Probes, primers and methods for nucleic acid detection
The novel nucleic acid probe system with secondary structures addresses false positives in 3WJ-based detection by preventing probe interactions in the absence of a target, enhancing sensitivity and specificity in nucleic acid detection and amplification.
Patent Information
- Application Number
- PCT/GB2025/050543
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-18
- Filing Date
- 2025-03-17
- Publication Date
- 2025-09-25
AI Technical Summary
Existing nucleic acid detection methods using three-way junctions (3WJs) suffer from false positives due to probe interactions in the absence of a target nucleic acid, leading to high background noise and difficulties in multiplex detection, particularly in isothermal amplification techniques like LAMP.
A novel nucleic acid probe system with secondary structures that prevent probe interaction in the absence of a target nucleic acid, allowing specific 3WJ formation only in its presence, thereby reducing background noise and enhancing sensitivity.
The system minimizes background signal noise, increasing the sensitivity and specificity of nucleic acid detection and amplification, enabling more reliable assays, especially in isothermal amplification methods.
Smart Images

Figure GB2025050543_25092025_PF_FP_ABST
Abstract
Description
[0001] PROBES, PRIMERS AND METHODS FOR NUCLEIC ACID DETECTIONField The present invention generally relates to detection of a nucleic acid target sequence. More specifically, the present invention relates to a novel nucleic acid probe system for formingthree-way junctions for use in methods of nucleic acid amplification and detection, wherein thesystem comprises novel probes having one or more secondary structures designed to prevent interaction of the probes in the absence of a target nucleic acid sequence. The present invention also relates to methods of amplification and detection of target nucleic acid sequences, novel optimised primers for amplification and detection of target nucleic acidsequences. Also provided are kits and substrates comprising the novel nucleic acid probesystem, the novel primers and / or reagents for performing the methods of the invention. Introduction Nucleic acid target sequence detection is routinely used in many medical, veterinary and research applications. For example, it may be used to diagnose a particular disease or detect the presence of a particular infectious agent (e.g. bacterium, virus and the like). It may also be used in personalised medicine to identify patients most likely to respond to a particulartherapy based on the patient’s genetic make-up or in a variety of research studies that involveunderstanding specific allele sequences present in an individual or model organism. The conventional strategy to detect nucleic acid target sequences is to use amplification reactions (such as those based on polymerase chain reaction (PCR)) in methods that require expensive machinery and / or the use of expensive materials such as fluorescent probes, and are typically carried out within the laboratory setting away from the subject (patient / animal) being tested. There is an increasing need for reliable and inexpensive tools to diagnose diseases of animals (including livestock, farmed aquatic animals, pedigree animals and companion animals), that can be used in the field (outside of a laboratory setting). A three-way junction (3WJ) is a three-nucleic acid complex formed when parts of two nucleicacid sequences (also referred to as “probes”) hybridise to a target nucleic acid sequence inan adjacent or substantially adjacent manner and other parts of the two probes hybridise toeach other. The use of such three-way junctions to identify a particular target sequence andcreate a signalling oligonucleotide that can then be detected was first described in WO93 / 06240 in the ‘SMART’ technique. This technique generates an RNA oligonucleotide signal sequence as a result of RNA transcription from an RNA promoter created by an extensionreaction from the 3WJ. The use of such methods for detecting evidence of pathogens, suchas E. coli genomic DNA and ribosomal RNA has demonstrated the sensitivity of such methods,even using crude E. coli cell lysates without sophisticated sample preparation (Wharam et al.,Nucleic Acids Research, 29:e54, 2001).Combining 3WJ formation with isothermal amplification methods, such as rolling-circleamplification (RCA), Nucleic Acid Sequence-Based Amplification (NASBA) and loop-mediatedisothermal amplification (LAMP) offers the possibility to detect target nucleic acids without theneed to perform thermocycling. Murakami, T et al., (Nucleic Acids Research. 40:e22, 2012)demonstrated the use of a 3WJ with primer generation-rolling circle amplification (PG-RCA)in an isothermal reaction format could detect an RNA target sequence.Loop-mediated isothermal amplification is a robust and highly specific method for amplifyingnucleic acid templates. The method utilises specially designed primers to generate stem-loopDNA amplification products which are readily detectable. The method is promising for the development of diagnostic tests for use in the field, due to its ability to rapidly amplify a DNA template without the need for thermocycling and the ease of signal detection, such as via fluorescence. However, there remain issues such as false positives, low signal-to-noise ratiosand difficulties in developing assays for multiplex detection (Yu et al., Analytical andBioanalytical Chemistry, 4152173-21832023). In particular, interactions between primershave been identified as contributing to false positive results (Bercherer et al., AnalyticalMethods, 12717-7462020). A number of problems remain for developing robust and reliable methods for nucleic acidtarget sequence detection to harness the benefits of 3WJ and isothermal amplificationtechnologies. For instance, interaction between the first and second probes, which form the3WJ, in the absence of any target nucleic acid can generate false signals and give a highbackground reading during detection. One or more embodiments of the present invention aim to solve one or more of the above mentioned problems. In particular, the novel nucleic acid probe system of the invention allowsincreased specificity by minimising interactions of 3WJ probes prior to binding the targetsequence. Such improvements allow for multiplexing, flexibility to target variation and rapiddevelopment of new assays. Novel primers for signal amplification ensure optimal LAMP reactions which are unconstrained by target sequence. Statements of InventionThe inventors have developed a novel nucleic acid probe system for forming three-wayjunctions (3WJs) for use in nucleic acid detection and amplification methods. The novel nucleicacid probe system comprises a pair of nucleic acid probes comprising one or more secondarystructures which prevent the binding of a first probe and a second probe to each other in the absence of a target nucleic acid, but allow binding of the first and second probes to form a 3WJ in the presence of a target nucleic acid. Advantageously, this reduces background signal noise in methods of nucleic acid detection and amplification which use three-way junctions.This could be particularly advantageous in isothermal amplification methods. Reduction inbackground noise makes such detection and amplification methods more sensitive. In one aspect, the invention provides a nucleic acid probe system comprising a pair of nucleic acid probes capable of creating a three-way junction when in the presence of a target nucleicacid sequence, wherein the pair of nucleic acid probes comprises a first nucleic acid probeand a second nucleic acid probe, wherein the first nucleic acid probe comprises a bindingregion substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non-complementary to the target nucleic acid sequence but comprising a sequence substantially complementary to the second nucleic acid probe and so capable of hybridising thereto, and a signal region which is the complement of at least part ofa signal oligonucleotide; and wherein the second probe comprises a binding regionsubstantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, and a core region non-complementary to the target nucleic acid sequence but comprising a sequence substantially complementary to the first nucleic acid probe and socapable of hybridising thereto; wherein the first probe and / or the second probe comprises asecondary structure, wherein the secondary structure is disrupted upon creation of the three- way junction.Suitably wherein creation of the three-way junction occurs upon hybridisation of the first probeand the second probe with the target nucleic acid sequence and hybridisation of the coreregions of the first and second nucleic acids with each other.In a second aspect, the invention provides a nucleic acid probe system for use in loop-mediated isothermal amplification (LAMP) comprising a pair of nucleic acid probes capable ofcreating a three-way junction when in the presence of a target nucleic acid sequence, whereinthe pair of nucleic acid probes comprises a first nucleic acid probe and a second nucleic acidprobe, wherein the first nucleic acid probe comprises a binding region substantiallycomplementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non-complementary to the target nucleic acid sequence but comprising a sequence substantially complementary to the second nucleic acid probe and so capable of hybridising thereto, and a signal region which is the complement of at least part of a signal oligonucleotide; and wherein the second probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non-complementary to the target nucleic acid sequence but comprising a sequence substantially complementary to the first nucleic acid probe and so capable of hybridising thereto, and a head region wherein the head region is non-complementary to thetarget nucleic acid sequence and the first nucleic acid probe; wherein the first nucleic acidprobe, the second nucleic acid probe, the signal oligonucleotide and / or a synthesised strand comprising a nucleic acid sequence complementary to at least a portion of the head region of the second nucleic acid probe comprise nucleic acid sequences complementary to at least a portion of one or more primers, wherein the primers are LAMP primers.In some embodiments, the first probe for use in the nucleic acid probe system of the first orsecond aspect of the invention does not comprise a secondary structure. In someembodiments, the first probe for use in the nucleic acid probe system of the first or secondaspect of the invention comprises a secondary structure. In some embodiments, the secondprobe for use in the nucleic acid probe system of the first or second aspect of the inventiondoes not comprise a secondary structure. In some embodiments, the second probe for use inthe nucleic acid probe system of the first or second aspect of the invention comprises asecondary structure.In a third aspect, the invention provides one or more displacing nucleic acid sequencescomprising a sequence capable of hybridizing to a sequence in the first nucleic acid probe and / or the second nucleic acid probe according to the first or second aspect of the inventionand displacing a nucleic acid sequence bound thereto.In a fourth aspect, the invention provides a signal oligonucleotide comprising a sequencecomplementary to the signal region of the first nucleic acid probe according the first or second aspect of the invention.In some embodiments, the signal oligonucleotide comprises a sequence complementary tothe signal region of the first nucleic acid probe according the first or second aspect of the invention and further comprises the second nucleic acid probe or part of the sequence of the second nucleic acid probe according to the first or second aspect of the invention. In a fifth aspect, the invention provides an amplification product comprising at least a portion of the signal oligonucleotide according to the fourth aspect and / or comprising a sequence complementary to at least a portion of the signal oligonucleotide according to the fourth aspect.In a sixth aspect, the invention provides method of performing loop-mediated isothermalamplification (LAMP) of a target nucleic acid sequence, the method comprising: (a) contacting the target nucleic acid sequence with a nucleic acid probe systemso as to form a three-way junction;(b) generating a signal oligonucleotide from the three-way junction;(c) generating a LAMP amplification product that comprises at least a portion ofthe signal oligonucleotide and / or comprises a sequence complementary to atleast a portion of the signal oligonucleotide; (d) optionally detecting the amplification products generated in step (c).In one embodiment of the sixth aspect, the nucleic acid probe system is a system accordingto the first or second aspect of the invention. In one embodiment of the sixth aspect, the nucleic acid probe system may comprise one ormore displacing nucleic acid sequences according to the third aspect of the invention.In one embodiment of the sixth aspect, the signal oligonucleotide may be a signal oligonucleotide according to the fourth aspect of the invention.In one embodiment of the sixth aspect, the amplification product may be an amplificationproduct according to the fifth aspect of the invention. In one embodiment a plurality ofamplification products are produced.In a seventh aspect, the invention provides a method of amplifying a target nucleic acidsequence, the method comprising: (a) contacting the target nucleic acid with the pair of nucleic acid probes according tothe first aspect so as to form a three-way junction;(b) generating a signal oligonucleotide from the three-way junction; and (c) creating multiple copies of the signal oligonucleotide and / or generating an amplification product from the signal oligonucleotide.In an eighth aspect, the invention provides a method of detecting a target nucleic acidsequence, the method comprising: (a) contacting the target nucleic acid with the nucleic acid probe system according tothe first aspect or second aspect of the invention so as to form a three-way junction; (b) generating a signal oligonucleotide from the three-way junction; (c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product from the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) or the signaloligonucleotide and / or amplification product generated in step (c).In a ninth aspect, the invention provides a method of detecting a disease or infection in asubject, the method comprising: (a) contacting a sample obtained from the subject with a nucleic acid probe system according to the first aspect or second aspect of the invention so as to form a three- way junction with a target nucleic acid sequence present in the sample;(b) generating a signal oligonucleotide from the three-way junction, optionally the signal oligonucleotide according to the third aspect of the invention; (c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product comprising at least a portion of the signal oligonucleotide and / or comprising a sequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) or the signaloligonucleotide and / or amplification product generated in step (c); and optionally (e) diagnosing the presence of a disease or infection based upon said detection. In one embodiment, the target nucleic acid sequence is indicative of the disease or infection to be detected. In one embodiment, the detection of the signal oligonucleotide produced in step (b) or thesignal oligonucleotide and / or amplification product generated in step (c) indicates thepresence of a disease or infection, suitably in the subject.In a tenth aspect, the invention provides one or more primers comprising a nucleic acidsequence substantially complementary to a signal oligonucleotide and / or an amplificationproduct, wherein the signal oligonucleotide is complementary to at least a part of a first nucleicacid probe and / or wherein the amplification product comprises at least a portion of the signal oligonucleotide and / or a sequence complementary to at least a portion of the signal oligonucleotide.In one embodiment, the signal oligonucleotide is according to the fourth aspect. In oneembodiment, the amplification product is according to the fifth aspect. In one embodiment theone or more primers are substantially complementary to a signal oligonucleotide and / or anamplification product of a loop-mediated isothermal amplification (LAMP) process.In an eleventh aspect, the invention provides a kit for use in detecting the presence of a targetnucleic acid sequence. In some embodiments, the kit comprises the nucleic acid probe systemaccording to the first or second aspect, the displacing nucleic acid sequence according to thethird aspect and / or the one or more primers according to the tenth aspect. In someembodiments, the kit is for performing the method of the sixth, seventh, eighth or ninth aspect.In a twelfth aspect, the invention provides a substrate comprising reagents attached thereto,wherein the reagents comprise the nucleic acid probe system according to the first or secondaspect, the displacing nucleic acid sequence according to the third aspect and / or the one ormore primers according to the tenth aspect, and / or the reagents comprise the reagents necessary for performing the method of the sixth, seventh, eighth or ninth aspect. Further features and embodiments of the above aspects will now be described under the following headed sections. Any feature in any section may be combined with any aspect or embodiment in any combination. Nucleic Acid Probe SystemOne aspect of the present invention relates to a nucleic acid probe system comprising a pairof nucleic acid probes (or “probes” as referred to herein) capable of forming a three-wayjunction (3WJ or TWJ).As used herein, the term “probe” means a nucleic acid sequence, typically a single-strandedoligonucleotide that has regions complementary to and thus capable of hybridising to a targetsequence. Nucleic acid sequences capable of forming a 3WJ with a target nucleic acidsequence are referred to herein as “probes” or “nucleic acid probes”.Three-way junctions are typically formed when a first probe and a second probe hybridise together in the presence of a target nucleic acid sequence, preferably when each probe is also bound to the target nucleic acid sequence.The first probe may be a template probe. The second probe may be an extension probe.A probe can be any nucleic acid type, including DNA, or RNA, or any nucleic acid analoguesuch as: morpholino nucleic acids (e.g. PMO or PPMO), BNA (bridged nucleic acid), GNA(glycol nucleic acid), TNA (threose nucleic acid) or HNA (hexitol nucleic acids), PS (phosphorothioate nucleic acid), BP (borano-phosphate nucleic acid), 2’MOE nucleic acids,2’OMe nucleic acids, 2’F nucleic acids . BNA may also be referred to as an LNA (locked nucleicacid). Suitably such nucleic acid analogues contain modifications to the backbone and / or to the sugar of typical nucleic acids DNA or RNA.The first and / or second probes may comprise any nucleic acid, such as DNA, RNA, PMO,PPMO, GNA, TNA, HNA, PS, BP, 2’MOE, 2’MOE-F, 2’OMe, 2’F or BNA, or any combinationthereof. The first and / or second probes may comprise or consist of DNA.Furthermore, suitably the probes may comprise one or more modified or synthetic nucleotidesor nucleic acids, suitably which may comprise a modification to the base, such as: C7-modified deaza-adenine, C7-modiifed deaza guanosine, C5-modified cytosine, C5-modified uridine,(wherein the modification may be hydrogen, chloride, fluoride, bromide, methyl, azyl etc) phNA(alkyl phosphonate nucleic acid), PNA (peptide modified nucleic acid), or the like. For example:2,6-Diaminopurine, 5-Methyl cytosine, 5-hydroxybutynl-2’-deoxyuridine, 8-aza-7- deazaguanosine. Hybrid probes comprising, for example, portions of typical nucleic acids and portions of nucleicacid analogues and / or modified nucleic acids or nucleotides are envisaged, for example theprobes may comprise both DNA and PNA, or DNA and BNA. The first probe may compriseDNA and BNA. The second probe may comprise DNA and BNA. As PNA is not currentlyrecognised by any polymerase, suitably PNA is only used in portions of the probe that are not meant to function as a template and thus do not require copying.Probes, or regions of probes, comprising one or more nucleic acid analogues or one or moremodified nucleic acids, such as PNA, or BNA, may have greater thermodynamic stability whenbound to a complementary nucleic acid sequence. Regions of a probe which comprise one ormore nucleic acid analogues or modified nucleic acids may bind more strongly to acomplementary nucleic acid sequence relative to regions comprising DNA or RNA alone. Thus, thermodynamics of reactions can be influenced by introducing one or more nucleic acidanalogues or modified nucleic acids, such as PNA or BNA, to one or more regions of one ormore probes. The first and / or second probes may comprise between 0 and 40 nucleic acid analogues or modified nucleic acids, suitably between 5 and 30 nucleic acid analogues or modified nucleic acids, suitably between 10 and 25 nucleic acid analogues or modified nucleic acids, suitably between 15-20 nucleic acid analogues or modified nucleic acids. In one embodiment, the first and / or second probes may comprise 19-20 nucleic acid analogues or modified nucleic acids. The first and / or second probes may comprise one or more nucleic acid analogues or modifiednucleic acids in portions of the probes that do not anneal to the target nucleic acid sequenceof interest. The first probe may comprise one or more nucleic acid analogues or modifiednucleic acids (e.g. PNA or BNA) in a portion of the probe that binds the second probe. Thesecond probe may comprise one or more nucleic acid analogues or modified nucleic acids(e.g. PNA or BNA) in a portion of the probe that binds the first probe. The first and / or secondprobes may comprise PNA, or BNA in portions of the probe that anneal to the target nucleicacid sequence of interest. The first and / or second probes may comprise one or more nucleicacid analogues or modified nucleic acids / nucleotides (e.g. PNA or BNA) in portions of theprobes that that do not anneal to the target nucleic acid sequence of interest but are designedto anneal to other nucleic acids such as displacing nucleic acid sequence. The first and / orsecond probes may comprise one or more nucleic acid analogues or modified nucleic acids(e.g. PNA or BNA) in portions of the probes that are designed for self-annealing. The firstand / or second probes may comprise one or more nucleic acid analogues or modified nucleic acids (e.g. PNA, or BNA) in portions of the probe that are not substantially complementary to primers for use in amplification methods such as LAMP. Suitably the first and / or second probes may comprise one or more nucleic acid analogues or modified nucleic acids / nucleotides (e.g. PNA or BNA) in every part of the probe except the portion that is complementary to primers for use in amplification methods such as LAMP. In some embodiments, substantially every nucleotide of the first and / or second probes which is non-complementary to primers for use in amplification methods, or outside the part which is complementary to primers for use in amplification methods, is a nucleic acid analogue or modified nucleic acids / nucleotide (e.g. PNA or BNA). The first probe and the second probe may each comprise a plurality of regions. Each regionmay have a defined function as explained below.First probeThe first probe may comprise at least a binding region, a core region, and a signal region. Thefirst probe may comprise a binding region, a hinge region, a core region, and a signal region.The first probe may comprise a binding region, a core region, a spacer region, and a signalregion. The first probe may comprise a binding region, a hinge region, a core region, a spacerregion, and a signal region. The first probe may comprise a binding region, a hinge region, acore region, a spacer region, a signal region and one or more landing pad regions. The firstprobe may comprise a binding region, a hinge region, a core