br d, J = 1.1 Hz, 2H), 2.63 - 2.53 (m, 1H), 2.22 - 1.82 (m, 1H). QC LCMS: 408.1 [M+H]+.Example 3: Synthesis of two diastereoisomers of 1-217 via a late-stage Corey-Chaykovsky reactionStep 1:General procedure for preparation of compound A-2A-1 A-2

[0476] To a solution of tert-butyl (3S)-3-[(5-amino-l,3,4-thiadiazol-2-yl)sulfanyl]pyrrolidine- 1 -carboxylate (1 g, 3.31 mmol, 1 eq.) in DCM (10 mL) was added HCl / dioxane (4 M, 10.00 mL, 12.10 eq.). The mixture was stirred at 25 °C for 2 hr. LCMS showed tert-butyl (3S)-3-[(5-amino- l,3,4-thiadiazol-2-yl)sulfanyl]pyrrolidine-l-carboxylate was consumed completely and one main peak with desired mass was detected. The reaction mixture was concentrated under reduced pressure to remove solvent. Compound 5-[(3S)-pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-amine (1 g, 2.89 mmol, 87.32% yield, 90% purity, 3HC1) was obtained as a white solid. LCMS: 203.1 [M+H]+.Step 2:

[0477] To a solution of 5-[(3S)-pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-amine (550 mg, 2.72 mmol, 1 eq.) in ACN (6 mL) was added K2CO3 (1.38 g, 9.95 mmol, 3.66 eq.) and 3- bromobutan-2-one (410.53 mg, 2.72 mmol, 1 eq.). The mixture was stirred at 25 °C for 12 hr. LCMS showed 5-[(3S)-pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-amine was consumed completely and one main peak with desired mass was detected. TLC (Ethyl acetate : Methanol = 2: 1, Rf = 0.52) indicated 5-[(3S)-pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-amine was consumed completely and one new final compound spot formed. The reaction mixture was concentrated under reduced pressure to remove solvent. The residue was purified by column chromatography (SiC>2, Ethyl acetate : Methanol = 2: l,Rf = 0.52). Compound 3-[(3S)-3-[(5-amino-l,3,4-thiadiazol- 2-yl)sulfanyl]pyrrolidin-l-yl]butan-2-one (300 mg, 991.23 pmol, 36.46% yield, 90% purity) was obtained as a yellow solid. LCMS: 273.1 [M+H]+.Step 3:General procedure for preparation of compound A -5[00478J To a solution of 3-[rac-(3S)-3-[(5-amino-l,3,4-thiadiazol-2-yl)sulfanyl]pyrrolidin-l- yl]butan-2-one (500 mg, 1.84 mmol, 1 eq.) in DCM (5 mL) was added 4-isocyanatobenzonitrile (317.48 mg, 2.20 mmol, 1.2 eq.). The reaction mixture was stirred at 25 °C for 12 hr. LCMS showed 3-[rac-(3S)-3-[(5-amino-l,3,4-thiadiazol-2-yl)sulfanyl]pyrrolidin-l-yl]butan-2-one was consumed completely and one main peak with desired mass was detected. TLC (Petroleum ether : Ethyl acetate = 0: 1, Rf = 0.48) indicated 3-[rac-(3S)-3-[(5-amino-l,3,4-thiadiazol-2- yl)sulfanyl]pyrrolidin-l-yl]butan-2-one was consumed completely and one new final compound spot formed. The reaction mixture was concentrated under reduced pressure to remove solvent. The residue was purified by column chromatography (SiCL, Petroleum ether : Ethyl acetate=O: l, Rf = 0.48). Compound l-(4-cyanophenyl)-3-[5-[rac-(3S)- l-(l-methyl-2-oxo-propyl)pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-yl]urea (470 mg, 1.02 mmol, 55.33% yield, 90% purity) was obtained as a white solid, which was confirmed by1HNMR. LCMS: 417.2 [M+H]+.

[0479] ‘HNMR: (400MHz, DMSO-d6): 8 12.36 - 11.83 (m, 1H), 10.38 (br s, 1H), 7.84 - 7.67 (m, 4H), 4.16 - 3.94 (m, 1H), 3.14 - 2.93 (m, 2H), 2.83 - 2.52 (m, 3H), 2.45 - 2.31 (m, 1H), 2.12 (s, 3H), 1.79 (td, J = 5.7, 13.4 Hz, 1H), 1.13 (dd, J = 6.9, 8.8 Hz, 3H).Step 4:General procedure for preparation of compound A-6

[0480] To a solution of trimethylsulfonium;iodide (293.97 mg, 1.44 mmol, 2 eq.) in DMSO (2 mL) was added NaH (300.00 mg, 7.50 mmol, 60% purity, 10.41 eq.). The mixture was stirred at 25 °C for 1 h. l-(4-cyanophenyl)-3-[5-[rac-(3S)-l-(l-methyl-2-oxo-propyl)pyrrolidin-3-yl]sulfanyl-l ,3,4-thiadiazol-2-yl]urea (300 mg, 720.25 pmol, 1 eq.) was added. The reaction mixture was stirred at 25 °C for 1 h. LCMS showed l-(4-cyanophenyl)-3-[5-[rac-(3S)-l-(l- methyl-2-oxo-propyl)pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-yl]urea was consumed completely and one main peak with desired mass was detected. The reaction mixture was added NH4CI solution and extracted with ethyl acetate. The combined organic layers were concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (neutral condition; column: Waters Xbridge Prep OBD C18 150*40mm*10pm;mobile phase: [FLO OmM NH4HC03)-ACN];gradient:30%-60% B over 8.0 min). Compound l-(4-cyanophenyl)-3-[5-[rac- (3S)-l-[l-(2-methyloxiran-2-yl)ethyl]pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-yl]urea (80 mg, 185.81 pmol, 25.80% yield) was obtained as a white solid. LCMS: 431.1 [M+H]+.Step 5:General procedure for preparation of compounds 1-217 A and 1-217B

[0481] The compound l-(4-cyanophenyl)-3-[5-[(3S)-l-[l-(2-methyloxiran-2- yl)ethyl]pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-yl]urea (80 mg, 185.81 pmol, 1 eq.) was further separated by SFC. Compound l-(4-cyanophenyl)-3-[5-[(3S)-l-[l-(2-methyloxiran-2- yl)ethyl]pyrrolidin-3-yl]sulfanyl-l,3,4-thiadiazol-2-yl]urea (10 mg, 23.23 pmol, 12.50% yield) was obtained as a white solid and confirmed by1HNMR, LCMS and SFC. Compound l-(4- cyanophenyl)-3-[5-[(3S)-l-[l-(2-methyloxiran-2-yl)ethyl]pyrrolidin-3-yl]sulfanyl-l,3,4 -thiadiazol-2-yl]urea (10 mg, 23.23 pmol, 12.50% yield) was obtained as a white solid and confirmed by 'HNMR, LCMS and SFC. LCMS: (1-217A) 431.1 [M+H]+. LCMS: (1-217B) 431.1 [M+H]+.

