Hangover-alleviating probiotic and use thereof
By using Lactobacillus fermentum strains ibiome020, ibiome021, and ibiome022 with specific 16s rRNA sequences, the problem of acetaldehyde damage in existing hangover products is solved, and rapid and efficient ethanol and acetaldehyde metabolism is achieved, protecting liver health and alleviating the symptoms of alcohol poisoning.
Patent Information
- Application Number
- PCT/CN2025/080756
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-25
- Filing Date
- 2025-03-05
- Publication Date
- 2025-09-25
AI Technical Summary
Existing hangover products mainly focus on shortening the time of drunkenness, but ignore the damage to the human body caused by acetaldehyde, an intermediate product of alcohol metabolism. In addition, the ethanol and acetaldehyde metabolism efficiency of probiotic products is low.
One or more fermented Lactobacillus strains with specific 16s rRNA sequences, including ibiome020, ibiome021, and ibiome022, are used to prepare alcohol detoxification drugs, which can quickly and efficiently metabolize ethanol and acetaldehyde, relieve alcohol poisoning, and protect intestinal health.
It can effectively reduce the levels of AST and ALT in serum, reduce liver damage, increase the GSH content in the liver, shorten the sobering time, reduce the mortality rate caused by drinking, and relieve the discomfort caused by ethanol and acetaldehyde.
Smart Images

Figure CN2025080756_25092025_PF_FP_ABST
Abstract
Description
A kind of alcohol-relieving probiotics and application thereof Technical Field
[0001] The present invention relates to the technical field of functional microorganisms, in particular to a lactobacillus fermentation strain capable of sobering up and application thereof. Background Art
[0002] Alcohol is a psychoactive substance with addictive properties that permeates daily life, socioeconomic activities, and cultural activities. Drinking is widespread, with only 5% of adults experiencing abstaining from alcohol throughout their lives. According to a 2020 World Health Organization report, harmful alcohol use kills over 3 million people worldwide each year, accounting for 5.3% of all deaths. Alcohol is a contributing factor to over 200 diseases, injuries, and other health conditions. Alcohol dependence and its related problems are the third most common global public health issue, after cardiovascular disease and cancer, and have garnered widespread attention.
[0003] Alcohol is metabolized in two steps: first, alcohol dehydrogenase (ADH) breaks down alcohol into toxic acetaldehyde; second, acetaldehyde dehydrogenase (ALDH) breaks down acetaldehyde into non-toxic acetic acid. East Asian populations have genetic defects in both ADH and ALDH, resulting in poor alcohol metabolism. Therefore, supplementing with exogenous ADH and ALDH has significant research significance and potential applications.
[0004] Currently, alcohol detoxification and liver protection products on the market primarily consist of combination preparations of traditional Chinese medicine extracts. These focus solely on shortening the duration of intoxication and reducing the incidence of intoxication, but fail to address the harmful effects of the accumulation of acetaldehyde, an intermediate product of alcohol metabolism. Probiotic-based alcohol detoxification products can degrade ethanol, but their efficiency is relatively low. Probiotics can protect gastrointestinal health and boost immunity, so developing probiotics that can efficiently degrade ethanol and / or acetaldehyde is a promising approach. We have discovered Lactobacillus fermentum, a strain that can rapidly and efficiently metabolize ethanol and acetaldehyde and is resistant to gastrointestinal fluids and bile salts. Summary of the Invention
[0005] In order to efficiently metabolize ethanol and its harmful intermediate metabolite acetaldehyde after drinking, the present invention provides a fermentation lactobacillus that can quickly and efficiently metabolize ethanol and acetaldehyde.
[0006] The present invention is achieved through the following technical solutions:
[0007] The present invention protects the use of a microbial strain, or a culture of the microbial strain, or a processed product thereof, in preparing a hangover remedy. The microbial strain belongs to Limosilactobacillus fermentum and has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.
[0008] In this specification, the term "culture" refers to a colony of Lactobacillus fermentum suspended in a culture medium under conditions suitable for the survival and / or growth of Lactobacillus fermentum. As will be apparent to those skilled in the art, in some aspects, these terms as used herein relate to a combination of a colony of Lactobacillus fermentum and a culture medium in which the colony is suspended. On the other hand, these terms as used herein also refer to culture supernatants and culture components obtained after the cultivation of Lactobacillus fermentum of the present invention is completed. In the present invention, the culture includes but is not limited to a bacteria-containing solution, a culture supernatant or a bacteria-containing culture medium obtained by inoculating or transplanting Lactobacillus fermentum into a culture medium of any form (liquid or solid).
[0009] In this specification, the term "processed product" is not particularly limited as long as it is derived from a culture, and can be obtained by, for example, concentration, gelatinization, spray drying, freeze drying, vacuum drying, drum drying, liquefaction, dilution, pulverization, etc. of the culture. For these processes, known methods can be used as appropriate.
[0010] In the present invention, the microbial strain of the present invention in the culture or the processed product may be a living bacteria or a dead bacteria.
[0011] In this specification, the term "strain" may be a strain directly cultured from a deposited strain, or may be a progeny strain (offspring) or a strain cultured from the original strain (subclone strain).
[0012] Preferably, the alcohol detoxification drug includes at least one of the following: a drug for relieving chronic / acute alcohol poisoning; a drug for relieving alcoholic intestinal damage or alcoholic liver damage.
[0013] Furthermore, the alcohol-detoxifying drug can reduce the mortality rate and liver index of mammals, reduce the levels of AST and ALT, which are liver damage indicators, in serum, and increase the GSH content in the liver.
[0014] The present invention protects the use of a fermentation agent / functional bacterial agent / nutritional composition in preparing a product for sobering up and / or protecting the liver. The fermentation agent / functional bacterial agent / nutritional composition comprises a Lactobacillus fermentum strain, or a culture or processed product thereof, and the strain has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
[0015] The present invention protects the use of a microbial strain, or a culture thereof, or a processed product thereof, a fermentation agent, a functional bacterial agent, or a nutritional composition for the purpose of sobering up for purposes other than diagnosis and treatment of a disease. The microbial strain belongs to Limosilactobacillus fermentum and has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; and the fermentation agent / functional bacterial agent / nutritional composition comprises a Lactobacillus fermentum strain, or a culture thereof, or a processed product thereof, and the strain has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79%, or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. rRNA sequence.
[0016] Preferably, the hangover relief method includes at least one of the following: accelerating the metabolism of ethanol and / or acetaldehyde; delaying the onset of drunkenness; shortening the sobering time; reducing the mortality rate caused by drinking; reducing liver index; reducing AST and / or ALT levels in serum; alleviating discomfort reactions caused by ethanol and / or acetaldehyde; and improving oxidative stress caused by alcohol, such as increasing GSH content in the liver.
[0017] In the present invention, the improvement refers to a decrease in the level exceeding the normal range and / or an increase in the level below the normal range.
