A molecular motor and an optical method of controlling

Abstract

The invention relates to a molecular motor and a method of driving the molecular motor step-by-step on a track under bi-colour light irradiations. The molecular motor comprising a hairpin leg and a non-hairpin leg. The molecular motor can be instructed to move to specific states or positions on the track by illumination of alternate lights, such as ultraviolet light and visible light, presenting a translational molecular motor with capability of top-down control by selecting the irradiation wavelengths.

Description

A Molecular Motor And An Optical Method Of ControllingRelated Applications

[0001] The present invention claims priority to Singapore patent application no. 10202400631W filed on 7 March 2024, the disclosure of which is incorporated in its entirety.Field of Invention

[0002] The present invention relates to a non-intrusive method for top-down optomechanical control of nanoscale objects and single molecules via an advanced artificial molecular motor. The invention has wide applications across several industries, such as, in the areas of biomedical and chemical technologies.Background

[0003] Many industrial sectors require top-down control of small motion with microelectromechanical systems (MEMS), nano-electromechanical systems (NEMS) or nano- optomechanical systems (NOMS). These mainstream precision technologies, with their smallest objects under direct electrical or optical control being limited to hundreds of nanometers or above, are incapable of non-intrusive and high-throughput nanometers- resolved control or single-molecule control which is increasingly demanded by many nanotechnological industries.

[0004] Going beyond the MEMS / NEMS / NOMS-based precision technologies for non- intrusive high-throughput top-down nano-control will advance these industries for high- quality and cost-effective mass processing. A technical route along this direction of development is to replace MEMS / NEMS / NOMS with much smaller molecular motors, especially light-operated molecular motors that allow convenient top-down optomechanical control for potentially high-throughput mass processing. However, a molecular motor, unlike the largely deterministic MEMS / NEMS or NOMS, is a molecular object of stochastic nature, and ty p i cal 1 y makes an unpredictable number of steps under a top-down executed optical operation. This jeopardizes the precision and fidelity of motion control as the smallest motion under unambiguous top-down control is actually not the motor-enabled smallest motion (i.c., a single step by' a motor) but larger than it by a non-trivial and uncertain amount.

[0005] Currently there are molecular motors that are operated by top-down administered optical or electrical operations for small motion control, whilst other molecular motors are operated in a bottom-up manner, for e.g., by autonomous executed chemical reactions.

[0006] The first optically operated molecular motor is a synthetic small-molecule rotor from Feringa, et al., which is recognized by the 2016 Nobel prize in chemistry and has reported applications in actuation of microscale objects. This motor differs from the present invention in at least three aspects. Firstly, it is powered by a single colour of light irradiation, and therefore has no colour-based control of individual steps (which is one of the key features and a major function of the present invention). As a consequence, this prior art molecular rotor has an overshooting problem, i.e., a random number of steps being activated by an optical operation.Secondly, the motor from Feringa, et al. is a molecular rotor that requires non-trivial nanoscalc rotation-to-translation conversion mechanisms to control and scale up linear displacement (which is the most common ty pe of motion to be controlled in real-world applications). The present invention comprises a track-walking molecular motor that directly controls and scales up linear displacement.Thirdly, the rotor disclosed in Feringa, et al. is difficult for integration with biomolecules and also known for rather violent operation disrupting cell membranes because its core is a synthetic small molecule that is twisted 180-degree per light absorption around an individual chemical bond. On the other hand, the present invention is a deox ribonucleic acid (DNA) motor readily integrated with DNA or ribonucleic acid (RNA) systems through non- covalent Watson-Crick base pairing, or with protein systems through many natural DNA- binding proteins or the well-established chemistry of DNA-protein conjugation. Furthermore, according to an embodiment of the invention, the motor of the present invention is operated by azobenzene-mediated weakening of Watson-Crick base pairs, which is recommended for being mild and therefore applied to be used for safe biomedical applications.

[0007] Optically operated track -walking molecular motors disclosed in literature arc mainly' made of DNA and include several advanced motors capable of unidirectional motion for scalable and sustainable linear displacement and a few less advanced DNA nano walkers capable of only back-and-forth oscillating displacement within a limited range. These early optical unidirectional motors w hich arc mostly' from the lab of Feringa, all make a full step (with a stable ending state for population accumulation) by two colours of light irradiationwith the chance for successful step below 100% by a big gap. Attempts to saturate a full step by repeating the two-color operation inevitably results in a random number of steps, and therefore loss of control for a single step. This drawback is addressed by the present invention.

[0008] The molecular motors with bottom-up chemically fueled autonomous operation lose the top-down control targeted by the present invention but have already led to a variety of nano-robotic applications like nanoscale assembly lines, chemical synthesis, manipulation of nano-photonic components and molecular cargo sorting. The chemically fueled molecular motors in these nano-robotic applications (mostly via DNA origami-based nanorobots) may be replaced by the advanced motor from the present invention for top-down controlled optical operation, resulting in benefits not only in top-down controllability but also in clean waste-free optical operation.

[0009] There is therefore a need to provide a new molecular motor and a method of operation that overcomes the issues mentioned above.Summary

[0010] The following presents a simplified summary to provide a basic understanding of the present invention. This summary' is not an extensive ovendew of the present invention, and is not intended to identify key features of the invention. Rather, it is to present some of the inventive concepts of this invention in a generalised form as a prelude to the detailed description that is to follow.

[0011] In one embodiment, the present invention provides an optical method of controlling motion of a molecular motor on a track, comprising the steps of: choosing a molecular motor having a first leg and a second leg for binding on the track; selecting at least two colours of light irradiation wherein one colour fully saturates the first leg of the molecular motor and the second colour fully saturates the second leg of the molecular motor; repeating the alternate saturation of the first leg and the second leg until completion of movement of the molecular motor on the track.

[0012] In another embodiment, the molecular motor comprising a hairpin leg and a nonhairpin leg, wherein the molecular motor is capable of being driven on a track under repeated alternate light saturation of the hairpin leg and the non-hairpm leg.

[0013] The invention provides a low -cost but high-fidelity nano-optomechanical method and a working system to improve molecular motor-based precision technology' in the smallest controlled motion and also in the overall control fidelity, both beyond the levels afforded by previously reported artificial molecular motors.

[0014] Preferably, the molecular motor of this invention is a small molecule of singlestranded DNA that can be densely integrated into versatile DNA origami platforms by the established DNA nanotechnology, resulting in self-contained nano / micro-robotic systems for sustained and upscaled motor action and direct use in many precision-demanding technological applications.

[0015] Tire invention also comprises a non-intrusive method for top-down optomechanical nano-control through an advanced single-molecule motor that is much smaller than current MEMS / NEMS / NOMS but still retains a high level of top-down control fidelity inaccessible to prior art reported molecular motors.

[0016] The invention overcomes a general limit of intrusive nano-control that exists not only in MEMS / NEMS / NOMS but also in other mainstream top-down nano-control technologies such as magnetic tweezers, atomic force microscopy (AFM), and scanning tunneling microscopy (STM).

[0017] The invention thus goes beyond all the existing technologies to provide a new capability of top-down but non-intrusive nanometers-resolved control or single-molecule control, and thereby allows high-density parallel controls for high-throughput industrial applications.