[0482] ’H NMR: ( 217A) (400MHz, DMSO-d6): 8 9.96 - 9.84 (m, 1H), 7.78 - 7.70 (m, 4H), 4.09 - 4.02 (m, 1H), 2.95 (dd, J = 6.9, 10.0 Hz, 1H), 2.78 - 2.70 (m, 1H), 2.69 - 2.59 (m, 3H), 2.46 - 2.31 (m, 2H), 1.80 - 1.64 (m, 2H), 1.18 - 1.12 (m, 3H), 1.09 (d, J = 6.4 Hz, 3H).

[0483] 'H NMR: (I-217B) (400MHz, DMSO-d6): 8 10.63 - 10.10 (m, 1H), 7.88 - 7.70 (m, 4H), 4.08 - 3.99 (m, 1H), 2.99 (dd, J = 7.3, 9.9 Hz, 1H), 2.76 - 2.52 (m, 5H), 2.43 - 2.32 (m, 1H), 1.83 - 1.65 (m, 2H), 1.15 (s, 3H), 1.09 - 1.04 (m, 3H).Example 4: Covalent modification of target RNA sequences.

[0484] Covalent modification assay: The target RNA was diluted to 2.1 pM in refolding buffer (20 mM HEPES pH 7.5, 100 mM KC1) before heat denaturing at 95 °C for 3 minutes, followed by cooling on ice for 3 minutes. MgCh (100 mM in nuclease free water; final MgCh concentration in solution = 3 mM) was added to yield a final concentration of 2 pM RNA. The RNA was then refolded at 37 °C for 30 minutes. After refolding, the RNA was diluted further with IX complete refolding buffer (20 mM HEPES pH 7.5, 100 mM KC1, 3 mM MgCh) to a working concentration of 1 pM. For each reaction, 100 pL of 1 pM refolded RNA was treated with either 1 mM compound in DMSO (1 pL, final compound concentration = 10 pM), or DMSO alone (1 pL) and was incubated at 37 °C for 6 or 4 hours. Following incubation, the treated RNA was either purified by ethanol precipitation or by a plate-based method. For ethanol precipitation, each sample was treated with a 3M solution of sodium acetate (pH 5.2, 10 pL), followed by absolute ethanol (330 pL). Samples were incubated at -80 °C for > 1 hour. The RNA was then pelleted by centrifugation at 4 °C (1 hour, 14 100 x g). Supernatant was removed and discarded, and RNA pellets were air dried at room temperature for 10 minutes. The RNA pellets were then resuspended in 20 pL nuclease free water for MS analysis. For plate-based RNA purification, ZR-96 Oligo Clean & Concentrator plates were used according to manufacturers’ instructions (Zymo Research, Cat. # D4063).

[0485] The RNA was subsequently analyzed by either one of the LC-MS protocols described below:_(l) Novatia LC-MS protocol: The modified RNA samples were analyzed using a Thermo Finnigan LTQ spectrometer equipped with a Clarity 2.6 pm Oligo X-T column (50 * 2.1 mm, 60 °C). The elution gradient and flow rate set points were as follows:

[0486] where A = 1% HFIPA, 0.1% DIEA, 1 pM EDTA in H2O; B = 65% acetonitrile, 0.075% HFIPA, 0.0375% DIEA, 1 pM EDTA in H2O; and C = 40% methanol, 40% acetonitrile in H2O. Data processing, including spectrum deconvolution, was performed using ProMass and Xcaliber software.

[0487] (2) Momentum Biotechnologies LC-MS protocol: The modified RNA samples were analyzed using an Agilent 6230 TOF equipped with an AdvanceBio Oligo UHPLC Guard column (1.7 pm, 2.1 x 5 mm). The elution gradient and flow rate set points were as follows:

[0488] where A = 15 mM hexylamine and 50 mM HFIP in H2O; B = methanol.

[0489] RNA sequences used: AST-452 (STAT3), AST-625 (SARS-CoV-2 Stem Loop 5) and AST-627 (SARS-CoV-2 mutant control), AST-265 (SAM- 1 -Riboswitch control) and AST-29 (PreQi Riboswitch control.

[0490] AST-625:GGGAUGGAGAG(XUUGUCC(XK3UU(XK:AGGACACGAGUAAaJCGUCUAUCCC (SEQ ID NO: 1);

[0491] AST-627:GGGAUGGAGAGCUUGUCCCUGUUCGCAGGACACGAGCUCGUCUAUCCC (SEQ ID NO: 2),

[0492] AST-452:GGAUUUGGGUGAUGCACUGCACCCCUAGGAAGGGAAGGGCUGGGAUGGCAGUAGACUUGGCUUUCCCAUUACOCUUUUCUCCAGG (SEQ ID NO: 3);

[0493] AST-265:GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCAGAAAUGGUGCCAAUIJCCUGCAGCGGAAACGCUGAAAGAUGAGCCA (SEQ ID NO: 4);

[0494] AST-29:GGCCGUGCGAUAUGCGGGAGAGGUUCUAGCUACACCCUCUAUAAAAAACUAA (SEQ ID NO: 5).