[0018] The present invention also protects a microbial strain, which is at least one of the strains of Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021, and Lactobacillus fermentum ibiome022 preserved with the accession numbers CCTCC NO: M 2024188, CCTCC NO: M 2024222, and CCTCC NO: M 2024189, wherein the Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021, and Lactobacillus fermentum ibiome022 are selected from the group consisting of: fermentum)ibiome022 strain was deposited in the China Center for Type Culture Collection, located at China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the deposit dates of January 24, 2024, January 26, 2024, and January 24, 2024, respectively.
[0019] The present invention further protects the culture of the above-mentioned microbial strain or its processed product.
[0020] The present invention protects a medicine comprising the above-mentioned microbial strain, or the culture of the above-mentioned microbial strain or its processed product, and pharmaceutically acceptable excipients.
[0021] There are many ways to classify excipients in preparations, and they can be classified based on their source, function and use, route of administration, etc. According to their source, they can be divided into natural products, semi-synthetic products, and fully synthetic products. According to the function and use of excipients in preparations, there are 65 types of classifications, namely pH regulators, chelating agents, inclusion agents, coating agents, protective agents, moisturizers, disintegrants, surfactants, virus inactivators, supplements, precipitants, film-forming materials, flavoring agents, freeze-drying excipients, carbon dioxide adsorbents, foaming agents, fragrances, preservatives, excipients, desiccants, curing agents, buffers, sustained-release materials, adhesives, flavoring agents, antioxidants, antioxidant enhancers, anti-adhesive agents, and air replacement agents. , condensing agent, ointment base material, gel material, polishing agent, propellant, solvent, softener, emulsifier, ointment base, soft capsule material, lubricant, wetting agent, penetration enhancer, osmotic pressure regulator, suppository base, sweetener, filler, pill core, stabilizer, adsorbent, absorbent, diluent, defoaming agent, flocculant, ethanol modifier, hard paste base, ink, thickener, solubilizer, plasticizer, adhesive, Chinese medicine preparation excipients, filter aid, solubilizer, suspending agent, colorant.
[0022] The pharmaceutically acceptable excipients include at least one of adjuvants, stabilizers or protective agents, antibacterial agents, excipients, solubilizers, flavoring agents, diluents, and buffers.
[0023] Adjuvant: A substance mixed with one or more components that is combined with a vaccine antigen to enhance [such as strengthen, accelerate, prolong and / or possibly direct] its specific immune response and the clinical effect of the vaccine.
[0024] Stabilizer or protective agent: a substance used to stabilize or protect the active ingredients of biological products to prevent them from degradation or loss of activity.
[0025] Antimicrobial agents: Substances used to inhibit microbial growth and prevent microbial contamination. Excipients: Substances used to shape and support the drug in freeze-dried products. Cosolvents: Substances used to increase the solubility of drugs. Flavoring agents: Substances used to improve the taste of oral drugs. Diluents and buffers: Solvents used to dissolve, dilute, and adjust the pH of drugs, such as water for injection, sodium chloride injection, and phosphate-buffered saline (PBS).
[0026] Exemplary excipients include, but are not limited to, butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monohydrogen), calcium stearate, croscarmellose, cross-linked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, povidone, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.
[0027] The drug can be prepared in the form of an injectable preparation or an oral preparation. The injectable preparations are classified by physical state into liquid injections, powders for injection, and tablets for injection; and by injection site into intradermal injections, subcutaneous injections, intramuscular injections, intravenous injections, and spinal injections. The solvent for the injectable preparations is preferably water for injection or physiological saline.
[0028] Formulations for oral use include tablets containing the active ingredient mixed with nontoxic pharmaceutically acceptable excipients. These excipients may be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starch including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate, or sodium phosphate); granulating and disintegrants (e.g., cellulose derivatives including microcrystalline cellulose, starch including potato starch, croscarmellose sodium, alginates, or alginic acid); binders (e.g., sucrose, glucose, sorbitol, gum arabic, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, ethylcellulose, polyvinyl pyrrolidone, or polyethylene glycol); and lubricants, glidants, and anti-adherents (e.g., magnesium stearate, zinc stearate, stearic acid, silicon dioxide, hydrogenated vegetable oil, or talc). Formulations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate or kaolin), or in the form of soft gelatin capsules in which the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin or olive oil). Powders, granules and pills can be prepared using the ingredients mentioned above under tablets or capsules in a conventional manner using, for example, a mixer, fluidized bed equipment or spray drying equipment.
[0029] Other pharmaceutically acceptable excipients for oral formulations include, but are not limited to, colorants, flavorings, plasticizers, humectants, and buffers. Preparations for oral use may also be in the form of chewable tablets, or in the form of hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent (e.g., potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or in the form of soft gelatin capsules in which the active ingredient is mixed with water or an oil medium (e.g., peanut oil, liquid paraffin, or olive oil). Powders, granules, and pills can be prepared in a conventional manner using, for example, a mixer, fluidized bed apparatus, or spray drying apparatus using the ingredients mentioned above under tablets or capsules.
[0030] In some embodiments, administration comprises administering an agent described herein intramuscularly, intravenously (e.g., as a sterile solution and in a solvent system suitable for intravenous use), intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, transperitoneally, subcutaneously, subconjunctivally, intracapsularly, transmucosally, intrapericardially, intraumbilically, intraocularly, orally (e.g., as a tablet, capsule, caplet, gel-tablet, or syrup), topically (e.g., as a cream, gel, lotion, or ointment), topically, by inhalation, by injection, or by infusion (e.g., continuous infusion as a cream or lipid composition, local perfusion directly bathing target cells, catheterization, lavage).
[0031] The present invention protects a pharmaceutical composition comprising the above-mentioned microbial strain, or a culture thereof or a processed product thereof, and a combined drug, wherein the combined drug is another drug that has a synergistic effect with Limosilactobacillus fermentum.
[0032] The dosage form of the medicine of the present invention is granules, capsules, tablets, powders, oral liquids, suspensions or emulsions.
[0033] The effective dose of the present invention is that the total number of live bacteria in the live bacteria preparation prepared with Lactobacillus fermentum as the main active ingredient is 10 6 -10 14 CFU.
[0034] The medication cycle is based on the ability to achieve the desired effect, including but not limited to 1-3 times a day, 3-7 days a week, etc., and is also related to the effective concentration of the specific preparation.
[0035] The present invention also protects a fermentation agent / functional bacterial agent / nutritional composition comprising the above-mentioned microbial strain, or a culture of the above-mentioned microbial strain or a processed product thereof.
[0036] The starter or functional bacterial agent includes a bacterial liquid prepared from the above-mentioned microbial strain, or a powder or granule obtained by further processing; the starter may further contain one or more non-antagonistic microbial agents, selected from Lactobacillus plantarum, Bacillus coagulans, Lactobacillus casei, Bifidobacterium longum subspecies longum, etc. to prepare a composite bacterial agent.
[0037] Effective bacterial concentration and viable bacterial count are 10 6 -10 14 CFU.
[0038] Fermentation agents or functional bacterial agents can also be used as functional foods and nutritional products.
[0039] A nutritional composition comprising the above-mentioned microbial strain, or a culture or processed product of the microbial strain. Preferably, the nutritional composition is a food, a nutritional product, a supplement, a probiotic or a symbiotic bacteria.
