Methods and compositions for the treatment of autosomal dominant polycystic kidney disease

Abstract

Compositions for the treatment of Autosomal Dominant Polycystic Kidney Disease (ADPKD) are provided, in particular for targeted genomic or mRNA editing to treat ADPKD The compositions comprise a nucleic acid encoding at least one guide RNA (gRNA) wherein the at least one gRNA is configured to hybridise with a region within a 3' untranslated region (UTR) of a PKD1 gene, optionally wherein the region is proximal to or within a miR-17 binding site. Removal or disruption of the miR-17 binding site reduces or eliminates miRNA-17 mediated suppression of expressed PKD1 mRNA within target cells of the kidney thereby treating ADPKD.

Description

[0001] METHODS AND COMPOSITIONS FOR THE TREATMENT OF AUTOSOMAL DOMINANT POLYCYSTIC KIDNEY DISEASE

[0002] FIELD OF THE INVENTION

[0003] The present application relates to methods and compositions for the treatment of Autosomal Dominant Polycystic Kidney Disease (ADPKD), in particular methods and compositions for targeted genomic editing to treat ADPKD. The present application also provides guide RNAs for use in CRISPR systems to treat ADPKD.

[0004] BACKGROUND OF THE INVENTION

[0005] Autosomal dominant polycystic kidney disease (ADPKD), among the most common human genetic conditions and a frequent etiology of kidney failure, is primarily caused by heterozygous mutations in the PKD1 or PKD2 genes. ADPKD is characterized by fluid-filled cyst development and causes progressive and irreversible deterioration of kidney function. An estimated 12.5 million people worldwide suffer from ADPKD, making it among the most common monogenetic conditions known to humankind. ADPKD occurs because of heterozygous, loss-of-fu notion mutations in PKD1 (~78% of cases) or PKD2 (~15% of cases).

[0006] Mutations in the PKD1 gene are the most common cause of ADPKD. This locus previously had been mapped to a gene-rich 500 kb interval in band 16p13.3 (Germino et al., 1992) that includes the TSC2 locus for tuberous sclerosis (TS) (European Chromosome 16 Tuberous Sclerosis Consortium, 1993). Some TS patients are known to develop renal cystic lesions that resemble those of ADPKD, which led investigators to examine families with TS for positional segregation of ADPKD (International Polycystic Kidney Disease Consortium. "Polycystic kidney disease: the complete structure of the PKD1 gene and its protein." Cell 81 .2 (1995): 289-298.). miR-17 is believed to be the primary pathogenic miRNAto promote cyst growth within miR17-92 family through in vivo screening of anti-miRNAs targeting miR-17, miR-18, miR-19 or miR-25 individually. Anti- miR-17 treatment slowed cyst growth in Pkd1 flox / RC:Ksp-Cre mice, a mouse model that carries a flox allele and a R3277C mutant allele of Pkd1 gene, through regulating mitochondrial metabolism, mTOR pathway, and inflammation. Specifically, miR-17 inhibits the expression of peroxisome proliferator- activated receptor-a (PPARa) by binding to the 3'-UTR of its mRNA. miR-17 downregulated the expression of PPARa target genes in cystic kidneys, including Pparg, Ppargd a, Sod2, Me, Oxctl , Pdk4, Etfa, Etfb, Etfdh, Cd36, Slc27a2, and Cpt2. PPARa is the key regulator of mitochondrial oxidative phosphorylation (OXPHOS) and fatty acid oxidation (FAO), suggesting that miR-17 promotes cyst growth through affecting the mitochondrial metabolism in renal epithelial cells. These findings also indicate that miR-17-PPARa axis-mediated mitochondrial dysfunction is one of the alterations leading to the pro-proliferative metabolic reprogramming of cyst epithelia, in addition to the defective glucose metabolism and dysregulated lipid and amino acid metabolism. Lakhia et al (Nature Communications volume 13, Article number: 4765 (2022)) examined mRNAs produced by a non-inactivated PKD1 allele and showed that they are repressed via their 3'-UTR miR- 17 binding element. In a mouse model, Lakhia et al. showed that eliminating this motif improved mRNA stability, raised Polycystin-1 levels, and alleviated cyst growth.

[0007] There exists a need to develop novel approaches to address ADPKD in humans and to provide strategies that are safe and effective to use in vivo. These and other uses, features and advantages of the invention should be apparent to those skilled in the art from the teachings provided herein.

[0008] SUMMARY OF THE INVENTION

[0009] In a first aspect, this disclosure provides a composition comprising: a. a first ribonucleoprotein (RNP) comprising a first sequence-guided endonuclease and a first guide RNA (gRNA) wherein the first gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a human PKD1 gene upstream of a miR-17 binding site; and b. a second RNP comprising a second sequence-guided endonuclease and a second guide RNA (gRNA) wherein the second gRNA is configured to hybridise with a region within the 3’ UTR of the human PKD1 gene downstream of the said miR-17 binding site.

[0010] The first gRNA comprises a sequence of nucleotides selected from any one of SEQ ID NO 1 to SEQ ID NO 1316, or the reverse complement thereof as defined in any one of SEQ ID NOS 1317 to SEQ ID NO 2632.

[0011] In a specific embodiment, the first gRNA comprises a nucleotide sequence comprising at least 80% similarity to SEQ ID NO 1976 and / or the second gRNA comprises a nucleotide sequence comprising at least 80% similarity to SEQ ID NO 2780.

[0012] In embodiments, the first gRNA comprises a nucleotide sequence comprising at least 80% similarity to a sequence selected from: SEQ ID NO 1945, SEQ ID NO 560, SEQ ID NO 555, SEQ ID NO 1963, SEQ ID NO 600, SEQ ID NO 1907 and SEQ ID NO 540.

[0013] In embodiments, the second gRNA comprises a nucleotide sequence comprising at least 80% similarity to a sequence selected from: SEQ ID NO 2973, SEQ ID NO 2986, SEQ ID NO4247, SEQ ID NO4393, SEQ ID NO 4396, SEQ ID NO4378 and SEQ ID NO 4225.

[0014] In an embodiment, the first sequence-guided endonuclease is selected from: Cas9, Cpf1 , Cas12a, Cas12b, or CasX, and variants or derivatives of any thereof. In another embodiment, the second sequence-guided endonuclease is selected from: Cas9, Cpf1 , Cas12a, Cas12b, or CasX, and variants or derivatives of any thereof.

[0015] In a specific embodiment, the first and / or second sequence-guided endonuclease is an endonuclease having Cas9 activity or a variant or derivative thereof, such as those selected from SpCas9, SpCas9_NAG, and XCas9_3.7.

[0016] In a second aspect, this disclosure provides a method of treating a kidney disease, said method comprising administering a composition according to the first aspect. Suitably the kidney disease is ADPKD.

[0017] A third aspect of the invention provides, a composition comprising: a. a first nucleic acid encoding a first guide RNA (gRNA) wherein the first gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a PKD1 gene upstream of a miR-17 binding site; and b. a second nucleic acid encoding a second gRNA wherein the second gRNA is configured to hybridise with a region within a 3’ UTR of a PKD1 gene downstream of a miR-17 binding site.

[0018] A fourth aspect of the invention provides a pharmaceutical composition comprising any one of the compositions described, and a pharmaceutically acceptable carrier.

[0019] A fifth aspect of the invention provides a method of editing a PKD1 gene comprised within a genome of a human somatic cell in order to remove a miR-17 binding site from a 3’ UTR located within the said PKD1 gene, the method comprising contacting the human somatic cell with any of the compositions described herein.

[0020] A sixth aspect of the invention provides a method of treating autosomal dominant polycystic kidney disease (ADPKD) in a human patient in need thereof, the method comprising editing a PKD1 gene comprised within a genome of a somatic cell present in a kidney of the human patient in order to remove a miR-17 binding site from a 3’ UTR located within the said PKD1 gene, the method comprising contacting the somatic cell with any of the compositions described herein.

[0021] A seventh aspect provides a composition comprising a nucleic acid encoding at least one guide RNA (gRNA) wherein the at least one gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a PKD1 gene. Optionally, the said region is proximal to or within a miR-17 binding site, suitably the region spans at least a portion of a miR-17 binding site.

[0022] An eighth aspect of the invention provides a method of editing a PKD1 gene comprised within a genome of a human somatic cell in order to mutate a miR-17 binding site located within a 3’ UTR located within the said PKD1 gene, the method comprising contacting the human somatic cell with any of the compositions described herein. A ninth aspect of the invention provides for a composition comprising a nucleic acid encoding at least one gRNA wherein the at least one gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a PKD1 gene proximal to or within a miR-17 binding site, and wherein at least one gRNA comprises a sequence of nucleotides selected from any one of SEQ ID NO: 1 to SEQ ID NO: 1316, or the reverse complement thereof as defined in any one of SEQ ID NO: 1317 to SEQ ID NO: 2632.

[0023] Within the scope of this application, it is expressly intended that the various aspects, embodiments, examples and alternatives set out in the preceding paragraphs, in the claims and / or in the following description and drawings, and in particular the individual features thereof, may be taken independently or in any combination. That is, all embodiments and / or features of any embodiment can be combined in any way and / or combination, unless such features are incompatible.

[0024] BRIEF DESCRIPTION OF THE DRAWINGS

[0025] One or more embodiments of the invention will now be described, by way of example only, with reference to the accompanying drawings, in which:

[0026] Figure 1 shows gel electrophoresis analysis of a PCR assay confirming deletion of an 88bp region in PKD1 gene of HEK293T cells transfected with a guide RNA pair disclosed herein according to one embodiment of the invention. Lanes are marked L1 to L5, in which L1 : 100 bp DNA ladder; L2: HEK293T untransfected control; L3: HEK293T transfected with sgRNAI ; L4: HEK293T transfected with sgRNA2; L5: HEK293T transfected with sgRNA 1 and sgRNA2.

[0027] Figure 2 shows the results of a T7E1 assay confirming editing of PKD1 in HEK293T cells. Lanes are marked L1 to L5, in which L1 : 100 bp DNA ladder; L2: HEK293T untransfected control; L3: HEK293T transfected with sgRNAI ; L4: HEK293T transfected with sgRNA2; L5: HEK293T transfected with sgRNA 1 and sgRNA2.

[0028] Figure 3 shows gel electrophoresis analysis of a PCR assay confirming deletion of an 88bp region in PKD1 gene of HEK293T cells using two different compositions with different endonuclease to gRNA molar ratios. Lanes are marked L1 to L4, in which L1 : 100 bp DNA ladder; L2: HEK293T untransfected control; L3: HEK293T transfected with 500ng Cas9 mRNA, 250ng sgRNAI , 250ng sgRNA2; L4: HEK293T transfected with transfected with 1000ng Cas9 mRNA, 500ng sgRNAI , 500ng sgRNA2.

[0029] Figure 4 shows the results of a T7E1 assay confirming editing of PKD1 in HEK293T cells using two different compositions with different endonuclease to gRNA molar ratios. Lanes are marked L1 to L4, in which L1 : 100 bp DNA ladder; L2: HEK293T untransfected control; L3: HEK293T transfected with 500ng Cas9 mRNA, 250ng sgRNAI , 250ng sgRNA2; L4: HEK293T transfected with transfected with 1000ng Cas9 mRNA, 500ng sgRNAI , 500ng sgRNA2.

[0030] Figure 5 shows CLUSTAL alignment of sequence in unedited and edited PKD1 in HEK293T (SEQ ID NOs: 5631 and 5632) by dual guide RNAs showing 87bp excision of the desired target region. Figure 6 shows gel electrophoresis analysis of a PCR assay confirming deletion of an 88bp region in PKD1 gene of WT9-12 cells transfected with a guide RNA pair disclosed herein. Lanes are marked L1 to L5, in which L1 : 100 bp DNA ladder; L2: WT 9-12 untransfected control; L3: WT 9-12 transfected with 500ng Cas9 mRNA, 250ng sgRNAI , 250ng sgRNA2; L4: WT 9-12 transfected with 500ng Cas9 mRNA, 500ng sgRNAI , 500ng sgRNA2; L5: WT 9-12 transfected with transfected with 1000ng Cas9 mRNA, 500ng sgRNAI , 500ng sgRNA2.

[0031] Figure 7 shows the results of a T7E1 assay confirming editing of PKD1 in WT9-12 cells. Lanes are marked L1 to L5, in which L1 : 100 bp DNA ladder; L2: WT 9-12 untransfected control; L3: WT 9-12 transfected with 500ng Cas9 mRNA, 250ng sgRNAI , 250ng sgRNA2; L4: WT 9-12 transfected with 500ng Cas9 mRNA, 500ng sgRNAI , 500ng sgRNA2; L5: WT 9-12 transfected with transfected with 1000ng Cas9 mRNA, 500ng sgRNAI , 500ng sgRNA2.

[0032] Figure 8 shows gel electrophoresis analysis of a PCR assay confirming deletion of an 88bp region in PKD1 gene of WT9-12 cells using 500ng Cas9 + 250ng gRNA1 (AAGAGGCTGTGTGGCCAACCAGG SEQ ID NO: 1976) + 250ng gRNA2 (CTACGTGCAGCCATTCTGCCTGG SEQ ID NO: 2780). Lanes are marked L1 to L3, in which L1 : 100 bp DNA ladder; L2: WT 9-12 untransfected control; L3: WT 9-12 transfected with 500ng Cas9 mRNA, 250ng sgRNAI , 250ng sgRNA2.