[0495] The results are shown in Tables 4-7 below:Table 4. % Covalent modification of AST452Table 5. % Covalent modification of AST625Table 6. % Covalent modification of AST627Table 7. % Covalent modification of other ASTs

[0496] Additional results are shown in Table 7a below:Table 7a. % Covalent modification of ASTsExample 5: Cell free translation assays (CFT assays)

[0497] Generation of the reporter constructs: Reporter RNA constructs were generated by combining an AST sequence of interest with aHiBiT tag followed by a poly-Atail. For the SARS- CoV-2 SL5 constructs, the AST sequence spanned the AUG start codon. For the coding sequence (CDS) construct (AUG-452), an AUG start codon was inserted prior to the AST sequence. For the 5’-UTR construct (452-AUG), the AUG start codon was inserted between the AST sequence and the HiBiT tag.

[0498] Cell free translation assay (pre-modified): A reporter RNA construct was diluted to 101 nM in refolding buffer (20 mM HEPES pH 7.5, 100 mM KC1) before heat denaturing at 95 °C for 3 minutes, followed by cooling on ice for 3 minutes. MgCL (100 mM in nuclease free water; final MgCh concentration in solution = 3 mM) was added to yield a final concentration of 100 nM RNA. The RNA was then refolded at 37 °C for 30 minutes. For each reaction, 50 pL of 100 nM refolded RNA was treated with either 1 mM compound in DMSO (0.5 pL, final compound concentration = 10 pM), or DMSO alone (0.5 pL) and was incubated at 37 °C for 6 hours. Following incubation, RNA was purified by a plate-based method using ZR-96 Oligo Clean & Concentrator plates according to manufacturers’ instructions (Zymo Research, Cat. # D4063). RNA was eluted using an equal volume of nuclease free water, assuming RNA concentration in the eluent was equivalent to input concentration.

[0499] Cell lysate from 293T cells (6.25 pL per sample), 20X translation mix (1.25 pL per sample, ThermoFisher Scientific, Cat.# B28860C001), and nuclease free water (12.5 pL per sample) were pre-mixed. The pre-mixed solution was dispensed into a 96-well plate (20 pL per sample), followed by addition of 5 pL of pre-modified RNA (presumed final concentration = 20 nM). The plate was sealed and incubated at 30 °C for 1 hour. After equilibrating to room temperature for 10 minutes, 10 pL of each sample was dispensed into a 384-well white opaque plate. Luminescence was measured using an equal volume of the Nano-Gio HiBiT Lytic Detection System (Promega, Cat #N3030) according to manufacturers’ instructions.

[0500] The results for 1-217, 1-170, 1-118, and 1-205 in the pre-modified assay are shown in FIG. 1. 1-217, 1-170, and 1-118, which can selectively covalently modify AST-625 (WT SARS- CoV-2 SL5) over AST-627 (mutant or “zippered” SARS-CoV-2 SL5), see Tables 4-7 above, show the same selectively in the CFT assay. Control compound 1-205, which does not modify either AST-625 or AST-627 does not show activity in the CFT assay for either AST.

[0501] The same four compounds were also tested in the “AUG-452 construct”, with an AUG - AST-452 - HiBiT sequence and the “452-AUG construct”, with an AST-452 - AUG - HiBiT sequence (See FIG. 3). 1-217, 1-170 and 1-118, which can covalently modify AST-452, were able to suppress translation when the AUG was located upstream of the AST-452 site. However, the same compounds were not able inhibit translation when the AUG was located downstream of the AST-452 site. Thus, when the modified site is located upstream of an AUG (in the 5’region) no effect is seen on translation. However, when the modified site is in the coding sequence (downstream from AUG) the modification results in the suppression of translation.

[0502] Cell free translation assay (one pot): RNA was diluted to 206 nM in refolding buffer (20 mM HEPES pH 7.5, 100 mM KC1) before heat denaturing at 95 °C for 3 minutes, followed by cooling on ice for 3 minutes. MgCh (100 mM in nuclease free water; final MgCh concentration in solution = 3 mM) was added to yield a final concentration of 200 nM RNA. The RNA was then refolded at 37 °C for 30 minutes.

[0503] For the cell free translation assay, 293T lysate (6.25 pL per sample), 20X translation mix (1.25 pL per sample, ThermoFisher Scientific, Cat.# B28860C001), and nuclease free water (5 pL per sample) were pre-mixed. The pre-mixed solution was dispensed into a 96-well plate (12.5 pL per sample), followed by addition of 12.5 pL of refolded RNA (final RNA concentration = 100 nM), then compound in DMSO (0.5 pL, final concentration = 10 pM). The plate was sealed and incubated at 30 °C for 3 hours, then allowed to equilibrate to room temperature for 10 minutes. 10 pL of each sample was dispensed into a 384-well white opaque plate. Luminescence was measured using an equal volume of the Nano-Gio HiBiT Lytic Detection System (Promega, Cat #N3030) according to manufacturers’ instructions.

[0504] The results for 1-217, 1-170, 1-118 and 1-205 in the one-pot assay are shown in FIG. 2. 1-217, 1-170 and 1-118, which can selectively covalently modify AST-625 (WT SARS-CoV-2 SL5) over AST-627 (mutant or “zippered” SARS-CoV-2 SL5) also show this selectivity in the CFT assay. Control compound 1-205, which does not modify either AST-625 or AST-627 does not show activity in the CFT assay for either AST.Example 6: In cell RNA modificationDNA transfection and compound dosing

[0505] The ability to modify target RNA intracellularly was evaluated using in-cell covalent- seq. One day prior to transfection, 225,000 H1299 cells were seeded in a 6-well plate. Transfection was carried out using 1.25 pg plasmid containing AST-452 in the 3’UTR of Firefly luciferase reporter, facilitated by lipofectamine 3000 (Invitrogen). 24 hours post-transfection, cells were treated with 10 pM compound (for compounds with a photoprobe) or 100 pM compound (for compounds that can covalently modify RNA) in DMSO in the presence of 40 pM reserpine, followed by incubation for three hours at 37 °C. Each treatment condition was performed in triplicate. For the cell aliquot treated with the photoprobe, the cells were UV crosslinked for 5 minutes to activate the photo warhead, after which the cells were lysed with TRIzol. Total RNA was purified from the lysed cells using the Direct-zol RNA miniprep kit (Zymo), with elution in nuclease-free water. Additional experiments were performed in which the concentration of, and / or the time of exposure to, compounds that can covalently modify RNA was varied.Covalent-seq library preparation, sequencing and analysis

[0506] A protocol based on Mukherjee et al., (Chem. Biol. 2020, 15, 9, 2374-2381) was employed for sequencing library preparation. The RNA was treated with reverse transcriptase to generate cDNA libraries. After reverse transcription and cDNA purification, CircLigase (Lucigen) was used for the adaptor ligation step, with the reaction incubated at 60 °C for 1 hour and heat inactivated at 80 °C for 10 minutes. Double-stranded DNA libraries for next-generation sequencing were generated by two rounds of PCR, following the original protocol.