[0040] The food includes the above-mentioned microbial strains, or the culture or processed products of the microbial strains and auxiliary substances that realize the functions of the food, and its presentation forms include but are not limited to "dietary supplements", "fermented foods", etc.
[0041] The dietary supplement comprises the culture or processed product of the above-mentioned microbial strain, and is further processed by adding cellulose, vitamins, minerals and other nutrients.
[0042] The fermented foods include dairy products, soy products, or fruit and vegetable products. The dairy products include milk, sour cream, or cheese. The soy products include soy milk, fermented black beans, or soybean paste. The fruit and vegetable products include cucumber, carrot, beet, celery, or cabbage products.
[0043] Probiotics are live microorganisms that, when provided in appropriate amounts, confer a beneficial effect on the health of the host organism.
[0044] The commensal bacteria refer to foods containing a mixture of prebiotics and probiotics. They generally contain prebiotic components that are beneficial to growth and / or metabolic activity, and generally the probiotic effects of microorganisms such as, but not limited to, the above-mentioned microbial strains in combination with oligofructose or oligogalactose.
[0045] The beneficial effects of the present invention are:
[0046] The fermented lactobacillus of the present invention is a natural bacterium derived from the intestines of healthy people and is a food-listed bacterium with high safety. It can metabolize high-concentration acetaldehyde, prevent a series of human discomforts caused by acetaldehyde accumulation and damage to human organs and their functions, thereby alleviating symptoms such as dizziness, headache, nausea and vomiting, and hangover after drinking. It also has the ability to metabolize ethanol and accelerate the decomposition of alcohol / ethanol. It also has excellent resistance to gastrointestinal fluid and bile salts, can adapt to complex environments in the body, can maintain activity in the human body, and better play its role.
[0047] Biological Deposit Description
[0048] Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021, and Lactobacillus fermentum ibiome022 were deposited on January 24, 2024, January 26, 2024, and January 24, 2024, respectively. The deposit was made at China Center for Type Culture Collection, China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the accession numbers are CCTCC NO: M 2024188, CCTCC NO: M 2024222, and CCTCC NO: M 2024189, respectively. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figures 1 to 3 are smear microscopic images (40X) of ibiome020, ibiome021, and ibiome022 of the present invention.
[0050] FIG4 shows the colony morphology of ibiome020, ibiome021, and ibiome022 of the present invention on solid culture medium.
[0051] FIG5 is a statistical diagram of the growth of ibiome020, ibiome021, ibiome022 of the present invention and control bacteria 1, control bacteria 2, and control bacteria 3 in culture media with different acetaldehyde concentrations.
[0052] FIG6 is a statistical graph showing the logarithm of viable bacteria tolerant to pH 2 gastric juice of ibiome020, ibiome021, and ibiome022 of the present invention.
[0053] FIG7 is a statistical graph showing the logarithm of viable bacteria tolerant to pH 8 intestinal fluid of ibiome020, ibiome021, and ibiome022 of the present invention.
[0054] FIG8 is a statistical graph showing the logarithm of 0.6% bile salt-tolerant viable bacteria of ibiome020, ibiome021, and ibiome022 of the present invention.
[0055] FIG9 is a statistical diagram showing the in vivo alcohol sobering effect evaluation of ibiome020, ibiome021, and ibiome022 of the present invention (9A: drunkenness time; 9B: sobering time).
[0056] FIG10 is a statistical graph showing the results of evaluating the survival rate of ibiome020, ibiome021, and ibiome022 of the present invention in an in vivo acute alcoholic liver injury mouse model.
[0057] FIG11 is a statistical graph showing the results of evaluating liver index using ibiome020, ibiome021, and ibiome022 of the present invention in an in vivo acute alcoholic liver injury mouse model.
[0058] FIG12 is a statistical graph showing the results of evaluating serum AST and ALT using ibiome020, ibiome021, and ibiome022 of the present invention in an in vivo acute alcoholic liver injury mouse model.
[0059] FIG13 is a statistical graph showing the results of evaluating liver GSH using ibiome020, ibiome021, and ibiome022 of the present invention in an in vivo acute alcoholic liver injury mouse model.
[0060] FIG14 is a statistical graph showing the effects of ibiome022 of the present invention on the levels of ethanol and acetaldehyde in serum after drinking alcohol. DETAILED DESCRIPTION
[0061] For a better understanding of the present invention, the present invention is further described below in conjunction with embodiments and drawings. The following embodiments are merely illustrative of the present invention and are not intended to limit the present invention.
[0062] Example 1 Isolation of intestinal bacteria
[0063] Healthy volunteers who had not used antibiotics within one year were recruited. After signing the informed consent form, the volunteers collected 2 to 5 grams of fresh feces and placed them in a sample collection tube containing glycerol. After shaking and homogenization, the processed fecal samples were placed in an ice box and delivered to the applicant's laboratory for strain isolation within 24 hours.
[0064] ① Pretreatment of fecal samples: Take 1 mL of the mixture from the sample collection tube containing glycerol and feces, add it to 9 mL of 1× sterile PBS solution, vortex and mix well, then take 100 μL of the mixture and dilute it step by step to 10 -9 , used for flat plate coating.
[0065] ② Take 100 μL of the diluted sample and spread it on GAM (purchased from Qingdao Haibo Biological, product number HB8518-1), BHI (purchased from Qingdao Haibo Biological, product number HB8297-1), MRS (purchased from Solarbio, product number M8540), RCM (purchased from Qingdao Haibo Biological, product number HB0316) and other culture media. After the surface of the plate is dry, invert it and place it on a microaerobic workbench for culture (temperature: 37°C, O2: 5%, CO2: 5%, mixed gas: 90%). Incubate it for 24 to 36 hours. After a single clone colony grows, the single clone is purified by multiple streaking. The purified strain is sequenced by 16s rRNA to determine the taxonomic status of the strain.
[0066] 16s rRNA sequencing: 16s rRNA PCR amplification was performed on the strains to be identified. The amplification system consisted of 12.5 μL of 2Taq Master Mix (Novozymes; P112-01), 1 μL of primer 1 (27F: AGAGTTTGATCCTGGCTCAG), 1 μL of primer 2 (1492R: TACGGCTACCTTGTTACGACTT), 1 μL of liquid cultured bacteria, and 9.5 μL of ddH2O. Amplification conditions were: 95°C for 3 min, followed by 35 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 30 s, and finally 72°C for 5 min. The amplified product was sent to Qingke Biotechnology Co., Ltd. for sequencing. The resulting 16s rRNA gene sequence was submitted to the NCBI Basic Local Alignment Search Tool for 16s rRNA gene analysis. The species corresponding to the strain with the highest similarity was designated as the corresponding strain. This established a human intestinal microbial library.