[0033] Figure 9 shows the results of a T7E1 assay confirming editing of PKD1 in WT9-12 cells using 500ng Cas9 + 250ng gRNA1 + 250ng gRNA2. Lanes are marked L1 to L3, in which L1 : 100 bp DNA ladder; L2: WT 9-12 untransfected control; L3: WT 9-12 transfected with 500ng Cas9 mRNA, 250ng sgRNAI , 250ng sgRNA2.

[0034] Figure 10 provides the results of an equivalent further assay as described in Figure 8

[0035] Figure 11 provides the results of an equivalent further assay as described in Figure 9

[0036] Figure 12 shows CLUSTAL alignment of sequence in unedited and edited PKD1 in WT9-12 (SEQ ID NOs: 5633 and 5634) by dual guide RNAs showing 87bp excision of the desired target region.

[0037] Figure 13 shows a graphical representation of relative expression of PKD1 in WT9-12 untransfected cells versus WT9-12 transfected cells utilising gRNAs disclosed herein. The relative expression was normalized with human p-actin and GADPH mRNA and the values were calculated using 2ACtmethod. Data (n=3) was expressed as + / - SEM (***p <0.001 ; one way ANOVA followed by SNK test).

[0038] Figure 14 shows a schematic representation of PKD1 regulation by miR-17 and the strategy for rescue by gene editing to remove the miR-17 binding motif.

[0039] Figure 15 shows gel electrophoresis analysis of a PCR assay confirming deletion of an 88bp region in PKD1 gene of WT 9-7 cells transfected with a guide RNA pair disclosed herein. Lanes are marked L1 to L3, in which L1 : 100 bp DNA ladder; L2: WT 9-7 untransfected control; L3: WT 9-7 transfected with 500ng Cas9 mRNA, 250ng sgRNAI , 250ng sgRNA2.

[0040] Figure 16 provides the results of an equivalent further assay as described in Figure 15 Figure 17 provides the results of an equivalent further assay as described in Figure 15

[0041] Figure 18 shows CLUSTAL alignment sequence of unedited and edited WT9-7 (SEQ ID NOs: 5635 and 5636) by dual guide RNAs showing 87bp excision of the desired target region.

[0042] Figure 19 shows a schematic representation of relative expression of PKD1 in WT9-7 untransfected cells versus WT9-7 transfected cells utilising gRNAs disclosed herein. The relative expression was normalized with human p-actin and GADPH mRNA and the values were calculated using 2ACtmethod. Data (n=3) was expressed as + / - SEM (***p <0.001 ; one way ANOVA followed by SNK test).

[0043] Figure 20 shows a schematic representation of Western Blot assay for (a) pCREB protein measured against p-actin as housekeeping protein; (b) PKA protein measured against p-actin as housekeeping protein; (c) mTOR protein measured against p-actin as housekeeping protein; (d) relative expression of pCREB, PKA-C and mTOR levels in WT9-7 cells (control versus genome-edited). In each case, there is downregulation of protein expression in genome-edited cells: 40.9% downregulation in pCREB levels, 22.2% downregulation in PKA-C levels, 23.8% downregulation in mTOR levels.

[0044] Figure 21 shows gel electrophoresis analysis of a PCR assay confirming deletion of an 88bp region in PKD1 gene of WT 9-7 cells using eight different pairs of dual guide RNAs, Cas9 mRNA and Messenger MAX. Lanes are marked L1 to L11 , in which L1 : 100 bp DNA ladder; L2: WT 9-7 untransfected control; L3 to L11 : WT 9-7 ADPKD guide RNA pairs 1 to 9, respectively.

[0045] DETAILED DESCRIPTION OF THE INVENTION

[0046] Unless otherwise indicated, the practice of the present invention employs conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA technology, and chemical methods, which are within the capabilities of a person of ordinary skill in the art. Such techniques are also explained in the literature, for example, M.R. Green, J. Sambrook, 2012, Molecular Cloning: A Laboratory Manual, Fourth Edition, Books 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausubel, F. M. et al. (Current Protocols in Molecular Biology, John Wiley & Sons, Online ISSN:1934-3647); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridisation: Principles and Practice, Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, IRL Press; and D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Synthetic Biology, Part A, Methods in Enzymology, Edited by Chris Voigt, Volume 497, pages 2-662 (2011); Synthetic Biology, Part B, Computer Aided Design and DNA Assembly, Methods in Enzymology, Edited by Christopher Voigt, Volume 498, Pages 2-500 (2011); RNA Interference, Methods in Enzymology, David R. Engelke, and John J. Rossi, Volume 392, Pages 1-454 (2005). All references cited herein are incorporated by reference in their entirety. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term ‘comprising’ means any of the recited elements are necessarily included and other elements may optionally be included as well. ‘Consisting essentially of means any recited elements are necessarily included, elements that would materially affect the basic and novel characteristics of the listed elements are excluded, and other elements may optionally be included. ‘Consisting of’ means that all elements other than those listed are excluded. Embodiments defined by each of these terms are within the scope of this invention.

[0047] The term ‘operably linked’ refers to the joining of distinct DNA molecules, or DNA sequences, to produce a functional transcriptional unit. When applied to DNA sequences, for example in an expression vector or a recombinantly modified gene construct, it indicates that the sequences are arranged, or juxtaposed, so that they function cooperatively in order to achieve their intended purposes, e.g. a promoter sequence allows for initiation of transcription that proceeds through a linked coding sequence as far as a termination sequence.

[0048] A ‘polynucleotide’ is a single or double stranded covalently-linked sequence of nucleotides in which the 3' and 5' ends on each nucleotide are joined by phosphodiester bonds. The polynucleotide may be made up of deoxyribonucleotide bases or ribonucleotide bases. Polynucleotides include DNA and RNA, and may be manufactured synthetically in vitro or isolated from natural sources. Sizes of polynucleotides are typically expressed as the number of base pairs (bp) for double stranded polynucleotides, or in the case of single stranded polynucleotides as the number of nucleotides (nt). One thousand bp or nt equal a kilobase (kb). Polynucleotides of less than around 40 nucleotides in length are typically called “oligonucleotides”. The term further includes known types of chemical modifications, for example, labels which are known in the art, methylation, caps, substitution of one or more of the naturally occurring nucleotides with nucleotide modifications such as pseudouridine, or those with uncharged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing nucleotide analogs (e.g., peptide nucleic acids and locked nucleic acids), as well as unmodified forms of the polynucleotide. In reference to polynucleotide or oligonucleotide molecules described herein, the term ‘sequence’ may be used to refer to the molecule itself. Hence, in context, reference to a polynucleotide sequence should not be taken as mere reference to the informational content of the of the molecule - i.e. the sequential arrangement of deoxyribonucleotide bases or ribonucleotide bases - but may be taken as incorporating the physical embodiment of the molecule itself.

[0049] As used herein, the terms ‘3" (‘3 prime’) and ‘5" (‘5 prime’) take their usual meanings in the art, i.e. to distinguish the ends or directionality within linear polynucleotide molecules. A polynucleotide has a 5' and a 3' end and polynucleotide sequences are conventionally written in a 5' to 3' direction. The 5’ end is suitably considered to be upstream of the 3’ end of a polynucleotide sequence. Hence, sequence referred to as upstream of a given reference point in a gene, such as the transcription start codon of an open reading frame (ORF), is sequence that is 5’ to the reference point. Likewise sequence denoted as downstream is 3’ to the reference point.

[0050] The term ‘gene expression control sequence’ comprises regulatory sequences, sometimes referred to as a cis-regulatory element (CRE) and includes promoters, ribosome binding sites, enhancers, silencers and insulators and other control elements which regulate transcription of a gene or translation of a resultant mRNA. In particular embodiments of the invention, the gene expression control sequences confertissue or cell-type specificity that assist in determining the phenotype of the cell. Gene expression control sequences may also contribute to regulation of gene expression levels. For example, the expression level of a particular gene can be considered as the amount of mRNA and / or polypeptide produced from that particular gene. Gene expression levels can refer to an absolute (e.g., molar or gram-quantity) abundance of mRNA or polypeptide, or a relative (e.g., the amount relative to a standard, reference, calibration, or to another gene expression level).

[0051] Cell-type specificity refers to the observable characteristics or traits of a particular cell, such as its morphology, development, biochemical or physiological properties, phenology, or behaviour. The celltype may referto the ‘phenotype’ of the cell and results primarily from the expression of the genes within the cell as well as any influence from external / environmental factors, such as disease pathogens or physical stresses (e.g. hypoxia, hypo- or hyperthermia and / or dehydration). Tissues or cells may be comprised within organ systems within the body, such as but not limited to those selected from the group consisting of: muscle; liver; central nervous system (CNS); brain; breast; endothelium; pancreas; esophagus; colon; gastrointestinal tract; kidney; lung; spleen; skin; heart; thyroid; lymphatic tissue; cardiovascular; eye; bone marrow; blood; connective tissue; bladder; reproductive organs; and placenta. Within each organ system there are multiple tissue and cellular subtypes as well as less differentiated cells, e.g. precursor and stem cells. Hence, as used herein, the term ‘organ’ is synonymous with an ‘organ system’ and refers to a combination of tissues and / or cell types that may be compartmentalised within the body of a subject to provide a biological function, such as a physiological, anatomical, homeostatic or endocrine function. Suitably, organs or organ systems may mean a vascularized internal organ, such as a liver or pancreas. Typically organs comprise at least two tissue types, and / or a plurality of cell types that exhibit a phenotype characteristic of the organ.

[0052] In addition, many organs may comprise so-called healthy or non-aberrant pathology as well as non- healthy or diseased cells. The term ‘diseased’ as used herein, as in ‘diseased cells’ and / or ‘diseased tissue’ indicates tissues and organs (or parts thereof) and cells which exhibit an aberrant, non-healthy or disease pathology. In certain instances disease cells may be pathologically normal but comprise an altered intra-cellular miRNA environment that represents a precursor state to disease. Diseased tissues may comprise healthy tissues that have been infiltrated by diseased cells from another organ or organ system. By way of example, many inflammatory diseases comprise pathologies where otherwise healthy organs are subjected to infiltration with immune cells such as T cells and neutrophils. By way of a further example, organs and tissues cysts or scar tissue lesions may comprise both healthy and diseased cells in close proximity.

[0053] ‘Subject’, ‘individual subject’ or ‘patient’ as used herein, may mean either a human or non-human animal. The term includes, but is not limited to, mammals (e.g., humans, other primates, pigs, rodents (e.g., mice and rats or hamsters), rabbits, guinea pigs, cows, horses, cats, dogs, sheep, and goats). In an embodiment, the subject is a human. The terms "treat," "treating," and "treatment" as used herein mean the treatment of a disease in a subject (e.g., a human subject), including one or more of inhibiting a disease pathology, i.e., arresting or preventing its development or progression; relieving the disease, i.e., causing regression of the disease state; relieving one or more symptoms of the disease; and curing the disease. In the present context the disease is ADPKD and treatment may be determined as the lessening of at least one symptom characteristic of the disease pathology compared to a subject who has not received the treatment.

[0054] The term ‘healthy’ as used herein, as in ‘healthy cells’ and / or ‘healthy tissue’ indicates tissues and organs (or parts thereof) and cells which are not themselves diseased and approximate to a typically normal functioning phenotype. It can be appreciated that in the context of the invention the term ‘healthy’ is relative, as, for example, non-neoplastic cells in a tissue affected by tumours may well not be entirely healthy in an absolute sense. Therefore ‘non-healthy cells’ is used mean cells which are not themselves neoplastic, cancerous or pre-cancerous but which may be cirrhotic, inflamed, or infected, or otherwise diseased for example. Similarly, ‘healthy or non-healthy tissue’ is used to mean tissue, or parts thereof, such as within a kidney without cysts.

[0055] The terms ‘guide molecule’ and ‘guide RNA’ or ‘gRNA’ are used interchangeably herein to refer to RNA- based molecules that are capable of forming a complex with an RNA-guided endonuclease complex, such as a CRISPR-Cas protein. A gRNA typically comprises a guide sequence having sufficient complementarity with a target nucleic acid to hybridize via Watson-Crick base pairing interactions with the target nucleic acid molecule at a given sequence and to direct sequence-specific binding of the endonuclease complex to the target nucleic acid sequence. Typical gRNA molecules include a targeting sequence, which binds to the complementary DNA sequence, and a Cas protein binding scaffold region, which interacts with the Cas enzyme (or equivalent or derivative thereof). The guide molecule or guide RNA may encompass RNA-based molecules having one or more chemical modifications, including synthetic bases, or by chemical linking two ribonucleotides or by replacement of one or more ribonucleotides with one or more deoxyribonucleotides). For example, chemical modifications such as 2'-O-methyl or phosphorothioate modifications can be introduced to increase gRNA stability. The present disclosure provides a guide nucleic acid suitable for use in a CRISPR / Cas system. A gRNA binds to a Cas protein via the scaffold region and targets the Cas protein to a specific location within a target nucleic acid. In some cases, a guide nucleic acid comprises a single nucleic acid molecule, referred to as a single guide nucleic acid (sgRNA). Alternatively, a guide nucleic acid comprises two separate nucleic acid molecules, referred to as a double guide nucleic acid.

