Functionalized biological reactants
Patent Information
- Application Number
- PCT/US2025/018504
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-06
- Filing Date
- 2025-03-05
- Publication Date
- 2025-10-02
AI Technical Summary
Existing biological sequencing methods face challenges in efficiently attaching biological reactants, such as oligonucleotides, to substrate surfaces in a controlled orientation, particularly under storage stress, which affects the stability and functionality of these reactants.
The use of norbomenyl-functionalized or trans-cyclooctene-functionalized oligonucleotides that can be attached additively-free to a polymeric hydrogel, enhancing stability and enabling controlled orientation on substrate surfaces.
This approach allows for enhanced stability and efficient attachment of oligonucleotides, improving the reliability and performance of biological sequencing operations.
Smart Images

Figure US2025018504_02102025_PF_FP_ABST
Abstract
Description
FUNCTIONALIZED BIOLOGICAL REACTANTSCROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional Application S.N. 63 / 562,185, filed March 6, 2024, the content of which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing, which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on February 19, 2025 is named ILI274BPCTJP- 2736-PCT_sequence_listing.xml and is 17,776 bytes in size.BACKGROUND
[0003] Various protocols in biological or chemical research involve performing a large number of controlled reactions on local support surfaces or within predefined reaction chambers of a flow cell. The reactions may then be observed or detected, and subsequent analysis may help identify or reveal properties of molecules involved in the controlled reactions. In some examples, the reactions generate fluorescence, and thus an optical system that is configured for fluorescence detection may be used to analyze the controlled reactions. In other examples, the controlled reactions alter charge, conductivity, or some other electrical property of the molecule(s) being analyzed, and thus an electronic system may be used for detection.SUMMARY
[0004] Some biotechnological applications utilize a substrate having a surface, where the substrate surface is used for the preparation and / or analysis of biological molecules. The substrate surface may be polymer-coated. Molecular analyses, such as certain nucleic acid sequencing methods, may operate using biological reactants, such as nucleic acid strands (e.g., oligonucleotides) that are attached directly to thesubstrate or that are attached to the polymer coating included thereon. In such nucleic acid sequencing methods, the biological reactants may be capable of seeding DNA library templates thereto.
[0005] Further, in such methods, it is useful for the biological reactants to be attached to the substrate (or coating) in a particular orientation. For example, the 5’ end of an oligonucleotide biological reactant may be functionalized with a particular moiety, such that the 5’ end of the oligonucleotide attaches to the substrate (or coating), while the 3’ end of the oligonucleotide becomes available for seeding a target molecule thereto (e.g., DNA library templates).
[0006] Disclosed herein are flow cells and methods utilizing biological reactants that are (and can act as) functionalized oligonucleotides. The functionalized oligonucleotides disclosed herein may be norbomenyl-functionalized oligonucleotides or trans-cyclooctene-functionalized oligonucleotides and may be used for a variety of biological sequencing operations. These examples enable additive-free attachment of the oligonucleotides to a polymeric hydrogel. Additionally, the norbomenyl- functionalized oligonucleotides may exhibit enhanced stability when exposed to storage stress.BRIEF DESCRIPTION OF THE DRAWINGS
[0007] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0008] Fig. 1A is a top view of an example flow cell;
[0009] Fig. 1 B is an enlarged, partially cutaway, cross-sectional, and perspective view of an example of a lane defined in a substrate of the flow cell;
[0010] Fig. 1 C is an enlarged, partially cutaway, cross-sectional, and perspective view of an example of an architecture within a flow channel of the flow cell that includes depressions;
[0011] Fig. 1 D is an enlarged, partially cutaway, cross-sectional, and perspective view of an example of another architecture within a flow channel of the flow cell that includes functionalized pads;
[0012] Fig. 2 is a schematic illustration of a flow cell including a complementary metal-oxide semiconductor (CMOS) imaging device that is coupled to a substrate of the flow cell;
[0013] Fig. 3 depicts a reaction mechanism that may be used to form an example of a norbornene-functionalized oligonucleotide disclosed herein, where A. depicts 5-norbornene-2-methanol, B. depicts a norbornene phosphoramidite, and C. depicts a structure of the norbornene-functionalized oligonucleotide;
[0014] Fig. 4 depicts a reaction mechanism that may be used to form an example of a norbornene-functionalized oligonucleotide disclosed herein that further includes an amide linkage, where A. depicts 5-norbornene-2-carboxylic acid, B. depicts a first intermediate, C. depicts a norbomene-phosphoramidite with an amide linkage; and D. depicts the norbornene-functionalized oligonucleotide with the amide linkage; and
[0015] Fig. 5A through Fig. 5C is a schematic illustration an example of a method of functionalizing the substrate of a flow cell with a biological reactant, where Fig. 5A depicts a depression that is defined in a substrate, Fig. 5B depicts a polymeric hydrogel applied within the depression that includes surface azide groups, and Fig. 5C depicts the attachment of the biological reactant to the surface azide groups of the polymeric hydrogel.DETAILED DESCRIPTION
[0016] Disclosed herein are flow cells and methods utilizing biological reactants, and these biological reactants may be norbornene-functionalized oligonucleotides or trans-cyclooctene-functionalized oligonucleotides. The structure of the flow cells (and methods of forming some aspects thereof) will be described in reference to Fig. 1A through Fig. 1 D and in reference to Fig. 2. Formation of the biological reactants will be described in reference to Fig. 3 and Fig. 4. Methods of attaching the biologicalreactants to the substrate (as part of a process of forming the flow cells) are described in reference to Fig. 5A through Fig. 5C.
[0017] Definitions
[0018] It is to be understood that terms used herein will take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0019] The singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise.
[0020] The terms comprising, including, containing and various forms of these terms are synonymous with each other and are meant to be equally broad.
[0021] The terms top, bottom, lower, upper, on, adjacent, etc. are used herein to describe the flow cell and / or the various components of the flow cell. It is to be understood that these directional terms are not meant to imply a specific orientation, but are used to designate relative orientation between components. The use of directional terms should not be interpreted to limit the examples disclosed herein to any specific orientation(s).
[0022] The terms first, second, etc. also are not meant to imply a specific orientation or order, but rather are used to distinguish one component from another.
[0023] An “acrylamide monomer” refers to a monomer with the structureor a monomer including an acrylamide group. Examples of the monomer including an acrylamide group include azido acetamido pentyl acrylamide:Other acrylamide monomers may be used.
[0024] The term “activation,” as used herein, refers to a process that generates reactive groups at the surface of a single layer substrate or an outermost layer of a multi-layer substrate. Activation may be accomplished, for example, using silanization or plasma ashing. Though not explicitly shown in the figures, when activation of a surface is performed, it is to be understood that silane groups or -OH functional groups become introduced to the surface. These functional groups can then be used to covalently attach a material, such as a polymeric hydrogel or a biological reactant, to the surface that includes the functional groups.
[0025] An “aldehyde,” refers to an organic compound containing a functional group with the structure -CHO, which includes a carbonyl center (i.e. , a carbon double-bonded to oxygen), with the carbon atom also being bonded to hydrogen and an R group (such as an alkyl or other side chain). The general structure of an aldehyde is:.
[0026] An “alkyl” refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group may have 1 to 20 carbon atoms. Example alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation “C1- 4 alkyl” indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n- butyl, isobutyl, sec-butyl, and tert-butyl.
[0027] As used herein, “alkenyl” refers to a straight or branched hydrocarbon chain containing one or more double bonds. The alkenyl group may have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.
[0028] As used herein, “alkyne” or “alkynyl” refers to a straight or branched hydrocarbon chain containing one or more triple bonds. The alkynyl group may have 2 to 20 carbon atoms.
[0029] As used herein, “aryl” refers to an aromatic ring or ring system (i.e. , two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When the aryl is a ring system, every ring in the system is aromatic. The aryl group may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.
[0030] An “amino” functional group refers to an -NRaRb group, where Raand Rb are each independently selected from hydrogen (e.g.,C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5- 10 membered heterocyclyl, as defined herein. As used herein, an “amine base” may refer to a basic tertiary amine, such as triethylamine, N,N-diisopropylethylamine (DiPEA) or 4-dimethylaminopyridine (DMAP).
[0031] As used herein, the terms “attach,” “attached,” and “attachment” refer to the state of two things being joined, fastened, adhered, connected or bound to each other, either directly or indirectly. The terms may refer to chemical attachment or physical attachment. As examples of chemical attachment, a biological reactant (i.e., functionalized oligonucleotide) can be attached to a polymeric hydrogel by a covalent or non-covalent bond, or a biological reactant can be attached to an activated (e.g., silanized or plasma-ashed) substrate surface by a covalent or non-covalent bond. As an example of physical attachment, in enclosed versions of the flow cell disclosed herein, a lid may be physically coupled to a patterned structure at a bonding region (e.g., using an adhesive).
[0032] An “azide” or “azido” functional group refers to -N3. Azide groups may refer to those included in a polymeric hydrogel, or to azide groups that are chemically present at a substrate surface (without an intervening polymeric hydrogel).
[0033] As used herein, a “biological reactant” refers to a molecule, such as a functionalized oligonucleotide, which is capable of participating in a desired reaction with a substrate surface or with a polymer-coated substrate surface. The term “biological reactant” may refer to a norbornenyl-functionalized oligonucleotide or a trans-cyclooctene-functionalized oligonucleotide.
[0034] As used herein, a “bonding region” refers to an area of a structure that is to be bonded to another material, which may be, as examples, a spacer layer, a lid, another structure, etc., or combinations thereof (e.g., a spacer layer and a lid, or a spacer layer and another structure). The bond that is formed at the bonding region may be a chemical bond (as described above), or a mechanical bond (e.g., using a fastener, etc.). The bonding region may be free of surface chemistry (e.g., may be free of biological reactants).
[0035] As used herein, “carbocycle” means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocycle is a ring system, two or more rings may be joined together in a fused, bridged or spiro-connected fashion. Carbocycles may have any degree of saturation, provided that at least one ring in a ring system is not aromatic. Thus, carbocycles include cycloalkyls, cycloalkenyls, and cycloalkynyls. The carbocycle group may have 3 to 20 carbon atoms. Examples of carbocycle rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.
[0036] As used herein, the term “carboxylic acid” or “carboxyl” refers to -COOH.
[0037] The phrase “chemically present,” as used herein, refers to functional groups that are inherently part of the chemical structure of a material, or that are bonded to the material. For example, a functional group that is “chemically present” may be a functional group that is inherently included in the chemical structure of a material (e.g., resin or tantalum oxide) used to form a substrate component. As another example, a functional group that is “chemically present” may be a functionalgroup that has been introduced to the surface of a material using a chemical process, such as a chemical vapor deposition (CVD) process.
[0038] As used herein, “cycloalkyl” refers to a completely saturated (no double or triple bonds) mono- or multi- cyclic hydrocarbon ring system. When composed of two or more rings, the rings may be joined together in a fused fashion. Cycloalkyl groups can contain 3 to 10 atoms in the ring(s). In some examples, cycloalkyl groups can contain 3 to 8 atoms in the ring(s). A cycloalkyl group may be unsubstituted or substituted. Example cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
[0039] As used herein, “cycloalkenyl” or “cycloalkene” means a carbocycle ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. One specific example of a cycloalkene is trans-cyclooctene (TOO). Also as used herein, “heterocycloalkenyl” or “heterocycloalkene” means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.
[0040] As used herein, “cycloalkynyl” or “cycloalkyne” means a carbocycle ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. Also as used herein, “heterocycloalkynyl” or “heterocycloalkyne” means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.
[0041] The term “depositing,” as used herein, refers to any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties or attachment of one substance to another. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating / deposition, aerosol printing, screen printing, microcontact printing, inkjet printing, slot-die coating, or the like.
[0042] As used herein, the term “depression” refers to a discrete recessed feature defined in a substrate and having a surface opening. In some instances, the surface opening is at least partially surrounded by interstitial region(s) of the substrate. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As examples, the depression can be a well or two interconnected wells.
[0043] The term “each,” when used in reference to a collection of items, is intended to identify an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.A.