[0018] In addition to the non-intrusiveness and high-throughput capabilities, the control method from the invention is fully bio-compatible and bio-integrable: the small biomolecular DNA motor can be linked with other biomolecules like DNA, RNA and proteins by their natural inter-binding abilities or established nucleic acid-peptide conjugation chemistry'. Like the MEMS / NEMS / NOMS-based methods, this new control method is force-capable as the molecular motor generates a finite force and the force can be amplified by' high-density' motor integration.Bncf Description of the Drawings

[0019] FIGs. 1A-1C illustrate a motor-track system, depicting a molecular motor of the present invention, a track and a schematic of the motor’s operation under alternating ultraviolet (UV) and visible light irradiations according to an embodiment;

[0020] FIGs. 2A-2D are graphs illustrating the operation of a motor from the track’s minusend according to an embodiment of the invention, obtained under alternating UV-visible light irradiations;

[0021] FIGs. 3A-3F are graphs illustrating the operation of a motor from the track’s minusend by a single UV-visible light cycle, according to another embodiment of the invention;

[0022] FIGs. 4A-4B are graphs illustrating the operation of a motor from the track’s middle site, according to another embodiment of the invention;

[0023] FIGs. 5A-5C are schematic diagrams of the tracks according to embodiments of the invention;

[0024] FIG. 6 is a table showing the major functional segments and their sequences according to an embodiment of the invention;

[0025] FIG 7 is a Polyacry lamide Gel Electrophoresis (PAGE) analysis of an annealed track and motor-track assembly according to an embodiment of the invention;

[0026] FIGs. 8A-8B are Polyacrylamide Gel Electrophoresis (PAGE) analysis of a legoverhang binding according to an embodiment of the invention;

[0027] FIGs. 9A-9H illustrate fluorescence measurements of leg-overhang binding with dye-labelled overhang strands and quencher-labelled leg strands according to an embodiment of the invention;

[0028] FIGs. 10A-10D illustrate raw fluorescence data of the motor operation and track- only control depicted for the embodiment of the invention shown in FIGs. 2A-2D;

[0029] FIGs. 11A-11D are graphs illustrating the operation of a motor operation starting from the track’s minus-end under alternating UV and visible light irradiations that each last 10 minutes according to an embodiment of the invention;

[0030] FIGs. 12A-12B are graphs illustrating the operation of a motor operation starting from the track’s minus-end under two cycles of UV / visible light irradiations that each last 30 minutes according to an embodiment of the invention; and

[0031] FIGs. 13A-13B are graphs illustrating the control operation of a motor operation starting from the track’s plus-end according to an embodiment of the invention.Detailed Description

[0032] In one embodiment, the present invention provides a new light-powered artificial molecular motor 101 and a bi-colour optical method for controlling the motor’s motiondown to every single step along a track 106. Specifically, each step of the motor 101 can be selected by light irradiation of a predetermined wavelength / colour for saturated optical driving but without overshooting for more than one step; this allows high-fidelity top-down optomechanical control of the motor’s single steps (~ 14 nm each step) as well as scalable displacement of multiple consecutive steps under alternating bi-colour driving. In this invention, the saturated driving for each single step can be realized by repeating low- intensity optical operations with minimum motor damage although each operation is apparently short of saturating a step (a reality now' and in foreseeable future due to many practical limits to optical driving of molecular motor systems).

[0033] Tire present invention will now be described in terms of the motor’s 101 design, tire fabrication procedure for the motor 101 plus its track 106, and the experimental data verifying the motor’s technical features in relation to the attached figures. Tire DNA sequences for the motor-track system that will be described arc only one of many possible embodiments of the present invention, hr other words, tire present invention is thus not limited to the examples given in the following description.

[0034] The core concept of the present invention is a single-stranded DNA (ssDNA) molecular motor 101 that makes a full directional step by UV light irradiation and makes another full step in the same direction by visible light irradiation, thereby the molecular motor 101 is operable to move continuously along a periodic track 106 under alternating UV-visible light irradiations. This bicolour driving for double-step operation is a more efficient optomechanical driving mechanism for molecular motors than the prior art bicolour-per-step driving. A full step by either the UV or the visible light driving further minimizes derailment and avoids the problem of unsettled middle state, thus removing a major hurdle for the top-down step control. Specifically, this new bicolour-driving mechanism prevents more than one step movement under either the UV or visible light irradiation until a colour change is applied, thus providing a w avelength- or colour-selected step-locking for better top-down control of molecular motors down to every individual step by maximized driving at either colour light activation. This motor 101 ’s minimal ssDNA construction is also advantageous for high-density integration with DNA origami platforms for optomechanical nano-dcviccs / robots.A bi-colour optomechanical method for controlling single steps of a bipedal molecular motor.

[0035] The first design feature enabling this bi-colour optical control method is the use of a hairpin leg and a non-hairpin leg for this bipedal molecular motor 101 to ensure opposite binding affinity of the two legs with the track under two colours of light irradiation, namely, low affinity for hairpin leg and high affinity for non-hairpin leg under the first colour, and high affinity for hairpin leg and low affinity for non-hairpin leg under the second colour. The two colours of light irradiation have w ell -separated wavelengths, one is within visible light (500 nm- 650 nm) and the other within ultraviolet light (~ 365 nm). The colourdependent affinity of the two legs is enabled by light-responsive azobenzenes that are engineered into the non-hairpin leg and into the other leg’s hairpin component that covers the leg’s major track-binding segment. Tire second design feature enabling this bi-colour optical control method is two colour-selected asymmetric two-legged binding states betw een the bipedal motor 101 and the periodic track 106 (with polarity defined by local binding sites that arc identical and repeated along the track): one state is uniquely accessible under tire first colour, but is disrupted upon irradiation by the second colour for a full handover-hand walking step towards a unique direction of the polar track - just one step maximally despite repeated irradiation of the second colour to saturate the stepping probability as the motor 101 is braked under the second colour and the intermittent dark periods. The other two-legged binding state is uniquely accessible under the second colour but disrupted upon irradiation by the first colour for a full hand-over-hand walking step towards the same direction as in the first step - again just one step maximally despite repeated irradiations of the first colour to saturate the stepping probability' as the motor 101 is now braked under this colour and the intermittent dark periods. The two types of steps, each selected and enabled by a single colour of light irradiation, are both full steps that start and end in stable two-legged motor-track binding states. The stable ending state accumulates and preserves the motor population that completes the step under repeated optical operations. This feature allows saturated driving of a colour-locked step towards a high chance of completion (i .e ., stepping fidelity) by repeating an imperfect optical operation that alone has a low chance of step completion. The same direction for both colour-sclcctcd steps is ensured by designed asymmetry of the two-legged states starting the steps: the trailing leg has high binding affinity and the leading leg low affinity; a colour change selectively dissociates the trailing leg off the track 106 (due to blocked low-affinity on-track bindingfrom the states’ design) but switches the leading leg to high affinity and on-track migration (hence, biasing the dissociated leg for forward hand-over-hand step). Advantage: This bicolour optomechanical method allows braking for the motor’s every individual step and therefore saturated driving for each step without overshooting. As a consequence, the fidelity to make a successful directional step - just one step, no more, and no less - by a top-down optical operation is much higher than known molecular motors because their optical driving often results in an uncontrollable number of steps. Therefore, the bi-colour control method of the present invention improves the smallest top-down controllable motion for molecular motor-based precision technology. In this invention, the saturated driving for each single step can be realized by repeating an optical operation though each operation alone is unable to saturate a step. Such an imperfect optical driving for molecular motors is a reality now and in the foreseeable future due to many practical limits. The perfect 100% effective driving for a motor step by an optical operation requires not only 100% photon absorption but also 100% effectiveness of the motor’s optomechanical conversion mechanism to activate and accomplish a directional step. The photon absorption may be improved by high-intensity light irradiation though optical damage to molecular motor systems also increases (especially for ultraviolet irradiation typically involved in light- powered molecular motors). But even 100% photon absorption cannot guarantee 100% occurrence of a desired mechanical activation (due to finite photoisomerization efficiency and often stability-capped density of light-absorbing moieties in a molecular motor) nor the subsequent rectification for a directional step (unless for a perfect motor design). The bicolour control method of this invention locks each step and allows its saturated driving by repeating many times an imperfect optical operation despite imperfect motor designs and low-intensity light irradiation (which is cheap and minimized system damage). This invention thus provides a low-cost nano-optomechanical method for high-fidelity step control, with a theoretical possibility for future optimization up to virtually deterministic control fidelity for every single step of a molecular motor. The practical feasibility of virtually deterministic control of molecular motors down to each step is unobvious (perhaps surprising to many) since a molecular motor, as a small molecule, is intrinsically stochastic and presumably overwhelmed by uncontrollable Brownian motion in its environment. This paradox is resolved by an early theoretical paper that explains feasibility of virtually deterministic control of molecular motors down to each step by a modest energy cost. Theopen question is how to realize this feasibility for real molecular motors. A concrete technical solution is provided by this invention.