[0067] Example 2 Initial screening and identification of acetaldehyde-resistant strains
[0068] We cultured the strains from the aforementioned human gut microbial library using a 0.1% (m / v) acetaldehyde solution (13.9 μL of a 36% acetaldehyde stock solution filtered through a 0.22 μm filter was added to 5 mL of MRS medium and mixed thoroughly). We discovered three strains of Lactobacillus fermentum with strong acetaldehyde tolerance, designated ibiome020, ibiome021, and ibiome022. The 16s rRNA sequences of these three strains, SEQ ID NOs. 1-3, were submitted to the NCBI Basic Local Alignment Search Tool for 16s rRNA gene analysis. Comparison results showed that the strains with the highest similarity were Limosilactobacillus fermentum strain NBRC 15885, Limosilactobacillus fermentum strain CIP 102980, and Limosilactobacillus fermentum strain NBRC 15885, with similarities of 99.66%, 99.65%, and 99.58%, respectively. Pairwise comparisons of the three strains revealed 16s rRNA sequence similarities of 99.52%, 99.52%, and 99.79%, respectively.
[0069] Smears of ibiome020, ibiome021, and ibiome022 were examined under a microscope at 40X, yielding the images shown in Figures 1-3. As can be seen from the images, ibiome020, ibiome021, and ibiome022 were Gram-positive, rod-shaped, short rod-shaped, or spherical, with no spores and no motility.
[0070] ibiome020, ibiome021, and ibiome022 were cultured on MRS medium for 48 h and photographed. The photos of single colonies are shown in Figure 4 , showing ibiome020: 1 mm in diameter, round, white, with a raised surface; ibiome021: 2 mm in diameter, round, milky white, with a raised surface; and ibiome022: 1 mm in diameter, irregular in shape, white, and flat.
[0071] Example 3 Lactobacillus fermentum can grow in high concentrations of acetaldehyde
[0072] To evaluate the acetaldehyde tolerance of the three strains of Lactobacillus fermentum, we tested their growth at different acetaldehyde concentrations. The experimental method is as follows:
[0073] Strain activation: Lactobacillus fermentum ibiome020, ibiome021, ibiome022 stored in 20% glycerol in a -80°C refrigerator, as well as Lactobacillus plantarum (control bacteria 1), Lactobacillus brevis (control bacteria 2), Lactobacillus rhamnosus (control bacteria 3) and two strains of Lactobacillus fermentum (control bacteria 4 and control bacteria 5) were taken out and thawed and mixed. 20 μL of the bacterial solution was respectively drawn and streaked on MRS medium. After recovery and culture in a 37°C anaerobic incubator for 24 hours, a single clone was picked to verify that the 16s rRNA sequence was correct, and the bacteria were inoculated into 5 mL of MRS medium and cultured in a 37°C anaerobic incubator overnight for activation.
[0074] Preparation of MRS medium containing acetaldehyde: 0.36 g / mL (36%) acetaldehyde mother solution was sterilized by filtration through a 0.22 μm pore size filter membrane. The volume of acetaldehyde mother solution was calculated according to Table 1 below, and added to MRS medium and mixed thoroughly to prepare MRS medium containing 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, and 0.4% acetaldehyde, respectively.
[0075] Table 1 Preparation of MRS medium containing acetaldehyde
[0076] Take 50 μL of activated ibiome020, ibiome021, ibiome022, control bacteria 1 (Lactobacillus plantarum), control bacteria 2 (Lactobacillus brevis), control bacteria 3 (Lactobacillus rhamnosus), control bacteria 4 (Lactobacillus fermentum), and control bacteria 5 (Lactobacillus fermentum) respectively and add them to the above-mentioned MRS medium containing 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, and 0.4% acetaldehyde, and culture in an anaerobic incubator at 37°C for 24 hours. OD was measured using a microplate reader. 600 , and observed its growth status. The results are shown in Table 2 and Figure 5.
[0077] Table 2 OD of Lactobacillus fermentum in culture medium with different acetaldehyde concentrations 600 value
[0078] Experimental results: ibiome020, ibiome021, and ibiome022 strains can still grow in a high concentration of 0.4% acetaldehyde, which is significantly better than the control strain, indicating that Lactobacillus fermentum ibiome020, ibiome021, and ibiome022 have significant acetaldehyde resistance advantages.
[0079] Example 4 Acetaldehyde metabolism by Lactobacillus fermentum 16h
[0080] To verify the ability of Lactobacillus fermentum to metabolize acetaldehyde, we used 2,4-dinitrophenylhydrazine pre-column derivatization-high performance liquid chromatography to detect the acetaldehyde metabolism of Lactobacillus fermentum for 16 hours.
[0081] Experimental methods:
[0082] 1. Reagent Preparation
[0083] (1) Saturated aqueous solution of 2,4-dinitrophenylhydrazine (DNPH): Take an appropriate amount of 2,4-dinitrophenylhydrazine (DNPH) solid, add a small amount of water, and drop concentrated sulfuric acid to dissolve it. Dilute it with water to make a saturated solution, extract and purify it with dichloromethane several times, and store it in a sealed container away from light.
[0084] (2) Acetate buffer solution (pH = 5): Weigh 25.1 g of sodium acetate, dissolve it in an appropriate amount of water, add 6 mL of concentrated acetic acid, and then dilute to 250 mL with water.
[0085] 2. Preparation of Standard Curve
[0086] (1) Accurately pipette 20 μL of acetaldehyde stock solution dissolved in MRS medium at 0, 100, 200, 500, 1000, 2000, and 4000 mg / L into test tubes. Add 500 μL of sodium acetate buffer solution (pH = 5) and 800 μL of saturated aqueous 2,4-dinitrophenylhydrazine to each tube, dilute to 10 mL with water, shake well, and derivatize in a 60°C water bath for 20 min.
[0087] (2) After cooling to room temperature, 3.00 mL of n-hexane was added to extract the derivative. After standing for stratification, 1 mL of the n-hexane layer was taken out with a pipette and blown dry in a nitrogen blower at 50 °C.
[0088] (3) Add 1 mL of mobile phase (acetonitrile: water = 52:48 (V:V)) and filter through a 0.22 μm filter into an automatic injection bottle for testing.
[0089] 3. Sample Pretreatment
[0090] (1) Prepare MRS medium containing 0.1% acetaldehyde, take 100 μL of activated bacterial suspensions of ibiome020, ibiome021, ibiome022, and control bacteria 1, centrifuge and remove the supernatant, add 1 mL of MRS medium containing 0.1% acetaldehyde, and culture in an anaerobic incubator at 37°C for 16 h;
[0091] (2) 100-fold dilution of bacterial solution for detection: After centrifugation of the bacterial solution, take 20 μL of the supernatant and transfer it to a test tube. Add 500 μL of sodium acetate buffer solution and 800 μL of saturated aqueous 2,4-dinitrophenylhydrazine to each tube, and add water to make up to 10 mL. The remaining steps are the same as above.
[0092] 4. Chromatographic conditions
[0093] Chromatographic column: Agilent Eclipse XDB C18 stainless steel column (250 mm×4.6 mm, 5 μm); mobile phase: acetonitrile:water = 52:48 (V:V); flow rate: 1.0 mL / min; detection wavelength: 365 nm; column temperature: 40°C; injection volume: 10 μL, isocratic elution.