[0056] The synthesis of gRNA typically involves two main steps: in vitro transcription and purification. In the in vitro transcription step, a DNA template containing the scaffold region, targeting sequence, and a promoter recognized by an RNA polymerase is used. This template is subjected to transcription using an RNA polymerase, resulting in the synthesis of a single-stranded RNA molecule, which is the gRNA. After the in vitro transcription, the gRNA is usually purified to remove impurities and any remaining DNA template or RNA polymerase. Common purification methods include column purification, precipitation, or enzymatic treatment to eliminate contaminants. The purified gRNA is then typically quantified and quality checked using spectrophotometry or gel electrophoresis. Modified versions of Cas enzymes, such as Cas9 variants, engineered derivatives (e.g. XCas9), or other CRISPR systems (e.g., Cas12a, Cas12b, MAD-7, Cas13), have been developed, which may require specific modifications or considerations during gRNA synthesis. It will be appreciated that gRNA synthesis protocols are known to the skilled person (for example see Doensch et al. Nat Biotechnol. (2014) December; 32(12): 1262- 1267).

[0057] According to the present invention, homology to any of the nucleic acid sequences, such as the gRNA sequences described herein, is not limited simply to 100%, 99%, 98%, 97%, 95%, 90%, 85% or even 80% sequence identity. Optimal alignments may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). Many nucleic acid sequences can demonstrate biochemical equivalence to each other despite having apparently low sequence identity. In the present invention homologous nucleic acid sequences are considered to be those that will hybridise to common target sequence under conditions of low stringency (Sambrook J. et al, Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY). However, it may be desired in some cases to distinguish between two sequences which can hybridise to common target sequence but contain some mismatches - an “inexact match”, “imperfect match”, or “inexact complementarity” - and two sequences which can hybridise to the target with no mismatches - an “exact match”, “perfect match”, or “exact complementarity”. Further, possible degrees of mismatch are considered. A sequence capable of hybridizing with a given target sequence is referred to as the “complement” of the given sequence. In specific embodiments, when comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent.

[0058] The term “target sequence”, in the context of formation of an RNA-guided endonuclease complex, refers to a sequence of nucleotides to which a guide sequence is configured to target, e.g. have complementarity with where hybridization between a target sequence and a guide sequence promotes the formation of an endonuclease complex, such as a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In specific embodiments, a target sequence is located in the nucleus of a cell, typically referred to as being comprised within the genome of the cell. Typically the target sequence will be comprised within a tissue specific region of a chromosome within a cell. Suitably, the target sequence will be comprised within an accessible chromatin region, such as within a locus that is active within a specific cell type, and that is uniquely accessible within the cell-type or tissue type, thereby conferring a level of phenotypic specificity to a gRNA that binds to the target sequence.

[0059] In embodiments of the invention the target sequence may be comprised within candidate nucleic acid sequences and / or tissue specific candidate sequences identified via the methods of the present invention. In particular embodiments of the invention the target sequence is comprised within a 3’ untranslated region (UTR) of a human PKD1 gene proximal to a miR-17 binding site. In particular embodiments the target tissue is comprised within the kidney, more suitably within renal proximal and distal convoluted tubule, and / or collecting duct tissue.

[0060] Various RNA guided endonucleases are consistent with the gene editing performed and analysed by the methods of the present disclosure. Typically, these sequence guided endonucleases fall within the general disclosure of a CRISPR / Cas endonuclease system. In general, the ‘CRISPR / Cas endosystem’, used interchangeably with ‘CRISPR system’ refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA- processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as those described in more detail below. In general, a CRISPR / Cas endonuclease system is characterized by elements that promote the formation of a CRISPR complex - referred to as a ribonuclear protein (RNP) at the site of a target sequence as defined herein.

[0061] In particular embodiments of the invention, the target sequence may be associated with a PAM (protospacer adjacent motif); that is, a short sequence recognized by the CRISPR complex as the site for cleavage of the DNA. The precise sequence and length requirements for the PAM differ depending on the CRISPR enzyme used, but PAMs are typically 2-5 base pair sequences located adjacent to a protospacer - i.e. the target sequence.

[0062] In some embodiments of the invention, the endonuclease is selected from Cas9, Cpfl, c2cl, C2c2, Casl3, c2c3, Casl, CasIB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8, Cas8a, Cas8al, Cas8a2, Cas8b, Cas8c, Csnl, Csxl2, Cas9, Casi o, Cas10d, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, CasF, CasG, CasH, CasX, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Cse5, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csxl, Csx15, Csfl, Csf2, Csf3, Csf4, Cul966, or a derivative thereof, a variant thereof, and a fragment thereof, wherein a fragment of the RNA-guided endonuclease is a protein recognizable by a person of skill in the art as retaining some or all of the common activity or having sufficient sequence identity as a protein listed above. Alternatively, some RNA-guided endonucleases are modified versions of the wildtype form, for example, comprising an amino acid change such as a deletion, insertion, substitution, variant, mutation, fusion, chimera, or any combination thereof, relative to a wild-type version of the protein. In some embodiments, the endonuclease comprises a region exhibiting at least 70% identity over at least 70% of its residues to a Cas9 domain or a Cpfl domain. In particular embodiments, the Cas9 is selected from the group consisting of SpCas9 SaCas9, StCas9, NmCas9, FnCas9, and CjCas9. In embodiments of the invention the endonuclease comprises an endonuclease having a Cas9 activity or a variant or derivative thereof. In alternative embodiments a Cas3 system may be employed to introduce longer unidirectional genomic deletions (see Morisaka et al., Nature Communications (2019) 10:5302).

[0063] RNA-guided nucleases of the types disclosed herein are derived either directly or modified from a number of possible sources. Such endonucleases may be eubacterial, archaeal, or thermostable in origin. In specific embodiments, the programmable endonuclease is derived from a species selected from the group consisting of Streptococcus pyogenes (S. pyogenes), Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinae spiralis, Streptomyces viridochromo genes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Pseudomonas aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Leptotrichia shahii, Prevotella, and Francisella novicida.

[0064] In embodiments, the endonuclease is selected from AsCpfl , FnCpfl , BhCas12b, NmCas9, SpCas9, Xcas9_3.7, CjCas9, SaCas9, VQR_SpCas9, Nme2Cas9, Spy_macCas9, StCas9, SpCas9_NGG, VRER_SpCas9, DpbCasX_Cas12e, LtCas12a, BhCas12b, Cas12f1 and St3Cas9. Table 1 below provides additional information pertaining to different Cas editing enzymes, their corresponding PAM motifs, and total possible gRNA count in the PKD1 target region of 3200 nucleotides. For each of Cas endonucleases the possible gRNAs which could bind on the forward strand and reverse strand of DNA are disclosed.

[0065] TABLE 1 - Cas endonucleases for use in gene editing modification of PKD1 gene

[0066] Standard IUPAC nucleotide codes are used where N = any nucleotide; M = A or C; R = A or G; W = A or T ; V = A or C or G; Y= C or T.

[0067] ‘miRNA as used herein refers to microRNA. miRNAs are non-coding RNAs that are between 21 and 23 nucleotides in length that play key roles in posttranscriptional gene regulation. miRNAs are believed to regulate the expression of 30% of all mammalian protein-encoding genes. miRNAs can be important in development, differentiation, cell cycle and growth control, and in virtually all biological pathways in mammals and other multicellular organisms. miRNAs can also be involved in cell cycle control, apoptosis and stem cell differentiation, hematopoiesis, hypoxia, muscle development, neurogenesis, insulin secretion, cholesterol metabolism, aging, viral replication and immune responses. The principle of miRNA action is via RNA-based interference (RNAi). In eukaryotes, the effector proteins that mediate the silencing of target nucleic acids, such as mRNAs, are in the Argonaute protein family. Argonautes are comprised within a versatile class of effector proteins, forming the core of various multiprotein regulatory systems or RNA-lnduced Silencing Complexes (RISC). The other critical protein component of eukaryotic RNA-induced silencing pathways are nucleases that process precursor RNAs into small RNAs that can be loaded onto Argonaut proteins. Dicer protein is an important component in multiple RNAi pathways. Dicer is an RNAse III type endonuclease that cleaves double-stranded RNA molecules to generate targeting-competent small RNAs that guide the effector machinery. A microprocessor complex, composed of the RNase III endonuclease Drosha and its co-factor Pasha (Partner of Drosha, or DGCR8 in vertebrates) cleaves the primary miRNA transcript in the nucleus and releases a hairpin precursor, that upon export to the cytoplasm is further cleaved by Dicer to give rise to a short RNA duplex with characteristic 2-nucletotide 3' overhangs. From this duplex, one strand is preferentially loaded into an Argonaute protein to generate a functional miRNA-induced silencing complex (miRISC). Effective repression of a target gene by miRISC requires a high concentration of a miRNA relative to its target. Hence, removal of miRNA binding site from within a mRNA gene transcript will eliminate miRISC mediated repression of the gene.

[0068] ‘ADPKD’ as used herein refers to Autosomal dominant polycystic kidney disease. ADPKD shows both locus and allelic heterogeneity. It is caused by mutations in PKD1 and PKD2 genes. Some studies have shown that compared with PKD2-mutated patients (13%), in PKD1 -mutated patients (78%), the glomerular filtration rate decreases faster, ESRD occurs earlier, and morbidity and mortality are higher (Hateboer et al., 1999; Kurashige et al., 2015). There are six PKD1 pseudogenes (PKDP1-P6) on chromosome 16 and share high homology with PKD1 (Bogdanova et al., 2001 ; Martin et al., 2004; Payne et al., 2021), and the GC content of some of these sequences is high (Al-Muhanna et al., 2019). Next generation sequencing (NGS) alone has a poor capture efficiency for high-GC-content regions, resulting in some PKD1 gene mutations being undetected. To address this problem, NGS screening has been attempted after PKD1 gene amplification with a long-range PCR technique.

[0069] PKD1 gene is located on human chromosome 16, and codes for a transcript of length 14,148 bp distributed amongst 46 exons spanning 52 kb. PKD1 codes for a polycystin protein (PC1 ; 4304 aa) which is a glycoprotein with multiple transmembrane domains and a cytoplasmic C-tail. PKD1 is an integral membrane protein involved in cell-cell / matrix interactions. The 3'-untranslated region (3'-UTR) of a mRNA transcript is the mRNA portion that lies immediately downstream of the translation termination codon. It protects the mRNA from degradation and facilitates translation through its poly(A) tail. The miR-17 binding motif is eight nucleotides long i.e., TAAAGTGC (5’ to 3’) and GCACTTTA (3’ TO 5’) and is present in the 3’ UTR region of PKD1 gene in chromosome16 (Chr16) at location 2089567- 2089575, according to GRCh38 version of the human genome. GRCh38 refers to the assembly of the human genome released December of 2013 that uses alternate or ALT contigs to represent common complex variation, including HLA loci (NCBI RefSeq assembly: GCF_000001405.26, Submitted GenBank assembly: GCA_000001405.15).

[0070] It is postulated that miR-17 promotes the growth of kidney cysts in ADPKD via the proliferation and post-transcriptional repression of PKD genes.

[0071] Amongst the three clusters, miR-17-92 is the most abundantly expressed in diverse cell types. Absence of miR-17-92 causes perinatal lethality with developmental defects in the bone, heart, lungs, and B cells in mice whereas deletion of the miR-106a~363 or miR-106b~25 clusters does not produce any obvious abnormality. Thus, miR-17-92 is essential, but the other two paralogous clusters are dispensable for embryonic development. miR-17-92 is also required for kidney development. Conditional miR-17-92 deletion in the mouse nephron progenitors impairs nephrogenesis. Consistent with its role in development, germline microdeletions involving miR-17-92 underlie Feingold syndrome, a developmental genetic disease primarily characterized by short stature and skeletal abnormalities. However, the expression of these miRNAs declines with maturation. Accordingly, inducible deletion of miR-17-92 in adult mice does not impact their lifespan or general well-being, other than a mild reduction in mature hematopoietic lineages. Moreover, miR-17-92 deletion in renal tubules subsequent to nephrogenesis, also, has no impact.

[0072] The present inventors have found that the miR-17-92 miRNA cluster is transactivated in multiple orthologous models of PKD and in human ADPKD. In fact, the miR-17 family alone accounts for >2.7% of the total dysregulated miRNA pool in ADPKD. The oncogene c-Myc primarily mediates this upregulation. The miR-17-92 gene has many conserved Myc binding sites. c-Myc binding to the miR- 17-92 promoter is both sufficient and necessary for miR-17-92 upregulation in ADPKD. Transgenic c- Myc upregulation is known to cause PKD in mice. Consistent with the c-Myc —> miR-17-92 pathogenic axis in ADPKD, transgenic upregulation of miR-17-92 in wild-type kidney tubules is also sufficient to produce kidney cysts. More importantly, genetic deletion of the miR-17-92 cluster markedly attenuates disease progression and improves renal function and survival of multiple ADPKD mouse models. These proof-of-principle genetic studies have conclusively established miR-17-92 as a novel drug target for ADPKD.

[0073] Gene editing to excise the miR-17 binding site

[0074] As described herein, the PKD1 gene contains a miR-17 binding motif within its 3'-UTR, and miR-17 expression and activity are shown to be higher in ADPKD cellular models. As PKD1 mRNA is cisinhibited by the binding of mir-17 to 3'-UTR miR-17 binding motif, one embodiment of the present invention focusses upon providing compositions and methods that delete this motif from the gene and thereby reverse miRNA mediated PKD1 inhibition (see Figure 14). This approach relies on a two gRNA system which directs double strand cleavage of the PKD1 gene within the non-coding 3’ UTR at locations upstream and downstream of the miR-17 binding site, followed by non-homologous end joining (NHEJ) that restores the integrity of the gene. Approaches and embodiments of the present invention seek to delete or disrupt the miR-17 binding site motif in the region mentioned but without disturbing the functionality of the PKD1 gene. It will be appreciated that single gRNA approaches can also be utilised to create large scale deletions within the genome at a target site, such as those described by Morisaka et al. Nature Communications (2019) 10:5302. Hence, alternative embodiments of the present invention allow for the deletion or disruption of the miR-17 binding site motif in the region mentioned utilising a single gRNA comprising a sequence of nucleotides suitably selected from the target sequences, or their reverse complement, as described herein.