[0036] A light-powered bipedal molecular motor capable of processive stepwise walking under repeated bi-colour driving, and therefore capable of accumulated nanoscale displacement that is highly controllable thanks to the bi-colour method for step control (enabled by the same light irradiations for bi-colour driving of processive steps). The motor’s steps all have the same size of ~ 14 nanometers per step: the motor has a similar size of ~ 14 nanometers across. The processive walking steps are enabled by the cooptimized motor-track designs (375’ alignment and lengths for legs and overhangs from the binding site; motor-track size match; location and number of azo-moieties for optical driving, etc.) to ensure the two colour selected states as the predominate motor-track binding states, to ensure their distinct asymmetry necessary' for directional light-powered steps, and to further ensure that a step triggered by a colour ends at a two-lcggcd binding state as the start for the next step to be triggered by applying light of the other colour. Hence the bipedal motor 101 makes processive hand-over-hand steps for accumulated nanoscalc displacement when the two colours are alternated and repeated. Advantage: Uris molecular motor 101 allows top-down execution of nanoscale displacement as a number of consecutive steps, with the total length of displacement better controlled by' the number of optical operations than previously' reported molecular motors. Thus, the molecular motor 101 of this invention amplifies the single-step control to a scalable displacement control, and thereby improves the overall control fidelity' of molecular motor-based precision technology.

[0037] The motor’s small size and single-molecule construction, which allow convenient and high-density integration of many motor copies in nano / micro-robotic systems for upscaled action. Specifically, the entire motor 101 is a single molecule, namely a singlestranded DNA (deoxyribonucleic acid) that is only 68-base long. The single-stranded DNA overhangs that form the track’s binding sites are 15-base or 10-base long. Advantage: This small single-stranded DNA motor 101 can be conveniently and densely integrated with many DNA origami structures to create nano / micro-robotic systems of diverse functions by capitalizing on the well-established DNA nanotechnology (for rich designability, sequencebased programmability, and nanometer-resolved functionalization). This is a major route towards commercial applications of this invention since the resultant nano / micro-robots are self-contained and directly usable for precision-demanding technological applications. Five specific targets of commercially viable application for the invention are identified and listedin paragraph

[0080] , As compared to the prior art nano / micro-robotic systems, those from this invention are advantageous in finer motion control, high control fidelity, remote and waster-free optical operation, biocompatibility (fully DNA-based), and high power density (due to bottom-up driving from many small molecular motors within a single robot).

[0038] A variation of the motor-track design with further reduced size to better facilitate high-density integration and upscaled action. Specifically, in this variation, the motor 101a is reduced to a 15-base single-stranded DNA molecule (no azobenzene now) by shifting the azobenzene -containing hairpin to the periodic DNA track 106a for the same purpose of colour-dependent opposite binding affinity, now between the track’s two types of binding sites for the azo-free motor 101a, namely, low affinity of the site with the hairpin and high affinity of the other hairpin-frcc site under visible light, and vice versa under UV light. This variation preserves the bi-colour control of single steps (again towards the same direction) and the motor’s proccssivc walking but with the single-molecule motor 101a reduced to 15- base long and all tire track’s overhangs capped at 34 bases or shorter (34 bases long for the overhang with the azo-containing hairpin, 15 or 10 bases long for other hairpin-frcc overhangs with or without azobenzenes). Advantage: This variation further miniaturized motor-track system, when compared with the first system 101-106, allows better quality of integration with DNA origami for nano / micro-robots: the motor 101a and the overhangs for the track 106a function can each be implemented as a short extension (below 35 bases) of a staple strand for a DNA origami, therefore allowing high-yield and high-quality integration into the origami simply through the origami’s fabrication by one-pot annealing.

[0039] A second variation 101b-106b is to minimize the azo-containing DNA strands for the motor or track for sake of cost effectiveness. This variation, which is applicable to both the first motor-track system (with the hairpin-containing motor) 101-106 and the second system (with the hairpin-containing track) 101 a-106a, is to remove the hairpin from the motor or the track but preserve the hairpin’s function by keeping the hairpin’s azo- containing segment ( 1 bases long) in another linear overhang near the motor or the track’s original hairpin overhangs. This extra overhang (as short as 20 bases) is conveniently introduced when the motor 101b or / and the track 106b are accommodated by a DNA origami, as the origami platform has a sufficient surface area for the extra overhang and also allows its site-selective arrangement. For the first system, this variation reduces the azo- containing motor 101b from 68 bases to 34 bases long (now a linear DNA molecule) and caps all other track 106b overhangs no more than 20-base long. For the second system, thisvariation caps all overhangs ofthe motor-track system 101b-106b at 20-base long or shorter. Advantage: For DNA origami-based functional nano-robots with high-density integration of the motor 101b from this invention, a major source of cost is the azo-containing DNA strands for the motor 101b or the track 106b’s overhangs. Shortening the length for these azo-containing DNA strands reduces the cost for commercial applications.

[0040] Scalability is not a limitation but an advantage for this invention due to the processive motor for accumulated displacement and due to the motor’s small size and single-molecule construction for easy integration with DNA origami upscaled action. The speed of controlled motion in this invention is reduced by repeated optical operations but improved by the resultant high fidelity for directional steps. As a balance of these two effects, the final speed is at the level of one substantially 14nm step by a few minutes for the optical operation from common lamps in commercial spectrophotometers (e.g., xenon lamp) and can be promoted to one substantially 14nm step by seconds for stronger light sources. The two levels of speed already meet the requirements of many applications that arc precision-demanding but not extremely speed-demanding. The UV light irradiation required for this invention is mild and safe for the DNA materials making up the motortrack system for the first level of speed (~ 14 nm by a few minutes). Note that an advantage of this invention is to allow use of weak optical driving for high level of control . The second level of speed (~ 14 nm by seconds) requires stronger UV. The UV damage to the DNA systems can be mitigated and the system durability improved by replacing the UV irradiation with infrared (IR) irradiation via up conversion nanoparticles (an established technique for IR-to-UV conversion) or two-photon excitation (for complete removal of UV).