[0044] The term “epoxy” as used herein refers toor A
[0045] As used herein, the term “flow cell” is intended to refer to a vessel having an enclosed or open flow channel where a reaction can be carried out. A flow cell with an enclosed channel may also include an inlet for delivering reagent(s) to the channel and an outlet for removing reagent(s) from the channel. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like. As another example, the flow cell can include a complementary metal oxide semiconductor (CMOS) chip coupled thereto, allowing for the electrical detection of arrays, optically labeled molecules, or the like.
[0046] As used herein, a “flow channel” or “channel” may be (i) an area defined between two bonded components or may be (ii) a recessed area, or lane, defined in a single substrate. In either case, the “flow channel” or “channel” can selectively receive a liquid sample, reagents, etc. through an inlet. In some examples, the flow channel may be defined between two substrates, and thus the flow channel may be in fluid communication with surface chemistry disposed on either of the two substrates. In other examples, the flow channel may be defined between one substrate and a lid, and thus the flow channel may be in fluid communication with surface chemistrydisposed on the one substrate. In still other examples, the flow channel may be defined by a recessed area that is formed in a surface of a single substrate, and thus the flow channel may be in fluid communication with surface chemistry within the recessed area.
[0047] As used herein, “heteroaryl” refers to an aromatic ring or ring system (i.e. , two or more fused rings that share two adjacent atoms) that contain(s) one or more heteroatoms, that is, an element other than carbon, including but not limited to, nitrogen, oxygen and sulfur, in the ring backbone. When the heteroaryl is a ring system, every ring in the system is aromatic. The heteroaryl group may have 5-18 ring members.
[0048] As used herein, “heterocycle” means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in a fused, bridged or spiro-connected fashion. Heterocycles may have any degree of saturation provided that at least one ring in the ring system is not aromatic. In the ring system, the heteroatom(s) may be present in either a non- aromatic or aromatic ring. The heterocycle group may have 3 to 20 ring members (i.e., the number of atoms making up the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom(s) are O, N, or S.
[0049] The term “hydrazine” or “hydrazinyl” as used herein refers to a -NHNH2 group.
[0050] The term “hydrazone” or “hydrazonyl,” as used herein, refers to agroup, in which Raand Rb are each independently selected from hydrogen, C1 -6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocycle, as defined herein.
[0051] As used herein, “hydroxy” or “hydroxyl” refers to an -OH group.
[0052] The term “hydrogel” or “polymeric hydrogel” refers to a semi-rigid polymer that is permeable to liquids and / or gases. The hydrogel can swell when liquid (e.g., water) is taken up and that can contract when liquid is removed, e.g., by drying.While a hydrogel may absorb water, the examples described herein may not be water- soluble.
[0053] As used herein, the term “interstitial region” refers to an area, e.g., of a substrate, that separates individual depressions from one another (see interstitial regions 34 separating depressions 32 in Fig. 1 C) or that separates individual functionalized pads from one another (see interstitial regions 34 separating functionalized pads 36 in Fig. 1 D). The separation provided by an interstitial region can be partial or full separation.
[0054] “Nitrile oxide,” as used herein, means a “RaC=N+O’” group in which Rais as defined herein. Examples of preparing nitrile oxide include in situ generation from aldoximes by treatment with chloramide-T or through action of base on imidoyl chlorides [RC(CI)=NOH] or from the reaction between hydroxylamine and an aldehyde.
[0055] “Nitrone,” as used herein, meansgroup in which R1, R2, and R3may be any of the Raand Rb groups defined herein, except that R3is not hydrogen (H).
[0056] The terms “norbornene” and “norbornenyl,” as used herein, refer to a strained, bridged, cyclic hydrocarbon including a cyclohexene ring and a methylene bridge between Ci and C4. These terms may also be used to refer to a modified norbornenyl structures (i.e. , strained, bridged, cyclic hydrocarbons including a ring structure, a methylene bridge between Ci and C4, and an oxygen atom, a nitrogen atom, or another heteroatom within the ring structure (e.g., see “X” in Fig. 5)).
[0057] An “oligonucleotide” refers to a nitrogen-containing heterocyclic base (i.e., nitrogenous base), a sugar, one or more phosphate groups, and a plurality of linked nucleotides. Examples of the oligonucleotide disclosed herein are functionalized at the 5’ end with a norbornene moiety or a trans-cyclooctene moiety. Thus, the term “functionalized oligonucleotide,” as used herein, is a biological reactant, and may be the norbornenyl-functionalized oligonucleotide (an oligonucleotide including the norbornene moiety at its 5’ end) or the trans-cyclooctene-functionalizedoligonucleotide (an oligonucleotide including a trans-cyclooctene moiety at its 5’ end). Each individual nucleotide in the plurality of linked nucleotides (included in the functionalized oligonucleotide(s)) is a monomeric unit of a nucleic acid sequence. In RNA (ribonucleic acid), the sugar is a ribose, and in DNA (deoxyribonucleic acid), the sugar is a deoxyribose, i.e. , a sugar lacking a hydroxyl group that is present at the 2' position in ribose. The nitrogen containing heterocyclic base can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9 of a purine. A nucleic acid analog may have any of the phosphate backbone, the sugar, or the nitrogen-containing heterocyclic base altered. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acid (PNA).
[0058] In some examples, the term “over” may mean that one component or material is positioned directly on another component or material. When one is directly on another, the two are in physical contact with each other. In Fig. 1 B, for example, when a multi-layer substrate 16 (including a base support 18 having an additional layer 20 positioned thereon) is used, the layer 20 is positioned directly “over” the base support 18, such that there is no intervening component or material therebetween.
[0059] In other examples, the term “over” may mean that one component or material is positioned indirectly on another component or material. By indirectly on, it is meant that a gap or an additional component or material may be positioned between the two components or materials. In Fig. 1 B, for example, when a multi-layer substrate 16 is utilized, the polymeric hydrogel 30 is indirectly over the base support 18. The layer 20 is positioned therebetween.
[0060] A “patterned structure” refers to a substrate that has been patterned with depressions (see the patterned structure 17A including depressions 32 in Fig. 1 C) or with functionalized pads (see the patterned structure 17B including functionalized pads 36 in Fig. 1 D). In some examples, the substrate is exposed to patterning techniques (e.g., etching, nanoimprint lithography, photolithography, etc.) in order to generate thedesired pattern(s). However, the term “patterned structure” is not intended to imply that such patterning techniques have to be used to generate the pattern. In contrast, an “unpatterned structure” refers to a substrate having a recessed feature or a lane defined therein (in which surface chemistry is included), but that does not include functionalized pads or depressions within the lane (see the unpatterned structure 15 including the lane 22 in Fig. 1 B).
[0061] As used herein, the term “polyhedral oligomeric silsesquioxane” (an example of which is commercially available under the tradename “POSS®” from Hybrid Plastics) refers to a chemical composition that is a hybrid intermediate (e.g., RSiOi.s) between that of silica (SiO2) and silicone (FbSiO). An example of polyhedral oligomeric silsesquioxane may be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In an example, the composition is an organosilicon compound with the chemical formula [RSiO3 / 2]n, where the R groups can be the same or different. Example R groups for POSS® include epoxy, azide / azido, a thiol, a poly(ethylene glycol), a norbornene, a tetrazine, acrylates, and / or methacrylates, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups.
[0062] As used herein, a “primer” is defined as the nucleotides that are included in a functionalized oligonucleotide. The functionalized oligonucleotides disclosed herein are represented by either structure (I) or structure (II). In structure (I) or (II), the primer encompasses the nucleotide that is depicted as well as a plurality of linked nucleotides, which are represented by “A.” In the depicted nucleotide, B represents the nitrogenous base. The primers are single stranded nucleic acid sequences (e g., single stranded DNA). Some primers, referred to herein as amplification primers, serve as a starting point for template amplification and cluster generation on the functionalized oligonucleotide (e.g., at the 3’ end). Other primers, such as those referred to herein as sequencing primers, serve as a starting point for DNA synthesis. The primer may include a number of nucleotides ranging from 2 nucleotides to 200 nucleotides. It is to be understood, however, that the primer can be any number of bases long and can include a variety of non-natural nucleotides. In an example, theprimer ranges from 10 to 150 bases, or from 10 to 60 bases, or from 20 to 40 bases, etc.
[0063] A “spacer layer,” as used herein, refers to a material that bonds two components together. In some examples, the spacer layer can be a radiationabsorbing material that aids in bonding, or can be put into contact with a radiationabsorbing material that aids in bonding.
[0064] The term “substrate” may be used herein in conjunction with the term “single layer substrate” or “multi-layer substrate.” A single layer substrate is one layer of a support material that can be imprinted to form a lane (see the substrate 14 shown in Fig. 1 B) and / or that can be patterned with depressions (see Fig. 1 C) or functionalized pads (see Fig. 1 D). The multi-layer substrate includes at least two layers, e.g., a base support with an additional layer thereon, where the additional layer can be imprinted to form the lane (see the substrate 16 including the base support 18 and the layer 20 shown in Fig. 1 B) and / or that can be patterned with depressions (see Fig. 1 C) or functionalized pads (see Fig. 1 D).
[0065] The phrase “surface functional groups,” as used herein, refers to functional groups that are present at a substrate surface. Surface functional groups may be present within a polymeric hydrogel that is applied over a substrate, or surface functional groups may be chemically passivated on the substrate surface, or surface functional groups may be part of the chemical makeup of the substrate (without any hydrogel present).
[0066] “Surface chemistry,” as defined herein, refers to at least one biological reactant (e.g., functionalized oligonucleotide) that is directly or indirectly attached to a substrate. The biological reactant may be (indirectly) attached to the substrate via an intervening polymeric hydrogel layer, or the biological reactant may be (directly) attached to the substrate surface via azide / tetrazine groups that have been chemically introduced to the substrate surface (e.g., without any intervening hydrogel layer). Surface chemistry may be disposed within a lane defined in a substrate surface (see the lane 22 in Fig. 1 B), or may be disposed within depressions defined in a substrate surface (see the depressions 32 in Fig. 1 C), or may form functionalized pads on a substrate surface (see the functionalized pads 36 in Fig. 1 D).
[0067] A “thiol” functional group refers to -SH.
[0068] As used herein, the terms “tetrazine” and “tetrazinyl” refer to sixmembered heteroaryl group comprising four nitrogen atoms. Tetrazine can be optionally substituted.
[0069] “Tetrazole,” as used herein, refers to five-membered heterocyclic group including four nitrogen atoms. Tetrazole can be optionally substituted.
[0070] The term “transparent” when describing a material (e.g., substrate, layer, etc.) means that that the material allows light of a particular wavelength or range of wavelengths to pass through. Transparency may be quantified using transmittance, i.e. , the ratio of light energy falling on a body to that transmitted through the body. The transmittance of a transparent material will depend upon the thickness of the material and the wavelength of light. In the examples disclosed herein, the transmittance of the transparent material may range from 0.25 (25%) to 1 (100%). The material may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting material is capable of the desired transmittance. As an example, tantalum pentoxide (i.e., the inorganic compound with the formula Ta20s) is transparent, having a transmittance ranging from about 0.25 (25%) to 1 (100%), to wavelengths ranging from about 0.35 pm (350 nm) to at least 1 .8 pm (1800 nm). Additionally, depending upon the transmittance of the material, the time for light exposure and / or the output power of the light source may be increased or decreased to deliver a suitable dose of light energy through the transparent material to achieve the desired effect.
[0071] Flow Cells
[0072] Examples of the flow cells disclosed herein generally include a substrate and a biological reactant attached to the substrate, the biological reactant being a norbornenyl-functionalized oligonucleotide or a trans-cyclooctene-functionalized oligonucleotide. The biological reactant may be attached to a polymeric hydrogel layer applied over the substrate, or the biological reactant may be attached directly to the substrate (without any intervening hydrogel layer).
[0073] Fig. 1 A depicts an example of the flow cell 10 from a top view. The flow cell 10 shown in Fig. 1A may include patterned structure(s), unpattemed structure(s),and / or a lid. An example of an unpatterned structure 15 including a lane 22 defined therein is shown in Fig. 1 B, and different examples of patterned structures 17A, 17B that respectively include depressions 32 and functionalized pads 36 are separately shown in Fig. 1 C and in Fig. 1 D.