[0094] Experimental results:
[0095] As shown in Table 3, in MRS medium containing 0.1% acetaldehyde, the acetaldehyde metabolism rate of Lactobacillus fermentum was as high as over 99% after anaerobic culture at 37°C for 16 h, while the control strain 1 metabolized only 8.7%, indicating that Lactobacillus fermentum has a strong acetaldehyde metabolism ability.
[0096] Table 3 Lactobacillus fermentum acetaldehyde metabolism detection results
[0097] Example 5 Acetaldehyde metabolism by Lactobacillus fermentum 4h
[0098] In order to verify the ability of Lactobacillus fermentum to metabolize high concentrations of acetaldehyde in a short time, we used 2,4-dinitrophenylhydrazine pre-column derivatization-high performance liquid chromatography to detect the acetaldehyde metabolism of Lactobacillus fermentum for 4 hours.
[0099] Except for sample pretreatment, the rest of the experimental methods are the same as Example 4.
[0100] Sample preparation:
[0101] (1) MRS culture medium containing 0.2%, 0.3%, and 0.4% acetaldehyde was prepared. The OD values of fresh bacterial cultures cultured overnight were 1.127, 1.1106, 1.2056, and 1.3677 for ibiome020, ibiome021, ibiome022, and control bacteria 1 (Lactobacillus plantarum), respectively. The amount of bacterial culture required for 2OD was calculated, and the culture was added to a 14 mL EP tube and centrifuged to remove the supernatant. 2 mL of MRS culture medium containing the three different acetaldehyde concentrations was then added, and the cells were cultured in an anaerobic incubator at 37°C for 4 h.
[0102] (2) Bacterial liquid dilution test: After centrifugation of the bacterial liquid, take 20 μL of the supernatant and transfer it to a test tube. Add 500 μL of sodium acetate buffer solution and 800 μL of saturated aqueous 2,4-dinitrophenylhydrazine to each tube, and add water to make the volume to 10 mL. The remaining steps are the same as above.
[0103] Experimental results:
[0104] As shown in Table 4, in MRS medium containing 0.2-0.4% acetaldehyde, under anaerobic culture at 37°C for 4 h, the acetaldehyde metabolism rates of Lactobacillus fermentum ibiome020, ibiome021, and ibiome022 were all above 80%, while the control strain 1 only metabolized 3.89-9.24%.
[0105] Table 4 Metabolism rate of high concentration acetaldehyde by Lactobacillus fermentum in 4 h
[0106] Example 6 Acetaldehyde metabolism by Lactobacillus fermentum 1-2h
[0107] In order to verify the ability of Lactobacillus fermentum to metabolize high concentrations of acetaldehyde in a short time, we used 2,4-dinitrophenylhydrazine pre-column derivatization-high performance liquid chromatography to detect the acetaldehyde metabolism of Lactobacillus fermentum in 1-2 hours.
[0108] Except for sample pretreatment, the rest of the experimental methods are the same as Example 4.
[0109] Sample preparation:
[0110] (1) MRS culture medium containing 0.2%, 0.3%, and 0.4% acetaldehyde was prepared. The OD values of fresh bacterial cultures cultured overnight were measured. The values of ibiome020, ibiome021, and ibiome022 were 1.2234, 1.258, and 1.4273, respectively. The amount of bacterial culture required for 2OD was calculated and added to 14 mL EP tubes, centrifuged, and the supernatant removed. 2 mL of MRS culture medium containing the three different acetaldehyde concentrations was added to each tube. The cells were cultured in an anaerobic incubator at 37°C for 2 h, and samples were taken at 1 h and 2 h.
[0111] (2) Bacterial liquid dilution test: After centrifugation of the bacterial liquid, take 20 μL of the supernatant and transfer it to a test tube. Add 500 μL of sodium acetate buffer solution and 800 μL of saturated aqueous 2,4-dinitrophenylhydrazine to each tube, and add water to make up to 10 mL. The remaining steps are the same as above.
[0112] Experimental results:
[0113] As shown in Table 5, in MRS medium containing 0.2-0.4% acetaldehyde, fermentative Lactobacillus ibiome020, ibiome021, and ibiome022 were cultured anaerobically at 37°C for 1 hour. The metabolic rates of 0.2% acetaldehyde ranged from 42.19% to 69.70%, 0.3% acetaldehyde ranged from 21.66% to 35.76%, and 0.4% acetaldehyde ranged from 13.48% to 22.96%. After 2 hours of culture, the metabolic rates of 0.2% acetaldehyde were above 90%, 0.3% acetaldehyde ranged from 61.55% to 87.89%, and 0.4% acetaldehyde ranged from 29.24% to 56.72%. Low concentrations metabolized most of the acetaldehyde in 1 hour and were essentially complete in 2 hours. High concentrations metabolized less in 1 hour and about half in 2 hours. Metabolism accelerated significantly over time.
[0114] Table 5 Metabolic rate of high concentration acetaldehyde by Lactobacillus fermentum 1-2h
[0115] Example 7 Lactobacillus fermentum can grow in high concentrations of ethanol
[0116] In order to verify the ability of Lactobacillus fermentum to tolerate ethanol, it was inoculated into different concentrations of ethanol to test its growth. The experimental method is as follows:
[0117] Strain activation: same as Example 3.
[0118] Prepare MRS medium containing ethanol: Calculate the volume of anhydrous ethanol according to Table 6, add it to the MRS medium and mix well to prepare MRS medium containing 0%, 10%, 12%, and 15% ethanol respectively.
[0119] Table 6 Preparation of MRS medium containing ethanol
[0120] Take 50 μL of activated ibiome020, ibiome021, ibiome022, and control bacteria 1 (Lactobacillus plantarum) culture medium respectively and add them to the above MRS medium containing 0%, 10%, 12%, and 15% ethanol, and culture them in an anaerobic incubator at 37°C for 24 hours. Measure OD with a microplate reader. 600 , observe its growth status, OD 600 The values are shown in Table 7.
[0121] Table 7 OD of Lactobacillus fermentum in different concentrations of ethanol culture medium 600 value
[0122] Experimental results:
[0123] As shown in Table 7, compared with the control medium without ethanol, the growth of Lactobacillus fermentum in the medium with 10%, 12%, and 15% ethanol content was not affected, showing excellent ethanol tolerance. However, the growth of control bacteria 1 (Lactobacillus plantarum) was significantly affected in the presence of ethanol.
[0124] Example 8 Lactobacillus fermentum has excellent gastrointestinal fluid resistance
[0125] In order to verify the tolerance of Lactobacillus fermentum to human gastrointestinal fluid and bile salts, an artificial gastrointestinal fluid environment was simulated to detect the number of viable Lactobacillus fermentum cells. The experimental method is as follows:
[0126] 1. Reagent Preparation
[0127] (1) Artificial gastric fluid: 10 g of pepsin (CSN pharm, CSN51458) was added to 800 mL of water, the pH was adjusted to 2 with dilute hydrochloric acid, and the volume was made up to 1000 mL with water.
