Methods for measuring foetal fraction or maternal contamination and / or determining foetal genotype or foetal abnormalities

Abstract

Disclosed herein are novel target genomic regions and corresponding primers and probes for performing prenatal testing assays, and methods for performing prenatal testing assays which comprise estimation of foetal fraction, aneuploidy assays, and 22q microdeletion assays, to obtain aneuploidy scores and 22q microdeletion scores, and suitably foetal fraction adjusted aneuploidy scores, and foetal fraction adjusted 22q microdeletion scores. The methods may be particularly useful for NIPT or IPT applications.

Description

METHODS FOR MEASURING FOETAL FRACTION OR MATERNAL CONTAMINATION AND / OR DETERMINING FOETAL GENOTYPE OR FOETAL ABNORMALITIES Background of the Invention Accurate diagnosis of chromosomal aneuploidies, such as trisomies of chromosomes 13, 18, and 21, requires an accurate estimate of the foetal fraction or maternal contamination of foetal DNA samples, which requires foetal DNA to be distinguished from maternal DNA despite the high similarity in genetic sequence. Digital PCR (dPCR) assays are used for applications such as foetal fraction estimation and non-invasive prenatal testing (NIPT) assaying chromosome copy number, which require highly accurate detection and counting of target sequences in cell-free DNA (cfDNA). Aneuploidy assays typically require many targets, often including multiple target loci for each target chromosome, which limits the use of target sequence specific probe strategies given that amplification of multiple target sequences often results in unwanted side-reactions, such as primer dimers and primer-probe interactions which impact the performance of the assay. However, alternative probe strategies often yield poor signal strength as the probes are not cleaved throughout the PCR cycles. In recent years, multiplexing dPCR methodologies have emerged, wherein multiple target DNA sequences are able to be simultaneously detected within a single dPCR reaction. dPCR multiplexing requires the dPCR data to be separated at the analysis stage, wherein the extent of separation can be discriminating and / or non-discriminating at the target level. Current methods of multiplexing dPCR known in the art include: probe fluorophore-based multiplexing, in which one or more target sequence specific probes comprise a fluorophore, and each fluorophore has a unique excitation and emission spectra; amplitude-based multiplexing, in which the concentrations of dPCR amplification primers and dPCR probes are varied on a specific target sequence basis; and ratio-based multiplexing, in which the ratio of two or more target sequence specific probes labelled with fluorophores each emitting in different colour channels is varied for each specific target sequence. In the context of dPCR NIPT and / or IPT applications, there is generally a limited amount of DNA available, and so highly accurate detection and counting of target sequences is required. For example, there may be, on average, about 3,000 genome equivalent copies extracted from one tube of sample (e.g. a blood sample), and from that between approximately 4 to 15% may be of foetal origin. In the prior art, therefore, a multitude of target loci per chromosome are interrogated in a single assay, which in some cases extends across more than one chromosome. However, amplification of multiple target sequences often results in unwanted side-reactions. Furthermore, knowledge of the target cfDNA sequence is typically required in order to design dPCR assays, and for NIPT applications, for example, the 5’ and 3’ extremities of cfDNA generally vary within and across subjects, and this can affect the consistency of cfDNA copy number measurements and pose a challenge for dPCR assay design, particularly multiplexing assay design.Having regard to the prior art, therefore, it would be desirable to have a method for preparing and detecting target sequences in DNA that reduces the number of sequence specific primers and probes required for amplifying multiple targets in dPCR. Such a method may be particularly beneficial for use in NIPT and / or IPT applications, which are not limited to dPCR, and may comprise qPCR assays. It would also be desirable to5 have probes which do not produce unwanted side-reactions and yield suitable signal strength in a multiplexed assay.The present invention seeks to overcome one or more of the problems found in the prior art.10 Summary of the InventionThe disclosure relates generally to methods and systems for measuring foetal fraction or maternal contamination and / or determining foetal genotype or foetal abnormality of a sample obtained from a pregnant human subject. The disclosure also relates to oligonucleotide probes activated by RNAseH2. The disclosure15 also relates to methods and systems for detecting oligonucleotides by means of polynucleotide amplification. In various aspects and embodiments, the disclosure provides methods for preparing and detecting target sequences in DNA that reduces the number of sequence specific primers and probes required for amplifying multiple targets in dPCR. Such methods can be particularly beneficial for use in NIPT and / or IPT applications, which are not limited to dPCR, and may include qPCR assays. The disclosure also provides probes which20 beneficially do not produce unwanted side-reactions and yield suitable signal strength in a multiplexed assay.Beneficially, the disclosure provides methods, systems and consumables, such as universal primers and probes, which allow for the detection of multiple different oligonucleotides using a reduced number of different primers and probes compared to prior art methods and systems. In this way, methods and systems for25 detection and diagnosis may be facilitated by one or more of reduced cost and complexity, ease of performance, increased efficacy and / or improved reliability.In aspects of the invention, a method for measuring foetal fraction or maternal contamination and / or determining foetal genotype or foetal abnormality of a sample obtained from a pregnant human subject is30 provided, the method comprising: (a) providing a DNA sample; (b) incubating the DNA with at least one methylation-sensitive restriction enzyme; (c) treating the DNA to generate a plurality of target single stranded oligonucleotides; (d) reverse transcribing the plurality of target single stranded oligonucleotides to obtain a plurality of first double stranded oligonucleotides, using a plurality of reverse transcription primers, each comprising: a universal RNAseH2 probe sequence, and / or a universal forward primer sequence, wherein the35 plurality of reverse transcription primers comprises: at least one primer configured to anneal to one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA; and at least one primer configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA; and optionally one or more of: at least one primer configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA, at least one primer configured to anneal to40 one or more loci hypermethylated in both foetal DNA and maternal DNA, at least one primer configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal DNA; (e) performing a template switching reaction on the plurality of first double stranded oligonucleotides to generate a plurality of seconddouble stranded oligonucleotides, using a plurality of ISO’s each comprising a universal reverse primer sequence; (f) amplifying the plurality of second double stranded oligonucleotides to obtain a plurality of amplification products and a plurality of probe signals; (g) detecting and quantifying the plurality of probe signals.5In aspects of the invention, a method for determining foetal genotype or foetal abnormality of a sample is provided, the method comprising: (a) providing a DNA sample; (b) treating the DNA to generate a plurality of target single stranded oligonucleotides; (c) reverse transcribing the plurality of target single stranded oligonucleotides to obtain a plurality of first double stranded oligonucleotides, using a plurality of reverse10 transcription primers, each comprising: a universal RNAseH2 probe sequence, and / or a universal forward primer sequence, (d) performing a template switching reaction on the plurality of first double stranded oligonucleotides to generate a plurality of second double stranded oligonucleotides, using a plurality of ISO’s each comprising a universal reverse primer sequence; (e) amplifying the plurality of second double stranded oligonucleotides to obtain a plurality of amplification products and a plurality of probe signals; (f) detecting and15 quantifying the plurality of probe signals.In aspects of the invention, the method of detecting one or more oligonucleotides by amplification comprises: (a) providing a plurality of target single stranded oligonucleotides, (b) contacting at least one target single stranded oligonucleotide of the plurality of target single stranded oligonucleotides with a first oligonucleotide,20 wherein the first oligonucleotide comprises: a 3’ sequence configured to anneal to a sequence of the at least one target single stranded oligonucleotide, and a first universal oligonucleotide probe sequence corresponding to an annealing portion of a first universal oligonucleotide probe, and / or a first universal forward primer sequence corresponding to an annealing portion of a first universal forward amplification primer; and (c) synthesising a complementary strand to the at least one target single stranded oligonucleotide by extending25 the first oligonucleotide, thereby generating at least one first double stranded oligonucleotide, and (d) contacting the at least one first double stranded oligonucleotide with a second oligonucleotide, wherein the second oligonucleotide comprises: a 3’ sequence configured to anneal to a sequence towards or at the 3’ end of the complementary strand, a first universal reverse primer sequence corresponding to an annealing portion of a first universal reverse amplification primer; and (e) extending the complementary strand of the at least one30 first double stranded oligonucleotide along the second oligonucleotide, thereby generating at least one second double stranded oligonucleotide, and (f) providing: a first universal forward amplification primer, a first universal reverse amplification primer; and a first universal oligonucleotide probe and / or a first non-universal oligonucleotide probe configured to anneal to a sequence of the target single stranded oligonucleotide; and (g) performing an amplification reaction on the at least one second double stranded oligonucleotide to generate35 a plurality of oligonucleotide amplification products and detecting a plurality of probe signals emitted by one or more universal oligonucleotide probes or one or more non-universal oligonucleotide probes, wherein the probe signals are emitted during the amplification reaction.In aspects of the invention, the method of detecting one or more oligonucleotides by amplification comprises:40 (a) providing a plurality of target single stranded oligonucleotides, (b) contacting at least one target single stranded oligonucleotide of the plurality of target single stranded oligonucleotides with a first oligonucleotide, wherein the first oligonucleotide comprises: a 3’ sequence configured to anneal to a sequence of the at leastone target single stranded oligonucleotide, and a first universal oligonucleotide probe sequence corresponding to an annealing portion of a first universal oligonucleotide probe, and / or a first universal forward primer sequence corresponding to an annealing portion of a first universal forward amplification primer; and (c) synthesising a complementary strand to the at least one target single stranded oligonucleotide by extending5 the first oligonucleotide, thereby generating at least one first double stranded oligonucleotide, and (d) contacting the at least one first double stranded oligonucleotide with a second oligonucleotide, wherein the second oligonucleotide comprises: a 3’ sequence configured to anneal to a sequence towards or at the 3’ end of the complementary strand, a first universal reverse primer sequence corresponding to an annealing portion of a first universal reverse amplification primer; and (e) extending the second oligonucleotide along the10 complementary strand of the first double stranded oligonucleotide, thereby generating at least one second double stranded oligonucleotide, and (f) providing: a first universal forward amplification primer, a first universal reverse amplification primer; and a first universal oligonucleotide probe and / or a first non-universal oligonucleotide probe configured to anneal to a sequence of the target single stranded oligonucleotide; and (g) performing an amplification reaction on the at least one second double stranded oligonucleotide to generate15 a plurality of oligonucleotide amplification products and detecting a plurality of probe signals emitted by one or more universal oligonucleotide probes or one or more non-universal oligonucleotide probes, wherein the probe signals are emitted during the amplification reaction.In aspects and embodiments of the invention, the amplification reaction further comprises: denaturing the at20 least one second double stranded oligonucleotide to obtain: at least one antisense single stranded oligonucleotide comprising the sequence of the complementary strand to the target single stranded oligonucleotide, at least one sense single stranded oligonucleotide comprising the sequence of a target single stranded oligonucleotide; and annealing a first universal forward amplification primer to the at least one sense single stranded oligonucleotide, annealing a first universal reverse amplification primer to the at least one25 antisense single stranded oligonucleotide, annealing a first universal oligonucleotide probe to the at least one sense single stranded oligonucleotide, or annealing a first non-universal oligonucleotide probe to the at least one sense single stranded oligonucleotide, and quantifying the plurality of probe signals.In embodiments, amplifying the plurality of second double stranded oligonucleotides further comprises30 providing: RNAseH2 enzyme, a plurality of universal forward amplification primers, a plurality of universal reverse amplification primers, a polymerase, and a plurality of universal RNAseH2 activated oligonucleotide probes, each comprising: a fluorophore, a quencher, a sequence configured to anneal to the universal RNAseH2 probe sequence, at least one ribonucleotide separating the fluorophore and the quencher; or a plurality of non-universal RNAseH2 activated oligonucleotide probes, each comprising: a fluorophore, a35 quencher, a sequence configured to anneal to a sequence of the target single stranded oligonucleotide, at least one ribonucleotide separating the fluorophore and the quencher.In embodiments, amplifying the plurality of second double stranded oligonucleotides or the amplification reaction further comprises: denaturing the at least one second double stranded oligonucleotide to obtain: at40 least one antisense single stranded oligonucleotide comprising the sequence of the complementary strand to the target single stranded oligonucleotide, at least one sense single stranded oligonucleotide comprising the sequence of a target single stranded oligonucleotide; and annealing the first universal forward amplificationprimer to the at least one sense single stranded oligonucleotide, annealing the first universal reverse amplification primer to the at least one antisense single stranded oligonucleotide, annealing the first universal oligonucleotide probe to the at least one sense single stranded oligonucleotide, or annealing the first non- universal oligonucleotide probe to the at least one sense single stranded oligonucleotide.5In embodiments the sample may be obtained from any of the following: blood from a pregnant woman comprising maternal and foetal DNA, plasma from a pregnant woman comprising maternal and foetal DNA, serum from a pregnant woman comprising maternal and foetal DNA, chorionic villus comprising maternal and foetal DNA, amniotic fluid comprising maternal and foetal DNA, foetal blood, optionally obtained from the10 umbilical cord.In embodiments, target single stranded oligonucleotides of the plurality of target single stranded oligonucleotides originating from: one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA, one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA, one or15 more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA, one or more loci hypermethylated in both foetal DNA and maternal DNA, one or more loci hypomethylated in both foetal DNA and maternal DNA; are each distinguishable from each other based on their respective probe signals of the plurality of probe signals.20 In embodiments probe signals of the plurality of probe signals originating from either: one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA, one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA, one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA, one or more loci hypermethylated in both foetal DNA and maternal DNA, one or more loci hypomethylated in both foetal DNA and maternal DNA; are distinguishable25 from each other.In embodiments, two or more target single stranded oligonucleotides of the plurality of target single stranded oligonucleotides are derived from at least two different chromosomes.30 In embodiments at least one specific amplification product originating from a specific chromosome of the plurality of oligonucleotide amplification products is distinguishable from at least one other specific amplification product from a different specific chromosome, optionally wherein the plurality of distinguishable amplification products is at least about 10, at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, or at least about 150.35In embodiments, the method comprises at least two populations of universal or non-universal RNAseH2 probes for targeting a corresponding plurality of different target chromosomes; for example, wherein the at least two populations of universal or non-universal RNAseH2 probes each include up to 20, up to 12, up to 10, up to 8, up to 6, or up to 4 universal or non-universal RNAseH2 probes, optionally wherein at least one specific40 amplification product of the plurality of oligonucleotide amplification products is distinguishable from at least one other specific amplification product.In embodiments, the at least one primer configured to anneal to one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA, at least one primer configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA, at least one primer configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA,5 at least one primer configured to anneal to one or more loci hypermethylated in both foetal DNA and maternal DNA, at least one primer configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal DNA, each comprise a different universal RNAseH2 probe sequence.In embodiments, the at least one primer configured to anneal to one or more loci hypermethylated in foetal10 DNA and hypomethylated in maternal DNA, at least one primer configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA, at least one primer configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA, at least one primer configured to anneal to one or more loci hypermethylated in both foetal DNA and maternal DNA, at least one primer configured to anneal to one or more loci hypomethylated in both foetal DNA and15 maternal DNA, comprise one or more different universal RNAseH2 probe sequence.In embodiments, the plurality of reverse transcription primers comprises at least three primers configured to anneal to a loci hypermethylated in foetal DNA and hypomethylated in maternal DNA; and at least three primers configured to anneal to at least three loci hypomethylated in foetal DNA and hypermethylated in20 maternal DNA.In embodiments, the plurality of reverse transcription primers comprises at least one primer configured to anneal to at least three or between 6-10 methylation-insensitive loci in foetal DNA and in maternal DNA, and at least one primer configured to anneal to at least three or between 6-10 loci hypermethylated in both foetal25 DNA and maternal DNA, and at least one primer configured to anneal to at least three or between 6-10 loci hypomethylated in both foetal DNA and maternal DNA.In embodiments, the loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA of at least one primer is configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal30 DNA and in maternal DNA is on the Y chromosome.In embodiments, the DNA is partitioned into a plurality of separate volumes, optionally prior to incubating the DNA with at least one methylation-sensitive restriction enzyme; optionally wherein the separate volumes are droplets or microwells.35In embodiments, the method is performed in a reaction mixture, wherein the reaction mixture is in two or more partitions.In embodiments, the reaction mixture comprises: the DNA extracted from the sample, the plurality of reverse40 transcription primers, and the plurality of TSO’s, and the plurality of universal forward amplification primers, and the plurality of universal reverse amplification primers, and the plurality of universal RNAseH2 probe or the plurality of non-universal RNAseH2 probe.In embodiments, each universal or non-universal RNAseH2 probe of the plurality of universal or non-universal RNAseH2 probes forms a stem-loop and comprises 5’ to 3’: a first stem sequence, a loop sequence, and a second stem sequence that is the reverse complement of the first stem sequence, wherein the ribonucleotide5 is in the loop sequence, and wherein the 5’ universal sequence comprises at least part of the loop sequence.In embodiments, the RNaseH2 enzyme is a Pyrococcus abyssi RNase H2 enzyme or a mutant thereof, Pyrococcus furiosis RNase H2 enzyme or a mutant thereof, Pyrococcus horikoshii RNase H2 enzyme or a mutant thereof, Thermococcus kodakarensis RNase H2 enzyme or a mutant thereof, or a Thermococcus10 litoralis RNase H2 enzyme or a mutant thereof.In embodiments, quantifying the plurality of probe signals further comprises determining a corrected concentration of foetal DNA (foetal_FF) in the sample and / or a corrected concentration of maternal DNA (matemal_FF) in the sample.15In embodiments, determining the corrected concentration of foetal DNA comprises a calculation (stepta): foetal_FF = [foetal] / [hyper]-[hypo] / [hyper]-0.0820 wherein ‘foetal_FF’ represents a corrected concentration of foetal DNA; [hyper] is hypermethylated reference copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypermethylated in both foetal DNA and maternal DNA; [hypo] is hypomethylated reference copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the universal25 RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal DNA; [foetal] is foetal DNA copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA; and 0.08 is a background correction factor derived by performing30 regression analysis between foetal methylation targets and chrY targets in male samples.In embodiments, determining the corrected concentration of maternal DNA comprises a calculation (stepl b): maternal_FF = 1-[maternal] / [hyper]35 wherein ‘maternal_FF’ represents a corrected concentration of maternal DNA; [maternal] is maternal DNA copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA; and [hyper] is as defined above.40 In embodiments, the method further comprises determining the average methylation foetal fraction value and performing custom background correction based on the calculation (step 2):meth_FF = average(foetal_FF,maternal_FF) wherein ‘meth_FF’ represents the average methylation foetal fraction value; and ‘foetal_FF’ and ‘maternal_FF’ are as defined above.5In embodiments, the method further comprises determining the final foetal fraction (FF) value in the case of a male foetus or a female foetus i.e. with or without chrY present in the foetal fraction.First, the proportion of chrY in the foetal fraction is determined based on the calculation (step 3):10 chrY_FF=2-[chrY] / [control] wherein ‘chrY_FF’ is the proportion of chromosome Y in the foetal fraction DNA sample; [chrY] is the concentration of chrY in the total DNA sample; and [control] is the total DNA concentration based on signal (in15 partitions) from the methylation insensitive amplification primer and probe set.In the next step, the final foetal fraction in the case of a male foetus or a female foetus is calculated based on a threshold value of 0.02 for the value ‘chrY_FF’, based on the calculations: for a male foetus, i.e. where chrY_FF is above a threshold of 0.02 (step 4a):20FF_calculated = (2-meth_FF+chrY_FF) / 3 or for a female foetus, i.e. where chrY_FF is 0.02 or below (step 4b):25 FF_calculated = meth_FF if no chrY signal is present above thresholdWherein ‘FF_calculated’ is the final, calculated foetal fraction value; and ‘meth_FF’ and ‘chrY_FF’ are as defined above.30 In alternative embodiments, quantifying the plurality of probe signals further comprises determining a corrected concentration of foetal DNA (FetCorr) in the sample and / or a corrected concentration of maternal DNA (MatCorr) in the sample, wherein determining the corrected concentration of foetal DNA comprises a calculation:[TotaZ][Fet, .[Hyper]-[tfypo] * ([FetJ - [Hypo]) (Eq. 1);35 wherein [Total] is total copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA, [Hyper] is hypermethylated reference copy concentration based on signal in partitions from the RNAseH240 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypermethylated in both foetal DNA and maternal DNA, [Hypo] ishypomethylated reference copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal DNA, and [Fet] is foetal DNA copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the5 universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA; and determining the corrected concentration of maternal DNA comprises a calculation:[Hypo]) (Eq .2),10 wherein [Mat] is maternal DNA copy concentration based on signal in partitions from the RNAseH2 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA.15 In embodiments, the method further comprises determining the foetal fraction (FF) in the sample, wherein determining the foetal fraction comprises at least one of the following calculations (a)-(d):(a) FF = VFetcorrA[TotaZ] '2025 In embodiments, the method further comprises computing an estimated foetal fraction at least partially based on the foetal fraction in the sample and a model.In embodiments, the model is a generalized additive model (GAM), a linear model, or a second-order polynomial model at least partially based on a set of clinical foetal fraction data and a corresponding set of30 foetal fraction measurements using next-generation sequencing (NGS).In embodiments, the method further comprises determining the foetal fraction of a male foetus in the DNA sample, wherein determining the male foetus foetal fraction comprises:35 orwherein [YChr] is the concentration of Y-chromosome specific sequences based on signal in partitions from the RNAseH2 probes configured to anneal to the universal RNAseH2 probe sequence of the reverse transcription primers configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA, wherein the one or more methylation-insensitive loci are on5 the Y chromosome.In embodiments, the at least one primer configured to anneal to one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA of the plurality of reverse transcription primers comprises one of SEQ IDs 13 to 20. In embodiments, the sequence configured to anneal to one or more loci hypermethylated10 in foetal DNA and hypomethylated in maternal DNA of the reverse transcription primer comprises one of SEQ IDs 60 to 67. In embodiments, the at least one primer configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA of the plurality of reverse transcription primers comprises one of SEQ IDs 21 to 27. In embodiments, the sequence configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA of the reverse transcription primer15 comprises one of SEQ IDs 68 to 74. In embodiments, the at least one primer configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA of the plurality of reverse transcription primers comprises one of SEQ IDs 39 to 47. In embodiments, the sequence configured to anneal to one or more methylation-insensitive loci unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA of the reverse transcription primers comprises one of SEQ IDs 86 to 94. In embodiments,20 the at least one primer configured to anneal to one or more loci hypermethylated in both foetal DNA and maternal DNA of the plurality of reverse transcription primers comprises one of SEQ IDs 28 to 34. In embodiments, the sequence configured to anneal to one or more loci hypermethylated in both foetal DNA and maternal DNA of the reverse transcription primer comprises one of SEQ IDs 75 to 81. In embodiments, the at least one primer configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal25 DNA of the plurality of reverse transcription primers comprises one of SEQ IDs 35 to 38, 58, 59. In embodiments, the sequence configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal DNA of the reverse transcription primer comprises one of SEQ IDs 82 to 85, 105, 106. In embodiments, the at least one primer configured to anneal to one or more methylation-insensitive loci on the Y chromosome unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA of the plurality of reverse30 transcription primers comprises one of SEQ IDs 48 to 57. In embodiments, the sequence configured to anneal to one or more methylation-insensitive loci on the Y chromosome unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA of the reverse transcription primers comprises one of SEQ IDs 95 to 104. In embodiments, the sequence of the universal reverse amplification primer comprises one of SEQ IDs 1 to 6.35 In embodiments, the sample is invasive. In some such embodiments, the calculated foetal fraction instead comprises a measurement of maternal contamination.In embodiments of the invention, the amplification reaction is dPCR, optionally dPCR using droplets. In embodiments of the invention, the plurality of target single stranded oligonucleotides is obtained from a plurality40 of parent oligonucleotides selected from any of the following: a plurality of denatured double stranded or nonlinear single stranded parent oligonucleotides; and / or a plurality of 3’ end homo-polynucleic acid-tailed parent oligonucleotides; and / or a plurality of parent oligonucleotides processed to reduce its length to obtain a pluralityof target single stranded oligonucleotides having a desirable length by any of or any combination of the following methods: digestion with at least one restriction enzyme, heat denaturing, fragmentase mediated shearing, size selection, sonication; and / or a plurality of cell free oligonucleotides.5 In embodiments of the invention, the desirable length of the plurality of target single stranded oligonucleotides is up to about 25, up to about 50, up to about 100, up to about 200, up to about 300, up to about 400, up to about 500, up to about 600, up to about 700, up to about 800, up to about 900, up to about 1000, or up to about 1500 nucleotides, or between about 25 and 1500, between about 50 and 1000, between about 50 to 500, between about 75 and 300, or between about 100 and 200 nucleotides.10In embodiments of the invention, the method may be performed in a reaction mixture, wherein two or more reaction mixtures comprise a two or more partitions comprising the reaction mixture.In embodiments of the invention, the reaction mixture may comprise: the plurality of target single stranded15 oligonucleotides, and at least one first oligonucleotide, and at least one second oligonucleotide, and at least one first universal forward amplification primer, and at least one first universal reverse amplification primer, and at least one universal oligonucleotide probe or at least one non-universal oligonucleotide probe.In embodiments of the invention, the 3’ end of the first oligonucleotide may be complementary to a sequence20 at or towards the 3’ end of a target single stranded oligonucleotide, optionally wherein the sequence comprises at least the terminal nucleotide of the 3’ end of the target single stranded oligonucleotide. In embodiments of the invention, the first oligonucleotide may comprise a 3’ poly(A) sequence which anneals to one or more 3’ T nucleotides of the 3’ end T-tailed plurality of parent oligonucleotides of which the target single stranded oligonucleotides are derived. In embodiments of the invention, the complementary strand to the target25 oligonucleotide may be synthesised by a polymerase to generate the first double stranded oligonucleotide, wherein the polymerase is a reverse transcriptase with terminal nucleotide transferase activity, wherein a one or more 3’ overhanging terminal nucleotides are added to the 3’ end of the complementary strand by the reverse transcriptase during reverse transcription, optionally wherein one or more C nucleotides are added to the 3’ end of the complementary strand by the reverse transcriptase during reverse transcription. In30 embodiments of the invention, the second oligonucleotide may be a template switching oligo (TSO) comprising a one or more 3’ nucleotides complementary to the one or more overhanging terminal nucleotides of the complementary strand. In embodiments of the invention, the method may comprise the addition of one or more T nucleotides to the 3’ end of the complementary strand of the first double stranded oligonucleotide by T- tailing.35In embodiments of the invention, at least one first double stranded oligonucleotide may be denatured to produce: at least one single stranded target strand oligonucleotide comprising the sequence of the target single stranded oligonucleotide, and at least one single stranded complementary strand comprising the sequence of the complementary strand to the target oligonucleotide.40In embodiments of the invention, the second oligonucleotide may comprise a poly(A) sequence configured to anneal to the one or more T nucleotides added to the complementary strand by T-tailing. In embodiments ofthe invention, a first population of universal oligonucleotide probes may be configured to anneal to second double stranded oligonucleotides generated from target single stranded oligonucleotides derived from a specific chromosome, and wherein a second population of universal oligonucleotide probes may be configured to anneal to second double stranded oligonucleotides generated from target single stranded oligonucleotides5 derived from a different specific chromosome.In embodiments of the invention, the method may comprise at least two populations of universal oligonucleotide probes for targeting a corresponding plurality of different chromosomes; for example, wherein the at least two populations of universal or non-universal oligonucleotide probes each include up to 20, up to10 12, up to 10, up to 8, up to 6, or up to 4 universal oligonucleotide probes, optionally wherein at least one specific amplification product of the plurality of oligonucleotide amplification products may be distinguishable from at least one other specific amplification product.In embodiments of the invention, all of the second double stranded oligonucleotides may be amplified by a15 first universal reverse amplification primer. Beneficially, in embodiments of the invention, the concentration of universal reverse amplification primers may be at least about 1 .2, about 1 .5, about 2, about 3, about 5, about 10, about 20, or about 50-fold higher than the concentration of universal forward amplification primers in the amplification reaction.20 In embodiments of the invention, two or more ofthe plurality of target single stranded oligonucleotides may be derived from at least two different chromosomes. In embodiments of the invention, at least one specific amplification product originating from a specific chromosome of the plurality of oligonucleotide amplification products is distinguishable from at least one other specific amplification product from a different specific chromosome, optionally wherein the plurality of distinguishable amplification products is at least about 10, at25 least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, or at least about 150. In embodiments of the invention, the first universal oligonucleotide probe may be configured to anneal to the complementary sequence of the universal forward primer sequence. In embodiments of the invention, the plurality of single stranded oligonucleotides may be derived from a cfDNA sample containing maternal and foetal DNA from a pregnant human subject. In embodiments of the invention,30 the method comprises quantifying the plurality of probe signals to estimate the fraction of foetal DNA in a cfDNA sample and / or estimate the copy number of one or more chromosomes in a cfDNA sample.In any aspects and embodiments of this disclosure, prior to performing an amplification reaction, the sample / amplification mixture may be partitioned. In any aspects and embodiments, a partitioned sample or reaction35 mixture may comprise 2 or more partitions. In embodiments there may be between about 2 and 1 ,000,000 partitions, between about 50 and 1 ,000,000 partitions, between about 100 and 100,000 partitions, or between about 1 ,000 and 100,000 partitions, depending on the means of partitioning. For example, partitions may be achieved by forming droplets of the sample or reaction mixture within a non-miscible liquid; or partitions may be achieved by aliquoting multiple fractions of the sample of reaction mixture into e.g. separate containers.40Within the scope of this disclosure, it is expressly intended that the invention encompasses any of the various aspects, embodiments, examples and alternatives set out in the preceding paragraphs, in the clauses, in theclaims and / or in the following description, and in particular the individual features thereof, and that any such features may be taken independently or in any combination. That is, all embodiments and / or features of any aspect or embodiment can be combined in any way and / or combination, unless such features are incompatible. More particularly, it is specifically intended that any embodiment of any aspect may form an5 embodiment of any other aspect, and all such combinations are encompassed within the scope of the disclosure. The applicant reserves the right to change any originally filed claim or file any new claim accordingly, including the right to amend any originally filed claim to depend from and / or incorporate any feature of any other claim although not originally claimed in that manner.10 Brief Description of the DrawingsA better understanding of the nature and advantages of embodiments of the present invention may be gained with reference to the following detailed description and the accompanying drawings. Those skilled in the art will appreciate that the invention described in the drawings is susceptible to variations and modifications other15 than those specifically described in the drawings. It is to be understood that the invention includes all such variations and modifications. The present invention is not to be limited in scope by the specific drawings described herein, which are intended for the purpose of exemplification only.Figure 1 Methylation-sensitive digestion ddPCR and Y chromosome ddPCR foetal fraction estimations.20 This figure shows the correlation between the methylation-sensitive foetal fraction estimations and the SRY- based foetal fraction estimations for an illustrative assay detailed herein including the Examples section.Figure 2A An analysis of methylation patterns for maternal and foetal methylation sites as well as ubiquitously methylated or unmethylated sites, particularly, foetal hypermethylation sites.25Figure 2B An analysis of methylation patterns for maternal and foetal methylation sites as well as ubiquitously methylated or unmethylated sites, particularly, maternal hypermethylation sites.Figure 2C An analysis of methylation patterns for maternal and foetal methylation sites as well as30 ubiquitously methylated or unmethylated sites, particularly, hypermethylation sites.Figure 2D An analysis of methylation patterns for maternal and foetal methylation sites as well as ubiquitously methylated or unmethylated sites, particularly, hypomethylation sites.35 Figure 3 Depiction of how methylation-sensitive restriction enzymes (MSREs) enable ddPCR to quantify foetal and maternal cfDNA based on differences in foetal and maternal cfDNA methylation. As depicted, MSRE digestion is performed in-droplet, with no disruption to the ddPCR workflow. Foetal and maternal cfDNA are quantified simultaneously in the same ddPCR reaction. 1) Hypermethylated foetal cfDNA is quantified after MSRE digestion of hypomethylated maternal cfDNA. 2) Maternal cfDNA is quantified after40 MSRE digestion of hypomethylated foetal cfDNA. 3) Total cfDNA is quantified from non-digested regions.Figure 4A Depiction of multiplexed ddPCR assays, which depicts in particular, a general ddPCR assay format.Figure 4B Depiction of multiplexed ddPCR assays, which depicts in particular, that multiplex primer pairs5 targeting the same chromosome are combined in a single fluorescent channel using a unique universal probe.Figure 5A Depiction of foetal fraction estimation with the developed linear model, polynomial model, and generalized additive model (GAM) described herein including in Example 2, which depicts in particular, the foetal fraction estimation with the developed linear model (“LM”) and using prior methods (“FF_calculated”),10 compared to foetal fraction estmination using next-generation sequencing (NGS).Figure 5B Depiction of foetal fraction estimation with the developed linear model, polynomial model, and generalized additive model (GAM) described herein including in Example 2, which depicts in particular, the calculated foetal fraction with respect to foetal / hyper and maternal / hyper variables. The residual plots indicates15 a non-linear relationship of foetal / hyper (510) compared with maternal / hyper (512).Figure 5C Depiction of foetal fraction estimation with the developed linear model, polynomial model, and generalized additive model (GAM) described herein including in Example 2, which depicts in particular, the foetal fraction estimation with the order-2 polynomial model (“poly2LM”), compared to foetal fraction20 estmination using NGS.Figure 5D Depiction of foetal fraction estimation with the developed linear model, polynomial model, and generalized additive model (GAM) described herein including in Example 2, which depicts in particular, the GAM for foetal fraction estimation, compared to foetal fraction estimation using NGS. MPAE, mean average25 percentage error. MSE, mean squared error.Figure 6 Working mechanism of molecular beacon fluorescent probes and the difference when using a molecular beacon with an RNA base in their loop sequence cleaved with RNaseH2 activated fluorescent probes. (6A) During the first cycle of PCR, the 5' universal tail of the forward primer is incorporated in the30 amplified DNA template; (6B) During subsequent PCR cycles, reverse strands of DNA comprising the reserve complement of the universal tail sequence incorporated in step A are synthesized. (6C) Standard molecular beacons (without RNA base) bind to the reverse complement of the universal sequence located at the 3’ end of the amplified reverse DNA strands. They bind to their target during annealing steps and are released during denaturation steps. In the context of real-time PCR, the fluorescence signal can be monitored in real time35 during the annealing step of each PCR cycle. As the quantity of synthesized reverse DNA strand increases, the fluorescence signal increases. In dPCR, the signal is read at end point. To ensure maximum binding of the molecular beacons, a final denaturation step (i.e. 98°C for 10min) followed by a ramp down step to 4°C at 2.5°C / sec may be added. This enables all the amplified DNA molecules and the molecular beacons to fully denature and to find their hybridization targets during the cool down step. Maximum fluorescent signal is40 generated during that step and remains stable to be read at room temperature. (6D) With Molecular Beacons containing at least 1 RNA base in their loop sequence, the molecular beacons bind to their target during the annealing steps, and once the RNA:DNA hybrid structure is stable, the RNaseH2 cleaves the RNA base ofthe molecular beacon. This generates a stronger fluorescence signal than just the binding of the molecular beacon itself. New molecular beacons with an RNA base can hybridize and get cleaved during each subsequent cycle of PCR. F= Fluorophore, Q= quencher, R= RNA base.5 Figure 7 Examples of RNaseH2 activated fluorescent probes designs. (7 A) The 5’ universal tail of the forward primer comprises the same sequence as the loop sequence of the molecular beacon. One base at the center of the molecular beacon loop is changed from a DNA to an RNA base. During annealing steps, the loop sequence of the molecular beacon binds to the reverse complement of the universal sequence, and the RNA base is cleaved by the RnaseH2. (7B) The 5’ universal tail of the forward primer can comprise the same10 sequence as the loop sequence and one of the stem sequences of the molecular beacon. One base at the center of the molecular beacon loop is changed from a DNA to an RNA base. During annealing steps, the loop sequence and one stem sequence of the molecular beacon bind to the reverse complement of the universal sequence, and the RNA base is cleaved by the RnaseH2. (7C) The 5’ universal tail of the forward primer can comprise the full length of a linear probe sequence. One base at the center of the linear probe is changed from15 a DNA to an RNA base. During annealing steps, the full length of the linear probe binds to the reverse complement of the universal sequence, and the RNA base is cleaved by the RnaseH2. F= Fluorophore, Q= quencher, R= RNA base.Figure 8 Differences in fluorescence separation using molecular beacon probe and linear probe20 configurations with RNA base tested with and without RNase H2.Figure 9 Results from a 60-plex tested on the Bio-Rad QX600 Droplet Digital PCR System comparing standard molecular beacons and RNaseH2 cleavable molecular beacons.25 Figure 10 A schematic overview of the method of preparing and detecting target oligonucleotides comprising a template switching reaction.Figure 11 An overview of an exemplary multiplexing configuration for preparing and detecting more than one target single stranded oligonucleotide simultaneously.30Figure 12 A schematic overview of the method of preparing and detecting target oligonucleotides comprising a template switching reaction and non-universal oligonucleotide probes.Figure 13 A schematic overview of the method of preparing and detecting target oligonucleotides35 comprising a template switching reaction and T-tailing.Figure 14 A schematic overview of the method of preparing and detecting target oligonucleotides comprising restriction enzyme digestion of parent oligonucleotides and a template switching reaction.40 Figure 15 A schematic overview of the method of preparing and detecting target oligonucleotides comprising an initial T-tailing reaction and a subsequent T-tailing reaction.Figure 16 A schematic overview of the 22q11.2 region and the most common / established 22q11 .2 microdeletion subtypes, wherein the regions where the breaks typically occur are indicated in dark grey and annotated as ‘AA’, ‘A’, ‘B’, ‘C’, ‘D’ and ‘E’. The thick arrows represent the deletion variants and the regions targeted by an exemplary 6-plex ddPCR assay with corresponding fluorophores assigned to each probe5 targeted (as shown by the thin arrows) to each specific assay loci of each target region within the 22q11.2 region.Figure 17A Next-generation sequencing (NGS) coverage plot displaying the data obtained by sequencing the 22q11 .2 region of three 22q1 1 .2 micro-deleted samples compared to a non-22q1 1 .2 micro-deleted sample.10Figure 17B Results obtained from genotyping three 22q11 .2 micro-deleted samples compared to a non- 22q11 .2 micro-deleted sample using an exemplary 6-plex ddPCR 22q11 .2 microdeletion assay.Figure 18 2D amplitude plots depicting results obtained from an exemplary 6-plex 22q11 .2 ddPCR assay15 for discrimination of 22q11.2 microdeletion variants.Figure 19 (A) Plot depicting Z-score of copy ratio results obtained from an exemplary 6-plex 22q11.2 ddPCR assay using a 5 ng sample input comprising contrived samples created by spiking in DNA from a ‘AA’, ‘A’, and ‘B’ 22q11.2 microdeletion subtype sample into a DNA sample obtained from a non-22q.11.220 microdeleted sample; (B) Plot depicting Z-score of copy ratio results obtained from an exemplary 6-plex 22q11.2 ddPCR assay using a 10 ng sample input comprising contrived samples created by spiking in DNA from a ‘AA’, ‘A’, and ‘B’ 22q11.2 microdeletion subtype sample into a DNA sample obtained from a non- 22q.11 .2 microdeleted sample; (C) Plot depicting Z-score of copy ratio results obtained from an exemplary 6- plex 22q11.2 ddPCR assay using a 5 ng sample input comprising contrived samples created by spiking in25 DNA from a ‘A’ to ‘D’ 22q11 .2 microdeletion subtype sample into a DNA sample obtained from a non-22q.11 .2 microdeleted sample; and (D) Plot depicting Z-score of copy ratio results obtained from an exemplary 6-plex 22q11 .2 ddPCR assay using a 10 ng sample input comprising contrived samples created by spiking in DNA from a ‘A’ to ‘D’ 22q1 1.2 microdeletion subtype sample into a DNA sample obtained from a non-22q.11.2 microdeleted sample.30Detailed Description of the InventionAll references cited herein are incorporated by reference in their entirety. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one35 of ordinary skill in the art to which this invention belongs, such as molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization.Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, and nucleic acid chemistry and hybridization described below are those well-known and40 commonly employed in the art.Unless otherwise indicated, the practice of the present invention employs conventional techniques of molecular biology and genetics, organic chemistry, and nucleic acid chemistry and hybridization, which are within the capabilities of a person of ordinary skill in the art. Standard techniques are used for nucleic acid synthesis.5 The techniques and procedures are generally performed according to conventional methods in the art (see generally, Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., which is incorporated herein by reference).Those skilled in the art will appreciate that the invention described herein is susceptible to variations and10 modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps and features referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only.15As used herein, the term "comprising" means any of the recited elements are necessarily included and other elements may optionally be included as well. "Consisting essentially of’ means any recited elements are necessarily included, elements that would materially affect the basic and novel characteristics of the listed elements are excluded, and other elements may optionally be included. "Consisting of’ means that all elements20 other than those listed are excluded. Embodiments defined by each of these terms are within the scope of this invention. It should also be understood that the term "and / or" as used herein refers to and encompasses any or all possible combinations of one or more associated listed items.The terms “a,” “an," or “the" as used herein may not only include aspects with one member, but may also25 include aspects with more than one member. For instance, the singular forms “a,” “an," and “the" may include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a bead" may include a plurality of such beads and reference to “the sequence” may include reference to one or more sequences known to those skilled in the art, and so forth.30 Terminology:The term ‘oligonucleotide’ as used herein, is a macromolecule comprising at least two or more covalently- linked nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds, such as a nucleic acid. Oligonucleotides that may be applied are as follows. The oligonucleotide may be natural or synthetic. For the purposes of the present invention such oligonucleotides may constitute nucleic acids. Typical35 nucleic acids include DNA and RNA. The oligonucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. An oligonucleotide may be linear and single stranded and may be derived from an oligonucleotide in linear or circular conformation, and in either single- or double-stranded conformation, or comprise one or more double stranded regions and one or more single regions. The terms ‘oligonucleotide’, and ‘polynucleotide’ are used interchangeably. Oligonucleotides are comprised of nucleotides.40The term ‘nucleotide’ as used herein, typically contains a nucleobase, a sugar and at least one phosphate group. The nucleobase is typically heterocyclic. Nucleobases include but are not limited to purines andpyrimidines and more specifically include but are not limited to, adenine, guanine, thymine, uracil and cytosine. The sugar is typically a pentose sugar. Nucleotide sugars include, but are not limited to, ribose and deoxyribose. The nucleotide is typically a ribonucleotide or deoxyribonucleotide. The nucleotide typically contains a monophosphate, diphosphate or triphosphate. Phosphates may be attached on the 5' or 3' side of5 a nucleotide. For the purposes of this invention, the terms ‘nucleotide’ and ‘base’ are used interchangeably.The oligonucleotide may comprise any combination of any nucleotides. The nucleotides can be naturally occurring or artificial. One or more nucleotides in any oligonucleotide of the invention may be modified, comprising one or more chemical modifications of a nucleotide. Modified nucleotides may occur singularly or10 in a plurality with other nucleotide modifications that are the same modification or a different modification, which may be contiguous or non-contiguous with other nucleotide modifications that are the same modification or a different modification.One or more nucleotides in any oligonucleotide of the invention may be non-natural or synthetic nucleotides.15 Non-natural nucleotides may include analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and / or phosphate moieties (e.g. phosphorothioate backbones). The oligonucleotides of the invention may also comprise any synthetic nucleic acid known in the art, including but not limited to peptide nucleic acids (PNA), glycerol nucleic acids (GNA), threose nucleic acids (TNA), locked nucleic acids (LNA) or other synthetic polymers with nucleotide side chains. One or more nucleotides in the oligonucleotides may be20 modified with a label or a tag. The oligonucleotides may comprise one or more spacers. Modifications can also include 3' and 5' modifications including but not limited to capping with a fluorophore (e.g., quantum dot) or another moiety.In many embodiments, oligonucleotides will have fewer than 250 nucleotides, in some embodiments, between25 4-200, e.g., 10-150 nucleotides.A “template” or “target” unless otherwise indicated refers to a polynucleotide sequence that comprises the polynucleotide to be amplified, and may be flanked by one or a pair of primer hybridization sites. Thus, a "target nucleic acid" may comprise the target polynucleotide sequence adjacent to at least one hybridization site for30 a primer. In some cases, a "target nucleic acid" comprises the target polynucleotide sequence flanked by a hybridization site for a “forward” primer and a “reverse” primer.As used herein, "nucleic acid" means DNA, RNA, single-stranded, double-stranded, or more highly aggregated hybridization motifs, and any chemical modifications thereof. Modifications include, but are not limited to, those35 providing chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, points of attachment and functionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Such modifications include, but are not limited to, peptide nucleic acids (PNAs), phosphodiester group modifications (e.g., phosphorothioates, methylphosphonates), 2'-position sugar modifications, 5- position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines,40 substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, methylations, unusual base-pairing combinations such as the isobases, isocytidine and isoguanidine and the like. Nucleic acids can also include non-natural bases, such as, for example, nitroindole. Modifications can also include 3'and 5' modifications including but not limited to capping with a fluorophore (e.g., quantum dot) or another moiety.A ‘gene’, as used herein, is a segment of nucleic acid (typically DNA) that encodes the sequence information5 required for the production of a polypeptide or ribonucleic acid gene product. It includes regions preceding and following the coding region (5’ UTR and 3’UTR) as well as intervening sequences (introns) between individual coding segments (exons). Conveniently, this term also includes the necessary control sequences for gene expression (e.g. enhancers, silencers, promoters, terminators etc.), which may be adjacent to or distant to the relevant coding sequence, as well as the coding and / or transcribed regions encoding the gene product.10The term ‘NIPT’ refers to non-invasive prenatal testing, which includes methods to determine the risk for a foetus being born with a chromosomal abnormality, such as trisomy 21 , by analysing foetal cfDNA present in a sample, typically a blood sample, of a pregnant woman.15 The term ‘copy number variation’ (CNV) refers to the variable number of copies of a specific segment of DNA between different individuals’ genomes or within an individual’s genome across different cell or tissue types. The variant regions are of variable length, typically defined as segments greater than 1 ,000 base pairs in length and less than 5 megabases in length. CNVs include both additional copies of a sequence as well as losses of genetic material, which may have come about through duplications, deletions, or other structural20 changes (e.g. by recombination). Such regions may or may not contain one or more genes. CNVs may be detected by qPCR ordPCR, wherein the copy number of a specific genomic region may manifest in the number of detected molecules or partitions which contain a target oligonucleotide originating from the specific genomic region.25 The term ‘expression’ as used herein relates to the process by which the information encoded in a sequence of nucleotides which may comprise a gene or a pseudogene is transcribed to produce functional gene products. Expression of a given gene may be detectable using techniques such as qPCR or dPCR, wherein the expression of a gene may manifest in the number of detected molecules or partitions which contain a target oligonucleotide originating from a given RNA produced by transcription of a gene or pseudogene.30The term ‘amplification reaction’ for the purposes of this invention refers to any in vitro method for multiplying the copies of a target nucleic acid sequence in a linear or exponential manner. Components of an amplification reaction include, but are not limited to primers, an oligonucleotide template, a polymerase, and nucleotides. Amplification reaction methods include but are not limited to two-primer methods such as polymerase chain35 reaction (PCR);ligase methods such as DNA ligase chain reaction (see U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et at., eds, 1990)) (LCR); QBeta, RNA replicase and RNA transcription-based amplification reactions (e.g., amplification that involves T7, T3, or 5P6 primed RNA polymerization), such as the transcription amplification system (TAS), nucleic acid sequence based amplification (NASBA), and self-sustained sequence replication (3 SR); isothermal amplification40 reactions (e.g., single-primer isothermal amplification (SPIA)); as well as others known to those of skill in the art.The term "polymerase chain reaction" or "PCR" as used herein refers to a method whereby a specific segment or subsequence of a target double-stranded DNA, is amplified in a geometric progression. PCR is well known to those of skill in the art; see, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202; and PCR Protocols: A Guide to Methods and Applications, Innis et al., eds, 1990. Exemplary PCR reaction conditions typically comprise either5 two or three step cycles. Two step cycles have a denaturation step followed by a hybridization / elongation step. Three step cycles comprise a denaturation step followed by a hybridization step followed by a separate elongation step.In embodiments, the amplification reaction may comprise a digital PCR (dPCR) reaction, for example, a droplet10 digital PCR (ddPCR) reaction. Methods for performing PCR in droplets are described, for example, in US 2014 / 0162266, US 2014 / 0302503, and US 2015 / 0031034, the contents of each of which is incorporated by reference. In embodiments, the QX200, QX600, or OX One Droplet Digital PCR (ddPCR) System (Bio-Rad) may be used. In embodiments, the amplification reaction may comprise a qPCR reaction.15 "Amplifying" refers to a step of submitting a solution to conditions sufficient to allow for the amplification of a polynucleotide if all the components of the reaction are intact. Components of an amplification reaction include, e.g., primers, a polynucleotide template, polymerase, nucleotides, and the like. The term "amplifying" typically refers to an "exponential" increase in target nucleic acid. However, "amplifying" as used herein can also refer to linear increases in the numbers of a select target sequence of nucleic acid, such as is obtained with cycle20 sequencing or linear amplification. In some embodiments, “amplifying” refers to PCR amplification using a first and a second amplification primer.Reaction characteristics of an amplification reaction, such as amplification rate, or reaction outputs, such as a detectable number of molecules, may be detected and measured. These amplification methods may comprise25 a detection reagent or a detectable label which can be detected using any of a variety of detector devices. Exemplary detection methods include optical detection (e.g., fluorescence, or chemiluminescence) as well as others known to those of skill in the art. As a non-limiting example, a fluorescent label can be detected using a detector device equipped with a module to generate excitation light that can be absorbed by a fluorophore, as well as a module to detect light emitted by the fluorophore. In embodiments, the amplification reaction may30 be qPCR, or dPCR.A ‘primer’ refers to an oligonucleotide sequence that hybridizes to a sequence on a target nucleic acid and serves as a point of initiation of nucleic acid synthesis. Primers can be of a variety of lengths. In embodiments, the primers are typically less than 60 nucleotides in length, for example between about 12 and 35 nucleotides35 in length. In embodiments, the primer may typically be less than 100 nucleotides in length, for example, 18 to 55 nucleotides in length. The length and sequences of primers for use in PCR can be designed based on principles known to those of skill in the art, see, e.g., Innis et al., eds, 1990. Primers can be DNA, RNA, or a chimera of DNA and RNA portions. In some cases, primers can include one or more modified or non-natural nucleotide bases. In some cases, primers are labelled. In some instances, a primer may also contain a nucleic40 acid sequence that is not involved in hybridization to the target for amplification, for example, a sequence that hybridizes to another oligonucleotide that is labelled, or a sequence that hybridizes to a capture oligonucleotide, or a tag sequence such as a barcode.An oligonucleotide, or portion thereof, ‘anneals’ to another oligonucleotide under conditions such that nonspecific annealing is minimal at a defined temperature in a buffer suitable for annealing. For the purposes of this invention, the terms ‘anneals’ and ‘hybridizes’ may be used interchangeably. In embodiments, a primer,5 or portion thereof, hybridizes to a sequence shared among a group of target oligonucleotides. In embodiments, the defined temperature at which specific hybridization occurs is room temperature. In embodiments, the defined temperature at which specific hybridization occurs is higher than room temperature. In embodiments, the defined temperature at which specific hybridization occurs is at least about 37°C, about 40°C, about 42°C, about 45°C, about 50°C, about 55°C, about 60°C, about 65°C, about 70°C, about 75°C, or about 80°C, e.g.,10 about 50°C to about 70°C, e.g., or about 55 °C to about 65°C. The defined temperature at which specific hybridization occurs may be about 5°C below the calculated melting temperature of the primers.The term ‘fully complementary sequences’ refers to two hybridising sequences which share 100% sequence complementarity. The term ‘partially complementary sequences’ refers to two hybridising sequences which15 share less than 100% sequence complementarity, comprising one or more mismatches between two annealing nucleotide sequences.In embodiments, a primer, or portion thereof, can hybridize to a primer binding site if there are at least 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous complementary20 nucleotides, e.g., at least about 15. Alternatively, a primer, or portion thereof, can hybridize to a primer binding site if there are fewer than 1 , 2, 3, 4, 5, 6 complementarity mismatches over at least about 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 contiguous complementary nucleotides.A ‘polymerase’ refers to an enzyme that performs template-directed synthesis of oligonucleotides, e.g., DNA.25 The term encompasses both the full-length polypeptide and a domain that has polymerase activity. DNA polymerases are well-known to those skilled in the art. DNA polymerases for use in the compositions and methods disclosed herein can be any polymerase capable of replicating a DNA molecule. The DNA polymerase may be a thermostable polymerase. Thermostable DNA polymerases are known in the art and are commercially available.30Thermostable polymerases are isolated from a wide variety of thermophilic bacteria, such as "Thermus aquaticus (Taq), Pyrococcus furiosus (Pfu), Pyrococcus woesei (Pwo), Bacillus sterothermophilus (Bst), Sulfolobus acidocaldarius (Sac) SulfoIobus solfataricus (Sso), Pyrodictium occultum (Poc), Pyrodictium abyssi (Pab), and Methanobacterium thermoautotroph icum (Mth), as well as other species.35The DNA polymerase may be Tag, Tbr, Tfl, Tru, Tth, Tij, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENTTm, DEEPVENTTm, or an active mutant, variant, or derivative thereof, as known in the art. In aspects and embodiments, the DNA polymerase may be Taq DNA polymerase. In other aspects and embodiments, the DNA polymerase may be a high-fidelity DNA polymerase (e.g., IProofrm High-40 Fidelity DNA Polymerase, Phusion® High-Fidelity DNA polymerase, Q5 High-Fidelity DNA polymerase, Platinum® Taq High Fidelity DNA polymerase, Accura® High-Fidelity Polymerase).In some embodiments, the DNA polymerase may be a fast-start or hot-start polymerase (e.g., FastStart™ Taq DNA polymerase, FastStart™ High Fidelity DNA polymerase, or iTaq™ DNA polymerase).Polymerases also include a family of polymerases known as ‘reverse transcriptases’, which are typically used5 to synthesise the complementary strand of a template RNA oligonucleotide, but can also synthesise the complementary strand of a DNA or cDNA oligonucleotide (see Gerard G. F., and D‘ Alessio J. M., Chapter 6 (73-93), Methods in Molecular Biology, Vol.16: Enzymes of Molecular Biology Edited by: M. M. Burell 1993 Humana Press Inc. Totowa, NJ). Reverse transcriptases are well-known to those skilled in the art. In embodiments, suitable reverse transcriptases for use in the methods, systems and compositions disclosed10 herein can be any polymerase capable of synthesising a complementary strand. In embodiments, the reverse transcriptase exhibits terminal nucleotide transferase activity, which comprises the non-templated addition of one or more terminal nucleotides to the 3’ end of a reverse transcription synthesised oligonucleotide sequence complementary to a template sequence.15 The term ‘extending the [...] along the sequence of’ refers to the synthesis of a sequence complementary to a target template sequence, wherein the complementary sequence is synthesised along the sequence of the target template sequence. In embodiments, extending the complementary strand of the at least one first double stranded oligonucleotide along the second oligonucleotide comprises synthesis of a sequence complementary to the second oligonucleotide, thereby generating at least one second double stranded oligonucleotide longer20 than the first double-stranded oligonucleotide. In embodiments, extending the second oligonucleotide along the complementary strand of the first double stranded oligonucleotide comprises synthesis of a sequence complementary to the complementary strand of the first double stranded oligonucleotide, thereby generating a second double stranded oligonucleotide.25 As used herein, the term ‘oligonucleotide probe’ or ‘probe’ refers to an oligonucleotide conjugated to a moiety that may emit a detectable signal under desired circumstances. For example, the probe moiety may change signal status depending on whether the probe anneals to a target nucleic acid. In embodiments, a probe comprises a nucleic acid that changes signal status depending on whether the probe anneals to a target nucleic acid or not, as described herein. The probe nucleic acid, in some embodiments, comprises a blocked30 3’ end preventing a polymerase from extending the annealed probe.The oligonucleotide probe may further be extended during an amplification reaction such as PCR, as described herein. Suitable probes include fluorescent probes, such as Taqman™ probes. Such probes may require hydrolysis by a 5' to 3' exonuclease activity of a DNA polymerase to separate a fluorescent moiety of the probe35 from a quenching moiety in the structure of the probe, in orderto allow generation of a fluorescent signal during amplification. Any suitable probe may be used. For example, suitable fluorescent probes include molecular beacons, which comprise a stem-loop structure increasing the binding specificity of the probe to its target. During an annealing step of an amplification reaction, the loop portion of the molecular beacon probe may anneal to a target sequence, thereby denaturing the stem and separating a fluorescent moiety from a40 quenching moiety, resulting in detectable fluorescence from the fluorescent moiety.Fluorophores or fluorescent agents can include a variety of organic and / or inorganic small molecules or a variety of fluorescent proteins and derivatives thereof. Fluorophores and quenchers are reported in the literature and thus known to those skilled in the art, and many are readily available from commercial suppliers to the biotechnology industry. Literature sources for fluorophores include Cardullo et al., Proc. Natl. Acad. Sci.5 USA 85: 8790-8794 (1988); Dexter, D.L., J. of Chemical Physics 21 : 836- 850 (1953); Hochstrasser et al., Biophysical Chemistry 45: 133-141 (1992); Selvin, P., Methods in Enzymology 246: 300-334 (1995); Steinberg, I. Ann. Rev. Biochem., 40: 83- 114 (1971); Stryer, L. Ann. Rev. Biochem., 47: 819-846 (1978); Wang et al., Tetrahedron Letters 31 : 6493-6496 (1990); Wang et al., Anal. Chem. 67: 1197-1203 (1995), which are hereby incorporated by reference in their entirety. Non-limiting examples of fluorophores include cyanines,10 fluoresceins (e.g., 5' carboxyfluorescein (FAM), Oregon Green, and Alexa 488), HEX, rhodamines (e.g., N,N,N',N-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethyl rhodamine, and tetramethyl rhodamine isothiocyanate (TRITC)), eosin, coumarins, pyrenes, tetra pyrroles, arylmethines, oxazines, polymer dots, and quantum dots. In embodiments, the probe may comprise a blocked 3' end preventing a polymerase from extending the annealed probe.15The term “cell-free DNA sample’’ or “cfDNA sample’’ refers to a nucleic acid sample comprising extracellular DNA, which nucleic acid sample is obtained from any cell-free biological fluid, for example, whole blood processed to remove cells, urine, saliva, or other biological fluid. In typical embodiments, cfDNA for analysis is obtained from whole blood processed to remove cells, e.g., a plasma or serum sample. As used herein, the20 term “cfDNA” thus refers to DNA recoverable from the non-cellular fraction of a bodily fluid, such as blood.The methylation status refers to the presence of methyl groups at a particular DNA sequence. In some embodiments, methylation of DNA refers to the presence or absence of methylcytosine at one or more CpG dinucleotides in a DNA sequence. The term “methylation state" or "methylation status" with respect at CpG25 dinucleotide methylation refers to the presence or absence of 5-methylcytosine ("5-mC" or "5-mCyt") at one or a plurality of CpG dinucleotides within a DNA sequence. Methylation states at one or more particular methylation sites within a DNA sequence include "unmethylated," "fully-methylated," and "hemi-methylated." For purposes of the present application, the term “hypermethylation’’ refers to a region where the average frequency of methylation for a particular subset of samples, e.g., foetal DNA or maternal DNA, is greater than30 80% as determined by methylation-based sequencing. “Hypomethylation” refers to a region where the average frequency of methylation for a particular subset of samples, e.g., foetal DNA or maternal DNA, is less than 20% as determined by methylation-based sequencing.A methylation-sensitive restriction enzyme (MSRE) refers to an enzyme that cleaves DNA at specific35 unmethylated cytosine residues, but does not cleave at the recognition sequence when the cytosine residues are methylated.As used herein, a “methylation-sensitive” genomic region refers to a genomic DNA that can be methylated, e.g., at CpG sequences, such that the site is not cleavable by a methylation sensitive restriction enzyme in a40 methylated state and cleavable when methylation is not present. “Cleavable” as used herein means that at least 50% of the DNA is digested with the methylation-sensitive restriction enzyme when the recognition sequence is unmethylated compared to when it is methylated. Accordingly, detection of an amplificationproduct obtained from amplification of cfDNA that comprises a methylation site following digestion with MSRE means that the cfDNA is methylated at that site.The term ‘partitioning’ or ‘partitioned’ refers to separating a sample into a plurality of portions, or ‘partitions’.5 Partitions are typically physical, such that the contents of one partition does not, or does not substantially, mix with the contents of an adjacent partition.Partitions can be solid or fluid. In some embodiments, a partition is a solid partition, e.g., a microchannel or microwell. In some embodiments, a partition is a fluid partition, e.g., a droplet. In some embodiments, a fluid10 partition (e.g., a droplet) is a mixture of immiscible fluids (e.g., water and oil). In some embodiments, a fluid partition (e.g., a droplet) is an aqueous droplet that is surrounded by an immiscible carrier fluid (e.g., oil). Exemplary array of wells and well descriptions can be found for example in U.S. Patent No. 9,103,754 and 10,391 ,493. The array of wells (set of nanowells, microwells, wells) can function to capture the solid supports, optionally in addressable, known locations. As such, the array of wells can be configured to facilitate bead15 capture in at least one of a single-solid support format or optionally in small groups of solid supports. Exemplary microwell arrays and methods of delivery of beads to the microwells and analysis thereof is described in, e.g., PCT / US2021 / 034152.Partitions can be fluid, such as a droplet. In embodiments, a fluid partition such as a droplet may comprise a20 mixture of immiscible fluids such as water and an oil. In embodiments, a droplet may comprise an emulsion composition. In embodiments, a droplet may be an aqueous droplet that is surrounded by an immiscible carrier fluid, such as oil. In embodiments, a droplet may be an oil droplet that is surrounded by an immiscible carrier fluid, such as an aqueous solution. In embodiments, the droplets may be relatively stable and have minimal coalescence between two or more droplets. In embodiments, less than 0.0001%, 0.0005%, 0.001 %, 0.005%,25 0.01%, 0.05%, 0.1%, 0.5%, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10% of droplets generated from a sample coalesce with other droplets. The emulsions can also have limited flocculation, a process by which the dispersed phase, comes out of suspension in aggregates. Methods of emulsion formation are described, for example, in published patent applications WO 2011 / 109546 and WO 2012 / 061444, each of which is incorporated in its entirety by reference herein.30Methods and compositions for delivering reagents to one or more partitions include microfluidic methods as known in the art; droplet or microcapsule merging, coalescing, fusing, bursting, or degrading (e.g., as described in U.S. 2015 / 0027,892; US 2014 / 0227,684; WO 2012 / 149,042; and WO 2014 / 028,537); droplet injection methods (e.g., as described in WO 2010 / 151 ,776); and combinations thereof, each of which is35 incorporated in its entirety by reference herein. In embodiments, the components of the reaction mixture may be combined by the methods described above, particularly if the method is performed in a stepwise manner as described previously.In embodiments wherein the partition is a droplet, the droplet may be formed by flowing an oil phase through40 an aqueous sample comprising the sample and reaction components. The oil phase may or may not comprise a fluorinated base oil which may additionally be stabilized by combination with a fluorinated surfactant such as a perfluorinated polyether. In embodiments, the base oil comprises one or more of a HFE 7500, FC-40, FC-43, FC-70, or another common fluorinated oil. In embodiments, the oil phase comprises an anionic fluorosurfactant. In embodiments, the anionic fluorosurfactant is ammonium Krytox (Krytox-AS), the ammonium salt of Krytox FSH, or a morpholino derivative of Krytox FSH. Krytox-AS may be present at a concentration of about 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, or 4.0%5 (w / w). In embodiments, the concentration of Krytox-AS is about 1.8%. In embodiments, the concentration of Krytox-AS is about 1.62%. Morpholino derivative of Krytox FSH may be present at a concentration of about 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, or 4.0% (w / w). In embodiments, the concentration of morpholino derivative of Krytox FSH is about 1 .8%. In embodiments, the concentration of morpholino derivative of Krytox FSH is about 1.62%. In embodiments, the oil phase further comprises an10 additive for tuning the oil properties, such as vapor pressure, viscosity, or surface tension. Non-limiting examples include perfluorooctanol and 1 H,1 H,2H,2H-perfluorodecanol. In embodiments, 1 H,1 H,2H,2H- Perfluorodecanol is added to a concentration of about 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1 .0%, 1 .25%, 1 .50%, 1 .75%, 2.0%, 2.25%, 2.5%, 2.75%, or 3.0% (w / w). In embodiments, 1 H,1 H,2H,2H-perfluorodecanol is added to a concentration of about 0.18% (w / w). In15 embodiments, the emulsion is formulated to produce highly monodisperse droplets having a liquid-like interfacial film that can be converted by heating into microcapsules having a solid-like interfacial film; such microcapsules may behave as bioreactors able to retain their contents through an incubation period (see, e.g., U.S. Patent No. 10,378,048, which is incorporated herein in its entirety). The conversion to microcapsule form may occur upon heating. For example, such conversion may occur at a temperature of greater than about20 40°C, 50°C, 60°C, 70°C, 80°C, 90°C, or 95°C. During the heating process, a fluid or mineral oil overlay may be used to prevent evaporation. Excess continuous phase oil may or may not be removed prior to heating. The biocompatible capsules may be resistant to coalescence and / or flocculation across a wide range of thermal and mechanical processing. Following conversion, the microcapsules may be stored at about -70°C, -20°C, 0°C, 3°C, 4°C, 5°C, 6°C, 7°C, 8°C, 9°C, 10°C, 15°C, 20°C, 25°C, 30°C, 35°C, or 40°C.25The microcapsule / microdroplet according to any of the aspects and embodiments of this disclosure partitions may resist coalescence, particularly at high temperatures. Accordingly, the capsules can be incubated at a very high density (e.g., number of partitions per unit volume). In embodiments, greater than 100,000, 500,000, 1 ,000,000, 1 ,500,000, 2,000,000, 2,500,000, 5,000,000, or 10,000,000 partitions may be incubated per ml_. In30 some embodiments, the sample-probe incubations occur in a single well, e.g., a well of a microtiter plate, without inter-mixing between partitions. The microcapsules may also contain other components necessary for the incubation. In embodiments, a sample is partitioned into at least 500 partitions, at least 1 ,000 partitions, at least 2,000 partitions, at least 3,000 partitions, at least 4,000 partitions, at least 5,000 partitions, at least 6,000 partitions, at least 7,000 partitions, at least 8,000 partitions, at least 10,000 partitions, at least 15,000 partitions,35 at least 20,000 partitions, at least 30,000 partitions, at least 40,000 partitions, at least 50,000 partitions, at least 60,000 partitions, at least 70,000 partitions, at least 80,000 partitions, at least 90,000 partitions, at least 100,000 partitions, at least 200,000 partitions, at least 300,000 partitions, at least 400,000 partitions, at least 500,000 partitions, at least 600,000 partitions, at least 700,000 partitions, at least 800,000 partitions, at least 900,000 partitions, at least 1 ,000,000 partitions, at least 2,000,000 partitions, at least 3,000,000 partitions, at40 least 4,000,000 partitions, at least 5,000,000 partitions, at least 10,000,000 partitions, at least 20,000,000 partitions, at least 30,000,000 partitions, at least 40,000,000 partitions, at least 50,000,000 partitions, at least60,000,000 partitions, at least 70,000,000 partitions, at least 80,000,000 partitions, at least 90,000,000 partitions, at least 100,000,000 partitions, at least 150,000,000 partitions, or at least 200,000,000 partitions.In embodiments, the droplets that are generated are substantially uniform in shape and / or size. For example,5 in embodiments, the droplets are substantially uniform in average diameter. In embodiments, the droplets that are generated have an average diameter of about 0.001 microns, about 0.005 microns, about 0.01 microns, about 0.05 microns, about 0.1 microns, about 0.5 microns, about 1 microns, about 5 microns, about 10 microns, about 20 microns, about 30 microns, about 40 microns, about 50 microns, about 60 microns, about 70 microns, about 80 microns, about 90 microns, about 100 microns, about 150 microns, about 200 microns,10 about 300 microns, about 400 microns, about 500 microns, about 600 microns, about 700 microns, about 800 microns, about 900 microns, or about 1000 microns. In embodiments, the droplets that are generated have an average diameter of less than about 1000 microns, less than about 900 microns, less than about 800 microns, less than about 700 microns, less than about 600 microns, less than about 500 microns, less than about 400 microns, less than about 300 microns, less than about 200 microns, less than about 100 microns, less than15 about 50 microns, or less than about 25 microns. In embodiments, the droplets that are generated are non- uniform in shape and / or size.In embodiments, the droplets that are generated are substantially uniform in volume. For example, in embodiments, the droplets that are generated have an average volume of about 0.001 nL, about 0.005 nL,20 about 0.01 nL, about 0.02 nL, about 0.03 nL, about 0.04 nL, about 0.05 nL, about 0.06 nL, about 0.07 nL, about 0.08 nL, about 0.09 nL, about 0.1 nL, about 0.2 nL, about 0.3 nL, about 0.4 nL, about 0.5 nL, about 0.6 nL, about 0.7 nL, about 0.8 nL, about 0.9 nL, about 1 nL, about 1 .5 nL, about 2 nL, about 2.5 nL, about 3 nL, about 3.5 nL, about 4 nL, about 4.5 nL, about 5 nL, about 5.5 nL, about 6 nL, about 6.5 nL, about 7 nL, about 7.5 nL, about 8 nL, about 8.5 nL, about 9 nL, about 9.5 nL, about 10 nL, about 11 nL, about 12 nL, about 1325 nL, about 14 nL, about 15 nL, about 16 nL, about 17 nL, about 18 nL, about 19 nL, about 20 nL, about 25 nL, about 30 nL, about 35 nL, about 40 nL, about 45 nL, or about 50 nL. In embodiments, the droplets have an average volume of about 50 picoliters to about 2 nanoliters. In embodiments, the droplets have an average volume of about 0.5 nanoliters to about 50 nanoliters. In embodiments, the droplets have an average volume of about 0.5 nanoliters to about 2 nanoliters.30In embodiments wherein the partitions are solid, the partition may be a microchannel or microwell, wherein an array of wells (i.e. one or more sets of nanowells, microwells, wells) can function to capture a solid support such as a bead, optionally in addressable, known locations. As such, the array of wells can be configured to facilitate bead capture in at least one of a single-solid support format or optionally in small groups of solid35 supports. Exemplary arrays of wells and well descriptions can be found for example in U.S. Patent No. 9,103,754 and 10,391 ,493, which are incorporated herein by reference in their entirety. Exemplary microwell arrays and methods of delivery of beads to the microwells and analysis thereof is described in for example PCT / US2021 / 034152 incorporated herein in its entirety. The reaction mixture partitions can be picowells, nanowells, or microwells. The partitions comprising the reaction mixture can be pico-, nano-, or micro- reaction40 chambers, such as pico, nano, or microcapsules. In embodiments, the reaction mixture partitions can be pico- , nano-, or micro- channels.For the purposes of this invention, the term ‘reaction mixture’ refers to an aqueous solution comprising the reagents and oligonucleotides used to perform any of the methods described herein. The term ‘amplification reaction mixture’ refers to reaction mixtures configured to amplify a target nucleic acid.5 The reaction mixture may comprise, but is not limited to, enzymes, aqueous buffers, salts, and nucleoside triphosphates. The reaction mixture may comprise nucleotides. Nucleotides for use in the method described herein can be any nucleotide useful in the polymerization of a nucleic acid. Nucleotides can be naturally occurring, modified, derivative, or artificial. In embodiments, nucleotides will typically be unlabelled. In embodiments, the reaction mixture may comprise one or more buffers or salts which optimise reaction10 efficiency and specificity. A wide variety of buffers and salt solutions and modified buffers are known in the art. For example, in embodiments, the buffer is TRIS, TRICINE, BIS-TRICINE, HEPES, MOPS, TES, TAPS, PIPES, or CAPS. In embodiments, the salt is potassium acetate, potassium sulfate, potassium chloride, ammonium sulfate, ammonium chloride, ammonium acetate, magnesium chloride, magnesium acetate, magnesium sulfate, manganese chloride, manganese acetate, manganese sulfate, sodium chloride, sodium15 acetate, lithium chloride, or lithium acetate. In embodiments, the reaction mixture may comprise a salt (e.g., potassium chloride) at a concentration of about 10 mM to about 100 mM.The reaction mixture may comprise one or more stabilizers to optimize reaction efficiency and specificity. Stabilizers for use in the methods described herein include, but are not limited to, a polyol (glycerol, threitol,20 etc.), a polyether including cyclic polyethers, polyethylene glycol, organic or inorganic salts, such as ammonium sulfate, sodium sulfate, sodium molybdate, sodium tungstate, organic sulfonate, etc., sugars, polyalcohols, amino acids, peptides or carboxylic acids, a quencher and / or scavenger such, as mannitol, glycerol, reduced glutathione, superoxide dismutase, bovine serum albumin (BSA) or gelatine, spermidine, dithiothreitol (or mercaptoethanol) and / or detergents such as TRITON® X-10025 [Octophenol(ethyleneglycolether)], THESIT® [Polyoxyethylene 9 lauryl ether (Polidocanol C12 E9)], TWEEN® (Polyoxyethylenesorbitan monolaurate 20, NP40) and BRIJO-35 (Polyoxyethylene 23 lauryl ether).Once formed, the reaction mixture may be submitted to conditions to allow generation of a suitable target single stranded oligonucleotide, such as a denaturing step. The reaction mixture may be submitted to30 conditions for primer annealing, such as a first oligonucleotide or second oligonucleotide, and extension using one or more primers that anneal to a target oligonucleotide to be detected. The reaction mixture may be submitted to primer extension conditions, which can be, but is not limited to, conditions suitable for PCR, allowing a primer to anneal to the target oligonucleotide or prepared oligonucleotide, if present, and be extended by a polymerase in a template specific manner, which may be repeated for one or more cycles. The35 amplification reaction can be monitored for oligonucleotide probe signals at an end-point or in real time, i.e. , continuously or every cycle.The terms “forward” and “reverse” are arbitrary designations, indicating that forward and reverse primers anneal to opposite strands of a double-stranded DNA molecule and when annealed have 3’ ends directed40 towards each other such that an amplicon is formed under PCR conditions.Method for Estimation of Foetal Fraction in Cell-Free DNA from a Maternal Sample or DNA from a Foetal or Maternal SampleAccurate diagnosis of chromosomal aneuploidies, such as trisomies of chromosomes 13, 18, and 21 , requires5 an accurate estimate of the foetal fraction of cell-free DNA (cfDNA) in maternal blood plasma. Cell-free DNA is present at low levels in maternal whole blood, 0 - 100 ng / ml_, and while the median foetal fraction of cfDNA is around 11 % in the first trimester of pregnancy, it can be lower than 4% in the early stages of pregnancy when noninvasive prenatal testing (NIPT) is recommended (Wang et al, Prenat. Diagn. 