region, one or more spacer regions, a signal region, one or more landing pad regions, and a linker region. The first probe may comprise a binding region, a hinge region, a core region, one or more spacer regions, a signal region, one or more landing pad regions, a linker region and a handle region. The first probe may comprise a binding region that is substantially complementary to a portionof a target nucleic acid sequence and so is capable of binding thereto. The binding region maybind to a target nucleic acid sequence, preferably the binding region binds to a complementaryportion of a target nucleic acid sequence. The binding region may be located at the 3’ end ofthe first probe. The binding region may comprise between 8-200 nucleotides, such as between8-25, 10-25, 15-25, 20-30, 17-50, and 8-50 nucleotides. Preferably, the binding regioncomprises between 17 and 50 nucleotides.The first probe may comprise a core region that is non-complementary to the nucleic acidsequence of interest, but which is substantially complementary to the second probe and socapable of hybridising thereto. The core region may be substantially complementary to at leasta portion of the core region of the second probe. The core region may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%,at least 99%, or 100% complementarity to at least a portion of the core region of the secondprobe. Suitably this is what is meant by ‘substantially complementary’ thereto as used herein in relation to the core region of the probes. The core region may be complementary to at least 5, at least 8, at least 10, at least 13, at least 15, at least 18, at least 20, at least 25, at last 30, at least 35, at least 40, at least 45, at least 50 nucleotides, or the entire core region of thesecond probe. Preferably, the core region is complementary to the entire core region of thesecond probe. The core region of the first probe may bind to a substantially complementaryportion of the second probe. Preferably, the core region of the first probe binds to the coreregion of the second probe. The core region may comprise between about 3-50 nucleotides,such as between 3-20 nucleotides, 4-20 nucleotides, 4-12 nucleotides or 6-8 nucleotides.Preferably the core region comprises between 4 to 20 nucleotides. In one embodiment, thecore region comprises 6, 7, 8 or 9 nucleotides. The first probe may comprise a signal region comprising a sequence which is the complement of at least a part of a signal oligonucleotide. The signal region may be used as a template togenerate a signal oligonucleotide. The signal region may form the sense strand for extensionof the second probe. Thus, extension of the second probe may form a complementarysequence to the signal region of the first probe. Suitably this sequence is the signaloligonucleotide. Therefore, the signal region may be the complement of at least a portion ofan oligonucleotide which is used as the signal oligonucleotide. Suitably the signal region is thecomplement of at least 30 nucleotides of the signal oligonucleotide, suitably between 30 to 70nucleotides of the signal oligonucleotide. Suitably the signal region is the complement ofbetween 35-70, 40-70, 45-70, 50-70, or 55-70 nucleotides of the signal oligonucleotide. In one embodiment, the signal region is the complement of 55, 56, 60, 63, 64, or 67 nucleotides of the signal oligonucleotide. The signal region may comprise one or more nucleic acid sequences which correspond to at least a portion of the nucleic acid sequences of one or more primers, such that the one or more primers are complementary to the signal oligonucleotide. The signal region maycomprise one or more nucleic acid sequences which correspond to at least a portion of thenucleic acid sequences of a FIP primer, such that the FIP primer is complementary to one ormore nucleic acid sequences of the signal oligonucleotide. The signal region may comprise one or more nucleic acid sequences which correspond to at least a portion of the nucleic acid sequences of an F3 primer, such that the F3 primer is complementary to one or more nucleic acid sequences of the signal oligonucleotide. Suitably a FIP primer and a F3 primer are knownin the art for use in LAMP processes. Suitably FIP primer refers to a forward inner primer, theFIP consists of a F2 region at the 3'end and a F1c region at the 5'end. The F2 region is complementary to the F2c region of the template sequence. The F1c region is identical to theF1c region of the template sequence. Sutiably F3 primer refers to an outer F3 primer. The F3primer hybridizes to the F3c region of the target DNA and extends, displacing the FIP linkedcomplementary strand. The signal region may be located at the 5’ end of the first probe. Thesignal region may be located between two regions of the first probe, such as between thespacer region and the handle region or between the core region and the handle region. Thesignal region may comprise between 30 and 10,000 nucleotides, suitably between 30 and5000 nucleotides, suitably between 30 and 1000 nucleotides, suitably between 30 and 900nucleotides suitably between 30 and 800 nucleotides, suitably between 30 and 700nucleotides, suitably between 30 and 600 nucleotides, suitably between 30 and 500nucleotides, suitably between 30 and 400 nucleotides, suitably between 30 and 300 nucleotides, suitably between 30 and 200 nucleotides, suitably between 30 and 100 nucleotides. Preferably, once the first probe anneals to the second probe, the signal region of the first probe is used as a template to extend the second probe, such that the extended second probe comprises a nucleic acid sequence complementary to the signal region of the first probe. Theextension of the second probe, using the signal region as a template, may form a signaloligonucleotide. The signal oligonucleotide may refer to the extended second probe,comprising a nucleic acid sequence complementary to at least a portion of the signal region of the first probe. The first probe may comprise a hinge region that is non-complementary to the target nucleic acid sequence. The hinge region may be non-complementary to the second probe. The hinge region may be located between the binding region and the core region. The hinge region mayconnect the binding region of the first probe to the core region of the first probe. The hingeregion may be flexible. The hinge region may comprise between 0 and 50 nucleotides, suitablybetween 0-40, 0-30, 0-20, 0-10 nucleotides. In one embodiment, the hinge region may comprise between 0-6 nucleotides.The first probe may comprise a spacer region that is non-complementary to the target nucleicacid sequence. The spacer region may be located between the core region and the signalregion. The presence of the spacer region may allow the formation of secondary structureswithin each probe. As noted elsewhere, such secondary structures have the beneficial effect of preventing binding of the first probe to the second probe in the absence of the target nucleicacid sequence, increasing performance of the system. In particular, the spacer reduces theamount of signal generated in the absence of a target by non-target specific interactions ofthe probes, reducing this allows the detection of an amplification time difference with smaller target loadsand so increases the analytic sensitivity of the system. The spacer region may comprisemodifications, such as one or more nucleic acid analogues and / or one or more modifiednucleic acids / nucleotides as defined hereinabove, suitably the spacer region may comprise anucleic acid analogue such as BNA. Such modification may influence the formation andstability of secondary structures within the first probe. Suitably the spacer region may compriseno nucleic acid analogues and / or one or more modified nucleic acids / nucleotides, alternatively up to the entire spacer region may comprise nucleic acid analogues and / or one or more modified nucleic acids / nucleotides. The first probe may comprise a handle region. The handle region may comprise a sequence complementary to a first displacing nucleic acid. The nucleic acid sequence of the handle region may be optimised for binding a first displacing nucleic acid sequence. For instance, the handle region may comprise GC rich nucleic acid sequences and / or nucleic acid analogues / modified nucleic acids / modified nucleotides such as PNA and / or BNA. Suitably the handle region may have a GC content of between 70% and 95%, suitably between 75% and 90%, suitably between 77% and 89%. In one embodiment the handle region may have a GC content of 77%, or a GC content of 89%. The nucleic acid sequence of the handle region may be partially complementary to the first displacing nucleic acid sequence, for example the sequence of the handle region may comprise one or more mismatches relative to the first displacing nucleic acid sequence. The handle region may be located at the 5’ end of the firstprobe. The handle region may comprise between 15 and 2000 nucleotides, suitably between15 and 1000 nucleotides, suitably between 15 and 500 nucleotides, suitably between 15 and400 nucleotides, suitably between 15 and 300 nucleotides, suitably between 15 and 200 nucleotides, suitably between 15 and 100 nucleotides, suitably between 15 and 50nucleotides, suitably between 15 and 25 nucleotides. In one embodiment, the handle regionmay comprise 19 or 22 nucleotides. The first probe may comprise one or more landing pad regions. The one or more landing pad regions may comprise a sequence substantially complementary to a first displacing nucleic acid and so capable of hybridising thereto. The one or more landing pad regions may be located within the signal region of the first probe. The one or more landing pad regions may comprise a sequence substantially complementary to a signal oligonucleotide and so capable of hybridising thereto. The nucleic acid sequence of the one or more landing pad regions may be optimised to weaken the interaction between the one or more landing pad regions and a complementary nucleic acid strand, such as the interaction between the one or more landing pad regions and the signal oligonucleotide. For instance, the nucleic acid sequence of the one or more landing pad regions may have a higher adenosine and / or thymine content (AT content) relative to the rest of the first probe nucleic acid sequence. The nucleic acid sequence of one of the one or more landing pad regions may have a higher adenosine and / or thyminecontent (AT content) relative to the rest of the first probe nucleic acid sequence. Suitably theone or more landing pad regions has an adenosine and / or thymine content (AT content) of 60-100%, suitably of between 70-100%, suitably of between 80-100%, or suitably of between90-100%. Such optimisation may allow annealed strands of the first probe and the signaloligonucleotide to melt spontaneously, allowing a displacing nucleic acid sequence to annealto the first probe and displace the signal oligonucleotide. In one embodiment, the first probecomprises 1, 2, 3, 4, or 5 landing pads, in one embodiment the first probe comprises 3 landingpads. The first probe may comprise a linker region. The linker region may comprise one or more modifications to disrupt the activity of a polymerase. The linker region may comprise a multicarbon modification, such as 18-atom hexa-ethyleneglycol, the C3 spacerphosphoramidite, hexanediol, 1’,2’-Dideoxyribose or triethylene glycol. The skilled person isaware of other appropriate multicarbon modifications. Preferably, the linker region comprises18-atom hexa-ethyleneglycol. The linker region may comprise an abasic site. Suchmodifications may disrupt polymerase activity. Such modifications may prevent a polymerase from reading through, preventing sequences upstream of the modifications from being used as a template for further extension of the second probe. Such modifications may limit the extension of the signal oligonucleotide. Such modifications may prevent a polymerase from reading through and disrupting hybridisation between the first probe and a bound nucleic acid, such as a first displacing nucleic acid. The particular modification for use in the linker regionmay be selected to minimise or avoid creation of a kink of a nucleic acid helix. The linker regionmay be located between the signal region and the handle region of the first probe.The first probe may comprise in the 3’ to 5’ direction:(i) a binding region;(ii) optionally a hinge region; (iii) a core region;(iv) optionally a spacer region; (iv) a signal region, optionally comprising one or more landing pad regions;(v) a modification capable of disrupting polymerase activity which may be a linkerregion; and (vi) optionally a handle region.The first probe may comprise in the 3’ to 5’ direction:(i) a binding region;(ii) optionally a hinge region; (iii) a core region;(iv) optionally a spacer region; (iv) a signal region, optionally comprising one or more landing pad regions;(v) a linker region comprising a modification capable of preventing polymerase activity;and (vi) a handle region.The first probe may comprise in the 5’ to 3’ direction:(i) an optional handle region;(ii) an optional modification capable of preventing polymerase activity, further optionally within a linker region; (iii) a signal region;(iv) an optional spacer region;(v) a core region; (vi) an optional hinge region; and(vii) a binding region.The skilled person will understand that the sequences of regions of the first probe will depend on the sequences of the second probe and target to which it is intended to bind, while other regions, such as the signal region, can be readily varied. The skilled person will readily be able to design such first probes using methods known in the art. Non-limiting examples of suchfirst probes are provided in the examples. For instance, a first probe may comprise or consistof the sequence of P651 (SEQ ID NO 3), P530 (SEQ ID NO: 12), P532 (SEQ ID NO: 18),P547 (SEQ ID NO: 19) or P576 (SEQ ID NO: 20).Second probe The second probe may comprise at least a binding region and a core region. The second probe may comprise a binding region, a core region and a head region. The second probe may comprise a binding region, a hinge region, and a core region. The second probe maycomprise a binding region, a hinge region, a core region and a head region.The second probe may comprise a binding region that is substantially complementary to aportion of the target nucleic acid sequence and so capable of hybridising thereto. The bindingregion may bind to the target nucleic acid sequence, preferably to a complementary portion ofthe target nucleic acid sequence. The binding region may be located at the 5’ end of thesecond probe. The binding region may be located between the core region and the head region of the second probe, if present. The binding region may be located between the hinge region and the head region of the second probe, if present. The binding region may comprise between 7-200 nucleotides, such as between 7-5, 7-25, 7-50, 8-25, 8-50, 10-25, 15-25, 20-30 and 20-50 nucleotides. Preferably the binding region comprises between 20-50nucleotides. The binding region of the second probe may bind to the target nucleic acid sequence in a position adjacent or substantially adjacent to the binding region of the first probe such that substantially complementary portions of the first and second probes can hybridise to eachother. Suitably the binding region of the first probe and the binding region of the second probebind to the target in positions that are between 0 and 30 nucleotides apart, suitably to positions that are between 0-2 nucleotides apart. In one embodiment, the binding region of the first probe and the binding region of the second probe bind to the target in positions that are immediately adjacent i.e.0 nucleotides apart.Preferably, the first probe and second probe hybridise at the core regions. When the first andsecond probes bind to the target nucleic acid sequence and to each other a three-way junction(3WJ) structure is formed. The second probe may comprise a hinge region that is non-complementary to the targetnucleic acid sequence and / or non-complementary to the first probe. The hinge region may belocated between the binding region and the core region. The hinge region may connect thebinding region to the core region. Optionally, the hinge region may be flexible. The hinge region may comprise between 0 and 50 nucleotides, sutiably between 0-40, 0-30, 0-20, 0-10 nucleotides. In one embodiment, the hinge region may comprise between 0-6 nucleotides.The second probe may contain a core region that is non-complementary to the target nucleicacid sequence, but which is substantially complementary to a portion of the first probe and socapable of hybridising thereto. The second probe may contain a core region that issubstantially complementary to the target nucleic acid sequence and also substantiallycomplementary to a portion of the first probe and so capable of hybridising thereto. The coreregion may be substantially complementary to at least a portion of the core region of the firstprobe. The core region may have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarityto at least a portion of the core region of the first probe. Suitably this is what is meant by‘substantially complementary’ thereto as used herein in relation to the core region of the probes.The core region may be complementary to at least 5, at least 8, at least 10, at least 13, at least 15, at least 18, at least 20, at least 25, at last 30, at least 35, at least 40, at least 45, at least 50 nucleotides, or the entire core region of the first probe. The core region of thesecond probe may be complementary to the core region of the first probe. The core region ofthe second probe may bind to a complementary portion of the first probe. The core region ofthe second probe may bind to the core region of the first probe. Preferably, the core region islocated at the 3’ end of the second probe. The core region may comprise between about 3-50 nucleotides, such as between 3-20 nucleotides, 4-20 nucleotides, 4-12 nucleotides or 6-8nucleotides. Preferably the core region comprises between 4 to 20 nucleotides.Preferably once the first probe anneals to the second probe, extension of the second probetakes place. The second probe may be extended at the 3’ end. Extension of the second probemay be carried out by polymerisation. The polymerisation may be carried out by a DNA polymerase. Extension of the second probe may form the signal oligonucleotide. Preferably, the signal oligonucleotide is complementary to the signal region of the first probe. The signaloligonucleotide may be complementary to the signal and spacer regions of the first probe. Theextended second probe, comprising a nucleic acid sequence complementary to at least a portion of the signal region, may be referred to as a signal oligonucleotide. The second probe may comprise a head region. Embodiments in which the second probe comprises a head region are suitably when the second probe is used in an amplification process such as LAMP. The head region may be non-complementary to the target nucleicacid sequence and the first probe. The head region may be adjacent to the binding region ofthe second probe, optionally 5’ of the binding region. The head region may be located at the 5’ end of the second probe. The head region may comprise a modification capable ofpreventing polymerase activity, such as a multicarbon linker or and abasic site as referencedabove. The head region may comprise a multicarbon modification, such as 18-atom hexa-ethyleneglycol, the C3 spacer phosphoramidite, hexanediol, 1’,2’-Dideoxyribose or triethyleneglycol. The skilled person is aware of other appropriate multicarbon modifications. In oneembodiment the head region may comprise 18-atom hexa-ethyleneglycol (iSP18). Suchmodifications may limit extension of a newly synthesised nucleic acid strand generated usingthe second probe or extended second probe as a template. The head region may comprisebetween 15 and 2000 nucleotides, suitably between 25 and 1000 nucleotides, suitablybetween 50 and 500 nucleotides, suitably between 60 and 250 nucleotides, suitably between 70 and 150 nucleotides, suitably between 86 and 128 nucleotides. The head region of the second probe may comprise one or more nucleic acid sequences capable of being bound by one or more primers. The head region of the second probe may comprise one or more nucleic acid sequences which are complementary to one or more nucleic acid sequences which are capable of being bound by one or more primers, such that the primers can bind to a newly synthesised nucleic acid strand comprising one or moresequences which are complementary to the second probe. The second probe may compriseone or more nucleic acid sequences capable of being bound by a displacing nucleic acid sequence, such as a second displacing nucleic acid sequence. The one or more nucleic acid sequences capable of being bound by a displacing nucleic acid sequence may be located in the head region of the second probe. Binding of a displacing nucleic acid sequence, such asa second displacing nucleic acid sequence, to the second probe may assist in the efficientgeneration of amplification products, such as LAMP amplification products. The second probe may comprise in the 5’ to 3’ direction: (i) an optional head region;(ii) a binding region;(iii) an optional hinge region; and(iv) a core region.The second probe may comprise one or more nucleic acid sequences which correspond to at least a portion of the nucleic acid sequence of one or more primers, such that the primers can bind to a newly synthesised nucleic acid strand complementary to the second probe.Preferably, the head region of the second probe comprises one or more nucleic acidsequences which correspond to at least a portion of the nucleic acid sequence of one or more primers, such that the primers can bind to a newly synthesised nucleic acid strand complementary to the second probe, such as the signal oligonucleotide. The primers mayinitiate generation of an amplification product directly from the second probe or from a nucleicacid sequence complementary thereto, such as from the signal oligonucleotide. The amplification product as referred to herein includes end products or intermediate products of any amplification process. The amplification product may be a LAMP amplification product, either an intermediate product or end product. The one or more primers may be primers suitable for use in LAMP. The one or more primers may be primers suitable for use in LAMP.The one or more primers may be F3, FIP, B3 and / or BIP primers. The one or more primersmay be F3 primers. The one or more primers may be FIP. The one or more primers may beF3 primers and FIP. The one or more primers may be B3 primers. The one or more primersmay be BIP. The one or more primers may be B3 primers and BIP. As noted hereinabove,these primers are known in the art for LAMP processes. The FIP consists of a F2 region at the 3'end and a F1c region at the 5'end. The F2 region is complementary to the F2c region of the template sequence. The F1c region is identical to the F1c region of the template sequence. The BIP consists of a B2 region at the 3'end and a B1c region at the 5'end. The B2 region is complementary to the B2c region of the template sequence. The B1c region is identical to the B1c region of the template sequence. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand. This displaced strand forms a loop at the 5' end. The outer primer B3 hybridizes to B3c region of the target DNA and extends, displacing the BIP linked complementary strand. This results in the formation of a dumbbell shaped DNA. The one or more primers may be able to prime the synthesis of a complementary strand ofthe signal oligonucleotide, the complementary strand being an amplification product. The oneor more primers may be able to prime the extension of the signal oligonucleotide to generate an amplification product. The one or more primers may be able to prime the synthesis of a complementary strand of the signal oligonucleotide, the complementary strand being anamplification product, and to prime the extension of the signal oligonucleotide to generate afurther amplification product. The amplification product may be a LAMP amplification product as defined above. The one or more primers may be primers suitable for use in LAMP. The oneor more primers may be F3, FIP, B3 and / or BIP as defined above. The one or more primersmay be F3. The one or more primers may be FIP. The one or more primers may be F3 and FIP. When using LAMP to amplify the signal oligonucleotide, the one or more primers, such as FIP primers, bind the 5’ end of the signal oligonucleotide i.e. the region of the signal oligonucleotide complementary to the first probe. Once the LAMP primers have bound to the 5' end of thesignal oligonucleotide extension of these primers towards the 5' end of the signaloligonucleotide produces a first amplification product. The first amplification product containsregions complimentary to LAMP primers that allow for extension of those primers on the firstamplification product. This means the second probe for use in methods utilising LAMPincludes within it the same sequences as the LAMP primers. The skilled person will understand that the sequences of regions of the second probe will depend on the sequences of the first probe and the target to which it is intended to bind, while other regions, such as the head region, can be readily varied. The skilled person will readily be able to design such second probes using methods known in the art. Non-limiting examplesof second probes are provided in the examples. For instance, a second probe may compriseor consist of the sequence of P652 (SEQ ID NO 2), P531 (SEQ ID NO: 13) or P533 (SEQ IDNO: 24). Secondary structures The first probe and / or the second probe may comprise one or more secondary structures. Both the first and second probes may comprise one or more secondary structures. Alternatively, one of the first or second probes may comprise one or more secondary structures. The first probe may comprise one or more secondary structures. The second probe may comprise one or more secondary structures.The one or more secondary structures may be present in any region of a probe. The one ormore secondary structures may be present in the binding, hinge, core, spacer, or signalregions of the probe.The one or more secondary structure may be present within one region of the probe. At leastone of the secondary structures may be present in the core region. The one or more secondarystructures may be within the core region of the probe.Alternatively the one or more secondary structures may span across multiple regions of theprobe. Preferably the one or more secondary structures may span across multiple regions ofthe probe, wherein at least one of the regions is the core region. The first probe and / or the second probe may comprise one or more secondary structureswhich span across multiple regions of the probe. The first probe and / or the second probe maycomprise a secondary structure which spans across multiple regions of the probe. The secondary structure may be formed between two or more regions of the first probe. The secondary structure may be formed between two or more regions of the second probe.The one or more secondary structures may span two, three, or four regions of the probe.Preferably the one or more secondary structures spans two regions of the probe. The one ormore secondary structures may span between the core region and any other region of theprobe. The one or more secondary structures may span between any of the following pairs ofregions: the core region and the binding region; the core region and the spacer region; the core region and the hinge region; the core region and the signal region, the hinge region and the spacer region. The one or more secondary structures may span between any regions within the first probe which affect the availability of the first probe core region for binding to the second probe and / or the one or more secondary structures may span between any regions within the second probe which affect the availability of the second probe core region for bindingto the first probe. Preferably, the one or more secondary structures span between the coreregion and the spacer region. Since neither the core region nor spacer region are involved in target binding, designing the first and / or second probe with one or more secondary structures spanning between the core region and the spacer region leaves the binding region unaffected, allowing fine-tuned optimisation and modularity. Alternatively, the one or more secondarystructures may span between the core region and the signal region. A benefit of thisarrangement is that it allows for shorter probes while still leaving the binding region unaffected.The one or more secondary structures may involve regions other than the binding region,leaving the binding region unaffected and free to bind the target nucleic acid sequence. Theone or more secondary structures may not span the binding region, leaving the binding regionunaffected and free to bind the target nucleic acid sequence. Alternatively, the one or moresecondary structures may span a portion of the binding region, leaving another portion of the binding region free to initiate hybridisation with the target sequence.The one or more secondary structures may be formed by a portion of the core region of aprobe and another portion of the same probe, suitably the portions may be in the same regionor different regions of the probe. The one or more secondary structures may span betweenthe core region and the signal region. The one or more secondary structures may be formedbetween the core region and the signal region of the first probe. The one or more secondarystructures may span between the core region and the binding region. Preferably the one ormore secondary structures span between the core region and the binding region of each probe, such that the secondary structure of each probe is disrupted when the binding region binds the target nucleic acid, releasing the core region to bind to the other probe.The one or more secondary structures may span between the core region and the spacerregion. Such an arrangement involving two variable regions of the probe allows for fine-tunedoptimisation and development of modular systems. The one or more secondary structuresmay be formed between the core region and the spacer region of the first probe. The one or more secondary structures may span between the core region and the hinge region. The one or more secondary structures may span between the core region and thehinge region of the second probe. Such an arrangement involving two variable regions of theprobe allows for fine-tuned optimisation and development of modular systems. The first and / or second probe may comprise more than one secondary structure. The first and / or second probe may comprise 1, 2, 3, 4, or 5 secondary structures, up to 35 secondary structures. Preferably the first and / or secondary probe comprise one secondary structure. Preferably at least one of said structures is located at least partially within the core region.The one or more secondary structures may be stem-loop structures. Non-limiting examples ofstem loop structures include a hairpin, a cloverleaf, a pseudoknot. The skilled personunderstands that stem loop structures include many variants, such as nested stem loops, stem loops containing bulges, stem loops containing bubbles within in the stem region. The one ormore secondary structures may be a hairpin. The one or more secondary structures may bea pseudo knot. The one or more secondary structures may be a G-quadruplex. It is envisaged that the probes of the invention may comprise any combination of such secondary structures. The skilled person can readily identify other secondary structures that could be used in probes of the invention. In one embodiment, the first probe comprises one secondary structure which spans between the core region and the binding region, suitably wherein the secondary structure is a hairpin. In one embodiment, the second probe comprises one secondary structure which spans between the core region and the binding region, suitably wherein the secondary structure is a hairpin.Preferably the one or more secondary structures are displaced upon binding of the first probeand / or the second probe with the target nucleic acid sequence. The one or more secondary structures may prevent the first probe interacting with the second probe in the absence of atarget nucleic acid sequence. The one or more secondary structures may prevent the firstprobe binding to the second probe in the absence of a target nucleic acid sequence. The oneor more secondary structures may prevent the core region of the first probe interacting withthe core region of the second probe in the absence of a target nucleic acid sequence. The oneor more secondary structures may prevent the core region of the first probe binding to the coreregion of the second probe in the absence of a target nucleic acid sequence. Displacement of the one or more secondary structures upon binding of the first probe and / or the second probewith the target nucleic acid sequence therefore allows the binding of the first and secondprobes to each other in the presence of the target nucleic acid sequence, and formation of a 3WJ.Preferably the one or more secondary structures are more thermodynamically favourable thanthe first probe interacting with the second probe in the absence of the target nucleic acidsequence. Preferably the one or more secondary structures are less thermodynamicallyfavourable than the first probe interacting with the second probe in the presence of a targetnucleic acid sequence. Preferably therefore the one or more secondary structures are lessthermodynamically favourable than the three-way junction structure. The first and / or second probe may further comprise additional preventative features. Such additional preventative features may prevent interaction of the first and second probes in theabsence of a target nucleic acid sequence. For instance, the core region of the first and / orsecond probe may comprise one or more nucleic acid analogues or modified nucleicacids / nucleotides or a high AT content to reduce the binding affinity between the core regions of the two probes in the absence of the target nucleic acid sequences. Suitable nucleic acidanalogues or modified nucleic acids / nucleotides, and suitable AT contents, are defined above.Alternatively, the core regions of the first and second probes may comprise nucleic acid sequences which are only partially complementary to each other. Suitably the core regions may comprise a complementarity of less than 80%, less than 70%, less than 60%, less than 50%. Alternately still, the core regions of the first and second probes may comprise only shortcomplementary regions. Suitably they may comprise complementary regions of a maximumof 5 nucleotides in length. In some embodiments, the first an / or second probes may comprise more than one such preventative feature in combination. The length of the complementary portion between the core region of the first probe and the core region of the second probe may be varied. The length of the complementary portion between the core region of the first probe and the core region of the second probe may beincreased. Suitably the length of the complementary portion of the core regions may be up to30 nucleotides in length, suitably between 5 and 30 nucleotides in length, suitably between 5 and 20 nucleotides in length, suitably between 510 nucleotides in length. In one embodiment the length of the complementary portion of the core regions is 6, 7, 8, or 9 nucleotides. This may act to increase the thermodynamic stability of the first probe interacting with the second probe. This may act to increase the thermodynamic stability of the three-way junction. Alternatively, the length of the complementary portion between the core region of the first probe and the core region of the second probe may be decreased, as noted above, to reduce the binding affinity between the core regions of the two probes in the absence of the target nucleic acid sequences. Nucleic acid analogues and / or modified nucleic acids / nucleotides may be included in the core region of the first and / or second probe. The GC content of the core regions may be varied. The GC content of the core regions maybe increased. Suitably the core regions may comprise a GC content of 20-100%, suitablybetween 20-90%, suitably between 20-86%. This may increase the thermodynamic stability of the first probe interacting with the second probe. This may act to increase the thermodynamic stability of the three-way junction. The GC distribution within the core regions may be varied. The GC distribution may form a gradient across the core region. The GC content of the core region may form a gradient from high to low across the core region. The GC content of the core region may form a gradient from high to low between the 5’ and the 3’ end of the core region. The GC content of the core region may form a gradient from high to low between the 3’ and the 5’ end of the core region. Mismatches may be introduced between the complementary portions of the two core regions. This may act to decrease the thermodynamic stability of the first probe interacting with the second probe. This may act to decrease the thermodynamic stability of the three-way junction. Multiplexing The nucleic acid probe system may be suitable for detecting a single target nucleic acid sequence or multiple different target nucleic acid sequences. The nucleic acid probe system may be suitable for multiplexing. For instance, the nucleic acid probe system may comprise a plurality of pairs of first and second probes designed to bind to different target nucleic acid sequences. For each pair of probes the binding sequence of the first and second probes may be designed to bind to a specific target nucleic acid sequence, such that each pair of probes binds to a different target nucleic acid sequence. Thus, the nucleic acid probe system may beused to detect one or more target nucleic acid sequences in a sample. The nucleic acid probesystem may be used to detect 2-10, 2-20 or more than 20 different target sequences When a plurality of pairs of first and second probes are used to detect a plurality of target nucleic acid sequences, each pair may generate the same signal oligonucleotide following formation of a three-way junction between the first and second probes and the target nucleic acid sequences. Detection of a signal oligonucleotide may indicate the presence of one ormore of the plurality of nucleic acids in a sample. For instance, the signal oligonucleotide maybe detected using one or more primers, such as the LAMP primers of the invention. Alternatively, each pair of probes may generate a different signal oligonucleotide following formation of a three way junction between the first and second probes and the target nucleic acid sequences. The generation of different signal oligonucleotides could be achieved by altering the signal region of the first probe in each probe pair, such that the signal region and signal oligonucleotide differ in sequence between each pair of probes. Detection of different signal oligonucleotides may allow for identification of a plurality of different target nucleic acid sequences in a single sample. For instance, the detection of two distinct signal oligonucleotides may indicate the presence of two distinct target nucleic acid sequences. The skilled person is aware of reporting methods suitable for detecting distinct signal oligonucleotides, such as using sequence specific reporting agents. Alternatively, each pair of probes may be designed such that each signal oligonucleotide or amplification product generated from each signal oligonucleotide comprises a sequence complementary to one or more primers, such as the LAMP primers of the invention. In this case, multiple different signal oligonucleotides may be detected with one set of primers, allowing one set of primers to amplify and detect diverse specific sequences, such as multiple pathogen specific sequences. Forming a Three-Way JunctionMethods of the invention may begin with step (a) which comprises contacting the target nucleicacid sequence with a nucleic acid probe system to form a three-way junction (3WJ).The three-way junction may be formed by the first and second probes binding to the targetnucleic acid sequence in an adjacent manner so as to allow the complementary core regionsof the first and second probes to bind to each other. The target nucleic acid sequence maytherefore comprise two regions which are each complementary to one of the binding regions of the probes. Suitably the target nucleic acid sequence comprises a first region complementary to the binding region of the first probe and a second region complementary to the binding region of the second probe. Suitably the first and second regions of the targetnucleic acid sequence are adjacent, suitably between 0-5, 0-25, 5-25 or 7-25 nucleotidesapart. Suitably the first and second regions of the target nucleic acid sequence are between 0and 30 nucleotides apart, suitably between 0-2 nucleotides apart. In one embodiment, the first and second regions of the target nucleic acid are immediately adjacent, i.e. 0 nucleotides apart. Suitably the binding regions of each probe are complementary to at least 5, at least 8, at least 10, at least 13, at least 15, at least 18, at least 20, at least 25, at last 30, at least 35, at least40, at least 45, at least 50 nucleotides, or the entire, target nucleic acid sequence, suitably tothe relevant region of the target nucleic acid sequence. Suitably the binding regions of each probe have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarity to at least a portion of the target nucleic acid sequence, sutiably to entire target nucleic acid sequence, suitably to the relevant region of the target nucleic acid sequence. Suitably this is what is meant by ‘substantially complementary’ thereto as used herein in relation to the probes and the target nucleic acid sequence. The first probe may comprise a portion substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, and a portion non-complementary to the nucleic acid sequence of interest but comprising a sequence substantially complementary to the second probe, and a template signal sequence. Therefore, the first probe may comprise at least a binding region, a core region and a signal region. The second probe may comprise a portion substantially complementary to the target nucleic acid and so capable of hybridising thereto and a portion non-complementary to the nucleic acid sequence of interest but substantially complementary to a part of that portion of the first probe which is non-complementary to the nucleic acid sequence of interest. Therefore, the second probe may comprise at least a binding region and a core region.When a target nucleic acid sequence is present in a sample, contacting the sample with thenucleic acid probe system of the invention produces a three-way junction between the targetnucleic acid sequence, the first probe and the second probe. The formation of the three-way junction allows generation of a signal oligonucleotide, step (b) in methods of the invention, to take place. It is important that the first and second probes, when bound to the target nucleic acid sequence, are adjacent or substantially adjacent to each other so as to allow the core regions of the first and second probes to anneal to each other. In some situations, the first and secondprobes can hybridise to the target nucleic acid sequence such that there are nogaps / nucleotides of the target sequence left without base-pairing to the binding regions of the first and second probes. In this scenario, the first and second probes are herein referred to as being adjacent to each other on the target nucleic acid sequence. As used herein, the first and second probes are said to be substantially adjacent on the target nucleic acid sequence whenthere is one or more, 1-5, 1-25, 5-25 or 7-25 nucleotides between the portions on the targetnucleic acid sequence that are base-paired with the first and second probes. It will be appreciated by the person skilled in the art that the greater the distance between the location of binding of the first probe and the second probe on the target nucleic acid sequence, the greater the amount of unpaired sequence there may be, and thus the greater likelihood of instability in binding. Displacing nucleic acid sequences One aspect of the present invention relates to one or more displacing nucleic acid sequencescomprising a sequence capable of hybridizing to a sequence in a first probe and / or a secondprobe and displacing a nucleic acid sequence bound thereto. Such displacing nucleic acidsequences may be referred to as “displacing nucleic acids” or “displacing oligonucleotides”.A first displacing nucleic acid may comprise a sequence capable of hybridizing to a first probeand displacing a nucleic acid sequence bound thereto. The first displacing nucleic acid may comprise a sequence substantially complementary to and thus capable of hybridising to oneor more regions of the first probe. The first displacing nucleic acid may comprise a sequencesubstantially complementary to the signal region of the first probe. The first displacing nucleicacid may comprise a sequence substantially complementary to the handle region of the firstprobe. The first displacing nucleic acid may comprise a sequence substantiallycomplementary to the signal region and the handle region of the first probe. Suitably by‘substantially complementary’ in this context is meant that the first displacing nucleic acid has a complementarity of at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarity to at least a portion of the first probe as defined above.The first displacing nucleic acid sequence may displace a signal oligonucleotide bound to afirst probe. Hybridisation of the first displacing nucleic acid to the first probe may act to displace the signal oligonucleotide following extension of the second probe. Displacement of the signaloligonucleotide may make it available for primer binding for signal amplification.The first displacing nucleic acid may be a separate nucleic acid or may be part of the firstprobe. The first displacing nucleic acid may be located at the 5’ end of the first probe. The firstdisplacing nucleic acid may comprise a nucleic acid sequence capable of self-annealing to the first probe.A second displacing nucleic acid may comprise a sequence capable of hybridizing to a secondprobe and displacing a nucleic acid sequence bound thereto. The second displacing nucleic acid may comprise a sequence substantially complementary to and thus capable of hybridisingto one or more regions of the second probe. The second displacing nucleic acid may comprisea sequence substantially complementary to the head region of the second probe. The seconddisplacing nucleic acid may displace a newly synthesised strand bound to the second probe.The second displacing nucleic acid may displace an amplification product bound to a secondprobe. Hybridisation of the second displacing nucleic acid to the second probe may act todisplace an amplification product bound to the second probe. Suitably by ‘substantially complementary’ in this context is meant that the second displacing nucleic acid has a complementarity of at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarity to at least a portion of the second probe as defined above. The second displacing nucleic acid may be a separate nucleic acid or may be part of the second probe. The second displacing nucleic acid may be located at the 5’ end of the second probe. The second displacing nucleic acid may comprise a nucleic acid sequence capable of self-annealing to the second probe. The one or more displacing nucleic acids may be any nucleic acid type, including DNA, or RNA, or any nucleic acid analogue such as: morpholino nucleic acids (e.g. PMO or PPMO), PNA (peptide nucleic acid), BNA (bridged nucleic acid), GNA (glycol nucleic acid), TNA(threose nucleic acid) or HNA (hexitol nucleic acids). BNA may also be referred to as an LNA(locked nucleic acid). Suitably such nucleic acid analogues contain modifications to the backbone of typical nucleic acids DNA