[0507] The multiplexed library was sequenced on a MiSeq instrument (Illumina) using a v2 300-cycle kit with 150 bp paired-end reads for a final library concentration of 8 pM with 25% PhiX. Computational analysis of sequencing data was conducted according to Mukheijee et al. The sites on the RNA transcript which were modified by the compounds with a photoprobe or compounds that can covalently modify RNA were determined by identifying specific reverse transcriptase stalling sites.

[0508] The data are shown in FIGs 4-6. FIG. 4 shows in-cell modification of AST-452 RNA with epoxide-based covalent modifiers 1-170 and 1-158. Cells treated with the photoprobe, Compound A, showed adduct formation at U70 (See lane 1), while cells treated with the covalent modifying compounds showed adduct formation at C74 (See lane 4 and 6). The modification by the photoprobe was competed away by the corresponding parent ligand (See lane 2). A covalentcompound (1-205) that does not recognize AST-452 has no impact on modification by the photoprobe (See lane 3). Three AST-452-targeted covalent compounds compete away photoprobe modification, indicating in-cell target engagement; two of these compounds exhibit the expected covalent modification at C74 (See lanes 4-6). Each covalent compound shows the same in-cell modification in the absence of photoprobe (See lanes 7-10).

[0509] FIG. 5 shows an increase in modification when the cell is exposed to 1-158 for a longer period of time. Covalent stalling appears to rapidly accumulate within the initial hour following the compound addition and remains relative stable from 1 to 4.5 hours post treatment.

[0510] FIG. 6 shows an increase in modification when the cell is exposed to 1-158 at increasing concentrations. The occurrence of covalent stalling is strongest at concentrations of 50 pM or higher.Example 7: X-ray analysis of modified RNA targetsRNA construct design

[0511] Crystallization constructs AST-639 and AST-711 were designed for SARS-CoV-2 Stem Loop 5 and STAT3, respectively. The terminal helix in each was stabilized and a modified crystallization module was incorporated at the distal end of the other helix. (See e.g., Coonrod LA, Lohman JR, Berglund JA. Biochemistry. (2012) 51, 8330-8337.). Crystallization construct AST- 639 includes the SARS-CoV-2 Stem Loop 5 sequences GGGAGAGCCUUGUGC (SEQ ID NO: 6) and GCACGAGUAACUCGUCCC (SEQ ID NO: 7), while crystallization construct AST-711 includes the STAT3 sequences CGGGCUGGGAUGGC (SEQ ID NO: 8) and GCUUUCCCAUUACUCG (SEQ ID NO: 9).AST-639 crystallization methods

[0512] AST-639 in 10 mM HEPES pH 7.4 and 15 mM NaCl was folded by heating at 95 °C, followed by cooling on ice for 3 minutes. MgCh was added to a final concentration of 5 mM, then the sample was incubated at 37 °C for 30 minutes. AST-639 was treated with excess compound in DMSO and incubated for 16 hours at 37 °C. AST-639 was modified with either 1-158 or 1-121 and was then concentrated to 350 pM. Sitting drop vapor diffusion crystallization experiments were set using an NT8 liquid handler (Formulatrix) with equal volumes of RNA and reservoir solution in the drop on Axygen crystallization 96-well plates (Coming).

[0513] Crystals of AST-639 modified with 1-158 were cryoprotected by serial transfer and then plunged into liquid nitrogen. Diffraction data were collected at the CLS beamline CMCF- 08ID with data recorded on an Eiger X 9M detector. The data was reduced using the xiaZ pipeline (Winter, G. J. Appl. Cryst. (2010) 43, 186-190.) and processed at 2.62 A into space group P2i 2i 2i. The phase problem was solved by molecular replacement in CCP4 (Winn MD, et al. Acta Crystallogr D Biol Crystallogr. (2011) 67 235-242) using phaser (A. J. McCoy, et al. J. Appl. Cryst. (2007) 40, 658-674). The crystallization module was used as the search model, which was generated by RNAComposer (Popenda, M., et al Nucleic Acids Research (2012) 40, el 12). The model was iteratively built in COOT (Emsley P., et al. Acta Crystallogr. D Biol. Crystallogr. (2010) 66:486-501), which was refined to an Rwork / Rfree of 21.93 / 26.54 (%) using refmac5 (O.Kovalevskiy, et al. Acta Crystallogr. D (2018) 74, 492-505; G.N.Murshudov et al. Acta Crystallogr. D (2011) 67, 355-367; and G.N. Murshudov, et al. Acta Crystallogr. D (1997) 53, 240-255) in CCP4.

[0514] Crystals of AST-639 modified with 1-121 were cryoprotected by serial transfer and then plunged into liquid nitrogen. Diffraction data were collected at the EMBL beamline P13 with data recorded on a Pilatus3 6M detector. The data was reduced using the xiaZ pipeline (Winter, G. J. Appl. Cryst. (2010) 43, 186-190.) and processed at 3.00 A into space group P2i 2i 2i. The phase problem was solved by molecular replacement in CCP4 (Winn MD, et al. Acta Crystallogr D Biol Crystallogr. (2011) 67 235-242) using phaser (A.J. McCoy, et al. J. Appl. Cryst. (2007) 40, 658-674) using the same search model described above. The model was iteratively built in COOT (Emsley P., et al. Acta Crystallogr. D Biol. Crystallogr. (2010) 66:486-501), which was refined to an Rwork / Rfree of 23.40 / 26.58 (%) using refmac5 (O.Kovalevskiy, et al. Acta Crystallogr. D (2018) 74, 492-505; G.N.Murshudov et al. Acta Crystallogr. D (2011) 67, 355-367; and G.N. Murshudov, et al. Acta Crystallogr. D (1997) 53, 240-255) in CCP4.