[0075] Tables 2A and 2B show target sequences for gRNAs upstream and proximate to the miR-17 binding site within the 3’ UTR of PKD1 , as well as gRNA sequences that bind downstream and proximate to the miR-17 binding site. The selection of a first gRNA sequence that binds upstream of the miR-17 binding site and a second gRNA sequence that binds downstream of the miR-17 binding site can be made to obtain a pair of gRNAs that can excise a part of the genome containing the miR-17 binding site. Excision of a portion of the genome allows for that portion to be deleted from that gene. The term ‘proximate’ refers to a target sequence that is typically within the 3’ UTR of the PKD1 gene and suitably not more than around 1 ,600 nucleotides upstream of the miR-17 binding site and / or not more than around 500 nucleotides downstream of the miR-17 binding site. In specific embodiments of the invention, the target sequence for the first gRNA is located not more than 1000, 900, 800, 700, 600, 500, 400, 300, 200 or 100 nucleotides upstream of the miR-17 binding site. In particular embodiments of the invention, the target sequence for the second gRNA is located not more than 300, 200 or 100 nucleotides downstream of the miR-17 binding site. Tables 2A and B also provide the endonucleases that can be used with the gRNA pair. The skilled person will be able to determine which endonuclease can be used with a specifically selected gRNA pair. TABLE 2A - Endonuclease target sequences located upstream of miR-17 binding motif 5

[0076] TABLE 2B - Endonuclease target sequences located downstream of miR-17 binding motif Ill

[0077] In embodiments of the invention, the first gRNA comprises a sequence of nucleotides comprising a target sequence selected from SEQ ID NO 1 to SEQ ID NO 1316, or the reverse complement thereof as defined in SEQ ID NO: 1317 to SEQ ID NO: 2632.

[0078] In a specific embodiment, the first gRNA comprises a sequence of nucleotides comprising all or a part of the target sequence as defined in SEQ ID NO: 1976. Where a part of the target sequence is comprised within the first gRNA, it is understood that a sufficient proportion of the target sequence is included to effect endonuclease mediated double strand cleavage of the target sequence within the cell. In relation to SEQ ID NO: 1976, it is anticipated that the appropriate sequence guided endonuclease is a Cas9 endonuclease, suitably SpCas9 or a homologue or an engineered variant thereof including but not limited to XCas9.

[0079] In other embodiments, second gRNA comprises a sequence of nucleotides comprising a target sequence selected from SEQ ID NO: 2633 to SEQ ID NO: 3954, or the reverse complement thereof as defined in SEQ ID NO: 3955 to SEQ ID NO: 5276.

[0080] In a specific embodiment, the second gRNA comprises a of nucleotides comprising all or a part of the target sequence as defined in SEQ ID NO: 2780. Where a part of the target sequence is comprised within the second gRNA, it is understood that a sufficient proportion of the target sequence is included to effect endonuclease mediated double strand cleavage of the target sequence within the cell. In relation to SEQ ID NO: 2780, it is anticipated that the appropriate sequence guided endonuclease is also a Cas9 endonuclease, suitably SpCas9 or an engineered variant thereof including but not limited to XCas9.

[0081] In specific embodiments, the first gRNA comprises a sequence of nucleotides comprising all or a part of the target sequence as defined in any one of SEQ ID NOS:

[0082] In specific embodiments, the second gRNA comprises a sequence of nucleotides comprising all or a part of the target sequence as defined in any one of SEQ ID NOS:

[0083] In embodiments of the invention, the selected gRNAs enable disruption and / or deletion of the miR17 binding motif in 3'-UTR of PKD1 but are optimised which have fewer off-targets and are more specific to diseased kidney proximal tubular cell lines in humans. According to one embodiment of the invention, the selected sequences show no off targets with up to two mismatches, and optionally less than ten off targets with three mismatches across a typical sequence length of 20 to 23 nucleotides in non-kidney proximal tubular cells.

[0084] Gene, base or prime editing to disrupt the miR-17 target site

[0085] Genome editing methods based around excision of a specified region of a gene, such as those described previously, introduce double-stranded DNA breaks (DSBs) at genomic target loci targeted by first and second RNPs. The cellular response to a DSB lesion primarily proceeds through nonhomologous end joining (NHEJ) and related processes. Although NHEJ usually rejoins the two ends flanking the DSB, in a number of instances as described in embodiments of the invention, it results in rejoining of ends that result in deletion of the target region. An alternative strategy to complete excision of the miR-17 binding motif involves disruption of the sequence itself using a single gRNA gene editing approach to introduce an insertion / deletion (or ‘indel’) within the core seed sequence thereby reducing the effective binding of the PKD1 mRNA to miRNA-17 in the cell. Alternatively, the indel may result in formation of a secondary structure, such as a stem loop within or adjacent to the miR-17 binding motif, that reduces effective hybridisation between the mRNA and a miRNA-17 in the cell. By reducing or even eliminating binding to miRNA-17, the miRNA mediated silencing of the PKD1 mRNA can be abrogated. Hence, according to an embodiment of the invention a gene editing gRNA is provided that comprises a sequence of nucleotides comprising all or a part of any one of the target sequences, or reverse complements, as defined in Table 3 below. Where a part of the target sequence is comprised within the gene editing gRNA, it is understood that a sufficient proportion of the target sequence is included to effect endonuclease mediated double strand cleavage of the target sequence within the cell, so as to induce formation of a mutation within or proximate to a miRNA-17 binding motif present within the 3’ UTR of a PKD1 gene. Suitably, proximity to the miRNA-17 binding motif is within five or fewer nucleotides upstream or downstream of the binding motif. Suitably, the corresponding endonuclease is any one as described within the present disclosure, however without imparting any form of limitation, particularly suitable endonucleases are set out in Table 3 in relation to particular target sequences. In particular embodiments of the invention the endonuclease is a Cas9 endonuclease or a homologue or derivative thereof, such as XCas9.

[0086] TABLE 3 - Endonuclease target sequences spanning miR-17 binding motif

[0087] In an alternative embodiment of the invention a base editing approach may be adopted to achieve disruption of all or part of the miR-17 binding motif nucleotide sequence. Cytidine deaminase base editing enables the direct, irreversible conversion of a C:G base pair to a T: A base pair in a programmable manner without requiring HDR or the introduction of a double strand break. In contrast to conventional gene editing which relies on a canonical sequence-guided endonuclease such as a Cas9 protein that creates a double strand break, base editors contain a single-stranded DNA- specific cytidine deaminase enzyme tethered to a catalytically impaired Cas9 protein and a base excision repair inhibitor (see . Y. B. Kim et al, Nat Biotechnol 35, 371-376 (2017)). In an embodiment of the present invention, the Cas9 variant binds a locus of interest within the 3’ UTR of the PKD1 gene, programmed by a corresponding guide RNA that may comprise a sequence of nucleotides that correspond to any one of those set out in Table 3. This leads to the formation of a protein-RNA-DNA ternary “R- loop” complex that exposes a small (~5-nt) bubble of single-stranded DNA that serves as a substrate for the tethered cytidine deaminase enzyme. Cytidines within this bubble may be hydrolytically deaminated to uracils, resulting in G:U intermediates. The cell’s primary response to the presence of G:U mismatches is to initiate a base excision repair mechanism to replace the uracils with cytidines. This process is initiated by excision of the uracil by uracil N-glycosylase. To protect the edited G:U intermediate from excision by uracil N-glycosylase, an uracil glycosylase inhibitor (UGI) can be incorporated into the base editing complex, such as via fusion with the C-terminus of catalytically impaired Cas9. Manipulation of the cellular DNA mismatch repair systems into preferentially replacing the G in the G:U mismatch with an A, requires that Cas9 is modified to have nickase activity rather than catalysing a double strand break. This enables the Cas9 protein to nick the DNA strand opposite the newly formed uracil in the G:U mismatch, resulting in much more efficient conversion of the G:U intermediate to sequence altered A:U and A:T products.

[0088] An alternative to cytidine deaminase base editing utilises an adenosine deaminase base editor complex to convert A:T base pairs to G:C base pairs at a given target location. The deamination of adenine yields inosine (I), which is read and replicated as guanine (G) by polymerases. The approach is broadly similar to that described in relation to cytidine deamination base editing (see Gaudelli et al. Nature. (2017) Nov 23; 551 (7681): 464-471).

[0089] Hence, in an embodiment of the present invention a gene editing gRNA is provided that comprises a sequence of nucleotides comprising all or a part of any one of the target sequences, or reverse complements, as defined in Table 3 above. Where a part of the target sequence is comprised within the gene editing gRNA, it is understood that a sufficient proportion of the target sequence is included to permit a base-editing complex mediated deamination of a cytidine or adenosine located within or proximate to a miRNA-17 binding motif present within the 3’ UTR of a PKD1 gene. The resulting deaminated mismatched intermediate (e.g. G:U or T:G) is then typically converted to a desired base edited product as described above via manipulation of the base excision repair machinery within the cell. Suitably, the corresponding base-editing complex comprises a modified endonuclease engineered to possess nickase activity. The endonuclease may be such as any described herein, however without imparting any form of limitation, particular endonucleases suitable for modification are set out in Table 3 in relation to the respective target sequences. In specific embodiments of the invention the endonuclease is an engineered Cas9 endonuclease or a homologue or derivative thereof, such as XCas9, that possesses nickase activity (e.g. nCas9), such as via Alanine substitutions at D10 in the RuvC domain, and / or H840 in the HNH domain, and / or N854 and / or N863 of Cas9.

[0090] Prime editing is a powerful editing tool that is an alternative to the base editing approaches described previously. Prime editing also allows precise modifications to genomic DNA utilising a protein editing complex that is guided to a locus within a gene via a guide RNA sequence. It consists of two key components: nCas9, modified Cas9 endonuclease having nickase activity, which nicks the DNA strand, and an associated Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), which facilitates the editing process (Anzalone AV et al. Nature 576, 149-157 (2019)). The RT component may be comprised within the prime editing complex or present in solution. Guide RNAs (called pegRNAs) direct the prime editor complex to the target locus in the genome. These pegRNAs have an extended structure at their 3’ end compared to single-guide RNAs (sgRNAs) which includes a primer binding site (PBS): complementary to a portion of the DNA protospacer and an RT template that encodes the intended edit. Once nicking occurs, the PBS sequence pairs with the complementary target DNA sequence to start priming reverse transcription from the RT template, which enables the desired editing. However, unlike cytidine / adenosine deaminase containing base editors, prime editing can induce a relatively high frequencies of indels. Hence, prime editing represents an alternative mechanism for sequence guided disruption of the miR-17 binding motif within the 3’ UTR of a PKD1 gene.

[0091] Accordingly, in an embodiment of the present invention a prime editing gRNA is provided that comprises a sequence of nucleotides comprising all or a part of any one of the target sequences, or reverse complements, as defined in Table 3 above. The gRNA may be comprised within an sgRNA or a pegRNA for use in a prime editing reaction. Where a part of the target sequence is comprised within the pegRNA or sgRNA, it is understood that a sufficient proportion of the target sequence is included to permit a prime-editing complex mediated sequence alteration located within or proximate to a miRNA-17 binding motif present within the 3’ UTR of a PKD1 gene. Suitably the prime-editing complex comprises an engineered Cas9 endonuclease or a homologue or derivative thereof, such as XCas9, that possesses nickase activity (e.g. nCas9), such as via Alanine substitutions at D10 in the RuvC domain, and / or H840 in the HNH domain, and / or N854 and / or N863 of Cas9. mRNA editing to disrupt or remove the miR-17 target site

[0092] Unlike the genome-editing techniques described previously, which alter the cellular genome itself, RNA editing focuses on manipulating mRNA to achieve therapeutic effects. RNA editing aims to mitigate the risk of harmful mutations or off target effects by changing the sequence of mRNA. RNA editing, sometimes referred to as re-writing, relies upon the general concept of trans-splicing of mRNA, wherein a non-natural trans-splicing reaction is engineered to alter the nucleotide sequence of one or more mRNAs. A range of mRNA editing techniques exist that rely upon manipulation of trans-splicing of mRNA. Initially techniques for mRNA editing were based on a techniques called SMaRT™ (Spliceosome-mediated RNA trans-splicing) - see Yang and Walsh, Mol. Ther. Vol. 12, No. 6, December 2005. SMaRT™ uses specialized constructs called pre-trans-splicing molecules (PTMs) that can bind to specific endogenous mutant nuclear RNAs and effect a trans-splicing event to create a composite repaired product. Each PTM molecule is configured to include a binding domain, a splicing domain, and a coding domain. The binding domain may comprise as few as 30 nucleotides, but typically comprises hundreds or more nucleotides that are complementary to a target sequence within the mRNA. The binding and splicing domain sequences of the PTM RNA are excised after trans-splicing has occurred and, thus, are not retained in the edited final mRNA product. As mentioned, typically, the binding domain is a long sequence provides specificity to trans-splicing between the unmodified target mRNA and the PTM molecule, whereas the splicing and coding domains provide essential consensus motifs that are recognized by the spliceosome and make the trans-splicing reaction occur. Hence, in theory SMaRT™ can result in simultaneous repair, replacement, and removal of undesired RNA sequences from the defective target pre-mRNA. However, despite the potential of SMaRT™ to rewrite multiple kilobases of target mRNAs, the widespread adoption of this approach as a reliable therapeutic platform has generally been hindered by low efficiency.