or RNA. The presence of BNA or other nucleic acid analogues or modified nucleotides may act to increase the thermodynamic stability of the displacing nucleic acid interacting with its complementary nucleic acid sequence. Thus, the presence of one or more BNA or othernucleic acid analogues or modified nucleotides in the first displacing nucleic acid may act tofavour displacement of the signal oligonucleotide, increasing the signal oligonucleotide’s availability for signal amplification. The efficiency of signal amplification can therefore be enhanced by the presence of modified nucleotides in the first displacing oligonucleotide by reducing the bottleneck of conversion from detecting the target by formation of a three-way junction to generation of amplificationproducts. The presence of one or more BNA modifications or other nucleic acid analogues ormodified nucleotides in the second displacing nucleic acid may act to favour release andfurther extension of amplification products.The first displacing nucleic acid may comprise BNA within a region complementary to thehandle region of the first probe. The first displacing nucleic acid may comprise BNA within aregion complementary to the signal region of the first probe. The first displacing nucleic acidmay comprise BNA within a region complementary to the landing pad region of the first probe.The one or more displacing nucleic acids may comprise mismatches in nucleic acid sequencecorresponding to primer sequences. The mismatches may be in sequences corresponding to the 3’ end of primer sequences. The primers may be primers of the invention, as describedbelow. The primers may be F3, FIP, B3 and / or BIP as described above.The skilled person will understand that the sequences of the one or more displacing nucleic acids will depend on the sequences of the probes to which they are designed to bind. The skilled person will readily be able to design such displacing nucleic acids using methods known in the art. Non-limiting examples of such displacing nucleic acids are provided in the examples.For instance, a displacing nucleic acid may comprise or consist of a sequence of P660 (SEQID NO: 4), P557 (SEQ ID NO: 21), P575 (SEQ ID NO: 22), or P577 (SEQ ID NO: 23).Signal oligonucleotide One aspect of the present invention relates to a signal oligonucleotide comprising a sequence complementary to the signal region of the first probe. The signal oligonucleotide may comprise a nucleic acid sequence capable of self-annealing, suitably therefore capable of annealing to the signal oligonucleotide. Such self-annealing may be advantageous for the generation of amplification products, such as LAMP amplificationproducts. The signal oligonucleotide may comprise a nucleic acid sequence capable of self-priming i.e. able to initiate synthesis of an amplification product.The signal oligonucleotide may comprise one or more nucleic acid sequences which are substantially complementary to one or more primers. Suitably by ‘substantially complementary’ in this context is meant that the signal oligonucleotide has a complementarity of at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarity to one or more primers. The one or more primers may be able to prime the synthesis of a complementary strand ofthe signal oligonucleotide, the complementary strand being an amplification product. The oneor more primers may be able to prime the extension of the signal oligonucleotide to generate an amplification product. The one or more primers may be able to prime the synthesis of a complementary strand of the signal oligonucleotide, the complementary strand being anamplification product, and to prime the extension of the signal oligonucleotide to generate afurther amplification product. The amplification product may be a LAMP amplification product.The one or more primers may be primers suitable for use in LAMP. The one or more primersmay be F3, FIP, B3 and / or BIP as described hereinabove. The one or more primers may beF3. The one or more primers may be FIP. The one or more primers may be B3. The one or more primers may be BIP. The one or more primers may be B3 and BIP. In methods of the present invention, once a 3WJ forms, step (b) comprises the generation of a signal oligonucleotide.The signal oligonucleotide may be complementary to the first probe. The signal oligonucleotidemay be complementary to the signal region of the first probe. The signal oligonucleotide maycomprise a nucleic acid sequence complementary to the signal region of the first probe. Thesignal oligonucleotide may comprise a nucleic acid sequence complementary to at least a portion of the signal region of the first probe. The signal oligonucleotide may comprise asequence complementary to at least a portion of the first probe and comprise the sequence ofthe second probe. The signal oligonucleotide may comprise a nucleic acid sequence complementary to the signal region of the first probe and comprise the sequence of the secondprobe. The signal oligonucleotide may comprise a nucleic acid sequence complementary toat least a portion of the signal region of the first probe and comprise the sequence or part of the sequence of the second probe.The signal oligonucleotide may be generated by extension of the second probe. The signaloligonucleotide may be generated by extension of the second probe using the first probe as atemplate. The signal oligonucleotide may be generated by extension of the second probeusing the signal region of the first probe as a template. The signal oligonucleotide may be generated by extension of the second probe using the spacer region and the signal region of the first probe as a template.Extension of the second probe may be carried out by polymerisation. The polymerisation maybe DNA polymerisation. The polymerisation may be carried out by a nucleic acid polymerase,such as a DNA polymerase. The DNA polymerase may be a thermophilic DNA polymerase.The DNA polymerase may be an isothermal DNA polymerase.The nucleic acid polymerase used for generating a signal oligonucleotide from the three-way junction, such as in step (b) of methods of the invention, may be selected from: Bacillusstearothermophilus (Bst) DNA polymerase, Vent(exo-) DNA polymerase, a derivative of 9°N™DNA Polymerase such as Therminator DNA polymerase (M0261, New England Biolabs), and Klenow polymerase. There are various mutant or variant forms of these polymerases (e.g. Bst 2.0 and Bst 3.0), and any suitable mutant or variant form could be utilised. Preferably, thenucleic acid polymerase that extends the second probe is Bacillus stearothermophilus (Bst)DNA polymerase. This polymerase is suitable for isothermic reactions, allowing the reactionto proceed at a single temperature, such as room temperature (around 22°C) up to around72°C for example: 55°C, 62°C, 64°C or 65°C, or between 50-72°C without needing thermalcycling. The person skilled in the art is aware of other polymerases which are suitable for usein the methods of the invention.The signal oligonucleotide may be a single stranded DNA molecule. The signal oligonucleotidemay be an RNA molecule.The signal oligonucleotide may act as a template for amplification. Amplification may producemultiple copies of the signal oligonucleotide. The multiple copies of the signal oligonucleotide may be detected. References to the ‘signal oligonucleotide’ herein may refer to (i) the oligonucleotide sequence generated and released from the 3WJ produced without an additional amplification step, or (ii) an oligonucleotide sequence that has the same sequence as the oligonucleotide sequence generated and released from the 3WJ, but it has been produced (in part) by an amplification step, or (iii) an oligonucleotide sequence that has a different sequence to that of the oligonucleotide sequence generated and released from the 3WJ. The signal oligonucleotide may have a sequence that comprises some or all of the oligonucleotide sequence generated and released from the 3WJ, for example theoligonucleotide signal sequence may be the same as the oligonucleotide sequence producedfrom the 3WJ, but it include additional nucleotides at one or both ends.The signal oligonucleotide may have the same sequence as the oligonucleotide sequencegenerated and released from the 3WJ. The signal oligonucleotide may comprise the sequence of the oligonucleotide generated and released from the 3WJ. The signal oligonucleotide may comprise or consist of the sequence of SEQ ID NO: 28: TTATAGTAAGAGGAAAATCCGTCGACTTTTTAAATCGTGAGGGTTCAAGTCCCTCTATCC CCAATAAAAAGTTCGCTTTACCCCCAAgcgacccccgctcaggttaagatgtgcttgagcgccctcgtcctcTT AATCCTTTTTTCAGCGGTTCCAcattggttatgtttctcattTCTCACAAATGGATCGGATgGGTTTCTCTTTTATCACAAGTTT [SEQ ID NO: 28]SEQ ID NO: 28 is the signal oligonucleotide produced in a nucleic acid probe system usingP530 (SEQ ID NO: 12) as the first probe and P531 (SEQ ID NO: 13) as the second probe.The signal oligonucleotide may comprise or consist of the sequence of SEQ ID NO 29: CAACCCTTGAGTACACACGTCAATACAACCCACCTTCCAGACATCGAGTACCCAATACT GTATTCAACCTTGTACTGCGCAACTGAacccgaagatgagttttgagatattaaggcaggtgactggcaattgg cgtccctaatTATCGCAAGCTCGAGCTTTGAATCTCTGAATAGTCTTCCTTTCTTCTCAGTAAGTCTCGAATCCGTGCCTTCTTCCAATCAACCTTAGCgcaat [SEQ ID NO: 29]SEQ ID NO 29 is the signal oligonucleotide produced in a nucleic acid probe system usingP651 (SEQ ID NO: 3) as the first probe and P652 (SEQ ID NO: 2) as the second probe.The signal oligonucleotide may be used to initiate loop-mediated isothermal amplification. The signal oligonucleotide may be amplified by LAMP. The signal oligonucleotide may be used to generate a LAMP amplification product. Amplification product The term “amplification product” as used herein refers to one or more products generated following synthesis of a signal oligonucleotide. As noted hereinabove, the amplification product may be an intermediate amplification product, or an end product of any amplificationprocess. An amplification product may comprise at least a portion of a signal oligonucleotide.An amplification product may comprise a sequence complementary to at least a portion of a signal oligonucleotide. An amplification product may comprise at least a portion of a signal oligonucleotide and a sequence complementary to at least a portion of a signal oligonucleotide. An amplification product may comprise at least a portion of a signal oligonucleotide and a sequence complementary to at least a portion of a signal oligonucleotide and a portion of oneor more primers, such as one or more LAMP primers, and a portion of a sequencecomplimentary to one or more primers, such as one or more LAMP primers. An amplificationproduct may comprise at least a portion of a signal oligonucleotide and a portion of one or more primers, such as one or more LAMP primers. An amplification product may comprise at least a portion of a signal oligonucleotide and a portion of a sequence complimentary to oneor more primers, such as one or more LAMP primers. An amplification product may compriseat least a portion of a signal oligonucleotide and a portion of one or more primers, such as one or more LAMP primers, and a portion of a sequence complimentary to one or more primers, such as one or more LAMP primers. An amplification product may comprise a sequence complementary to at least a portion of a signal oligonucleotide and a portion of one or moreprimers, such as one or more LAMP primers. An amplification product may comprise asequence complementary to at least a portion of a signal oligonucleotide and a portion of a sequence complimentary to one or more primers, such as one or more LAMP primers. An amplification product may comprise a sequence complementary to at least a portion of a signal oligonucleotide, a portion of one or more primers, such as one or more LAMP primers, and aportion of a sequence complimentary to one or more primers, such as one or more LAMPprimers. Suitably by ‘complementary’ in this context is meant that the amplification producthas a complementarity of at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarity to at least aportion of a signal oligonucleotide and optionally at least a portion of one or more primers, Theamplification product may be generated via polymerisation using a signal oligonucleotide as a template. Further amplification products may be generated using earlier amplification products as a template. Amplification products may be generated using one or more primers substantially complementary to a signal oligonucleotide or to a strand complementary to a signal oligonucleotide. Amplification products may be generated using one or more primers substantially complementary to a newly synthesised strand which is complementary to the head region of a second probe. The amplification product may be generated from a LAMP process as defined below, and is therefore a LAMP amplification product. The amplification product may be generated using other amplification methods known in theart, such as PCR, rolling circle amplification (RCA), strand displacement amplification (SDA),recombinase polymerase amplification (RPA) etc. The skilled person is aware of otheramplification methods which would be suitable for use with the nucleic acid probe system of the invention. Loop-mediated isothermal amplificationOne aspect of the present invention relates to a method of performing loop-mediatedisothermal amplification (LAMP) of a target nucleic acid sequence.LAMP is a robust and specific isothermal nucleic acid amplification method. A schematic ofinitiation of an example LAMP reaction is provided in Fig.3 LAMP can be carried out by mixingan initiation sequence, such as a signal oligonucleotide, with a polymerase and one or more specially designed primers. The one or more primers comprise a sequence substantially complementary to the initiation sequence, allowing hybridisation at the complementary region or regions. Following hybridisation between the primer or primers and the initiation sequence, the primer sequence is extended by the polymerase, with the initiation sequence used as a template for the extension. Following extension, the newly generated single-stranded nucleic acid may be displaced. The displaced single-stranded nucleic acid is then available to be bound by one or more primers, which may be the same or different than the primers used to initiate LAMP. The one or more primers comprise a sequence substantially complementary to the single-stranded nucleic acid, allowing hybridisation at the complementary region. The displaced single-stranded nucleic acid therefore acts as a template for nucleic acid synthesis initiated by the one or more primers. Complementarity between regions of the newly generated single-stranded nucleic acid leads to formation of stem loop structures, which can in turn be bound by the one or more primers, initiating further polymerisation and amplification of thesingle-stranded nucleic acid with stem loop structures. The single-stranded nucleic acids andthe single-stranded nucleic acids with stem loop structures may herein be referred to as“amplification products” or “LAMP amplification products”.The polymerase may be a DNA polymerase as described elsewhere herein. The polymerasemay be a DNA polymerase with strand-displacement activity.The nucleic acid synthesis may be DNA synthesis. Thus the single stranded nucleic acid sequence may be a DNA sequence and / or the stem loop structures may be DNA stem loopstructures. The amplification products may therefore be DNA amplification products.The one or more primers comprising a sequence substantially complementary to the initiation sequence may be forward primers. The forward primers may be a forward internal primer (FIP) and / or an F3 primer. Forward primers used in LAMP are generally termed FIP and F3 primers, and the skilled person will be familiar with this nomenclature. Preferably the initiation sequence is a signal oligonucleotide, such as a signal oligonucleotide generated following formation of a three-way junction. The one or more primers comprising a sequence substantially complementary to the single- stranded nucleic acid amplification product may be backward primers. The backward primers may be a backward internal primer (BIP) and or a B3 primer. Backward primers used in LAMP are generally termed BIP and B3 primers and the skilled person will be familiar with this nomenclature. The one or more primers may bind the single-stranded nucleic acid amplification product at the 3’ end. The one or more primers may bind the amplification products at multiple positions. The primers for use in LAMP may be optimised such that a single primer, two primers, three primers or four primers can be used. The primers may be designed such that two primers can be used. For instance, optimised FIP primers may be used to prime synthesis of a nucleic acidstrand complementary to the initiation sequence, such as the signal oligonucleotide, and toprime synthesis of a nucleic acid strand complementary to the amplification product. Alternatively, optimised FIP and F3 primers may be used to prime synthesis of a nucleic acidstrand complementary to the initiation sequence, such as the signal oligonucleotide, and toprime synthesis of a nucleic acid strand complementary to the amplification product. Thussuch primers or primer pairs can prime the synthesis of amplification products from signal oligonucleotides and / or can prime the synthesis of further amplification products from starting amplification products. The methods of the invention may use a single type of primer, two types of primers, threetypes of primer or four types of primers. The methods of the invention may use only a FIPprimer. The method of the invention may use FIP and F3 primers. The methods of the inventionmay use the FIP, F3, BIP and B3 primers. The method of performing LAMP of a target nucleic acid sequence may comprise: (a) contacting the target nucleic acid sequence with a nucleic acid probe system so as toform a three-way junction; (b) generating a signal oligonucleotide from the three-way junction;(c) generating a LAMP amplification product from the signal oligonucleotide(d) optionally detecting the amplification products generated in step (c) with a reportingagent. The nucleic acid probe system may be a nucleic acid probe system according to the first or second aspect of the invention. The signal oligonucleotide may be a signal oligonucleotide according to the fourth aspect of the invention. The LAMP amplification product may be generated via the extension of one or more primers capable of hybridising to the signal oligonucleotide. Optionally the extension may be of one primer, two primers, three primers, or four primers. The primers may be selected from FIP, F3, BIP and / or B3. The primers may have the same sequence or different sequences. The LAMP amplification product may be generated by self-primed extension of the signal oligonucleotide followed by extension of one or more primers capable of hybridising to the signal oligonucleotide. Self-primed extension of the signal oligonucleotide may be possible due to self-annealing between sequences of the signal oligonucleotide. The efficiency of LAMP may be increased by using a single stranded initiation sequence. Thus the efficiency of LAMP may be increased by the presence of a single-stranded signal oligonucleotide. Release of single-stranded signal oligonucleotides could be enhanced by presence of a displacing nucleic acid sequence in the nucleic acid probe system, to compete with the signal oligonucleotide for binding to the first probe. Thus the efficiency of LAMP may be increased by the presence of a first displacing nucleic acid sequence in the nucleic acid probe system. The efficiency of LAMP may be increased by the presence of single-stranded amplification products. Release of single-stranded amplification products could be enhanced by presence of a displacing nucleic acid sequence in the nucleic acid probe system, to compete with the amplification products for binding to a complementary sequence, such as the head region of the second probe. Thus the efficiency of LAMP may be increased by the presence of a second displacing nucleic acid sequence in the nucleic acid probe system. Method of amplifying a target nucleic acid sequence One aspect of the invention provides a method of amplifying a target nucleic acid, the method comprising: (a) contacting the target nucleic acid with a nucleic acid probe system so as to form athree-way junction; (b) generating a signal oligonucleotide from the three-way junction; and (c) creating multiple copies of the signal oligonucleotide and / or generating an amplification product from the signal oligonucleotide.The method of amplifying a target nucleic acid may comprise:(a) contacting the target nucleic acid with the nucleic acid probe system so as to forma three-way junction; (b) generating a signal oligonucleotide from the three-way junction; and (c) generating an amplification product from the signal oligonucleotide. The nucleic acid probe system may be a nucleic acid probe system according to the first orsecond aspect of the invention. Suitably the amplification method may be any such methodknown in the art, such as PCR, rolling circle amplification (RCA), strand displacementamplification (SDA), recombinase polymerase amplification (RPA) etc. and LAMP (describedin more detail above). Suitably therefore the amplification method may include standard conditions and reagents that are known in the art to carry out such methods.Suitably when the amplification is LAMP, the amplification product may be a LAMPamplification product. Details of how a signal oligonucleotide is generated and how amplification products are generated therefrom are provided elsewhere herein. Statements relating to these productsapply equally to these methods.Method of detecting target nucleic acid sequence One aspect of the invention provides a method of detecting a target nucleic acid sequence, the method comprising: (a) contacting the target nucleic acid with a nucleic acid probe system so as to form athree-way junction; (b) generating a signal oligonucleotide from the three-way junction; (c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product comprising at least a portion of the signal oligonucleotideand / or comprising a sequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) or the signaloligonucleotide and / or amplification product generated in step (c).The method of detecting a target nucleic acid sequence may comprise:(a) contacting the sample with the nucleic acid probe system so as to form a three-way junction; (b) generating a signal oligonucleotide from the three-way junction; (c) generating an amplification product from the signal oligonucleotide, wherein the amplification product comprises at least a portion of the signal oligonucleotide and / orcomprises a sequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) and / or the amplification product generated in step (c). In the methods of the invention, detection of the signal oligonucleotide is indicative of the presence of the target nucleic acid sequence. The nucleic acid probe system may be a nucleic acid probe system according to the first or second aspect of the invention. Suitably the step of generating an amplification product may comprise performing an amplification method as set out above. Suitably the amplification method may be any such method known in the art, such as PCR, rolling circle amplification (RCA), strand displacementamplification (SDA), recombinase polymerase amplification (RPA) etc. and LAMP (describedin more detail above). Suitably therefore the amplification method may include standard conditions and reagents that are known in the art to carry out such methods. The amplification product may be a LAMP amplification product. Details of how a signal oligonucleotide is generated and how amplification products are generated therefrom are provided elsewhere herein. Statements relating to these products apply equally to these methods. Suitable means of detecting the signal oligonucleotide and / or the amplification product are described hereinbelow. Method of diagnosingOne aspect of the invention provides a method of detecting a disease or infection in a subject,the method comprising (a) contacting a sample obtained from the subject