[0074] Enclosed examples of the flow cell 10 disclosed herein may include one unpatterned structure 15 or one patterned structure 17A, 17B bonded to a lid (lid not shown), e.g., at a bonding region 24 (see Fig. 1 B). Enclosed examples of the flow cell 10 may alternatively include one (un)patterned structure 15, 17A, 17B bonded to another unpatterned or patterned structure via a spacer layer positioned at the bonding region 24 (second structure and spacer layer not shown). Open-wafer examples of the flow cell 10 include a single unpatterned structure 15 or patterned structure 17A, 17B, where the surface chemistry included in the single unpatterned structure 15 or patterned structure 17A, 17B is open to a surrounding environment.
[0075] In some enclosed versions of the flow cell 10, the spacer layer used to attach the unpatterned structure 15 or patterned structure 17A, 17B to the lid may be any material that will seal portions of the unpatterned structure 15 or patterned structure 17A, 17B and the lid. Alternatively, the spacer layer may be any material that will seal portions of the unpatterned structure 15 or patterned structure 17A, 17B and the second unpatterned or patterned structure. As examples, the spacer layer may be an adhesive, a radiation-absorbing material that aids in bonding, or the like. In some examples, the spacer layer is the radiation-absorbing material, e.g., KAPTON® black (DuPont de Nemours, Inc.).
[0076] In both enclosed and open-wafer versions of the flow cell 10, the unpatterned structure 15 or patterned structure 17A, 17B of the flow cell 10 may be a single layer substrate 14. Alternatively, the unpatterned structure 15 or patterned structure 17A, 17B may be a multi-layer substrate 16 including a base support 18 having a layer 20 positioned thereon. The single layer substrate 14 and the multi-layer substrate 16 are depicted in each of Fig. 1 B, Fig. 1 C, and Fig. 1 D.
[0077] Examples of suitable materials for the substrate 14 include siloxanes (e.g., epoxy siloxane), glass, modified or functionalized glass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials,polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), polyethylene terephthalate (PET), polycarbonate, cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceram ics / ceramic oxides, silica (i.e. , silicon dioxide (SiO2)), fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (SisN4), tantalum pentoxide (Ta2Os) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, resins, or the like. Examples of suitable resins include inorganic oxides, such as tantalum pentoxide (e.g., Ta2Os) or other tantalum oxide(s) (TaOx), aluminum oxide (e.g., AI2O3), silicon oxide (e.g., SiCh), hafnium oxide (e.g., HfC ), indium tin oxide, titanium dioxide, etc., or polymeric resins, such as a polyhedral oligomeric silsesquioxane based resin (e.g., POSS® from Hybrid Plastics), a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof. It is to be understood that the material of the substrate 14 may be any material that can be etched, imprinted, or manipulated to form the lane 22 shown in Fig. 1 B, or to form the depressions 32 shown in Fig. 1C. The material of the substrate 1 may further be any suitable material that can be patterned with the functionalized pads 36 shown in Fig. 1 D.
[0078] As mentioned, examples of the multi-layer substrate 16 include the base support 18 and at least one other layer 20 positioned thereon. Any example of the material of the single layer substrate 14 provided herein may be used as the material for the base support 18 of the multi-layer substrate 16. Examples of suitable materials for the layer 20 include inorganic oxides, such as tantalum oxide (e.g., Ta2Os), aluminum oxide (e.g., AI2O3), silicon oxide (e.g., SiC ), or hafnium oxide (e.g., HfCh), or polymeric resins, such as a polyhedral oligomeric silsesquioxane based resin (e.g., POSS® from Hybrid Plastics), a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof. It is to be understood that inexamples of the flow cell 10 that include the substrate 16, the other layer 20 (positioned on the base support 18) may be any material that can be etched, imprinted, or manipulated to form the lane 22 shown in Fig. 1 B, or to form the depressions 32 shown in Fig. 1 C. The material of the layer 20 may further be any material that can be patterned with the functionalized pads 36 shown in Fig. 1 D.
[0079] Suitable deposition techniques for applying the layer 20 of over the base support 18 include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. It is to be understood that the deposition technique(s) that is / are used may depend, in part, upon the material of the layer 20.
[0080] The single layer substrate 14 or the base support 18 (of the multi-layer substrate 16) may be a circular sheet, a panel, a wafer, a die etc. having a diameter ranging from about 2 mm to about 300 mm, e.g., from about 200 mm to about 300 mm, or may be a rectangular sheet, panel, wafer, die etc. having its largest dimension up to about 10 feet (~ 3 meters). For example, a die may have a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a substrate 14 or base support 18 with any suitable dimensions may be used.
[0081] The thickness of the layer 20 (when the substrate 16 is used) is variable. In examples of the flow cell 10 that include depressions 32 (as in Fig. 1 C), the thickness of the layer 20 is greater than the desired depth for the depressions 32 formed therein. In examples of the flow cell 10 that include the lane 22 (as in Fig. 1 B), the thickness of the layer 20 is greater than the desired depth for the lane 22 formed therein.
[0082] Suitable patterning techniques for the substrate 14 (or for the layer 20 of the substrate 16) include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, etc. It is to be understood that the patterning technique(s) that is / are used may depend, in part, upon the material used for the substrate 14 or for the layer 20 of the substrate 16.
[0083] Regardless of whether the substrate 14 or 16 is used (and regardless of the patterned structure 17A, 17B or unpatterned structure 15 that is used), the enclosed flow cell 10 and the open-wafer flow cell 10 may include one or more flow channel(s) 12. In the enclosed flow cell 10, the flow channel(s) 12 is / are defined between the one (un)patterned structure 15, 17A, 17B and the lid (not shown) or between the one (un)pattemed structure 15, 17A, 17B and the second (un)patterned structure (not shown), which are bonded together via the spacer layer. Thus, the flow channel(s) 12 in the enclosed form of the flow cell 10 is / are defined by the unpatterned structure 15 or patterned structure 17A, 17B, the spacer layer, and either the lid or the second patterned or unpatterned structure.
[0084] Alternatively, in the open-wafer form of the flow cell 10, a single unpatterned structure 15 or patterned structure 17A, 17B is included, and the flow channel(s) 12 may be defined by the lane 22 that has been defined in the single patterned structure 17A, 17B or unpatterned structure 15 (e.g., via nanolithography).
[0085] The depth of each flow channel 12 in the enclosed versions of the flow cell 10 can be as small as a monolayer thick when microcontact, aerosol, or inkjet printing is used to deposit a separate material (e.g., the spacer layer) that defines at least a portion of the sidewalls of the flow channel 12. This depth could be thicker if the spacer layer is pre-formed or applied via another technique. The depth of the flow channel 12 in some of the open-wafer versions of the flow cell 10 is approximately equivalent to the depth of the lane 22. For other examples, the depth of the flow channel 12 can be about 1 pm, about 10 pm, about 50 pm, about 100 pm, or more. In an example, the depth may range from about 10 pm to about 400 pm. In another example, the depth may range from about 10 pm to about 30 pm. In still another example, the depth is about 5 pm or less. It is to be understood that the depth of the flow channel 12 may be greater than, less than or between the values specified above.
[0086] The example flow cell 10 shown in Fig. 1A includes eight flow channels 12. While eight flow channels 12 are shown in Fig. 1A, it is to be understood that any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12, twelve flow channels 12, etc.). When multiple flow channels 12 are included in the flow cell 10, each flow channel 12 may be isolatedfrom another flow channel 12 so that fluid introduced into one flow channel 12 does not flow into (an) adjacent flow channel(s) 12.
[0087] Regardless of the number of flow channels 12 that are included in the flow cell 10, each flow channel 12 may have any desirable shape. In an example, the flow channel 12 has a substantially rectangular configuration with curved ends (as shown in Fig. 1 A). The length of the flow channel 12 depends, in part, upon the size of the substrate 14 or 16 used to form the patterned or unpatterned structure 17A, 17B, or 15. The width of each flow channel 12 depends, in part, upon the size of the substrate 14 or 16 used to form the patterned or unpatterned structure 17A, 17B, 25 the desired number of flow channels 12, the desired number of depressions 32 or functionalized pads 36 (when included), and the desired space at a perimeter of the patterned or unpatterned structure 17A, 17B, or 15.
[0088] Each flow channel 12 that is included in the flow cell 10 may be in fluid communication with an inlet and an outlet (not shown in Fig. 1A through Fig. 1 D). The inlet and outlet of each flow channel 12 may be positioned at opposed ends of the flow cell 10. The inlets and outlets of the respective flow channels 12 may alternatively be positioned anywhere along the length and width of the flow channel 12 that enables desirable fluid flow. The inlets and outlets may be fluidic passages that are defined in the spacer layer and / or in one of the substrates and / or in the lid.
[0089] The inlet allows fluid(s) to be introduced into the flow channel 12, and the outlet allows fluid(s) to be extracted from the flow channel 12. Each of the inlet(s) and outlet(s) is / are fluidly connected to a fluidic control system (e.g., reservoirs, pumps, valves, waste containers, and the like) that controls fluid introduction and expulsion. Some examples of the fluids that may be introduced into the flow channel(s) 12 include reaction components (e.g., DNA library templates, polymerases, sequencing primers, nucleotides, etc.), washing solutions, etc.
[0090] The substrate 14, 16 of the flow cell 10 may further include surface functional groups that are capable of attaching to a biological reactant (e.g., azide groups or tetrazine groups, not shown in Fig. 1 A through Fig. 1 D). In the examples disclosed herein, the surface functional groups are chemically present on a surface of the substrate 14 or the layer 20. In some instances, the surface functional groups arethe result of chemical introduction of the functional groups to the substrate material or to the layer material (as is explained in more detail in regard to the methods disclosed herein). While not shown in Fig. 1A through Fig. 1 D, in examples where the substrate 14 includes or has the surface functional groups added thereto, a polymeric hydrogel 30 is not included in the flow cell 10. In other examples, the polymeric hydrogel 30 is utilized and the surface functional groups are part of the hydrogel chemistry.
[0091] As described, and as shown in Fig. 1 B through Fig. 1 D, the lane 22, the depressions 32, or the functionalized pads 36 may include (or may be formed using) the polymeric hydrogel 30.
[0092] The polymeric hydrogel 30, when included, may be any gel material that can swell when liquid is taken up and that can contract when liquid is removed, e.g., by drying. In an example, the polymeric hydrogel 30 includes an acrylamide copolymer, such as poly / V-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM. PAZAM and some other forms of the acrylamide copolymer are represented by the following structuwherein:RAis selected from the group consisting of an azide and a tetrazine;RBis H or optionally substituted alkyl;Rc, RD, and REare each independently selected from the group consisting of H and optionally substituted alkyl; each of the -(CH2)P- can be optionally substituted;p is an integer in the range of 1 to 50; n is an integer in the range of 1 to 50,000; and m is an integer in the range of 1 to 100,000.
[0093] One of ordinary skill in the art will recognize that the arrangement of the recurring “n” and “m” features in structure (A) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof).
[0094] The molecular weight of PAZAM and other forms of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa. In a specific example, the molecular weight of the acrylamide copolymer is about 312 kDa.
[0095] In some examples, PAZAM and other forms of the acrylamide copolymer are linear polymers. In some other examples, PAZAM and other forms of the acrylamide copolymer are lightly cross-linked polymers.
[0096] In other examples, the gel material may be a variation of the structure (A). In one example, the acrylamide unit may be replaced with N,N-dimethylacrylamide ( ). In this example, the acrylamide unit in structure(A) may be replaced with , where RD, RE, and RFare each H or a C1 -C6 alkyl, and RGand RHare each a C1-C6 alkyl (instead of H as is the casewith the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N,N-dimethylacrylamide may be used in addition to the acrylamide unit. In this example, structure (A) may includein addition to the recurring “n” and “m” features, where RD, RE, and RFare each H or a C1-C6 alkyl, and RGand RHare each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0097] As another example of the polymeric hydrogel 30, the recurring “n” feature in structure (A) may be replaced with a monomer including a heterocyclic azido group having structure (B):wherein R1is H or a C1-C6 alkyl; R2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1 -C4 alkylattached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0098] As still another example, the polymeric hydrogel 30 may include a recurring unit of each of structure (C) and (D):wherein each of R1a, R2a, R1 band R2bis independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R3aand R3bis independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each of L1and L2is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0099] It is to be understood that other polymeric hydrogels 30 may be used, provided that the hydrogels are suitable for grafting biological reactants (i.e. , functionalized oligonucleotides) thereto. Some additional examples of suitable materials for the polymeric hydrogel 30 include functionalized polysilanes, such as azido silane or any other polysilane having functional groups that can attach the desired biological reactants. Other examples of suitable polymeric hydrogels 30 include those having a polymer mesh structure, such as gelatin (which includes aminegroups) or other (poly)peptides; or a cross-linked polymer structure, such as an azidolyzed version of silane free acrylamide (SFA).