[0041] The motor-track system for this invention requires an ionic liquid environment (typical solution for DNA) This imposes a limit to this invention when it is applied to precision technologies based on dry solid-state systems (not impossible but extra treatment is necessary, e.g.. sealing the DNA motor-track system plus the liquid in a transparent membrane). Nevertheless, this invention is directly usable for numerous applications in soft matter, chemistry, biotechnology, and medicine. Indeed, this invention is especially advantageous for biotechnological and medical applications since the DNA motor-track system and associated liquid are fully bio-compatible.

[0042] Currently, synthesis technology involves chemically fueled bridge-burning motors that are incapable of repeated operation. Applying the top-down controllable advancedmotor of this invention to the synthesis technology may lead to improvement in repeated operation, longer synthesized molecules, and better encoding flexibility and accuracy for the synthesis products. More emerging technologies may benefit from this invention, e.g., sub-diffusion positioning of nano-photonic components on demand, new precision technologies based on optomechanical actuation of soft matter, and so on.

[0043] This invention can be applied to several downstream nano-robotic systems. This invention is a ‘root’ technique as its DNA motor-track system is directly integrable with versatile DNA origami platfonns for a wide variety' of self-contained nano-robotic systems tailor-designed to target specific commercial applications. The possible materials required for this invention are Synthetic oligos and azo-modified synthetic oligos.

[0044] The present invention will now be described in terms of its motor’s design, the fabrication procedure for the motor 101 plus its track 106, and the experimental data verifying the motor’s technical features in relation to the attached figures. The DNA sequences for the motor-track systems to be described are only one of many possible embodiments for the motor and track designs of this invention. Thus, the present invention is not limited to the examples given in the following description.Motor Design

[0045] FIGs. 1A and IB show a design of the motor-track system according to an embodiment of the present invention. In FIGs 1 A- IB, the star marks the segments with azo- moieties; * denotes complementary sequence; ‘ denotes mutation (e.g., a point mutation in i*’ segment to help the hairpin opening under UV irradiation); ‘nt’ stands for nucleotides and ‘bp’ for base pairs. FIG. 1C illustrates the schematic of the motor’s operation under alternating UV and visible light irradiations. UV and VIS arrows denote movement induced by UV light and visible light irradiation, respectively. For example, states 1, 7, 8 and 9 are induced by visible light; while states 2, 3, 4, 5, 6 and 10 are induced by UV light.

[0046] Tire ssDNA motor 101 is a hairpin with a 15bp stem and a 34nt overhang; in FIG. 1A, ‘bp’ stands for base pair, ‘nt’ stands for nucleotide). The motor 101 has two 20nt leglike segments, i.e., a-b-c segments for leg A 102 and k-j-i for leg B 103, which can hybridize respectively with the bi-overhang binding site A 104 (i.e., neighbouring F1A, F2A with 21bp gap, see FIG IB, and bi-overhang binding site B 105 (neighbouring FIB, F2B with 21bp gap). These two types of bi-ovcrhang binding sites A, B arc alternately arranged on adouble-stranded backbone at a constant inter-site spacing (2 Ibp) to form a linear periodic track 106 (with its two polar ends marked as plus-end or minus-end in FIG. IB).

[0047] To demonstrate optical driving, the ssDNA motor 101 has azobenzene incorporated, which adopt trans or cis configuration under visible light or U V light to stabilize or disrupt DNA duplexes, respectively. Specifically, the motor’s leg A 102 carries 5 light-responsive azobenzenes (incorporated in the lOnt c segment); leg B 103 has none but the stem protecting this leg carries 5 azobenzenes too (in i*’ segment complementary to the leg’s lOnt / segment, in FIG. 1 A). Under visible light irradiation, leg A 102 is fully exposed as part of the motor’s overhang but leg B 103 is half protected (via its i segment) by the doublestranded stem. Hence, leg A 102 has full binding to site A 104, i.e., both its F1A and F2A overhangs, for a cartwheeling migration between the two overhangs (if the other leg is dissociated off the track 106, see state 7 in FIG. 1C). But leg B 103 has partial binding to site B 105, i.e., its FIB only, with the cartwheeling to F2B blocked by the closed hairpin (see state 1 in FIG 1C).

[0048] Under UV light irradiation, leg B 103 has full binding to site B 105 for cartwheeling between FIB and F2B (as in state 3) after UV-induced hairpin opening, but leg A 102 has partial binding to site A 104 (i.e., only F1A) with the cartwheeling to F2A blocked (by cis azobenzenes in the leg’s c segment, see state 6 in FIG. 1C). Thus, the two legs 102,103 always have different high or low binding affinity with the track 106 under the same light, and a new light will switch both legs 102,103 between the high and low affinity but in an opposite way. This colour-dependent converse affinity control for the two legs 102,103 ensures the motor’s efficient plus-end directed motion on the track 106 under alternating UV-visible light irradiations, as schematically illustrated in FIG. 1C.

[0049] Due to the converse leg affinity and size restriction, the motor 101 under visible light forms an asymmetric but stable inter-site state, i.e., state 1 in FIG. 1 C, in which leg A 102 (rear leg) hybridizes with the 15nt F2A (binding site A) and leg B 103 (front leg) hybridizes with the adjacent Wnt FlB (binding site B). Under UV light irradiation, the motor lOl forms another stable asymmetric intcr-sitc state, i.e., state 6, in which leg B 103 (rear leg) hybridizes with the 15nt F2B and leg A 102 (front leg) hybridizes with the adjacent lOnt F1A.

[0050] In FIG. 1C, the motor 101 operation starts under visible light irradiation from state 1. Applying a UV irradiation switches leg A 102 to low binding affinity for its dissociation from the F2A (i.e., selective rear leg dissociation) but fully exposes leg B 103 (via hairpinopening) for spontaneous downhill cartwheeling from the lOnt FIB to the 15nt F2B (see states 2-5). The cartwheeling, which is a directional intra-site displacement of the trackbound leg to the track 106’s plus-end, places the dissociated leg A 102 near the F1A overhang in front for their hybridization (see state 6). Both the cartwheeling of leg B 103 and the ensuing binding of leg A 102 with Fl A can be completed under the UV irradiation to bring the motor 101 to state 6. Thus, UV irradiation alone can drive the motor 101 from state 1 to state 6, resulting in a hand-over-hand step to displace the center of mass of the motor 101 to 42 bps (~ 14 nm) towards the plus-end of the track 106. This is a full step for the motor 101 as the ending state (i.e., state 6) remains stable as long as the UV irradiation lasts and until the UV is replaced bv visible light irradiation.

[0051] The visible light irradiation resumes leg B 103’s low binding affinity for its dissociation off F2B (selective rear leg dissociation, via toehold-mediated strand displacement upon hairpin closing), and also resumes leg A 102’s high binding affinity for its downhill intra-site cartwheeling (from lOnt F1A to 15nt F2A) to place the dissociated leg B 103 near the front FIB for hybridization (sec states 7-9). Similar to UV irradiation, visible light irradiation alone can drive another ~ 14mn full step of the motor 101 to the track 106’s plus-end, with the ending state as state 1 that is stable under the visible light but ready for the UV -induced frill step again. Hence, the motor 101 under alternating UV and visible light irradiations will move continuously on the periodic track 106 by the two types of full steps towards the same direction (plus-end). The motion of the motor 101 is processive as the converse affinity control for its two legs 102,103 suppresses the chance of simultaneous weak binding for both legs 102,103, i.e., the channel for the motor 101 to derail off the track 106.