with a nucleic acid probe system so as to form a three-way junction with a target nucleic acid sequence present in thesample; (b) generating a signal oligonucleotide from the three-way junction; (c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product from the signal oligonucleotide, wherein the amplification product comprises at least a portion of the signal oligonucleotide and / or comprises asequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) or the signaloligonucleotide and / or amplification product generated in step (c); and optionally(e) diagnosing the presence of a disease or infection based upon said detection. In one embodiment, the target nucleic acid sequence is indicative of the disease or infection to be detected, suitably in the subject. In one embodiment, the detection of the signal oligonucleotide produced in step (b) or thesignal oligonucleotide and / or amplification product generated in step (c) indicates thepresence of a disease or infection, suitably in the subject. In one embodiment, the method may be a method of diagnosing a disease or infection in a subject.The method of detecting a disease or infection in a subject may comprise:(a) contacting a sample obtained from the subject with a nucleic acid probe system so as to form a three-way junction with a target nucleic acid sequence present in thesample; (b) generating a signal oligonucleotide from the three-way junction; (c) generating an amplification product from the signal oligonucleotide wherein theamplification product comprises at least a portion of the signal oligonucleotide and / orcomprises a sequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) and / or amplificationproduct generated in step (c); and optionally (e) diagnosing the presence of a disease or infection based upon said detection.Detection of the signal oligonucleotide and / or amplification product is indicative of thepresence of the disease or infection, suitably in the subject. In one embodiment, the detection of the signal oligonucleotide and / or amplification productgenerated in step (c) indicates the presence of a disease or infection, suitably in the subject.The nucleic acid probe system may be a nucleic acid probe system according to the first or second aspect of the invention. The amplification product may be a LAMP amplification product.In the methods of the invention, the signal oligonucleotide may be generated by extension ofthe second probe following formation of the three-way junction, wherein the signal region of the first probe acts as a template for extension of the second probe by polymerisation.The signal oligonucleotide may be generated via polymerisation. The nucleic acid polymerasefor use in step (b) may be a DNA polymerase. The DNA polymerase may have strand-displacement activity. The nucleic acid polymerase in step (d) of the methods may be a DNApolymerase. The DNA polymerase may have strand-displacement activity. The nucleic acidpolymerase in step (b) and / or step (d) may be selected from: Bacillus stearothermophilus (Bst)DNA polymerase, Vent(exo-) DNA polymerase, a derivative of 9°N™ DNA Polymerase suchas Therminator DNA polymerase (M0261, New England Biolabs), and Klenow polymerase. There are various mutant or variant forms of these polymerases (e.g. Bst 2.0 and Bst 3.0), and any suitable mutant or variant form could be utilised. The nucleic acid polymerase thatextends the second probe may be Bacillus stearothermophilus (Bst) DNA polymerase. Thispolymerase is suitable for isothermic reactions, allowing the reaction to proceed at a single temperature, such as room temperature, (around 22°C) up to around 72°C for example: 55°C,62°C, 64°C or 65°C, or between 50-72°C without needing thermal cycling.The efficiency of the methods of the invention may be improved by utilising one or more displacing nucleic acid to aid release of the signal oligonucleotide. The efficiency of the methods of the invention may be improved by utilising one or more displacing nucleic acid to aid release of the amplification product. Properties of such displacing nucleic acids are described above. It is envisaged that one or more displacing nucleic acids could be used in any method of the invention. For instance, a first displacing nucleic acid may be used to aid release of the signal oligonucleotide. A second displacing acid may be used to aid release of amplification products, such as LAMP amplification products. In the methods of the invention, the amplification product may be generated by extension ofone or more primers capable of hybridising to the signal oligonucleotide. Details of how theamplification product may be generated are provided above, and apply equally to the methodsof the invention. Alternatively, the amplification product may be generated by self-primedextension of the signal oligonucleotide. In the methods of the invention, the target nucleic acid may be in a sample. The sample canbe any sample where nucleic acids can be found, suitably a biological sample such as bodytissues and fluids, including: blood, plasma, serum, bile, amniotic, cerebrospinal fluid, lymph, pleural, pus, semen, sputum, saliva, bronchoalveolar washings, sweat, tears, vomit, urine, milk and faeces. The sample may be a milk sample. The sample may be selected from: nasal swabs, rectal swabs, skin scrapings, hair or fur sample, ear exudate, eye discharge, joint fluid, bone marrow, fecal swabs, uterine discharge, hoof trimmings, tissue biopsies, orenvironmental samples (e.g. sewage, water or soil samples).Sutiably a sample may be obtained from a subject by any known techniques such as drawing blood, collecting saliva, or lung lavage for example. In some embodiments, the methods may further comprise a step of treating the subject,suitably if they are diagnosed with a disease or infection. Suitably the subject may be treatedwith a medicament suitable for and intended to treat the relevant disease or infection, at an effective dose. Suitably for example if the infection is bacterial, the subject may be treated withappropriate antibiotics. Suitably for example if the infection is viral, the subject may be treatedwith appropriate antivirals. Detection of the amplification product The amplification products produced in the methods of the invention may be detected using one or more reporting agents.Detection of the amplification product indicates detection of the target nucleic acid sequence,since the amplification product is only generated in the presence of a target nucleic acidsequence which allows the three-way junction to form. Therefore, detection of the amplificationproduct is equivalent to detection of the target nucleic acid sequence. The skilled personunderstands that such detection should be performed immediately in a method of theinvention, before a pre-determined time threshold. A pre-determined time threshold is used asa cut-off for detecting the desired amplification product, to prevent false-positive results caused by off-target amplification when reactions proceed for long periods of time. The skilled person can readily identify a suitable pre-determined time threshold for a given reaction.If the target nucleic acid sequence of interest is present in a test sample multiple copies of thesame amplification product are produced. The presence of these can then be detected usinga reporting agent that can generate a measurable signal. In some instances, the signal oligonucleotide(s) generated from the 3WJ may be detected by reporting agents, such as those described below. The reporting agent may generate a measurable signal in the presence of amplification products. The measurable signal may be fluorescent, colorometric, electrochemical,voltametric turbidometric, optical, magnetic, piezoelectric, or magnetoresistive. Themeasurable signal may be bioluminescence, chemiluminescence, thermometric, surfaceplasmon resonance (SPR), or electrophoretic mobility. The measurable signal may befluorescence. The measurable signal may be a colour change, such as through use of anenzyme (for instance lacZ) that is capable of effecting a colour change reaction using theappropriate substrate or use of pH sensitive-dyes. The measurable signal may beelectrochemical. The measurable signal may be detected on a lateral flow device, for example by using capture antibodies. The reporting method may be sequence independent. Non-limiting examples of sequence independent reporting methods include gel electrophoresis, measurement of turbidity, metalindicators for calcium, colorimetrics, coffee-ring effect on colloid crystal substrates, paper-based rapid detection of LAMP–magnetic bead aggregates, melting and annealing curveanalysis, intercalating fluorescent dyes such as SYBR green, bioluminescence orelectrochemiluminescence (see, e.g., Bercherer et al., Analytical Methods, 12717-7462020). The reporting method may be sequence specific. Such reporting methods allow for highly specific detection of amplification products. Sequence specific detection methods may beparticularly useful for detecting different amplification products produced by different targetnucleic acid sequences in multiplexed reactions. Sequence specific reporting methods includefluorescence, chemiluminsense, colorimetrics, piezoelectrics, electrochemical (such as amperometry, voltammetry, impedimetry), and magnetoresistance.Reporting agents are well known in the art for nucleic acid amplification processes such asthose utilised in the methods of the invention. Thus the skilled person is aware of furtherreporting agents which may be suitable for use in the methods of the invention, such as riboregulator switches, molecular beacons and aptamers. Preferably, the amplification product is detected using intercalated dye. The intercalated dyemay be a fluorescent dye, such as SYBR green or EvaGreen.Total Reaction The present invention provides methods of detection of target nucleic acid sequences using three-way junctions. Such three-way junctions may be formed using the nucleic acid probe system of the invention.The methods of the invention may comprise a two phases, the first phase comprising formationof the 3WJ, a the second phase comprises signal amplification and optionally detection.Alternatively, the methods of the invention may comprise three phases, the first phasecomprising formation of the 3WJ, the second phase comprising conversion of the 3WJ to aLAMP reaction, the third phase comprising detection of amplification products.Preferably the methods of the invention are isothermal.The reactions may be carried out at a temperature of 55˚-72˚C for a period of time. Thereactions may be carried out at a temperature of 65˚C + / - 2˚C for a period of time. Thereactions may be carried out at 62˚C or 64˚C for a period of time.The length of time required for the reactions to complete and deliver a measurable reporting signal will depend on factors such as the amount of reagents, the amount of target nucleic acid present in the sample and the reaction temperature. The amounts of the particular reagents will need to be combined in quantities which maximise the overall reaction. It is likely that a compromise set of reaction conditions will be required that allows each of the essential reactions to proceed efficiently, albeit at less than maximum level. The person skilled in the art can devise such conditions using routine experimentation. It will be appreciated that the longer the reaction time allowed the greater the amount of product that could be generated.The reactions which form part of the methods of the invention may be carried out within aperiod of time of 5-300 minutes. For instance, the methods of the invention may be carried out within around 3-4 hours. However, it will be appreciated that the total reaction time can bealtered to suit the conditions. Longer time periods, for instance 4 hours, may be used to assessthe performance of the methods. Shorter time periods may be used when using the methods in real-world applications, such as for detecting pathogenic sequences, suitably in a method of detecting a disease or infection as described herein. Substrate and Device The components of the present invention may be provided upon a substrate together with reagents. The substrate may be part of a device, such as a testing device. The various probes and other reagents such as polymerases, required to carry out the amplification methods of the invention may be provided on a solid substrate.The solid substrate may be a semi-porous substrate. Alternatively, the solid support may be aporous substrate. The solid support can be in any form including, but is not limited to, a well, a tube, a planar substrate (e.g., a chip or a plate), a sphere, a porous substrate (e.g., a mesh or a foam), a 3D scaffold, a patterned surface (e.g., nano-patterns, or micro-patterns, or both), a porous or solid bead, a hydrogel, a channel (e.g., a microfluidic channel), a smooth surface, and a rough surface.Paper is an extremely cheap and promising material for use as a substrate. It is slender, easyto stock, employ and transport. It is compatible with biological samples and can be chemically treated to bond with molecules or proteins and is environmentally friendly. Particular paper- based substrates include paper and card. The substrate, e.g. card, can be any size but is conveniently small enough to be portable and / or held in the hand. A5 size and below would be convenient. The substrate may be a paper-based product such as a card. The porous substrate maycomprise paper, for instance the probes and reagents to facilitate the reactions may be appliedto card in a dried or lyophilised form.A nucleic acid containing test sample may be used to rehydrate detection components thathave been dried or lyophilised onto a substrate, such as onto a plastic / paper or other suitablesupport medium. Lyophilization, or freeze-drying, is a method for the preservation of labile materials in a dehydrated form. It is particularly suitable for high-value labile biomolecules such as proteins. The process involves the removal of bulk water from a frozen protein solution by sublimation under vacuum with gentle heating (primary drying). This is followed by controlled heating to more elevated temperatures for removal of the remaining “bound” water from the protein preparation (secondary drying). Other drying methods can also be employed. Alternatively, the substrate may comprise plastic, polymer-based, hydrogel, glass, silicon, quartz, microfiber, mixed esters of cellulose, porous aluminium oxide, or a patterned surface. Suitably each step of the amplification methods of the invention can be carried out at the same zone or location on a substrate, or at different zones or locations on a substrate, such as where the reaction product from the first reaction (e.g. target detection) is transferred to the second reaction (e.g. signal amplification) and the reaction product from this is transferred to the next reaction module (e.g. signal reporting).The reactions of the invention may be carried out in one zone / location on the substrate. Insuch instances, the fluid test sample is applied to the zone containing the reagents and thereaction is allowed to proceed. The fluid can also be applied to other zones that contain controlreactions. After the incubation period the results can be read by visualisation of, for example a colour change. The probes and reagents may be provided at distinct zones on the solid substrate so that the reactions of the method can be carried out in different locations. For example the reaction leading to formation of the 3WJ could be carried out at one site, and LAMP could be carried out at the same site as formation of the 3WJ or at another site. Product / fluid from a onereaction may be transferred to the site of the next reaction, such as via a pipette or by lateralflow etc. The solid support may comprise 1 or more, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 etc.,spatially distinct reaction regions, or zones, where the reaction reagents are confined.The solid support may be pre-treated with bovine serum albumin, polyethylene glycol, Tween-20, Triton-X, milk powder, casein, fish gelatin, or a combination of one or more thereof. Without wishing to be bound by theory, this pre-treatment step can increase the signal-over-noise ratio for a fluorescent signal by limiting non-specific binding and / or irreversible binding of the reaction components. The substrate may also have one or more of the following reagents attached thereon in a zone: a DNA polymerase, an RNA polymerase, ribo-nucleotide triphosphates, deoxyribo- nucleotide triphosphates, a cell-free extract comprising ribosomes and an enzyme substrate reagent. All the reagents may be present within one zone. Alternatively, some of the reagentsmay be within one zone and others within one or more other zones.The methods of the invention may be carried out in a microfluidic device.According to a further aspect of the invention, there is provided a microfluidic device for use in performing the methods of the invention. The microfluidic device may comprise a solid substrate according to the invention. In such a microfluidic device, some of the reaction components, such as the nucleic acidprobes of the invention, may be bound to a zone in the microfluidic device and the test sampleand various reaction reagents applied to the zone to initiate a particular reaction (e.g. formation of a three-way junction). After suitable reaction times the fluids can be washed off and new reaction reagents applied to initiate the next reaction. In this way, a series of reactions can be carried out sequentially using the device. The reaction components can also be contained in, and the reactions themselves carried out in a microfluidic device. This would allow the different phases of the reaction, such as 3WJ oligonucleotide trigger sequence synthesis, amplification and detection to take place in distinct zones with the initial sample fluid applied in one zone and the sample liquid and reaction products arising from each reaction zone being capable of moving to another zone where the next reaction can take place. In this way, the different reaction components (such as polymerases, buffers, bases etc.) can be located in distinct zones to minimise interference in the reaction by components that do not participate in the reaction. Of course, it will beappreciated that distinct reaction steps can be separated in this way or combined into one orother zones, such that, for example, the initial 3WJ reaction and RNA signal amplification could be carried out in zone 1 and the detection carried out in another zone; the two zones being connected by a channel through which fluid from the first zone can pass to the second zone.Microfluidic approaches, devices and systems are well known in the art. Various techniquescan be employed to fabricate devices for microfluidics. For example, it is possible to use photolithography, soft lithography, thermoforming or etching techniques. According to a further aspect of the invention there is provided a solid substrate comprising one or more zones of lyophilised or dried reagents, said reagents comprising one or more of the following: a first nucleic acid probe and a second nucleic acid probe capable of creating a three-way junction with a target nucleic acid sequence of interest; a DNA polymerase; deoxyribo-nucleotide triphosphates; an enzyme substrate reagent; buffers; and one or more primers. The solid support may comprise one or more fluidic channels (e.g., microfluidic channels) thatconnect reaction regions with an area for adding an aqueous sample (e.g. test sample). In such cases, when an aqueous sample is added to the area, the fluid is wicked away to the reaction regions, thereby a plurality of reaction regions can be activated by the same sample. The target nucleic acid may be present in a sample. The sample can be any sample where nucleic acid can be found, such as a biological sample, for example body tissues and fluids, including: blood, plasma, serum, bile, amniotic, cerebrospinal fluid, lymph, pleural, pus, semen, sputum, saliva, bronchoalveolar washings, sweat, tears, vomit, urine, milk and faeces. In order to release their nucleic acid, cells may need to be lysed (e.g. in the presence of lysis buffer). Kit In one aspect of the invention there is provided a kit for use in detecting the presence of atarget nucleic acid sequence. The kit may comprise the nucleic acid probe system accordingto the invention and / or the one or more primers according to the invention. The kit may be foruse in performing a method of the invention. The kit may comprise further comprise packaging and instructions for use. The instructionsmay be for use in performing the methods of the invention.The kit may further comprise one or more of the following: a DNA polymerase; deoxyribo- nucleotide triphosphates; reporting agents; and buffers.The kit may comprise a DNA polymerase selected from: Bacillus stearothermophilus (Bst)DNA polymerase, Vent(exo-) DNA polymerase, a derivative of 9°N™ DNA Polymerase suchas Therminator DNA polymerase (M0261, New England Biolabs), GspSSD2.0 DNAPolymerase (OptiGene), Bsm DNA polymerase large fragment (Thermo Scientific) andKlenow polymerase. Preferably, the kit comprises Bst DNA polymerase.The kit may further comprise one or more primers. The one or more primers may be selected from FIP, F3, BIP and / or B3, or other primers optimised for conducting LAMP. The kit may be for use in performing loop-mediated isothermal amplification (LAMP). Uses of the invention A useful feature of the present system is that the target sequence can be any nucleic acid (RNA or DNA) sequence of interest, such as a sequence from a pathogen (like Mycobacteriumbovis or bovine viral diarrhoea virus), or a sequence of a particular mammalian or plant allele.The system could be used to distinguish between allelic variations (such as gene mutations),which may be useful in the diagnosis of diseases. Through the use of specially designed probes, the nucleic acid probe system and / or methods of the invention can be used to detect single nucleotide differences (such as single nucleotide polymorphisms or single point mutations) in genetic material using stringent hybridisation conditions to ensure the binding of the first or second probe to the target sequence is achieved over binding to a target sequence where there is mismatch (perhaps as present in a normal genetic sequence). Thus, depending on the use it is to be put to the target sequence can be very long, such as for use in detecting the presence of a pathogen in a sample, or small, such as for detecting single point mutations. The target sequence can be changed by altering the binding region of the first and second probes. The nucleic acid probe system and / or methods of the invention may be for use in detecting one or more infectious agents. The one or more infectious agents may be bacterial, viral, or eukaryotic. The nucleic acid probe system and / or methods of the invention may be for use in detecting one or more pathogens. The one or more pathogens may be bacterial, viral, or eukaryotic.The one or more pathogens may be selected from E. coli, S. uberis, S. aureus, S. agalactiae,S. dysgalactiae, bovine diarrhoea virus 1, bovine diarrhoea virus 2, and / or brucellosis. Forexample bovine viral diarrhoea virus (BVDV) may be detected by designing probes againstthe 5’UTR of BVDV as the target nucleic acid sequence. S. dysgalactiae could be detectedusing probes targeting the S. dysgalactiae ribosomal RNA as the target nucleic acid sequence.S. agalactiae could be detected using probes comprising complementary sequences to the S.agalactiae accB gene as the target nucleic acid sequence. S. aureus could be detected usingprobes comprising complementary sequences to the S. aureus nuc gene as the target nucleicacid sequence. E. coli could be detected using probes comprising complementary sequencesto the . E. coli GadB gene as the target nucleic acid sequence.The nucleic acid probe system and / or methods of the invention may be for use in detecting a target nucleic acid which is associated with a particular disease. For instance, for use indetecting genetic mutations associated with disease. Genetic mutations