[0100] The polymeric hydrogel 30 may be formed using any suitable copolymerization process and may be deposited using any of the methods disclosed herein. For at least some of the deposition techniques, the polymeric hydrogel 30 may be incorporated into a mixture, e.g., with water or with ethanol and water, and then applied within the lane 22, within the depression(s) 32, or to form the functionalized pad(s) 36. In some instances, the polymeric hydrogel 30 is a cured hydrogel (e.g., that has been cured using heat, UV / high energy light, or the like).
[0101] The attachment of the polymeric hydrogel 30 to the substrate 14 or to the layer 20 of the multi-layer substrate 16 may be through covalent bonding. As will be described in more detail in regard to the methods depicted in Fig. 5A through Fig. 5C, in some instances, the substrate 1 or the layer 20 may be activated before the polymeric hydrogel 30 is applied thereon, e.g., through silanization or plasma ashing. Both silanization and plasma ashing are explained in more detail in regard to the methods disclosed herein. Activation of the substrate 14 or layer 20, when performed, facilitates the attachment of the polymeric hydrogel 30 to the substrate 14 or layer 20. Covalent linking is helpful for maintaining the biological reactants at desired regions of the substrate 14 or layer 20 throughout the lifetime of the flow cell 10 and during a variety of uses.
[0102] As described, the polymeric hydrogel 30 may provide the surface functional groups. These surface functional groups may be used for the chemical attachment of desired materials to the polymeric hydrogel 30, such as the biological reactants 26, 28 shown in the figures. In an example (and as shown in structure (A)), these surface functional groups are selected from the group consisting of an azide and a tetrazine.
[0103] The flow cell 10 may include the patterned structure 17A shown in Fig. 1 C having the plurality of depressions 32 defined therein. In the example shown in Fig. 1 C, the polymeric hydrogel 30 is positioned within each of the depressions 32 and provides the surface functional groups within each of the depressions 32. In another example (not shown), the polymeric hydrogel 30 is not positioned within thedepressions 32 and the surface functional groups are chemically present on the substrate 14 or layer 20 (e.g., at areas where depressions 32 are formed). As such, some examples of the flow cell 10 include a plurality of depressions 32 defined in the substrate 14, 16 and the surface functional groups are present within the plurality of depressions 32. In these examples, individual depressions 32 (having the surface functional groups) are separated from each other individual depression 32 by interstitial regions 34.
[0104] Alternatively, the flow cell 10 may include the patterned structure 17B shown in Fig. 1 D (having the plurality of functionalized pads 36 formed thereon). As such, other examples of the flow cell 10 include a plurality of functionalized pads 36 formed on the substrate 14, 16 that are separated by interstitial regions 34, wherein the polymeric hydrogel 30 forms each of the functionalized pads 36 and provides the surface functional groups.
[0105] As yet another alternative, the flow cell 10 may include the unpatterned structure 15 shown in Fig. 1 B (having the lane 22 defined therein). In the example shown in the figure, the polymeric hydrogel 30 is positioned within the lane 22 and provides the surface functional groups. In another example (not shown), the polymeric hydrogel 30 is not positioned within the lane 22 and the surface functional groups are chemically present on the substrate 14 or layer 20 (e.g., at areas where the lane 22 is formed). As such, some examples of the flow cell 10 include a lane 22 defined in the substrate 14, 16 and the surface functional groups are present within the lane 22.
[0106] Many different layouts of the depressions 32 (when included) or functionalized pads 36 (when included) may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 32 or functionalized pads 36 are disposed in a hexagonal grid for close packing and improved density. Other layouts of the depressions 32 or functionalized pads 36 may include, for example, rectilinear (rectangular) layouts, triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In other examples, the layout or pattern can be a repeating arrangement of the depressions 32 or functionalized pads 36 and the interstitial regions 34. In still otherexamples, the layout or pattern can be a random arrangement of the depressions 32 or functionalized pads 36 (and the interstitial regions 34).
[0107] The layout or pattern of the depressions 32 or functionalized pads 36 may be characterized with respect to the density (number) of the depressions 32 or functionalized pads 36 in a defined area. For example, the depressions 32 or functionalized pads 36 may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1 ,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used. As examples, a high density array may be characterized as having the depressions 32 or functionalized pads 36 separated by less than about 100 nm, a medium density array may be characterized as having the depressions 32 or functionalized pads 36 separated by about 400 nm to about 1 pm, and a low density array may be characterized as having the depressions 32 or functionalized pads 36 separated by greater than about 1 pm.
[0108] The layout or pattern of the depressions 32 or functionalized pads 36 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 32 or functionalized pad 36 to the center of an immediately adjacent depression 32 or functionalized pad 36. Alternatively, the average pitch may refer to the spacing from a left edge of one depression 32 or functionalized pad 36 to the left edge of an immediately adjacent depression 32 or functionalized pad 36. As an additional alternative, average pitch may refer to the spacing from the right edge of one depression 32 or functionalized pad 36 to the right edge of an immediately adjacent depression 32 or functionalized pad 36. The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.15 pm, about 0.5 pm, about 1 pm, about 5 pm, about 10 pm, about 100 pm, ormore or less. The average pitch for a particular pattern of depressions 32 or functionalized pads 36 can be between one of the lower values and one of the upper values selected from the ranges herein.
[0109] The size of each of the depressions 32 may be characterized by the volume, opening area, depth, and / or diameter or length and width of the depressions 32. For example, the volume can range from about 1 *10-3pm3to about 100 pm3, e.g., about 1 x10“2pm3, about 0.1 pm3, about 1 pm3, about 10 pm3, or more, or less. For another example, the opening area can range from about 1 X10"3pm2to about 100 pm2, e.g., about 1 xi o-2pm2, about 0.1 pm2, about 1 pm2, at least about 10 pm2, or more, or less. For still another example, the depth can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less. For another example, the depth can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less. For yet another example, the diameter or each of the length and width can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less.
[0110] The size of each of the functionalized pads 36 may be characterized by the volume or by the diameter or the length and width of the functionalized pads 36. For example, the volume can range from about 1 xW3pm3to about 100 pm3, e.g., about 1 xi o-2pm3, about 0.1 pm3, about 1 pm3, about 10 pm3, or more, or less. As another example, the diameter or each of the length and width can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less.
[0111] As shown in Fig. 1 B through Fig. 1 D, the polymeric hydrogel 30 of the flow cell 10 (within the depressions 32, within the lane 22, or forming the pads 36) includes a plurality of biological reactants 26, 28 attached thereto, and these biological reactants 26, 28 may be functionalized oligonucleotides (e.g., norbornenyl- functionalized oligonucleotides or trans-cyclooctene-functionalized oligonucleotides). The biological reactants 26, 28 may be attached to respective surface functional groups included in the polymeric hydrogel 30. It is to be understood, however, that in examples in which the polymeric hydrogel 30 is not included, the plurality of biological reactants 26, 28 is attached directly to the layer 20 of the substrate 16 or to thesubstrate 14, via surface functional groups and with no intervening hydrogel 30 layer. In these examples, the substrate 14 or layer 20 includes chemically present functional groups that attach to the biological reactants 26, 28.
[0112] In an example, the biological reactant 26, 28 includes a norbornenyl- functionalized or a trans-cyclooctene-functionalized oligonucleotide respectively having a structure (I):, or a structure (II):wherein in either structure (I) or structure (II), A is a plurality of linked nucleotides and B is a nitrogenous base. It is to be understood that in the structure (I), the norbornene moiety is positioned at the 5’ end of the functionalized oligonucleotide in which it is included. It is to be further understood that in the structure (II), the trans-cyclooctene moiety is positioned at the 5’ end of the functionalized oligonucleotide in which it is included. The inclusion of the norbornene moiety or the trans-cyclooctene moiety at the 5’ end of the biological reactants 26, 28 may be used to orient the biological reactants 26, 28 on the flow cell 10, such that each biological reactant 26, 28 is attached, at its respective 5’ end, to the surface functional groups of the substrate 14, layer 20, or polymeric hydrogel 30. Further, with this orientation, the biological reactant 26, 28 is suitably positioned for seeding a target molecule thereto (e.g., a DNA library template), and its 3’ end is free for an extension reaction.
[0113] The plurality of nucleotides (represented by A in structure (I) and structure (II)) ranges from 1 nucleotide to 200 nucleotides. It is to be understood,however, that any sub-range of nucleotides within this range may be included in the primer portion of the biological reactant 26, 28, such as 20 nucleotides to 100 nucleotides, or 50 nucleotides to 150 nucleotides, or 2 nucleotides to 40 nucleotides, etc.
[0011] In an example, the biological reactant 26, 28 is the norbornenyl- functionalized oligonucleotide and the norbomenyl-functionalized oligonucleotide further includes an amide linkage positioned between the norbornene group and the phosphate group (in the structure (I)). This particular example of the norbomenyl- functionalized oligonucleotide is further described in reference to Fig. 4.
[0115] In an example, the biological reactants 26, 28 may be amplification oligonucleotides. In this example, the amplification oligonucleotides can be immobilized to the polymeric hydrogel 30 (or to surface functional groups chemically present on the substrate 14 or the layer 20) by single point covalent attachment at or near the 5’ end of the biological reactants 26, 28. This attachment leaves i) an adapter-specific portion of the biological reactants 26, 28 free to anneal to their cognate sequencing-ready nucleic acid fragment and ii) the 3’ hydroxyl group free for oligonucleotide extension. Any suitable covalent attachment may be used for this purpose.
[0116] In examples, two different biological reactants 26, 28 (i.e. , functionalized oligonucleotides) are utilized in the flow cell 10 as part of a set, and these biological reactants 26, 28 may be amplification primers used in sequential paired end sequencing. The different biological reactants 26, 28 in the set may have different primer portions (i.e., primers). In each of structure (I) and structure (II), the primer includes the depicted nucleotide and the plurality of linked nucleotides represented by “A.” As examples, for their respective primer portions, the biological reactants 26, 28 may respectively include P5 and P7 primer sequences, P15 and P7 primer sequences, or any combination of the PA primer sequence, the PB primer sequence, the PC primer sequence, and the PD primer sequence set forth herein. As further examples, the biological reactants 26, 28 may respectively include any two PA, PB, PC, and PD primer sequences, or any combination of one PA primer sequence and one PB, PC, or PD primer sequence, or any combination of one PB primer sequence and one PC orPD primer sequence, or any combination of one PC primer sequence and one PD primer sequence in their primer portions.
[0117] Specific examples of suitable primer sequences for the different biological reactants 26, 28 include P5 and P7 primer sequences used on the surface of commercial flow cells sold by Illumina Inc. for sequencing on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, NOVASEQX™, GENOME ANALYZER™, ISEQ™, and other instrument platforms.