[0093] As an alternative to SMaRT™, Splice Editing and CRISPR Assisted mRNA Fragment Trans-splicing (CRAFT) have been proposed both of which utilise CRISPR-Cas13 mediated approaches for mRNA editing (Borrajo J, et al. Programmable multi-kilobase RNA editing using CRISPR-mediated trans- splicing. bioRxiv. 2023 Aug 18; and Fiflis D, et al. Repurposing CRISPR-Cas13 systems for robust mRNA trans-splicing. bioRxiv. 2024 Feb 6). Cas13 enzymes do not require a PAM sequence at the target locus, making them more flexible than Cas9 / Cpf1 , and they have been proposed for RNA base editing via a technique called RNA Editing for Programmable A to I Replacement (REPAIR) that incorporates adenosine deaminase activity into the editing complex (Cox et al., Science. 2017 Nov 24; 358(6366): 1019-1027). Some Cas13 enzymes prefer targets with a given single base protospacer flanking site (PFS) sequence, but orthologs like LwaCas13a do not require a specific PFS.

[0094] According to embodiments of the present invention, gRNAs described herein may be utilised in any Cas13 mediated RNA editing and / or rewriting techniques. In a specific embodiment the gRNA comprises a sequence of nucleotides, or the reverse complement thereof, selected from any one of Tables 4A or 4B (see below) which are a subset of the target sequences disclosed in Tables 2A and 2B that are compatible with Cas13 mRNA editing. Alternatively, in an embodiment of the invention the gRNA comprises a sequence of nucleotides, or the reverse complement thereof, selected from Table 4C which represent novel Cas13 target sequences within Exonl of the PKD1 gene as well as within the 3’ UTR. In a further embodiment, the gRNA comprises a sequence of nucleotides that are proximal, fully or partially spanning the miR-17 binding motif. TABLE 4A - Cas13 mRNA editing target sequences located upstream of miR-17 binding motif

[0095] TABLE 4B - Cas13 mRNA editing target sequences located downstream of miR-17 binding motif

[0096] TABLE 4C - additional Cas13 mRNA editing target sequences

[0097] Delivery of compositions

[0098] Implementation of genome, base or RNA editing systems can be achieved in a variety of ways. Depending upon the disease or target tissue different implementations may be suitable for a particular application. By way of example, a given genome, base or RNA editing system may implemented, in certain embodiments, as a protein / RNA complex (a ribonucleoprotein, or RNP), which can be included in a pharmaceutical composition. Alternatively, mRNA encoding the appropriate protein component (e.g. endonuclease, base-editor complex, mRNA editor complex) may be combined with one or more gRNAs within a pharmaceutical composition.

[0099] Delivery compositions, such as those for pharmaceutical or therapeutic use, typically include a pharmaceutically acceptable carrier and / or an encapsulating agent, such as a lipid, lipidoid or other polymer micro- or nano-particle, micelle, liposome, etc. In other embodiments, a genome editing system may implemented as one or more nucleic acids encoding the RNA - guided nuclease and gRNA components described herein (optionally with one or more additional components); in still other embodiments, the genome editing system is implemented as one or more nucleic acid vectors, for example a viral vector such as an AAV; and in yet other embodiments, the genome editing system is implemented as a combination of any of the aforementioned platforms.

[0100] In an embodiment, the composition further comprises a lipid nanoparticle. "Lipid nanoparticle" (LNP) as used herein refers to a particle that comprises a plurality of (i.e. more than one) lipid molecules physically associated with each other by intermolecular forces. The LNPs may be, e.g., microspheres (including unilamellar and multilamellar vesicles, e.g., "liposomes" — lamellar phase lipid bilayers that, in some embodiments, are substantially spherical — and, in more particular embodiments, can comprise an aqueous core, e.g., comprising a substantial portion of RNA molecules), a dispersed phase in an emulsion, micelles, or an internal phase in a suspension. Hence, in specific embodiments pharmaceutical compositions of RNPs or vectors (e.g. AAVs) include liposomes. Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV) which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV) which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV) which may be between 50 and 500 nm in diameter. Liposome design may include, but is not limited to, opsonins or ligands in order to improve the attachment of liposomes to target tissues or to improve cellular uptake of the composition. Liposomes may contain a low or a high pH in order to improve the delivery of the pharmaceutical formulations.

[0101] The formation of liposomes may depend on the physicochemical characteristics such as, but not limited to, the particular pharmaceutical formulation of the cargo therapeutic and the liposomal ingredients, the nature of the medium in which the lipid vesicles are dispersed, the effective concentration of the entrapped cargo and its potential toxicity, any additional processes involved during the application and / or delivery of the vesicles, the optimization size, polydispersity and the shelf-life of the vesicles for the intended application, and the batch-to-batch reproducibility and possibility of large-scale production of safe and efficient liposomal products. As an example a liposome can contain, but is not limited to, 55% cholesterol, 20% disteroylphosphatidyl choline (DSPC), 10% PEG-S-DSG, and 15% 1 ,2- dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al. Pharm Res. 2005 22:362- 372.

[0102] In a further embodiment, the RNPs or polynucleotide vectors (e.g. AAVs) may be formulated in a lipidpolycation complex. The formation of the lipid-polycation complex may be accomplished by methods known to the skilled person. As a non-limiting example, the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyornithine and / or polyarginine. In another embodiment, the RNPs or polynucleotide vectors (e.g. AAVs) may be formulated in a lipid-polycation complex which may further include a neutral lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE).

[0103] According to embodiments of the invention, the selection of the cationic lipid component, the degree of cationic lipid saturation, the nature of the PEGylation, ratio of all components and biophysical parameters such as size may influence the formulation. An exemplary the liposome formulation may be composed of 57.1 % cationic lipid, 7.1 % dipalmitoylphosphatidylcholine, 34.3% cholesterol, and 1.4% PEG-c-DMA, as described by Semple et al. Nature Biotech. 2010 28:172-176. Lipid nanoparticle formulations may be further modified by using a biodegradable cationic lipid. Rapid metabolism of the biodegradable lipids can improve the tolerability and therapeutic index of the lipid nanoparticles substantially. Biodegradability of the LNP may be achieved through Inclusion of an enzymatically degradable ester linkage within the ionizable cationic lipid. The ester linkage can be internally located within the lipid chain or it may be terminally located at the terminal end of the lipid chain. The internal ester linkage may replace any carbon in the lipid chain.

[0104] According to one embodiment, the compositions of the present invention may comprise nanoparticles comprising a polymeric matrix. By way of non-limiting example, the nanoparticle may comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polylysine, polyethylene imine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4- hydroxy-L-proline ester) or combinations thereof. In one particular embodiment, the diblock copolymer may include PEG in combination with a polymer such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polylysine, polyethylene imine), poly(serine ester), poly(L- lactide-co-L-lysine), poly(4-hydroxy-L-proline ester) or combinations thereof. In a further embodiment, the therapeutic nanoparticle may comprise a diblock copolymer. As a non-limiting example the therapeutic nanoparticle comprises a PLGA-PEG block copolymer.

[0105] In one embodiment, the therapeutic nanoparticles described herein may be formulated for sustained release. As used herein, ‘sustained release’ refers to a pharmaceutical composition that conforms to a release rate of the encapsulated therapeutic over a specific period of time. The period of time may include, but is not limited to, hours, days, weeks, months and even years.

[0106] Pharmaceutical compositions as described in the present disclosure may by formulated with a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, Md., 2006) discloses various excipients used in formulating pharmaceutical compositions and known techniques for the preparation thereof. Except insofar as any conventional excipient medium is incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition, its use is contemplated to be within the scope of this invention. Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, and suspensions. Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing agents, wetting agents, and / or suspending agents. Sterile injectable preparations may be sterile injectable solutions, suspensions, and / or emulsions in nontoxic parenterally acceptable diluents and / or solvents.

[0107] The compositions as described herein may be used in combination with one or more other therapeutic, prophylactic, diagnostic, or imaging agents. By “in combination with,” it is not intended to imply that the agents must be administered at the same time, or consecutively within a defined therapeutic time-frame, and / or formulated for delivery together. Compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent.

[0108] In a specific embodiment, the compositions of the present invention may be administered in advance of or in conjunction, combination or concurrently with a vasopressin V2-receptor antagonist. Suitable vasopressin V2-receptor antagonists drugs may include pharmaceutical compositions comprising Tolvaptan and salts thereof, which is sold under the brand names Jynarque®, Samsca®, and Jinarc®. Dosage regimens for Tolvaptan are known to the skilled person and may be adapted to a given individual patient dependent upon factors such as body mass index, age, gender, genotype, metabotype or severity of disease.

[0109] Kits

[0110] Another embodiment of the invention provides for a kit containing compositions useful for the treatment of ADPKD as described above. In one embodiment, the kit comprises (a) a container comprising a composition of the present invention, optionally in a pharmaceutically acceptable carrier or diluent; and (b) a package insert with instructions for treating ADPKD thereof in a subject in need thereof. In accordance with this embodiment, the package insert is on or associated with the container. Suitable containers include bottles, vials, ampules, syringes, vessels, etc. The containers may be formed from a variety of materials such as glass or plastic. The container holds or contains a composition that is effective for treating the ADPKD and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). At least one active agent in the composition is the compositions of the present invention. The label or package insert indicates that the composition is used for treating a subject eligible for treatment, e.g., one having or predisposed to ADPKD, with specific guidance regarding dosing amounts and intervals of composition and any other medicament being provided. The kit may further comprise an additional container comprising a pharmaceutically acceptable diluent buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution, and / or dextrose solution. The kit may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0111] The kit optionally further comprises a container comprising a second medicament, wherein the compositions of the present invention is a first medicament, and which article further comprises instructions on the package insert for treating the subject with the second medicament, in an effective amount. The second medicament may be any of those set forth above, such as a vasopressin V2- receptor antagonist.

[0112] Methods of treatment and therapeutic uses

[0113] In another aspect, the invention provides a method of treating a kidney disease, said method comprising administering an effective amount of the composition to a subject in need thereof. The kidney disease is suitably ADPKD. The treatment may be to prevent, reduce or eliminate the formation of cysts, the number or cysts, the persistence of cysts and / or the size of cysts associated with the pathology of ADPKD. An ‘effective amount’ of the composition refers, at least in part, to the amount of active needed to ensure efficient gene editing in the target tissue in order to achieve the desired full or partial prevention, reduction or elimination of cysts within the target tissue.

[0114] According to specific embodiments, the methods comprising administering the disclosed compositions that comprise polynucleotides (e.g. gRNAs), RNPs and / or polynucleotide vectors (e.g. AAVs) to a subject in need thereof. Compositions, may be administered to a subject using any amount and any route of administration effective for preventing, treating, a kidney disease, disorder, and / or condition (e.g., a disease, disorder, and / or condition relating to ADPKD). Compositions in accordance with the invention are typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention may be decided by an attending physician within the scope of expert medical judgment. The specific therapeutically effective or prophylactically effective dosage level for any particular patient will depend upon a variety of factors including the severity of the disorder; the activity of the delivery composition employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; the genetic background of the individual and like factors well known in the medical field.

[0115] Also disclosed herein is a composition comprising: a. a first nucleic acid encoding a first sequence-guided endonuclease and a first guide RNA (gRNA) wherein the first gRNA is configured to hybridise with a region within the 3’ UTR of a PKD1 gene upstream of a miR-17 binding site; and b. a second nucleic acid encoding a second RNP comprising a second sequence-guided endonuclease and a second guide RNA (gRNA) wherein the second gRNA is configured to hybridise with a region within the 3’ UTR of a PKD1 gene downstream of a miR-17 binding site.

[0116] The PKD1 gene or RNA editing systems, compositions, and methods of any embodiments of the present disclosure can support high levels of productive editing in kidney cells. In certain embodiments, at least 10%, 15%, 20%, 25%, 30% or higher of kidney cells in samples modified according to the methods of this disclosure comprise a productive alteration of an allele of the PKD1 gene to remove a miR-17 binding site within the 3’ UTR. In certain embodiments, 25%, 30%, 35%, 40%, 45%, 50%, or more than 50% of kidney cells are modified according to the methods of this disclosure and thereby comprise a productive alteration of an allele of the PKD1 gene.

[0117] Further disclosed herein are compositions comprising a protein having sequence-guided endonuclease activity and at least one gRNA wherein the at least one gRNA is configured to hybridise with a region within the 3’ UTR of a PKD1 gene upstream, spanning or downstream of a miR-17 binding site motif. Suitably the sequence-guided endonuclease activity comprises the ability to induce a double strand break in the PKD1 gene. Alterntively, the sequence-guided endonuclease activity comprises the ability to induce a single strand nick in the PKD1 gene.

[0118] The invention is further illustrated by the following non-limiting examples.