[0515] AST-639 modified with 1-158 is shown in FIG. 7, while AST-639 modified with 1-121 is shown in FIG. 8.

[0516] In FIG. 7, 1-158 modifies G5 in SARS-CoV-2 SL5. X-ray co-crystal structure shows modification of N7 of G5 of AST-639 by 1-158 (2.68 A). The thiadiazole urea has three H-bonds with C8 and positions the epoxide near G5.

[0517] In FIG. 8, 1-121 modifies N7 of G5 of AST-639. 1-121 has hydrogen bonding to C8. N7 of G5 is modified through attack at the distal carbon of the epoxide. The oxygen from the epoxide hydrogen bonds with Hoogsteen edge of A6.

[0518] As shown in the figures both 1-158 and 1-121 bind the RNA at nucleotide at C8 with 3 hydrogen bonds. The electron density also shows that the epoxide warhead has opened at the distal carbon, which forms a new bond on the Hoogsteen edge of Guanine 5 at N7 nitrogen.AST-711

[0519] AST-711 in 10 mM HEPES pH 7.4 and 15 mM NaCl was folded by heating at 95 °C, followed by cooling on ice for 3 minutes. MgCh was added to a final concentration of 5 mM, then the sample was incubated at 37 °C for 30 minutes. AST-711 was treated with excess compound in DMSO and incubated for 16 hours at 37 °C. AST-711 was modified with either 1-158 or 1-182 and was concentrated to 610 pM. Sitting drop vapor diffusion crystallization experiments were set using an NT8 liquid handler (Formulatrix) with equal volumes of RNA and reservoir solution in the drop on Axygen crystallization 96-well plates (Coming).

[0520] Crystals of AST-711 modified with 1-158 or 1-182 were cryoprotected using a low viscosity perfluoropolyether oil and then plunged into liquid nitrogen. Diffraction data were collected at the EMBL beamline P13 with data recorded on a Pilatus3 6M detector and reduced using the xzr / 2 pipeline (Winter, G. J. Appl. Cryst. (2010) 43, 186-190).

[0521] For crystals of AST modified with 1-158, data were processed at 1.97 A into space group P65 2 2. The phase problem was solved by molecular replacement in CCP4 (Winn MD, et al. Acta Crystallogr D Biol Crystallogr. (2011) 67, 235-242) using phaser (A.J. McCoy, et al. J. Appl. Cryst. (2007) 40, 658-674) using the same search model described above. The model was iteratively built in COOT (Emsley P., et al. Acta Crystallogr. D Biol. Crystallogr. (2010) 66:486- 501), which was refined to an Rwork / Rfree of 24.27 / 27.27 (%) using refmac5 (O.Kovalevskiy, et al. Acta Crystallogr. D (2018) 74, 492-505; G.N.Murshudov et al. Acta Crystallogr. D (2011) 67, 355-367; and G.N. Murshudov, et al. Acta Crystallogr. D (1997) 53, 240-255) in CCP4.

[0522] For crystals of AST-711 modified with 1-182, data were processed at 2.23 A into space group P65 2 2. The phase problem was solved by molecular replacement in CCP4 (Winn MD, et al. Acta Crystallogr D Biol Crystallogr. (2011) 67 235-242) using phaser (A.J. McCoy, et al. J. Appl. Cryst. (2007) 40, 658-674) using the same search model described above. The model wasiteratively built in COOT (Emsley P., etal. Acta Crystallogr. D Biol. Crystallogr. (2010) 66:486- 501), which was refined to an Rwork / Rfree of 23.86 / 27.98 (%) using refmac5 (O.Kovalevskiy, et al. Acta Crystallogr. D (2018) 74, 492-505; G.N.Murshudov et al. Acta Crystallogr. D (2011) 67, 355-367; and G.N. Murshudov, et al. Acta Crystallogr. D (1997) 53, 240-255) in CCP4.

[0523] AST-711 modified with 1-182 is shown in FIG. 9, while AST-711 modified with 1-158 is shown in FIG. 10. As shown in the figures each compound binds at nucleotide C5 in each structure through 3 hydrogen bonds. The electron density also shows that the epoxide warhead has opened at the distal carbon, which forms a new bond on the Hoogsteen edge of nucleotide Guanine 2 at N7 nitrogen. The OH moiety of reacted 1-182 forms an additional hydrogen bond with a non-bridging oxygen atom of G2 whereas the OH moiety of 1-158 coordinates a sodium ion through inner sphere contacts. Additionally, a hydrated magnesium coordinates the Hoogsteen edge of A40 and the thiadiazole ring of 1-182 through outer sphere contacts. In FIG. 10, 1-158 modifies G2 in AST-711. The epoxide alkylates N7 of a guanine base (1.97 A “cocrystal” structure).Example 8: Synthesis of Compounds

[0524] General: Unless otherwise noted, all reactions were conducted under an N2 atmosphere. All solvents and reagents were used as received without further purification. Rotary evaporation was performed under 30 torr with a bath temperature below 40 °C. Preparatory HPLC was performed at neutral pH using a Phenomenex Gemini-NX column (80 mm x 40 mm x 3 pM), a WePure Biotech XP tCis (150 mm x 40 m x 7 pm), or a Waters XBridge BEH Cis column (100 mm x 30 mm x 5 pM) with a gradient of 10 mM NH4HCO3 in water (solvent A) and acetonitrile (solvent B). Preparatory HPLC was performed under acidic conditions using a Phenomenex Luna Cis column (75 mm x 35 mm x 3 pM) where solvent A was either 0.2% formic acid in water, 0.04% HC1 in water, or 0.1% trifluoroacetic acid in water; and solvent B was acetonitrile. Preparatory SFC was performed using a Daicel Chiralpak IG column with a mobile phase of CO2 (solvent A) and 0.1% ammonia in methanol (solvent B). Analytical LC-MS data were obtained using an Agilent 1200 HPLC system equipped with a Waters XBridge BEH Cis column (2.1 mm x 50 mm x 5 pM) using a gradient of 10 mM NH4HCO3 in water (solvent A) and acetonitrile (solvent B). NMR data were collected on a NMR spectra were obtained on a Bruker 400 MHz spectrometer; chemical shifts are uncorrected.Synthesis of Targeted Covalent RNA Inhibitors (TCRIs) via alkylation of primary or secondary amines with rac-epibromohydrin