[0118] The P5 primer sequence (which may be a cleavable primer due to the cleavable nucleobase uracil or “n”) is:P5 #1 : 5’ 3’AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO. 1 );P5 #2: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 2) where “n” is inosine in SEQ. ID. NO. 2; orP5 #3: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 3) where “n” is alkene-thymidine (i.e. , alkene-dT) in SEQ. ID. NO. 3.The P7 primer (which may be a cleavable primer) may be any of the following:P7 #1 : 5’ - 3’CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO. 4) where “n” is 8-oxoguanine in SEQ. ID. NO. 4;P7 #2: 5’ 3’CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO. 5) where “n” is 8-oxoguanine in SEQ. ID. NO. 5;P7 #3: 5’ 3’CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO. 6) where both instances of “n” are 8-oxoguanine in SEQ. ID. NO. 6;P7 #4: 5’ 3’CAAGCAGAAGACGGCATACGAUAT (SEQ. ID. NO. 7); orP7 #5: 5’ 3’CAAGCAGAAGACGGCATACUAGAT (SEQ. ID. NO. 8).It P7 #4 or P7 #5 is selected for the primer sequence of one of the two different biological reactants 26, 28, it is to be understood that the primer sequence selected for the other of two different biological reactants 26, 28 should have an orthogonal cleavage site. By orthogonal, it is meant that the cleavage site of one of the primer sequences in the set is cleavable by an agent or mechanism that does not cleave the other of the primer sequences in the set, and vice versa.The P15 primer (shown as a cleavable primer) is:P15: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 9) where “n” is allyl-T (i.e. , a thymine nucleotide analog having an allyl functionality).The other primers (PA-PD, shown as non-cleavable primers) mentioned above include:PA 5’ - 3’GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO. 10);PB 5’ 3’CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO. 11 );PC 5’ 3’ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO. 12); andPD 5’ 3’GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO. 13).While not shown in the example sequences for PA-PD, it is to be understood that any of these primer sequences may include a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc. at any point in the strand. It is to be understood that the cleavage sites of the primer sequences that make up a primer set should be orthogonal, i.e. , the cleavage site of one of the primers is not susceptible to a cleaving agent used to remove the cleavage site of the other of the primers, and vice versa.
[0119] Each of the biological reactants 26, 28 disclosed herein may also include a polyT sequence linking the norbornene moiety or the trans-cyclooctene moiety to the 5’ end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.
[0120] In addition to the biological reactants 26, 28, in some instances, the flow cell 10 further includes a complementary metal oxide semiconductor (CMOS) chip 94 coupled to a bottom of the substrate 14, which forms the flow cell 10’ shown in Fig. 2. For ease of illustration, the substrate 14 is shown in Fig. 2. It is to be understood, however, that when the multi-layer substrate 16 (including the base support 18 havingthe layer 20 thereon) is used, the CMOS chip 94 may be coupled to the bottom of the base support 18 of the substrate 16.
[0121] While the flow cell 10’ depicted in Fig. 2 is shown as an enclosed version with a lid 116, it is to be understood that other enclosed versions of the flow cell 10’ may be used, such as a flow cell 10’ including two patterned structures 17A, 17B that are bonded together. Further, open-wafer versions of the flow cell 10’ may be used, where a single patterned structure 17A, 17B is open to the surrounding environment and is coupled to the CMOS chip 94.
[0122] Moreover, for further ease of illustration, the substrate 14 of the flow cell 10’ of Fig. 2 is shown as including a plurality of depressions 32 separated by interstitial regions 34, each of the depressions 32 including the polymeric hydrogel 30 and the biological reactants 26, 28. While the flow cell 10’ shown in Fig. 2 includes the depressions 32 (similar to the patterned structure 17A shown in Fig. 1 C), the flow cell 10’ of Fig. 2 may alternatively include a plurality of functionalized pads 36 separated by interstitial regions 34, where each functionalized pad 36 is formed using the polymeric hydrogel 30 and has the biological reactants 26, 28 attached thereto (similar to the patterned structure 17B shown in Fig. 1 D). As an additional alternative, it is to be understood that the substrate 14, 16 of the flow cell 10’ may include the lane 22 defined therein, where the lane 22 has the polymeric hydrogel 30 and the biological reactants 26, 28 therein (similar to the unpattemed structure 15 shown in Fig. 1 B).
[0123] Further, regardless of whether depressions 32, pads 36, or a lane 22 is / are included in the flow cell 10’, the biological reactants 26, 28 may be attached to the polymeric hydrogel 30 (e.g., within the depressions 32, lane 22, or forming the pads 36), or the biological reactants 26, 28 may be attached to the (e.g., azide- functionalized or tetrazine-functionalized) substrate 14 or layer 20, without any intervening polymeric hydrogel 30 layer.
[0124] In the illustrated example, the substrate 14 of the flow cell 10’ may be affixed directly to, and thus be in physical contact with, the CMOS chip 94 through one or more securing mechanisms (e.g., adhesive, bond, fasteners, and the like). It is to be understood that the substrate 14 (or the base support 18 of the substrate 16) may be removably coupled to the CMOS chip 94.
[0125] The CMOS chip 94 includes a plurality of stacked layers 96 including, for example, silicon layer(s), dielectric layer(s), metal-dielectric layer(s), metal layer(s), etc.). The stacked layers 96 make up the device circuitry, which includes detection circuitry.
[0126] The CMOS chip 94 includes optical components, such as optical sensor(s) 98 and optical waveguide(s) 100. The optical components may be arranged such that each optical sensor 98 at least substantially aligns with, and thus is operatively associated with, a single optical waveguide 100 and a single depression 32 (or functionalized pad 36) of the flow cell 10’. However, in other examples, a single optical sensor 98 may receive photons through more than one optical waveguide 100 and / or from more than one depression 32 (or functionalized pad 36). In these other examples, the single optical sensor 98 is operatively associated with more than one optical waveguide 100 and / or more than one depression 32 (or functionalized pad 36). In an example including the lane 22, it is to be understood that multiple optical waveguides 100 and optical sensors 98 may be positioned to receive signals from different portions of the lane 22.
[0127] As used herein, a single optical sensor 98 may be a light sensor that includes one pixel or more than one pixel. As an example, each optical sensor 98 may have a detection area that is less than about 50 pm2. As another example, the detection area may be less than about 10 pm2. As still another example, the detection area may be less than about 2 pm2. In the latter example, the optical sensor 98 may constitute a single pixel. An average read noise of each pixel of the optical sensor 98 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor(s) 98 may be greater than about 0.5 megapixels (Mpixels). In other examples, the resolution may be greater than about 5 Mpixels, or greater than about 10 Mpixels.
[0128] Also as used herein, a single optical waveguide 100 may be a light guide including a cured filter material that i) filters the excitation light 104 (propagating from an exterior of the flow cell 10’ into the flow channel 12), and ii) permits the light emissions resulting from reactions at the depressions 32 or functionalized pads 36 (not shown) or the lane 22 (also not shown) to propagate therethrough towardcorresponding optical sensor(s) 98. In an example, the optical waveguide 100 may be, for example, an organic absorption filter. As a specific example, the organic absorption filter may filter excitation light 104 of about 532 nm wavelength and permit light emissions of about 570 nm or more wavelengths. The optical waveguide 100 may be formed by first forming a guide cavity in a dielectric layer 106, and then filling the guide cavity with a suitable filter material.
[0129] The optical waveguide 100 may be configured relative to the dielectric material 106 in order to form a light-guiding structure. For example, the optical waveguide 100 may have a refractive index of about 2.0 so that the light emissions are substantially reflected at an interface between the optical waveguide 100 and the surrounding dielectric material 106. In certain examples, the optical waveguide 100 is selected such that the optical density (OD) or absorbance of the excitation light 104 is at least about 4 OD. More specifically, the filter material may be selected and the optical waveguide 100 may be dimensioned to achieve at least 4 OD. In other examples, the optical waveguide 100 may be configured to achieve at least about 5 OD or at least about 6 OD.
[0130] The substrate 14 (or substrate 16) functions as a passivation layer for the flow cell 10’. At least a portion of the passivating substrate 14 is in contact with a first embedded metal layer 112 of the CMOS chip 94 and also with an input region 110 of the optical waveguide 100. The contact between the passivating substrate 14 and the first embedded metal layer 112 may be direct contact or may be indirect contact through a shield layer 114.
[0131] The substrate 14 may provide one level of corrosion protection for the embedded metal layer 112 of the CMOS chip 94 that is closest in proximity to the substrate 14. In this example, the substrate 14 may include a passivation material that is transparent to the light emissions resulting from reactions within the depressions 32 (e.g., visible light), and that is at least initially resistant to the fluidic environment and moisture that may be introduced into or present in the flow channel 12. An at least initially resistant material acts as an etch barrier to high pH reagents (e.g., pH ranging from 8 to 14) and as a moisture barrier. Examples of suitable materials for the substrate 14 of the flow cell 10’ include silicon nitride (SislS ), silicon oxide (SiCh),tantalum pentoxide (Ta2Os), hafnium oxide (HfCh), boron doped p+ silicon, or the like. The thickness of the substrate 14 may vary depending, in part upon the sensor dimensions. In an example, the thickness of the substrate 14 ranges from about 100 nm to about 500 nm.
[0132] As described, in the example shown in Fig. 2, the flow cell 10’ also includes a lid 116 that is operatively connected to the substrate 14 to partially define the flow channel 12 between the substrate 14 (and the depressions 32 or the pads 36 or the lane 22) and the lid 116. The lid 116 may be any material that is transparent to the excitation light 104 that is directed toward the depressions 32 (or toward the pads 36). As examples, the lid 116 may include glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D 263®, available from Schott North America Inc. Commercially available examples of suitable plastic materials, namely cyclo olefin polymers, are the ZEONOR® products available from Zeon Chemicals L.P.
[0133] The lid 116 may be physically connected to the substrate 14 (or base support 18 of the substrate 16) through material 62. In the example shown in Fig. 2, the material 62 is / are coupled to a portion the surface of the substrate 14 (e.g., at bonding regions 24 of the substrate 14). The material 62 also extends between the surface of the substrate 14 and an interior surface 120 of the lid 116. In some examples, the material 62 and the lid 116 may be integrally formed such that they 62, 116 are a continuous piece of material (e.g., glass or plastic). In these examples, a thin layer of adhesive may be used to attach the integrally formed piece to the substrate 14 at the bonding region 24. In other examples, the material 62 and the lid 116 may be separate components that are coupled to each other. In these other examples, the material 62 may be the same material as, or a different material than the lid 116. In still other examples, the material 62 includes a curable adhesive layer that bonds the lid 116 to the substrate 14 (at a portion of its surface).
[0134] In an example, the lid 116 may be a substantially rectangular block having an at least substantially planar exterior surface 118, and an at least substantially planar interior surface 120 that defines a portion of the flow channel 12. The block may be mounted onto the material 62. Alternatively, the block may beetched to define the lid 116 and the material 62 (which functions as sidewall(s)). For example, a recess may be etched into the transparent block. When the etched block is mounted to the substrate 14, the recess may become the flow channel 12.
[0135] The lid 116 may include inlet and outlet ports 122, 124 that are configured to fluidical ly engage other ports (not shown) for directing fluid(s) into the flow channel 12 (e.g., from a reagent cartridge or other fluid storage system component) and out of the flow channel 12 (e.g., to a waste removal system).
[0136] The flow channel 12 may be sized and shaped to direct a fluid along the depressions 32, along the lane 22, or over the functionalized pads 36, depending on the unpatterned or patterned structure 15, 17A, or 17B that is used in the flow cell 10’. The height of the flow channel 12 and other dimensions of the flow channel 12 may be configured to maintain a substantially even flow of the fluid over the depressions 32, the lane 22, or the functionalized pads 36. The dimensions of the flow channel 12 may also be configured to control bubble formation. In an example, the height of the flow channel 12 may range from about 50 pm to about 400 pm. In another example, the height of the flow channel 12 may range from about 80 pm to about 200 pm. It is to be understood that the height of the flow channel 12 may vary.
[0137] Each depression 32 or functionalized pad 36, when included in the flow cell 10’, is a localized region in the substrate 14 of the flow cell 10’ where a designated reaction may occur. In an example, each depression 32 (or functionalized pad 36) is at least substantially aligned with the input region 110 of a single optical waveguide 100. As such, light emissions at the depressions 32 or functionalized pads 36 may be directed into the input region 110, through the waveguide 100, and to an associated optical sensor 98. In other examples, one depression 32 or functionalized pad 36 may be aligned with several input regions 110 of several optical waveguides 100. In still other examples, several depressions 32 or functionalized pads 36 may be aligned with one input region 110 of one optical waveguide 100.
[0138] The embedded metal layer 112 may be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AICIs), tungsten (W), nickel (Ni), or copper (Cu). In an example, the embedded metal layer 112 may be a functioning part of the CMOS AVdd line, and through the stacked layers 96, is also electrically connected to theoptical sensor 98. Thus, the embedded metal layer 112 participates in the detection / sensing operation.
[0139] It is to be understood that the other optical sensors 98 and associated components may be configured in an identical or similar manner. It is also to be understood, however, that the CMOS chip 94 may not be manufactured identically or uniformly throughout. Instead, one or more optical sensor 98 and / or associated components may be manufactured differently or have different relationships with respect to one another.