33:662-666, 2013). Additionally, foetal cfDNA must be distinguished from maternal cfDNA, despite the high similarity in genetic10 sequence.In one aspect, the disclosure provides a digital PCR (dPCR) method for quantifying the foetal fraction cfDNA in maternal blood plasma, utilizing methylation-sensitive restriction enzyme (MSRE) digestion. In some embodiments, the disclosure provides a method of estimating the fraction of foetal DNA in a cfDNA sample15 obtained from a blood sample from a pregnant human subject.The disclosed methods may be used in conjunction with non-invasive samples as well as invasive samples; e.g., from amniocentesis or CVS.20 In some embodiments, the method comprises a digital amplification reaction method comprising: (a) partitioning (e.g., distributing) into partitions an amplification reaction mixture comprising cfDNA from the cfDNA sample, amplification reagents, and a plurality of amplification sets comprising primer and probe sets, wherein each amplification set comprises primers and probes for multiplex amplification and each amplification set generates amplification products, when target is present, comprising a distinct label distinguishable from25 the label for each of the other amplification sets; and wherein the plurality comprises: (i) an amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA; and (ii) an amplification set that targets sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA and optionally one or more of (iii), (iv), and (v); (iii) an amplification set that targets total cfDNA comprising methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy; (iv) an amplification set that30 targets sites that are hypermethylated in foetal DNA and maternal DNA; (v) an amplification set that targets sites that are hypomethylated in foetal DNA and maternal DNA; (b) incubating the cfDNA with a methylationsensitive restriction enzyme (MSRE) cocktail comprising at least one methylation-sensitive restriction enzyme that cleaves unmethylated (e.g., hypomethylated) DNA; (c) amplifying in the partitions target nucleic acid sequences, if present, to obtain amplification products; (d) detecting in the partitions a signal from each distinct35 label from the amplification products; and (e) quantifying the signal for each distinct label. In some embodiments, the plurality comprises (iii) the amplification set that targets total cfDNA comprising methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy. In some embodiments, each of the amplification sets of (i) and (ii) comprises primers and probes to target at least three sites. In some embodiments, wherein each of the amplification sets of (i)-(v) comprises primers and probes to target at least40 three sites or between 6-10 sites. In some embodiments, the method further comprises employing an amplification set that targets methylation-insensitve regions of the Y chromosome. In additional embodiments, the method can further comprise employing an amplification set that targets sites that are hypomethylated inboth foetal and maternal cfDNA; and / or an amplification set that targets sites that are hypermethylated in both foetal and maternal cfDNA. In some embodiments, the amplification reaction mixture further comprises a control target completely methylated synthetic DNA sequence and / or a completely unmethylated version of the same synthetic DNA sequence. In some embodiments, the digital amplification reaction method is a digital5 PCR method, such as a droplet digital PCR method. In some embodiments, the amplification reaction mixture in the partitioning comprises the MSRE cocktail, and after the incubating occurs after the partitioning and before the amplifying. In some embodiments, step (b) is performed before the partitioning and cfDNA subjected to digestion is added to the amplification reaction mixture. In some embodiments, the MSRE cocktail comprises at least two, at least three, or al least four methylation-sensitive restriction enzymes; and / or wherein the MSRE10 cocktail comprises a restriction enzyme selected from Hhal, Hpall, Acil, HpyCH4IV, and BsaHI. In some embodiments, the MSRE cocktail comprises at least two, orthree of the restriction enzymes Hhal, Hpall, Acil, HpyCH4IV, and BsaHI. In some embodiments, the MSRE cocktail comprises at least Hhal and HpyCH4IV. In some embodiments, the cfDNA sample is obtained from plasma or serum. In some embodiments, each label is a fluorescent label. In some embodiments, the probe is a molecular beacon probe comprising a fluorescent15 label. In some embodiments, each probe is an oligonucleotide that hybridizes to complementary oligonucleotide that comprises label that provides a detectable signal. In some embodiments, the incubating of the cfDNA with the MSRE cocktail occurs in the partitions. In some embodiments, the incubating of the cfDNA with the MSRE cocktail occurs in a bulk solution before the distributing (a). In some embodiments, the method further comprises determining the normalized copy concentration for each of the targets, for example20 based on the number of targets in an amplification set (Ni).In embodiments, the method further comprises determining a corrected concentration of foetal DNA (foetal_FF) in the sample and / or a corrected concentration of maternal DNA (maternal_FF) in the sample. In embodiments, determining the corrected concentration of foetal DNA comprises a calculation (slept a):25 foetal_FF = [foetal] / [hyper]— [hypo] / [hyper]— 0.08 wherein ‘foetal_FF’ represents a corrected concentration of foetal DNA; [hyper] is hypermethylated reference copy concentration based on signal from probes configured to anneal to one or more loci hypermethylated in30 both foetal DNA and maternal DNA; [hypo] is hypomethylated reference copy concentration based on signal from probes configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal DNA; and [foetal] is foetal DNA copy concentration based on signal configured to anneal to one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA.35 In embodiments, determining the corrected concentration of maternal DNA comprises a calculation (stept b): maternal_FF = 1-[maternal] / [hyper] wherein ‘maternal_FF’ represents a corrected concentration of maternal DNA; wherein [maternal] is maternal DNA copy concentration based on signal from probes configured to anneal to one or more loci hypomethylated40 in foetal DNA and hypermethylated in maternal DNA; and [hyper] is as defined above.In embodiments, the method further comprises determining the average methylation foetal fraction value and performing custom background correction based on the calculation (step 2): meth_FF = average(foetal_FF,maternal_FF)5 wherein ‘meth_FF’ represents the average methylation foetal fraction value; and ‘foetal_FF’ and ‘maternal_FF’ are as defined above.In embodiments, the method further comprises determining the final foetal fraction (FF) value in the case of a10 male foetus or a female foetus i.e. with or without chrY present in the foetal fraction.First, the proportion of chrY in the foetal fraction is determined based on the calculation (step 3): chrY_FF = 2 [chrY] / [control]15 wherein ‘chrY_FF’ is the proportion of chromosome Y in the foetal fraction DNA sample; [chrY] is the concentration of chrY in the total DNA sample; and [control] is the concentration of DNA in the sample.In the next step, the final foetal fraction in the case of a male foetus or a female foetus is calculated based on20 a threshold value of 0.02 for the value ‘chrY_FF’, based on the calculations: for a male foetus, i.e. where chrY_FF is above a threshold of 0.02 (step 4a):FF calculated = (2-meth_FF+chrY_FF) / 325 or for a female foetus, i.e. where chrY_FF is 0.02 or below (step 4b):FF_calculated = meth_FF if no chrY signal is present above threshold wherein ‘FF_calculated’ is the final, calculated foetal fraction value; and ‘meth_FF’ and ‘chrY_FF’ are as30 defined above.In alternative embodiments, the method may comprise determining a corrected concentration of foetal cfDNA (Fetcorr) in the cfDNA sample and / or a corrected concentration of maternal cfDNA (Matcorr) in the cfDNA sample using an alternative methodology, wherein determining the corrected concentration of foetal cfDNA comprises35 a calculation: [Hypo]) (Eq.1),wherein [Total] is total cfDNA copy concentration based on signal in partitions from the amplification set that40 targets total cfDNA comprising methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy, [Hyper] is hypermethylated reference copy concentration based on signal in partitions from theamplification set that targets sites that are hypermethylated in foetal DNA and maternal DNA, [Hypo] is hypomethylated reference copy concentration based on signal in partitions from the amplification set that targets sites that are hypomethylated in foetal DNA and maternal DNA and [Fet] is foetal cfDNA copy concentration based on signal in partitions from the amplification set that targets sites that are hypermethylated5 in foetal DNA and hypomethylated in maternal DNA and determining the corrected concentration of maternal cfDNA comprises a calculation: [Hypo]) (Eq.2),10 wherein [Mat] is maternal cfDNA copy concentration based on signal in partitions from the amplification set that targets sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA In some embodiments, the method further comprises determining the foetal fraction (FF) in the cfDNA sample, wherein determining the foetal fraction comprises at least one of the following calculations (a)-(d):F VFetcorF(a) F = [Total] ’15FF [FetCorr](b) = [FetCorr]+ [MatCorr]'(c) FF = 1 - [MatCorrl[Totai] orIn some embodiments, the method further comprises computing an estimated foetal fraction at least partially based on the foetal fraction in the cfDNA sample and a model. In some embodiments, the model is a generalized additive model (GAM), a linear model, or a second-order polynomial model at least partially based25 on a set of clinical foetal fraction data and a corresponding set of foetal fraction measurements using nextgeneration sequencing (NGS).In some embodiments, the method further comprises determining the foetal fraction of a male foetus in the cfDNA sample, wherein determining the male foetus foetal fraction comprises:FF = [YChr][TotaZ] (Eq. 10) orFF = _ [YChr] _[Fetcarr]+ [MatCarr] ’35 wherein [YChr] is the concentration of Y-chromosome specific sequences based on signal in partitions from the amplification set that targets methylation-insensitive regions of the Y chromosome.In some embodiments of the methods or kits described herein, the sites that are hypermethylated in foetalDNA and hypomethylated in maternal DNA are sites within one or more or all of:Chromosome Start End chr1 10965026 109651185 chr1 36457885 36458000 chr11 77152247 77152348 chr14 100081619 100081733 chr14 105390470 105390583 chr15 81781663 8178175310 chr17 75997501 75997633 chr2 196211575 19621 1683.In some embodiments of the methods or kits described herein, the sites that are hypermethylated in maternalDNA and hypomethylated in foetal DNA are sites within one or more or all of:15 Chromosome Start End chr1 110390715 110390806 chr19 8525569 8525674 chr2 236576106 236576215 chr2 239532002 23953212620 chr2 72115414 72115526 chr4 90104102 90104228 chr5 142280348 142280462.In some embodiments of the methods or kits described herein, the sites that are hypermethylated in foetal25 DNA and maternal DNA are sites within one or more or all of:Chromosome Start End chr19 12930395 12930501 chr2 98903445 98903560 chr20 50670188 5067028730 chr4 186620052 186620153 chr4 41181277 41181358 chr5 133097153 133097246 chr6 3363036 3363147.35 In some embodiments of the methods or kits described herein, the sites that are hypomethylated in foetal DNA and maternal DNA are sites within one or more or all of:Chromosome Start End chr10 73744741 73744849 chr12 104050025 10405012040 chr17 48108167 48108297 chr17 68292301 68292434 chr2 27369852 27369937chr2 28870489 28870604.In some embodiments of the methods or kits described herein, the methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy are sites within one or more or all of:5 Chromosome Start End chr3 104042356 104042470 chr3 104263905 104264029 chr3 133296976 133297077 chr3 169019731 16901983610 chr3 17807278 17807410 chr3 22594415 22594519 chr3 25620061 25620168 chr3 35697692 35697774 chr3 82529219 82529320.15In some embodiments of the methods or kits described herein, the methylation-insensitive regions of the Y chromosome are within one or more or all of:Chromosome Start End chrY 13817626 1381772620 chrY 13861919 13862016 chrY 14225706 14225797 chrY 14405980 14406112 chrY 15558950 15559068 chrY 16701419 1670154125 chrY 17109321 17109424 chrY 19228514 19228627 chrY 19731092 19731204 chrY 21046467 21046568.30 In a further aspect, the disclosure provides a digital amplification kit for estimating the fraction of foetal DNA in a cfDNA sample obtained from a plasma or serum sample from a pregnant human subject, the kit comprising:(a) an amplification reaction mixture comprising amplification reagents, and a plurality of amplification sets comprising primer and probe sets, wherein each amplification set comprises a distinct label distinguishable from the label for each of the other sets, and each set comprises primers and probes for35 multiplex amplification, and wherein the plurality of comprises:(i) an amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA; and(ii) an amplification set that targets sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA; and optionally one or more of (iii), (iv), and (v);40 (iii) an amplification set that targets total cfDNA comprising methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy;(iv) an amplification set that targets sites that are hypermethylated in foetal DNA and maternalDNA;(v) an amplification set that targets sites that are hypomethylated in foetal DNA and maternal DNA. In some embodiments, each of the amplification sets of (i) and (ii) comprises primers and probes to5 target at least three sites.In some embodiments, the kit further comprises an amplification set that targets methylation-insensitve regions of the Y chromosome. In some embodiments, the kit further comprises a completely methylated synthetic sequence of DNA and / or a completely unmethylated version of the same syntehtic sequence. In some10 embodiments, each label is a fluorescent label. In some embodiments, the probe is a molecular beacon probe comprising a fluorescent label. In some embodiments, each probe is an oligonucleotide that hybridizes to complementary oligonucleotide that comprises label that provides a detectable signal. In some embodiments, the kit further comprises a methylation-sensitive restriction enzyme (MSRE) cocktail comprises at least one MSRE that cleaves hypomethylated DNA. In some embodiments, the MSRE cocktail comprises at least two,15 at least three, or at least four methylation-sensitive restriction enzymes; and / or wherein the MSRE cocktail comprises a restriction enzyme selected from Hhal, Hpall, Acil, HpyCH4IV, and BsaHI. In some embodiments, the kit comprises a methylation-sensitive restriction enzyme (MSRE) cocktail comprising at least two, three, or more of the restriction enzymes Hhal, Hpall, Acil, HpyCH4IV, and BsaHI. In some embodiments, the MSRE cocktail comprises at least Hhal and HpyCH4IV. In some embodiments, the kit further comprises a methylation¬20 sensitive restriction enzyme (MSRE) cocktail comprising at least two, three, or more of the restriction enzymes Hhal, Hpall, Acil, HpyCH4IV, and BsaHI.In aspects and embodiments, a dataset of calculated foetal fractions based on the disclosed methods and corresponding measured foetal fractions using next-generation sequencing (NGS) of different NIPT clinical25 samples from human subjects is created. Several models are developed that could take into account not only the calculated foetal fractions and corresponding NGS measurements but also parameters such as gestation week and the Y chromosome calculations.The present disclosure provides a method of estimating the fraction of foetal DNA in a cfDNA sample obtained30 from a maternal cell-free biological sample. As described herein, the method comprising a digital amplification reaction comprising evaluating cfDNA obtained from a pregnant subject, typically a human subject, to determine the methylation status, using methylation-sensitive restriction enzymes, of loci that are differentially methylated in foetal vs maternal cfDNA. In particular, the method comprises: analyzing the methylation status of one or more sites in foetal and maternal cfDNA that are hypermethylated in foetal DNA and hypomethylated35 in maternal DNA; and detecting the methylation status of one or more sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA. In some embodiments, the method further comprises amplifying sites that target total cfDNA comprising methylation insensitive genomic regions from chromosome unlikely to exhibit aneuploidy, which provide the ability to quantify the total concentration of DNA, i.e. , both foetal and maternal, in the sample. In some embodiments, the method further comprises detection of40 methylation-insensitive regions of the Y chromosome, if desired, e.g., to determine the foetal sex. In some embodiments, the method further comprises evaluating sites that are hypomethylated in both foetal and maternal cfDNA and / or evaluating sites that are hypermethylated in both foetal and maternal cfDNA for useas internal controls for MSRE digestion. Assessing the level of these various chromosome regions, which have differing methylation profiles, thus provides the ability to quantify the fraction of cfDNA from the maternal sample that arises from the foetus. The estimation of the foetal fraction is important to quality check and predict foetal aneuploidy in a non-invasive prenatal test.5In some embodiments, a foetal fraction calculated / determined according to the methods of the present disclosure may be used in methods for assessing foetal aneuploidy (e.g., trisomies, such as of chromosomes 13, 18 or 21), chromosomal deletions (e.g., microdeletions such as in chromosome 22), or other genomic alterations (e.g., gene mutations associated with diseases such as alpha- or beta-thalassemia, cystic fibrosis,10 sickle cell anemia, or hemophilia A). For example, the foetal fraction calculated / determined according to the methods of the present disclosure may be used for quality control in such methods.ComponentsIn the present disclosure, cell-free DNA obtained from a pregnant subject is evaluated to determine the quantity15 of foetal cfDNA in maternal blood, i.e., the fraction of cfDNA in maternal blood that is from the foetus. A cfDNA sample from the pregnant subject is digested with one or more methylation-sensitive restriction enzymes followed by amplification of a plurality of target loci that have differing methylation profiles in foetal vs maternal DNA. The fraction of foetal cfDNA can be calculated based on the levels of differentially methylated DNA.20 CfDNACell-free DNA for use in the invention is obtained from a biological fluid sample, typically a blood sample, that is free of cells. Thus, in typical embodiments, the sample is a plasma or serum sample. Isolation of cfDNA can be achieved using any number of different methodologies, e.g., by employing columns or magnetic beads, or other isolation procedures. Kits for extracting cfDNA from samples are commercially available, e.g., from25 Qiagen, Beckman (e.g., Apostle™ kit), and ThermoFisher (e.g., MagMax™ kit), among others. The disclosed methods may be used in conjunction with non-invasive samples as well as invasive samples; e.g., from amniocentesis or CVS.Methylation-sensitive restriction enzymes30 The cfDNA is subject to digesting with one or more methylation sensitive restriction enzymes (MSRE). Such enzymes will digest unmethylated regions of DNA, but not methylated regions. Accordingly, amplification products from hypermethylated regions of DNA will be greater in abundance than those from hypomethylated regions of DNA.35 In some embodiments, one restriction enzyme is employed. In alternative embodiments, two MSREs are employed. In other embodiments, at least three MSRE are employed. In other embodiments, at least four MSREs are employed. Illustrative restriction enzymes include Aatll, Acil, Acil, Afel, Agel, Asci, BmgBI, BsaAl, BsaHI, BspDI, Dial, Eagl, Fsel, Paul, Hhal, Hpall, HpyCH4IV, HinPII, Mlul, Narl, Notl, Nrul, Pvul, Sacll, and Sall, and Smal. In some embodiments, one or more of Hhal, Hpall, Acil, and HpyCH4IV is employed in the40 analysis.In some embodiments, digestion with the one or more MSREs is performed in bulk prior to distribution of the reaction mixture to partitions as detailed below. However, in preferred embodiments, the cfDNA is added to the dPCR reaction mix along with the PCR reagents for the target amplification sites and the one or more restriction enzymes. Restriction enzyme digestion can then be performed in the partitions, but before5 amplification.Further, targets within the cfDNA eluate may be pre-amplified following bulk MSRE digestion, for example, to reduce the amount of assay multiplexing needed to attain sufficient sensitivity and precision.10 Amplification targetsDetermination of foetal fraction typically comprises multiplex amplification of each of the targeted hypomethylated or hypermethylated site in the genomes that are evaluated. Thus, in some embodiments, at least two sites, or at least three sites, or at least four sites or more are targeted for each of the categories of DNA that may be employed in an assay, i.e., sites that are hypermethylated in foetal cfDNA, sites that are15 hypomethylated in foetal cfDNA, sites that are hypermethylated in maternal cfDNA, sites that are hypomethylated in maternal cfDNA, sites from methylation-insensitive regions of chromosomes unlikely to exhibit aneuploidy, sites from methylation-insensitive regions of the Y chromosome, sites that are hypomethylated in both foetal and maternal cfDNA and sites that are hypermethylated in both foetal and maternal cfDNA.20Differentially methylated sites in maternal compared to foetal cfDNA have been described (see, e.g., lonnides, Mol. Genet. Genomic Med. 8:e1094, 2020; Hatte et a!., PLOS ONE DOM 0.1371 / joumal.pone.012891 , 2015; Bunce et al, Prenat. Diagn. 32:542-54, 2012; Xiang et al, Mol Hum Reprod 20:875-884, 2014). See also, Hatt et al, PLOS ONE, July 31 , 2015, pages 1-12; Dol:10.1371 / journal. pone.0128918. Differentially methylated25 sites can also be determined. For example, methylation-based sequencing can be used to identify hypermethylated vs. hypomethylated sequences from a collection of foetal, maternal, and non-pregnant samples. Exemplary target sites are listed in Table 6A and one can use one, some of, or all of the target sites listed in Table 6A, optionally with other target sites not listed in Table 6A. Table 6B shows exemplary primer and probe sets for detection of each target site of Table 6A. Two alternative reverse primer sequences are30 provided for each target site; the reverse primers of SEQ ID NOs: 154 to 200 include an optional 6 nucleotide (ATGACT) 5’ terminal sequence, which acts as an extension to increase the annealing temperature of the primer in second and all subsequent round of amplification.Sites from chromosomes that are unlikely to exhibit aneuploidy can be from an autosome other than35 chromosome 21 , chromosome 13, or chromosome 18. In some embodiments, the sites are from chromosome 3. Methylation-insensitive regions refer to regions of the chromosome not containing CpG sites and thus are unlikely to be methylated in any cell and lack a recognition sequence for the MSRE employed in the method, meaning these sites will not be cleaved by the MSRE even though they are unmethylated.40 Sites from methylation-insensitive regions of the Y chromosome refers to methylation-insensitive sequences that are unique to the Y-chromosome such that their detection indicates the presence of a Y-chromosome, i.e., a male foetus.For purposes of this application, a differentially methylated site is one where the methylation pattern between foetal and maternal DNA is statistically different by two-sample Kolmogorov-Smirnov test (p<0.015). Furthermore, for the selection of methylated sites in foetal cfDNA, sites are selected that have a greater than5 80% average methylation frequency in foetal cfDNA, i.e., are hypermethylated; and have less than 20% average methylation frequency, i.e., are hypomethylated, in maternal DNA. Similarly, for the selection of methylated sites in maternal cfDNA, sites are selected that have a greater than 80% average methylation frequency in maternal cfDNA, i.e., are hypermethylated; and have less than 20% average methylation frequency, i.e., are hypomethylated, in foetal DNA.10For selection of hypermethylated target sites as reference sites, sites are selected that have greater than 80% average methylation frequency in both foetal cfDNA and maternal cfDNA.For selection of hypomethylated target sites as reference sites, sites are selected that have less than 20%15 average methylation frequency in both foetal cfDNA and maternal cfDNA.By way of illustration, results of such selections based on analysis of differences in foetal and maternal methylation for selection of foetal hypermethylated, maternal hypermethylated, reference hypermethylated, and reference hypomethylated sites are provided in Figures 2A to 2D, respectively. In some embodiments,20 target sites from Table 6A are assayed according to the methods described herein.Primers and probesPrimer and probe sequences for detection of amplified product for a desired target can be designed based on known principles. Amplified products are detected with a detectable label. The person of skill in the art25 understands that there are any number of labeling configurations for the detection of amplified products. In some embodiments, an oligonucleotide is labeled with a detectable agent such as a fluorescent agent, phosphorescent agent, chemiluminescent agent, and the like.In some embodiments, a probe is labeled, e g., with a fluorescent label. In alternative embodiments, at least30 one of a pair of amplification primers is labeled with a detectable label, e.g., a fluorescent label. In some embodiments, a complementary oligonucleotide that hybridizes to a non-target region of a primer or probe is labeled with a detectable label, e.g., a fluorescent label.In some embodiments, the probe is a TAQMAN™ probe, a SCORPION™ probe, an ECLIPSE™ probe, a35 molecular beacon probe, a double-stranded probe, a dual hybridization probe, or a double-quenched probe.In some embodiments, an oligonucleotide, e.g., a primer or probe, is labeled with a detectable label, e.g., a fluorescent label. In some embodiments, the agent is a fluorophore. A large number of fluorophores are available, including from commercial vendors. Non-limiting examples of fluorophores include cyanines (e.g.,40 Cy3, Cy5), indocarbocyanines (e.g., Quasar® 570, Quasar® 670, and Quasar® 705), fluoresceins (e.g., 5'- carboxyfluorescein (FAM), 6-carboxyfluorescein (6-FAM), 5- and 6-carboxyfluorescein (5,6-FAM), 2 -chloro- 7'phenyl-1 ,4-dichloro-6-carboxy-fluorescein (VIC), 6-carboxy-4'-, 5'-dichloro-2'-, 7 -dimethoxy-fluorescein(JOE), 4,7,2',4',5',7'-hexachloro-6-carboxy-fluorescein (HEX), 4,7,2',7’-tetrachloro-6-carboxy-fluorescein (TET), 2'-chloro-5'-fluoro-7',8'-benzo-1 ,4-dichloro-6-carboxyfluorescein (NED), Oregon Green, and Alexa 488), rhodamines (e.g., N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA) and 5- and 6-carboxy-X- rhodamine (ROX)), tetramethyl rhodamine, and tetramethyl rhodamine isothiocyanate (TRITC)), an Atto dye,5 eosin, coumarins, pyrenes, tetra pyrroles, arylmethines, and oxazines. In some embodiments, the dye is selected from Cy3, Cy5, Cy4.4, ROX, Atto, FAM, HEX, JOE, QUASAR, rhodamine, TAMRA, TET, Texas Red, TYE, and VIC.In some embodiments, detection of amplification products is performed via reporter-quencher pairs. Reporter¬10 quencher pairs can be selected from xanthene dyes including fluoresceins and rhodamine dyes. Many suitable forms of these compounds are available commercially with substituents on the phenyl groups, which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide. Another group of fluorescent compounds for use as reporters are the naphthylamines, having an amino group in the alpha or beta position. Included among such naphthylamino compounds are 1 -dimethylaminonaphthyl -5 sulfonate, 1-15 anilino-8-naphthalene sulfonate and 2-p-touidiny1-6-naphthalene sulfonate. Other dyes include 3-phenyl-7- isocyanatocoumarin; acridines such as 9-isothiocyanatoacridine; N-(p-(2-benzoxazolyl)phenyl)maleimide; benzoxadiazoles; stilbenes; pyrenes and the like.Suitable examples of quenchers ccaann bbee sseelleecctteedd from 6-carboxy-tetramethyl-rhodamine, 4-(4-20 dimethylaminophenylazo) benzoic acid (DABYL), tetramethylrhodamine (TAMRA), BHQ-OTM, BHQ-1 TM, BHQ-2TM, and BHQ-3TM, each of which are available from Biosearch Technologies, Inc. of Novato, Calif., Qy7TM QSY-9TM, QSY-21 TM and QSY-35TM, each of which are available from Molecular Probes, Inc, and ZEN™ and TAO™ Double-Quenched Probes from Integrated DNA Technologies. Fluorescent and dark quenchers and their relevant optical properties from which exemplary reporter-quencher pairs can be selected25 are listed and described, for example, in R. W. Sabnis, HANDBOOK OF FLUORESCENT DYES AND PROBES, John Wiley and Sons, New Jersey, 2015.Primers can be designed taking into consideration the recognition sequences of the one or more MSREs employed for the reaction. Thus, for example, primers and target regions to be amplified are selected to avoid30 the presence of the one or more MSRE recognition sequences in the primer and / or in amplicons generated during the amplification reactions.In some embodiments, multiple amplicons can be detected with the same color probe. For example, in some embodiments, 2-20, e.g., 6-10 amplicons are detected with a single-color probe. In some embodiments,35 multiple color signals are used. For example, in some embodiments, one color signal is used to detect regions that are hypermethylated in foetal cfDNA compared to maternal cfDNA, a second color signal is used to detect regions that are hypermethylated in maternal cfDNA compared to foetal cfDNA, and optionally a third color can be used to detect Y-chromosome-specific sequences if present. Additional colors can be used to detect regions that are hypermethylated in both foetal cfDNA and maternal cfDNA, regions that are hypomethylated40 in both foetal cfDNA and maternal cfDNA, or controls to confirm that the assay functioned as expected.Additional Amplification Reaction ComponentsThe reagent mixture can further comprise additional reagents, e.g., amplification reagents, including for example, one or more of buffers, salts, nucleotides, stabilizers, primers, polymerases, or nuclease-free water. In some embodiments, an additive, e.g., tetramethylammonium chloride (TMAC), DMSO, DTT, or betaine, may be used to enhance amplification specificity or yield.5PartitioningDistributing a reaction mixture, e.g., cfDNA, digital amplification reaction components, and the methylation sensitive restriction enzymes, into partitions can be achieved by any methods available. In some embodiments, methods and compositions for delivering reagents to one or more partitions include microfluidic methods using10 microwell plate, capillaries, oil emulsions, and arrays of miniaturized chambers for partitioning. In some embodiments, partitioning employs droplets. Methods of producing such droplets include droplet or microcapsule merging, coalescing, fusing, bursting, or degrading (e.g., as described in U.S. 2015 / 0027,892; US 2014 / 0227,684; WO 2012 / 149,042; and WO 2014 / 028,537); droplet injection methods (e.g., as described in WO 2010 / 151 ,776); and combinations thereof. Thus, for example, in methods in which the partitions are15 droplets, one can form droplets as an emulsion with an immiscible fluid such as oil, such that the bulk solution forms droplets that contain reaction mixture reagents, including cfDNA template. Methods of emulsion formation are described, for example, in patent applications WO 2011 / 109546 and WO 2012 / 061444.In some embodiments, the amplification reaction is a droplet digital FOR reaction. Methods for performing20 FOR in droplets are described, for example, in US 2014 / 0162266, US 2014 / 0302503, and US 2015 / 0031034, the contents of each of which is incorporated by reference. In some embodiments, the QX600 Droplet Digital PCR (ddPCR) System (Bio-Rad) is used.In some embodiments, a detection reagent or a detectable label in the partitions can be detected using any of25 a variety of detector devices. Exemplary detection methods include optical detection (e.g., fluorescence, or chemiluminescence). As a non-limiting example, a fluorescent label can be detected using a detector device equipped with a module to generate excitation light that can be absorbed by a fluorophore, as well as a module to detect light emitted by the fluorophore.30 In some embodiments, the detector further comprises handling capabilities for the partitioned samples (e.g., droplets), with individual partitioned samples entering the detector, undergoing detection, and then exiting the detector. In some embodiments, partitioned samples (e.g., droplets) can be detected serially while the partitioned samples are flowing. In some embodiments, partitioned samples (e.g., droplets) are arrayed on a surface and a detector moves relative to the surface, detecting signals) at each position containing a single35 partition. Examples of detectors are provided in WO 2010 / 036352, the contents of which are incorporated herein by reference. In some embodiments, detectable labels in partitioned samples can be detected serially without flowing the partitioned samples (e.g., using a chamber slide).Following acquisition of fluorescence detection data, a general-purpose computer system (referred to herein40 as a "host computer") can be used to store and process the data. A computer-executable logic can be employed to perform such functions as subtraction of background signal, assignment oftarget and / or reference sequences, and quantification of the data. A host computer can be useful for displaying, storing, retrieving, orcalculating foetal fraction in the sample; storing, retrieving, or calculating raw data from the nucleic acid detection; or displaying, storing, retrieving, or calculating any sample or source information useful in the methods.5 The host computer can be configured with many different hardware components and can be made in many dimensions and styles (e.g., desktop PC, laptop, tablet PC, handheld computer, server, workstation, mainframe). Standard components, such as monitors, keyboards, disk drives, CD and / or DVD drives, and the like, can be included. Where the host computer is attached to a network, the connections can be provided via any suitable transport media (e.g., wired, optical, and / or wireless media) and any suitable communication10 protocol (e.g., TCP / IP); the host computer can include suitable networking hardware (e.g., modem, Ethernet card, WiFi card). The host computer can implement any of a variety of operating systems, including UNIX, Linux, Microsoft Windows, MacOS, or any other operating system.Computer code for implementing aspects of the present invention can be written in a variety of languages,15 including PERL, C, C++, Java, JavaScript, VBScript, AWK, or any other scripting or programming language that can be executed on the host computer or that can be compiled to execute on the host computer. Code can also be written or distributed in low level languages such as assembler languages or machine languages.Scripts or programs incorporating various features of the present invention can be encoded on various20 computer readable media for storage and / or transmission. Examples of suitable media include magnetic disk or tape, optical storage media such as compact disk (CD) or DVD (digital versatile disk), flash memory, and carrier signals adapted for transmission via wired, optical, and / or wireless networks conforming to a variety of protocols, including the Internet.25 Calculation of Foetal FractionData processing can be used to take detected copy concentrations of foetal-specific or maternal-specific target sites to produce a foetal fraction calculation, optionally as well as a determination of foetal sex (when desired). Table 3 illustrates the various copy concentrations supplied by an exemplary six assay collection across six illustrative fluorescence channels. As noted herein, copy concentrations from one or more foetal-specific or30 maternal-specific target sites, as well as various control target sites can be determined in partitions from a sample. Thus, for example, foetal cfDNA copy concentration can be determined from one or more target sites that are specifically hypermethylated in foetal cells and hypomethylated in maternal cells, cleaved with one or more MSREs, and detected for example by a probe in a digital assay. Signal for one or more target sites can be multiplexed such that, for example, probes that detect different foetal hypermethylated target sites have the35 same color probe, and the sum of partitions having signal of that color divided by the number of targets indicates the foetal copy concentration.In some embodiments, priorto any downstream calculation, each of the copy concentrations (e.g., each of the six copy concentrations) are normalized by dividing by the number of assays in the relevant multiplex, Nt. The40 number of partitions being positive for a particular signal (e.g., detectable wavelength, or “color”) can represent amplicons from multiple targets (each detected with the same color probe). In these embodiments, Ni represents the number of multiple targets that are detected in an amplification set (and, for example, detectedwith probes having the same color label). In one illustrative embodiment, the average corrected concentration of foetal and maternal cfDNA may be found via interpolation within the hypermethylated and hypomethylated reference corrections, as shown by the equations of step 1 a and step 1 b. foetal_FF = [foeta l] / [hy pe r]— [hy po] / [hy per]— 0.08 (step 1 a)5 maternal_FF = 1 -[maternal] / [hyper] (step 1 b) wherein ‘foetal_FF’ represents a corrected concentration of foetal DNA; [hyper] is hypermethylated reference copy concentration based on signal in partitions from the amplification set that targets sites that are10 hypermethylated in foetal DNA and maternal DNA; [hypo] is hypomethylated reference copy concentration based on signal in partitions from the amplification set that targets sites that are hypomethylated in foetal DNA and maternal DNA; and [foetal] is foetal cfDNA copy concentration based on signal in partitions from the amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA; wherein ‘maternal_FF’ represents a corrected concentration of maternal DNA; [maternal] is maternal15 cfDNA copy concentration based on signal in partitions from the amplification set that target sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA.The proportion of chromosome Y (chrY) in the foetal fraction can be determined and used to accurately determine foetal fraction according to the sex of the foetus. For example, the proportion of chromosome Y in20 the foetal fraction (‘chrY_FF’) can be determined based on the calculation (step 3): chrY_FF = 2-[chrY] / [control] wherein [chrY] is the concentration of chrY in the total DNA sample; and [control] is the total concentration of25 DNA.A male foetus may be identified, for example, when the value ‘chrY_FF’ is above the threshold of 0.02. Thereafter, foetal fraction can be determined based on the calculations of step 4a for a male foetus, and step 4b for a female foetus, as follows:30FF_calculated = (2 meth_FF+chrY_FF) / 3 (step 4a)FF calculated = meth FF (step 4 b)35 wherein ‘FF_calculated’ is the final, calculated foetal fraction value; and ‘meth_FF’ and ‘chrY_FF’ are as defined above.In another alternative embodiment, the average corrected concentration of foetal and maternal cfDNA may be found via interpolation within the hypermethylated and hypomethylated reference corrections, as shown in40 Equations 1 and 2.Hypo]) (Eq. 1) [Hypo]) (Eq.2),5 wherein [Total] is total cfDNA copy concentration based on signal in partitions from the amplification set that targets total cfDNA comprising methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy, [Hyper] is hypermethylated reference copy concentration based on signal in partitions from the amplification set that targets sites that are hypermethylated in foetal DNA and maternal DNA, [Hypo] is hypomethylated reference copy concentration based on signal in partitions from the amplification set that10 targets sites that are hypomethylated in foetal DNA and maternal DNA and [Fet] is foetal cfDNA copy concentration based on signal in partitions from the amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA and [Mat] is maternal cfDNA copy concentration based on signal in partitions from the amplification set that target sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA.15Additionally, several relationships exist between independently measured metrics. Thus, adherence to the relationships expressed in Equations 3 - 5 can be used as measures of data quality.[Total] = [FetCorr] + [MatCorr] (Eq. 3)20 \MatCorr\1 = FF + [TotaZ] (Eq. 4)2 * [YChr] = [Fet, ■1 (Eq. 5), wherein [YChr] is the concentration of Y-chromosome specific sequences based on signal in partitions from25 the amplification set that targets methylation-insensitive regions of the Y chromosome.A male foetus may be determined by confirming that the Y chromosome copy concentration is non-zero and fulfills the relationship shown in Equation 5. Additionally, in the case of a Y chromosomal sex aneuploidy, the coefficient will be 1 instead of 2.30In the case of either a female or male foetus, the foetal fraction may be calculated, for example, by the four methods illustrated by Equations 6-9), which may be averaged to obtain a more precise value. Additionally, failure of the foetal fraction calculations to converge on an average value would indicate a problem with the data quality.In the case of a male foetus, two additional foetal fraction calculations (Equations 10 and 11) become possible with the inclusion of data for the copy concentration of the Y chromosome.5Foetal fraction estimation modelsTo increase the accuracy of the calculated foetal fraction, a model is developed to take in as input the calculated foetal fraction and outputs an adjusted foetal fraction based on the model. The model is developed with the objective of minimizing the average error of calculated foetal fractions from clinical samples with the10 next-generation sequencing (NGS) measurement of the foetal fractions of the same clinical samples. In one example, the model is designed to reduce the mean average percentage error, or the mean squared error.For example, consider that x1 , x2, x3, ... , xN represent the calculated foetal fraction and z1 , z2, z3, ... , zN is corresponding NGS measurements, e.g., z1 is corresponding to x1 , z2, is corresponding to x2, and so on.15 Further, consider the estimation model is represented as a function f( ) that takes in the calculated values x1 , x2, ... , xN, and for each calculated fraction computes an estimated foetal fraction y1 , y2, y3, ... , yN, e.g., y1 = f(x1), y2 = f(x2) yN = f(xN). An error for each estimated value can be defined as e1 = (y1 - z1) = (f(x1) - z1), e2 = (y2-z2)=(f(x2)-z2), ... eN = (yN - zN)=(f(xN)-zN). Several criteria may be considered in defining the estimation or mapping function f( ). For example, in minimizing the mean squared error (MSE), function f( ) is20 designed such that the MSE, e.g., (e12+e22+...+eN2) / N, is minimized. In another example, f() may be designed such that the mean average absolute percentage error (MARE), e.g., (|e1 | / z1 +|e2| / z2+...+|eN| / zN) / N, where |.| is the absolute value operation, is minimized.In one example, once the model is designed using the clinical or training data, the model may be used to25 estimate the foetal fraction based on the calculated foetal fraction. In another example, the model may be dynamic and can be updated using additional training data.In one example, the function f(-) is a linear function. For example, f(x) = a x + b. In another example, a randomized noise may be included in the model, e.g., f(x) = a x + b + n, where n is a random variable having30 a predefined distribution.Figure 5A illustrates the impact of applying a linear model on the calculated foetal fraction and its impact on MSE and MARE. In 501 , the calculated foetal fraction is depicted against the corresponding NGS foetal fraction. The calculated foetal fraction data has an MARE of 28% and MSE of 6.9 x w4. In 503, the same data35 as in 501 is represented using boxes and whiskers. In 502, a linear model is applied to the calculated foetal fractions to obtain the depicted estimated foetal fractions. As the figure shows, the estimated values are more aligned with the corresponding NGS values, which is also validated by the reduced MSE and MARE values. Using the linear model, the MARE is reduced to 19% and the MSE to 2.8 x i o4. In 504, the same data as in 502 is represented using boxes and whiskers. Comparing the boxes and whiskers in 504 and 503 shows the40 smaller variation in data and that the estimated foetal fraction is closer to the measured NGS values compared to the calculated foetal fractions.In one example, the function f( ) may be a polynomial. For example, f(x) = aO + at x + a2 x2+ a3 x3+ ... + aM xM, where M determines the order of the polynomial. For example, M=2 for a second-order polynomial and f(x) = aO + a1 x + a2 x2. Using optimization criteria, e.g., minimizing MSB or MARE, and applying the model to the5 clinical data, coefficients aO, at , and a2 can be computed.Figure 5B depicts the residual plots. In 510, the calculated foetal fraction is depicted against the foetal / hyper variable. Compared to the residual plot of the foetal / hyper, in 512, the calculated foetal fraction is depicted against the maternal / hyper variable. The plot does not suggest a linear relationship between the foetal / hyper10 and calculated foetal fraction.Figure 5C illustrates the impact of applying a linear model on the calculated foetal fraction and its impact on MSE and MARE. The same calculated foetal fraction data as in 501 is used to develop a second-order polynomial model. The second-order polynomial model (poly2LM) is applied to the calculated foetal fractions15 to obtain the depicted estimated foetal fractions. As Figure 5C shows, the estimated values are more aligned along a line with the corresponding NGS values, which is also validated by the reduced MSE and MARE values. Using the second-order polynomial model, the MARE is reduced to 17% and the MSE to 2.5 x io4.In one example, a generalized additive model (GAM) may be used to estimate the foetal fraction based on a20 calculated foetal fraction. GAM may be used to model non-linearity using an additive model. For example, a different relationship may exist between the calculated foetal fraction and the corresponding NGS values at different NGS values. A piece-wise model may be developed that defines a different estimator function. For example, the range of NGS can be divided into K regions, e.g., K = 20, 30, or 40, and each region is estimated using a spline, e.g., a spline of order 2, 3, 4, or different orders. In addition, the GAM may incorporate other25 parameters as variables for the model, e.g., the gestational week, maternal weight, etc.Figure 5D illustrates the impact of applying GAM on the calculated foetal fraction and its impact on MSB and MARE. The same calculated foetal fraction data as in 501 is used. The GAM is applied to the calculated foetal fractions to obtain the depicted estimated foetal fractions. As Figure 5D shows, the estimated values are more30 aligned along a line with the corresponding NGS values, which is also validated by the reduced MSB and MARE values. Using GAM, the MARE is reduced to 13% and the MSE to 1 .5 x io4.KitsIn a further aspect, the disclosure provides a digital amplification kit for estimating the fraction of foetal DNA in35 a cfDNA sample obtained from a blood sample (such as a plasma or serum sample) from a pregnant subject, e.g., a human. The kit can include any of the components described herein with regard to the methods. In some embodiments, the kit comprises an amplification reaction mixture comprising amplification reagents, and a plurality of amplification sets comprising primer and probe sets, wherein each amplification set comprises a distinct label distinguishable from the label for each of the other sets, and each set comprises primers and40 probes for multiplex amplification, and wherein the plurality of amplification sets comprises (i) an amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA; and / or (ii) an amplification set that targets sites that are hypermethylated in maternal DNA and hypomethylated in foetalDNA. In some embodiments, the kit further comprises an amplification set that targets total cfDNA comprising methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy. In some embodiments, the kit comprises an amplification set that targets sites that are hypermethylated in foetal DNA and maternal DNA; and / or an amplification set that targets sites that are hypomethylated in foetal DNA and maternal DNA. In some5 embodiments, the kit further comprises an amplification set that targets methylation-insensitive regions of the Y chromosome. In some embodiments, one or more sites are selected from Table 6A as described elsewhere herein. In some embodiments, a kit as described in this paragraph comprises a completely methylated synthetic sequence of DNA and / or a completely unmethylated version of the same synthetic sequence. In some embodiments, the probes employed for detection are molecular beacon probes, e.g., fluorescently10 labeled molecular beacon probes.In some embodiments, each of the amplification sets of (i) and (ii) comprises primers and probes to target at least two sites, at least three sites, or more, for example, 1 -20 sites, e.g., or between 6-10 sites.15 In some embodiments, each label for an amplification set is a fluorescent label. In some embodiments, one or more primers or a probe comprises a region that does not hybridize to the target amplification site but is complementary to an oligonucleotide that provides a detectable signal.In some embodiments, a kit comprising one or more amplification sets as described in the preceding20 paragraphs further comprises at least one methylation-sensitive restriction enzyme that cleaves hypomethylated DNA. In some embodiments, the kit comprises one or more of the restriction enzymes, Hhal, Hpall, Acil, HpyCH4IV, or BsaHI. In some embodiments, a methylation-sensitive restriction enzyme (MSRE) cocktail comprises at least one, two, at least three, or at least four methylation-sensitive restriction enzymes; selected from Hhal, Hpall, Acil, HpyCH4IV, and BsaHI. In some embodiments, the kit comprises a methylation¬25 sensitive restriction enzyme (MSRE) cocktail comprising at least two, three, or more of the restriction enzymes Hhal, Hpall, Acil, HpyCH4IV, and BsaHI. In some embodiments, the MSRE cocktail comprises at least Hhal and HpyCH4IV.In some embodiments, the reaction mixture is lyophilized.30In some embodiments, a kit comprises a standard ddPCR kit, sets of primers and probes for a foetal fraction assay as described herein, and at least one MSRE. In some embodiments, such a kit further comprises at least one PCR-enhancing agent such as TMAC and / or salts.35 In some embodiments, a kit comprises a standard ddPCR kit, sets of primers and probes for a foetal fraction assay as described herein, at least one MSRE, and stabilizing agents (e.g., trehalose, potassium glutamate, ammonium sulfate) (lyophilized together in one mix).In some embodiments, a kit comprises a standard ddPCR kit, sets of primers and probes for a foetal fraction40 assay as described herein; stabilizing reagents (lyophilized together) and at least one MSRE, which may or may not be lyophilized.Universal Fluorescent Probes Activated with RNaseH2A variety of probe formats have been used to detect amplification products in bulk or in partitions (e.g., dPCR or droplet dPCR). The most common fluorescent probe used in qPCR (quantitative PCR) and dPCR (digital PCR) are Taqman™ probes that require hydrolysis by the 5’ to 3’ exonuclease activity of the DNA polymerase5 to generate a fluorescent signal during each amplification signal. Another type of fluorescent probes are molecular beacons, which have a stem-loop structure increasing the binding specificity of the probe to its target. The downside of molecular beacons is that the fluorescence signal produced is not as strong as with hydrolysis probes as the probes are not cleaved throughout the PCR cycles. In the context of dPCR that reads end-point fluorescent signal, molecular beacons hybridize to their targets during a final step consisting of10 denaturing amplified product (e.g., 10 minutes at 98° C) followed by a ramp down to 4° C. The default configuration quantifying target DNA with fluorescent hydrolysis probes is to use a primer pair and a fluorescent probe specific to each target amplicon. In the case of multiplex, this means each target amplicon requires a set of 3 components, a forward primer, a reverse primer and a fluorescent probe.15 In some embodiments, methods of detecting a target nucleic acid in a sample are provided. In some embodiments, the method comprises: (a) forming a reaction mixture comprising: sample nucleic acids; a plurality of forward primers comprising 3’ target-specific forward sequences, a plurality of reverse primers comprising 3’ target-specific reverse sequences, wherein the forward primers or the reverse primers further comprise a 5’ universal sequence; probe nucleic acids comprising (i) a fluorophore, (ii) a quencher, (iii) at least20 25% (e.g., at least 50%), or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the 5’ universal sequence and (iv) having at least one ribonucleotide separating the fluorophore and the quencher; a DNA polymerase; and an RNaseH2 enzyme; (b) annealing the forward primers to target nucleic acids in the sample nucleic acids and extending with a polymerase the forward primers using the target nucleic acids as a template to form first strand extension products; (c)annealing the reverse primers to the first strand extension products25 and extending with the polymerase the reverse primers using the first strand extension products as a template to form second strand extension products, wherein the first strand extension products comprise a reverse complement of the 5’ universal sequence if the reverse primers comprise the 5’ universal sequence and the second strand extension products comprise a reverse complement of the 5’ universal sequence if the forward primers comprise the 5’ universal sequence; and (d) annealing the probe nucleic acids to the reverse30 complement of the 5’ universal end sequence and the RNase H2 enzyme cleaves the annealed probe at the ribonucleotide, thereby separating the quencher from the fluorophore to generate a detectable signal indicating the presence of the target nucleic acid.