[0525] General Procedure 1: A solution of the primary amine (1 eq, 0.1 - 0.3 M in DMF) and rac-epibromohydrin (1.0 - 2.0 eq) was treated with solid K2CO3 (3.0 - 5.0 eq). The resulting suspension was stirred at 25 °C until LC-MS analysis indicated full consumption of the starting amine (2 - 24 h). The reaction mixture was then filtered and concentrated under reduced pressure. The crude products were then purified by preparatory HPLC. Fractions containing the desired product were then combined and lyophilized to afford the final compounds as white to off-white solids. Analytical data for compounds synthesized via this method can be found in Table 8.Table 8. Compound Characterization Data for Compounds synthesized via General Procedure 1Synthesis of TCRIs via alkylation of primary or secondary amines with functionalized glycidyl tosylates

[0526] General Procedure 2: To a solution of the starting amine (1 eq, 0.2 - 0.5 M) and N,N- diisopropylethyl amine (3.0 - 10.0 eq) in DMF at 25 °C was added the indicated tosylate (1 - 13, as shown below, 2.0 - 5.0 eq). The resulting mixture was maintained at 25 °C until LC-MS analysis indicated complete consumption of the starting amine. In cases where no reaction occurred at 25 °C, the reaction mixture was heated to 60 - 80 °C until the reaction was determined to be complete by LC-MS analysis (typically 2 - 16 h). The reaction mixture was concentrated under reduced pressure and the crude products subjected to preparatory HPLC chromatography. Fractions containing the desired products were combined and lyophilized to afford the final compounds as white to off-white solids. Analytical data for compounds synthesized via this method can be found in Table 9. Certain compounds synthesized from tosylates rac-cis-3, rac-trans-3, rac-cis-4, rac-cis-5, rac-cis-6, rac-7a, rac-7b, rac-8, rac-9, rac-10, rac-cis-11, rac-12a, and rac-12b were further subjected to preparatory chiral SFC chromatography; these compounds were isolated as single diastereomers of unknown absolute stereochemistry at the epoxide stereocenter(s). Data for these compounds is found in Table 10.Chemical Structures of the Functionalized Glycidyl Tosylates used in General Procedure 2Table 9. Compound Characterization Data for Compounds synthesized via General Procedure 2Table 10. Compound Characterization Data for Compounds synthesized via General Procedure 2 followed by chiral SFC to isolate single diastereomersSynthesis of TCRIs via alkylation of primary or secondary amines with epichlorohydrin derivatives

[0527] General Procedure 3: TCRIs were also synthesized via alkylation of primary or secondary amines with epichlorohydrin derivatives 14 - 16 as shown below. This followed General Procedure 2, substituting the indicated epichlorohydrin derivative in place of the tosylate reagent, with the exception that the reactions were generally performed at elevated temperatures(typically 60 - 80 °C). Purification was performed by preparatory HPLC as previously described. Analytical data for compounds synthesized via this method can be found in Table 11. Certain compounds synthesized from epichlorohydrin derivatives rac-15 and rac-16 were further subjected to preparatory chiral SFC chromatography; these compounds were isolated as single diastereomers of unknown absolute stereochemistry at the epoxide stereocenter(s). Data for these compounds is found in Table 12.Chemical Structures of epichlorohydrin derivatives used to synthesize TCRIs via GeneralProcedure 3Table 11. Compound Characterization Data for Compounds synthesized via General Procedure 3Table 12. Compound Characterization Data for Compounds synthesized via General Procedure 3 followed by chiral SFC to isolate single diastereomersSynthesis of TCRIs via alkylation of primary or secondary amines with epibromohydrin derivatives

[0528] General Procedure 4: TCRIs were also synthesized via alkylation of primary or secondary amines with epibromohydrin derivatives 17 - 19 as shown below. This followed General Procedure 1, substituting the indicated epibromohydrin derivative in place of rac- epibromohydrin, with the exception that the reactions were generally performed at elevated temperatures (typically 60 - 80 °C). Purification was performed by preparatory HPLC as previously described. Analytical data for compounds synthesized via this method can be found in Table 13. Certain compounds synthesized from epibromoohydrin derivatives rac-19a and rac 19b were further subjected to preparatory chiral SFC chromatography; these compounds were isolated as single diastereomers of unknown absolute stereochemistry at the epoxide stereocenter(s). Data for these compounds is found in Table 14.Chemical Structures of epibromohydrin derivatives used to synthesize TCRIs via GeneralProcedure 4Table 13. Compound Characterization Data for Compounds synthesized via General Procedure 4Table 14. Compound Characterization Data for Compounds synthesized via General Procedure 4 followed by chiral SFC to isolate single diastereomersSynthesis of TCRIs via amidation of secondary amines with glycidic acid derivatives

[0529] General Procedure 5: A stirring solution of the secondary amine (1 eq, 0.1 - 0.3 M) in DMF or CEhChat 25 °C was treated with T4P (1.2 - 3.0 eq), N,N-diisopropylethylamine (2.0 - 5.0 eq), and rac-20 or rac-cis-21 (as indicated in Table 15, 1.2 - 2.0 eq). The resulting mixture was maintained at 25 °C until LC-MS analysis indicated complete consumption of the starting amine (typically 2 - 16 h). The reaction mixture was then concentrated under reduced pressure and the residue purified by preparatory HPLC (when rac-20 was used) or preparatory SFC (when rac-cis-21 was used). Analytical data for compounds synthesized via this method can be found in Table 15Table 15. Compound Characterization Data for Compounds synthesized via General Procedure 5Synthesis of hydroxyl-containingTCRIs via a two-step alkylation-deprotection sequence