[0140] The stacked layer 96 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) that can conduct electrical current. The circuitry may be configured for selectively transmitting data signals that are based on detected photons. The circuitry may also be configured for signal amplification, digitization, storage, and / or processing. The circuitry may collect and analyze the detected light emissions and generate data signals for communicating detection data to a bioassay system. The circuitry may also perform additional analog and / or digital signal processing in the CMOS chip 94.
[0141] The CMOS chip 94 may be manufactured using integrated circuit manufacturing processes. The CMOS chip 94 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer). The sensor base may include the optical sensor 98. When the CMOS chip 94 is fully formed, the optical sensor 98 may be electrically coupled to the rest of the circuitry in the stack layer 96 through gate(s), transistor(s), etc.
[0142] As used in reference to Fig. 2, the term “layer” is not limited to a single continuous body of material unless otherwise noted. For example, the sensor base / layer may include multiple sub-layers that are different materials and / or may include coatings, adhesives, and the like. Furthermore, one or more of the layers (or sub-layers) may be modified (e.g., etched, deposited with material, etc.) to provide the features described herein.
[0143] The stacked layer 96 also includes a plurality of metal-dielectric layers. Each of these layers includes metallic elements (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOSconductive material) and dielectric material 106 (e.g., SiCh). Various metallic elements M1-M5 and dielectric materials 106 may be used, such as those suitable for integrated circuit manufacturing.
[0144] In the example shown in Fig. 2, each of the plurality of metal-dielectric layers L1-L6 includes both metallic elements M1 , M2, M3, M4, M5 and dielectric material 106. In each of the layers L1 -L6, the metallic elements M1 , M2, M3, M4, M5 are interconnected and are embedded within dielectric material 106. In some of the metal-dielectric layers L1 -L6, additional metallic elements may also be included.Some of these additional metallic elements may be used to address individual pixels through a row and column selector. The voltages at these elements may vary and switch between about -1 .4 V and about 4.4 V depending upon which pixel the device is reading out.
[0145] The configuration of the metallic elements M1 , M2, M3, M4, M5 and dielectric layer 106 in Fig. 2 is illustrative of the circuitry, and it is to be understood that other examples may include fewer or additional layers and / or may have different configurations of the metallic elements M1-M5.
[0146] In the example shown in Fig. 2, the shield layer 114 is in contact with at least a portion of the substrate 14. The shield layer 114 has an aperture at least partially adjacent to the input region 110 of the optical waveguide 100. This aperture enables the depressions 32 or pads 36 (and at least some of the light emissions therefrom) to be optically connected to the waveguide 100. It is to be understood that the shield layer 114 may have an aperture at least partially adjacent to the input region 110 of each optical waveguide 100. The shield layer 114 may extend continuously between adjacent apertures.
[0147] The shield layer 114 may include any material that can block, reflect, and / or significantly attenuate the light signals that are propagating through the flow channel 12. The light signals may be the excitation light 104 and / or the light emissions from the depressions 32. As an example, the shield layer 114 may be tungsten (W).
[0148] It is to be understood that the flow cell 10’ may also be used for optical detection.
[0149] Methods of Forming the Functionalized Oligonucleotides
[0150] A method of forming the biological reactant 26, 28 that includes the norbornene-functionalized oligonucleotide generally involves reacting 5-norbornene-2- methanol with 2-cyanoethyl-A / , / V,A / ', / \ / '-tetraisopropylphosphordiamidite to form a norbornenyl phosphoram idite, and incorporating the norbornenyl phosphoram idite into the norbomenyl-functionalized oligonucleotide via solid phase oligonucleotide synthesis. An example of this reaction mechanism is shown in Fig. 3.
[0151] The arrow between the structure shown at A. in Fig. 3 (5-norbornene-2- methanol) and the structure shown at B. in Fig. 3 (norbornenyl phosphoramidite) represents a chemical reaction involving attachment of the nucleophilic alcohol group in the 5-norbornene-2-methanol, A., to the electrophilic phosphorus of the cyanoethyl- A / ,A / ,A / ',A / '-tetraisopropylphosphordiamidite, B. The reaction also involves the removal of one of the nitrogen atoms and the attached isopropyl group from the cyanoethyl- / V, / V, / V', / V'-tetraisopropylphosphordiamidite. As shown in Fig. 3, the reaction between the 5-norbornene-2-methanol (shown at A.) and the 2-cyanoethyl-A / ,A / ,A / ',A / '- tetraisopropylphosphordiam idite (structure above the arrow between A. and B.) to form the norbornenyl phosphoramidite (shown at B.) may be facilitated by imidazole (structure beneath the arrow between A. and B.). It is to be understood, however, that in other examples, the reaction of the 5-norbornene-2-methanol with 2-cyanoethyl- / V, / V, / V', / V'-tetraisopropylphosphordiamidite to form the norbornenyl phosphoramidite is facilitated using other materials, such as other imidazole-based materials (e.g., N- methyl imidazole triflate), triazoles, basic tertiary amines (e.g., trimethylamine, A / , / V- diisopropylethylamine, dimethylamino pyridine), and others.
[0152] After the norbornenyl-phosphoramidite is formed (shown at B.), a solid phase oligonucleotide synthesis process may be performed to generate the structure shown at C. in Fig. 3, which is the norbornenyl-functionalized oligonucleotide, an example of the biological reactant 26, 28. This solid phase oligonucleotide synthesis process generally involves successive cycles of (1 ) activation and coupling, (2) capping, (3) oxidation, and (4) detritylation. During this process, the nucleotides that make up the primer portion of the norbornenyl-functionalized oligonucleotides are added and the norbornene moiety is incorporated into a sugar-phosphate backbone,forming the norbornenyl-functionalized oligonucleotide shown at C. At C., the second phosphate group and the wavy line attached thereto represent “A” as described in reference to structures (I) and (II).
[0153] Some examples of the biological reactant 26, 28 comprising the norbornenyl-functionalized oligonucleotide further include an amide linkage positioned between the norbornene group and the phosphate group. In these instances, the method further comprises forming the norbornenyl-functionalized oligonucleotide by reacting 5-norbornene-2-carboxylic acid with ethanolamine to generate a first intermediate, reacting the first intermediate with 2-cyanoethyl- / V, / V, A / ' , / V'- tetraisopropylphosphordiamidite to form a norbornenyl phosphoram idite with an amide linkage, and incorporating the norbornenyl phosphoramidite with the amide linkage into the norbornenyl-functionalized oligonucleotide using solid phase oligonucleotide synthesis. This reaction mechanism is shown in Fig. 4.
[0154] The arrow between the structure shown at A. in Fig. 4 (5-norbornene-2- carboxylic acid) and the structure shown at B. in Fig. 4 (first intermediate) represents an acid dehydration reaction between the 5-norbornene-2 -carboxylic acid, A., and the ethanolamine (structure above the arrow between A. and B.) to form the first intermediate (B.) and water. The first intermediate includes an amide group and a norbornene group. As shown in Fig. 4, the acid dehydration reaction between the 5- norbornene-2-carboxylic acid and the ethanolamine to form the first intermediate may be facilitated by EDC (1 -ethyl-3-(3-dimethylaminopropyl) carbodiimide) or DCC (A / - / V - dicyclohexylcarbodiimide). It is to be understood, however, that in other examples, the reaction between the 5-norbornene-2 -carboxylic acid and ethanolamine to form the first intermediate is facilitated using other materials, such as activated esters or DIC ( / V- / V’ -diisopropylcarbodiimide).
[0155] After the first intermediate is formed, the first intermediate (B.) is reacted with 2-cyanoethyl-A / , / V,A / ', / \ / '-tetraisopropylphosphordiamidite (structure above the arrow between B. and C. in Fig. 4) to form a norbornenyl phosphoramidite with an amide linkage (C.).
[0156] The arrow between the structure shown at B. in Fig. 4 (first intermediate) and the structure shown at C. in Fig. 4 (norbornenyl phosphoramidite with an amidelinkage) represents a chemical reaction involving attachment of the nucleophilic alcohol group (in the first intermediate) to the electrophilic phosphorus of the cyanoethyl- / V, / V, / \ / ', / \ / '-tetraisopropylphosphordiamidite. This reaction also involves the removal of one of the nitrogen atoms and the attached isopropyl group from the cyanoethyl- / V, / \ / ,A / ', / \ / '-tetraisopropylphosphordiamidite. As shown in Fig. 4, the reaction between the first intermediate (shown at B.) and the 2-cyanoethyl-A / , / , / V', / \ / '- tetraisopropylphosphordiamidite (structure above the arrow between B. and C.) to form the norbornenyl phosphoramidite with the amide linkage (shown at C.) may be facilitated by imidazole (structure beneath the arrow between B. and C.). It is to be understood, however, that in other examples, the reaction of the first intermediate, B., with 2-cyanoethyl- / \ / , / \ / , / \ / ', / \ / '-tetraisopropylphosphordiamidite to form the norbornenyl phosphoramidite with the amide linkage, C., is facilitated using other materials, such as other imidazole-based materials (e.g., A / -methyl imidazole triflate), triazoles, basic tertiary amines (e.g., trimethylamine, A / W-diisopropylethylamine, dimethylamino pyridine), and others.
[0157] After the norbornenyl-phosphoramidite with the amide linkage (C.) is formed, solid phase oligonucleotide synthesis may be performed to generate the structure shown at D., which is an example of the biological reactant 26, 28 that includes the norbornenyl-functionalized oligonucleotide with an amide linker. This solid phase oligonucleotide synthesis process generally involves successive cycles of (1 ) activation and coupling, (2) capping, (3) oxidation, and (4) detritylation. During this process, the nucleotides that make up the primer portion of the norbornenyl- functionalized oligonucleotides are added and the norbornene moiety is incorporated into a sugar-phosphate backbone, forming the norbornenyl-functionalized oligonucleotide with an amide linkage shown at D. At D., the second phosphate group and the wavy line attached thereto represent “A” as described in reference to structures (I) and (II). While not shown in Fig. 3 or Fig. 4, an example of a method of forming the biological reactant 26, 28 that includes the trans-cyclooctene- functionalized oligonucleotide generally involves a(n) [4+2] inverse electron demand Diels Alder (iEDDA) cycloaddition reaction, followed by a nitrogen extrusion and ring aromatization / oxidation. This example method may be used to generate the trans-cyclooctene-functionalized oligonucleotide disclosed herein that is represented by structure (II).
[0158] Method of Using Biological Reactants
[0159] An example of a method utilizing the biological reactants 26, 28 is shown in Fig. 5A through Fig. 5C and will now be described. This method involves introducing a biological reactant 26, 28 to a substrate 14, 16 or a layer (e.g., polymeric hydrogel 30) positioned over the substrate 1 , 16, the substrate 14, 16 or layer 30 having surface functional groups selected from the group consisting of an azide and a tetrazine, whereby the biological reactant 26, 28 attaches to one of the surface functional groups, wherein the biological reactant 26, 28 is a norbornenyl- functionalized or a trans-cyclooctene-functionalized oligonucleotide respectively having the structure (I) or (II), as defined herein. In the description of Fig. 5A through Fig. 5C, the surface functional groups are specifically described as being the surface azide groups. It is to be understood that this method may be performed using any of the surface functional groups described herein, and that the reaction mechanism involved for attachment may vary depending upon the groups used.
[0160] As shown at Fig. 5A, the substrate 14 (or the layer 20 of the substrate 16) has a depression 32 defined therein (similar to the patterned structure 17A depicted in Fig. 1 C). It is to be understood, however, that the example method shown in Fig. 5A through Fig. 5C may alternatively utilize a substrate 14, 16 having a lane 22 defined therein (similar to the unpatterned structure 15 in Fig. 1 B) or having pads 36 formed thereon (similar to the patterned structure 17B in Fig. 1 D). In any case, either the single layer substrate 14 or the multi-layer substrate 16 including the base support 18 and the layer 20 may be used.
[0161] The depression 32 may be defined in the substrate 14 (or in the layer 20 of the substrate 16) using any suitable technique described herein (e.g., etching, nanoimprint lithography, photolithography, etc.). The material of the substrate 14 or the material of the components of the substrate 16 (i.e., the material of the base support 18 and the layer 20) may be any suitable example set forth herein. Thepatterning technique that is used for the substrate 14 or the layer 20 will depend, in part, upon the material selected for the substrate 1 or the layer 20.