[0001] In some embodiments, (a)-(d) occurs in partitions wherein the target nucleic acid is distributed35 among the partitions such that at least a portion of the partitions do not contain a target nucleic acid.In some embodiments, the sample nucleic acids are cell-free DNA. In some embodiments, the sample nucleic acids are from a pregnant woman and contain maternal and foetal DNA.40 In some embodiments, the partitions are droplets. In some embodiments, the partitions are microwells. In some embodiments, the microwells are sealed by a lid, an air gap, or an oil layer.In some embodiments, the detectable signal is monitored in real-time. In some embodiments, the detectable signal is monitored at an end point of the method.In some embodiments, the forward primers comprise the 5’ universal sequence and the concentration of5 reverse primers is higher than the concentration of forward primers. In some embodiments, the reverse primers comprise the 5’ universal sequence and the concentration of forward primers is higher than the concentration of forward primers.In some embodiments, the forward primers comprise the 5’ universal sequence and the reverse primers have10 a 5’ tail sequence that does not anneal to the target nucleic acids. In some embodiments, the reverse primers comprise the 5’ universal sequence and the forward primers have a 5’ tail sequence that does not anneal to the target nucleic acids.In some embodiments, the probe nucleic acids are linear probes. In some embodiments, the linear probes15 comprise 80-100% of the 5’ universal sequence. In some embodiments, the probe nucleic acids have at least 10 (e.g., at least 15, 20, 25, 30) nucleotides that anneal to the reverse complement of the 5’ universal sequence. In some embodiments, the probes are non-universal, and bind to target sequences present in a target nucleic acid or oligonucleotide.20 In some embodiments, the forward primer comprises the 5’ universal sequence and the linear probes and the reverse complement of the 5’ universal sequence on the second strand extension products form a duplex having a higher melting temperature than a duplexformed from the 5’ universal sequence of the forward primer and the reverse complement of the 5’ universal sequence. In some embodiments, the reverse primer comprises the 5’ universal sequence and the linear probes and the reverse complement of the 5’ universal25 sequence on the first strand extension products form a duplex having a higher melting temperature than a duplex formed from the 5’ universal sequence of the reverse primers and the reverse complement of the 5’ universal sequence.In some embodiments, the probe nucleic acids form a stem-loop and comprise 5’ to 3’: a first stem sequence,30 a loop sequence, and a second stem sequence that is the reverse complement of the first stem sequence, wherein the ribonucleotide is in the loop sequence, and wherein the 5’ universal sequence comprises at least part of (or all of) the loop sequence. In some embodiments, the 5’ universal sequence further comprises at least part of (or all of) the second stem sequence. In some embodiments, the first stem sequence and the second stem sequence are each 4-10 (e.g., 4, 5, 6, 7, 8, 9, or 10) nucleotides long. In some embodiments, the35 loop sequence is between 5-50 (e.g., 10-40 or 17-32) nucleotides long. In some embodiments, the 5’ universal sequence comprises all of the loop sequence, all of the second stem sequence, or all of the loop sequence and second stem sequence.In some embodiments, the probe nucleic acids form a stem-loop and comprise 5’ to 3’: a first stem sequence,40 a loop sequence, and a second stem sequence that is the reverse complement of the first stem sequence, wherein the ribonucleotide is in the loop sequence, and wherein a target sequence of a target nucleic acid or oligonucleotide comprises at least part of (or all of) the loop sequence. In some embodiments, the targetsequence of a target nucleic acid or oligonucleotide further comprises at least part of (or all of) the second stem sequence. In some embodiments, the first stem sequence and the second stem sequence are each 4- 10 (e.g., 4, 5, 6, 7, 8, 9, or 10) nucleotides long. In some embodiments, the loop sequence is between 5-50 (e.g., 10-40 or 17-32) nucleotides long. In some embodiments, the target sequence of a target nucleic acid or5 oligonucleotide comprises all of the loop sequence, all of the second stem sequence, or all of the loop sequence and second stem sequence.In some embodiments, the plurality of forward primers comprises at least 2 (e.g., at least 3, 5, 10, 20, 30, 40, 50) different forward primers having 5 different 3’ target-specific sequences and the plurality of reverse primers10 comprises at least 5 different reverse primers to allow for amplification of 2 (e.g., at least 3, 5, 10, 20, 30, 40, 50) target nucleic acids.In some embodiments, the RNase H2 enzyme is a Pyrococcus abyssi RNase H2 enzyme or a mutant thereof, Pyrococcus furiosis RNase H2 enzyme or a mutant thereof, Pyrococcus horikoshii RNase H2 enzyme or a15 mutant thereof, Thermococcus kodakarensis RNase H2 enzyme or a mutant thereof, or a Thermococcus litoralis RNase H2 enzyme or a mutant thereof.In some embodiments, the reaction mixture comprises: (a) a first set of the forward and reverse primers, wherein the first set targets a first plurality of different target nucleic acids and the forward or reverse primers20 of the first set comprise a first 5’ universal sequence, and a first set of the probe nucleic acids comprising (i) a first fluorophore, (ii) a first quencher, (iii) at least 25% (e.g., at least 50%) , or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the first 5’ universal sequence; and b) a second set of the forward and reverse primers, wherein the second set targets a second plurality of different target nucleic acids and the forward or reverse primers of the second set comprise a second 5’ universal sequence different from the first25 5’ universal sequence, and a second set of the probe nucleic acids comprising (i) a second fluorophore, (ii) a second quencher, (iii) at least 25% (e.g., at least 50%) , or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the second 5’ universal sequence, such that first amplicons from the first set of forward and reverse primers and having the first 5’ universal sequence can be distinguished from second amplicons from the second set of forward and reverse primers and having the second 5’ universal sequence based on30 signal from the first set of the probe nucleic acids and the second set of the probe nucleic acids, respectively.In some embodiments, the DNA polymerase lacks 5'-3' exonuclease activity.Also provided are reaction mixtures. In some embodiments, the reaction mixture comprises: a plurality of35 forward primers comprising 3’ target-specific forward sequences, a plurality of reverse primers comprising 3’ target-specific reverse sequences, wherein the forward primers or the reverse primers further comprise a 5’ universal sequence; probe nucleic acids comprising (i) a fluorophore, (ii) a quencher, (iii) at least 25% (e.g., at least 50%), or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the 5’ universal sequence and (iv) having a least one ribonucleotide separating the fluorophore and the quencher; a DNA polymerase;40 and an RNaseH2 enzyme.In some embodiments, the reaction mixture further comprises sample nucleic acids. In some embodiments, the sample nucleic acids are cell-free DNA. In some embodiments, the sample nucleic acids are from a pregnant woman and contain maternal and foetal DNA.5 In some embodiments, the reaction mixture is in partitions wherein the target nucleic acid is distributed among the partitions such that at least a portion of the partitions do not contain a target nucleic acid. In some embodiments, the partitions are droplets. In some embodiments, the partitions are microwells. In some embodiments, the microwells are sealed by a lid, an air gap, or an oil layer.10 In some embodiments, the forward primers comprise the 5’ universal sequence and the concentration of reverse primers is higher than the concentration of forward primers. In some embodiments, the reverse primers comprise the 5’ universal sequence and the concentration of forward primers is higher than the concentration of forward primers.15 In some embodiments, the forward primers comprise the 5’ universal sequence and the reverse primers have a 5’ tail sequence that does not anneal to the target nucleic acids. In some embodiments, the reverse primers comprise the 5’ universal sequence and the forward primers have a 5’ tail sequence that does not anneal to the target nucleic acids.20 In some embodiments, the probe nucleic acids are linear probes. In some embodiments, the linear probes comprise 80-100% of the 5’ universal sequence. In some embodiments, the probe nucleic acids have at least 10 (e.g., at least 15, 20, 25, 30) nucleotides that anneal to the reverse complement of a target sequence of a target nucleic acid or oligonucleotide. In some embodiments, the linear probes comprise 80-100% of a target sequence of a target nucleic acid or oligonucleotide. In some embodiments, the probe nucleic acids have at25 least 10 (e.g., at least 15, 20, 25, 30) nucleotides that anneal to a target sequence of a target nucleic acid or oligonucleotide.In some embodiments, the probe nucleic acids form a stem-loop and comprise 5’ to 3’: a first stem sequence, a loop sequence, and a second stem sequence that is the reverse complement of the first stem sequence,30 wherein the ribonucleotide is in the loop sequence, and wherein the 5’ universal sequence comprises at least part of the loop sequence. In some embodiments, the 5’ universal sequence further comprises at least part of the second stem sequence. In some embodiments, the first stem sequence and the second stem sequence are each 4-10 (e.g., 4, 5, 6, 7, 8, 9, or 10) nucleotides long. In some embodiments, the loop sequence is between 5-50 (e.g., 10-40 or 17-32) nucleotides long. In some embodiments, the 5’ universal sequence35 comprises all of the loop sequence, all of the second stem sequence, or all of the loop sequence and second stem sequence.In some embodiments, the plurality of forward primers comprises at least 2 (e.g., at least 3, 5, 10, 20, 30, 40, 50) different forward primers having 5 different 3’ target-specific sequences and the plurality of reverse primers40 comprises at least 5 different reverse primers to allow for amplification of 2 (e.g., at least 3, 5, 10, 20, 30, 40, 50) target nucleic acids.