[0119] EXAMPLES

[0120] Example 1 Designing single guide RNAs

[0121] A) On target analysis

[0122] A significant consideration while designing sgRNAs for use with CRISPR systems is to avoid disrupting the functionality of the gene PKD1 while deleting an 8Bbp miR17 binding motif in the 3' UTR of PKD1 gene. To this end, dual sgRNAs were designed wherein each sgRNA pair targeted DNA sequences upstream and downstream of the miR-17 binding motif in the PKD1. In order to enhance NHEJ and eliminate the binding motif without impairing other functions, these sgRNA pairs were designed such that the cutting site is adjacent to the motif site. Six sgRNAs were identified with these criteria (sgRNAI , sgRNA2, sgRNA3, sgRNA4, sgRNA5, and sgRNA6). Of these, sgRNAI to sgRNA3 cut upstream ofthe binding motif and others cut downstream of the binding motif.

[0123] The next step was to identify cell types where the cysts manifest in the kidney and analyze the epigenetic properties for accessibility of the human genome where these sgRNA pairs are targeted. Renal proximal tubules and distal convoluted tubules are the target cell type, and all other primary cell types in the kidney and liver are the off-target cell type / tissue.

[0124] The ATAC values of the selected gRNAs targeted to PKD1 in kidney and liver samples from ADPKD patients were compared with those in healthy kidney and liver cell lines.

[0125] The total region examined (3’ UTR) was 1018BP. The ATAC values for each base pair for the entire gene (47000+ BP) were extracted, checked for its distribution, and calculated the mean and standard deviation. The mean is 1 .8, and the standard deviation is 2.03. The region where the accessibility values are mean+(2* std. dev), i.e., 5.63 or above was selected. The average genomic DNAs ATAC values for the six sgRNAs fragments selected and the distance from the binding motif are given below in Table 4:

[0126] TABLE 5

[0127] Of the three pairs of sgRNAs, the locations of sgRNAI and sgRNA4 are the most accessible, and sgRNA3 and sgRNA6 are the least accessible. However, the risk of altering other functionality in the UTR region is high because of the significant distance between sgRNAI and sgRNA4 (402BP from cut site to cut site). Whereas with sgRNA3 and sgRNA6, the distance between cut site to cut site is 25BP, which is too low for PCR amplification / identification and downstream processing to assess the editing activity of sgRNAs. The pair sgRNA2 and sgRNA5 are at an ideal space of 88BP from cut site to cut site.

[0128] Even though the accessibility is slightly less than that of sgRNAI and sgRNA4, it is still higher than other regions. The accessibility of this region of liver / hepatocytes (probable off-target tissue) is very low (~0.2). Even the peak analysis shows that the nearest peak to the selected region in the liver is 11000

[0129] BP far, and that of healthy proximal tubules, distal convoluted tubule cell type is 2000 BP far.

[0130] The Table 6 below indicates the properties of sgRNAs 1 , 2, 4 and 5:

[0131] TABLE 6

[0132] B) Off-target analysis

[0133] The total off-targets possible for the guide pair of sgRNAI and sgRNA4, and sgRNA2 and sgRNA5, up to 6 mismatches, are given in Table 7 below:

[0134] TABLE 7

[0135] Based on all the data points available at this level, although sgRNA pair 1 and 4 appeared better, based on the deletion length of 402 BP, because this 402 BP region excises a major portion of the coding exon this increases the risk of altering the PKD1 protein product. Hence, it was decided to proceed further with sgRNA pairs 2 and 5, which delete a far smaller region of only 88 base pairs from the 3 ’UTR that includes the miR-17 binding motif.

[0136] Regions where the off-targets fall in the genome for sgRNA 2 and sgRNA5 are indicated below in Table 8:

[0137] TABLE 8 Kidney off targets for sgRNA 2 and sgRNA 5:

[0138] From the total of 12,516 and 8,328 mismatch-based off-targets, 80 and 47 are defined as EPIC-off- targets (most probable and selected off-targets after removing false positives) with highly accessible (on peaks) and highly expressed (genic) or intergenic / unknown in the off-target-cell (kidney) forsgRNA2 and sgRNA5, respectively - see International Patent Application No. WO2023 / 225349 which is incorporated herein by reference.

[0139] TABLE 9 - Off-target-cell EPIC-off-target for sgRNA2:

[0140] TABLE 10 - Off-target-cell EPIC-off-target for sgRNA5:

[0141] Liver off targets for sgRNA 2 and sgRNA 5:

[0142] From the total of 12,516 and 8,328 mismatch-based off-targets, 16 and 25 are EPIC-off-targets with highly accessible (on peaks) and highly expressed (genic) or intergenic / unknown in the liver for sgRNA2 and sgRNA5 respectively.

[0143] TABLE 11 - Liver EPIC-off-target for sgRNA2: TABLE 12 - Liver EPIC-off-target for sgRNA5: sgRNA 2 and sgRNA 5 off target analysis using COSMIC gene analysis:

[0144] The Catalogue of Somatic Mutations in Cancer (COSMIC - https: / / cancer.sanger.ac.uk / cosmic) is the world's largest source of expert manually curated somatic mutation information relating to human cancers and includes over 37,000 genomes comprising peer reviewed large scale genome screening data. Genes and miRNAs within the COSMIC that bind to the target binding regions of sgRNA2 and sgRNA5 were shortlisted. Only two potential off-targets were identified in off-target kidney tissue, one in an exonic region of NOTCH2 and one in the intronic region of ELN. However, for both potential off- targets there were at least five nucleotide mismatches, thus, reducing their risk substantially.

[0145] Example 2 Deletion of miR-17 binding site in the 3’ UTR of PKD1 to rescue PKD1 gene expression

[0146] The objective of this study was to delete the mir-17 binding region in the 3’ UTR region of the PKD1 gene using a sequence targeted endonuclease, such as CRISPR / Cas9, in order to rescue the PKD1 gene expression, serving as a therapeutic strategy for Autosomal Dominant Polycystic Kidney Disease (ADPKD). The impact of the excision of the mir-17 binding region for the rescue was measured by the editing percentage at the genomic level and phenotypic recovery at the PKD1 mRNA level. The study had two parts:

[0147] 1) Measure editing efficiency of the designed dual guide RNAs (gRNA) to excise mir-17 binding motif in the 3’ UTR region in a HEK293T cell line. This is to validate the editing efficiency of the designed gRNAs.

[0148] 2) Measure editing efficiency of designed dual guide RNAs (gRNA) to excise mir-17 binding motif in the 3’ UTR region in ADPKD a patient derived immortalized WT 9-12 cell line. b. Validation of target excision (mir-17 binding motif) in patient derived WT 9-12 cells and measure the phenotypic impact at PKD1 transcript level using rt-PCR.

[0149] Materials'. Two-part (crRNA and ATTO labelled tracrRNA) guide RNAs were procured from IDT; CleanCap® Cas9 mRNA (catalog no. L-7606) was procured from TriLink Biotechnologies, Lipofectamine Messenger MAX (catalog no. LMRNAOO3), DMEM (catalog no. 10569010), Opti-MEM (catalog no. 31985070), FBS (fetal bovine serum catalog no: 10270106) and Penicillin-Streptomycin (10,000 U / mL) (catalog no. 15140122) were procured from Thermo Fisher Scientific. Alt-R Genome Editing Detection Kit (catalog no. 1075932) was procured from IDT. Trypsin Phosphate Versene Glucose (TPVG)( catalog no. TCL031) was procured from Himedia. TRIzol reagent (catalog no. 15596018) was procured from Invitrogen. DNeasy Blood & Tissue Kit (catalog no. 69506) was procured from Qiagen. ADPKD patient-derived immortalized human WT 9-12 cell line (catalog no. CRL-2833) was procured from ATCC and HEK293T was procured from NCCS, Pune.

[0150] Guide RNA and Cas9 mRNA complexation-. Working stock solutions of Cas9 mRNA and two-part guide RNAs in Opti-MEM media were mixed along with Messenger MAX. The mixture was incubated for 5 minutes at room temperature to allow the Cas9 mRNA / guide RNA complex for self-assembly. Cas9 mRNA and two guide RNAs were mixed in a 1 :0.5:0.5 weight ratio.

[0151] PCR and T7E1 genome editing detection assay. Targeted genomic loci were amplified by PCR with gene-specific primers and PCR amplification conditions (mentioned in subsequent sections). The amplified product was subjected to T7E1 assay using Alt-R Genome Editing Detection Kit according to the manufacturer’s protocol.

[0152] Polymerase Chain Reaction-. The primers were designed to amplify the desired genomic region spanning the targeted region for editing by CRISPR / Cas9. The PCR reaction was performed for 30 cycles: initial denaturation for 2 min at 98 °C, denaturation for 30 s at 98 °C, annealing 30 s at 63 °C and extension for 2 min at 72 °C with 2 min extension at 72 °C.

[0153] A) in vitro transfection in HEK293T cells

[0154] The transfection of two guide RNAs and Cas9 mRNA with Lipofectamine Messenger MAX was done in HEK293T cells. The HEK293T cells were seeded at a concentration of 50,000 cells / well in a 24-well plate and allowed to grow for 24 hours in the growth medium (DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin (100 units / ml), streptomycin (100 pg / ml). After 24 hours, cells were washed with 1x PBS, and the two guide RNAs and Cas9 mRNA complex were subsequently delivered into cultured cells with the help of a transfection reagent (Lipofectamine Messenger MAX). Transfected cells were incubated for 48 hours under standard growth conditions of 5% CO2 and 37°C. Post incubation, cells were trypsinized with TPVG and proceeded for kit-based genomic DNA isolation. On- target edits were confirmed by T7E1 assay and Sanger sequencing.

[0155] Results: CRISPR-Cas9 was the strategy used to knock out (excise / delete) the mir-17 binding motif found in the 3’UTR region of the PKD1 gene in human derived cells. Dual guide RNAs were designed to remove 88 base pairs region spanning the mir-17 binding motif using the approach set out in Example 1 , see above. Initially, to confirm the editing efficiency of the designed guide RNAs, two guide RNAs, and Cas9 mRNA complex were transfected in HEK293T cells with Messenger MAX as the transfecting reagent. The editing was confirmed by a PCR reaction followed by a T7E1 assay (as shown in Fig. 1 , Fig. 2, Fig. 3 and Fig. 4) and multiple sequence alignment post-Sanger Sequencing (as shown in Fig. 5). 35.6 ± 8 % editing was observed in edited HEK293T cells. The deletion of the desired region was confirmed by Sanger sequencing performed on edited duplicate samples (n1 and n2) B) In vitro transfection (dual guide RNA transfection) in WT 9-12 cells

[0156] The designed two guide RNAs and Cas9 mRNA with Lipofectamine Messenger MAX were used to transfect WT 9-12 cells (representative of epithelial cell lines from over 30 individual renal cysts obtained from 11 patients with ADPKD). The WT 9-12 cells were seeded at a concentration of 50,000 cells / well in a 24-well plate and allowed to grow for 24 hours in the growth medium (DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin (100 units / ml), streptomycin (100 pg / ml). After 24 hours, the cells were washed with 1x PBS, and the two guide RNAs and Cas9 mRNA complex were subsequently delivered into cultured cells with the help of a transfection reagent (Lipofectamine Messenger MAX). Transfected cells were incubated for 48 hours under standard growth conditions of 5% CO2 and 37°C. Post incubation, cells were trypsinized with TPVG and processed for kit-based genomic DNA isolation. On-target edits were confirmed by T7E1 assay and Sanger sequencing.

[0157] To further validate the target, ADPKD patient derived immortalized WT 9-12 cells were transfected with the designed dual guide RNAs, Cas9 mRNA and Messenger MAX. The inventors observed an 87 bp deletion in a heterogeneous pool of edited cells and observed 54 ± 5 %, editing percentage in edited WT 9-12 Cells. The deletion of the desired region was confirmed by performing the experiment thrice (n1 , n2, and n3) and validated by PCR followed by T7E1 assay (as shown in Fig. 6, Fig. 7, Fig. 8, Fig. 9, Fig. 10 and Fig. 11) and multiple sequence alignment post-Sanger Sequencing (as shown in Fig. 12).

[0158] C) qPCR of PKD1 in untransfected and transfected WT 9-12 cells

[0159] Total RNA was extracted from untransfected (control) and ADPKD1 dual guide RNA transfected WT 9- 12 cells, using TRIzol reagent (Invitrogen, Cat. no. 15596018) as per manufacturer’s protocol. Subsequently, cDNA was synthesized from the extracted RNA using a PrimeScript™ 1st strand cDNA Synthesis Kit (TAKARA, Cat. No. 6110A). The qPCR reactions were carried out in triplicate using specific primers for the human PKD1 , and internal controls p-actin and GAPDH genes and TB Green® Premix Ex Taq ™ II (TaKaRa, Cat. No.: RR820A) was used for SYBR Green master mix preparation. Amplification and quantification were performed on a real-time PCR, StepOnePlus™ Real-Time PCR System (Applied Biosystems) with cycling conditions consisting of an initial denaturation step 10 min at 95 °C, followed by two-step qPCR at 95 °C for 15 sec and 60 °C for 1 min, for a total of 40 cycles. Data analysis was conducted using the comparative Ct (AACt) method to determine the relative expression levels of the PKD1 normalized to an internal control gene (p-actin and GAPDH genes, respectively). Standard curves were generated to validate the efficiency and significance of the qPCR reactions.

[0160] The phenotypic effect of this deletion was further confirmed by qRT-PCR which showed a significant 4- fold increase in PKD1 mRNA expression (as shown in Fig. 13) in the edited WT 9-12 cells when compared to the unedited cells.