[0162] As an example of forming the depression 32, when the substrate 14 or the layer 20 includes a resin material, a working stamp (including a negative replica of the depression 32) may be pressed into the resin material of the substrate 14 or layer 20 while the resin is soft. The resin of the substrate 14 or layer 20 may then be cured while the working stamp is in place, e.g., via exposure to actinic radiation or to heat. After curing, the working stamp is released, which forms the depression 32 in the substrate 14 or in the layer 20. While a single depression 32 is shown in Fig. 5A, it is to be understood in that many depressions 32 may be formed in the substrate 14, 16, including tens, hundreds, thousands, etc., of individual depressions 32.
[0163] As an example of forming the lane 22 (when included), when the substrate 14 or the layer 20 includes a resin material, a working stamp (including a negative replica of the lane 22) may be pressed into the resin material of the substrate 14 or layer 20 while the resin is soft. The resin of the substrate 14 or layer 20 may then be cured while the working stamp is in place, e.g., via exposure to actinic radiation or to heat. After curing, the working stamp is released, which forms the lane 22 in the substrate 14 or in the layer 20.
[0164] As an example of forming the functionalized pads 36, the polymeric hydrogel 30 may be selectively deposited (e.g., via inkjet, microcontact printing, etc.), or may be applied using a patterning process. With a patterning process, a mask (e.g., a shadow mask or masks formed using sacrificial layers and / or photoresists) may be used to cover portions of the substrate 14, 16 where the functionalized pads 36 are not to be formed, thus allowing the hydrogel to be deposited in desirable areas. After the polymeric hydrogel 60 is cured, the mask may be removed to expose the interstitial regions 34. Alternatively, the polymeric hydrogel 30 could be blanketly deposited, and then selectively cured in regions where the pads 36 are to be formed.
[0165] Referring back to the method shown in Fig. 5A through Fig. 5C, once the depression(s) 32 are formed in the substrate 14, 16, the polymeric hydrogel 30 may be applied within the depression(s) 32. This is shown in Fig. 5B. The deposition of the polymeric hydrogel 30 may be performed using any suitable deposition techniquedisclosed herein. The polymeric hydrogel 30 may then be cured using any suitable curing process disclosed herein.
[0166] The polymeric hydrogel 30 may be any suitable hydrogel material disclosed herein. In examples, the polymeric hydrogel 30 is an acrylamide polymer. In a specific example, the polymeric hydrogel 30 is PAZAM. As shown in Fig. 5B, the polymeric hydrogel 30 may include surface azide groups 38. While not shown, the polymeric hydrogel 30 may alternatively include tetrazine groups.
[0167] In some examples, the polymeric hydrogel 30 is applied over the entire substrate 14, 16 and is removed from desired regions, such as interstitial regions 34. The removal of the polymeric hydrogel 30 from the desired regions, such as interstitial regions 34, may involve a polishing process. The polishing process may be performed with a chemical slurry (including, e.g., an abrasive, a buffer, a chelating agent, a surfactant, and / or a dispersant) which can remove the polymeric hydrogel 30 from the interstitial regions 34 without deleteriously affecting the underlying substrate 14, 16. Polishing may also be performed with a solution that does not include the abrasive particles. The polishing process may also be performed using polishing head(s) / pad(s) or other polishing tool(s). As an example, the polishing head may be a Strasbaugh ViPRR II polishing head.
[0168] In other examples, the polymeric hydrogel 30 is applied only within the depressions 32 and not over other regions of the substrate 14, 16, such as the interstitial regions 34. In these examples, polishing is not performed. These examples may involve the application of sacrificial layers and / or photoresists to the substrate 14, 16, or the selective activation of portions of the substrate 14, 16 where attachment of the polymeric hydrogel 30 is desired.
[0169] While not shown in Fig. 5B, in some examples, prior to applying the polymeric hydrogel 30 over the substrate 14 or layer 20, the surface of the substrate 14 (or of the layer 20) may first be activated, e.g., via plasma ashing or treatment with a silane, to generate surface groups (e.g., -OH groups), and these groups may be used to facilitate the attachment of the polymeric hydrogel 30 to the substrate 14 (or layer 20).
[0170] Plasma ashing involves the generation of -OH groups at a surface via exposure of the surface to oxygen plasma. Silanization involves the application of a silane or silane derivative over the surface of the substrate 14 or the layer 20 (of the substrate 16). The selection of the silane or silane derivative may depend, in part, upon the polymeric hydrogel 30 that is to be applied. Some example silane derivatives include a cycloalkene unsaturated moiety, such as norbornene, a norbornene derivative (e.g., a (hetero)norbornene including an oxygen or nitrogen in place of one of the carbon atoms), trans-cyclooctene, trans-cyclooctene derivatives, transcyclopentene, trans-ycloheptene, trans-cyclononene, bicyclo[3.3.1 ]non-1 -ene, bicyclo[4.3.1]dec-1 (9)-ene, bicyclo [4.2.1 ]non-1 (8)-ene, and bicyclo[4.2.1 ]non-1 -ene. Any of these cycloalkenes can be substituted, for example, with an R group, such as hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heteroalicyclyl, aralkyl, or (heteroalicyclyl)alkyl. An example of the norbornene derivative includes [(5-bicyclo[2.2.1 ]hept-2-enyl)ethyl]trimethoxysilane. Other example silane derivatives include a cycloalkyne unsaturated moiety, such as cyclooctyne, a cyclooctyne derivative, or bicyclononynes (e.g., bicyclo[6.1.0]non-4-yne or derivatives thereof, bicyclo[6.1 ,0]non-2-yne, or bicyclo[6.1 ,0]non-3-yne). These cycloalkynes can be substituted with any of the R groups described herein. The method used to apply the silane or silane derivative may vary depending upon the silane or silane derivative that is being used. Examples of suitable silanization methods include vapor deposition (e.g., a YES method), spin coating, or other deposition methods. These methods may silanize the entire substrate 14, 16 surface, or the methods may silanize only the portion(s) of the substrate 14, 16 surface that is to be coated with the polymeric hydrogel 30 (e.g., the portion of the substrate 14, 16 that forms the depression 32).
[0171] After the polymeric hydrogel 30 has been applied within the depression(s) 32 (and, in some instances, removed from the interstitial regions 34), the biological reactants 26, 28 are introduced and become individually attached to a surface azide group 38. In some instances, and as shown in Fig. 5C, the biological reactants 26, 28 become attached to the polymeric hydrogel 30 by reacting with azide groups 38 of the polymeric hydrogel 30, e.g., when the polymeric hydrogel 30 is an azide-functionalized acrylamide polymer. As such, in these instances, the polymerichydrogel layer 30 is positioned over the substrate 14, 16, the layer 30 is an azide- functionalized acrylamide polymer, each of the surface functional groups is the azide, and the attaching of the biological reactant(s) 26, 28 to one of the surface azide groups involves attaching the biological reactant 26, 28 to the azide-functionalized acrylamide polymer. While not shown in Fig. 5C (and as described), in some instances, surface tetrazine groups may be utilized instead of azide groups 38 (e.g., when the polymeric hydrogel 30 includes tetrazine groups). In these instances, the biological reactant(s) 26, 28 individually attach to one of the surface tetrazine groups.
[0172] In the example shown in Fig. 5C, the biological reactants 26, 28 are shown as norbornenyl-functionalized oligonucleotides, and the norbornene moiety of the reactants 26, 28 attaches to the polymeric hydrogel 30. It is to be understood, however, that the biological reactants 26, 28 used in this example method may include any example of the norbornene-functionalized or trans-cyclooctene-functionalized oligonucleotides disclosed herein. Additionally, each individual oligonucleotide may include any combination of the P5, P7, P15, and PA-PD primer sequences disclosed herein.
[0173] In one example, at least one biological reactant 26, 28 is the norbornenyl-functionalized oligonucleotide, and prior to introducing the biological reactant 26, 28, the method further comprises forming the norbornenyl-functionalized oligonucleotide by reacting 5-norbornene-2-methanol with 2 -cyanoethyl-ZV, / , / \ / ', / '- tetraisopropylphosphordiamidite to form a norbornenyl phosphoram idite, and incorporating the norbornenyl phosphoramidite into the norbornenyl-functionalized oligonucleotide via solid phase oligonucleotide synthesis. This reaction may be performed using the parameters described herein (e.g., in reference to Fig. 3).
[0174] In another example, at least one biological reactant 26, 28 is the norbornenyl-functionalized oligonucleotide and further includes the amide linkage positioned between the norbornene group and the phosphate group, and prior to introducing the biological reactant 26, 28, the method further comprises forming the norbornenyl-functionalized oligonucleotide by reacting 5-norbornene-2-carboxylic acid with ethanolamine to generate a first intermediate, reacting the first intermediate with 2-cyanoethyl-A / ,A / , / V',A / '-tetraisopropylphosphordiamidite to form a norbornenylphosphoramidite with an amide linkage, and incorporating the norbornenyl phosphoramidite with the amide linkage into the norbornenyl-functionalized oligonucleotide using solid phase oligonucleotide synthesis. This reaction may be performed using the parameters described herein (e.g., in reference to Fig. 4).
[0175] In examples, the biological reactants 26, 28 form an oligonucleotide set, where each biological reactant 26, 28 is respectively complementary to a designated adapter sequence on DNA library templates that are to be seeded to the biological reactants 26, 28.
[0176] While not shown in Fig. 5B or Fig. 5C, in some examples, the polymeric hydrogel 30 is not utilized; but rather, the substrate 14, 16 has the surface functional groups. In these examples, prior to attaching the biological reactant 26, 28 to the one of the surface functional groups, the method further comprises chemically introducing surface (e.g., azide or tetrazine) functional groups to the substrate 14, 16 to generate the surface functional groups. The chemical introduction of the surface functional groups may be performed before or after the depression 32 (or lane 22) is formed in the substrate 14, 16. Further, in these examples, the biological reactants 26, 28 become directly attached to the substrate 14 or layer 20 (with no intervening hydrogel layer 30 therebetween) by chemically reacting with the chemically-introduced surface functional groups.
[0177] In examples where the polymeric hydrogel 30 is not utilized, the chemical introduction of the surface functional groups to the substrate 14, 16 may be performed when forming the material used for the substrate 14, 16. For example, when a resin is used for the substrate 14 (or for the layer 20 of the substrate 16), the surface functional groups may be part of the monomeric components used to form the resin. As such, in some examples, the surface functional groups are inherently present in the material of the substrate 14 (or layer 20).
[0178] The chemical introduction of the surface functional groups to the substrate 14, 16 may alternatively be performed after the material used for the substrate 14, 16 has been formed. For example, the surface functional groups may be introduced to the substrate 14 (or the layer 20) using a chemical vapor depositionprocess, in which the surface of the substrate 14 (or layer 20) is heated and exposed to a silane that introduces the desired surface functional groups thereto.
[0179] Regardless of whether the polymeric hydrogel 30 is included, the attachment of the biological reactant 26, 28 to the polymeric hydrogel 30, or to the substrate 14, or the layer 20 may be facilitated by a catalyst. In an example, the attaching of the biological reactant 26, 28 to one of the surface functional groups of the substrate 14, 16 is catalyzed via exposure to a copper-based catalyst. The copperbased catalyst may be a copper sulfide catalyst. As such, the catalyst may facilitate the attachment of the biological reactants 26, 28 to functional groups of the polymeric hydrogel 30 or to functional groups that have been chemically introduced to the substrate 14 or layer 20.
[0180] Kit
[0181] A biological reactant kit generally comprises: a flow cell precursor, including: a substrate 14, 16; and an acrylamide polymer functionalized with surface groups selected from the group consisting of an azide and a tetrazine, the acrylamide polymer being positioned over at least a portion of the substrate 14, 16; and a biological reactant 26, 28, wherein the biological reactant 26, 28 is a norbornenyl- functionalized or a trans-cyclooctene-functionalized oligonucleotide respectively having either the structure (I) or the structure (II), as defined herein.
[0182] As described, the biological reactant 26, 28 includes a plurality of linked nucleotides ranging from 1 nucleotide to 200 nucleotides.