[0052] The UV-induced leg rehybridization off a track has turned out to be an effective mechanism for optical driving of DNA molecular motors 101 (by use of azo-carrying legs). Prior art motors exploiting this driving mechanism but without the converse affinity control typically have the front leg’s forw ard intra-site displacement halted under the UV irradiation that dissociates the rear leg from a two-legged motor-track binding state (like state 1 or 6 in this invention). Hence the motor 101 remains in a low-affinity single-legged binding state under UV irradiation as the dissociated leg cannot access the front binding site due to the frustrated displacement of the track-bound leg (like the exposed leg B 103 in state 2 unable to access the front F1A, sec FIG. 1C).

[0053] For a full forward step starting and ending at stable two-legged states, the motor 101 must further undergo a visible light irradiation to complete the track-bound leg’s intra-site displacement for the dissociated leg to bind the front site. But the leg always has a chance to resume its hybridization ability before the track-bound leg’s migration, and thus bind the closer back site to result in a futile step. Consequently, a UV irradiation plus a visible light irradiation is necessary for a single full step, and this optical driving is less efficient not only for two irradiations per step but also for the inevitable futile steps that are impossible to suppress by prolonging the UV or visible light irradiation. Long UV irradiation also increases the chance of motor derailment off the low-affinity intermediate state.Fabrication

[0054] To verify the technical features of the motor 101, two track 106 versions are fabricated and characterized (see schematics in FIG. 5 for different track versions): version 1 has its FIB overhang mutated for lower binding affinity with leg B 103 to make its F1B^F2B cartwheeling more downhill (by removing 2 nucleotides from FIB’sj * segment and further introducing a point mutation in k* segment): version 2 keeps the native FIB and has an extra F 1 A overhang to form a full F 1 A-F2A bi-overhang site at the minus-end. These tracks are fabricated by an annealing procedure and characterized using polyacrylamide gel electrophoresis (PAGE, see FIG. 7). The fabrication method is elaborated further below. The DNA sequences for the fabricated motor-track systems are also described below.

[0055] In the sequence choice for leg A 102, leg B 103 and complementary binding overhangs, special cares are taken to avoid unwanted cross-binding of leg A 102 with FIB or F2B and of leg B 103 with F1A or F2A. The fluorescence and PAGE studies using truncated azo-free leg / overhang strands confirm that these unwanted bindings are minimal (~ 10% versus > 80% for the desired bindings of leg A with Fl A or F2A and leg B with FIB or F2B, see FIG. 3, FIG. 8, FIG. 9). The motor 101 thus has fairly exclusive bindings of leg A 102 with site A and leg B 103 with site B to suppress undesirable motor-track binding states that compete with state 1 or state 6 (c.g., intra-site states in which the motor’s leg A 102 hybridizes with F2A and leg B 103 hybridizes with Fl A of the same bi -overhang site A under visible light, or the motor’s leg B 103 hybridizes with F2B and leg A 102 hybridizes with FIB of the same binding site B under UV light irradiations).Experimental data verifying the technical features of the motor

[0056] Operation of the motor 101 according to an embodiment of the invention is studied by site-controlled motility experiments in which the motor 101 is initially bound to the track’s minus-end to form state 1, or to the track’s middle to form state 6 under a UV treatment. To report the on-track motion of the motor, the ssDNA motor 101 is labelled with quenchers 107 on both ends (see FIG. 1 A) and the track 106 is labelled with three different dyes (see FIG. IB) subject to quenching by the motor 101 when it forms state 1 at the track 106’ s minus-end or plus-end or state 6 in the middle (in FIG. 1C). Following previous studies, the fluorescence from the site-controlled motor-track assembly under alternating UV / visible (UV / VIS) light irradiations is divided by the fluorescence from a track -only control experiment to remove influence of dye photoblcaching (negligible or below 10% for three used dyes, see FIG. 10). The control-calibrated fluorescence signal indicates relative motor population at different sites (the lower the signal, the higher the population at a binding site). The signal before and after tire optical operation confirms the initial sitespecific motor placement (by apparently higher population at the desired site, sec FIGs. 2A, 2B and FIG. 4A) and the motor’s light-driven motion (see FIGs. 2-4).

[0057] The fluorescence motility experiments with the motor 101 started from the minusend verify the motor’s ability to make two plus-end directed steps per UV -visible light cycle (see FIG. 2A). Immediately after the first UV irradiation, the fluorescence of the minus-end dye rises and the fluorescence of the middle-site dye drops, indicating a UV-induced step from the minus-end site to the middle-site, i.e., state 1 to state 6 in FIG. 1C. When the irradiation is switched to visible light, the middle-site fluorescence rises rapidly and the plus-end fluorescence starts to drop below its initial value prior to the first UV light irradiation, indicating a visible light-induced step from the middle-site to the plus-end site, i.e., state 6 to state 9. These distinct fluorescence patterns suggest processive translocation of the motor 101 from the minus-end to the plus-end through the middle-site by a single UV / VIS light cycle. The same fluorescence patterns for the three sites repeat for later UV / VIS cycles, with a successively increasing profile for the minus-end fluorescence, a successively decreasing profile for the plus-end fluorescence, and a slightly decreasing profile for the middle-site fluorescence. These fluorescence profiles arc again consistent with a processive motor flow through the middle site (with both incoming and outcoming motor, hence a profile between the oppositely divergent profiles for minus- and plus-ends). The motor-track version 1 and version 2 show almost identical fluorescence patterns butwith larger magnitude of minus-end fluorescence rise and plus-end fluorescence drop for version 1 than version 2. This is consistent with the expectation of better plus-end directed motility for the motor 101 when its intra-site cartwheeling towards the plus-end is more downhill.

[0058] The motor’s ability for two full steps per UV / VIS cycle is further confirmed by a single-cycle motility experiment with different UV durations (5m, 10m, 30m, 60m) but the same visible light duration (10m) for sake of comparison. All the single-cycle data for motor-track version 1 and version 2 replicate the characteristic fluorescence patterns for the motor’s UV-induced step from the track’s minus-end to the middle-site and a visible-light- induced second step from the middle-site further to the plus-end (see FIGs. 3A-3D). For the present 6-ovcrhang track 106, a single step is indeed insufficient for the minus-end started motor to reach the plus-end, but such a long-range translocation (requiring two consecutive steps) is necessary for the gain of motor population at the plus-end as signified by the net fluorescence drop there below the pre-operation level after the single UV / VIS cycle (note the smaller net drop of final middle-site fluorescence in FIG. 3B,3D that indicates a slight motor population gain too at the middle-site; hence the plus-end gain of motor population must come from initial motor population at the minus-end). Thus, the net plus-end fluorescence drop from the single-cycle experiment provides one more evidence for the motor’s two consecutive steps induced by a single UV / VIS cycle.