which could bedetected using the nucleic acid probe system and / or methods of the invention include single nucleotide polymorphisms (SNPs), such as SNP rs334 in the HBB gene which is associated with sickle cell disease.The nucleic acid probe system and / or methods of the invention may be for detecting classicalswine fever (CSF), mastitis, bovine viral diarrhea virus (BVDV) or Johne's disease(Mycobacterium avium subspecies paratuberculosis, abbreviated as MAP). To detect mastitis,the target sequence may be a sequence from Staphylococcus aureus, Streptococcusagalactiae, Escherichia coli (E. coli), Streptococcus uberis, Streptococcus dysgalactiae orKlebsiella spp,The nucleic acid probe system and / or methods of the invention may be for detecting targetgenetic material, such as ribosomal RNA, mRNA, viral RNA genomes (such as 5’UTR, for example the 5’UTR of BVDV), or DNA genes. Possible mRNA targets include nuc1, such asS, aureus nuc1, phoA, such as E. coli phoA and gadB, such as E. coli gadB, . Possible DNAgene targets include the nuc1 gene (S. aureus); phoA (E. coli), and gadB (E. coli). Fordetecting DNA, an additional step to melt the DNA may be required in the methods of the invention, prior to target detection. Primers One aspect of the invention provides one or more primers comprising a nucleic acid sequence substantially complementary to a signal oligonucleotide and / or amplification product, wherein the signal oligonucleotide is complementary to a first probe and / or wherein the amplification product is generated from the signal oligonucleotide.The one or more primers may comprise a nucleic acid sequence substantially complementaryto a portion of a signal oligonucleotide, wherein the signal oligonucleotide comprises asequence complementary to the signal region of a first probe and at least a portion of thesecond probe, suitably to the head region of the second probe. The first probe may be a firstprobe of a nucleic acid probe system of the invention. The second probe may be a secondprobe of a nucleic acid probe system of the invention.The one or more primers may comprise a nucleic acid sequence substantially complementaryto an amplification product, wherein the amplification product is generated from a signal oligonucleotide. The amplification product may be a LAMP amplification product. The one or more primers may be one primer, two primers, three primers or four primers. The one or more primers may all have the same sequence. The one or more primers may have different sequences. The one or more primers may comprise a nucleic acid sequence corresponding to a portion of a first and / or second probe. The one or more primers may comprise a nucleic acid sequence substantially complementary to a portion of a first and / or second probe. The one or more primers may comprise a nucleic acid sequence substantially complementary to the reverse complement of a portion of a first and / or second probe.The one or more primers may comprise a nucleic acid sequence corresponding to a portionof the signal region of a first probe. The one or more primers may comprise a nucleic acid sequence substantially complementary to the signal region of a first probe. The one or more primers may comprise a nucleic acid sequence substantially complementary to the reverse complement of the signal region of the first probe. The one or more primers may comprise a nucleic acid sequence substantially complementary to a signal oligonucleotide. The one or more primers may comprise a nucleic acid sequence corresponding to a portion of the head region of a second probe. The one or more primers may comprise a nucleic acidsequence substantially complementary to the head region of a second probe. The one or moreprimers may comprise a nucleic acid sequence substantially complementary to the reverse complement of the head region of a second probe. The one or more primers may be LAMP primers. The one or more primers may be optimisedLAMP primers. The one or more primers may be F3, FIP, B3 and / or BIP primers. The one ormore primers may be loop forward (LF) and loop backward (LB) primers. LF and LB areprimers used in LAMP and the skilled person will be familiar with this nomenclature. Fig. 3 shows how LF and LB primers can be used in LAMP reactions. The one or more primers may be a single primer optimised for use in all stages of LAMP. The single primer may be a FIP primer. The FIP primer may be optimised to initiate each synthesisstep in LAMP, to generate amplification products. The FIP primer may be optimised to bind toboth a signal oligonucleotide and an amplification product. The FIP primer may be optimised to initiate nucleic acid synthesis following binding to a signal oligonucleotide and an amplification product. The one or more primers may be a pair of primers optimised for use in all stages of LAMP. The pair of primers may be a FIP primer and an F3 primer. The FIP primer and F3 primer may be optimised to initiate each synthesis step in LAMP, to generate amplification products. The FIP primer and F3 primer may be optimised to bind to both a signal oligonucleotide and an amplification product. The FIP primer and F3 primer may be optimised to initiate nucleic acid synthesis following binding to a signal oligonucleotide and an amplification product. The one or more primers may be capable of initiation of nucleic acid sequence at a constant temperature. The skilled person will understand that the sequences of the one or more primers will depend on the sequences to which they are intended to bind.. The skilled person will readily be able to design such primers using methods known in the art and the disclosure herein. Non-limiting examples of such primers are provided in the examples. For instance, suitable primers maycomprise or consist of the sequence of P598 (F3, SEQ ID NO: 5), P599 (B3, SEQ ID NO: 6),P729 (FIP, SEQ ID NO: 7), P601 (BIP, SEQ ID NO: 8), P600 (FIP, SEQ ID NO: 10). Definitions Features, integers, characteristics, embodiments described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to anyother aspect, embodiment or example described herein unless incompatible therewith.Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of them mean “including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise. The patent, scientific and technical literature referred to herein establish knowledge that was available to those skilled in the art at the time of filing. The entire disclosures of the issuedpatents, published and pending patent applications, and other publications, includingsequence accession numbers, that are cited herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference. In the case of any inconsistencies, the present disclosure will prevail. Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For example, Singleton and Sainsbury, Dictionary of Microbiology and MolecularBiology, 2d Ed., John Wiley and Sons, NY (194); and Hale and Marham, The Harper CollinsDictionary of Biology, Harper Perennial, NY (1991) provide those of skill in the art with ageneral dictionary of many of the terms used in the invention. Although any methods andmaterials similar or equivalent to those described herein find use in the practice of the present invention, suitable methods and materials are described herein. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. It is to be understood that this invention is not limited to the particular methodology, protocols, and reagents described, as these may vary, depending upon the context they are used by those of skill in the art. Brief description of the drawings Figure 1 shows a schematic of an example three-way junction. The binding regions of the template probe (or “first probe”) and extension probe (or “second probe”) are bound to thetarget sequence. As the template probe and extension probe are bound to the targetsequence, the complementary regions of the probes are brought together and hybridise to each other, for example via the core region of each probe, forming a three-way junction. Following hybridisation the spacer and signal region of the template probe are available for use as a template sequence to generate the complementary signal oligonucleotide via extension of the extension probe. Figure 2 shows schematics of probes with secondary structures, Fig 2A shows a probe with ahairpin formed between the core region and spacer region. Fig 2B shows a probe with a stemloop formed between the core region and signal region. Fig 2C shoes a probe with a hairpin formed between the core region and hinge region.Figure 3 shows a schematic of a LAMP reaction (image credit: Silva, S.J.R.d.; Pardee, K.;Pena, L. Loop-Mediated Isothermal Amplification (LAMP) for the Diagnosis of Zika Virus: AReview. Viruses 2020, 12, 19), showing how a target nucleic acid is amplified by using aforward internal primer (FIP) and backward internal primer (BIP) to generate LAMPamplification products. Figure 4 shows results of LAMP reactions using a nucleic acid probe system according to the invention. A three-way junction was formed using P530 as the first probe and P531 as the second probe to detect a region of the 5’ untranslated region (UTR) of BVDV. LAMP was used to amplify a signal oligonucleotide produced following formation of a three-way junction. The results indicate that the nucleic acid probe system of the invention can be used with amplification methods such as LAMP for reliable detection of the target sequence.Figure 5 shows LAMP results when using different mechanisms to assist conversion fromthree-way junction to LAMP. Schematics of the three-way junctions and additional nucleicacids are also shown. -ve = negative control; A = TWJ with primer binding site but no extra components to aid displacement of synthesised strand, at a low target load (1e07); B = TWJ with primer binding site but no extra components to aid displacement of synthesised strand,at a high target load (1e09); C = use of displacing oligonucleotide as part of the template (first)probe; D = use of a short displacing oligonucleotide complementary to the template (first)probe, covering 2 / 3 of the sequences complementary to primer binding sites; E = use of a longdisplacing oligo nucleotide complementary to the template probe, covering all of the sequences complementary to primer binding sites; F = use of a separate displacing oligonucleotide complementary to the template probe and containing LNA nucleotides to aidin displacement; G = use of an displacing oligonucleotide as part of the extension (second)probe, to aid release of amplification products ; H = use of an integrated displacingoligonucleotide on both extension (second) probe and template (first) probe; +ve = positive control, a double stranded sequence mimics the three way junction after extension of the extension probe but in the form of a single double stranded block. The square plot points show the positive signal, indicating the time at which LAMP products were detected. The triable plot points show the negative signal, indicating the time at which unwanted products (e.g. primerdimer, unwanted amplification products) were detected. The results demonstrate that allmechanisms could lead to formation of a 3WJ and thus generation of LAMP amplification products.Figure 6(secondary structures of TWJ probes in the system. The pairing probability plot is avisual representation depicting the likelihood of base pairing between interacting nucleic acidstrands. Strand 1 is a target sequence, strand 2 is an extension (second) probe, strand 3 is atemplate (first) probe, strand 4 is a displacing oligonucleotide. Interactions between the nucleicacids are indicated: Interaction A - between the target and second probe; interaction B -between target and first probe (Tp); interaction C - between handle region of first probe andhandle region of displacing oligonucleotide; interaction D - between displacing oligo and signalregion of first probe; interaction E - priming interaction between first probe and second probein which the second probe primes the first probe; interaction F - internal secondary structurewithin second probe (Ep) which competes with the interaction between the first probe and the secondary probe to improve performance;interaction G - internal secondary structure within first probe (Tp) which competes with theinteraction between the first probe and the secondary probe to improve performance.Figure 7 shows a schematic of a three-way junction formed between a target sequence,template (first) probe (Tp) and extension (second) probe (Ep). Binding of a first displacingoligonucleotide (DO1) to the first probe releases the synthesised strand / signal oligonucleotide(SS) to be bound by primers FIP and F3. The interaction between a second displacing oligonucleotide and the extension (second) probe is also shown. FIP binds to the templateprobe at the F1 binding site (non-priming interaction that does not lead to extension). FIP andF3 are also able to bind the synthesised strand (signal oligonucleotide. Triangle protrusions on the displacing oligonucleotides indicate the positions of modified nucleotides, such as LNAs, to stabilising the interactions between the displacing oligonucleotides and the probes. Figure 8 shows results of LAMP using three-way junction probes having secondary structures and a displacing oligonucleotide complementary to the template strand to aid release of the signal oligonucleotide. OC14 = positive control, showing that the conditions have been acceptable for LAMP. OC14 = test of 3WJ probe system. The square plot points show thepositive signal, indicating the time at which LAMP products were detected. The triangle plotpoints show the negative signal, indicating the time at which unwanted products (e.g. primer dimer, unwanted amplification products) were detected. N = 3. Figure 9 shows results of LAMP using a three-way junction probe system to detect a targetsequence in a biological sample of milk.Figure 10 shows the results of LAMP performed with two or four primers. It can be seen thatusing two specially designed primers in combination with a three-way junction probe system can generate LAMP product. The smaller error bars for the two-primer reaction demonstrates that the use of fewer primers can minimise stochasticity. Examples The invention will now be further described with reference to the following non-limiting examples, and the figures described above.Example 1 – SequencesTable 1 provides the sequences of targets, an extension (second) probe, a template (first)probe, a displacing oligonucleotide (displacing nucleic acid), and primers for use in LAMP (F3,B3, FIP, BIP).
[0002] Oligo ComponentOligo name SEQ ID NO Sequence (IDT notation)system name Three-Way E.coli nucleotide P650POS1 tcccctaggggacgccac^gctgg^tgtgagtgaaagtcacctgcc^aatatctcaaaJunction M sequence target actcatc^cgggtaaaaaaaaa (with spacer) Synthetic ssDNA construct Extension Probe P652 2 CAACCCTTGAGTACACACGTCAATACAACCCACCTTCCAGACATCGAGTACCCAATACTGTATTCAACCTTGTACTGCGCA ACTGA acccgaagatgagttttgagatattaaggcaggtgactggcaat Template ProbeP651 3 GGCCCAGGCGGCAGGCGCC / iSp18 / attgc Gwith “18-atom CTAAGGTTGATTGGAAGAAGGCACGGATTCGAGACTTACT hexa- GAGAAGAAAGGAAGACTATTCAGAGATTCAAAGCTCGAGC ethyleneglycol TTGCGATA att a spacer” gggacgccaattgcctcactcacaaaccagcaagtggcgtcccctagggga Displacing oligo*,P660 4 +C+T+TTCT at TCAGTAAGTCTCGAATC CGT+G+C tawith Locked TCTTCCAATCAACCTTAG C +g+c+a+a+t +aaaa Nucleic Acid GGCGCCTGCCGCCTGGGCC annotated as ‘+N’
[0003] Set OC30 F3 orthogonal P598 5 CTaAGGTTGATTGGAAGAAGamplification primer B3 orthogonalP599 6 AACCCTTGaGTaCACACGamplification primer FIP orthogonalP729 7 TATCGCaAGCTCGAGCTTTGAATGGATTCGAGACTTACTGamplification A primer BIP orthogonalP601 8 CAGTTGCGCAGTAcAAgGTTATACAACCCACCTTCCAGACAamplification TC primer Table 1 Selected oligonucleotides for use in the disclosed methods. * Locked Nucleic Acid annotated as ‘+N’, where N is G, C, A or T as indicated in the sequence provided
[0004] P653 (extension probe) (SEQ ID NO: 9)GCTAAGGTTGATTGGAAGAAGGCACGGATTCGAGACTTACTGAGAAGAAAGGAAGACT ATTCAGAGATTCAAAGCTCGAGCTTGCGATAattacccgaagatgagttttgagatattaaggcaggtgact ggcaat OC14 positive control, associated primersP598_LAMP_F3 primer (SEQ ID NO: 5):CTaAGGTTGATTGGAAGAAGP599_LAMP_ B3 primer (SEQ ID NO: 6):AACCCTTGaGTaCACACGP600_LAMP_FIP primer (SEQ ID NO: 10):ATCGCaAGCTCGAGCTTTGAATGATTCGAGACTTACTGAGAP601_LAMP_Orthogonal_BIP (SEQ ID NO: 8):CAGTTGCGCAGTAcAAgGTTATACAACCCACCTTCCAGACATCOC14 positive control template sequence (gs158) (SEQ ID NO: 11):ACCGGCTAAGGTTGATTGGAAGAAGGCACGGATTCGAGACTTACTGAGAAGAAAGGAA GACTATTCAGAGATTCAAAGCTCGAGCTTGCGATAACTGTTCAGTTGCGCAGTACAAGG TTGAATACAGTATTTCCACACAGGGTACTCGATGTCTGGAAGGTGGGTTGTATTGACGT GTGTACTCAAGGGTTGTGTGAAExample 2 – Methods for Use of a Three-Way Junction Probe System to initiate LAMPThe in following protocols were utilised for the performing the experiments described in the examples below. “One pot protocol”In the one pot protocol, a sample (containing E. coli nucleotide sequence target or doublestranded OC14 control), three-way junction probes, a displacing oligonucleotide, amplification primers and enzyme (Bst DNA polymerase, contained in the WarmStart LAMP 2X Master Mix(New England Biolabs)) were combined together in the amounts indicated in Tables 2 and 3.The reagents were combined on ice and Rnase free water was used to make up the finalreaction volume of 10 uL. The reaction mixture was then incubated at 65 ºC in a thermocycler,to allow the 3WJ probe system to bind to the target DNA and initiate LAMP. Fluorescence wasmeasured every minute for the duration of the experiment (approximately 4 hrs), to detect theaccumulation of LAMP amplification products. “Two pot protocol”In the two pot protocol, the sample three-way junction probes, displacing oligonucleotide andbuffer were combined (in amounts as indicated in Table 2) and diluted with RNAse-free waterto a final volume of 2 uL. The mixture was incubated at 55ºC for 30 mins to allow the the-wayjunction probes to anneal.Following annealing, amplification primers, additional buffer and enzyme (Bst DNApolymerase, contained in the WarmStart LAMP 2X Master Mix (New England Biolabs)) wereadded to the reaction mixture in the amounts shown in Table 3. The two mixtures werecombined on ice and made up to a final volume of 10 uL with RNAse-free water.The final reaction mixture was then incubated at 65 ºC in a thermocycler to initiate LAMP.Fluorescence was measured every minute for the duration of the experiment (approximately 4 hrs), to detect the accumulation of LAMP amplification products. The experiment was allowed to run for approximately 4 hrs to allow detection of off-target amplification products which form over time. Shorter reaction times of around 1 hour would be sufficient for use in real-world applications.The inventors found that the two pot protocol increased analytic sensitivity.Table 2 provides details of a reaction mix for annealing a three-way junction probe system toa target. This mix is also referred to as “annealing mix”.Component Desired final concentrationIsothermal Amplification Buffer Pack(NEB) 1XTemplateprobe (1nM) 0.213 nMDisplacing nucleic acid (1nM) 0.213 nMExtension probe (0.1nM) 0.0213 nMRNAse- freewater make up volumeSampleTable 3 provides details of a reaction mix for LAMP amplification, for use with the annealing mix described above.Component Desired final conc.F3 LAMP Amplificationprimers 0.2 μMB3 LAMP Amplificationprimers 0.2 μMFIP LAMP Amplificationprimers 1.6 μMBIP LAMP Amplificationprimers 1.6 μMRNAse-free waterBuffer (WarmStart LAMP2X Master Mix) 1XFluorescent LAMP dye(50X) 1XBetaine (additive) 1 MEDTA (additive) 1.25 mMAnnealing Mix 15 % of total volumeExample 3 –Use of a three-way junction probe system to initiate LAMPThe aim of this experiment was to assess whether the three-way junction probe system could be used for target detection using an amplification method to amplify the signal oligonucleotide. LAMP was used as an amplification method in this experiment, because it isa robust and highly specific method for amplifying nucleic acid templates. However, the skilledperson will understand that other amplification methods could also be utilised to amplify the signal oligonucleotide for target detection. The reactions were run using the two-pot protocol as described in Example 2, using P430(SEQ ID NO: 26), a region of the 5’UTR of the BVDV viral genome, as the target nucleic acidsequence, P530 template probe (SEQ ID NO: 12) and P531 extension probe (SEQ ID NO: 13). The LAMP primers were P511 (SEQ ID NO: 14), P512 (SEQ ID NO: 15), P513 (SEQ ID NO: 16) and P514 (SEQ ID NO: 17). The template probe (first probe) was designed with secondary structure between the target binding region and core region. The secondary structure also partially extends between the target binding and the spacer region to further stabilise the interaction between the binding site and the core region. The extension probe (second probe) was designed with secondary structure between the target binding region and core region. The secondary structures of the probes were designed using an objective function which simulated the nucleic acid structural ensemble then tested the probability of the priming nucleotides of the second probe, priming the template probe (for robustness this prediction was repeated using varied temperature and slat concentrations to optimise for designs which are robust to variation in the operating environment). This objective function was then used to optimize Three way junction designs using a machine learning approach, starting with a pool of candidate Three way junctions spread across the latent space. This was followed by gradient ascent using an evolutionary machine learning algorithm. The mutator function of the evolutionary algorithm was designed with an understanding of the structures that would befavourable. For designing further nucleic acid probe systems this process would be repeatedthree times and the best three candidates tested in vitro to identify the probe designs with the highest sensitivity and specificity. The final concentrations of the components in the LAMP reaction mix were as described in Example 2 and Table 3. When a given component, such as a displacing oligonucleotide, was not included the difference in the final reaction volume was made up with water. The results of the LAMP reaction are shown in Fig 4. The positive and negative signals were clearly distinct, suggesting that the nucleic acid probe system of the invention can successfullyform three-way junctions and generate signal oligonucleotides, which can be amplified usingamplification methods such as LAMP. This leads to reliable detection of the target sequence.Example 4 – Adaptations to a three-way junction probe system to initiate LAMPThe aim of this experiment was to assess whether introducing additional oligonucleotides, such as displacing oligonucleotides (displacing nucleic acids), had any effects on theconversion from TWJ formation to LAMP amplicon, efficiency, sensitivity and / or specificity of the reaction. An overview of each of the concepts tested is provided in Table 4. Details of the oligonucleotides tested are provided in Table 5. Each of the template probes (first probes) were designed with secondary structure between the target binding region and core region. The secondary structure partially also partially extends between the target binding and the spacer region to further stabilise the interaction between the binding site and the core region. Each of the extension probes (second probes) were designed with secondary structure between the target binding region and core region.The reactions were run using the two-pot protocol described in Example 2, using P430 , aregion of the 5’UTR of the BVDV viral genome, as the target nucleic acid sequence and theprobes and displacing oligonucleotide were as indicated in Table 4. The no template controlwas an oligonucleotide P294 (SEQ ID NO: 25) lacking complementarity to other componentsin the system. The final concentrations of the components were as described in Example 2. When a given component, such as a displacing oligonucleotide, was not included the difference in the final reaction volume was made up with water. The sequences and concentrations of oligonucleotides used are provided in Table 5.