[0128] (2) (0% bile salt) artificial intestinal fluid: Weigh 6.8 g of potassium dihydrogen phosphate and dissolve it in 500 mL of pure water. Adjust the pH to 8.0 with 0.1 mol / L sodium hydroxide solution. Dissolve 10 g of pancreatic enzyme (Aladdin, P110505) in an appropriate amount of water. Mix the two solutions and dilute to 1000 mL with water.
[0129] (3) (0.6% bile salt) artificial intestinal fluid: Bile salt (OXOID, LP0055) solid was added to the above (0% bile salt) artificial intestinal fluid to prepare a 0.6% (m / v) bile salt simulated intestinal fluid group.
[0130] 2. Simulated artificial gastric juice experiment
[0131] The activated bacterial suspension was shaken and mixed, 1 mL of bacterial suspension was added to 9 mL of artificial gastric fluid (pH = 2.0), and cultured at 37 ° C for 3 h. The artificial gastric fluid cultured for 0, 1, and 3 h was used to count the viable bacteria on the plate: 20 μL of bacterial suspension was added to a 96-well plate containing 180 μL of sterile water, and the dilution was graded to 10 -6 ; 10 -1 -10 -6 100 μL of each solution was applied, and the survival rate was calculated according to formula 1, with 0 h as the control.
[0132] Survival rate of simulated artificial gastric fluid (%) = Nt / N0*100% Formula I
[0133] Wherein, Nt represents the number of viable bacteria after incubation for th hour, and N0 represents the number of viable bacteria at 0 hour.
[0134] 3. Simulated artificial intestinal fluid (0% bile salt) experiment
[0135] Take 1 mL of the artificial gastric fluid from the two cultures after 3 hours of culture and add it to 9 mL of artificial intestinal fluid containing 0% bile salts (pH = 8.0) and incubate at 37°C for 3 hours. Take the artificial intestinal fluid from the cultures for 0, 1, and 3 hours respectively for plate count of viable bacteria: take 20 μL of the bacterial solution and add it to a 96-well plate containing 180 μL of sterile water, and dilute it to 10 -6 ; 10 -1 -10 -6 100 μL of each solution was applied, and the survival rate was calculated according to Formula II, with 0 h as the control.
[0136] Survival rate in simulated artificial intestinal fluid (%) = Nt / N0*100% Formula II
[0137] Wherein, Nt represents the number of viable bacteria after incubation for th hour, and N0 represents the number of viable bacteria at 0 hour.
[0138] 4. Simulated artificial intestinal fluid (0.6% bile salt) experiment
[0139] Take 1 mL of the artificial gastric fluid from the two cultures after 3 hours of culture and add it to 9 mL of artificial intestinal fluid containing 0.6% bile salts (pH = 8.0) and incubate at 37°C for 3 hours. Take the artificial intestinal fluid from 0, 1, and 3 hours of culture for plate count of viable bacteria: take 20 μL of the bacterial solution and add it to a 96-well plate containing 180 μL of sterile water, and dilute it to 10 -6 ; 10 -1 -10 -6 100 μL of each solution was applied, and the survival rate was calculated according to Formula II, with 0 h as the control.
[0140] Experimental results:
[0141] In addition to being digested in the stomach, foreign bacteria must also be digested and transported through the small intestine before they can reach their destination, colonize, and function. Therefore, the study tested the ability of the three strains of fermented lactobacillus to tolerate gastrointestinal fluid and bile salts. The results are shown in Tables 8-10 and Figures 6-8. As shown in Table 8 and Figure 6, after being treated with simulated gastric fluid for 3 hours, the viable CFU of the strains remained at 10 8 The strain can survive and grow in gastric fluid and has excellent acid tolerance. Table 9 and Figure 7 show that after 3 hours of treatment with simulated intestinal fluid, the viable CFUs remained at the same level, indicating that the strain can survive and grow in intestinal fluid and has excellent alkali tolerance. Table 10 and Figure 8 show that after 3 hours of treatment with simulated intestinal fluid containing 0.6% bile salts, the survival rates at 0.6% and 0% bile salt concentrations are similar, indicating that the strain can survive and grow in intestinal fluid with higher bile salt concentrations and has excellent bile salt tolerance.
[0142] Table 8 Lactobacillus fermentum gastric juice tolerance test results
[0143] Table 9 Lactobacillus fermentum intestinal juice tolerance test results
[0144] Table 10 Lactobacillus fermentum bile salt tolerance test results
[0145] Example 9 Preparation of bacterial powder containing Lactobacillus fermentum
[0146] Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021, Lactobacillus fermentum ibiome022 (2*10 9 The fermented Lactobacillus powder is prepared by anaerobic culture using MRS medium (CFU / mL) at 37° C. for 24-36 hours, centrifuging, cooling and drying until the moisture content is less than 3%, thereby preparing the powder. The powder can be used as a fermentation agent, functional bacterial agent or medicine after packaging.
[0147] Example 10 Solid beverage containing lactobacillus fermentum
[0148] A solid beverage containing Lactobacillus fermentum ibiome020 comprises the following components by weight: 5% dietary fiber powder, 35% stachyose, 30% maltodextrin, and 30% Lactobacillus fermentum ibiome020. The preparation method is as follows:
[0149] (1) Preparation: Weigh dietary fiber powder, stachyose, maltodextrin, and Lactobacillus fermentum ibiome020 according to the formula mass and set aside;
[0150] (2) Preliminary mixing: Dietary fiber powder, stachyose, and maltodextrin are added and mixed uniformly to obtain a preliminary mixing material for later use;
[0151] (3) Secondary mixing: adding Lactobacillus fermentum ibiome020 to the primary mixture prepared in step (2), and stirring at low temperature to mix uniformly;
[0152] (4) Packaging: The materials mixed in step (3) are packaged to prepare a solid beverage containing Lactobacillus fermentum ibiome020.
[0153] Example 11 Dairy products containing Lactobacillus fermentum
[0154] A coagulated fermented dairy product containing Lactobacillus fermentum ibiome021 is prepared according to the following steps:
[0155] (1) Weigh 10 kg of raw milk, standardize it, add 5 g of zinc sulfate and 0.8 kg of arabinose, mix well, and pour into a mixing tank to prepare material 1;
[0156] (2) homogenizing material 1 at 70°C and 20 MPa for 10 min, and sterilizing at 90-95°C for 5-10 min to obtain material 2;
[0157] (3) Material 2 is rapidly cooled to 35-39° C., inoculated with Lactobacillus fermentum ibiome021 at a rate of 0.01%, filled, covered, and fermented at 37° C. until curdled milk is obtained. The fermentation is terminated when the curdled milk is in a good state and the pH reaches 4.2-4.5. The fermentation is stopped and the material is rapidly placed in a cold storage room at 2-6° C. and post-ripened for 12 hours to obtain a coagulated fermented milk (i.e., yogurt) prepared by using Lactobacillus fermentum ibiome021 as a starter.