[0059] With the UV irradiation prolonged from 5 minutes to 10, 30, and 60 minutes, the single optical cycle produces increasingly bigger plus-end fluorescence drop for both version 1 and version 2 (see FIG. 3A,3C). This is expected as a longer UV is more effective to dissociate the motor’s leg A 102 off the minus-end F2A overhang and open the hairpin at leg B 103 for the motor’s translocation from the minus-end to the middle-site (hence biggest UV-induced middle-site fluorescence drop for 60min. UV in FIG. 3B for version 1 and in FIG. 3D for version 2). A single cycle of 60min. UV followed by 60min visible light results in a net plus-end fluorescence drop near that from six cycles of lOmin. UV and lOmin. visible light per cycle or from two cycles of 30min. UV and 30min. visible light per cycle (see FIG 3E versus FIG. 1 IB, FIG. 12A for track version 1 and FIG. 3F versus FIG. 1 ID, FIG. 12B for track version 2). The three types of optical operation have the same total durations for UV and visible light irradiations, and the similar level of resultant plus-end directed motor translocation suggests the possibility of effectively controlling the motor’s individual steps by a single prolonged irradiation of either UV or visible light. This had beenimpossible for prior art light-powered DNA motors with an unsettled low-affinity state between the UV and visible light irradiations.

[0060] The motor lOTs direction towards the track 106’s plus-end is further supported by the middle-site start experiment and a control experiment with the motor 101 started from the plus-end. The plus-end start experiment, with the motor 101 initially prepared in state 1 at the plus-end (i.e., state 9 in FIG. 1C), yields a virtually flat fluorescence profile for the middle-site and minus-end under cyclic optical operation (see FIG. 13), despite successively increasing fluorescence forthe plus-end (likely due to motor dissociation from 1 Ont terminal FIB under UV, see state 10 in FIG. 1C). These data indicate negligible backward motion of the motor 101 from the plus-end to the middle-site and the minus-end. In the middle-site start experiment, the motor 101 is initially prepared in state 6 under UV as confirmed by the apparently more quenching of the middle-site dye than the dyes at the minus- and plus-ends (FIG. 4A). A visible light irradiation triggers the motor 101’s on-track motion, which is more towards the plus-end than tire minus-end as indicated by double fluorescence drop at the plus-end compared to the minus-end (FIG. 4B).

[0061] The minus-end start experiment and the plus-end start control, which both have tire motor 101 initially in state 1 but located at opposite terminal ends of the track 106, prove that the motor 101 bound between the pair of neighbouring F2A and FIB overhangs always moves towards the plus-end under UV irradiation regardless of location of the overhang pair. This is true even if the (F2A, FIB) pair is located in the middle of the track 106 to be sandwiched by another pair of neighbouring overhangs F2B, Fl A on both sides (see FIG. IB): then the motor 101 under UV irradiation still moves to the (F2B, F1A) pair in front to form state 6 (as proven by the minus-end start experiment) but not to the same (F2B, F1A) pair behind (as proven by the plus-end start control). The UV -induced step from the (F2A, FIB) pair has indeed a good directionality with apparent forward motion shown in FIG. 2A,2B versus negligible backward motion shown in FIGs. 13A-13B. The middle-site start experiment further proves that the motor 101 bound between the second pair of ncighbounng overhangs (F2B, F1A), which is sandwiched by the (F2A, FIB) pair on both sides as shown in FIG IB, moves preferentially towards the (F2A, FIB) pair in front under visible light irradiation. This confirms that the visible light-induced step from the (F2B, Fl A) pair also has a net directionality towards the plus-end (though not as good as the UV- induccd step). Altogether, these experimental observations lead to the conclusion that the motor 101 is capable of plus-end directed motion on any long track under cyclic UV / VISoperation, since the track 106 is essentially a periodic array of both overhang pairs (F2A, FIB), (F2B, F1A) alternately arranged on a duplex backbone.Fabrication Procedure for The DMA Motor and Track

[0062] The tracks 106 used in this invention are schematically illustrated in FIG. 5, with all constituent strands labelled. The sequence for track’s backbone strand (TSO in FIGs. 5A- 5C) was obtained from Z-DNA. The sequences for the binding sites (TS1 - TS6) and for the motor strand were generated by CANADA, checked using mfold and NUPACK, and manually adjusted to remove undesired secondary structure and minimize crosstalk outside the desired leg-site binding (i.e., leg A 102 with binding site F1B-F2B; leg B 103 with site Fl A-F2A). The track 106 was formed by mixing the constituent ssDNA oligos at equimolar ratio in TE buffer (10 mM Tris, 0.1 mM EDTA, pH 8.0) with 150mM NaCl. The mixture was annealed in a thermal cycler (C1000 Touch Thermal Cycler, Bio-Rad) at 95°C for 20 minutes and gradually cooled down to 20°C at a rate of -0.1°C / min. The motor-track assembly 101-106 was annealed by a similar procedure for operation experiments. The annealed products were analysed using Polyacrylamide Gel Electrophoresis (PAGE) against Low Molecular Weight DN A Ladder (New England Biolabs). Gels were stained by GelRed Nucleic Acid Gel Stain (Biotium) for 15 minutes before observation in Gel Doc EZ Imager (Bio-Rad).

[0063] To prepare the motor 101 starting at the track 106’s minus-end, a partial track with the motor 101 was first formed by one-pot annealing using an equimolar mixture of the motor strand, the track’s backbone (TSO), and another four strands (TS1 - TS4) forming the track’s three overhangs F2A, FIB, F2B from the minus-end. This annealed product has the motor 101 bound between F2A and FIB to form state 1 at the minus-end (as shown in FIG. 1C) because the F2B overhang has low binding affinity for the motor 101 before any UV irradiation. The annealed product was then mixed with strands TS5, TS6 to form the plusend site (equimolar ratio; incubated for 40 minutes at room temperature). This assembly method produced the full track with the motor 101 initially at the minus-end. Forthc control experiment with tire motor 101 starting at the track 106’s plus-end, a partial track with the motor 101 was first annealed using an equimolar mixture of the motor strand, the track’s backbone TSO and strands TS3 - TS6, and then incubated with TS2 (for the track’s minusend site) for 2 hours (1: 1 molar ratio, room temperature).

[0064] To prepare the motor 101 starting at the track 106’s middle-site, the motor 101 sample was first irradiated by UV light for 2 hours (using Shimadzu RF6000 Spectro fluorophotometer, 20nm excitation slit) to open the hairpin at leg B 103, and then mixed with the annealed full track 106 for 1 hour under continued U V irradiation (equimolar ratio, room temperature). The motor-track binding under the UV light produced a motor-track assembly with the motor 101 initially bound with F2B and F1A overhangs to form state 6 in the middle of the track 106 (as shown in FIG. 1C). This sample was subsequently irradiated by visible light for the motor 101 ’s motion.UV-Visible Light Operation of DNA Motor & Fluorescence Measurement

[0065] The motor operation and fluorescence measurement were performed with Shimadzu RF6000 Spectro fluorophotometer with motor-track samples all at WnM concentration and at room temperature (25°C). The low concentration was used to minimize the chance of a motor crosslinking tw o tracks for motor-track aggregation. Tire motor-track samples were irradiated by repeated cycles of alternating UV light (365nm) and visible light for the motor’s driving and also for the fluorescent motility detection (at 5nm excitation slit and 3nm emission slit). Visible light irradiations were chosen at excitation wavelengths for the fluorophores and their emissions were collected (495nm excitation, 520nm emission for FAM; 620nm excitation, 624nm emission for ATTO590; 649nm excitation, 662nm emission for ATTO647N). To account for the effects of fluorescence photobleaching, each operation experiment was accompanied by a track-only control experiment for the same track amount / concentration and under the same operation / detection procedure. The control showed weak photobleaching (negligible for ATTO590 and ATTO647N and < 10% for FAM, see FIG. 10). To further remove influence of the photobleaching, the motor-track fluorescence was divided by this track-only fluorescence to produce control-calibrated signal that is independent of the photobleaching effects.