[0002] In some embodiments, the RNase H2 enzyme is a Pyrococcus abyssi RNase H2 enzyme or a mutant thereof, Pyrococcus furiosis RNase H2 enzyme or a mutant thereof, Pyrococcus horikoshii RNase H2 enzyme or a mutant thereof, Thermococcus kodakarensis RNase H2 enzyme or a mutant thereof, or a Thermococcus litoralis RNase H2 enzyme or a mutant thereof.5In some embodiments, the reaction mixture comprises: (a) a first set of the forward and reverse primers, wherein the first set targets a first plurality of different target nucleic acids and the forward or reverse primers of the first set comprise a first 5’ universal sequence, and a first set of the probe nucleic acids comprising (i) a first fluorophore, (ii) a first quencher, (iii) at least 25% (e.g., at least 50%) , or at least 10 (e.g., at least 15, 20,10 25 or more) nucleotides, or both, of the first 5’ universal sequence; and (b) a second set of the forward and reverse primers, wherein the second set targets a second plurality of different target nucleic acids and the forward or reverse primers of the second set comprise a second 5’ universal sequence different from the first 5’ universal sequence, and a second set of the probe nucleic acids comprising (i) a second fluorophore, (ii) a second quencher, (iii) at least 25% (e.g., at least 50%) , or at least 10 (e.g., at least 15, 20, 25 or more)15 nucleotides, or both, of the second 5’ universal sequence, such that first amplicons from the first set of forward and reverse primers and having the first 5’ universal sequence can be distinguished from second amplicons from the second set of forward and reverse primers and having the second 5’ universal sequence based on signal from the first set of the probe nucleic acids and the second set of the probe nucleic acids, respectively.20 In some embodiments, the DNA polymerase lacks 5'-3' exonuclease activity.Also provided is a mixture comprising: (a) a first set of forward primers comprising 3’ target-specific forward sequences and reverse primers comprising 3’ target-specific reverse sequences, wherein the forward primers or the reverse primers of the first set further comprise a first 5’ universal sequence, wherein the first set targets25 a first plurality of different target nucleic acids, and a first set of the probe nucleic acids comprising (i) a first fluorophore, (ii) a first quencher, (iii) at least 25% (e.g., at least 50%), or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the first 5’ universal sequence and (iv) a least one ribonucleotide separating the fluorophore and the quencher; and (b) a second set of forward primers comprising 3’ target-specific forward sequences and reverse primers comprising 3’ target-specific reverse sequences, wherein the forward primers30 or the reverse primers of the second set further comprise a second 5’ universal sequence, wherein the second set targets a second plurality of different target nucleic acids, and a second set of the probe nucleic acids comprising (i) a second fluorophore, (ii) a second quencher, (iii) at least 25% (e.g., at least 50%), or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the second 5’ universal sequence and (iv) a least one ribonucleotide separating the fluorophore and the quencher, such that first amplicons from the first set of35 forward and reverse primers and having the first 5’ universal sequence can be distinguished from second amplicons from the second set of forward and reverse primers and having the second 5’ universal sequence based on signal from the first set of the probe nucleic acids and the second set of the probe nucleic acids, respectively.40 In some embodiments, the mixture further comprises an RNaseH2 enzyme.Methods of detecting target nucleic acids are provided using probes having a ribonucleotide. The probes are cleaved by a RNaseH2 enzyme when bound to a universal sequence introduced to a target nucleic acid by a primer. For example, the probes described herein can have a fluorophore and quencher moiety separated by the ribonucleotide such that signal from the fluorophore in an intact probe is relatively quenched compared to5 when the probe is cleaved at the ribonucleotide by the RNaseH2 enzyme. The inventors have found that such probes are of particular use in digital amplification assays and also will be useful in real-time bulk amplification assays. Some advantages of these methods include better separation of signal (target) from background (no target) as well as the ability to use DNA polymerases lacking 5’-3 ’ exonuclease activity. The methods described herein can also be used in various multiplex formats allowing for detection of large numbers of different10 amplicons as desired. Additional advantages will be apparent from the remainder of this disclosure.The methods can involve formation of a reaction mixture comprising sample nucleic acids, forward and reverse primers, probes as described herein, a DNA polymerase and an RNaseH2 enzyme. Each of these will be discussed in turn followed by a discussion of methods of their use.15A target nucleic acid is any DNA sequence (e.g., dsDNA, cDNA) to be detected from a sample. Biological samples can be obtained from any biological organism, e.g., an animal, plant, fungus, pathogen (e.g., bacteria or virus), or any other organism. In some embodiments, the biological sample is from an animal, e.g., a mammal (e.g., a human or a non-human primate, a cow, horse, pig, sheep, cat, dog, mouse, or rat), a bird20 (e.g., chicken), or a fish. A biological sample can be any tissue or bodily fluid obtained from the biological organism, e.g., blood, a blood fraction, or a blood product (e.g., serum, plasma, platelets, red blood cells, and the like), sputum or saliva, tissue (e.g., kidney, lung, liver, heart, brain, nervous tissue, thyroid, eye, skeletal muscle, cartilage, or bone tissue); cultured cells, e.g., primary cultures, explants, and transformed cells, stem cells, stool, urine, etc. In some embodiments, the sample is a cell-free nucleic acid sample. In some25 embodiments, the cell-free DNA sample is from a pregnant woman (for example, a cell-free sample from maternal blood containing maternal and foetal DNA) or a person having, or who had or is suspected of having cancer or who is an organ transplant recipient.The disclosed methods may be used with samples obtained non-invasively, or with samples obtained30 invasively (e.g., amniocentesis or CVS samples).The reaction mixture will have a plurality of forward primers comprising one or more 3’ target-specific forward sequences. The terms “forward” and “reverse” are arbitrary designations, indicating that forward and reverse primers anneal to opposite strands of a double-stranded DNA molecule and when annealed have 3’ ends35 directed towards each other such that an amplicon is formed under PCR conditions. The 3’ target-specific forward sequences can vary in composition and length and can be designed to specifically amplify a particular target nucleic acid in a mixture of different nucleic acids. In some embodiments, the 3’ target-specific forward sequence is between 10-30 nucleotides long that anneals to or adjacent to a target nucleic acid though other lengths can be used in other embodiments.40The plurality of forward primers will include a number of copies of the primers to achieve the desired amplification. In multiplex reactions, the plurality of forward primers will further include multiple different forwardprimers having different 3’ target-specific forward sequences, allowing for amplification of different targets in the same reaction. As a simple example, the reaction can have copies of a first forward primer having a first 3’ target-specific forward sequence and copies of a second forward primer having a second (different from first) 3’ target-specific forward sequence, allowing for amplification of a first and second target, if present in the5 sample. As discussed more below, the number of different forward primers can be high, e.g., at least 2, 5, 10, 20, 30, 40, 50, 70, 100, 120, or more, for example, from 2-200, in the same reaction. As will be discussed below, in some embodiments, the universal sequence will be located on the forward primers and will be located at the 5’ end of the forward primers in this case.10 In some embodiments, a plurality of reverse primers is provided. For example, in some embodiments, for each forward primer having a unique 3’ target-specific forward sequence there will be one reverse primer with a unique 3’ target-specific reverse sequence such that the forward and reverse primer together amplify a particular target nucleic acid. As with the forward primer, in multiplex options, reverse primers with different 3’ target-specific reverse sequences can be employed in the reaction mixture.15Either the forward primers or the reverse primers, but in some embodiments not both, and in some embodiments neither, will further comprise a 5’ universal sequence. The 5’ universal sequence is a sequence common to a set of primers but does not anneal to the target sequence in the initial amplification round (they are not target-specific). See, e.g., Figure 6. The 5’ universal sequence can be any length as desired so long20 as it is of sufficient length for annealing of the probe during the reaction as discussed below. In some embodiments, for example the 5’ universal sequence is between 10-50 nucleotides long, e.g., 15-40, 15-35, or 20-35 nucleotides long. At least a part of, and in some embodiments, all of, the 5’ universal primer, and at least part of the probe sequence, including the ribonucleotide(s) of the probe, will have identical sequences to each other such that the probe, including the ribonucleotide(s) and the reverse complement of the universal25 sequence will anneal, allowing for cleavage at the ribonucleotide by the RNaseH2 enzyme as explained further below.In embodiments in which a forward and reverse primer pair is provided, it can be advantageous to include a high number (e.g., high concentration) of the primer that does not have the 5’ universal sequence compared30 to the primer that does have the 5’ universal sequence. For example, in embodiments in which the forward primer has the 5’ universal sequence, in some cases the concentration of the reverse primer will be higher (e.g., at least 1.5, 2, 3, 5, 10 times higher) than the concentration of the forward primer. In embodiments in which the reverse primer has the 5’ universal sequence, in some cases the concentration of the forward primer will be higher (e.g., at least 1.5, 2, 3, 5, 10 times higher) than the concentration of the reverse primer. As an35 example, in some embodiments, the primer lacking the 5’ universal sequence has a concentration of 500- 2,000 nM (e.g., 900 or 1 ,000 nM) and the primer having the 5’ universal sequence is provided at a concentration of 50-200 nM (e.g., 90 or 100 nM). This is useful for generating an excess of the strand having the reverse complement of the 5’ universal sequence, which is detected by the probe.40 In some multiplex embodiments, some primers can have different 5’ universal sequences, allowing for use of different “color” probes in the same reaction. For example, in some embodiments, a first set of primers (forward or reverse) have a first 5’ universal sequence and a second set of primers (forward or reverse) have a second5’ universal sequence. In these embodiments, the reaction mixture has a first probe with a sequence identical to part or all of the first 5’ universal sequence and a second probe with a sequence identical to part or all of the second 5’ universal sequence. If the first and second probes have different linked fluorophores or quenchers such that the signals emitted have a different wavelength (color) then the first and second probe5 signals can be distinguished. While the example above is illustrated with two 5’ universal sequences and associated probes, one can employ more (e.g., 3, 4, 5, 6, 7, 8, 9, 10, etc.) 5’ universal sequences and associated probes wherein each probe can be distinguished from the other by the wavelength of their signals.Moreover, in some embodiments, each set of primers having the same 5’ universal sequence can include10 primers with more than one different 3’ target-specific forward (or reverse depending on which primer) sequence. Thus for example, a first set of forward primers could include 2, 5, 10, or 20, or more different 3’ target-specific forward sequences and each have a first 5’ universal sequence, and thus would be detectable by a first probe and a second set of forward primers could include 2, 5, 10, or 20, or more different 3’ targetspecific forward sequences and each have a second 5’ universal sequence, and thus would be detectable by15 a second probe. When all in one reaction mixture, this allows for a very high number of different amplifications to be monitored. For example, the inventors have used six distinguishable probes, each set probing 20 different amplification reactions having the set’s own 5’ universal sequence, allowing for 120 different reactions to be monitored in digital format.20 Probe nucleic acids use energy transfer between two moieties, e.g., a donor fluorophore and an acceptor moiety separated by the ribonucleotide. In some embodiments, the probe nucleic acids comprise a fluorophore moiety and quencher moiety (i.e. , an acceptor that absorbs energy released by the donor fluorophore, butthen does not itself fluoresce) separated by the ribonucleotide such that upon cleavage of the ribonucleotide, the two moieties are separated, resulting in a detectable signal. The fluorophore and quencher can be located at25 the ends of the probe, respectively, or one or both can be linked to an internal nucleotide in the probe. In some embodiments, the proximity of the quencher to the fluorophore in the intact probe results in quenched fluorescent signal, whereas the cleaved probe results in increased detectable signal due to a reduction or lack of quenching. In some embodiments in which two or more different probes are used, the different probes will have a different fluorophore or quencher or both such that the different probes emit signal at different30 wavelengths that can be differentiated from each other by a sensor. Because some quenchers can quench a broad range of wavelengths, in some embodiments, the same quencher is used for two or more different probes, each of which have different fluorophores that emit at different wavelengths.Fluorescent agents can include a variety of organic and / or inorganic small molecules or a variety of fluorescent35 proteins and derivatives thereof. A vast array of fluorophores and quenchers are reported in the literature and thus known to those skilled in the art, and many are readily available from commercial suppliers to the biotechnology industry. Literature sources for fluorophores include Cardullo et al., Proc. Natl. Acad. Sci. USA 85: 8790-8794 (1988); Dexter, D.L., J. of Chemical Physics 21 : 836- 850 (1953); Hochstrasser et al., Biophysical Chemistry 45: 133-141 (1992); Selvin, P., Methods in Enzymology 246: 300-334 (1995); Steinberg,40 I. Ann. Rev. Biochem., 40: 83- 114 (1971); Stryer, L. Ann. Rev. Biochem., 47: 819-846 (1978); Wang et al., Tetrahedron Letters 31 : 6493-6496 (1990); Wang et al., Anal. Chem. 67: 1197-1203 (1995). Non-limiting examples of fluorophores include cyanines, fluoresceins (e.g., 5'-carboxyfluorescein (FAM), Oregon Green,and Alexa 488), HEX, rhodamines (e.g., N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethyl rhodamine, and tetramethyl rhodamine isothiocyanate (TRITC)), eosin, coumarins, pyrenes, tetrapyrroles, arylmethines, oxazines, polymer dots, and quantum dots. In some embodiments, the fluorophores are selected from HEX, FAM, Cy5, Cy5.5, ROX, Atto 590, Alexa 405, Pacific Blue, ABY, and Texas Red. Exemplary5 quenchers can include, but are not limited to, Iowa Black® FQ, Iowa Black® RQ, Black Hole Quencher®- 1 , Black Hole Quencher®-2, DABCYL, and ZEN internal quencher.The nucleotide sequence of the probe (including the position of the ribonucleotide) will comprise at least 25%, and more preferably, at least 30, 40, 50, 60, 70, 80, 90, or 100% of the 5’ universal sequence. For example,10 in some embodiments, the probe can comprise 10-50, e.g., 15-30 nucleotides identical to the 5’ universal sequence. At the aligning position, the ribonucleotide will include the same nucleotide (but in ribonucleotide form) as the 5’ universal sequence, except if the position in the 5’ universal sequence is thymine, the ribonucleotide is the RNA equivalent, i.e., uracil. The nucleotide sequence will be composed of non- ribonucleotides aside from the one or more ribonucleotide separating the fluorophore and quencher moiety.15 The non-ribonucleotides can be, for example, deoxyribonucleotides (e.g., forming DNA) or analogs thereof. In some embodiments, the probe can include one or more non-natural nucleotide or analog thereof (e.g., peptidenucleic acids (PNAs) or locked nucleic acids (LNAs)) or other nucleotides that have greater affinity for the reverse complement of the 5’ universal sequence compared to the primer having the 5’ universal sequence (composed of DNA). Increased affinity (high melting temperature (Tm)) of the probe for the reverse20 complement of the 5’ universal sequence, compared to the primer having the 5’ universal sequence for the reverse complement of the 5’ universal sequence, can be used to further improve signal-to-noise differentiation.The nucleotide sequence of the probe (including the position of the ribonucleotide) will comprise at least 25%,25 and in embodiments at least 30, 40, 50, 60, 70, 80, 90, or 100% of a target sequence of a target nucleic acid or oligonucleotide. For example, in some embodiments, the probe can comprise 10-50, e.g., 15-30 consecutive nucleotides identical to the target sequence of a target nucleic acid or oligonucleotide. At the aligning position, the ribonucleotide will include the same nucleotide (but in ribonucleotide form) as the target sequence of a target nucleic acid or oligonucleotide, except if the position in the target sequence of a target nucleic acid or30 oligonucleotide is thymine, the ribonucleotide is the RNA equivalent, i.e. , uracil. The nucleotide sequence may be composed of non-ribonucleotides aside from the one or more ribonucleotide separating the fluorophore and quencher moiety. The non-ribonucleotides can be, for example, deoxyribonucleotides (e.g., forming DNA) or analogs thereof. In some embodiments, the probe can include one or more non-natural nucleotide or analog thereof (e.g., peptide-nucleic acids (PNAs) or locked nucleic acids (LNAs)) or other nucleotides that have35 greater affinity for the reverse complement of the target sequence of a target nucleic acid or oligonucleotide compared to the primer having the target sequence of a target nucleic acid or oligonucleotide (composed of DNA). Increased affinity (high melting temperature (Tm)) of the probe forthe reverse complement of the target sequence of a target nucleic acid or oligonucleotide, compared to the primer having the target sequence of a target nucleic acid or oligonucleotide for the reverse complement of the target sequence of a target nucleic40 acid or oligonucleotide, can be used to further improve signal-to-noise differentiation.As noted above, one or more ribonucleotide is positioned in the probe between the fluorophore and quencher such that when the RNaseH2 enzyme cleaves at the ribonucleotide, the fluorophore and quencher will diffuse from each other to generate the detectable signal. Moreover, the RNaseH2 enzyme cleaves ribonucleotides annealed to a deoxyribonucleotide counterpart in the context of two anneal strands (in this case the probe and5 reverse complement of the 5’ universal sequence). RNaseH2 enzyme cleavage is more efficient if there are multiple (e.g., 2, 3, 4, 5, 6, or more) annealed nucleotides on both sides of the ribonucleotide. Thus, in some embodiments, the ribonucleotide is positioned in a middle section of the probe or al least more than 2, 3, 4, 5, 6 or more nucleotides from either end of the probe.10 Optionally the probe will be modified at the 3’ end so that a polymerase cannot extend the probe. In some embodiments, the fluorophore or quencher is linked to the 3’ end of the probe and this blocks the polymerase from extending the probe. In other embodiments, the 3’ end of the probe can be modified to block extension. Non-limiting modifications of the 3’ end can include, for example, a 3' inverted dT, a 3' C3 spacer, a 3' amino, or 3' phosphorylation.15Various probe formats can be used. In some embodiments, the probe is a linear probe, meaning that the sequences within the probe do not form a stem-loop structure or otherwise self-anneal. In other embodiments, the probe can be in a stem-loop format where the ribonucleotide is located in the loop portion. See, e.g., Figure 7. Probe concentration can be selected to avoid background while generating detectable signal. For example,20 in some embodiments, the probe is provided at a concentration between 100 - 1000 nM, e.g., 500 nM. In some embodiments, the probe concentration is lower than the limiting primer (i.e., the primer having the 5’ universal sequence) concentration, and in some embodiments, is 2-10 times the limiting primer concentration.Linear probes can be of any length as desired. Exemplary probe nucleic acids can have, for example, at least25 10 (e.g., at least 15, 20, 25, 30) contiguous or non-contiguous nucleotides that are reverse complementary to the 5’ universal sequence. In some embodiments, the linear probe will comprise a sequence at least 80, 90, or 100% identical to the 5’ universal probe sequence, thereby improving the probe’s ability to compete for the reverse complement of the universal 5’ sequence compared to the primer having the 5’ universal sequence.30 Linear probes can be of any length as desired. Exemplary probe nucleic acids can have, for example, at least 10 (e.g., at least 15, 20, 25, 30) contiguous or non-contiguous nucleotides that are reverse complementary to a target sequence of a target nucleic acid or oligonucleotide. In some embodiments, the linear probe will comprise a sequence at least 80, 90, or 100% identical to the target sequence of a target nucleic acid or oligonucleotide, thereby improving the probe’s ability to compete for the reverse complement of the universal35 5’ sequence compared to the primer having the target sequence of a target nucleic acid or oligonucleotide.Stem-loop probes will have a first stem sequence, a loop sequence, and a second stem sequence that is the reverse complement of the first stem sequence, allowing for the two stem sequences to self-anneal to form a stem-loop. At least part of the loop sequence, which comprises the ribonucleotide, will have the same40 sequence as the 5’ universal sequence. In some embodiments, at least part of the second stem sequence is also the same as a sequence in the 5’ universal sequence. In some embodiments, all of the loop or second stem sequence or both are identical to adjacent sequences in the 5’ universal sequence; see, e.g., Figure 7.Stem-loop probes will have a first stem sequence, a loop sequence, and a second stem sequence that is the reverse complement of the first stem sequence, allowing for the two stem sequences to self-anneal to form a stem-loop. At least part of the loop sequence, which comprises the ribonucleotide, will have the same5 sequence as a target sequence of a target nucleic acid or oligonucleotide. In some embodiments, at least part of the second stem sequence is also the same as a sequence in the target sequence of a target nucleic acid or oligonucleotide. In some embodiments, all of the loop or second stem sequence or both are identical to adjacent sequences in the target sequence of a target nucleic acid or oligonucleotide.10 The lengths of the stem sequences and the loop sequences can be varied as desired. In some embodiments, the first stem sequence and the second stem sequence are each 4-10 (e.g., 4, 5, 6, 7, 8, 9, or 10) nucleotides long though other lengths can also be employed. In some embodiments, the loop sequence is between 5-50 (e.g., 10-40 or 17-32) nucleotides long though other lengths can also be employed.15 The reaction mixtures can comprise a DNA polymerase that acts to extend at least one of the primers in a template-dependent manner. In some embodiments, the DNA polymerase is a thermostable polymerase. Thermostable polymerases are isolated from a wide variety of thermophilic bacteria, such as Thermus aquaticus (Taq), Pyrococcus furiosus (Pfu), Pyrococcus woesei (Pwo), Bacillus sterothermophilus (Bst), Sulfolobus acidocaldarius (Sac) SulfoIobus solfataricus (Sso), Pyrodictium occultum (Poc), Pyrodictium abyssi20 (Pab), and Methanobacterium thermoautotrophicum (Mth), as well as other species. DNA polymerases are known in the art and are commercially available. In some embodiments, the DNA polymerase is Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENT™, DEEPVENT™, or an active mutant, variant, or derivative thereof. In some embodiments, the DNA polymerase is Taq DNA polymerase. In some embodiments, the DNA polymerase is a high-fidelity DNA polymerase (e.g.,25 iProof™ High-Fidelity DNA Polymerase, Phusion® High-Fidelity DNA polymerase, Q5® High-Fidelity DNA polymerase, Platinum® Taq High Fidelity DNA polymerase, Accura® High-Fidelity Polymerase). In some embodiments, the DNA polymerase is a fast-start polymerase (e.g., FastStart™ Taq DNA polymerase or FastStart™ High Fidelity DNA polymerase). In some embodiments, the polymerase lacks 5’-3’ exonuclease activity, for example, as found in Family B polymerases.30As noted above, the methods and compositions can involve the activity of a RNaseH2 enzyme. An RNaseH2 enzyme cleaves a ribonucleotide in an RNA / DNA duplex. A variety of RNAseH2 enzymes are known and can be used in the methods described herein. Exemplary RNAseH2 enzymes have been described, for example from Pyrococcus abyssi, Pyrococcus furiosis, Pyrococcus horikoshii, Thermococcus kodakarensis, and35 Thermococcus litoralis. In addition, a variety of mutant enzymes have been developed from these natural enzymes, for example, as described in WO2018 / 031625, which is incorporated by reference.The methods herein comprise forming a reaction mixture with some of all of the components described above, as well as reagents necessary for primer extension (e.g., amplification).40The amplification reaction mixture will also comprise nucleotides. Nucleotides for use in the methods described herein can be any nucleotide useful in the polymerization of a nucleic acid. Nucleotides can be naturallyoccurring, unusual, modified, derivative, or artificial. Nucleotides will generally be unlabeled in the embodiments described herein.In some embodiments, the amplification reaction mixture comprises one or more buffers or salts. A wide variety5 of buffers and salt solutions and modified buffers are known in the art. For example, in some embodiments, the buffer is TRIS, TRICINE, BIS-TRICINE, HEPES, MOPS, TES, TAPS, PIPES, or CAPS. In some embodiments, the salt is potassium acetate, potassium sulfate, potassium chloride, ammonium sulfate, ammonium chloride, ammonium acetate, magnesium chloride, magnesium acetate, magnesium sulfate, manganese chloride, manganese acetate, manganese sulfate, sodium chloride, sodium acetate, lithium10 chloride, or lithium acetate. In some embodiments, the amplification reaction mixture comprises a salt (e.g., potassium chloride) at a concentration of about 10 mM to about 100 mM.In some embodiments, the amplification reaction mixture comprises one or more stabilizers. Stabilizers for use in the methods described herein include, but are not limited to, polyol (glycerol, threitol, etc.), a polyether15 including cyclic polyethers, polyethylene glycol, organic or inorganic salts, such as ammonium sulfate, sodium sulfate, sodium molybdate, sodium tungstate, organic sulfonate, etc., sugars, polyalcohols, amino acids, peptides or carboxylic acids, a quencher and / or scavenger such, as mannitol, glycerol, reduced glutathione, superoxide dismutase, bovine serum albumin (BSA) or gelatine, spermidine, dithiothreitol (or mercaptoethanol) and / or detergents such as TRITON® X-100 [Octophenol(ethyleneglycolether)], THESIT® [Polyoxyethylene 920 lauryl ether (Polidocanol C12 Eg)], TWEEN® (Polyoxyethylenesorbitan monolaurate 20, NP40) and BRIJ®-35 (Polyoxyethylene23 lauryl ether).Once formed, the reaction mixture is submitted to conditions to allow for primer extension using one or more primer that anneals to a target nucleic acid to be detected. The reaction mixture is submitted to primer25 extension conditions, which can be but is not limited to PCR conditions, allowing the primer to anneal to the target nucleic acid, if present, and being extended by a polymerase in a template (i.e. , target nucleic acid)- specific manner. The reaction can be performed in bulk, or in partitions, and can be monitored for signal at an end-point or in real time, i.e., continuously or every cycle, for example.30 In embodiments comprising a forward and reverse primer, the forward primer is extended when the target nucleic acid is present, to form a first strand, which is followed by extension of the reverse primer using the first strand as a template to form a second strand complementary to the first strand Depending on whether the 5’ universal sequence is on the forward or reverse primers, the first or second strand will comprise the 5’ universal strand, respectively, and therefore the second or first strand, respectively, will comprise the reverse35 complement of the 5’ universal sequence. Because the probe nucleic acids and RNase H2 enzyme are also in the reaction mixture, as the reverse complement of the 5’ universal sequence is generated, the probe will anneal to the reverse complement of the 5’ universal sequence and the annealed probe will be cleaved at the ribonucleotide by the RNase H2 enzyme, separating the fluorophore and the quencher, resulting in a detectable fluorescent signal. The quantity of this signal can indicate the quantity or at least presence of the40 target nucleic acid in a bulk reaction, or alternatively, if the reaction is in partitions, the number of partitions having a signal above a threshold will be proportional to the quantity of the target nucleic acid in the sample.In general, the amount of sample nucleic acid and number of partitions is selected such that at least some partitions are empty as dictated by a Poisson distribution.In embodiments comprising a forward and reverse primer, the forward primer is extended when the target5 nucleic acid is present, to form a first strand, which is followed by extension of the reverse primer using the first strand as a template to form a second strand complementary to the first strand. Depending on whether the target sequence of a target nucleic acid or oligonucleotide is on the forward or reverse primers, the first or second strand will comprise the target sequence of a target nucleic acid or oligonucleotide strand, respectively, and therefore the second or first strand, respectively, will comprise the reverse complement of the target10 sequence of a target nucleic acid or oligonucleotide. In embodiments, because the probe nucleic acids and RNase H2 enzyme are also in the reaction mixture, as the reverse complement of the target sequence of a target nucleic acid or oligonucleotide is generated, the probe will anneal to the reverse complement of the target sequence of a target nucleic acid or oligonucleotide and the annealed probe will be cleaved at the ribonucleotide by the RNase H2 enzyme, separating the fluorophore and the quencher, resulting in a15 detectable fluorescent signal. The quantity of this signal can indicate the quantity or at least presence of the target nucleic acid in a bulk reaction, or alternatively, if the reaction is in partitions, the number of partitions having a signal above a threshold will be proportional to the quantity of the target nucleic acid in the sample. In general, the amount of sample nucleic acid and number of partitions is selected such that at least some partitions are empty as dictated by a Poisson distribution.20Methods and compositions for partitioning a sample are described, for example, in published patent applications WO 2010 / 036,352, US 2010 / 0173,394, US 2011 / 0092,373, and US 2011 / 0092,376, the contents of each of which are incorporated herein by reference in the entirety. The plurality of mixture partitions can be in a plurality of emulsion droplets, or a plurality of microwells, etc.25In some embodiments, sample nucleic acids can be partitioned into a plurality of mixture partitions, and then one or more amplification primer(s), probe(s), enzyme(s), oligonucleotides or a combination thereof, can be introduced into the plurality of mixture partitions. Methods and compositions for delivering reagents to one or more mixture partitions include microfluidic methods as known in the art; droplet or microcapsule merging,30 coalescing, fusing, bursting, or degrading (e.g., as described in U.S. 2015 / 0027,892; US 2014 / 0227,684; WO 2012 / 149,042; and WO 2014 / 028,537); droplet injection methods (e.g., as described in WO 2010 / 151 ,776); and combinations thereof.In some embodiments, the amplification reaction is a droplet digital PCR reaction. Methods for performing35 PCR in droplets are described, for example, in US 2014 / 0162266, US 2014 / 0302503, and US 2015 / 0031034, the contents of each of which is incorporated by reference. In some embodiments, the QX200, QX600, or QX One Droplet Digital PCR (ddPCR) System (Bio-Rad) is used.In some embodiments, a detection reagent or a detectable label in the partitions can be detected using any of40 a variety of detector devices. Exemplary detection methods include optical detection (e.g., fluorescence, or chemiluminescence). As a non-limiting example, a fluorescent label can be detected using a detector deviceequipped with a module to generate excitation light that can be absorbed by a fluorophore, as well as a module to detect light emitted by the fluorophore.In some embodiments, the detector further comprises handling capabilities for the partitioned samples (e.g.,5 droplets), with individual partitioned samples entering the detector, undergoing detection, and then exiting the detector. In some embodiments, partitioned samples (e.g., droplets) can be detected serially while the partitioned samples are flowing. In some embodiments, partitioned samples (e.g., droplets) are arrayed on a surface and a detector moves relative to the surface, detecting signals) at each position containing a single partition. Examples of detectors are provided in WO 2010 / 036352, the contents of which are incorporated10 herein by reference. In some embodiments, detectable labels in partitioned samples can be detected serially without flowing the partitioned samples (e.g., using a chamber slide).Following acquisition of fluorescence detection data, a general-purpose computer system (referred to herein as a "host computer") can be used to store and process the data.15Kits and mixtures useful for practice of the methods are also provided. Kits can be composed, for example, of plastic containers containing a mixture as described herein, optionally with instructions for its use. For example, in some embodiments, a mixture of forward, or forward and reverse primers as described herein are provided that can be mixed by an end user with a RNaseH2 enzyme, probes, polymerase, and / or other reagents as20 described herein.In some embodiments, a mixture comprises at least a first forward primer comprising a 3’ target-specific forward sequence and a reverse primer comprising a 3’ target-specific reverse sequence, wherein the forward primer or the reverse primer further comprise a first 5’ universal sequence, and probe nucleic acids comprising25 (i) a first fluorophore, (ii) a first quencher, (iii) at least 25% (e.g., at least 50%) , or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the 5’ universal sequence and (iv) a least one ribonucleotide separating the fluorophore and the quencher. In some embodiments, the mixture comprises a first set of forward and reverse primers as described above, each of the forward primer or reverse primer having an identical 5’ universal sequence but different (e.g., at least 2, 3, 4, 5, 8, 10, 15, 20, or more) 3’ target-specific forward30 sequence and 3’ target-specific reverse sequences, respectively, such that at least 2, 3, 4, 5, 8, 10, 15, 20, or more different target nucleic acids can be amplified by the primers and detected by the probe nucleic acid.In some embodiments, the mixture can comprise at least two different separately detectable probes along with two sets of primers: a first set of primers (forward and reverse) that include a first 5’ universal sequence, whose35 reverse complement is detectable by the first probe, and a second set of primers (forward and reverse) that include a second 5’ universal sequence, whose reverse complement is detectable by the second probe. For each set of primers, either the forward or reverse primers comprise the 5’ universal sequence, but not both. Either or both sets of primers can comprise a plurality of different primers having different 3’ target-specific sequences allowing for different target nucleic acids within the same set of primers.40For example, in some embodiments, the mixture comprises: (a) a first set of forward primers comprising 3’ target-specific forward sequences and reverse primers comprising 3’ target-specific reverse sequences,wherein the forward primers orthe reverse primers of the first set further comprise a first 5’ universal sequence, wherein the first set targets a first plurality of different target nucleic acids, and a first set of the probe nucleic acids comprising (i) a first fluorophore, (ii) a first quencher, (iii) at least 25% (e.g., at least 50%), or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the first 5’ universal sequence and (iv) a least one5 ribonucleotide separating the fluorophore and the quencher; and (b) a second set of forward primers comprising 3’ target-specific forward sequences and reverse primers comprising 3’ target-specific reverse sequences, wherein the forward primers or the reverse primers of the second set further comprise a second 5’ universal sequence, wherein the second set targets a second plurality of different target nucleic acids, and a second set of the probe nucleic acids comprising (i) a second fluorophore, (ii) a second quencher, (iii) at10 least 25% (e.g., at least 50%), or at least 10 (e.g., at least 15, 20, 25 or more) nucleotides, or both, of the second 5’ universal sequence and (iv) a least one ribonucleotide separating the fluorophore and the quencher, such that first amplicons from the first set of forward and reverse primers and having the first 5’ universal sequence can be distinguished from second amplicons from the second set of forward and reverse primers and having the second 5’ universal sequence based on signal from the first set of the probe nucleic acids and15 the second set of the probe nucleic acids, respectively.The mixtures can further comprise a third, fourth, fifth, sixth or more sets of primers and probes like those above but targeting different target nucleic acids and having probes that detect different universal sequences as described herein, allowing for higher degrees of multiplexing.20Methods of Preparing Oligonucleotides for Simultaneous Detection by AmplificationDigital PCR (dPCR) assays are used for applications such as foetal fraction estimation and non-invasive prenatal testing (NIPT) assaying chromosome copy number, which require highly accurate detection and counting of target sequences in cell-free DNA (cfDNA). In recent years, multiplexing dPCR methodologies25 have emerged, wherein multiple target DNA sequences are able to be simultaneously detected within a single dPCR reaction. dPCR multiplexing requires the dPCR data to be separated at the analysis stage, wherein the extent of separation can be discriminating and / or non-discriminating at the target level.Current methods of multiplexing dPCR known in the art include: probe fluorophore-based multiplexing, in which30 one or more target sequence specific probes comprise a fluorophore, and each fluorophore has a unique excitation and emission spectra; amplitude-based multiplexing, in which the concentrations of dPCR amplification primers and dPCR probes are varied on a specific target sequence basis; and ratio-based multiplexing, in which the ratio of two or more target sequence specific probes labelled with fluorophores each emitting in different colour channels is varied for each specific target sequence.35In the context of dPCR NIPT applications, there is generally a limited amount of cfDNA available, and so highly accurate detection and counting of target sequences is required. For example, there may be, on average, about 3,000 genome equivalent copies extracted from one tube of sample (e.g. a blood sample), and from that between approximately 4 to 15% may be of foetal origin. In the prior art, therefore, a multitude of target loci40 per chromosome are interrogated in a single assay, which in some cases extends across more than one chromosome. However, amplification of multiple target sequences often results in unwanted side-reactions, such as primer dimers and primer-probe interactions which impact the performance of the assay. Furthermore,knowledge of the target cfDNA sequence is typically required in order to design dPCR assays, and for NIPT applications, for example, the 5’ and 3’ extremities of cfDNA generally vary within and across subjects, and this can affect the consistency of cfDNA copy number measurements and pose a challenge for dPCR assay design, particularly multiplexing assay design.5Disclosed herein is a novel method of preparing oligonucleotides for simultaneous detection by a multiplex amplification reaction, comprising the addition of oligonucleotides to target single stranded oligonucleotides, wherein the oligonucleotides comprise sequences which are configured to anneal to universal amplification primers during an amplification reaction, and optionally comprise universal probe sequences which are10 configured to anneal to universal oligonucleotide probes during an amplification reaction. Oligonucleotides prepared accordingly are suitable for amplification using universal primers and detection using universal probes. The method may be particularly useful for designing and performing high-order multiplexing of amplification reactions such as dPCR, e.g. droplet dPCR, and / or for qPCR.15 In aspects and embodiments of the method, the method comprises the preparation of single stranded oligonucleotides for detection by amplification, wherein the preparation comprises the addition of universal sequences to target single stranded oligonucleotides. Oligonucleotides prepared according to this disclosure are suitable for subsequent amplification using primers targeting the universal sequences added to target single stranded oligonucleotides, not specifically the sequence of the target single stranded oligonucleotide.20 Oligonucleotides prepared according to this disclosure may be detected using an oligonucleotide probe which may anneal to a universal sequence added to the prepared oligonucleotides, and / or which may anneal to a sequence of the target single stranded oligonucleotide, and which emits a detectable signal during any suitable amplification reaction, such as PCR. The signal originating from the probe mediated detection of a prepared oligonucleotide may be suitably processed to calculate the abundance of a target oligonucleotide in a sample,25 wherein the target single stranded oligonucleotides may be derived from a nucleotide sequence of interest, such as but not limited to, one or more specific chromosome loci, or an RNA originating from a specific gene.The method is suitable for use in digital amplification assays and also in real-time bulk amplification assays. Aspects and embodiments of the disclosure address various technical problems that may be faced by the30 skilled person in performing the prior art methods and systems, such as eliminating or at least reducing unwanted primer dimers and / or primer-probe interactions. In addition, aspects and embodiments of the disclosure are advantageous in enabling the design of primers to target variable cfDNA 5’ and 3’ ends in amplification reactions, and may reduce the number of primers and probes required during such amplification reactions. Accordingly, beneficial technical effects of the claimed invention may include one or more of: a35 reduction in the formation of primer dimers and / or primer-probe interactions, a reduction of the risk of inconsistent primer-target binding due to 5’ and 3’ end variability of target cfDNA, a reduction in subsequent amplification bias, and an increase in the probability to amplify target cfDNA. Thus, the claimed invention may advantageously lead to an improvement in the sensitivity and consistency of multiplexed amplification reactions comprising a detection step, which facilitates unprecedented levels of high-order multiplexing.40 Beneficially, in aspects and embodiments, the methods and systems of the disclosure may reduce primer and probe design constraints associated with short oligonucleotide sequences such as miRNA, for