[0530] General Procedure 6: Hydroxyl-containing TCRIs were synthesized via a two-step sequence. Silyl ether-protected epoxides were prepared from tosylates 22 - 25 as shown below according to General Procedure 2 above. The resulting silyl ethers (50 - 200 pmol) were then dissolved in acetonitrile (2 mb) and treated with trifluoroacetic acid (200 pL). The reaction mixtures were maintained at 45 °C until LC-MS analysis indicated complete consumption of the silyl ether. The reaction mixtures were then concentrated under reduced pressure, and the crude products purified by preparatory HPLC. Analytical data for compounds synthesized via this method can be found in Table 16.Silyl ether-protected hydroxy tosylates used in General Procedure 6Table 16. Compound Characterization Data for Compounds synthesized via General Procedure 6Synthesis of 3-substituted l,3,4-thiadiazol-2-ylidene TCRIs via alkylation of 1,3,4- thiadiazoles with cyclopentyl tosylates

[0531] General Procedure 7: To a solution of the starting amine (1 eq, 0.2 - 0.4 M) and N,N- diisopropylethyl amine (3.0 eq) in DMF at 25 °C was added K2CO3 (2.0 eq) and the indicated tosylate (12 - 13, 1.5 - 2.0 eq). The resulting mixture was maintained at 80 °C until LC-MS analysis indicated complete consumption of the starting amine (typically 2 - 16 h). The reaction mixture was concentrated under reduced pressure and the crude products subjected to preparatory HPLC followed by preparatory chiral SFC to afford single diastereomers of the indicated products with unknown absolute stereochemistry. Fractions containing the desired products were combined and lyophilized to afford the final compounds as white to off-white solids. Analytical data for compounds synthesized via this method can be found in Table 17.Table 17. Compound Characterization Data for Compounds synthesized via General Procedure 7Synthesis of spiroepoxide-containing TCRIs via a niultistep sequence

[0532] General Procedure 8: TCRIs containing spiroepoxides were synthesized via a multistep sequence comprising hydrolysis of Boc-protected spiroepoxides, reductive amination, ring closing, and urea formation. Spiroepoxides 26a - 26c are commercially available and were used as received. Spiroepoxides 26d - 26q were synthesized from the corresponding ketones or olefins as shown below.

[0533] Synthesis of Int-1 (Step 1): To a solution of 5-amino-l,3,4-thiadiazole-2-thiol (35.9 g, 269 mmol, 1.5 eq) in DMF (100 mL) was added K2CO3 (74.5 g, 539 mmol, 3.0 eq) and 2- (bromomethyl)-l,3-dioxolane (30.0 g, 179 mmol, 18.4 mL, 1 eq). The resulting mixture was maintained at 80 °C for 12 h, at which point LC-MS analysis indicated formation of the desired product. The reaction mixture was then filtered and the filtrate concentrated under reduced pressure. The residue was purified by column chromatography over silica gel (100% ethyl acetate,Rf = 0.42) to afford the desired product as a white solid (15.0 g, 66.8 mmol, 37% yield, 97.7% purity). LC-MS: 220.0, [M+H]+.

[0534] Synthesis of Int-1 (Step 2): To a solution of 5-(l,3-dioxolan-2-ylmethylsulfanyl)- l,3,4-thiadiazol-2-amine (8.50 g, 38.8 mmol, 1 eq.) in THF (20 mL) was added aqueous HC1 (2.00 M, 100 mL, 5.16 eq.). The mixture was maintained at 60 °C for 12 h, at which point LC-MS analysis indicated complete consumption of the starting dioxolane. The reaction mixture was concentrated under reduced pressure to afford the Int-1 (HC1 salt) as a white solid (8.00 g, 37.8 mmol, 97.5% yield). Int-1 prepared by this method was used directly without further purification.

[0535] General Procedure 8-1: A solution of the Boc-protected amine 26 (0.2 - 0.5 M, 1 eq) in CH2CI2 was treated with a solution of HC1 (4.0 M in 1,4-dioxane, 4 eq). The resulting mixture was maintained at 25 °C until LC-MS analysis indicated complete consumption of the starting Boc-protected amine (typically 6 - 12 h). The reaction mixture was then concentrated under reduced pressure to afford the crude products as HC1 salts as white to off-white solids. The crude HC1 salts were then used directly in step 8-2 without further purification.

[0536] General Procedure 8-2: To a solution of the secondary amine HC1 salt (0.2 - 0.5 M, 1 eq) and Int-1 (1.2 - 1.5 eq) in methanol was added triethylamine (1.0 - 1.2 eq), acetic acid (1.0 - 1.2 eq) and sodium cyanoborohydride (1.5 - 3.0 eq). The resulting mixture was maintained at 25 °C until LC-MS analysis indicated complete consumption of the starting secondary amine (typically 12 - 24 h). The reaction mixture was diluted with water at 0 °C, then was extracted with two portions of ethyl acetate. The combined extracts were dried over Na2SC>4, filtered, and concentrated under reduced pressure to afford the crude products. The crude products were purified by column chromatography over silica gel (5 - 100% methanol in CH2CI2) to afford the desired products of general structure Int-2 as white to off-white solids.

[0537] General Procedure 8-3: A solution of epoxide precursor Int-2 (0.05 - 0.1 M) in DMF was treated with K2CO3 (1.5 - 2.5 eq). The resulting mixture was maintained at 60 °C until LC- MS analysis indicated complete consumption of the starting material. The resulting mixture was then filtered and concentrated under reduced pressure to afford the intermediate epoxide. The epoxide was immediately dissolved in CH2CI2 (0.05 - 0.2 M), then was treated with 4- isocyanatobenzonitrile (1.0 - 1.2 eq). The resulting mixture was maintained at 25 °C until LC-MS indicated complete consumption of the intermediate epoxide. The reaction mixtures were then concentrated under reduced pressure and the crude products purified by preparatory HPLC and / orchiral SFC. In cases where chiral SFC was used to isolate single diastereomers of spiroepoxides, the configuration at each stereocenter was assigned arbitrarily unless otherwise specified. Product structures and ana...

Claims

CLAIMSWe claim:

1. A compound of Formula A:A or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA;-L- is a bivalent linker that covalently connects the rSM to Warhead group; and Warhead group is a reactive functional group comprising an epoxide.