[0066] Examination of leg A-binding site B and leg B-binding site A crosstalk: The unwanted binding between the motor’s leg A 102 and site B (made of FIB and F2B overhangs) and between leg B 103 and site A (made of Fl A and F2B) were checked by PAGE (see FIG. 8) and by a fluorescence experiment (sec FIG. 9), both using truncated leg / overhang strands (see FIG. 8 for PAGE results and FIG. 9 for the fluorescence data, together with sequences for the used leg / overhang strands). In the fluorescence experiment, equimolar mixing of a quencher-labelled leg strand and a Cy3-labelled overhang strand wasmonitored using Cary Eclipse fluorescence spectrophotometer (549nm excitation and 563nm emission for detection of Cy3 fluorescence). Each leg-overhang combination, if hybridizing into a duplex, will have -100% contact quenching. The fluorescence quenching was > 80% for leg A + F2A, leg A+ F1A, leg B + F2B, and leg B + FIB mix (see FIG. 9), indicating effective binding for all the four leg-overhang combinations. However, the fluorescence quenching was ~ 10% for leg A + F2B, leg A+ FIB, leg B + F2A, and leg B + Fl A mix, indicating minimal binding for these four leg-overhang combinations. Hence the desired leg A-site A and leg B-site B bindings are effective, while the unwanted leg A-site B and leg B-site A bindings are minimal.

[0067] Tire conclusion was further supported by the PAGE study. The legA+F2A and lcgB+F2B lanes in FIGs. 8A-8B show effective binding for the two leg-overhang combinations as the leg band disappears but a new band of higher molecular weight appears in cither lane. No band for even lower molecular weight is seen in the lane of leg A+F1A+F2A, suggesting preference of leg A to hybridize with the longer F2A over F1A. The leg A+F2B lane and leg B+F2A lane do not show any binding for the two leg-overhang combinations as no new band is seen other than separate bands for each leg or overhang; similar are the leg A+F1B and leg B+F1A lanes. These four lanes confirm minimal leg A- site B and leg B-site A crosstalks. The Leg A+F1A and leg B+F1B lanes have no new band either, again suggesting weaker binding for the two leg-overhang combinations than leg A+F2A and leg B+ F2B (with longer complementary sequences).

[0068] A specific choice of DNA sequences forthe motor-track design (FIGs. 5A-5C to 7): The motor-track system based on the following DNA sequences are used to generate the experimental data in this technical description. The motor’s major functional segments and assigned nucleotide sequences are listed in FIG. 6, following the segment notations in FIGs. 1A-1B.

[0069] FIG. 6 shows major functional segments and their sequences (X denoting azobenzene moiety; the point mutation in i *’ segment to help UV-induced hairpin opening is underlined). Below is the full sequence of the ssDNA motor 101: Motor strand = 5’-BHQ2-c-b-a-(dT)4-k-j-i-h-(dT)4-h*-i*’-BHQ2-3’5 ’ -BHQ2-GAXTCXATXGGXCTX-GAGGT-ACACT-TTTT-CAGCT-CACGC- CCTACTGTTA-AATCG-TTTT-CGATT-XTAXTCXAGXTAXGG- BHQ2-3 ’The tracks 106 used for version 1 and version 2 of the motor-track system arc schematically' illustrated in FIGs 5A-5C, with all the constituent DNA strands named. The basic track ismade of 7 strands (TSO to TS6), which are adjusted slightly for the two versions of motortrack system. The 7 strands for the basic track are:• TS0(6 *2 Int) = 5 ' - GATTTGCTGCTTTCCATTGAG-CCTGTTTCTCTGCGCGACGTT-CGCGGCGGCACTTACGGAGCT-AATTCGGTCTCGCACTTACGG-CCAATGCTTCGTTTCGTATCA-CCGACCGTCTTCTGCCGTGTT -3’• TSl(b*-c*-21nt) = 5’-ACCTCAGCCATGATC-CTC AATGGAAAGCAGCAAATC-3 '• TS2(j*-k*-21nt-ATTO647N) = 5’- GCGTGAGCTG- AACGTCGCGCAGAGAAACAGG-ATTO647N -3’• TS3 (2 Int) = 5 AGCTCCGTAAGTGCCGCCGCG -3 ’• TS4(21nt-i*-j*) = 5’- CCGTAAGTGCGAGACCGAATT- TAACAGTAGGGCGTG -3’• TS5(b*-c*-21nt-a*-b*-ATTO590) = 5’- ACCTCAGCCATGATC-TGATACGAAACGAAGCATTGG-AGTGTACCTC-ATTO590 -3’• TS6(FAM-j*-k*-21nt) = 5’- FAM-GCGTGAGCTG-AACACGGCAGAAGACGGTCGG -3’

[0070] The track 106 for version 1 of the motor-track system is the same as the basic track except for TS2 being replaced by TS2’ that has a mutated and shortened FIB overhang (namely, j* segment shortened from 5nt to 3nt, and k* segment with a mutation as underlined in the sequence below):TS2’(j*’-k*-21nt-ATTO647N) = 5'-GTG-AGATG-AACGTCGCGCAGAGAAAC'AGG- ATTO647N-3'Track 106 for version 2 of the motor-track system is the same as the basic track except for TS 1 being replaced by TS 1 ’ that has an extra F 1 A overhang at the minus-end:TS1’ (b*-c*-21nt-a*-b*) = 5’- ACCTCAGCCATGATC-CTC AATGGAAAGCAGCAAATC-AGTGTACCTC -3 ’

[0071] FIG. 7 is a Polyacrylamide Gel Electrophoresis (PAGE) analysis of annealed track and motor-track assembly. Here version 2 motor-track system is shown for an example, with all bands obtained using 8% PAGE gel and 80V for 60 minutes. The first lane (from left) isfor the track (shown in FIG. 5C); the 3rd lane is for the templates strand (TSO); the 4th to 6th lanes are for other three constituent strands (TSF, TS2, and TS3). The first lane is obtained using the annealed track sample (equimolar ratio for all constituent strands); the 2nd lane is obtained using the track-motor assembly formed by one-pot annealing (equimolar ratio again). The first lane shows one prominent band plus minimal nearby bands and all bands for the four constituent strands disappear. This suggests formation of the full track that is identified as the major band. The 2nd lane further shows upshifted bands but disappearance of the motor band, suggesting motor binding onto the track. The 7th lane for the motor 101 displays 2 bands, likely due to 2 secondary structures corresponding to the hairpin opened or closed.

[0072] FIGs. 8A-8B arc Polyacrylamide Gel Electrophoresis (PAGE) analysis of legoverhang binding. FIG. 8 A shows the motor’s leg A 102 versus the right binding overhangs (F1A, F2A) and the wrong binding overhangs (FIB, F2B). FIG. 8B shows the motor’s leg B 103 versus the right binding overhangs (FIB, F2B) and the wrong binding overhangs (F1A, F2A).