[0161] Discussion-. Deletion of mir-17 binding motif in 3’ UTR region of PKD1 gene increases the expression of PKDI mRNA Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common human genetic conditions and has a frequent etiology of kidney failure. It is mainly caused due to heterozygous PKD1 mutations. ADPKD leads to End-Stage Renal Disease (ESRD), marked by the growth of fluid-filled cysts in the kidney originating from renal tubules. Upon decline in PKD1 dosage below a critical threshold, kidney cyst formation occurs. miR-17 promotes the growth of kidney cysts in ADPKD via the proliferation and post-transcriptional repression of PKD genes. The inventors’ strategy involved excision of the mir- 17 binding motif in the 3’UTR of PKD1 gene using dual gRNAs and CRISPR-cas9 mechanism, that can prevent the binding of mir-17 on PKD1 gene, halting the inhibition of the PKD1 gene expression by mir- 17 leading to a therapeutic benefit for ADPKD. It has been proven that re-expression of PKDI gene in cystic kidneys results in attenuation of cyst growth, rapid reversal of ADPKD and that the kidney has an unexpected capacity for plasticity which is controlled at least in part by ADPKD gene function. Excising the mir-17 binding motif leads to an increase in PKD1 gene expression and PC1 protein, confirmed through qRT-PCR and Western Blotting, respectively. This strategy proved that using CRISPR / Cas9 excision method involving designed dual gRNAs leads to a significant 4-fold increase in PKD1 mRNA post-editing. This increase in PKD1 mRNA within target tissue is surprisingly twice the amount achieved by previous attempts see Lakhia et al. (Nature Communications volume 13, Article number: 4765 (2022)).

[0162] Example 3: Deletion of miR-17 binding site in the 3’ UTR of PKD1 to rescue PKD1 gene expression in ADPKD patient derived immortalized WT9-7 cell line

[0163] The objective of the study was to delete the miR-17 binding region in the 3’ UTR region of the PKD1 gene using CRISPR / Cas9 in order to rescue the PKD1 gene expression, serving as a therapeutic strategy for Autosomal Dominant Polycystic Kidney Disease (ADPKD). The impact of the excision of the miR-17 binding region for the rescue was measured by the editing percentage at the genomic level, phenotypic recovery at the PKD1 mRNA level and estimation of changes in protein expression involved in cystogenesis and signaling pathways. The study had the following parts: a. Measure editing efficiency of Helex designed dual guide RNAs (gRNA) to excise miR-17 binding motif in the 3’ UTR region in ADPKD patient derived immortalized WT9-7 cell line. b. Validation of target excision (miR-17 binding motif) in patient derived WT9-7 cells and measure the phenotypic impact at PKD1 transcript level using RT-PCR. c. Validation of target excision by measuring changes in protein expression i.e. protein kinase A (PKA-C), cAMP response element-binding protein (pCREB) and mechanistic target of rapamycin (mTOR).

[0164] Materials and methods:

[0165] Materials- Two-part (crRNA and ATTO labelled tracrRNA) guide RNAs were procured from IDT; CleanCap® Cas9 mRNA (catalog no. L-7606) was procured from TriLink Biotechnologies, Lipofectamine Messenger MAX (catalog no. LMRNAOO3), DMEM (catalog no. 10569010), Opti-MEM (catalog no. 31985070), FBS (fetal bovine serum catalog no: 10270106) and Penicillin-Streptomycin (10,000 U / mL) (catalog no. 15140122) were procured from Thermo Fisher Scientific. Alt-R Genome Editing Detection Kit (catalog no. 1075932) was procured from IDT. Trypsin Phosphate Versene Glucose (TPVG) (catalog no. TCL031) was procured from Himedia. TRIzol reagent (catalog no. 15596018) was procured from Invitrogen. DNeasy Blood & Tissue Kit (catalog no. 69506) was procured from Qiagen. ADPKD patient-derived immortalized human WT 9-7 cell line (catalog no. CRL-2830) was procured from ATCC.

[0166] Guide RNA and Cas9 mRNA complexation- Working stock solutions of Cas9 mRNA and two-part guide RNAs in Opti-MEM media were mixed along with Messenger MAX. The mixture was incubated for 5 minutes at room temperature to allow the Cas9 mRNA / guide RNA complex for self-assembly. Cas9 mRNA and two guide RNAs were mixed in a 1 :0.5:0.5 weight ratio.

[0167] In vitro transfection (dual guide RNA transfection) in WT9-7 cells - The transfection of two guide RNAs and Cas9 mRNA with Lipofectamine Messenger MAX was done in WT9-7 cells. The WT9-7 cells were seeded at a concentration of 50,000 cells / well in a 24-well plate and allowed to grow for 24 hours in the growth medium (DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin (100 units / ml), streptomycin (100 pg / ml). After 24 hours, cells were washed with 1x PBS, and the two guide RNAs and Cas9 mRNA complex were delivered into cultured cells with the help of a transfection reagent (Lipofectamine MessengerMAX). Transfected cells were incubated for 24 hours under standard growth conditions of 5% CO2 and 37°C. Post incubation, cells were trypsinized with TPVG and proceeded for kit-based genomic DNA isolation. On-target edits were confirmed by PCR and Sanger sequencing.

[0168] Polymerase Chain Reaction — The primers were designed to amplify the desired genomic region spanning the targeted region for editing by CRISPR / Cas9. The PCR reaction was performed for 30 cycles: initial denaturation for 2 min at 98 °C, denaturation for 30 s at 98 °C, annealing for 30 s at 63 °C, and extension for 2 min at 72 °C with a 2-min extension at 72 °C. qPCR of PKD1 in untransfected and transfected WT 9-7 cells

[0169] Total RNA was extracted from untransfected (control) and ADPKD dual guide RNA transfected WT 9-7 cells, using TRIzol reagent (Invitrogen, Cat. no. 15596018) as per manufacturer’s protocol. Subsequently, cDNA was synthesized from the extracted RNA using a PrimeScript™ 1st strand cDNA Synthesis Kit (TAKARA, Cat. No. 6110A). The qPCR reactions were carried out in triplicate using specific primers for the human PKD1 , and internal controls p-actin and GAPDH genes and TB Green® Premix Ex Taq ™ II (TaKaRa, Cat. No.: RR820A) was used for SYBR Green master mix preparation. Amplification and quantification were performed on a real-time PCR, StepOnePlus™ Real-Time PCR System (Applied Biosystems), with cycling conditions consisting of an initial denaturation step 10 min at 95 °C, followed by two-step qPCR at 95 °C for 15 sec and 60 °C for 1 min, for a total of 40 cycles. Data analysis was conducted using the comparative Ct (2-AACt) method to determine the relative expression levels of the PKD1 normalized to an internal control gene (p-actin and GAPDH genes, respectively). Standard curves were generated to validate the efficiency and significance of the qPCR reactions.

[0170] Western blot for PKA-C, pCREB and mTOR proteins in untransfected and transfected WT 9-7 cells The control (untransfected) and transfected WT9-7 cells were washed with PBS followed by lysis with RIPA buffer for 10 min at 4°C. Post lysis, the cells were centrifuged at 12,000 x g, 4°C for 30 min and the supernatants were collected. The protein concentration of the samples was determined by Bradford protein assay (23238, Thermo Scientific), and the protein was denatured in equal amounts. Then, the protein was separated by 8% or 10% SDS-PAGE electrophoresis and transferred to polyvinylidene fluoride (PVDF) (88518, Thermo Scientific) membrane. The membrane was sealed with 3% BSA or at room temperature for 1 hour, then incubated with the diluent of the relevant primary antibody at 4°C overnight. On the second day, the membrane was washed three times with TBST and then incubated with the relevant secondary antibody dilutions for 1 hour at room temperature. Finally, ECL Kit (1705060, Bio-Rad) was used to detect, and Imaged software was used to analyze the results. Primary antibodies were used as follows: anti-PKA-C antibody (1 :1000, 5661 S, CST), anti-Phospo-CREB antibody (1 :1000, 9198, CST), anti-mTOR antibody (1 :1000, 2971 S, CST), anti-p-actin antibody (1 :1000, A3854, Merck) and Goat anti-Mouse IgG (H+L) secondary antibody, HRP (1 :1000, 31430, Thermo Scientific).

[0171] Results:

[0172] Part a): To further validate our target, ADPKD patient derived immortalized WT9-7 cells were transfected with the designed dual guide RNAs, Cas9 mRNA and Messenger MAX. We observed an 87 bp deletion in a heterogeneous pool of edited cells and observed 32 ± 5 %, editing percentage in edited WT 9-7 Cells. The deletion of the desired region was confirmed by performing the experiment thrice (n1 , n2, and n3) and validated by PCR (as shown in Fig. 15, Fig. 16, Fig. 17) and multiple sequence alignment post-Sanger Sequencing (as shown in Fig. 18).

[0173] Part b): The phenotypic effect of this deletion was further confirmed by qRT-PCR which showed a significant 3 to 4-fold increase in PKD1 mRNA expression (as shown in Fig. 19) in the edited WT9- 7 cells when compared to the unedited cells.

[0174] Part c): The phenotypic consequences of the deletion were subsequently validated through the application of western blot analysis. This technique enabled a detailed assessment of the downregulation of proteins that play crucial roles in cystogenesis and several key signaling pathways. A substantial downregulation of protein expression of 40.9%, 22.2% and 23.8% (as shown in Fig. 20(a), 20(b), 20(c) and 20(d)) was observed in pCREB, PKA-C and mTOR respectively.

[0175] Discussion:

[0176] This report provides comprehensive data on the validation of a gene editing approach applied to the patient-derived immortalized cell line WT9-7. This particular cell line is significant as it carries a heterozygous truncating mutation in the PKD1 gene while also expressing the full-length form of polycystin-1 , whereas the WT9-12 cell line carries a homozygous truncating mutation in the PKD1 gene and expresses polycystin-1 only in its truncated form.

[0177] The validation process utilizes advanced techniques to ensure accuracy and reliability. Initially, we estimated the percentage of successful gene editing through polymerase chain reaction (PCR). Subsequently, quantitative real time PCR (qRT-PCR) is employed to assess changes in PKD1 mRNA expression levels following transfection with the Helex-designed dual guide RNA. Additionally, this study explores the expression changes of key proteins involved in cellular signaling pathways, particularly Protein Kinase A (PKA), mechanistic target of rapamycin (mTOR), and phosphorylated cAMP response element-binding protein (pCREB). These proteins play significant roles in the pathogenesis of autosomal dominant polycystic kidney disease (ADPKD) [1], Notably, elevated levels of cyclic AMP (cAMP) in ADPKD cells activate PKA, promoting cell proliferation and cyst growth. The increased nuclear translocation of pCREB, a downstream effector of PKA, further stimulates the expression of genes that drive cell proliferation [2,4], Furthermore, the mTOR pathway is frequently inappropriately activated in ADPKD cyst-lining epithelial cells, contributing to abnormal cell growth and proliferation [3],

[0178] Our results indicate that the CRISPR / Cas9 excision approach, utilizing dual gRNAs designed by Helex, has the potential to significantly enhance PKD1 mRNA expression by 3-4 folds. Furthermore, we observed downregulation of 40.9%, 22.2%, and 23.8% for pCREB, PKA-C, and mTOR, respectively, due to editing of the binding site. This displays disease modifying capability of the drug.

[0179] Example 4: Further validation of editing efficiency of single guide RNA pairs

[0180] The objective of the study was to measure editing efficiency of the designed dual guide RNAs (gRNA) to excise miR-17 binding motif in the 3’ UTR region in WT9-7 cell line in order to validate the editing efficiency of the designed gRNAs.

[0181] ADPKD patient-derived immortalized WT9-7 cells were transfected with nine pairs of dual guide RNAs designed by the inventors, Cas9 mRNA and Messenger MAX. The gRNAs used are shown in Table 13, below. The gRNAs were paired as follows: pair 1 - sgRNAI and sgRNA2; pair 2 - sgRNA4 and sgRNA5; pair 3 - sgRNA6 and sgRNA7; pair 4 - sgRNA8 and sgRNA9; pair 5 - sgRNAI O and sgRNA11 ; pair 6 - sgRNAI 2 and sgRNAI 3; pair 7 - sgRNAI 4 and sgRNAI 5; pair 8 - sgRNAI 6 and sgRNAI 7; pair 9 - sgRNAI 8 and sgRNAI 9.

[0182] Table 13

[0183]

[0184] The inventors observed an 87 bp deletion in a heterogeneous pool of edited cells and observed 31.5, 29.1 , 27.8,31 .4, 31 .8, 30.8, 28.9 and 31 .7 % editing percentage in edited WT9-7 Cells with each pair of guide RNAs, respectively. The deletion of the desired region was confirmed by performing PCR (as shown in Fig 21).