[0158] Example 12 Fermented fruit and vegetable products containing Lactobacillus fermentum
[0159] A fermented fruit and vegetable product containing Lactobacillus fermentum ibiome022, the specific preparation method is as follows:
[0160] (1) Take 5 kg of fruit and vegetable raw materials, add 5 kg of purified water, 5 g of zinc sulfate, and 1.0 kg of arabinose, and mix them evenly to prepare material 3;
[0161] (2) homogenizing material 3 at 70°C and 20 MPa for 10 min, and sterilizing at 90-95°C for 5-10 min to obtain material 4;
[0162] (3) The material 3 was rapidly cooled to 37°C, inoculated with Lactobacillus fermentum ibiome022 at an inoculum rate of 0.01%, filled, covered, and fermented in a 37°C fermentation room for 16 hours, and then rapidly cooled to 4°C for post-maturation and maintained for about 12 hours to obtain a fermented fruit and vegetable product prepared with Lactobacillus fermentum ibiome022 as a starter.
[0163] Example 13 Evaluation of in vivo hangover relief effect
[0164] 1. Experimental Methods
[0165] (1) Mouse grouping:
[0166] Forty male C57BL / 6J mice were randomly divided into four groups according to body weight, with 10 mice in each group. They were adaptively fed for 3 days. The group information is as follows:
[0167] ① Model group: gavage with 0.2 mL PBS;
[0168] ②ibiome020: oral gavage 10 9CFU / Limosilactobacillus fermentum ibiome020 bacterial powder;
[0169] ③ibiome021: oral administration 10 9 CFU / Limosilactobacillus fermentum ibiome021 bacterial powder;
[0170] ④ibiome022: oral gavage 10 9 CFU / piece of Lactobacillus fermentum ibiome022 bacterial powder.
[0171] (2) Oral gavage and index determination:
[0172] Before the experiment, mice were fasted but not watered for 16 hours. Mice in each group were gavaged with the corresponding drug (probiotics or PBS), and 1 hour after the drug administration, they were gavaged with 0.3 mL / 20 g of alcohol solution, where the alcohol solution was a 50% ethanol-water solution by volume. After gavage with alcohol, the mice in each group were observed for drunkenness, and the drunkenness time (the time from gavage to the disappearance of the righting reflex, i.e., the righting reflex disappearance time) and the sobering time (the time from the disappearance of the righting reflex to the recovery, i.e., the righting reflex recovery time) were recorded. After gavage, the mice were gently placed on their backs. If they maintained the back-down position for more than 30 seconds, i.e., the righting reflex disappeared, they were considered drunk.
[0173] 2. Experimental Results
[0174] After acute alcohol consumption, the amount of alcohol in the body exceeds the body's maximum metabolic capacity, causing a sharp rise in blood alcohol concentration. Alcohol then enters the brain through the bloodstream, affecting central nervous system function and manifesting as alcohol intoxication. The effectiveness of alcohol-detoxifying drugs can be tested by the incubation period (drunkenness time) and the duration of sleep after intoxication (sobering time). As shown in Figure 9, oral administration of Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021, and Lactobacillus fermentum ibiome022 delayed the time to intoxication in mice (Figure 9A). Compared to the model group, the delays were 224.97% (P < 0.05), 140.94%, and 205.77% (P = 0.06), respectively. At the same time, oral administration of Lactobacillus fermentum ibiome022 was able to shorten the sobering time of mice ( FIG. 9B ), which was shortened by 30.88% compared with the model group ( P = 0.09).
[0175] Example 14 In vivo acute alcoholic liver injury mouse model - evaluation of survival rate and liver index
[0176] 1. Experimental Methods
[0177] (1) Mouse grouping:
[0178] Forty male C57BL / 6J mice were randomly divided into four groups according to body weight, with 10 mice in each group. They were adaptively fed for 3 days. The group information is as follows:
[0179] ① Model group: gavage with 0.2 mL PBS;
[0180] ②ibiome020: oral gavage 10 9 CFU / Limosilactobacillus fermentum ibiome020 bacterial powder;
[0181] ③ibiome021: oral administration 10 9 CFU / Limosilactobacillus fermentum ibiome021 bacterial powder;
[0182] ④ibiome022: oral gavage 10 9 CFU / piece of Lactobacillus fermentum ibiome022 bacterial powder.
[0183] (2) Oral gavage and index determination:
[0184] Before the experiment, mice in each group were gavaged with the corresponding drug (probiotics or PBS) once daily, and 1 hour after drug administration, they were gavaged with 0.2 mL / 20 g of an alcohol solution (50% ethanol in water). This gavage regimen continued for 7 days. On the 7th day, mice were fasted for 12 hours and sacrificed by cervical dislocation. The livers were removed and weighed, and the mouse liver index (liver weight / body weight) was calculated. Mouse deaths were recorded during the experiment, and survival curves were plotted and survival rates calculated.
[0185] 2. Experimental Results
[0186] High concentrations of alcohol can cause a certain degree of mortality in mice. As shown in Figure 10, compared with the model group, oral administration of Lactobacillus fermentum ibiome022 significantly improved the survival rate of mice (P<0.05) and reduced mortality by 40%. Oral administration of Lactobacillus fermentum ibiome020 and Lactobacillus fermentum ibiome021 also reduced mouse mortality by 20% and 30%, respectively.
[0187] Alcohol-induced liver damage triggers lipid metabolism disorders and fat accumulation in hepatocytes, leading to fatty degeneration of hepatocytes, liver enlargement, increased liver weight, and ultimately an elevated liver index. As shown in Figure 11, compared with the model group, oral administration of Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021, and Lactobacillus fermentum ibiome022 significantly reduced the liver index in mice (P < 0.05, P < 0.05, and P < 0.05).
[0188] Example 15 In vivo acute alcoholic liver injury mouse model - evaluation of serum AST and ALT and liver GSH
[0189] 1. Experimental Methods
[0190] (1) Mouse grouping:
[0191] Forty male C57BL / 6J mice were randomly divided into four groups according to body weight, with 10 mice in each group. They were adaptively fed for 3 days. The group information is as follows:
[0192] ① Model group: gavage with 0.2 mL PBS;
[0193] ②ibiome020: oral gavage 10 9 CFU / Limosilactobacillus fermentum ibiome020 bacterial powder;
[0194] ③ibiome021: oral administration 10 9 CFU / Limosilactobacillus fermentum ibiome021 bacterial powder;
[0195] ④ibiome022: oral gavage 10 9 CFU / piece of Lactobacillus fermentum ibiome022 bacterial powder.
[0196] (2) Oral gavage and index determination:
[0197] Before the experiment, mice in each group were gavaged with the corresponding drug (probiotics or PBS) once daily. Two days after gavage, mice were gavaged with the corresponding drug (probiotics or PBS) on the third day. One hour later, mice were gavaged with 0.3 mL / 20 g of an alcohol solution (50% ethanol in water), and six hours later, mice were gavaged again with 0.15 mL / 20 g of an alcohol solution (50% ethanol in water). After gavage, mice were fasted for 12 hours, then blood and liver samples were collected for analysis of serum AST and ALT levels and liver GSH levels.