example, by the addition of universal sequences corresponding to the annealing portion of universal amplification primersand probes, which anneal during an amplification reaction. Furthermore, addition of the universal sequences is not constrained by the sequence or knowledge of the sequence of the 3’ or 5’ ends of a target sequence, which provides yet greater advantages for short target oligonucleotides. Moreover, addition of universal sequences may comprise a reaction wherein the sequence of the 3’ or 5’ end does not introduce design5 constraints, which is particularly beneficial for short target oligonucleotides with a limited sequence to design against.Suitable target oligonucleotidesThe term ‘target single stranded oligonucleotide’ refers to any single stranded oligonucleotide sequence10 originating from a sample suitable for use in the method. In embodiments, the target single stranded oligonucleotide may be derived from a single stranded oligonucleotide, a denatured non-linear single stranded oligonucleotide, or a denatured double stranded oligonucleotide, and may be a linear oligonucleotide or a circular oligonucleotide. In embodiments, the target single stranded oligonucleotide may be comprised of DNA, cDNA, or RNA, wherein the RNA may comprise a poly(A) tail such as an mRNA and / or may be a ncRNA such15 as a microRNA (miRNA), a small interfering RNA (siRNAs), or a piwi-interacting RNAs (piRNAs).The target single stranded oligonucleotide can be any length, wherein the length corresponds to the number of nucleotides constituting an oligonucleotide. In embodiments, the target single stranded oligonucleotide has a length of about 25, about 50, about 100, about 200, about 300, about 400, about 500, about 600, about 700,20 about 800, about 900, about 1000, or about 1500 nucleotides. In embodiments, the target single stranded oligonucleotide has a length between about 25 and 1500, between about 50 and 500, between about 50 and 300, or between about 100 and 200 nucleotides.The term ‘plurality of target single stranded oligonucleotides’ refers to two or more target single stranded25 oligonucleotides, wherein the two or more specific target single stranded oligonucleotides may comprise different sequences, and / or wherein the two or more target single stranded oligonucleotides may be derived from different genomic loci. In embodiments, two or more target single stranded oligonucleotides of the plurality of target single stranded oligonucleotides may be derived from a single chromosome, or may be derived from at least two different chromosomes. For example, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19,30 20, or more target single stranded oligonucleotides may be derived from one chromosome. In embodiments, the plurality of target single stranded oligonucleotides comprises between about 2 and 500, between about 3 and 300, between about 5 and 200, between about 10 and 150, between about 20 and 120, or between about 25 and 100 unique target single stranded oligonucleotides.35 In embodiments, the plurality of target single stranded oligonucleotides is obtained from a plurality of parent oligonucleotides. The plurality of parent oligonucleotides may be selected from, but is not limited to, a plurality of denatured double stranded or non-linear single stranded parent oligonucleotides; and / or a plurality of 3’ end homo-polynucleic acid-tailed parent oligonucleotides; and / or a plurality of parent oligonucleotides processed to reduce its length to obtain a plurality of target single stranded oligonucleotides having a desirable length.40In embodiments, the processing of the plurality of parent oligonucleotides to obtain a plurality of target single stranded oligonucleotides having a desirable length may comprise, but is not limited to, any of or anycombination of the following methods: digestion with at least one restriction enzyme, heat denaturing, fragmentase mediated shearing, size selection, and / or sonication.In embodiments, the at least one restriction enzyme may be selected from, but is not limited to, any of the5 following restriction enzymes: Acc65l, Acll, Aflll, Alul*, Apal, Avril, BamHI-HF, Bglll, BsoBI, BssSI-v2, CviAII, CviQI* Dpnll, Eael, EcoRI-HF, Fatl, Haelll*, Hindlll-HF*, Hinfl, Hpal, Hphl, Hpy188l, Hpy188lll, HpyCH4V, Kpnl-HF, Mfel-HF, Mscl, Msel*, Neil, Ncol-HF, Nlalll, Rsal, Sacl-HF, Sphl-HF, Tfil, and / or Xhol.In embodiments, the method may comprise dephosphorylation of the 3’ ends of the plurality of parent10 oligonucleotides, optionally wherein dephosphorylation is performed by shrimp alkaline phosphatase. In further embodiments, the method may comprise the addition of nucleotides to the 3’ ends of the plurality of parent oligonucleotides by an enzyme with terminal transferase activity, optionally wherein the nucleotides are thymine (T) and the addition is performed by a T-tailing enzyme, for example, a terminal deoxynucleotidyl transferase.15In embodiments, the target single stranded oligonucleotides of the plurality of target single stranded oligonucleotides have a length of up to about 25, up to about 50, up to about 100, up to about 200, up to about 300, up to about 400, up to about 500, up to about 600, up to about 700, up to about 800, up to about 900, up to about 1000, or up to about 1500 nucleotides.20In embodiments, the target single stranded oligonucleotides of the plurality of target single stranded oligonucleotides have a length of between about 25 and 1500, between about 50 and 1000, between about 50 to 500, between about 75 and 300, or between about 100 and 200 nucleotides.25 The term ‘fragmentase’ refers to an enzyme-based reagent that shears DNA to produce fragments of a desired size according to treatment duration. In embodiments, the fragmentase may be NEBNext® dsDNA Fragmentase®.In embodiments, the plurality of target single stranded oligonucleotides may comprise linear and / or circular30 oligonucleotides.Suitable samplesThe methods and systems disclosed herein may be performed on any suitable oligonucleotide derived from a sample wherein a target oligonucleotide sequence to be analysed is present. The disclosed methods and35 systems may be carried out on any one or more suitable oligonucleotides derived from samples that are known to contain or suspected to contain one or more target oligonucleotides. Alternatively, the invention may be carried out on one or more suitable oligonucleotides derived from samples to confirm the presence of one or more target oligonucleotides whose presence in the sample is unknown.40 The sample from which an oligonucleotide is derived may be a biological sample. The methods and systems disclosed herein may be carried out on an oligonucleotide derived from a sample obtained from or extracted from any organism. The organism or microorganism may be prokaryotic or eukaryotic and typically belongs toone of the five kingdoms: plantae, animalia, fungi, monera, and protista. The methods and systems disclosed herein may be carried out on an oligonucleotide derived from a sample obtained from or extracted from any virus.5 The sample is typically a fluid sample. Alternatively, where the sample is solid or semi-solid in origin, it may subsequently be treated to provide a fluid sample. Examples of such samples are faecal, skin, tissue, hair, bone and muscle. The sample may comprise a body fluid of a patient. The sample may be chosen for example from urine, blood, plasma, serum, lymph, saliva, interstitial fluid, tears, mucus or amniotic fluid. Typically, the sample is human in origin, but alternatively it may be from another animal, particularly a mammal, such as a10 mouse model organism, or from commercially farmed animals, such as horses, cattle, sheep, or pigs; or may alternatively be from pets such as cats or dogs.The sample may be a non-biological sample. The non-biological sample may be a fluid sample. Examples of a non-biological sample include surgical fluids, water such as drinking water, sea water or river water, and15 industrial samples such as reagents for laboratory tests, or samples obtained from the synthesis of a polymer reagent.In embodiments, one or more target single stranded oligonucleotides are derived from a blood sample, wherein the sample may comprise plasma and / or serum, and wherein the sample is derived from a pregnant female20 human subject, particularly wherein the sample comprises maternal and foetal cfDNA. The disclosed methods may be suitable for use with non-invasive samples as well as with invasive samples, such as from amniocentesis or CVS.Preparation of oligonucleotides for an amplification reaction25 The term ‘first oligonucleotide’ with respect to the present disclosure refers to an oligonucleotide comprising a 3’ sequence configured to anneal to a sequence of the at least one target single stranded oligonucleotide of the plurality of target single stranded oligonucleotides, and a first universal oligonucleotide probe sequence corresponding to an annealing portion of a first universal oligonucleotide probe, wherein the first universal oligonucleotide probe sequence of the first oligonucleotide is configured to anneal to a complementary30 sequence of the first universal oligonucleotide probe, and / or a first universal forward primer sequence corresponding to an annealing portion of a first universal forward amplification primer, wherein the first universal forward primer sequence of the first oligonucleotide is configured to anneal to a complementary sequence of the first universal forward amplification primer.35 In embodiments, a ‘3’ sequence configured to anneal to a sequence of the at least one target single stranded oligonucleotide’ may be configured to anneal to a sequence, for example, of a gene, a PCR product, or an RNA molecule, or in alternative embodiments, may be configured to anneal to a nucleotide homopolymer added to a parent oligonucleotide of the plurality of parent oligonucleotides.40 The term ‘universal oligonucleotide probe’ refers to an oligonucleotide probe configured to anneal to a complementary sequence of a universal oligonucleotide probe sequence of the first oligonucleotide. In embodiments, a first universal oligonucleotide probe refers to one or more universal oligonucleotide probewhich all share the same sequence configured to anneal to a complementary sequence of the first universal oligonucleotide probe sequence. In embodiments, a second universal oligonucleotide probe refers to one or more universal oligonucleotide probes which all share the same sequence that is different to the first universal oligonucleotide probes, and is configured to anneal to a second universal oligonucleotide probe sequence.5The term ‘universal RNAseH2 probe’ refers to an oligonucleotide probe, specifically a universal oligonucleotide probe, configured to anneal to a complementary sequence of a universal oligonucleotide probe sequence of the first oligonucleotide which comprises a fluorophore and a quencher moiety separated by a ribonucleotide, such that the signal from the fluorophore in an intact probe is relatively quenched compared to when the probe10 is cleaved at the ribonucleotide by the RNaseH2 enzyme. In embodiments, a first universal RNAseH2 probe refers to one or more universal RNAseH2 probe which all share the same sequence configured to anneal to a complementary sequence of the first universal RNAseH2 probe sequence. In embodiments, a second universal RNAseH2 probe refers to one or more universal RNAseH2 probes which all share the same sequence that is different to the first universal RNAseH2 probes, and is configured to anneal to a second15 universal RNAseH2 probe sequence.In embodiments, the term ‘non-universal oligonucleotide probe’ refers to an oligonucleotide probe, specifically a non-universal oligonucleotide probe, configured to anneal to a sequence of the sense single stranded oligonucleotide generated from denaturing at least one second double stranded oligonucleotide. In other20 words, the non-universal oligonucleotide probe is complementary to and anneals to a sequence of the target single stranded oligonucleotide.In embodiments, the term ‘non-universal RNAseH2 probe’ refers to an oligonucleotide probe which comprises a fluorophore and a quencher moiety separated by a ribonucleotide, such that the signal from the fluorophore25 in an intact probe is relatively quenched compared to when the probe is cleaved at the ribonucleotide by the RNaseH2 enzyme, which is configured to anneal to a sequence of the sense single stranded oligonucleotide generated from denaturing at least one second double stranded oligonucleotide. In other words, the non- universal RNAseH2 probe is complementary to and anneals to a sequence of the target single stranded oligonucleotide.30The term ‘universal oligonucleotide probe sequence’ refers to a sequence present in the universal oligonucleotide probe and which may be present in the first oligonucleotide. In embodiments, a first universal oligonucleotide probe sequence comprises a sequence different to a second universal oligonucleotide probe sequence, wherein the first universal oligonucleotide probe sequence and the second universal oligonucleotide35 probe sequence may be present in the same or different oligonucleotide, such as the first oligonucleotide.The term ‘universal RNAseH2 probe sequence’ refers to a sequence present in the universal RNAseH2 probe and which may be present in the first oligonucleotide. In embodiments, a first universal RNAseH2 probe sequence comprises a sequence different to a second universal RNAseH2 probe sequence, wherein the first40 universal RNAseH2 probe sequence and the second universal RNAseH2 probe sequence may be present in the same or different oligonucleotide, such as the first oligonucleotide.The term ‘universal forward primer sequence' in the context of the first oligonucleotide refers to a sequence present in both the universal forward primer sequence of the first oligonucleotide and the first universal forward amplification primer. In embodiments, a first universal forward primer sequence of the first oligonucleotide comprises a sequence different to a second universal forward primer sequence of the first oligonucleotide,5 wherein the second universal forward primer sequence of the first oligonucleotide is configured to anneal to a sequence complementary to a second universal forward amplification primer. In embodiments, one or more first oligonucleotides may comprise the first universal forward primer sequence and optionally the second universal forward primer sequence.10 The term ‘universal forward amplification primer’ refers to an oligonucleotide primer configured to anneal to a complementary sequence of a universal forward primer sequence of the first oligonucleotide. In embodiments, a first universal forward amplification primer refers to one or more universal forward amplification primers which all share the same sequence configured to anneal to a complementary sequence of the first universal forward primer sequence. In embodiments, a second universal forward amplification primer refers to one or more15 universal forward amplification primers which all share the same sequence that is different to the first universal forward amplification primers, and is configured to anneal to a second universal forward primer sequence.The term ‘first double stranded oligonucleotide’ refers to a double-stranded oligonucleotide produced by contacting a target single stranded oligonucleotide with a first oligonucleotide and synthesising a20 complementary strand to the target single stranded oligonucleotide by extending the first oligonucleotide along the sequence of the target single stranded oligonucleotide.In embodiments, the first double stranded oligonucleotide comprises a target strand, wherein the target strand comprises the sequence of the target single stranded oligonucleotide; and a complementary strand comprising25 a sequence complementary to the sequence of the target single stranded oligonucleotide, and the sequence of the first oligonucleotide.In embodiments, the same first oligonucleotide may be provided for contacting more than one specific target single stranded oligonucleotide of a plurality of target single stranded oligonucleotides, or wherein the same30 first oligonucleotide may be provided for contacting one target single stranded oligonucleotide of a plurality of target single stranded oligonucleotides.The term ‘second oligonucleotide’ refers to an oligonucleotide comprising a 3’ sequence configured to anneal to a sequence towards or at the 3' end of the complementary strand of the first double stranded oligonucleotide,35 and a first universal reverse primer sequence corresponding to an annealing portion of a first universal reverse amplification primer, wherein the first universal reverse primer sequence of the second oligonucleotide is configured to anneal to a complementary sequence of the first universal reverse amplification primer. In embodiments, the second oligonucleotide may comprise a first universal oligonucleotide probe sequence.40 The term ‘universal reverse primer sequence’ refers to a sequence present in both second oligonucleotide and the first universal reverse amplification primer. In embodiments, a first universal reverse primer sequence of the second oligonucleotide comprises a sequence different to a second universal reverse primer sequence ofthe second oligonucleotide, wherein the second universal reverse primer sequence of the second oligonucleotide is configured to anneal to a sequence complementary to a second universal reverse amplification primer. In embodiments, one or more second oligonucleotides may comprise the first universal reverse primer sequence.5The term universal reverse amplification primer’ refers to an oligonucleotide primer configured to anneal to a complementary sequence of a universal reverse primer sequence of the second oligonucleotide. In embodiments, a first universal reverse amplification primer refers to one or more universal reverse amplification primers which all share the same sequence configured to anneal to a complementary sequence10 of the first universal reverse primer sequence. In embodiments, a second universal reverse amplification primer refers to one or more universal reverse amplification primers which all share the same sequence that is different to the first universal reverse amplification primers, and is configured to anneal to a complementary sequence of the second universal reverse primer sequence.15 In embodiments, for example wherein one or more C nucleotides, optionally 3, are added to the 3’ end of the complementary strand by the reverse transcriptase during a reverse transcription reaction, the universal reverse amplification primer may comprise one or more G nucleotides configured to anneal to the one or more C nucleotides. In embodiments, for example, wherein a parent single stranded oligonucleotide has been digested with at least one restriction enzyme, the universal reverse amplification primer may comprise part of20 the sequence of the recognition and cleavage site of a specific restriction enzyme, e.g. the sequence of the target oligonucleotide that is produced after cleavage with the restriction enzyme. In embodiments, the universal reverse amplification primer may be configured to anneal to the sequence of a digested restriction enzyme site, which may beneficially reduce the generation of non-specific amplification products, which may arise from the annealing and extension of a TSO to one or more homopolymers of C nucleotides.25The term second double stranded oligonucleotide’ refers to an oligonucleotide which is predominantly double stranded and may comprise a region of single stranded nucleotides, such as a universal primer sequence.In aspects of the invention, the second double stranded oligonucleotide is produced by contacting the first30 double stranded oligonucleotide with at least one second oligonucleotide and synthesising a second double stranded oligonucleotide.In aspects and embodiments, the second double stranded oligonucleotide comprises: a target strand, comprising: the sequence of the target single stranded oligonucleotide, and the sequence of the second35 oligonucleotide; and a complementary strand, comprising: a sequence complementary to the sequence of the target single stranded oligonucleotide, and the sequence of the first oligonucleotide.In embodiments, the complementary strand of the second double stranded oligonucleotide may also comprise a sequence complementary to the second oligonucleotide.40In embodiments, the target strand of the second double stranded oligonucleotide may also comprise a sequence complementary to the first oligonucleotide.In embodiments, one or more first oligonucleotides may comprise the first universal forward primer sequence. In embodiments, a first universal forward primer sequence of the first oligonucleotide comprises a sequence different to a second universal forward primer sequence of the first oligonucleotide, wherein the second5 universal forward primer sequence corresponds to an annealing portion of a second universal forward amplification primer, wherein the second universal forward primer sequence of the first oligonucleotide is configured to anneal to a sequence complementary to the second universal forward amplification primer.In embodiments, one or more second oligonucleotides may comprise the first universal reverse primer10 sequence. In embodiments, a first universal reverse primer sequence ofthe second oligonucleotide comprises a sequence different to a second universal reverse primer sequence of the second oligonucleotide, wherein the second universal reverse primer sequence corresponds to an annealing portion of a second universal reverse amplification primer, wherein the second universal reverse primer sequence of the second oligonucleotide is configured to anneal to a complementary sequence of the second universal reverse15 amplification primer.In embodiments, the same second oligonucleotide may be provided for contacting more than one specific first double stranded oligonucleotide, or wherein the same second oligonucleotide may be provided for contacting all first double stranded oligonucleotides, wherein the second oligonucleotide may be a TSO.20In embodiments, the first universal forward primer sequence may be located at or towards the 5’ end of the first oligonucleotide, and / or the first universal reverse primer sequence may be located at or towards the 5’ end of the second oligonucleotide defined according to the invention.25 In embodiments, the 3’ end of the first oligonucleotide may be fully complementary or may be partially complementary to the sequence at or towards the 3’ end of the target single stranded oligonucleotide. In embodiments, the at least one first oligonucleotide comprises one or more base-pair mismatches with the partially complementary sequence of the at least one target single stranded oligonucleotide. In embodiments, the number of base-pair mismatches may be 1 , 2, 3, 4, 5, or 6.30In embodiments, the first oligonucleotide may anneal to a sequence at the 3’ end of the target single stranded oligonucleotide, wherein the sequence comprises at least the terminal nucleotide of the 3’ end of the target single stranded oligonucleotide, or may anneal to a sequence spaced one or more nucleotides from the 3’ end of the target single stranded oligonucleotide. In embodiments, the first oligonucleotide may anneal at least 1 ,35 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or more nucleotides from the 3’ end of the target single stranded oligonucleotide.In embodiments of the invention, the first double stranded oligonucleotide may comprise regions of double stranded nucleotides and regions of single stranded nucleotides, wherein the region of single stranded40 nucleotides may comprise a sequence corresponding to the first oligonucleotide. In embodiments, the sequence may comprise part of orall of the universal forward primer sequence ofthe first oligonucleotide, and,in embodiments, may also comprise part of or all of a universal oligonucleotide probe sequence of the first oligonucleotide.In embodiments, the 3’ end of the at least one second oligonucleotide may be fully complementary or may be5 partially complementary to the sequence at or towards the 3’ end of the complementary strand synthesised to the target single stranded oligonucleotide. In embodiments, the at least one second oligonucleotide comprises one or more base-pair mismatches with the partially complementary sequence of the (at least one) first double stranded oligonucleotide. In embodiments, the number of base-pair mismatches may be 1 , 2, 3, 4, 5, or 6, wherein the base-pair mismatches may be contiguous or non-contiguous.10In embodiments, the second oligonucleotide may anneal to a sequence at the 3’ end of the complementary strand synthesised to the target single stranded oligonucleotide, wherein the sequence comprises at least the terminal nucleotide of the 3’ end of the complementary strand, or may anneal to a sequence spaced one or more nucleotides from the 3’ end of the complementary strand. In embodiments, the second oligonucleotide15 may anneal at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or more nucleotides from the 3’ end of the complementary strand to the target single stranded oligonucleotide.In embodiments, the second double stranded oligonucleotide is synthesised by extending the complementary strand of the first double stranded oligonucleotide along the second oligonucleotide; i.e. by extending the20 complementary strand along the overhanging sequence of the second oligonucleotide.In other embodiments, the second double stranded oligonucleotide is synthesised by extending the second oligonucleotide along the complementary strand of the first double stranded oligonucleotide, wherein the oligonucleotide sequence synthesised comprises a sequence complementary to the complementary strand.25In embodiments, the second double stranded oligonucleotide may comprise regions of double stranded nucleotides and regions of single stranded nucleotides, wherein the region of single stranded nucleotides may comprise a sequence of the first oligonucleotide, wherein the sequence may comprise part of or all of the universal forward primer sequence of the first oligonucleotide, and in embodiments, may also comprise part of30 or all of a universal oligonucleotide probe sequence of the first oligonucleotide. In embodiments, the region of single stranded nucleotides of the second double stranded oligonucleotide may comprise a sequence of the second oligonucleotide, wherein the sequence may comprise part of or all of the universal reverse amplification primer of the second oligonucleotide, and in embodiments, may also comprise part of or all of a universal oligonucleotide probe sequence of the second oligonucleotide.35In embodiments, for example wherein a target single stranded oligonucleotide comprises a polyA tail, such as a target single stranded oligonucleotide comprising mRNA, a first oligonucleotide may comprises a poly(T) sequence.40 The term ‘extending the [...] along the sequence of’ refers to the synthesis of a sequence complementary to a target template sequence, wherein the complementary sequence is synthesised along the sequence of the target template sequence. In embodiments, extending the complementary strand of the at least one first doublestranded oligonucleotide along the second oligonucleotide comprises synthesis of a sequence complementary to the second oligonucleotide, thereby generating at least one second double stranded oligonucleotide longer than the first double-stranded oligonucleotide. In embodiments, extending the second oligonucleotide along the complementary strand of the first double stranded oligonucleotide comprises synthesis of a sequence5 complementary to the complementary strand of the first double stranded oligonucleotide, thereby generating a second double stranded oligonucleotide.In embodiments, the complementary strand to the target oligonucleotide may be synthesised by a reverse transcription reaction, in order to generate the first double stranded oligonucleotide. The reverse transcription10 reaction may comprise a reverse transcriptase with terminal C transferase activity, such as MuMLV. In such embodiments, one or more C nucleotides may be added to the 3’ end of the complementary strand by the reverse transcriptase during reverse transcription. In embodiments, the second oligonucleotide may be a template switching oligo (TSO).15 The term ‘template switching oligo’ (TSO) for the purposes of the invention refers to an oligonucleotide comprising one or more nucleotides configured to anneal to an overhanging nucleotide sequence of the complementary strand of the first double stranded oligonucleotide. In embodiments, the overhanging nucleotide sequence is synthesised by a reverse transcription reaction comprising a reverse transcriptase (RT) with terminal nucleotide transferase activity, such as MuMLV. In this way, one or more nucleotides can be20 added to the 3’ end of a synthesised complementary strand of a target single stranded oligonucleotide during a reverse transcription reaction. Without wishing to be bound by a specific theory, the annealing of a TSO to the overhanging one or more nucleotides enables the RT to extend the sequence of the complementary strand of the first double stranded oligonucleotide by synthesising a sequence complementary to the TSO.25 In embodiments, the second oligonucleotide is a TSO, wherein the 3’ sequence configured to anneal to a sequence towards or at the 3’ end of the complementary strand of the first double stranded oligonucleotide is a sequence complementary to at least part of the one or more overhanging nucleotides added to the complementary strand by a reverse transcriptase (RT) with terminal nucleotide transferase activity during synthesis of the first double stranded oligonucleotide. In embodiments, the universal reverse amplification30 primer anneals to the complementary sequence of the template switching oligo.In embodiments, the sequence of the TSO complementary to at least part of the one or more overhanging nucleotides, e.g. as may be added by a reverse transcriptase, may comprise one or more 3’ G bases; typically three 3' G bases. In embodiments, the 3’ G bases may be modified or may be RNA or LNA bases. In35 embodiments, the sequence of the TSO complementary to at least part of the one or more overhanging nucleotides, e.g. added by a reverse transcriptase, comprises a rGrGrG at the 3’ end, which anneals to the overhanging C nucleotides.In embodiments, the TSO comprises a 5’ end biotin moiety, and / or one or more 5’ end abasic sites. In40 embodiments, the TSO comprises a blocked 3’ end, wherein the 3’ end may be blocked with a C3 spacer.In embodiments, synthesising the second double stranded oligonucleotide comprises annealing one or more 3’ G bases of the TSO to one or more terminal 3’ C bases of the complementary strand of the first double stranded oligonucleotide and extending the complementary strand using a polymerase to synthesise a sequence complementary to the TSO.5In embodiments wherein the second oligonucleotide is a TSO, and the universal reverse amplification primer is configured to anneal to the complementary sequence of the TSO, the universal reverse amplification primer may comprise any of SEQ IDs NO. 1 to 6.10 In embodiments, the 3’ ends of the plurality of target single stranded oligonucleotides may be dephosphorylated, wherein dephosphorylation is performed by shrimp alkaline phosphatase. In embodiments, one or more T nucleotides may be added to the 3’ ends of the target single stranded oligonucleotides by T- tailing, wherein T-tailing is performed by a T-tailing enzyme, such as, but not limited to, a terminal deoxynucleotidyl transferase. In embodiments the first oligonucleotide may comprise a poly(A) sequence15 which anneals to one or more 3’ T nucleotides of a target single stranded oligonucleotide.In embodiments, one or more T nucleotides are added to the 3’ end of the complementary strand of the first double stranded oligonucleotide by T-tailing. In embodiments, the at least one first double stranded oligonucleotide is denatured to produce at least one single stranded target strand oligonucleotide comprising20 the sequence of the target single stranded oligonucleotide, and at least one single stranded complementary strand comprising the sequence of the complementary strand to the target single stranded oligonucleotide. In embodiments, one or more T nucleotides are added to the 3’ end of the complementary strand by T-tailing.In embodiments, the second oligonucleotide comprises a poly(A) sequence configured to anneal to the one or25 more T nucleotides added to the complementary strand of the first double stranded oligonucleotide or the (denatured) single stranded complementary strand by T-tailing. In embodiments, wherein the second oligonucleotide comprises a poly(A) sequence, the universal reverse amplification primer may comprise any of SEQ IDs NO. 7 to 12.30 Oligonucleotide ProbesProbes suitable for use in the method include fluorescent probes, such as Taqman™ probes. Such probes may require hydrolysis by a 5' to 3' exonuclease activity of a DNA polymerase to separate a fluorescent moiety of the probe from a quenching moiety in the structure of the probe, in order to allow generation of a fluorescent signal during amplification. Any suitable probe may be used. For example, suitable fluorescent probes include35 molecular beacons, which comprise a stem-loop structure increasing the binding specificity of the probe to its target. During an annealing step of an amplification reaction, the loop portion of the molecular beacon probe may anneal to a target sequence, thereby denaturing the stem and separating a fluorescent moiety from a quenching moiety, resulting in detectable fluorescence from the fluorescent moiety. Further suitable fluorescent probes include RNaseH2 activated probes (e.g. as disclosed in US application No. 18 / 370,566,40 which is hereby incorporated by reference), which comprises a fluorophore and a quencher moiety separated by a ribonucleotide, such that the signal from the fluorophore in an intact probe is relatively quenched compared to when the probe is cleaved at the ribonucleotide by the RNaseH2 enzyme.In embodiments, at least one of the one or more universal oligonucleotide probes may be a linear probe, and / or at least one of the one or more oligonucleotide probes may form a stem-loop. In embodiments, a stem-loop may comprise, from 5' to 3': a first stem sequence, a loop sequence, and a second stem sequence that is the5 reverse complement of the first stem sequence. In embodiments, a stem-loop sequence of a universal oligonucleotide probe may anneal to the complementary sequence of the first oligonucleotide probe sequence as defined by the invention, and / or may anneal to a complementary sequence of a universal forward primer sequence of the first oligonucleotide.10 In embodiments, at least one of the one or more non-universal oligonucleotide probes may be a linear probe, and / or at least one of the one or more oligonucleotide probes may form a stem-loop as described above. In embodiments, a stem-loop sequence of a non-universal oligonucleotide probe may anneal to the strand of the second double stranded oligonucleotide comprising substantially the sequence of the target single stranded oligonucleotide, and / orthe sense single stranded oligonucleotide (comprising the sequence of the target single15 stranded oligonucleotide). In embodiments, a stem-loop sequence of a non-universal oligonucleotide probe may anneal to the complementary strand of the second double stranded oligonucleotide (i.e. the strand of the second double stranded oligonucleotide which is (substantially) complementary to the target strand sequence) and / or the antisense (or complementary) single stranded oligonucleotide (comprising the sequence of the complementary strand to the target single stranded oligonucleotide, which is (substantially) complementary to20 the target strand sequence).In embodiments, the oligonucleotide probe is a universal RNaseH2 probe. In embodiments, the oligonucleotide probe is a non-universal RNaseH2 probe.25 In embodiments, at least one of the one or more universal oligonucleotide probes anneal to the first oligonucleotide according to this disclosure, and / or at least one of the one or more oligonucleotide probes anneal to the second oligonucleotide according to this disclosure.In embodiments, the term ‘a first universal oligonucleotide probe’ refers to one or more universal30 oligonucleotide probes which all share the same oligonucleotide sequence, and are configured to anneal to the complementary sequence of a first universal oligonucleotide probe sequence of a first oligonucleotide or second oligonucleotide, or to the sense single stranded oligonucleotide generated from denaturing the second double stranded oligonucleotide. In embodiments, a first universal oligonucleotide probe is configured to anneal to the complementary sequence of a first universal oligonucleotide probe sequence in the second35 double stranded oligonucleotide, wherein the first universal oligonucleotide probe sequence does not correspond to a sequence of the target single stranded oligonucleotide.The term ‘a second universal oligonucleotide probe’ refers to one or more universal oligonucleotide probes which all share the same sequence that is different to the first universal oligonucleotide probe, and is40 configured to anneal to a sequence that is complementary to the second universal oligonucleotide probe sequence of a first oligonucleotide or second oligonucleotide.In embodiments, the term ‘a first non-universal oligonucleotide probe’ refers to one or more non-universal oligonucleotide probes which all share the same oligonucleotide sequence configured to anneal to a sequence of the sense single stranded oligonucleotide generated from denaturing at least one second double stranded oligonucleotide. In otherwords, the first non-universal oligonucleotide probe is complementary to and anneals5 to a sequence of the target single stranded oligonucleotide.The term ‘second non-universal oligonucleotide probe’ refers to one or more non-universal oligonucleotide probes which all share the same sequence that is different to the first non-universal oligonucleotide probe, and which is configured to anneal to a different sequence of the sense single stranded oligonucleotide generated10 by denaturing at least one second double stranded oligonucleotide.In embodiments, the term ‘a first non-universal RNAseH2 probe’ refers to one or more non-universal RNAseH2 probes which all share the same oligonucleotide sequence configured to anneal to a sequence of the sense single stranded oligonucleotide generated from denaturing at least one second double stranded15 oligonucleotide. In other words, the first non-universal RNAseH2 probe is complementary to and anneals to a sequence of the target single stranded oligonucleotide.The term ‘second non-universal RNAseH2 probe’ refers to one or more non-universal RNAseH2 probes which all share the same sequence that is different to the first non-universal RNAseH2 probe, and which is configured20 to anneal to a different sequence of the sense single stranded oligonucleotide generated by denaturing at least one second double stranded oligonucleotide.In embodiments, the term ‘a first fluorophore’ refers to one or more fluorophores of the universal or non- universal oligonucleotide probes which are identical. The term ‘second fluorophore’ refers to one or more25 fluorophores of the universal or non-universal oligonucleotide probes which are identical to each other, but are different to the first fluorophore. For example, the first and second fluorophores may have different excitation and emission spectra. In embodiments, the selection of a desired fluorophore may be based on the specific target single stranded oligonucleotide sequence. In embodiments, a first and second universal or non-universal oligonucleotide probe may comprise the same first fluorophore, or may comprise a first and second fluorophore30 (which are different), respectively.In embodiments, the term ‘a first population of universal oligonucleotide probes’ refers to one or more universal oligonucleotide probes comprising the first fluorophore, wherein the first population may include a first, second, third, fourth, fifth, or more universal oligonucleotide probe each of a different sequence. The term ‘a second35 population of universal oligonucleotide probes’ refers to one or more universal oligonucleotide probes comprising the second fluorophore, wherein the second population may include a first, second, third, fourth, fifth, or more universal oligonucleotide probe each of a different sequence.In embodiments, a first and second population of universal oligonucleotide probes are configured to anneal to40 different single stranded oligonucleotides. In embodiments, the first population of universal oligonucleotide probes is configured to anneal to sequences of target single stranded oligonucleotides derived from a specificchromosome, and the second population of universal oligonucleotide probes is configured to anneal to sequences of target single stranded oligonucleotides derived from a different specific chromosome.In embodiments, universal oligonucleotide probes may be mutually exclusive between different populations of5 universal oligonucleotide probes; for example, a first population of universal oligonucleotide probes may have a first universal oligonucleotide probe and a third universal oligonucleotide probe, and a second population of universal oligonucleotide probes may have a second universal oligonucleotide probe and a fourth universal oligonucleotide probe.10 In embodiments, the method comprises at least two populations of universal oligonucleotide probes for targeting a corresponding plurality (e.g. at least two) different chromosomes; for example, the at least two populations of universal oligonucleotide probes may include up to 20, up to 12, up to 10, up to 8, up to 6, or up to 4 different populations of universal oligonucleotide probes for targeting a corresponding number of different chromosomes.15In embodiments, the term ‘a first population of non-universal oligonucleotide probes’ refers to one or more non-universal oligonucleotide probes comprising the first fluorophore, wherein the first population may include a first, second, third, fourth, fifth, or more non-universal oligonucleotide probe, wherein each includes a different nucleotide sequence and hence, a different target binding sequence. The term ‘a second population20 of non-universal oligonucleotide probes’ refers to one or more non-universal oligonucleotide probes comprising the second fluorophore, wherein the second population may include a first, second, third, fourth, fifth, or more non-universal oligonucleotide probe, wherein each includes a different nucleotide sequence and hence, a different target binding sequence. In embodiments, a first and second population of non-universal oligonucleotide probes may be configured to anneal to different single stranded oligonucleotides. In25 embodiments, the first population of non-universal oligonucleotide probes is configured to anneal to target single stranded oligonucleotides derived from a specific chromosome, and the second population of non- universal oligonucleotide probes is configured to anneal to target single stranded oligonucleotides derived from a different specific chromosome.30 In embodiments, non-universal oligonucleotide probes may be mutually exclusive between the populations of non-universal oligonucleotide probes; for example, a first population of non-universal oligonucleotide probes has a first non-universal oligonucleotide probe and a third non-universal oligonucleotide probe, and a second population of a non-universal oligonucleotide probes has a second non-universal oligonucleotide probe and a fourth non-universal oligonucleotide probe. In embodiments, the method comprises at least two populations of35 non-universal oligonucleotide probes for targeting a corresponding plurality of different chromosomes; for example, the at least two populations of non-universal oligonucleotide probes include up to 20, up to 12, up to 10, up to 8, up to 6, or up to 4 different populations of non-universal oligonucleotide probes for targeting a corresponding number of different chromosomes.40 In embodiments, the universal oligonucleotide probe anneals to the complementary sequence of a universal oligonucleotide probe sequence located at or towards the 5’ end of the first oligonucleotide. In embodiments, the universal oligonucleotide probe anneals to the complementary sequence of a universal oligonucleotideprobe sequence located at or towards the 5' end of the second oligonucleotide. In embodiments, the template switching oligo may comprises a universal oligonucleotide probe sequence. In embodiments, a universal oligonucleotide probe anneals to the sequence complementary to a universal oligonucleotide probe sequence of the template switching oligo.5In embodiments, a first universal oligonucleotide probe may be configured to anneal to the complementary sequence of a universal forward primer sequence of the first oligonucleotide. In embodiments, a first universal oligonucleotide