[0005] Table 4: Reaction components tested in Example 4. EP = Extension (second) probe ; TP =Template (first) probe; DO = Displacing oligonucleotide (also referred to as a displacingnucleic acid); dsDNA = double-stranded DNA Label / Reaction Concept Oligonucleotides-ve Negative control only OC3 amplification primers, no three-way junction ATWJ with primer binding site but no extra components to EP - P531aid displacement of synthesised strand, at a low targetTP - P530load (1e07) BTWJ with primer binding site but no extra components to EP – P531aid displacement of synthesised strand, at a high targetTP – P530load (1e09) CA displacing oligonucleotide as part of the template (first) EP – P531probeTP – P532D A short displacing oligonucleotide complementary to the EP – P531template (first) probe, covering 2 / 3 of the primer bindingTP – P547sites at this end of the structure (F3 and F2, but not F1,DO – P557see Fig.7) EA long displacing oligonucleotide complementary to the EP – P531template probe, covering all of the sequencesTP – P547complementary to primer binding sitesDO – P575F Using a separate displacing oligonucleotide EP – P531complementary to the template probe and containing BNATP – P576nucleotides to aid in displacementDO – P577G Using a displacing oligonucleotide as part of the extension EP – P533(second) probe, to aid release of amplification productsTP – P530H Using an integrated displacing oligonucleotide on both EP – P533extension (second) probe and template (first) probeTP- P532+ve Positive control – a double stranded sequence mimics the dsDNA – gs155three-way junction after extension of the extension probe but in the form of a single double stranded blockTable 5 – Sequences and concentrations of oligonucleotides used in Example 4Component Name (SEQ ID NO) Primer sequence Final conc.TWJ – TemplateAAACTTGTGATAAAAGAGAAACCcATCCGATCCATTTGTGAGAaatgagaaacataaccaatgTGGAACCProbe P530 (SEQ ID NO: 12) GCTGAAAAAAGGATTAAgaggacgagggcgctcattgggcatgccctcgtccacgtggcatctcga 0.16 nMCTTActTCACAAATGGATCGGATgaaTTTCTCTTTTATCACAAGTTTAAAACGCCCGTTTACGGGCG / TWJ – Template P532 (SEQ ID NO:iSp18 / AAACTTGTGATAAAAGAGAAACCcATCCGATCCATTTGTGAGAaatgagaaacataaccaatgTGG Probe 18)AACCGCTGAAAAAAGGATTAAacgagggcgctcattgggcatgccctcgtccacgtggcatctcga 0.16 nMGTCAGGCCTTGTCGCCCCGCGC / iSp18 / AAACTTGTGATAAAAGAGAAACCcATCCGATCCATTTGTWJ – TemplateTGAGAaatgagaaacataaccaatgTGGAACCGCTGAAAAAAGGATTAAacgagggcgctcattgggcatgccctcgtcProbe P547 (SEQ ID NO: 19) cacgtggcatctcga 0.16 nMGTCAGGCCTTGTCGCCCCGCGC / iSp18 / cggagcAAACTTGTGATAAAAGAGAAACCcgacgcATCCGTWJ – Template P576 (SEQ ID NO:ATCCATTTGTGAGAaatgcgcaacataaccaatgTGGAACCGCTGAAAAAAGGATTAAacgagggcgctcattgg Probe 20)gcatgccctcgtccacgtggcatctcga 0.16 nMTWJ – Displacing P557 (SEQ ID NO:CTTActTCACAAATGGATCGGATgaaTTTCTCTTTTATCACAAGTTT aaa oligo 21)GCGCGGGGCGACAAGGCCTGAC 0.24 nMTWJ – Displacing P575 (SEQ ID NO:TCCACATTGGTTATGTTTCT CTTActTCACAAATGGATCGGATgaaTTTCTCTTTTATCACAAGTTT oligo 22)aaa GCGCGGGGCGACAAGGCCTGAC 0.24 nMTWJ – Displacing P577 (SEQ ID NO:Ttgc+gcattTCTCACAAATGGATCGGATgc+gtcgGGTTTCTCTTTTATCACAAGTTTg+c+t+c+c+gaaaa oligo 23)GCGCGGGGCGACAAGGCCTGAC 0.16 nMTWJ – extensionTTATAGTAAGAGGAAAATCCGTCGACTTTTTAAATCGTGAGGGTTCAAGTCCCTCTATCCCCAATprobe P531 (SEQ ID NO: 13) AAAAAGTTCGCTTTACCCCCAAgcgacccccgctcaggttaagatgtgcttgagcgccc 1.6 nMTWJ – extension P533 (SEQ ID NO:probe24) TGAgtCCTCACGATTTAAAAAGTCtgCGGATTTTCCTCTTACTATAAAAAACGCGCGCTAGCGCGC1.6 nM G / iSp18 / TTATAGTAAGAGGAAAATCCGTCGACTTTTTAAATCGTGAGGGTTCAAGTCCCTCTATCC
[0006] CCAATAAAAAGTTCGCTTTACCCCCAAgcgacccccgctcaggttaagatgtgcttgagcgcccTWJ – Target – P294- neTarget (SEQtagagaagggaaaaatgagaatagcaccaagagagtccgaaaaagacagtaagaccaagccgccggacgccacaatagtggtaga / 1.00E+09 negative control ID NO: 25) 3PHOS / copies / reactionTWJ – Target P430_3PHOS (SEQ1.00E+07 (BVDV)ID NO: 26) tcgagatgccacgtggacgagggcatgcccaaagcacatcttaacctgagcgggggtcgc / 3PHOS / copies / reaction AAACTTGTGATAAAAGAGAAACCcATCCGATCCATTTGTGAGAaatgagaaacataaccaatgTGGAACCTWJ – Target –GCTGAAAAAAGGATTAAgaggacgaGGGCGCTCAAGCACATCTTAACCTGAGCGGGGGTCGCTTG positive control – gs155 (SEQ ID NO: GGGGTAAAGCGAACTTTTTATTGGGGATAGAGGGACTTGAACCCTCACGATTTAAAAAGTCGAC 1.00E+09 double stranded 27) GGATTTTCCTCTTACTATAA copies / reaction Amplificationprimers – OC3 –F3 P511 (SEQ ID NO: 14) ttatagtaagaggaaaatccgtc 0.2 µMAmplificationprimers – OC3 –B3 P512 (SEQ ID NO: 15) aaacttgtgataaaagagaaacc 0.2 µMAmplificationprimers – OC3 –FIP P513 (SEQ ID NO: 16) tgggggtaaagcgaactttttatgactttttaaatcgtgagggt 1.6 µMAmplificationprimers – OC3 –BIP P514 (SEQ ID NO: 17) taatccttttttcagcggttccaatccgatccatttgtgaga 1.6 µM
[0007] Results are shown in Fig 5. It can be seen that no products were detected for the no three-way junction negative control (-ve) while a signal was detected for the positive control (+ve),as expected. All of the tested concepts (A-H) generated a positive signal (square on graph for each tested condition), indicating that three-way junctions were formed and able to initiate LAMP to generate detectable amplification products.Smaller error bars around the positive and negative signal depicted in Fig 5 indicate reducedstochasticity, for instance due to the formation of fewer undesired amplification products i.e. increased specificity. In reaction A, using TWJ with primer binding site but no extra components to aid displacement of synthesised strand and at a low target load (1e07), the negative signal (indicating the presence of unwanted products, such as primer dimers, plotted as triangle) was detected soon after the positive signal. This indicates that the low target load was close to the limit ofdetection. While the conversion from the TWJ to LAMP does occur, the conversion rate islower when the target load is low and there are no additional mechanisms in place to assist with strand displacement. For all other reactions (B-H), the positive and negative signals were clearly distinct, suggestingthat all concepts tested could reliably be used to detect the target sequence. The largest timeinterval between the positive and negative signals was seen for reaction F, utilising a separate displacing oligonucleotide complementary to the template probe and containing BNA nucleotides to stabilise the interaction between the template probe and the displacing oligonucleotide, to aid displacement of the signal oligonucleotide. The presence of BNAmodifications appear to make the binding of the displacing oligonucleotide to the templateprobe more energetically favourable, increasing the rate of signal oligonucleotide release afterthe extension probe has been extended. Reaction F also shows the lowest variation, suggesting that the use of a displacing oligonucleotide containing modified nucleic acids also decreases the formation of undesired amplification products. In summary, this example demonstrates that three-way junctions can reliably be used to initiate LAMP and generate amplification products, and that multiple factors can be altered to improve specificity.Example 5 –A three-way junction probe system using a displacing oligonucleotide can reliablyinitiate LAMP from an E. coli target sequenceThe aim of this experiment was to demonstrate that three-way junction probe systems can beused to initiate LAMP for detecting sequences from pathogens such as E. coli.The reactions were run using the two-pot protocol as described in Example 2. The targetsequence was the E. coli nucleotide sequence was P650POS as shown in SEQ ID NO: 1. Theextension probe was P652 (SEQ ID NO: 2), the template probe was P651 (SEQ ID NO: 3),having an 18-atom hexa-ethyleneglycol linker, the displacing oligonucleotide was P660 (SEQID NO: 4) and the LAMP primers were P598 (SEQ ID NO: 5), P599 (SEQ ID NO: 6), P729 (SEQ ID NO: 7) and P601 (SEQ ID NO: 8). The predicted secondary structures of the extension and template probes is shown in Fig.6A and 6B. The template (first) probe was designed to have secondary structure between its core region and binding region, as well as a free portion of binding region to allow initiation of interaction with the E. coli target sequence. The extension (second) probe was designed to have secondary structure between the core region and target region, and a long portion oftarget region free for initiation of binding with the E. coli target sequence. The secondarystructures of the probes were designed using an objective function which simulated the nucleic acid structural ensemble then tested the probability of the priming nucleotides of the second probe, priming the template probe (for robustness this prediction was repeated using variedtemperature and salt concentrations to optimise for designs which are robust to variation inthe operating environment). This objective function was then optimized using a machine learning approach, starting with a pool of candidate Three way junctions spread across the latent space. This was followed by gradient ascent using an evolutionary machine learning algorithm. The mutator function of the evolutionary algorithm was designed with anunderstanding of the structures that would be favourable. For designing further nucleic acidprobe systems this process would be repeated three times and the best three candidates tested in vitro to identify the probe designs with the highest sensitivity and specificity.Fig. 6 shows the predicted pairing probability for interactions between the probes, target anddisplacing oligonucleotide. A schematic of the three-way junction formed when the two probesinteract with the target sequence is shown in Fig.7.The LAMP reaction results are shown in Fig.8. The positive control is a dsDNA sequence which mimics a signal oligonucleotide, and demonstrates that the LAMP reaction is working. The results show that the LAMP reaction was successful when using the specially designed three-way junction probes to detect an E. coli target sequence. A positive signal was detected around 40 minutes into the reaction, which was similar to when the positive control signal was detected. The time interval between the positive and negative signal was approximately 90 minutes, which shows that that the reaction could reliably detect the target sequence with a low risk of reporting a false positive result. The similarity in results (time to positive and negative signals, and the gap between the two) for the reaction using the new three-way probe system to the positive control, which had been optimised, shows that the new three-way probe system works well for target detection.Example 6 – The three-way junction probe system and LAMP can detect a target sequencein a biological sample The aim of this experiment was to assess whether the new three-way junction probe system could be used with LAMP to detect a target sequence in a biological sample.A bovine milk sample was diluted 1 / 4 or 1 / 8 in fTris-EDTA (10 mM Tris, 0.1 mM EDTA, pH7.5), and used as a sample for the three-way junction / LAMP reaction.Nucleic acids were extracted by MagMAX magnetic bead extraction using the MagMAX Viral and Pathogenic Nucleic Acid Isolation kit (ThermoFisher Scientific) according to the manufacturer’s instructions. The reactions were run using the two-pot protocol as described in Example 2. The targetsequence was the BVDV 5’UTR as shown in SEQ ID NO (30). The extension probe wasP583_Hybrid_E_Ep (SEQ ID NO: 31), the template probe was P576 (SEQ ID NO: 20), thedisplacing oligonucleotide was P577 (SEQ ID NO: 23).P583_Hybrid_E_Ep (SEQ ID NO:31) TTATAGTAAGAGGAAAATCCGTCGACTTTTTAAATCGTGAGGGTTCAAGTCCCTCTATCC CCAATAAAAAGTTCGCTTTACCCCCAAgcgacccccgctcaggttaagatgtgcttgagcgcTarget region of BVDV_5'UTR (SEQ ID NO: 30)CCCUGAGUACAGGGUAGUCGUCAGUGGUUCGACGCCUUGGAAUAAAGGUCUCGAGA UGCCACGUGGACGAGGGCAUGCCCAAAGCACAUCUUAACCUGAGCGGGGGUCGCCC AGGUAAAAGCAGUUCUAACCGACUGUUACGAAUACAGCCUGAUAGGGU The probes and secondary structures were designed as describe in Example 5. The template (first) probe has secondary structure between target binding region and core region. The secondary structure partially extended between the target binding and the spacer region to further stabilise the interaction between the binding site and the core region The extension (second) probe has secondary structure between the target binding and core region.The “OC3” primer set as shown in Table 5 (P511, P512, P513, P514) was used foramplification of the signal oligonucleotide via LAMP. The results show that the 3WJ probesystem and LAMP can successfully detect a target sequence in a biological sample (Fig 9).The positive and negative signals were far enough removed to reliably identify a true positive. This demonstrates that the 3WJ probe system could be used with LAMP to detect a range of targets in biological samples, making it a promising method for use in diagnostics.Example 7 – LAMP can be successfully performed using only two optimised primersThe aim of this experiment was to test whether LAMP could perform efficiently when using reduced numbers of primers. Reducing the number of primers utilised in the reaction was intended to reduce the formation of unwanted products such as primer dimers and off-target amplification products which can result in false positives and / or earlier negative signals in LAMP reactions. The reaction used the “two-pot protocol” as described in Example 2. The three-way junction system used P651 template probe (SEQ ID NO: 3) and P660 displacing oligonucleotide (SEQID NO: 4) targeting an E. coli RNA operon P650. A synthetic ssDNA construct P650POS(tcccctaggggacgccacttgctggtttgtgagtgaaagtcacctgccttaatatctcaaaactcatcttcgggtaaaaaaaaaSEQ ID NO: 1) was used in place of the E.coli RNA transcript for convenience in theseexperiments. The extension probe differed between the four primer and two primer reactions, because the extension probes were designed with the required sequences in the head region to allow the specially designed primers to prime synthesis. The four primer system used the P652 extension probe (SEQ ID NO: 2) and the two primer system used the P653 extensionprobe (SEQ ID NO 9).The four primer amplification system (OC14) used the following primers: P598 (SEQ ID NO:5) as the F3 primer, P599 (SEQ ID NO: 6) as the B3 primer, P600 (SEQ ID NO: 10) and P601(SEQ ID NO: 8) as the BIP primer.The two primer amplification system (OC23) used the following primers: P598 (SEQ ID NO:5) as the F3 primer and P600 (SEQ ID NO: 10) as the FIP primer. ResultsThe results (Fig.10) show that LAMP can work efficiently with only two optimised primers.While the positive signal was detected earlier in the four primer reaction (approximately 35minutes versus 75 minutes for the two primer reaction), as expected the use of two primers reduced the generation of off-target amplification products. This can be seen in the reducedsize of the error bars around the negative time point in Figure 8 for the two primer experimentcompared to the four primer experiment. Therefore, this experiment demonstrates that LAMP successfully detect a target sequence even when the number of primers is significantly reduced. Reducing the number of primersutilised can decrease off target amplification, increasing the specificity of a reaction. Numbered Embodiments 1. A nucleic acid probe system comprising a pair of nucleic acid probes capable of creating a three-way junction when in the presence of a target nucleic acid sequence, wherein the pair of nucleic acid probes comprises a first probe and a second probe, wherein the first probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non- complementary to the target nucleic acid sequence but comprising a sequence substantially complementary to the second probe and so capable of hybridising thereto, and a signal region which is the complement of at least part of a signal oligonucleotide; and wherein the second probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, and a core region non-complementary to the target nucleic acid sequence but comprising a sequence substantiallycomplementary to the first probe and so capable of hybridising thereto; wherein the first probe and / or the second probe comprises a secondary structure, wherein the secondary structure is disrupted upon creation of the three-way junction upon hybridisation of the first probe and the second probe with the target nucleic acid sequence and the core regions of each other. 2. The nucleic acid probe system according to paragraph 1, wherein the first probe further comprises: (i) a hinge region, wherein the hinge region is non-complementary to the target nucleic acid sequence and the second probe, optionally wherein the hinge region is between the binding region and the core region; and / or (ii) a spacer region, wherein the spacer region is non-complementary to the target nucleic acid sequence and the second probe, optionally wherein the spacer region is between the core region and the signal region. 3. The nucleic acid probe system according to any preceding paragraph, wherein the first probe further comprises a handle region, optionally wherein the handle region includes a nucleic acid sequence complementary to a displacing nucleic acid. 4. The nucleic acid probe system according to any preceding paragraph, wherein the first probe comprises a modification capable of disrupting polymerase activity.5. The nucleic acid probe system according to paragraph 4, wherein the modification isbetween the signal region and the handle region.6. The nucleic acid probe system according to paragraph 4 or paragraph 5, wherein themodification is a multi-carbon linker or an abasic site. 7. The nucleic acid probe system according to any preceding paragraph, wherein the first probe comprises in the 3’ to 5’ direction: (i) the binding region; (ii) optionally a hinge region; (iii) the core region; (iv) optionally a spacer region; (iv) the signal region; (v) optionally a modification capable of disrupting polymerase activity; and (vi) optionally a handle region. 8. The nucleic acid probe system according to any preceding paragraph, wherein the first probe further comprises a landing pad region within the signal region, further optionally wherein the landing pad region comprises one or more AT rich sequences. 10. The nucleic acid probe system according to any preceding paragraph, wherein the second probe further comprises a hinge region, wherein the hinge region is non-complementary to the target nucleic acid sequence and the first probe.11. The nucleic acid probe system according to paragraph 10, wherein the hinge region isbetween the binding region and the core region. 12. The nucleic acid probe system according to any preceding paragraph, wherein the second probe further comprises a head region, wherein the head region is non-complementary to the target nucleic acid sequence and the first probe13. The nucleic acid probe system according to paragraph 12, wherein the head region isadjacent to the binding region, optionally wherein the head region is 5’ of the binding region.14. The nucleic acid probe system according to any one of paragraphs 12 or 13, wherein thehead region comprises a modification capable of disrupting polymerase activity.15. The nucleic acid probe system according to paragraph 14, wherein the modification is amulti-carbon linker or an abasic site. 16. The nucleic acid probe system according to any preceding paragraph, wherein the second probe comprises in the 5’ to 3’ direction: (i) optionally a head region; (ii) the binding region; (iii) optionally a hinge region; and (iiii) the core region. ^Binding of LAMP primers17. The nucleic acid probe system according to any preceding paragraph, wherein the second probe can act as a template for synthesis of a nucleic acid strand, wherein the synthesised nucleic acid strand comprises one or more nucleic acid sequences which are complementary to at least a portion of one or more primers, such that the one or more primers are able to prime synthesis of one or more amplification products. 18. The nucleic acid probe system according to any preceding paragraph, wherein the secondary structure involves at least a portion of the core region. 19. The nucleic acid probe system according to any preceding paragraph, wherein the secondary structure is formed between two or more regions of the first probe. 20. The nucleic acid probe system according to any preceding paragraph, wherein the secondary structure is formed between the core region and the spacer region of the first probe. 21. The nucleic acid probe system according to any preceding paragraph, wherein the secondary structure is between the core region and the signal region of the first probe. 22. The nucleic acid probe system according to any preceding paragraph, wherein the secondary structure is formed between two or more regions of the second probe. 23. The nucleic acid probe system according to any preceding paragraph, wherein the secondary structure spans between the hinge region and core region of the second probe. 24. The nucleic acid probe system according to any preceding paragraph, wherein thesecondary structure is a hairpin, a stem-loop or a G-quadruplex.25. The nucleic acid probe system according to any preceding paragraph, wherein the first probe is capable of acting as a template for extension of the second probe following formation of the three-way junction, wherein extension of the second probe generates a signal oligonucleotide which is complimentary to the signal region of the first probe optionally wherein the signal oligonucleotide comprises one or more sequences which are complementary to at least a portion of one or more primers such that the one or more primers are able to prime the synthesis of one or more amplification products.. 26. The nucleic acid probe system according to any preceding paragraph, wherein the signal region of the first probe can act as a template for synthesis of the signal oligonucleotide, optionally wherein the signal oligonucleotide comprises one or more sequences which are complementary to at least a portion of one or more primers such that the one or more primers are able to prime the synthesis of one or more amplification products. ^Independent embodiments to 3WJ probes suitable for LAMP (minus the secondarystructure) 27. A nucleic acid probe system for use in LAMP comprising a pair of probes capable of creating a three-way junction when in the presence of a target nucleic acid sequence, wherein the pair of probes comprises a first probe and a second probe, wherein the first probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non- complementary to the target nucleic acid sequence but comprising a sequence substantially complementary to the second probe and so capable of hybridising thereto, and a signal region which is the complement of at least part of a signal oligonucleotide; and wherein the second probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non-complementary to the target nucleic acid sequence but comprising a sequence substantiallycomplementary to the first probe and so capable of hybridising thereto, and a head region wherein the head region is non-complementary to the target nucleic acid sequence and the first probe; wherein the first probe, the second probe, the signal oligonucleotide and / or a synthesised strand complementary to the head region of the second probe comprise sequences complementary to at least a portion of one or more primers, wherein the primers are LAMP primers.28. The nucleic acid probe system according to paragraph 27, wherein the portion of the oneor more primers is complementary to at least a portion of the signal oligonucleotide and / or wherein the portion of the one or more primers is complementary to a synthesised strand which is complementary to the head region of the second probe. ^Multiplexing29. The nucleic acid probe system according to any preceding paragraph, wherein the system is for detecting multiple target sequences. 