[0198] 2. Experimental Results
[0199] AST and ALT are two types of transaminases present in liver cells. AST is mainly present in mitochondria, and ALT is present in the cell fluid. When liver cells suffer from severe lesions or necrosis, AST and ALT in the liver cells will leak from the liver cells into the blood. Therefore, changes in the activity of AST and ALT in serum can be used as a specific indicator to determine whether there is damage in liver cells. As shown in Figure 12, compared with the model group, Lactobacillus fermentum ibiome022 can significantly reduce the levels of AST and ALT, indicators of liver damage, in serum (P<0.01, P<0.05).
[0200] High doses of alcohol induce oxidative stress in the liver. Glutathione (GSH) is the primary endogenous antioxidant that protects cells against oxidative stress. As shown in Figure 13, oral administration of Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021, and Lactobacillus fermentum ibiome022 significantly increased GSH levels in the liver (P < 0.001, P < 0.01, and P < 0.05, respectively).
[0201] Example 16 Effect of Limosilactobacillus fermentum ibiome022 on Serum Ethanol and Acetaldehyde Levels
[0202] 1. Experimental Methods
[0203] (1) Mouse grouping:
[0204] Twenty male C57BL / 6J mice were randomly divided into two groups according to body weight, with 10 mice in each group. They were adaptively fed for 3 days. The group information is as follows:
[0205] ① Model group: gavage with 0.2 mL PBS;
[0206] ②ibiome022: oral administration 10 9 CFU / piece of Lactobacillus fermentum ibiome022 bacterial powder.
[0207] (2) Oral gavage and index determination:
[0208] Mice in each group were gavaged with the corresponding drug (probiotics or PBS) once daily for two consecutive days. At 6:00 PM on the second day, they were deprived of food but not water. On the third day, mice were gavaged with the drug (probiotics or PBS) first, followed one hour later by gavage with 0.3 mL / 20 g of an alcohol solution (50% ethanol in water). Blood was collected 4 and 8 hours after gavage for determination of serum ethanol and acetaldehyde levels.
[0209] 2. Experimental Results
[0210] The rapid increase in ethanol and acetaldehyde levels in the body caused by drinking alcohol is the direct cause of damage to the body. We directly tested the levels of ethanol and acetaldehyde in the serum of mice after gavage with Lactobacillus fermentum ibiome022 and alcohol solution. The results are shown in Figure 14. Gavage with Lactobacillus fermentum ibiome022 significantly reduced the ethanol content in the serum of mice 4 hours and 8 hours after drinking alcohol (P < 0.05, P < 0.05) and the acetaldehyde content in the serum 8 hours after drinking alcohol (P < 0.05). Compared with the model group, the ethanol content in the serum decreased by 13% and 11% 4 hours and 8 hours after drinking alcohol, respectively (Figure 14A); the acetaldehyde content in the serum decreased by 33% 8 hours after drinking alcohol (Figure 14B).
[0211] The above-described embodiments are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.
Claims
1. Use of a microbial strain, or a culture of the microbial strain, or a processed product thereof, in the preparation of a hangover remedy, characterized in that: The microbial strain belongs to Limosilactobacillus fermentum and has a 16srRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO:
3.
2. The use according to claim 1, wherein the alcohol detoxification drug comprises at least one of the following: Medications to relieve chronic / acute alcohol intoxication; Medications to relieve alcohol-induced intestinal damage or alcohol-induced liver damage.
3. Use of a fermentation agent / functional bacterial agent / nutritional composition in the preparation of a product for alcohol sobering and / or liver protection, characterized in that: The fermentation agent / functional bacterial agent / nutritional composition comprises a Limosilactobacillus fermentum strain, or a culture or processed product thereof, and the strain has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:
3.
4. Use of a microbial strain, or a culture or processed product thereof, a fermentation agent, a functional bacterial agent, or a nutritional composition thereof for the purpose of sobering up for purposes other than diagnosis or treatment of a disease, characterized in that: The microbial strain belongs to Limosilactobacillus fermentum and has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; the starter / functional bacterial agent / nutritional composition contains the Limosilactobacillus fermentum strain, or a culture or processed product thereof, and the strain has a 16s rRNA sequence that is at least 99.52%, at least 99.58%, at least 99.65%, at least 99.66%, at least 99.79% or 100% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:
3.
5. The use according to any one of claims 1 to 4, characterized in that: The hangover remedy comprises at least one of the following: Accelerate the metabolism of ethanol and / or acetaldehyde; Delayed onset of intoxication; Shorten the sobering time; Reduce alcohol-related mortality; Reduce liver index; Reduce serum AST and / or ALT levels; Relieve discomfort caused by ethanol and / or acetaldehyde; Improve alcohol-induced oxidative stress, such as increasing GSH levels in the liver.
6. A microbial strain characterized by: The microbial strain is at least one of the strains of Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021 and Lactobacillus fermentum ibiome022 preserved with the accession numbers CCTCC NO: M 2024188, CCTCC NO: M 2024222 and CCTCC NO: M 2024189, wherein the Lactobacillus fermentum ibiome020, Lactobacillus fermentum ibiome021 and Lactobacillus fermentum ibiome022 are selected from the group consisting of: fermentum)ibiome022 strain was deposited in the China Center for Type Culture Collection, located at China Center for Type Culture Collection, Wuhan University, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with the deposit dates of January 24, 2024, January 26, 2024, and January 24, 2024, respectively.
7. A culture of the microbial strain according to claim 6 or a processed product thereof.
8. A drug, characterized in that: The composition comprises the microbial strain according to claim 6, or the culture or processed product of the microbial strain according to claim 7, and pharmaceutically acceptable excipients. Preferably, the excipients include at least one of an adjuvant, a stabilizer or a protective agent, an antibacterial agent, an excipient, a solubilizer, a flavoring agent, a diluent, and a buffer.
9. A pharmaceutical composition, characterized in that: The method comprises the microbial strain according to claim 6, or a culture or a processed product thereof of the microbial strain according to claim 7, and a combined drug, wherein the combined drug is another drug that acts synergistically with Limosilactobacillus fermentum.
10. A fermentation agent / functional bacterial agent / nutrient composition, characterized in that: Comprising the microbial strain according to claim 6, or the culture of the microbial strain according to claim 7 or a processed product thereof; preferably, the nutritional composition is a food, a nutritional product, a supplement, a probiotic or a symbiotic bacteria.
Citation Information
Patent Citations
Anthropogenic lactobacilus fermentum grx07 and application thereof
CN103937716A
Microorganism having ability to degrade ethanol and acetaldehyde, and composition and kit each including the same
CN111566200A
Application of lactobacillus fermentum grx08 in preparation of food, functional food and medicine with effects of relieving alcoholic liver injury and related symptoms thereof
CN116268422A
Fermented lactobacillus mucilaginosus with function of relieving alcoholic liver injury and application of fermented lactobacillus mucilaginosus
CN116656542A
Lactobacillus fermentum strain A21252 for dispelling effects of alcohol, protecting liver, resisting oxidation and relieving digestive tract injury and application of lactobacillus fermentum strain A21252
CN117165488A