2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the Warhead group reacts selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof.

3. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the Warhead group reacts selectively with a guanine of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof.

4. The compound of claim 3, wherein the Warhead group reacts with an N7 nitrogen of the guanine of the target RNA.

5. The compound of any one of claims 1-4, wherein the Warhead group reacts selectively under physiological conditions inside a cell.

6. The compound of any one of claims 1-5, wherein the Warhead group iswherein:R2, R3, and R4are each independently H, D, Ci-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 deuterium, oxygen or halogen atoms, and optionallysubstituted with one -ORX, -CN, or NHRXgroup; halogen, -CN, -C(O)RX, -C(O)ORX, - OC(O)RX, -C(O)N(RX)2, -N(RX)C(O)RX, -N(RX)C(O)N(RX)2, -OC(O)N(RX)2, -N(RX)C(O)ORX, -ORX, -N(RX)2, -NO2, -SRX, -S(O)RX, -S(O)2RX, -S(O)2N(RX)2, or -NRXS(O)2RX; and each occurrence of Rxis independently H or a C1-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 halogen atoms; wherein one or more carbon atoms of Warhead group are optionally13C.

7. The compound of claim 6, wherein R2, R3, and R4are each independently H, D, Ci-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORX, -CN, or NH2 group; halogen, -CN, - C(O)RX, -C(O)ORX, -OC(O)RX, or -ORX.

8. The compound of claim 6, wherein R2, R3, and R4are each independently H, D, methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium, oxygen or halogen atoms, and optionally substituted with one -OH or -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

9. The compound of claim 6, wherein R2and R3are H or D and R4is H, D, methyl, ethyl, n- propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

10. The compound of claim 6, wherein R3and R4are H or D and R2is H, D, methyl, ethyl, n- propyl, isopropyl, n-butyl, s-butyl, t-butyl, vinyl, allyl, ethynyl, or propargyl group optionally substituted with 1, 2 or 3 deuterium or halogen atoms, and optionally substituted with one -ORXor -CN, group; halogen, -CN, -OH, -OMe, or OCH2CH3.

11. The compound of claim 6 or 10, wherein R2is selected from, HO?, -CH3,12. The compound of claim 6 or 9, wherein R4is selected from -CH3,13. The compound of any one of claims 1-5, wherein the Warhead group is selected from14. The compound of any one of claims 1-5, wherein the Warhead group is selected from15. The compound of any one of claims 1-14, wherein -L- is -L2-, wherein -L2- is a covalent bond or a Ci-4 bivalent straight or branched hydrocarbon chain optionally substituted with 1, 2 or 3 deuterium atoms, wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(RX)-, -C(O)N(RX)-, -(RX)NC(O)-, -OC(O)N(RX)- , -(RX)NC(O)O-, -N(RX)C(O)N(RX)-, -S-, -SO-, -SO2-, -SO2N(RX)-, -(RX)NSO2-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(RX)-, -(RX)NC(S)-, or -(RX)NC(S)N(RX)-; and each occurrence of Rxis independently H or a Ci-6 straight or branched alkyl, alkenyl, or alkynyl group optionally substituted with 1 , 2 or 3 halogen atoms.

16. The compound of claim 15, wherein -L2- is a C2.4 branched hydrocarbon chain wherein 1 , 2, or 3 methylene units of the chain are independently replaced with -O-, -C(O)-, -C(O)O-, - OC(O)-, -or N(Rx)-.

17. The compound of claim 15, wherein -L2- is selected from -CH2-, -(CH2)2-, -(CTb)?-,18. The compound of claim 15, wherein -L2- is a covalent bond.

19. The compound of any one of claims 1-18, wherein the rSM meets at least one of the following conditions: a molecular weight (MW) less than 500 Da; no more than 5 hydrogen bond donors; no more than 10 hydrogen bond acceptors; and an octanol -water partition coefficient log P not greater than 5.

20. The compound of any one of claims 1-18, wherein the rSM has a molecular weight (MW) between 100 and 800 Da.

21. The compound of any one of claims 1-18, wherein the rSM has a molecular weight (MW) between 100 and 500 Da.

22. The compound of any one of claims 1-21, wherein the rSM is not an oligonucleotide.

23. The compound of any one of claims 1-21, wherein the rSM does not comprise a nucleoside or nucleotide.

24. An RNA conjugate, comprising a target RNA covalently attached to a compound of any one of claims 1-23, or a pharmaceutically acceptable salt thereof, wherein the target RNA has reacted with the epoxide of the Warhead group to form a covalent bond.

25. The RNA conjugate of claim 24, wherein the epoxide of the Warhead group has reacted selectively with a nucleobase of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof.

26. The RNA conjugate of claim 25, wherein the epoxide of the Warhead group has reacted selectively with a guanine of the target RNA upon contacting of the target RNA with the compound or a pharmaceutically acceptable salt thereof.

27. The RNA conjugate of claim 26, wherein the epoxide of the Warhead group has reacted with an N7 nitrogen of the guanine of the target RNA.

28. The RNA conjugate of any one of claims 25-27, wherein the RNA conjugate is inside a cell.

29. A method of covalently modifying a target RNA intracellularly comprising contacting a cell with a composition comprising a compound of any one of claims 1-23, or a pharmaceutically acceptable salt thereof.

30. The method of claim 29, wherein the epoxide of the Warhead group has reacted selectively with a nucleobase of the target RNA upon contacting of the cell with the compound or a pharmaceutically acceptable salt thereof.

31. The method of claim 30, wherein the epoxide of the Warhead group has reacted selectively with a guanine of the target RNA upon contacting of the cell with the compound or a pharmaceutically acceptable salt thereof.

32. The method of claim 31, wherein the epoxide of the Warhead group has reacted with an N7 nitrogen of the guanine of the target RNA.

33. A method of creating an abasic site in a target RNA intracellularly, comprising contacting a cell with a composition comprising a compound of any one of claims 1-23, or a pharmaceutically acceptable salt thereof.

34. A method of selectively and covalently modifying an RNA coding sequence intracellularly, comprising contacting a cell with a composition comprising a compound of any one of claims 1- 23, or a pharmaceutically acceptable salt thereof.

Images