probe may be configured to anneal to the sequence complementary to a universal reverse primer sequence of the second oligonucleotide.10Reaction mixturesIn embodiments, the reaction mixture may comprise the plurality of target single stranded oligonucleotides, at least one first oligonucleotide, at least one second oligonucleotide, at least one first universal forward amplification primer, at least one first universal reverse amplification primer; and at least one universal15 oligonucleotide probe and / or at least one non-universal oligonucleotide probe.In embodiments, the preparation of oligonucleotides and the amplification of second double stranded oligonucleotides may be performed in a stepwise manner, for example, wherein a first step comprises preparation of the oligonucleotides, comprising the generation of at least one second double stranded20 oligonucleotide from the plurality of target single stranded oligonucleotides, and wherein a second step comprises the amplification reaction of the at least one second double stranded oligonucleotide. In embodiments wherein the method is performed in a stepwise manner, the reaction mixture may comprise the plurality of target single stranded oligonucleotides, at least one first oligonucleotide, and at least one second oligonucleotide. In embodiments wherein the method is performed in a stepwise manner, the reaction mixture25 may further comprise at least one second double stranded oligonucleotide, at least one first universal forward amplification primer, at least one first universal reverse amplification primer, at least one universal oligonucleotide probe, and / or at least one non-universal oligonucleotide probe; wherein the at least one first universal forward amplification primer, at least one first universal reverse amplification primer, and at least one universal oligonucleotide probe and / or at least one non-universal oligonucleotide probe are provided after the30 generation of at least one second double stranded oligonucleotide. In embodiments, the method may be performed as a one-pot reaction.Once formed, the reaction mixture may be submitted to conditions to allow generation of a suitable target single stranded oligonucleotide, such as a denaturing step. The reaction mixture may be submitted to35 conditions for primer annealing, such as a first oligonucleotide or second oligonucleotide, and extension using one or more primers that anneal to a target oligonucleotide to be detected. The reaction mixture may be submitted to primer extension conditions, which can be, but is not limited to, conditions suitable for PCR, allowing a primer to anneal to the target oligonucleotide or prepared oligonucleotide, if present, and be extended by a polymerase in a template specific manner, which may be repeated for one or more cycles. The40 amplification reaction can be monitored for oligonucleotide probe signals at an end-point or in real time, i.e. , continuously or every cycle.Partitioning of reaction mixtures and amplification reactionsIn embodiments, the method may be performed in bulk as a single reaction mixture, or may be performed in two or more reaction mixtures, wherein two or more reaction mixtures may comprise two or more partitions comprising the reaction mixture.5In embodiments, both the generation of one or more second double stranded oligonucleotides suitable for use in an amplification reaction and the amplification reaction itself occur in the same partition. In embodiments, a partition may comprise the reaction mixture, constituting a partition comprising the reaction mixture, or may comprise a partial reaction mixture comprising some but not all of the necessary reagents and components10 required to perform the method, or may be empty. In embodiments, the generation of at least one second double stranded oligonucleotide may occur in bulk or in a single reaction, priorto the partitioning of the at least one second double stranded oligonucleotide and reaction mixture, wherein the amplification reaction occurs in a partition.15 Amplification reactions and detection of amplification products and probe signalsIn embodiments, the plurality of oligonucleotide amplification products is produced from a population of second double stranded oligonucleotides, wherein a first population of second double stranded oligonucleotides may have been generated from a plurality of different target single stranded oligonucleotides, e.g. which are derived from 2 or more, 5 or more, 10 or more, e.g. at least 20 different genomic targets on one chromosome. In20 embodiments, a second population of second double stranded oligonucleotides may have been generated from a plurality of different target single stranded oligonucleotides, e.g. which are derived from 2 or more, 5 or more, 10 or more, e.g. at least 20 different genomic targets on a different chromosome to the first population of second double stranded oligonucleotides. As such, in aspects and embodiments of the disclosure, the population of second double stranded oligonucleotides may comprise at least a first sub-population of second25 double stranded oligonucleotides that have the same sequence (i.e. synthesised from target single stranded oligonucleotides derived from the same genomic target), and a second sub-population of second double stranded oligonucleotides that have the same sequence, but which sequence is different to the sequence of the first sub-population of second double stranded oligonucleotides, wherein the second sub-population of second double stranded oligonucleotides is derived from a target single stranded oligonucleotide30 corresponding to a different genomic target, which is the same target for all second double stranded oligonucleotides of the second sub-population.As will be appreciated, the plurality of second double stranded oligonucleotides may comprise one or more, such as between 1 and 23 populations of second double stranded oligonucleotides. As will be appreciated,35 the plurality of second double stranded oligonucleotides may comprise two or more, such as between 2 and about 150, between about 2 and about 100, between about 2 and about 50, or between about 2 and about 25 sub-populations of second double stranded oligonucleotides.In embodiments, 2 or more, 4 or more, 6 or more, 8 or more, 10 or more, 12 or more, 14 or more, 16 or more,40 18 or more, or 20 or more sub-populations of second double stranded oligonucleotides may be present in a population of second double stranded oligonucleotides.In embodiments, amplification products comprising a sequence of the at least one target single stranded oligonucleotide from a first chromosome may be detected by a first signal of the plurality of probe signals and amplification products comprising sequence of the at least one target single stranded oligonucleotide from a second chromosome are detected by a second signal of the plurality of probe signals.5In embodiments, a first signal ofthe plurality of probe signals and amplification products may be distinguishable from a second signal of the plurality of probe signals. In embodiments, a first signal of the plurality of probe signals may originate from target single stranded oligonucleotides derived from a different specific chromosome to the chromosome from which target single stranded oligonucleotides which a second signal of10 the plurality of probe signals may originate from.In embodiments, a first, second, third, fourth, fifth or more signals of the plurality of probe signals and amplification products may be generated. In embodiments, a plurality of probe signals and amplification products may comprise at least about 10, at least about 20, at least about 40, at least about 60, at least about15 80, at least about 100, at least about 120, or at least about 150 signals of the plurality of probe signals and amplification products.In embodiments, a first universal forward amplification primer is provided for the amplification of one subpopulation of second double stranded oligonucleotides, or at least one sub-population of second double20 stranded oligonucleotides. In embodiments, all second double stranded oligonucleotides of a population of second double stranded oligonucleotides may be amplified by a first universal forward amplification primer.In embodiments, a first universal reverse amplification primer is provided for the amplification of one subpopulation of second double stranded oligonucleotide, or at least one sub-population of second double25 stranded oligonucleotides. In embodiments, all second double stranded oligonucleotides of a population of second double stranded oligonucleotides may be amplified by a first universal reverse amplification primer.In embodiments, at least one specific amplification product derived from a first sub-population of second double stranded oligonucleotide is distinguishable from at least one other amplification product derived from a30 second sub-population of second double stranded oligonucleotides. In embodiments, at least one specific amplification product of the plurality of oligonucleotide amplification products is distinguishable from at least one other specific amplification product, wherein at least one specific amplification product originating from a specific chromosome of the plurality of oligonucleotide amplification products may be distinguishable from at least one other specific amplification product from a different specific chromosome. In embodiments, the35 plurality of distinguishable amplification products may be at least about 10, at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, or at least about 150.In embodiments, about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or 120 different amplification products (obtained from amplification of a corresponding number of sub-populations of second double stranded40 oligonucleotides) are detected simultaneously. In embodiments, the universal oligonucleotide probes are molecular beacon probes. In embodiments about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 differentamplification products are detected simultaneously. In embodiments, the non-universal oligonucleotide probes are TaqMan probes.In embodiments, a detection reagent or a detectable label in the partitions, such as an oligonucleotide probe,5 can be detected using any suitable detector device. Exemplary detection methods include optical detection (e.g., fluorescence, or chemiluminescence). As a non-limiting example, a fluorescent label can be detected using a detector device equipped with a module to generate excitation light that can be absorbed by a fluorophore, as well as a module to detect light emitted by the fluorophore. In embodiments, the detector further comprises handling capabilities forthe partitioned samples (e.g., droplets), with individual partitioned samples10 entering the detector, undergoing detection, and then exiting the detector. In embodiments, partitioned samples (e.g., droplets) can be detected serially while the partitioned samples are flowing. In embodiments, partitioned samples (e.g., droplets) are arrayed on a surface and a detector moves relative to the surface, detecting signal(s) at each position containing a single partition. Examples of detectors are provided in e.g. WO 2010 / 036352, the contents of which are incorporated herein by reference. In embodiments, detectable15 labels in partitioned samples can be detected serially without flowing the partitioned samples (e.g., using a chamber slide). Following acquisition of fluorescence detection data, a general-purpose computer system (e.g. which may be referred to as a ‘host computer’) can be used to store and process the data.In embodiments, as one or more copies of the sense single stranded oligonucleotide derived from denaturing20 one or more second double stranded oligonucleotides are generated during the amplification reaction, the universal or non-universal oligonucleotide probe will anneal to the sense single stranded oligonucleotide. In embodiments, the annealed oligonucleotide universal or non-universal oligonucleotide probe may be cleaved by an enzyme, wherein cleavage results in separation of the fluorophore and a quencher, or wherein the annealing of the universal or non-universal oligonucleotide probe results in separation of the fluorophore and25 a quencher, resulting in a detectable fluorescent signal. In embodiments, the enzyme may be, but is not limited to, a DNA polymerase such as Taq polymerase. In embodiments, wherein the probe is a RNaseH2 activated probe according to US application No. 18 / 370,566, an RNase H2 enzyme may cleave the probe at a ribonucleotide sequence of the RNaseH2 activated probe. The quantity of this signal can indicate the quantity or at least presence of the target nucleic acid in a bulk reaction, or alternatively, if the reaction is in partitions,30 the number of partitions having a signal above a selected threshold detection value may be proportional to the quantity of a target single stranded oligonucleotide or second double stranded oligonucleotide derived from a specific target single stranded oligonucleotide in a sample. In embodiments, the amount of target oligonucleotides and number of partitions is selected such that at least some partitions are empty as dictated by a Poisson distribution.35In embodiments the concentration of the universal reverse amplification primer may be higher than the concentration of the universal forward amplification primer. In embodiments, the universal reverse amplification primer may be present at a concentration at least about 1.2, 1.5, 2, 3, 5, 10, 20, or 50-fold higher than the universal forward amplification primer. As an example, in embodiments, the universal forward amplification40 primer may have a concentration of between about 50 and 200 nM (e.g., about 90 or 100 nM) and the universal reverse amplification primer is provided at a concentration of between about 500 and 2000 nM (e.g., about 900 or 1000 nM). In aspects and embodiments, such proportions may be beneficial for generating an excessof the sense single stranded oligonucleotide of the denatured second double stranded oligonucleotide. Amplified sense single stranded oligonucleotides comprise the complement of the universal oligonucleotide probe sequence, and / or the complement of the universal forward primer sequence, either or both of which the universal oligonucleotide probe may anneal to during the amplification reaction, and the sequence of a target5 single stranded oligonucleotide, to which a non-universal oligonucleotide probe anneals to during the amplification reaction, thus enabling detection of the prepared oligonucleotide.In embodiments, multiplexing of the reaction may comprise the first and second oligonucleotides added to the target single stranded oligonucleotides having different universal oligonucleotide probe sequences, allowing10 forthe use of different oligonucleotide probes comprising different coloured fluorophores in the same reaction. In embodiments, multiplexing of the reaction may comprise first oligonucleotides added to the target single stranded oligonucleotide having different universal forward primer sequences, allowing for the use of multiple different universal forward amplification primers in the same reaction, i.e. a first, second or more universal forward amplification primers. In embodiments, multiplexing of the reaction may comprise second15 oligonucleotides added to the target single stranded oligonucleotide having different universal reverse primer sequences, allowing for the use of multiple different universal reverse amplification primers in the same reaction, e.g. first, second or more universal reverse amplification primers. In these ways, a high number of different amplification reactions can be performed and monitored in e.g. a single reaction mixture and amplification reaction. In embodiments, 2 or more, 3 or more, 4 or more, 5 or more, or 6 or more (e.g. six)20 distinguishable probes may be used. In such embodiments, each distinguishable probe sequence may anneal to up to 2, up to 5, up to 10, or up to 20 (e.g. 20) different target second double stranded oligonucleotides during an amplification reaction, wherein each set of e.g. 20 different target second double stranded oligonucleotides is amplified with one universal forward amplification primer. For example, wherein 6 distinguishable probes are used and wherein each distinguishable probe sequence is capable of annealing to25 20 different target second double stranded oligonucleotides, 120 target second double stranded oligonucleotides may be amplified and detected using only a single sequence of universal reverse amplification primer (in combination with appropriate universal forward amplification primers)In embodiments wherein the plurality of single stranded oligonucleotides is derived from a cfDNA sample30 containing maternal and foetal DNA from a pregnant human subject, the methods and systems of the disclosure may comprise estimating the fraction of foetal DNA in a cfDNA sample. In embodiments, the methods and systems may comprise estimating the copy number of one or more chromosomes, such as any, or any combination of, but not limited to, the following: chromosome 21 , chromosome 18, chromosome 13, chromosome 22q, chromosome X, and chromosome Y.35In embodiments, the methods and systems may comprise estimating the copy number of one or more chromosomes or loci associated with a disease, such as any, or any combination of, but not limited to, the following: Down’s syndrome, Edwards’ syndrome, and Patau syndrome.40 The disclosed methods can be used with non-invasive samples as well as with invasive samples (e.g., from amniocentesis or CVS). In embodiments, the samples may be obtained from an invasive method. In embodiments, the samples may be obtained from a non-invasive method.In embodiments, the sample may comprise on average 3,000 genome equivalent copies extracted from 1 tube of blood, and from that about 4 to about 15% may be of foetal origin.5 Target genomic regions and corresponding primers and probes for performing prenatal testing assays Target genomic regions and corresponding primers and probes for performing prenatal testing assays are disclosed herein. Such primers and probes are suitable for the simultaneous amplification and analysis of multiple genetic markers across different chromosomes, e.g. to assess chromosomal copy number variations in foetal DNA.10Aneuploidy, defined as an abnormal number of chromosomes, is a major cause of developmental disorders and pregnancy complications. Common aneuploidies include trisomy 21 (Down syndrome), trisomy 18 (Edwards syndrome), and trisomy 13 (Patau syndrome). Prenatal detection of these chromosomal abnormalities is critical for informing parents about potential outcomes and enabling timely medical decision¬15 making.Conventional methods for detecting aneuploidy, such as karyotyping or fluorescence in situ hybridization (FISH), are effective but require invasive sampling methods like amniocentesis or chorionic villus sampling (CVS). Advances in non-invasive prenatal testing (NIPT) now allow the analysis of cell-free foetal DNA (cfDNA)20 from maternal blood using a PCR-based assay.As disclosed herein, the term “PCR-based assay” refers to any molecular diagnostic techniques that comprise, or consist essentially of, the use of polymerase chain reaction (PCR), which includes, but is not limited to: dPCR, droplet dPCR, and qPCR.25In some embodiments, the amplification reaction is a droplet digital PCR reaction. Methods for performing PCR in droplets are described, for example, in US 2014 / 0162266, US 2014 / 0302503, and US 2015 / 0031034, the contents of each of which is incorporated by reference. In some embodiments, the QX200, QX600, or QX One Droplet Digital PCR (ddPCR) System (Bio-Rad) is used.30Notably, single-plex PCR-based assays, which analyse only one chromosomal target at a time, are often insufficient for detecting aneuploidies due to their limited scope and inability to detect simultaneous abnormalities. A multiplex PCR-based assay offers the ability to detect multiple chromosomal targets in a single reaction, allowing for the analysis of multiple chromosomal regions (e.g., loci on chromosomes 21 , 18,35 13, X, and Y) in a single reaction. This capability is essential for screening multiple aneuploidies simultaneously, increasing diagnostic yield while minimizing the number of reactions required, and thus provides a more comprehensive and efficient approach to prenatal testing for aneuploidy. As such, by combining multiple primer-probe sets in one reaction, the multiplex assay reduces reagent usage, labour, and time compared to running separate single-plex assays for each chromosome. This makes the assay more40 cost-effective and scalable for high-throughput clinical settings.Multiplex PCR assays also exhibit comparatively higher sensitivity and specificity by leveraging highly specific primers and probes to amplify target regions uniquely associated with the chromosomes of interest, which minimizes the risk of false positives or negatives, particularly in the context of low-abundance cfDNA in maternal plasma. Furthermore, multiplex assays beneficially require a comparatively reduced amount of5 cfDNA for analysis given that all targeted loci are amplified simultaneously, which is advantageous given the low concentration of foetal DNA in maternal plasma and the high sensitivity requirement for accurate detection of aneuploidy, deletions, or other genetic abnormalities. Thus, the multiplex assay is a powerful tool for screening pregnancies at risk of aneuploidy without the need for invasive procedures.10 In general, throughout this disclosure, assays based on non-invasive DNA / oligonucleotide samples (e.g. non- invasive prenatal testing (NIPT) assays) may be multiplexed to increase signal strength and reliability. For example, such assays may comprise up to 60, up to 50, up to 30, or up to 20 primer and probe sets per target oligonucleotide / chromosome. In embodiments, NIPT assays may comprise from 2 to 60, from 3 to 50, from 4 to 40, from 5 to 30 or from 6 to 20 primer and probe sets per target oligonucleotide / chromosome. In15 particular, NIPT assays may comprise from 6 to 18, from 6 to 16, from 6 to 14, or from 6 to 12 primer and probe sets pertarget oligonucleotide / chromosome, e.g., 6, 7, 8, 9, 10, 11 , 12, 13 or 14 primer and probe sets per target oligonucleotide / chromosome.In general, throughout this disclosure, assays based on invasive DNA / oligonucleotide samples (e.g. invasive20 prenatal testing (IPT) assays) may or may not be multiplexed. For example, such assays may comprise up to 20; such as up to 18, up to 16, up to 14, up to 12, up to 10, up to 8 or up to 6 primer and probe sets per target oligonucleotide / chromosome. In embodiments, IPT assays may comprise from 1 to 20, from 2 to 18, from 3 to 16, from 4 to 14, or from 5 to 12 primer and probe sets; particularly, 6, 7, 8, 9, 10, 11 or 12 primer and probe sets per target oligonucleotide / chromosome.25The multiplex design also enables the inclusion of reference loci on unaffected chromosomes or stable genomic regions. These internal controls ensure the quality and validity of the assay, addressing potential variability in sample quality, DNA extraction, and amplification efficiency.30 Furthermore, multiplex PCR based assays provide a flexible platform for expanded testing panels wherein the assays can be easily adapted to include additional chromosomal targets (e.g., microdeletions or duplications) or markers of other conditions, providing a customizable solution for comprehensive prenatal genetic testing.Notably, cfDNA, derived from both maternal and foetal sources, is highly fragmented with an average size of35 approximately 150-200 base pairs. This fragmentation can pose challenges for certain genomic assays, such as reduced target availability or inefficient amplification.The disclosed regions, primers, and probes of the multiplex assay overcome this technical problem by incorporating multiple primer sets targeted to multiple regions, which increases the probability of amplifying at40 least one intact target region, even if some fragments are degraded or missing. Suitably, multiple regions per chromosome may be detected to ensure robust detection. For example, for trisomy 21 , several distinct regions of chromosome 21 might be targeted. If one region is missing due to fragmentation, another intact fragmentcan still be amplified, maintaining assay reliability. Consequently, the multiplex format ensures that even a small quantity of cfDNA in a cfDNA sample which is able to be amplified (and / or detected) is used efficiently as a single reaction amplifies multiple loci simultaneously, reducing the need for comparatively larger DNA input or additional reactions, which would be challenging with fragmented cfDNA.5Furthermore, the use of primers designed to amplify very short regions of DNA (e g., between about 60 and 100 bp, or between about 65 and 75 bp in length), ensures compatibility with the fragmented nature of cfDNA. Shorter amplicons are more likely to be present, intact, in the cfDNA pool, allowing efficient amplification despite the small size of cfDNA fragments.10In embodiments, a prenatal testing assay using a PCR-based method disclosed herein comprises a chromosome aneuploidy assay.In embodiments, a prenatal testing assay using a PCR-based method disclosed herein comprises a 22q15 microdeletion assay, suitably a 22q11 .2 microdeletion assay.In embodiments, a prenatal testing assay using a PCR-based method disclosed herein comprises a chromosome aneuploidy assay and a 22q microdeletion assay, suitably a 22q11 .2 microdeletion assay.20 Those skilled in the art would appreciate that determining a set of genomic regions to target in a multiplex prenatal assay, and also generating high-performance primers and probes for a multiplex prenatal testing assay, are each, and together, a complextask due to the interplay of several technical, biological, and practical factors.25 Prenatal testing assays typically rely on circulating cell-free foetal DNA (cfDNA) in maternal blood, which is present in low concentrations (around 10-15% of total cfDNA). As such, identifying genomic regions that are reliably represented in cfDNA, while minimizing maternal DNA interference, is challenging, notwithstanding that the signal-to-noise ratio of an assay may vary depending on the regions selected. Similarly, primers suitable for such assays must reliably amplify foetal-specific regions without (substantial) interference from the30 comparatively more abundant maternal DNA.Furthermore, as will be appreciated by those skilled in the art, many genomic regions exhibit populationspecific variation. Regions selected for one population may not provide reliable results in another due to, for example, differences in allele frequency, SNP density, the presence of polymorphisms or repetitive sequences35 (e.g. having variable length or composition), high / variable GC content, or unspecific background primer binding to other non-target genomic regions having greater similarity to a target genomic region in a different population, which can affect, amongst other things, primer binding efficiency and specificity. As such, identifying target genomic regions and primers that consistently perform well across diverse populations is difficult, and typically requires extensive data analysis.40Primers for prenatal testing assays should be suitably sensitive and reliable, in orderto detect subtle changes, such as aneuploidies, duplications, or deletions, which require consistent amplification across the genome androbust discrimination of copy number variations (CNVs). Suitable target genomic regions should provide consistent coverage during sequencing or other downstream processes. Uneven amplification or sequencing biases (e.g., GC bias) can compromise the detection of abnormalities.5 The selected regions should also be highly informative (e.g., targeting a specific genomic region, e.g. on a specific chromosome suspected to be aneuploid, on a chromosome arm, or on a specific region of a chromosome arm), while being technically feasible to amplify or sequence in a multiplex assay. Certain regions may be biologically ideal but, as indicated above, challenging to target due to high GC content, repetitive sequences, or structural complexity.10Primers must bind specifically to the target genomic regions without amplifying homologous or off-target sequences. This is particularly difficult in multiplex assays where multiple primers interact simultaneously, increasing the likelihood of primer dimer formation and mis-priming. Furthermore, interactions such as secondary structure formation can reduce assay performance. Additionally, in a multiplex assay, primers for15 different regions are configured to exhibit similar amplification efficiencies to ensure balanced amplification, particularly given that the multiplex assays are intended to work robustly across various sample types. Overamplification of one region can obscure results for others, and may reduce or eliminate the validity of the results.20 Computational tools are typically employed to predict and minimize these interactions and ensure clinical performance criteria are met, such as sensitivity for detecting low-frequency foetal DNA chromosomal variation, and high specificity to avoid false positives. However, the skilled person would appreciate that these computational predictions are not always accurate reflections of biological systems, as the interplay of biological, chemical, and technical factors means there is no straightforward method to predict which primer25 combinations will work well in a multiplex assay. Even with advanced computational tools, selecting regions that consistently work well in multiplex assays requires iterative empirical testing.Indeed, many regions, primers, and probes that appear suitable on paper may fail due to unanticipated issues, such as secondary structures or amplification artifacts. Notably, this optimization problem has no30 straightforward or predictable solution, as improving one factor (e.g., informativeness) can compromise another (e.g., primer interaction). As such, determination of suitable target genomic regions, primers, and probes, requires iterative testing, validation, and optimization of primer sets.The inventors are the first to discover that the disclosed target genomic regions are suitable for use in35 performing multiplex prenatal testing assays, and that the disclosed primers and probes targeting any such target genomic regions for use in performing multiplex prenatal testing assays should beneficially exhibit high sensitivity (very few false positive events detected) and discriminatory power (indicated by a clear separation between positive and negative wells / droplets).40 Furthermore, the disclosed target genomic regions, primers, and probes are suitable for use in performing multiplex prenatal testing assays in droplets, which presents additional challenges vs bulk PCR reactions. Droplets are much smaller than bulk reactions, often in the nanoliter or picoliter range. This significantly limitsthe total amount of template DNA, primers, and other reagents available in each droplet, increasing the risk of stochastic effects, such as uneven amplification or missing targets. Additionally, achieving the correct primer concentrations across the plurality of primers in a multiplex is more challenging due to the restricted volume and the potential for uneven partitioning of primers across droplets, which can lead to preferential amplification5 of certain targets and suppression of others. Additionally, each droplet encapsulates a small and potentially uneven subset of the DNA template, and thus not all droplets may contain all the target sequences, leading to incomplete amplification or target dropout. Furthermore, stochastic partitioning becomes a more significant issue when the template concentration is low, as some droplets may lack certain target sequences entirely. In multiplex PCR in droplets, primer-dimer formation and competition for reagents (e.g., DNA polymerase,10 dNTPs) can be more pronounced due to the confined environment, which can hinder the simultaneous amplification of multiple targets. Additionally, after amplification, analysing the results of a multiplex PCR in droplets is more complex. Each droplet needs to be individually interrogated, often requiring advanced imaging systems and analysis pipelines for multiplex readouts.15 The disclosed target genomic regions, primers, and probes, were determined following a significant research effort by the inventors, comprising initial selection based on differential methylation profiles, initial design(comprising multiple rounds of adjustment of the Tm of all multiplex primers and annealing temperature of the amplification reaction to reduce non-specific amplification arising from incorrect primer annealing and / or to achieve an effective annealing temperature for all primers to ensure even amplification).20The initial selection and design was followed by several iterative rounds of validation (comprising amplification and sequencing of resulting regions), down-selection (to remove regions which generated false positives, exhibited poor separation, exhibited off target effects, and / or formed undesirable primer products, e.g. primer dimers), and further validation (e.g. to test for new primer-target or primer-primer interactions occurring due25 to the new reduced selection of combination of regions / primers / probes).The coordinates corresponding to these target regions are shown below in Table 14.Table 14. Target regions: numbering based on '+’ strand; wherein forward primer binds to one or '+’ or30 strand; reverse primer binds to other of ‘+’ or strandForward primer region Reverse primer regionChromosome 5’ 3’ 5’ 3’13 91844031 91844057 91844076 9184410113 43267186 43267186 43267231 4326725613 41895493 41895519 41895537 4189556313 109181309 109181334 109181353 10918137918 33639390 33639415 33639435 3363946018 22729157 22729183 22729201 2272922718 63772554 63772580 63772598 6377262418 28791620 28791643 28791664 2879169021 26432073 26432097 26432116 2643214221 16379350 16379374 16379394 1637942021 32734387 32734412 32734436 3273445721 16013552 16013577 16013595 1601362122 19811169 19811195 19811217 1981123922 18991954 18991975 18992002 1899202422 19674805 19674829 19674856 1967487522 20092756 20092781 20092806 20092827X 82075313 82075337 82075360 82075383X 261 16906 26116927 26116953 26116976X 31620172 31620198 31620217 31620242X 84231540 84231562 84231587 84231610Y 17260739 17260763 17260783 17260809Y 8726016 8726039 8726061 8726086Y 14668394 14668420 14668438 14668464Y 17368492 17368515 17368540 17368562In aspects of the invention, a primer set for detecting chromosomal abnormalities in a PCR-based prenatal testing assay is disclosed, comprising: at least a first forward primer configured to anneal to at least 12 nucleotides of a first forward primer5 region of chromosome 13, and at least a first reverse primer configured to anneal to at least 12 nucleotides of a first reverse primer region of chromosome 13, the first forward primer region and reverse primer region selected from one or more or all of:Forward primer region Reverse primer regionChromosome 5’ 3’ 5’ 3’ a. 13 91844031 91844057 91844076 91844101 b. 13 43267186 43267186 43267231 43267256 c. 13 41895493 41895519 41895537 41895563 d. 13 109181309 109181334 109181353 10918137910 ; and at least a first forward primer configured to anneal to at least 12 nucleotides of a first forward primer region of chromosome 18 and at least a first reverse primer configured to anneal to at least 12 nucleotides of a first reverse primer region of chromosome 18, the first forward primer region and reverse primer region selected from one or more or all of:Forward primer region Reverse primer regionChromosome 5’ 3’ 5’ 3’ a. 18 33639390 33639415 33639435 33639460 b. 18 22729157 22729183 22729201 22729227c. 18 63772554 63772580 63772598 63772624 d. 18 28791620 28791643 28791664 28791690; and at least a first forward primer configured to anneal to at least 12 nucleotides of a first forward primer region of chromosome 21 , and at least a first reverse primer configured to anneal to at least 12 nucleotides of a first reverse primer region of chromosome 21 , the first forward primer region and reverse primer region5 selected from one or more or all of:Forward primer region Reverse primer regionChromosome 5’ 3’ 5’ 3’ a. 21 26432073 26432097 26432116 26432142 b. 21 16379350 16379374 16379394 16379420 c. 21 32734387 32734412 32734436 32734457 d. 21 16013552 16013577 16013595 16013621; and at least a first forward primer configured to anneal to at least 12 nucleotides of a first forward primer region of the q arm of chromosome 22, and at least a first reverse primer configured to anneal to at least 1210 nucleotides of a first reverse primer region of the q arm of chromosome 22, the first forward primer region and reverse primer region selected from one or more or all of:Forward primer region Reverse primer regionChromosome 5’ 3’ 5’ 3’ a. 22 19811169 19811 195 19811217 19811239 b. 22 18991954 18991975 18992002 18992024 c. 22 19674805 19674829 19674856 19674875 d. 22 20092756 20092781 20092806 20092827; and at least a first forward primer configured to anneal to at least 12 nucleotides of a first forward primer15 region of the chromosome X, and at least a first reverse primer configured to anneal to at least 12 nucleotides of a first reverse primer region of chromosome X, the first forward primer region and reverse primer region selected from one or more or all of:Forward primer region Reverse primer regionChromosome 5’ 3’ 5’ 3’ a. X 82075313 82075337 82075360 82075383 b. X 26116906 26116927 26116953 26116976 c. X 31620172 31620198 31620217 31620242 d. X 84231540 84231562 84231587 8423161020 ; and at least a first forward primer configured to anneal to at least 12 nucleotides of a first forward primer region of the chromosome Y, and at least a first reverse primer configured to anneal to at least 12 nucleotidesof a first reverse primer region of chromosome Y, the first forward primer region and reverse primer region selected from one or more or all of:Forward primer region Reverse primer regionChromosome 5’ 3’ 5’ 3’ a. Y 17260739 17260763 17260783 17260809 b. Y 8726016 8726039 8726061 8726086 c. Y 14668394 14668420 14668438 14668464 d. Y 17368492 17368515 17368540 173685625 In embodiments, the first forward primer is configured to anneal to at least 13 nucleotides of a first forward primer region, such as at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 21 nucleotides.In embodiments, the first reverse primer is configured to anneal to at least 13 nucleotides of a first reverse10 primer region, such as at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 21 nucleotides.In embodiments, the first forward primer is configured to anneal to at least 13 consecutive nucleotides of a first forward primer region, such as at least 14 consecutive nucleotides, at least 15 consecutive nucleotides, at15 least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, at least 20 consecutive nucleotides, or at least 21 consecutive nucleotides.In embodiments, the first reverse primer is configured to anneal to at least 13 consecutive nucleotides of a first reverse primer region, such as at least 14 consecutive nucleotides, at least 15 consecutive nucleotides, at20 least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, at least 20 consecutive nucleotides, or at least 21 consecutive nucleotides.In embodiments, the at least a first forward primer configured to anneal to a first forward primer region of chromosome 13, may comprise a first forward primer only, or may comprise first and second forward primers;25 first, second, and third forward primers; or first, second, third, and fourth forward primers.In embodiments, the at least a first reverse primer configured to anneal to a first reverse primer region of chromosome 13, may comprise a first reverse primer only, or may comprise first and second reverse primers; first, second, and third reverse primers; or first, second, third, and fourth reverse primers.30In embodiments, the at least a first forward primer configured to anneal to a first forward primer region of the chromosome 18, may comprise a first forward primer only, or may comprise first and second forward primers; first, second, and third forward primers; or first, second, third, and fourth forward primers.In embodiments, the at least first reverse primer configured to anneal to a first reverse primer region of the chromosome 18, may comprise a first reverse primer only, or may comprise first and second reverse primers; first, second, and third reverse primers; or first, second, third, and fourth reverse primers.5 In embodiments, the at least first forward primer configured to anneal to a first forward primer region of the chromosome 21 , may comprise a first forward primer only, or may comprise first and second forward primers; first, second, and third forward primers; or first, second, third, and fourth forward primers.In embodiments, the at least first reverse primer configured to anneal to a first reverse primer region of the10 chromosome 21 , may comprise a first reverse primer only, or may comprise first and second reverse primers; first, second, and third reverse primers; or first, second, third, and fourth reverse primers.In embodiments, the at least first forward primer configured to anneal to a first forward primer region of the q arm of chromosome 22, may comprise a first forward primer only, or may comprise first and second forward15 primers; first, second, and third forward primers; or first, second, third, and fourth forward primers.In embodiments, the at least first reverse primer configured to anneal to a first reverse primer region of the q arm of chromosome 22, may comprise a first reverse primer only, or may comprise first and second reverse primers; first, second, and third reverse primers; or first, second, third, and fourth reverse primers.20In embodiments, the at least first forward primer configured to anneal to a first forward primer region of the chromosome X, may comprise a first forward primer only, or may comprise first and second forward primers; first, second, and third forward primers; or first, second, third, and fourth forward primers.25 In embodiments, the at least first reverse primer configured to anneal to a first reverse primer region of the chromosome X, may comprise a first reverse primer only, or may comprise first and second reverse primers; first, second, and third reverse primers; or first, second, third, and fourth reverse primers.In embodiments, the at least first forward primer configured to anneal to a first forward primer region of the30 chromosome Y, may comprise a first forward primer only, or may comprise first and second forward primers; first, second, and third forward primers; or first, second, third, and fourth forward primers.In embodiments, the at least first reverse primer configured to anneal to a first reverse primer region of the chromosome Y, may comprise a first reverse primer only, or may comprise first and second reverse primers;35 first, second, and third reverse primers; or first, second, third, and fourth reverse primers.Exemplary primers targeting these regions are shown below in Table 15.Table 15. Exemplary primersSEQ ID Name Sequence (5’ to 3’)201 F_PR I MER_M B_03_02_A22q_13_25p_F_M B TTTGCGTTTATCTGATGTGAAGTCTC_03_02202 F_PR I MER_M B_03_02_A22q_13_3p_F_M B_ TCCCTGTTCTTCTCTCCTTTAGC03 02203 F_PRIMER_MB_03_02_A22q_13_51 p_F_MB CTCAGTTCAACATAGAGCATACATGG03 02204 F_PR I MER _M B_03_02_A22q_13_56p_F_M B TGATGAGACAGATTCCTTACTGGTG03 02205 F_PRIMER_MB_04_03_A22q_18_13p_F_MB CCCCAGCATAGGGATGGTAATATAG04 03206 F_PRIMER_MB_04_03_A22q_18_33p_F_MB AACAATTAGTACATAGCCCAAAACCA04 03207 F_PRIMER_MB_04_03_A22q_18_3p_F_MB_ AATAATTTAGGAGGTGAAATGGGACC04 03208 F_PRIMER_MB_04_03_A22q_18_59p_F_MB ACAATCCTGGTAGGCTTTCTTGT_04_03209 F_PRIMER_MB21_01_01_A22q_21_16p_F_ TCAGAAGTCCTGTTTTATGAGGCAMB21 01 01210 F_PRIMER_MB21_01_01_A22q_21_26p_F_ AGTGTCATGGAGATGAGGTTTTGTMB21 01 01211 F_PRIMER_MB21_01_01_A22q_21_3p_F_M TCACTCAATGACTAAGTCCACAACTB21_01_01212 F_PRIMER_MB21_01_01_A22q_21_52p_F_ TGTGGGGATTGTCAAATTTTCATGTMB21 01 01213 F_PRIMER_MB_11_09_A22q_22q_14p_F_M TGCAATGAACAAATAAATGCCTGTTCB 11 09214 F_PRIMER_MB_11_09_A22q_22q_41 p_F_M TGTCTGTGTGTTCTGGAACCAB_11_09215 F_PRIMER_MB_11_09_A22q_22q_57p_F_M GGTGATTGTCAAGAGTTAGGGTCTB 11 09216 F_PRIMER_MB_11_09_A22q_22q_58p_F_M GCTTTTGATGTCTTGACTCGTATGTB 11 09217 F_PR I M E R_M B_06_04_A22q_X_1 p_F_M B_0 TGTGCATTTGAAAGTTCAGGCTAC6_04218 F_PR I M E R_M B_06_04_A22q_X_44 p_F_M B_ TGGTTTGAGCCAGTTTCAGGT06 04219 F_PR I M E R_M B_06_04_A22q_X_46 p_F_M B_ TCTCACTGAACAATAGATTCATGGGT06 04220 F_PR I MER _M B_06_04_A22q_X_7p_F_M B_0 TCCCAAAATGCAGCTTCATCAC6_04221 F_PR I M E R_M B_09_07_A22q_Y_16 p_F_M B_ ATGTGATAAACATGGCATGCTTGT 09_07222 F_PR I M E R_M B_09_07_A22q_Y_22 p_F_M B_ CCCTGTGGACAGAACTACTAGTG 09 07223 F_PR I M E R_M B_09_07_A22q_Y_31 p_F_M B_ CTACCTGATTTGGAATGCTATTTCCT 09 07224 F_PRIMER_MB_09_07_A22q_Y_37p_F_MB_ TGTCTCCATTGTTCATTCTCCCA09 07225 R_PRIMER_MB_03_02_A22q_13_25p_R_MB CTCTTATCCTTTACCTCCTGTCCTG03 02226 R_PRIMER_MB_03_02_A22q_13_3p_R_MB_ CAGTTTCATCAGACAGGATGTTCAG03 02227 R_PRIMER_MB_03_02_A22q_13_51 p_R_MB AGTTATCTGTAGAAGACTTTGAGGCA ...