[0073] The lanes for leg-overhang binding (4th to 8th from left in FIG. 8A, 4th to 7th in FIG. 8B) are obtained with annealed equimolar binding complexes. The PAGE analysis is all done using truncated ssDNA strands of only leg and overhang sequences (strand for leg A = 5’-c-b-a-3’ = 5'- GATCATGGCT-GAGGT-ACACT -3'; leg B = 5 ’-k-j-i-h-3’ = 5'- CAGCT-CACGC-CCTACTGTTA-AATCG -3'; F1A = 5’-a*-b*-3’ = 5'- AGTGT-ACCTC -3', F2A = 5’-b*-c*-3’ = 5'- ACCTC-AGCCATGATC -3'; FIB = 5’-j*-k*-3’= 5'- GCGTG- AGCTG -3'; F2B = 5’-i*-j*-3’ = 5'- TAACAGTAGG-GCGTG -3'). All bands are obtained using TBE buffer, 20% gel, and 60-80V for 120-150 minutes.

[0074] FIGs. 9A-9H are fluorescence measurements of leg-overhang binding with dye- labelled overhang strands and quencher-labelled leg strands. Each leg-overhang combination (as indicated in component figure) is mixed at the time marked by the arrow and the fluorescence is detected to monitor the binding process (1 : 1 molar ratio at 50nM concentration in TE buffer with 150mM Na+). Shown in each component figure is the fluorescence normalized to the initial value. The time -dependent drop of this normalized fluorescence reflects the leg-overhang binding. All the data arc obtained using truncated overhang strands labelled with Cy3 dye and truncated leg strands labelled with BHQ2 quencher (leg A = 5’-c-b-a-BHQ2-3’ = 5'- GATCATGGCT-GAGGT-ACACT-BHQ2 -3'; leg B = 5’-k-j-i-BHQ2-3’=5’- CAGCT-CACGC-CCTACTGTTA-BHQ2 -3'; F1A = 5’-Cy3-a*-b*-3’ = 5'-Cy3-AGTGT-ACCTC -3'; F2A = 5’-Cy3-b*-c*-3’= 5'-Cy3-ACCTC- AGCCATGATC -3'; F2B = 5’-Cy3-i*-3' = 5'- Cy3-TAACAGTAGG-3'; FIB = 5’-Cy3- i* / 2-j*-k*-3’ = 5'- Cy3-GTAGG-GCGTG-AGCTG -3').

[0075] FIGs. 10A-10D are raw fluorescence data of the motor operation and track-only control for FIGs. 2A-2D. The data in FIG. 10B divided by the data in FIG. 10A yields the control-calibrated data shown in FIG. 2A. The data in FIG. 10D divided by the data in FIG. 10C yields the control -calibrated data shown in FIG. 2C.

[0076] FIGs. 11 A-l ID show the motor operation starting from tire track's minus-end under alternating UV and visible irradiations that each last 10 minutes. These figures are all the same as for FIGs. 2A-2D except for the different UV / visible light durations.

[0077] FIGs. 12A-12B show the motor operation from the track’s minus-end under two cycles of UV / visible light irradiations that each lasts 30 minutes. These figure are all the same as FIG. 2B, 2D except for longer irradiations.

[0078] FIGs. 13A-13B show the control experiment of motor starting from the track’s plus -end. The shown data arc for motor version 2 based on the track in FIG. 5C (without TS 1 ’ strand). This track can accommodate the motor’s backward translocation via state (see FIG. 1C) for quenching of ATTO590 dye at the middle-site in states 7, 8 and for quenching of ATTO647N at the minus-end in states 4 and 3. But neither quenching is observed, indicating the motor’s negligible backward motion to the middlesite and minus-end. The data are obtained under alternating UV and visible irradiations that each last 10 minutes (first UV starting at time zero). As for FIGs. 2A-2D, the fluorescence from each dye in FIG. 2A minus its own starting value at time zero yields the data in FIG. 2B.

[0079] The present invention has wide applications, and the invention method can be used to enhance or even replace the present mainstream top-down nano-control technologies in many existing applications for expansion towards non-intrusive and high-throughput operation. This invention can be applied to areas of biomedical technologies and chemical technologies. The motor 101 of this invention is directly applicable for system compatibility (e g., liquid environment, biocompatibility) and the need for better molecular control is uniquely satisfied by the invention (c.g., prccision / fidclity for top-down control plus nonintrusiveness, high throughput, and even force-required manipulation).

[0080] Specific examples include: (1) sequencing technologies for DNA, RNA, and proteins, especially commercial sequencers based on amplification-free single-moleculesequencing technologies, which involve many molecular control tasks (necessarily nonintrusive in a compact sequencer) and need better control methods to further improve sequencing performance (e.g., accuracy, read length) and reduce cost; (2) enzymatic synthesis of long DNA molecules (a relatively new industrial technology supplying for the markets of synthetic biology, DNA nanotechnology, and DNA information storage), which needs better non-intrusive dynamic control of growing DNA molecules to further improve product length and accuracy; (3) peptide synthesis on demand for peptide nanotechnology, especially enzymatic synthesis techniques that are again in need of non-trivial product control; (4) high-throughput drug screening technologies, especially latest expansions towards force-dependent manipulation of target protein molecules for binding small- molcculc drug candidates; (5) high-throughput proteomics technologies, which is also being extended towards force-dependent protein manipulation and analysis.

[0081] The above examples of existing industrial technologies arc enhanced by the present invention for commercial gains in performance improvement, capability expansion, and cost reduction. There arc also commercially viable emerging technologies that may be improved by this invention, including a new chemical synthesis technology enabled mainly by molecular motors, sub-diffusion positioning of nano-photonic components on demand, and new precision technologies based on optomechanical actuation of soft matter.

[0082] Although various aspects and embodiments of the present invention have been described above, it should be noted that the scope of the invention is by no means limited to the exemplary embodiments described above. The above description of the exemplary embodiments of the present invention merely serves to aid in the understanding of the underlying principle behind the present invention. The present invention is not to be construed as being limited to the illustrated embodiments either.

Claims

CLAIMS1. An optical method of controlling motion of a molecular motor on a track, comprises : choosing a molecular motor having a first leg and a second leg for binding on a track; selecting two colours of light irradiation wherein one colour saturates the first leg of the molecular motor and the second colour saturates the second leg of the molecular motor, and repeating alternate saturation of the first leg and the second leg until completion of movement of the molecular motor on the track.

2. The optical method according to claim 1 , wherein the two colours of light irradiation is ultraviolet (UV) light and visible light.

3. The optical method according to claim 1 or 2, wherein the first leg and second leg is a hairpin leg and a non-hairpin leg, respectively.

4. The optical method according to any one of claims 1 to 3, wherein the track has polanty defined by two asymmetric binding states that arc repeated alternately along the track.

5. A molecular motor comprising a hairpin leg and a non-hairpin leg, wherein the molecular motor is operable to be driven on a track under repeated alternate light saturation of the hairpin leg and the non-hairpin leg, with the molecular motor moving one step at a time.

6. The molecular motor according to claim 5, wherein the molecular motor is a singlestranded DNA molecular motor that makes a full directional step on the track by UV light irradiation and makes another full step of the same direction by visible light irradiation.

7. The molecular motor according to claim 6, wherein the single-stranded DNA molecular motor is operable to integrate with DNA or RNA system.

8. The molecular motor according to claim 7, wherein the molecular motor is a 15- base, single-stranded DNA molecule9. The molecular motor according to claims 5 to 8, wherein the size of the step is substantially 14 nanometers.

10. The molecular motor according to claim 9, wherein the size of the molecular motor is substantially 14 nanometers.

Images