[0183] In an example, the biological reactant 26, 28 is the norbornenyl- functionalized oligonucleotide, and the norbornenyl-functionalized oligonucleotide further includes an amide linkage positioned between the norbornene group and the phosphate group.
[0184] The substrate 14, 16 may include any of the materials set forth herein, and the biological reactants 26, 28 may be any suitable example disclosed herein.
[0185] The kit may be used to form a flow cell 10, 10’. When the flow cell 10, 10’ is to remain open, the biological reactant 26, 28 is introduced to the substrate 14, 16 and allowed to incubate to attach to the surface functional groups. When the flowcell 10, 10’ is to be enclosed, the lid 116 or second substrate may be bonded to the substrate 14, 16 as described herein, and the biological reactant 26, 28 may be introduced and incubated either before or after such attachment. When the biological reactant 26, 28 is introduced after the enclosed flow cell 10, 10’ is formed, the inlet / input port and outlet / output port may be used for fluid flow. When the flow cell 10’ is to be formed, the CMOS chip 94 may be attached to the bottom surface of the substrate 14, 16 as described herein.
[0186] Sequencing Operation
[0187] In an example, the sequencing operation involves sequencing by synthesis.
[0188] At the outset of sequencing by synthesis, template strands may be formed. In template strand formation, library fragments / templates may be prepared from any nucleic acid sample (e.g., a DNA sample or an RNA sample). This process occurs off board the flow cell 10, 10’. The DNA nucleic acid sample may be fragmented into single-stranded, similarly sized (e.g., < 1000 bp) DNA fragments. The RNA nucleic acid sample may be used to synthesize complementary DNA (cDNA), and the cDNA may be fragmented into single-stranded, similarly sized (e.g., < 1000 bp) cDNA fragments. During preparation, adapters may be added to the ends of any of the fragments. Through reduced cycle amplification, different motifs may be introduced in the adapters, such as sequencing primer binding sites, indices, and regions that are complementary to the primers of the biological reactants 26, 28. In some examples, the fragments from a single nucleic acid sample have the same adapters added thereto. The final library templates include the DNA or cDNA fragment and adapters at both ends. The DNA or cDNA fragment represents the portion of the final library template that is to be sequenced.
[0189] A plurality of library templates may be introduced to the flow cell 10, 10’. Multiple library templates are hybridized, for example, to one of the primers immobilized on the polymeric hydrogel 30 (or substrate 14 or layer 20).
[0190] In sequencing by synthesis, amplification of the library templates involves cluster generation. In one example of cluster generation, library templatesbecome seeded to the primer portion of the biological reactants 26, 28 attached to the flow cell surface as described herein. The library templates are copied from the hybridized oligonucleotides (i.e., the primer portion of the biological reactants 26, 28) by 3’ extension using a high-fidelity DNA polymerase. The original library templates are denatured, leaving the copies immobilized in the depression 32, in the lane 22, or over the functionalized pads 36. Isothermal bridge amplification or some other form of amplification may be used to amplify the immobilized copies. For example, the copied templates loop over to hybridize to an adjacent, complementary oligonucleotide, and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary oligonucleotide and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters in the depressions 32, in the lane 22, or over the functionalized pads 36. Each cluster of double stranded bridges is denatured. In an example, the reverse strand is removed by cleaving at the cleavage site (e.g., specific base cleavage), leaving forward template strands. In another example, the forward strand is removed by cleaving at the cleavage site, leaving reverse template strands. Clustering results in the formation of several different template strand copies immobilized in different regions of the flow cell 10, 10’. The clusters in a given region will depend upon the sequence of the library template that is seeded and amplified within a given depression 32, at a particular region of the lane 22, or on a given functionalized pad 36. This example of clustering is referred to as bridge amplification, and is one example of the amplification that may be performed. It is to be understood that other amplification techniques may be used, e.g., exclusion amplification.
[0191] Sequencing primers may then be introduced to the flow cell 10, 10’. The sequencing primers hybridize to a co7
[0192] mplementary portion of the sequence of the template strand copies that are attached in the depressions 32, in the lane 22, or over the functionalized pads 36. The sequencing primers render the template strand copies ready for sequencing.
[0193] An incorporation mix including labeled nucleotides may then be introduced into the flow cell 10, 10’ e.g., via the inlet. In addition to the labeled nucleotides, the incorporation mix may include water, a buffer, and polymerases capable of nucleotide incorporation. When the incorporation mix is introduced into the flow cell 10, 10’, the mix enters the flow channel 12, and contacts the template strand copies.
[0194] The incorporation mix is allowed to incubate in the flow cell 10, 10’, and labeled nucleotides (including optical labels) are incorporated by respective polymerases into the nascent strands along the template strand copies. During incorporation, one of the labeled nucleotides is incorporated, by a respective polymerase, into one nascent strand that extends one sequencing primer and that is complementary to one of the template strand copies. Incorporation is performed in a template strand dependent fashion, and thus detection of the order and type of labeled nucleotides added to the nascent strand can be used to determine the sequence of the template strand copies. Incorporation occurs in at least some of the template strand copies during a single sequencing cycle.
[0195] The incorporated labeled nucleotides may include a reversible termination property due to the presence of a 3’ OH blocking group, which terminates further sequencing primer extension once the labeled nucleotide has been added. After a desired time for incubation and incorporation, the incorporation mix, including non-incorporated labeled nucleotides, may be removed from the flow cell 10, 10’ during a wash cycle. The wash cycle may involve a flow-through technique, where a washing solution (e.g., buffer) is directed into, through, and then out of flow channel 12, e.g., by a pump or other suitable mechanism.
[0196] Without further incorporation taking place, the most recently incorporated labeled nucleotides can be detected through an imaging event. During the imaging event, an illumination system may provide an excitation light to the flow cell 10, 10’. The optical labels of the incorporated labeled nucleotides emit optical signals in response to the excitation light. When the flow cell 10’ is used, these optical signals are converted into electrical signals which are detected.
[0197] After imaging or electrical detection is performed, a cleavage mix may then be introduced into the flow cell 10, 10’. In an example, the cleavage mix is capable of i) removing the 3’ OH blocking group from the incorporated nucleotides, and ii) cleaving the optical label from the incorporated nucleotide. Examples of 3’ OH blocking groups and suitable de-blocking agents / components in the cleavage mix may include: ester moieties that can be removed by base hydrolysis; allyl-moieties that can be removed with Nal, chlorotrimethylsilane and Na2S20s or with Hg(ll) in acetone / water; azidomethyl which can be cleaved with phosphines, such as tris(2- carboxyethyl)phosphine (TCEP) or tri(hydroxypropyl)phosphine (THP); acetals, such as tert-butoxy-ethoxy which can be cleaved with acidic conditions; MOM ( — CH2OCH3) moieties that can be cleaved with LiBF4 and CH3CN / H2O; 2,4-dinitrobenzene sulfenyl which can be cleaved with nucleophiles such as thiophenol and thiosulfate; tetrahydrofuranyl ether which can be cleaved with Ag(l) or Hg(ll); and 3’ phosphate which can be cleaved by phosphatase enzymes (e.g., polynucleotide kinase). Examples of suitable optical label cleaving agents / components in the cleavage mix may include: sodium periodate, which can cleave a vicinal diol; phosphines, such as tris(2-carboxyethyl)phosphine (TCEP) or tris(hydroxypropyl)phosphine (THP), which can cleave azidomethyl linkages; palladium and THP, which can cleave an allyl; bases, which can cleave ester moieties; or any other suitable cleaving agent.
[0198] Additional sequencing cycles may then be performed until the template strand copies are sequenced.
[0199] Additional Notes
[0200] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated byreference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0201] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0202] It is to be understood that the ranges provided herein include the stated range and any value or sub-range within the stated range, as if such values or subranges were explicitly recited. For example, a range of about 400 nm to about 1 pm (1000 nm), should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 pm, but also to include individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as from about 425 nm to about 825 nm, from about 550 nm to about 940 nm, etc. Furthermore, when “about” and / or “substantially” are / is utilized to describe a value, they are meant to encompass minor variations (up to + / - 10%) from the stated value.
[0203] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.
Claims
What is claimed is:
1. A biological reactant, comprising: a norbornenyl-functionalized or a trans-cyclooctene-functionalized oligonucleotide respectively having a structure (I):wherein in either structure (I) or structure (II), A is a plurality of linked nucleotides and B is a nitrogenous base.
2. The biological reactant as defined in claim 1 , wherein the plurality of linked nucleotides ranges from 1 nucleotide to 200 nucleotides.
3. The biological reactant as defined in claim 1 or claim 2, wherein the biological reactant is the norbornenyl-functionalized oligonucleotide, and the norbornenyl-functionalized oligonucleotide further includes an amide linkage positioned between the norbomene group and the phosphate group.
4. A method, comprising: introducing a biological reactant to a substrate or a layer positioned over the substrate, the substrate or layer having surface functional groups selected from the group consisting of an azide and a tetrazine, whereby the biological reactant attaches to one of the surface functional groups, wherein the biological reactant is a norbornenyl-functionalized or a trans-cyclooctene-functionalized oligonucleotide respectively having a structure (I):wherein in either structure (I) or structure (II), A is a plurality of linked nucleotides and B is a nitrogenous base.
5. The method as defined in claim 4, wherein the plurality of linked nucleotides ranges from 1 nucleotide to 200 nucleotides.
6. The method as defined in claim 4 or claim 5, wherein the biological reactant is the norbornenyl-functionalized oligonucleotide and further includes an amide linkagepositioned between the norbornene group and the phosphate group, and wherein prior to introducing the biological reactant, the method further comprises: forming the norbornenyl-functionalized oligonucleotide by reacting 5- norbornene-2-carboxylic acid with ethanolamine to generate a first intermediate; reacting the first intermediate with 2-cyanoethyl-A / , A / , / V', A / '- tetraisopropylphosphordiamidite to form a norbornenyl phosphoram idite with an amide linkage; and incorporating the norbornenyl phosphoram idite with the amide linkage into the norbornenyl-functionalized oligonucleotide using solid phase oligonucleotide synthesis.
7. The method as defined in claim 4 or claim 5, wherein the biological reactant is the norbornenyl-functionalized oligonucleotide, and wherein prior to introducing the biological reactant, the method further comprises: forming the norbornenyl-functionalized oligonucleotide by reacting 5- norbornene-2-methanol with 2-cyanoethyl-A / , A / , A / ', A / ' -tetraisopropylphosphordiam idite to form a norbornenyl phosphoram idite; and incorporating the norbornenyl phosphoram idite into the norbornenyl- functionalized oligonucleotide via solid phase oligonucleotide synthesis.
8. The method as defined in one of claims 4 through 7, wherein: each of the surface functional groups is the azide; and the attaching of the biological reactant to the one of the surface functional groups is catalyzed via exposure to a copper-based catalyst.
9. The method as defined in one of claims 4 through 7, wherein: the layer is positioned over the substrate; the layer is an azide-functionalized acrylamide polymer; each of the surface functional groups is the azide; and the attaching of the biological reactant to the one of the surface functional groups involves attaching the biological reactant to the azide-functionalized acrylamide polymer.
10. The method as defined in one of claims 4 through 8, wherein: the substrate has the surface functional groups; and prior to attaching the biological reactant to the one of the surface functional groups, the method further comprises chemically introducing functional groups to the substrate to generate the surface functional groups.
11. A kit, comprising: a flow cell precursor, including: a substrate; and an acrylamide polymer functionalized with surface groups selected from the group consisting of an azide and a tetrazine, the acrylamide polymer being positioned over at least a portion of the substrate; and a biological reactant, wherein the biological reactant is a norbornenyl- functionalized or a trans-cyclooctene-functionalized oligonucleotide respectively having a structure (I):, or a structure (II):wherein in either structure (I) or structure (II), A is a plurality of linked nucleotides and B is a nitrogenous base.
12. The kit as defined in claim 11 , wherein the plurality of linked nucleotides ranges from 1 nucleotide to 200 nucleotides.
13. The kit as defined in claim 11 or claim 12, wherein the biological reactant is the norbornenyl-functionalized oligonucleotide, and the norbornenyl-functionalized oligonucleotide further includes an amide linkage positioned between the norbornene group and the phosphate group.