[0185] Example 5: 3D Cyst Assay

[0186] The aim is to establish the modifying capability of the Helex proprietary drug product (lipid nanoparticle encapsulated with ADPKD dual guide RNAs and Cas9 mRNA) in human primary kidney cysts cells. The human primary kidney cells were plated in a 6-well plate coated with phenol red-free, growth factor- reduced Matrigel in DMEM / F12 culture medium supplemented with 10% fetal bovine serum (FBS), 1 % penicillin / streptomycin (P / S), and 1 % GlutaMAX. The cells were incubated at 37°C with 5% CO2, and the medium was changed every 48 hours to sustain the cyst structures. The drug product was transfected in healthy primary renal epithelial (NHK) cells and ADPKD cystic cells and incubated for 48 hours. The success of the transfection was observed by i. measuring the proliferation rate of the transfected cells as compared to the untransfected (control) cells ii. measuring growth of transfected and untransfected cells from a single cyst in a 3D matrix and the rate of formation and expansion of spherical structures through microscopic observations

[0187] Although particular embodiments of the invention have been disclosed herein in detail, this has been done by way of example and for the purposes of illustration only. The aforementioned embodiments are not intended to be limiting with respect to the scope of the appended claims, which follow. It is contemplated by the inventors that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as defined by the claims.

Claims

What is claimed is:

1. A composition comprising: a. a first ribonucleoprotein (RNP) comprising a first sequence-guided endonuclease and a first guide RNA (gRNA) wherein the first gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a human PKD1 gene upstream of a miR-17 binding site; and b. a second RNP comprising a second sequence-guided endonuclease and a second guide RNA (gRNA) wherein the second gRNA is configured to hybridise with a region within the 3’ UTR of the human PKD1 gene downstream of the said miR-17 binding site.

2. The composition of claim 1 , wherein the first gRNA comprises a sequence of nucleotides selected from any one of SEQ ID NO: 1 to SEQ ID NO: 1316, orthe reverse complement thereof as defined in any one of SEQ ID NO: 1317 to SEQ ID NO: 2632.

3. The composition of claim 1 or claim 2, wherein the second gRNA comprises a sequence of nucleotides selected from any one of SEQ ID NO: 2633 to SEQ ID NO 3954, or the reverse complement thereof as defined in any one of SEQ ID NOS 3955 to SEQ ID NO 5276.

4. The composition of any preceding claim, wherein the first sequence-guided endonuclease is selected from: Cas9, Cpf1 , Cas12a, Cas12b, or CasX, and variants or derivatives of any thereof.

5. The composition of any preceding claim, wherein the second sequence-guided endonuclease is selected from: Cas9, Cpf1 , Cas12a, Cas12b, or CasX, and variants or derivatives of any thereof.

6. The composition of any preceding claim, wherein the first sequence-guided endonuclease comprises an endonuclease having Cas9 activity or a variant or derivative thereof.

7. The composition of any preceding claim, wherein the second sequence-guided endonuclease comprises an endonuclease having a Cas9 activity or a variant or derivative thereof.

8. The composition of claim 6 or claim 7, wherein the endonuclease having Cas9 activity is selected from: SpCas9, SpCas9_NAG, and XCas9_3.7.

9. The composition of any preceding claim, wherein the first sequence-guided endonuclease and the second sequence-guided endonuclease are of the same type.

10. The composition of any preceding claim, wherein the miR-17 binding site has a sequence having at least 80%, suitably 90%, more typically 100%, complementarity to the sequence TAAAGTGC (5’ to 3’) or GCACTTTA (3’ TO 5’).

11. The composition of any preceding claim, wherein the first gRNA comprises a nucleotide sequence comprising at least 80% similarity to a sequence selected from: SEQ ID NO: 1976; SEQ ID NO 1945; SEQ ID NO 560; SEQ ID NO 555; SEQ ID NO 1963; SEQ ID NO 600; SEQ ID NO 1907 and SEQ ID NO 540.

12. The composition of any preceding claim, wherein the second gRNA comprises a nucleotide sequence comprising at least 80% similarity to a sequence selected from: SEQ ID NO: 2780; SEQ ID NO 2973; SEQ ID NO 2986; SEQ ID NO4247; SEQ ID NO4393; SEQ ID NO 4396; SEQ ID NO4378 and SEQ ID NO 4225.

13. The composition of any preceding claim, wherein the composition is comprised within a lipid nanoparticle.

14. The composition of any preceding claim, for use in the treatment of a kidney disease.

15. The composition of claim 14, wherein the kidney disease is autosomal dominant polycystic kidney disease (ADPKD).

16. A method of treating a kidney disease, said method comprising administering a composition of any one of claims 1 to 15.

17. The method of treating a kidney disease of claim 16, wherein the kidney disease is autosomal dominant polycystic kidney disease (ADPKD).

18. A composition comprising: a. a first nucleic acid encoding a first guide RNA (gRNA) wherein the first gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a PKD1 gene upstream of a miR-17 binding site; and b. a second nucleic acid encoding a second gRNA wherein the second gRNA is configured to hybridise with a region within a 3’ UTR of a PKD1 gene downstream of a miR-17 binding site.

19. The composition of claim 18, wherein first gRNA comprises a sequence of nucleotides selected from any one of SEQ ID NO: 1 to SEQ ID NO: 1316, or the reverse complement thereof as defined in any one of SEQ ID NO: 1317 to SEQ ID NO: 2632.

20. The composition of claim 18 or 19, wherein the second gRNA comprises a sequence of nucleotides selected from any one of SEQ ID NO: 2633 to SEQ ID NO 3954, or the reverse complement thereof as defined in any one of SEQ ID NOS 3955 to SEQ ID NO 5276.21 . The composition of any one of claims 18 to 20, wherein the composition further comprises an mRNA that encodes a sequence-guided endonuclease.

22. The composition of claim 21 , wherein the sequence-guided endonuclease is selected from: Cas9, Cpf1 , Cas12a, Cas12b, or CasX, and variants or derivatives of any thereof.

23. The composition of claim 21 , wherein the sequence-guided endonuclease comprises an endonuclease having Cas9 activity or a variant or derivative thereof.

24. The composition of any one of claims 18 to 23, wherein the composition is comprised within lipid nanoparticle.

25. The composition of any one of claims 18 to 24, for use in the treatment of a kidney disease.

26. The composition of claim 25, wherein the kidney disease is autosomal dominant polycystic kidney disease (ADPKD).

27. The composition of any one of claims 18 to 24 for use in the treatment of a kidney disease.

28. The composition of claim 27, wherein the kidney disease is autosomal dominant polycystic kidney disease (ADPKD).

29. A method of treating a kidney disease, said method comprising administering a composition of any one of claims 18 to 24.

30. The method of treating a kidney disease according to claim 29, wherein the kidney disease is ADPKD.31 . The method of treating a kidney disease according to claim 29 or 30, wherein the composition is administered in combination with a vasopressin V2-receptor antagonist.

32. The method for the treatment according to claim 31 , wherein the vasopressin V2-receptor antagonist is tolvaptan, or a homologue or a derivative thereof.

33. A pharmaceutical composition comprising the composition of any one of claims 1 to 15 or 18 to 28, and a pharmaceutically acceptable carrier.

34. A method of editing a PKD1 gene comprised within a genome of a human somatic cell in order to disrupt a miR-17 binding site within a 3’ UTR located within the said PKD1 gene, the method comprising contacting the human somatic cell with a composition of any one of claims 1 to 15 or 18 to 28.

35. A method of editing a PKD1 gene comprised within a genome of a human somatic cell in order to disrupt a miR-17 binding site within a 3’ UTR located within the said PKD1 gene, the method comprising contacting the human somatic cell with a composition comprising at least one gRNA comprising a sequence of nucleotides selected from any one of SEQ ID NO: 1 to SEQ ID NO:1316, or the reverse complement thereof as defined in any one of SEQ ID NO: 1317 to SEQ ID NO: 2632, or homologues having at least 80% sequence similarity thereto.

36. A method of treating autosomal dominant polycystic kidney disease (ADPKD) in a human patient in need thereof, the method comprising editing a PKD1 gene comprised within a genome of a somatic cell present in a kidney of the human patient in order to disrupt a miR-17 binding site within a 3’ UTR located within the said PKD1 gene, the method comprising contacting the somatic cell with a pharmaceutical composition of claim 33.

37. A composition comprising a nucleic acid encoding at least one guide RNA (gRNA) wherein the at least one gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a PKD1 gene, optionally wherein the region is proximal to or within a miR-17 binding site.

38. The composition of claim 37, wherein the at least one gRNA is configured to hybridise with a region that spans at least a portion of a miR-17 binding site.

39. The composition of either of claims 37 or 38, wherein the at least one gRNA comprises a sequence of nucleotides, or their reverse complement, selected from the sequences as set out in Table 3 above.

40. The composition of any one of claims 37 to 39, wherein the gRNA is configured to be comprised within a gene editing complex.

41. The composition of claim 40, wherein the gene editing complex, is comprised within:(i) a RNP and further comprises a Cas endonuclease; or(ii) a mRNA that further encodes a Cas endonuclease.

42. The composition of claim 41 , wherein the Cas endonuclease is selected from: Cas3; Cas9, Cpf1 , Cas12a, Cas12b, Cas13 or CasX, and variants or derivatives of any thereof.

43. The composition of claim 42, wherein the Cas endonuclease comprises an endonuclease having Cas9 activity or a variant or derivative thereof.

44. The composition of any one of claims 37 to 40, wherein the gRNA is configured to be comprised within a base editing complex.

45. The composition of claim 44, wherein the base editing complex comprises a protein having cytidine deaminase activity and further comprises a modified Cas endonuclease having nickase activity.

46. The composition of claim 44, wherein the base editing complex comprises a protein having adenosine deaminase activity and further comprises a modified Cas endonuclease having nickase activity (nCas).

47. The composition of either of claims 45 or 46, wherein the Cas endonuclease comprises an endonuclease having nCas9 activity or a variant or derivative thereof.

48. The composition of claim 46, wherein the Cas endonuclease comprises an endonuclease having activity equivalent to nCas9 activity.

49. The composition of any one of claims 37 to 40, wherein the gRNA is configured to be comprised within a prime editing complex.

50. The composition of claim 50, wherein the prime editing complex, comprises a protein having reverse transcriptase activity and further comprises a modified Cas endonuclease having nickase activity (nCas).51 . The composition of claim 50, wherein the reverse transcriptase comprises a Moloney murine leukemia virus (M-MLV) reverse transcriptase.

52. The composition of claim 51 , wherein the Cas endonuclease comprises an endonuclease having nCas9 activity or a variant or derivative thereof53. The composition of any of claims 50 to 52, wherein the reverse transcriptase is not covalently attached to the modified Cas endonuclease.

54. The composition of any one of claims 37 to 40, wherein the gRNA is configured to be comprised within a mRNA editing complex.

55. The composition of claim 54, wherein the mRNA editing complex, comprises Cas13 endonuclease activity.

56. The composition of any one of claims 35 to 55, wherein the composition is comprised within lipid nanoparticle.

57. The composition of any one of claims 37 to 56, for use in the treatment of a kidney disease.

58. The composition of claim 57, wherein the kidney disease is autosomal dominant polycystic kidney disease (ADPKD).

59. A method of treating a kidney disease, said method comprising administering a composition of any one of claims 33 to 52 to an individual in need thereof, optionally wherein the kidney disease is ADPKD.

60. A pharmaceutical composition comprising the composition of any one of claims 37 to 56, and a pharmaceutically acceptable carrier.61 . A method of editing a PKD1 gene comprised within a genome of a human somatic cell in order to disrupt a miR-17 binding site located within a 3’ UTR located within the said PKD1 gene, themethod comprising contacting the human somatic cell with a composition of any one of claims 37 to 56.

62. The method of claim 61 , wherein the method comprises a gene editing step to generate an indel mutation within or proximate to the miR-17 binding site so as to disrupt miRNA-17 mediated suppression of an expressed PKD1 mRNA within the human somatic cell.

63. The method of claim 62, wherein the method comprises a base editing step to generate a mutation within or proximate to the miR-17 binding site so as to reduce or eliminate miRNA-17 mediated suppression of an expressed PKD1 mRNA within the human somatic cell.

64. The method of claim 62, wherein the method comprises a prime editing step to generate a mutation within or proximate to the miR-17 binding site so as to reduce or eliminate miRNA-17 mediated suppression of an expressed PKD1 mRNA within the human somatic cell.

65. The method of claim 62, wherein the method comprises a mRNA editing step to disrupt the miR-17 binding site via mutation or removal so as to reduce or eliminate miRNA-17 mediated suppression of an expressed PKD1 mRNA within the human somatic cell.

66. The method of any one of claims 59 to 65, wherein the human somatic cell is kidney cell.

67. The method of claim 66, wherein the human somatic cell is comprised within: a renal proximal tubule; a collecting duct and / or a distal convoluted tubule.

68. A composition comprising a nucleic acid encoding at least one gRNA wherein the at least one gRNA is configured to hybridise with a region within a 3’ untranslated region (UTR) of a PKD1 gene proximal to or within a miR-17 binding site, and wherein at least one gRNA comprises a sequence of nucleotides selected from any one of SEQ ID NO: 1 to SEQ ID NO: 1316, or the reverse complement thereof as defined in any one of SEQ ID NO: 1317 to SEQ ID NO: 2632.

69. A composition for mRNA editing comprising a nucleic acid encoding at least one gRNA wherein the at least one gRNA is configured to hybridise with a PKD1 mRNA, wherein the at least one gRNA comprises a sequence of nucleotides selected from any one of Tables 4A-C set out above, and wherein the composition further comprises an endonuclease having a Cas13 activity.

70. A kit comprising the composition according to any one of claims 1 to 15 or 18 to 28, together with instructions for use of the said composition.

71. The kit according to claim 70, wherein the kit further comprises a vasopressin V2-receptor antagonist.

72. The kit according to claim 71 , wherein the vasopressin V2-receptor antagonist is tolvaptan.

Images