Claims

CLAIMS:

1. A method of estimating the fraction of foetal DNA in a cfDNA sample obtained from a blood sample from a pregnant human subject, the method comprising a digital amplification reaction method comprising:5 (a) partitioning into partitions an amplification reaction mixture comprising cfDNA from the cfDNA sample, amplification reagents, and a plurality of amplification sets comprising primer and probe sets, wherein each amplification set comprises primers and probes for multiplex amplification and each amplification set generates amplification products, when target is present, comprising a distinct label distinguishable from the label for each of the other amplification sets; and wherein the plurality comprises:10 (i) an amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA; and(ii) an amplification set that targets sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA; and optionally one or more of (iii), (iv), and (v):(iii) an amplification set that targets total cfDNA comprising methylation insensitive regions from15 chromosomes unlikely to exhibit aneuploidy;(iv) an amplification set that targets sites that are hypermethylated in foetal DNA and maternal DNA;(v) an amplification set that targets sites that are hypomethylated in foetal DNA and maternal DNA;(b) incubating the cfDNA with a methylation-sensitive restriction enzyme (MSRE) cocktail comprising at least one methylation-sensitive restriction enzyme that cleaves unmethylated DNA;20 (c) amplifying target nucleic acid sequences in the partitions, if present, to obtain amplification products;(d) detecting in the partitions a signal from each distinct label from the amplification products; and(e) quantifying the signal for each distinct label.

2. The method of Claim 1 , wherein (iii), the amplification set that targets total cfDNA comprising25 methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy, is included in the plurality.

3. The method of Claim 1 or Claim 2, wherein each of the amplification sets of (i) and (ii) comprises primers and probes to target at least three sites.30 4. The method of Claim 1 or Claim 2, wherein each of the amplification sets of (i) to (v) comprises primers and probes to target at least three sites or between 6 and 10 sites.

5. The method of any one of Claims 1 to 4, further comprising an amplification set that targets methylation-insensitive regions of the Y chromosome.

356. The method of any one of Claims 1 to 5, further comprising an amplification set that targets sites that are hypomethylated in both foetal and maternal cfDNA; and / or an amplification set that targets sites that are hypermethylated in both foetal and maternal cfDNA.40 7. The method of any one of Claims 1 to 6, wherein the amplification reaction mixture further comprises a control target completely methylated synthetic DNA sequence and / or a completely unmethylated version of the same synthetic DNA sequence.

8. The method of any one of Claims 1 to 7, wherein the digital amplification reaction method is a digitalPCR method.5 9. The method of Claim 8, wherein the digital PCR method is a droplet digital PCR method.

10. The method of any one of Claims 1 to 9, wherein the amplification reaction mixture comprises the MSRE cocktail, and the incubating occurs after the partitioning and before the amplifying.10 11. The method of any one of Claims 1 to 9, wherein step (b) is performed before the partitioning, and cfDNA subjected to digestion is added to the amplification reaction mixture.

12. The method of any one of Claims 1 to 11 , wherein the MSRE cocktail comprises at least two, at least three, or at least four methylation-sensitive restriction enzymes; and / or wherein the MSRE cocktail comprises15 a restriction enzyme selected from Hhal, Hpall, Acil, HpyCH4IV, and BsaHI.

13. The method of Claim 12, wherein the MSRE cocktail comprises at least two, three, or four of the restriction enzymes Hhal, Hpall, Acil, HpyCH4IV, and BsaHI.20 14. The method of Claim 12 or Claim 13, wherein the MSRE cocktail comprises at least Hhal and HpyCH4IV.

15. The method of any one of Claims 1 to 14, wherein the cfDNA sample is obtained from plasma or serum.2516. The method of any one of Claims 1 to 15, wherein each label is a fluorescent label.

17. The method of Claim 16, wherein the probe is a molecular beacon probe comprising a fluorescent label.3018. The method of any one of Claims 1 to 15, wherein each probe is an oligonucleotide that hybridizes to complementary oligonucleotide that comprises label that provides a detectable signal.

19. The method of any one of Claims 1 to 18, further comprising determining the normalized copy35 concentration for each of the targets, based on the number of targets in an amplification set (Ni).

20. The method of any one of Claims 1 to 19, further comprising determining a corrected concentration of foetal cfDNA (Fet_FF) in the cfDNA sample and / or a corrected concentration of maternal cfDNA (Maternal_FF) in the cfDNA sample, wherein determining the corrected concentration of foetal cfDNA comprises a calculation:40 foetal_FF = [foetal] / [hyper]— [hypo] / [hyper]— 0.08wherein [hyper] is hypermethylated reference copy concentration based on signal from probes configured to anneal to one or more loci hypermethylated in both foetal DNA and maternal DNA; [hypo] is hypomethylated reference copy concentration based on signal from probes configured to anneal to one or more loci hypomethylated in both foetal DNA and maternal DNA; and [foetal] is foetal DNA copy concentration based5 on signal configured to anneal to one or more loci hypermethylated in foetal DNA and hypomethylated in maternal DNA; and / or determining the corrected concentration of maternal cfDNA comprises a calculation:10 maternal_FF = 1-[maternal] / [hyper] wherein [maternal] is maternal DNA copy concentration based on signal from probes configured to anneal to one or more loci hypomethylated in foetal DNA and hypermethylated in maternal DNA; and [hyper] is as defined above.1521. The method of Claim 20, further comprising determining the foetal fraction (FF) in the cfDNA sample, depending on whether the sample is associated with a male foetus or a female foetus, wherein determining the foetal fraction comprises: determining the average methylation foetal fraction value (meth_FF) comprises a calculation:20 meth_FF = average(foetal_FF,maternal_FF); determining the proportion of chrY in the foetal fraction based on the calculation:25 chrY_FF = 2 [chrY] / [control] wherein ‘chrY_FF’ is the proportion of chromosome Y in the foetal fraction DNA sample; [chrY] is the concentration of chrY in the total DNA sample; and [control] is the total concentration of DNA in the sample based on signals from probes configured to anneal to one or more loci comprising methylation insensitive30 regions from chromosomes unlikely to exhibit aneuploidy; and wherein:(D where chrY_FF is above 0.02, determining that the foetus is male, and calculating the foetal fraction comprises the calculation:35 FF_calculated = (2-meth_FF + chrY_FF) / 3 or(ii) where chrY_FF is 0.02 or below, determining that the foetus is female, and calculating the foetal fraction comprises the calculation:40 FF_calculated = meth_FFwherein ‘FF_calculated’ is the final, calculated foetal fraction value; and ‘meth_FF’ and ‘chrY_FF’ are as defined above.

22. The method of Claim 20 or Claim 21 , further comprising:5 computing an estimated foetal fraction at least partially based on the foetal fraction in the cfDNA sample and a model.

23. The method of Claim 22, wherein the model is a generalized additive model (GAM), a linear model, or a second-order polynomial model at least partially based on a set of clinical foetal fraction data and a10 corresponding set of foetal fraction measurements using next-generation sequencing (NGS).

24. The method of any one of Claims 1 to 23, wherein the sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA are sites within one or more, or all of the regions:Chromosome Start End15 chr1 10965026 10965118 chr1 36457885 36458000 chr11 77152247 77152348 chr14 100081619 100081733 chr14 105390470 10539058320 chr15 81781663 81781753 chr17 75997501 75997633 chr2 196211575 19621168325. The method of any one of Claims 1 to 24, wherein the sites that are hypermethylated in maternal DNA25 and hypomethylated in foetal DNA are sites within one or more, or all of the regions:Chromosome Start End chr1 110390715 110390806 chr19 8525569 8525674 chr2 236576106 23657621530 chr2 239532002 239532126 chr2 72115414 72115526 chr4 90104102 90104228 chr5 142280348 14228046235 26. The method of any one of Claims 1 to 25, wherein the sites that are hypermethylated in foetal DNA and maternal DNA are sites within one or more, or all of the regions:Chromosome Start End chr19 12930395 12930501 chr2 98903445 9890356040 chr20 50670188 50670287 chr4 186620052 186620153 chr4 41181277 41181358chr5 133097153 133097246 chr6 3363036 336314727. The method of any one of Claims 1 to 26, wherein the sites that are hypomethylated in foetal DNA5 and maternal DNA are sites within one or more, or all of the regions:Chromosome Start End chr10 73744741 73744849 chr12 104050025 104050120 chr17 48108167 4810829710 chr17 68292301 68292434 chr2 27369852 27369937 chr2 28870489 2887060428. The method of any one of Claims 1 to 27, wherein methylation insensitive regions from chromosomes15 unlikely to exhibit aneuploidy are sites within one or more, or all of the regions:Chromosome Start End chr3 104042356 104042470 chr3 104263905 104264029 chr3 133296976 13329707720 chr3 169019731 169019836 chr3 17807278 17807410 chr3 22594415 22594519 chr3 25620061 25620168 chr3 35697692 3569777425 chr3 82529219 8252932029. The method of any one of Claims 1 to 28, wherein the methylation-insensitive regions of the Y chromosome are within one or more, or all of the regions:Chromosome Start End30 chrY 13817626 13817726 chrY 13861919 13862016 chrY 14225706 14225797 chrY 14405980 14406112 chrY 15558950 1555906835 chrY 16701419 16701541 chrY 17109321 17109424 chrY 19228514 19228627 chrY 19731092 19731204 chrY 21046467 210465684030. A DNA amplification kit for estimating the fraction of foetal DNA in a cfDNA sample obtained from a plasma or serum sample from a pregnant human subject, the kit comprising:(a) an amplification reaction mixture comprising amplification reagents, and a plurality of amplification sets comprising primer and probe sets, wherein each amplification set comprises a distinct label distinguishable from the label for each of the other sets, and each set comprises primers and probes for multiplex amplification, and wherein the plurality of comprises:5 (i) an amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA; and(ii) an amplification set that targets sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA; and optionally one or more of (iii), (iv), and (v);(iii) an amplification set that targets total cfDNA comprising methylation insensitive regions from10 chromosomes unlikely to exhibit aneuploidy;(iv) an amplification set that targets sites that are hypermethylated in foetal DNA and maternal DNA;(v) an amplification set that targets sites that are hypomethylated in foetal DNA and maternal DNA.

31. The kit of Claim 30, wherein each of the amplification sets of (i) and (ii) comprises primers and probes15 to target at least three sites.

32. The kit of Claim 30 or Claim 31 , further comprising an amplification set that targets methylationinsensitive regions of the Y chromosome.20 33. The kit of any one of Claims 30 to 32, further comprising a completely methylated synthetic sequence of DNA and / or a completely unmethylated version of the same synthetic sequence.

34. The kit of any one of Claims 30 to 33, wherein each label is a fluorescent label.25 35. The kit of Claim 34, wherein the probes are molecular beacon probes comprising a fluorescent label.

36. The kit of any one of Claims 30 to 35, wherein each probe is an oligonucleotide that hybridizes to complementary oligonucleotide that comprises label that provides a detectable signal.30 37. The kit of any one of Claims 30 to 36, further comprising a methylation-sensitive restriction enzyme (MSRE) cocktail comprising at least one MSRE that cleaves unmethylated DNA.

38. The kit of Claim 37, wherein the MSRE cocktail comprises at least two, at least three, or at least four methylation-sensitive restriction enzymes; and / or wherein the MSRE cocktail comprises a restriction enzyme35 selected from Hhal, Hpall, Acil, HpyCH4IV, and BsaHI.

39. The kit of any one of Claims 1 to 38, wherein the MSRE cocktail comprises at least two, three, or more of the restriction enzymes Hhal, Hpall, Acil, HpyCH4IV, and BsaHI.40 40. The kit of Claim 38 or Claim 39, wherein the MSRE cocktail comprises at least Hhal and HpyCH4IV.

41. The kit of any one of Claims 30 to 40, wherein the sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA are sites within one or more, or all of the regions:Chromosome Start End chr1 10965026 109651185 chr1 36457885 36458000 chr11 77152247 77152348 chr14 100081619 100081733 chr14 105390470 105390583 chr15 81781663 8178175310 chr17 75997501 75997633 chr2 196211575 19621168342. The kit of any one of Claims 30 to 41 , wherein the sites that are hypermethylated in maternal DNA and hypomethylated in foetal DNA are sites within one or more, or all of the regions:15 Chromosome Start End chr1 110390715 110390806 chr19 8525569 8525674 chr2 236576106 236576215 chr2 239532002 23953212620 chr2 72115414 72115526 chr4 90104102 90104228 chr5 142280348 14228046243. The kit of any one of Claims 30 to 42, wherein the sites that are hypermethylated in foetal DNA and25 maternal DNA are sites within one or more, or all of the regions:Chromosome Start End chr19 12930395 12930501 chr2 98903445 98903560 chr20 50670188 5067028730 chr4 186620052 186620153 chr4 41181277 41181358 chr5 133097153 133097246 chr6 3363036 336314735 44. The kit of any one of Claims 30 to 43, wherein the sites that are hypomethylated in foetal DNA and maternal DNA are sites within one or more, or all of the regions:Chromosome Start End chr10 73744741 73744849 chr12 104050025 10405012040 chr17 48108167 48108297 chr17 68292301 68292434 chr2 27369852 27369937chr2 28870489 2887060445. The kit of any one of Claims 30 to 44, wherein methylation insensitive regions from chromosomes unlikely to exhibit aneuploidy are sites within one or more, or all of the regions:5 Chromosome Start End chr3 104042356 104042470 chr3 104263905 104264029 chr3 133296976 133297077 chr3 169019731 16901983610 chr3 17807278 17807410 chr3 22594415 22594519 chr3 25620061 25620168 chr3 35697692 35697774 chr3 82529219 825293201546. The kit of any one of Claims 30 to 45, wherein the methylation-insensitive regions of the Y chromosome are within one or more, or all of the regions:Chromosome Start End chrY 13817626 1381772620 chrY 13861919 13862016 chrY 14225706 14225797 chrY 14405980 14406112 chrY 15558950 15559068 chrY 16701419 1670154125 chrY 17109321 17109424 chrY 19228514 19228627 chrY 19731092 19731204 chrY 21046467 2104656830 47. The method according to any one of Claims 1 to 29, or the kit according to any one or Claims 30 to46, wherein at least one forward primer of the amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA comprises the sequence of one of SEQ ID NOs 13 to 20.

48. The method according to any one of Claims 1 to 29 and 47, or the kit according to any one or Claims35 30 to 47, wherein the sequence of at least one forward primer of the amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA comprises one of SEQ ID NOs 60 to67.

49. The method according to any one of Claims 1 to 29, 47 and 48, or the kit according to any one or40 Claims 30 to 48, wherein at least one forward primer of the amplification set that targets sites that are hypomethylated in foetal DNA and hypermethylated in maternal DNA comprises the sequence of one of SEQID NOs 21 to 27.

50. The method according to any one of Claims 1 to 29, and 47 to 49, or the kit according to any one or Claims 30 to 49, wherein the sequence of at least one forward primer of the amplification set that targets sites that are hypomethylated in foetal DNA and hypermethylated in maternal DNA comprises one of SEQ ID NOs5 68 to 74.

51. The method according to any one of Claims 1 to 29, and 47 to 50, or the kit according to any one or Claims 30 to 50, wherein at least one forward primer of the amplification set that targets sites that are methylation-insensitive and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA comprises the10 sequence of one of SEQ ID NOs 41 to 49.

52. The method according to any one of Claims 1 to 29, and 47 to 51 , or the kit according to any one or Claims 30 to 51 , wherein the sequence of at least one forward primer of the amplification set that targets sites that are methylation-insensitive and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA15 comprises one of SEQ ID NOs 88 to 96.

53. The method according to any one of Claims 1 to 29, and 47 to 52, or the kit according to any one or Claims 30 to 52, wherein at least one forward primer of the amplification set that targets sites that are hypermethylated in both foetal DNA and maternal DNA comprises the sequence of one of SEQ ID NOs 28 to20 34.

54. The method according to any one of Claims 1 to 29, and 47 to 53, or the kit according to any one or Claims 30 to 53, wherein the sequence of at least one forward primer of the amplification set that targets sites that are hypermethylated in both foetal DNA and maternal DNA comprises one of SEQ ID NOs 75 to 81.2555. The method according to any one of Claims 1 to 29, and 47 to 54, or the kit according to any one or Claims 30 to 54, wherein at least one forward primer of the amplification set that targets sites that are hypomethylated in both foetal DNA and maternal DNA comprises the sequence of one of SEQ ID NOs 35 to 40.3056. The method according to any one of Claims 1 to 29, and 47 to 55, or the kit according to any one or Claims 30 to 55, wherein the sequence of at least one forward primer of the amplification set targets sites that are hypomethylated in both foetal DNA and maternal DNA comprises one of SEQ ID NOs 82 to 87.35 57. The method according to any one of Claims 1 to 29, and 47 to 56, or the kit according to any one or Claims 30 to 56, wherein at least one forward primer of the amplification set that targets sites that are methylation-insensitive on the Y chromosome and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA comprises the sequence of one of SEQ ID NOs 50 to 59.40 58. The method according to any one of Claims 1 to 29, and 47 to 57, or the kit according to any one or Claims 30 to 57, wherein the sequence of at least one forward primer of the amplification set targets sites thatare methylation-insensitive on the Y chromosome and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA comprises one of SEQ ID NOs 97 to 106.

59. The method according to any one of Claims 1 to 29, and 47 to 58, or the kit according to any one or5 Claims 30 to 58, wherein at least one reverse primer of the amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA comprises the sequence of one of SEQ ID NOs 154 to 161.

60. The method according to any one of Claims 1 to 29, and 47 to 59, or the kit according to any one or10 Claims 30 to 59, wherein the sequence of at least one reverse primer of the amplification set that targets sites that are hypermethylated in foetal DNA and hypomethylated in maternal DNA comprises one of SEQ ID NOs 107 to 114.

61. The method according to any one of Claims 1 to 29, and 47 to 60, or the kit according to any one or15 Claims 30 to 60, wherein at least one reverse primer of the amplification set that targets sites that are hypomethylated in foetal DNA and hypermethylated in maternal DNA comprises the sequence of one of SEQ ID NOs 162 to 168.

62. The method according to any one of Claims 1 to 29, and 47 to 61 , or the kit according to any one or20 Claims 30 to 61 , wherein the sequence of at least one reverse primer of the amplification set targets sites that are hypomethylated in foetal DNA and hypermethylated in maternal DNA comprises one of SEQ ID NOs 115 to 121.

63. The method according to any one of Claims 1 to 29, and 47 to 62, or the kit according to any one or25 Claims 30 to 62, wherein at least one reverse primer of the amplification set that targets sites that are methylation-insensitive and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA comprises the sequence of one of SEQ IDs 182 to 190.

64. The method according to any one of Claims 1 to 29, and 47 to 63, or the kit according to any one or30 Claims 30 to 63, wherein the sequence of at least one reverse primer of the amplification set that targets sites that are methylation-insensitive and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA comprises one of SEQ ID NOs 135 to 143.

65. The method according to any one of Claims 1 to 29, and 47 to 64, or the kit according to any one or35 Claims 30 to 64, wherein at least one reverse primer of the amplification set that targets sites that are hypermethylated in both foetal DNA and maternal DNA comprises the sequence of one of SEQ ID NOs 169 to 175.

66. The method according to any one of Claims 1 to 29, and 47 to 65, or the kit according to any one or40 Claims 30 to 65, wherein the sequence of at least one reverse primer of the amplification set that targets sites that are hypermethylated in both foetal DNA and maternal DNA comprises one of SEQ ID NOs 122 to 128.

67. The method according to any one of Claims 1 to 29, and 47 to 66, or the kit according to any one or Claims 30 to 66, wherein at least one reverse primer of the amplification set that targets sites that are hypomethylated in both foetal DNA and maternal DNA comprises the sequence of one of SEQ ID NOs 176 to 181.

568. The method according to any one of Claims 1 to 29, and 47 to 67, or the kit according to any one or Claims 30 to 67, wherein the sequence of at least one reverse primer of the amplification set that targets sites that are hypomethylated in both foetal DNA and maternal DNA comprises one of SEQ ID NOs 129 to 134.10 69. The method according to any one of Claims 1 to 29, and 47 to 68, or the kit according to any one or Claims 30 to 68, wherein at least one reverse primer of the amplification set that targets sites that are methylation-insensitive on the Y chromosome and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA comprises the sequence of one of SEQ IDs 191 to 200.15 70. The method according to any one of Claims 1 to 29, and 47 to 69, or the kit according to any one or Claims 30 to 69, wherein the sequence of at least one reverse primer of the amplification set that targets sites that are methylation-insensitive on the Y chromosome and unlikely to exhibit aneuploidy in foetal DNA and in maternal DNA comprises one of SEQ ID NOs 144 to 153.20 71. The method of any one of Claims 1 to 70, wherein the partitions are droplets.

72. The method of any one of Claims 1 to 70, wherein the partitions are microwells.

Images