30. The nucleic acid probe system according to any preceding paragraph, wherein the system comprises a plurality of pairs of first and second probes.31. The nucleic acid probe system according to paragraph 30, wherein each pair of probesbinds to a different target nucleic acid sequence.32. The nucleic acid probe system according to paragraphs 30 or 31, wherein each pair ofprobes generates the same signal oligonucleotide following formation of a three way junction between the first and second probes and the target nucleic acid sequences.33. The nucleic acid probe system according to paragraphs 30 or 31, wherein each pair ofprobes generates a different signal oligonucleotide following formation of a three way junction between the first and second probes and the target nucleic acid sequences.34. The nucleic acid probe system according to paragraph 33, wherein the different signaloligonucleotides or amplification products generated from said signal oligonucleotides comprise a sequence complementary to one or more primers, optionally wherein sequence complementary to one or more primers is the same in each of the different signal oligonucleotides or amplification products. 35. One or more displacing nucleic acid sequences comprising a sequence capable of hybridizing to a sequence in the first probe and / or the second probe according to anypreceding paragraph and displacing a nucleic acid sequence bound thereto.36. The one or more displacing nucleic acid sequences according to paragraph 35, wherein afirst displacing nucleic acid sequence comprises a sequence capable of hybridizing to the first probe and displacing a nucleic acid sequence bound thereto, optionally wherein the first displacing nucleic acid sequence displaces the signal oligonucleotide.37. The first displacing nucleic acid sequence according to paragraph 36, wherein the firstdisplacing nucleic acid sequence comprises a sequence capable of hybridizing to a sequence within the signal region and / or the handle region of the first probe.38. The first displacing nucleic acid sequence according to any one of paragraphs 36 to 37,wherein the first displacing nucleic acid sequence is part of the first probe, optionally located at the 5’ end of the first probe. 39. The one or more displacing nucleic acid sequences according to any one of paragraphs35 to 38, wherein a second displacing nucleic acid sequence comprises a sequence capableof hybridizing to the second probe and displacing a nucleic acid sequence bound thereto.40. The one or more displacing nucleic acid sequences according to paragraph 39, whereinthe second displacing nucleic acid sequence comprises a sequence capable of hybridizing to a sequence within the head region of the second probe.41. The second displacing nucleic acid sequence according to any one of paragraphs 39 or40, wherein the second displacing nucleic acid sequence is part of the second probe, optionally located at the 5’ end of the second probe. 42. The one or more displacing nucleic acid sequences according to any one of paragraphs35 to 41, wherein the one or more displacing nucleic acid sequences comprise one or moremodifications to increase the stability of the interaction between the one or more displacing nucleic acid sequences and the sequence in the first probe and / or the second probe which the one or more displacing nucleic acid sequences are capable of hybridizing to.43. The one or more displacing nucleic acid sequences according to paragraph 41, whereinthe one or more modifications is a bridged nucleic acid or locked nucleic acid. Signal oligonucleotide 44. A signal oligonucleotide comprising a sequence complementary to the signal region of thefirst probe according the any one of paragraphs 1 to 34.45. The signal oligonucleotide according to paragraph 44, wherein the signal oligonucleotideis capable of self-annealing and / or self-priming. 46. An amplification product comprising at least a portion of the signal oligonucleotideaccording to paragraph 44 and / or comprising a sequence complementary to at least a portionof the signal oligonucleotide according to paragraph 44.Method of performing LAMP 47. A method of performing loop-mediated isothermal amplification (LAMP) of a target nucleic acid sequence, the method comprising: (a) contacting the target nucleic acid sequence with a nucleic acid probe systemso as to form a three-way junction; (b) generating a signal oligonucleotide from the three-way junction;(c) generating LAMP amplification products that comprise at least a portion of thesignal oligonucleotide and / or comprise a sequence complementary to at least a portion of the signal oligonucleotide; (d) optionally detecting the amplification products generated in step (c).48. The method according to paragraph 47, wherein the nucleic acid probe system is a nucleicacid probe system according to any one of paragraphs 1 to 34.49. The method according to paragraphs 47 or 48, wherein the LAMP amplification product isgenerated via extension of one or more primers capable of hybridising to the signal oligonucleotide and / or to a synthesised strand comprising a region complementary to the signal oligonucleotide, optionally one primer, two primers, three primers, or four primers.50. The method according paragraphs 47 or 48, wherein the LAMP amplification product isgenerated by self-primed extension of the signal oligonucleotide followed by extension of one or more primers capable of hybridising to the signal oligonucleotide and / or to a synthesised strand comprising a region complementary to the signal oligonucleotide.51. The method according to paragraphs 49 or 50, wherein the one or more primers have thesame sequence or different sequences.52. The method according to any one of paragraphs 47 to 51, wherein the LAMP amplificationproduct is generated by: (i) incubating the signal oligonucleotide with one or more primers in the presence of a DNA polymerase that catalyses a complementary strand synthesis reaction accompanying strand displacement, under a condition that ensures the synthesis of the complementary strand using the one or more primers as an origin, such that the region of the signal oligonucleotide to be annealed by a primer capable of amplifying the template nucleic acid at a constant temperature is placed in a condition that allows the region to undergo base pairing; (ii) annealing one or more primers that can amplify the signal oligonucleotide at a constant temperature, to the region obtained in step (i), which is placed in a condition suchthat it can undergo base pairing; and(iii) carrying out the complementary strand synthesis using the one or more primers as a synthesis of origin. 53. A method of amplifying a target nucleic acid sequence, the method comprising: (a) contacting the sample with the nucleic acid probe system according to any one of paragraphs 1 to 34 so as to form a three-way junction;(b) generating a signal oligonucleotide from the three-way junction; and (c) creating multiple copies of the signal oligonucleotide and / or generating an amplification product from the signal oligonucleotide. 54. A method of detecting a target nucleic acid sequence, the method comprising: (a) contacting the target nucleic acid sequence with the nucleic acid probe system according to any one of paragraphs 1 to 34 so as to form a three-way junction;(b) generating a signal oligonucleotide from the three-way junction; (c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product comprising at least a portion of the signal oligonucleotide and / or comprising a sequence complementary to at least a portion of the signal oligonucleotide ;(d) detecting the signal oligonucleotide produced in step (b) or the signal oligonucleotide and / or amplification product generated in step (c).55. The method according to paragraph 54, wherein detection of the signal oligonucleotideand / or amplification product is indicative of the presence of the target nucleic acid sequence. 56. A method of diagnosing a disease or infection, the method comprising (a) contacting a target nucleic acid sequence with a nucleic acid probe system according to any one of paragraphs 1 to 34 so as to form a three-way junction;(b) generating a signal oligonucleotide from the three-way junction; (c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product comprising at least a portion of the signal oligonucleotide and / or comprising a sequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) or the signal oligonucleotide and / or amplification product generated in step (c).57. The method according to paragraph 56, wherein detection of the signal oligonucleotideand / or amplification product is indicative of the presence of the disease or infection.58. The method according to any one of paragraphs 47 to 57, wherein the signaloligonucleotide is generated by extension of the second probe following formation of the three- way junction, wherein the signal region of the first probe acts as a template for extension of the second probe by polymerisation.59. The method according to paragraph 58, wherein the polymerisation is carried out by aDNA polymerase.60. The method according to paragraph 59, wherein the DNA polymerase is suitable for usein isothermal reactions.61. The methods according to paragraph 58 or 59, wherein the DNA polymerase is a strand-displacement DNA polymerase.62. The method according to any one of paragraphs 47 to 61, wherein extension of the signaloligonucleotide is limited by the presence of a modification in the first probe, optionally wherein the modification is capable of disrupting polymerase activity and further optionally wherein the modification is a multicarbon linker or an abasic site.63. The method according to any one of paragraphs 47 to 62, wherein a displacing nucleicacid aids release of the signal oligonucleotide.64. The method according to paragraph 63, wherein the a displacing nucleic acid issubstantially complementary to a portion of the first probe.65. The method according to paragraph 63 or paragraph 64, wherein the first probe comprisesa displacing nucleic acid, optionally at the 5’ end of the first probe.66. The method according to any one of paragraphs 63 to 65, wherein the displacing nucleicacid comprises one or more modifications to increase the complementarity between the displacing nucleic acid and the first probe, optionally wherein the one or more modifications is a bridged nucleic acid or locked nucleic acid.67. The method according to any one of paragraphs 47 to 66, wherein the amplificationproduct is generated by extension of one or more primers capable of hybridising to the signal oligonucleotide and / or to a synthesised strand comprising a region complementary to the signal oligonucleotide.68. The method according to any one of paragraphs 47 to 66, wherein the amplificationproduct is generated by self-primed extension of the signal oligonucleotide.69. The method according to any one of paragraphs 47 to 66, wherein the detection is via ameasurable signal, optionally wherein the signal is fluorescent, colorimetric orelectrochemical.70. The method according to any one of paragraphs 47 to 52 or 54 to 69, wherein the detectionis via a reporting agent, optionally wherein the reporting agent is an intercalated dye.71. The method according to any one of paragraphs 47 to 70, wherein the target nucleic acidsequence is a sequence associated with a particular disease or infectious agent.72. The method according to paragraph 71, wherein the disease is selected from mastitis,classical swine fever, bovine viral diarrhea virus and Johne’s disease.73. The method according to paragraph 71, wherein the infectious agent is selected from abacteria, a virus or a eukaryote. Any additional features of the probes 74. One or more primers comprising a nucleic acid sequence substantially complementary to a signal oligonucleotide and / or amplification product, wherein the signal oligonucleotide is complementary to a first probe; and / or wherein the amplification product comprises at least a portion of the signal oligonucleotide and / or a sequence complementary to at least a portion of the signal oligonucleotide.75. The one or more primers according to paragraph 74, wherein the first probe is a first probeof the nucleic acid probe system according to any one of paragraphs 1 to 34.76. The one or more primers according to paragraph 75, wherein the amplification product isa LAMP amplification product.77. The one or more primers according to any one of paragraphs 74 to 76, wherein the one ormore primers is one primer, two primers, three primers, or four primers, optionally wherein the primers have the same sequence or different sequences.78. The one or more primers according to any one of paragraphs 74 to 77, wherein the one ormore primers comprise a nucleotide sequence complementary to a synthesised strand that is complementary to a portion of the first and / or second probe according to any one ofparagraphs 1 to 34.79. The one or more primers according to any one of paragraphs 74 to 78, wherein the one ormore primers comprise a nucleotide sequence complementary to the signal oligonucleotideaccording to paragraphs 1 to 34 or 44 to 45.80. The one or more primers according to any one of paragraphs 74 to 79, wherein the one ormore primers comprise a nucleotide sequence complementary to a synthesised strand that is complementary to one or more portions of the head region of the second probe according toparagraphs 1 to 34.81. The one or more primers according to any one of paragraphs 74 to 80, wherein the one ormore primers are F3, FIP, B3 and / or BIP primers.82. The one or more primers according to any one of paragraphs 74 to 81, wherein the one ormore primers are FIP primers.83. The one or more primers according to any one of paragraphs 74 to 82, wherein the one ormore primers are F3 and FIP primers. 84. A kit for use in detecting the presence of a target nucleic acid sequence in a sample, wherein the kit comprises the nucleic acid probe system according to any one of claims 1 to34, the displacing oligonucleotide according to any one of paragraphs 35 to 43, and / or theone or more primers according to any one of paragraphs 74 to 83, and / or wherein the kit isfor performing the method of any one of paragraphs 47 to 57.85. A substrate comprising reagents attached thereto, wherein the reagents comprise the nucleic acid probe system according to any one of paragraphs 1 to 34, the displacingoligonucleotide according to any one of paragraphs 35 to 43, and / or the one or more primersaccording to any one of paragraphs 74 to 83, and / or the reagents comprise the reagentsnecessary for performing the method of any one of paragraphs 47 to 57.
Claims
Claims 1. A nucleic acid probe system comprising a pair of nucleic acid probes capable of creating a three-way junction when in the presence of a target nucleic acid sequence, wherein the pair of nucleic acid probes comprises a first nucleic acid probe and a second nucleic acid probe, wherein the first nucleic acid probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non- complementary to the target nucleic acid sequence but comprising a sequence substantially complementary to the second nucleic acid probe and so capable of hybridising thereto, and a signal region which is the complement of at least part of a signal oligonucleotide; and wherein the second nucleic acid probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, anda core region non-complementary to the target nucleic acid sequence but comprising asequence substantially complementary to the first nucleic acid probe and so capable of hybridising thereto; wherein the first nucleic acid probe and / or the second nucleic acid probe comprises a secondary structure, wherein the secondary structure is disrupted upon creation of the three- way junction.
2. A nucleic acid probe system according to claim 1, wherein creation of the three-way junctionoccurs upon hybridisation of the first nucleic acid probe and the second nucleic acid probewith the target nucleic acid sequence and hybridisation of the core regions of the first andsecond nucleic acid probes with each other.
3. The nucleic acid probe system according to claim 1 or 2, wherein the first nucleic acid probefurther comprises: (i) a hinge region, wherein the hinge region is non-complementary to the target nucleic acid sequence and the second nucleic acid probe, optionally wherein the hinge region is between the binding region and the core region; and / or (ii) a spacer region, wherein the spacer region is non-complementary to the target nucleic acid sequence and the second nucleic acid probe, optionally wherein the spacer region is between the core region and the signal region;(iii) a handle region, optionally wherein the handle region includes a nucleic acid sequencecomplementary to a displacing nucleic acid; and / or a modification capable of disruptingpolymerase activity, optionally wherein the modification is between the signal region and thehandle region and / or wherein the modification is a multi-carbon linker or an abasic site.
4. The nucleic acid probe system according to any preceding claim, wherein the first nucleic acid probe comprises in the 3’ to 5’ direction: (i) the binding region; (ii) optionally a hinge region; (iii) the core region; (iv) optionally a spacer region; (iv) the signal region; (v) optionally a modification capable of disrupting polymerase activity; and (vi) optionally a handle region, optionally wherein the first probe further comprises alanding pad region within the signal region, optionally wherein the landing pad region comprises one or more AT rich sequences.
5. The nucleic acid probe system according to any preceding claim, wherein the second nucleic acid probe further comprises:(a) a hinge region, wherein the hinge region is non-complementary to the target nucleic acidsequence and the first nucleic acid probe, optionally wherein the hinge region is between thebinding region and the core region; and / or(b) a head region, wherein the head region is non-complementary to the target nucleic acidsequence and the first nucleic acid probe, optionally wherein the head region is adjacent tothe binding region, optionally wherein the head region is 5’ of the binding region and / oroptionally wherein the head region comprises a modification capable of disrupting polymerase activity, optionally wherein the modification is a multi-carbon linker or an abasic site.
6. The nucleic acid probe system according to any preceding claim, wherein the second nucleic acid probe comprises in the 5’ to 3’ direction: (i) optionally a head region; (ii) the binding region; (iii) optionally a hinge region; and (iiii) the core region.
7. The nucleic acid probe system according to any preceding claim, wherein the first nucleic acid probe is capable of acting as a template for synthesis of a nucleic acid strand, wherein the synthesised nucleic acid strand comprises one or more nucleic acid sequences which are complementary to at least a portion of one or more primers, such that the one or more primers are able to prime synthesis of one or more amplification products.
8. The nucleic acid probe system according to any preceding claim, wherein:(a) the secondary structure: involves at least a portion of the core region;(b) the secondary structure is formed between two or more regions of the first nucleic acid probe;(c) the secondary structure is formed between the core region and the spacer region of thefirst nucleic acid probe;(d) the secondary structure is between the core region and the signal region of the first nucleicacid probe;(e) the secondary structure is formed between two or more regions of the second nucleic acidprobe; and / or(f) the secondary structure spans between the hinge region and core region of the secondnucleic acid probe; optionally wherein the secondary structure is a hairpin or a stem-loop.
9. The nucleic acid probe system according to any preceding claim, wherein the first nucleic acid probe is capable of acting as a template for extension of the second nucleic acid probefollowing formation of the three-way junction, wherein extension of the second nucleic acidprobe generates a signal oligonucleotide which is complimentary to at least part of the signal region of the first nucleic acid probe, optionally wherein the signal oligonucleotide comprises one or more sequences which are complementary to at least a portion of one or more primers such that the one or more primers are able to prime the synthesis of one or more amplification products.
10. The nucleic acid probe system according to any preceding claim, wherein the signal region of the first nucleic acid probe is capable of acting as a template for synthesis of the signal oligonucleotide, optionally wherein the signal oligonucleotide comprises one or more sequences which are complementary to at least a portion of one or more primers such that the one or more primers are able to prime the synthesis of one or more amplification products.
11. A nucleic acid probe system for use in LAMP comprising a pair of nucleic acid probes capable of creating a three-way junction when in the presence of a target nucleic acidsequence, wherein the pair of nucleic acid probes comprises a first nucleic acid probe and asecond nucleic acid probe; wherein the first nucleic acid probe comprises a binding region substantially complementary to the target nucleic acid sequence and so capable of hybridising thereto, a core region non- complementary to the target nucleic acid sequence but comprising a sequence substantiallycomplementary to the second nucleic acid probe and capable of hybridising thereto, and asignal region which is the complement of at least part of a signal oligonucleotide;and wherein the second nucleic acid probe comprises a binding region substantiallycomplementary to the target nucleic acid sequence and capable of hybridising thereto, a coreregion non-complementary to the target nucleic acid sequence but comprising a sequencesubstantially complementary to the first nucleic acid probe and capable of hybridising thereto, and a head region wherein the head region is non-complementary to the target nucleic acid sequence and the first nucleic acid probe; wherein the first nucleic acid probe, the second nucleic acid probe, the signal oligonucleotide and / or a synthesised strand complementary to the head region of the second nucleic acid probe comprise sequences complementary to at least a portion of one or more primers, wherein the primers are LAMP primers, optionally wherein the portion of the one or more primers is complementary to at least a portion of the signal oligonucleotide and / or wherein the portion of the one or more primers is complementary to a synthesised strand which is complementary to the head region of the second nucleic acid probe.
12. The nucleic acid probe system according to any preceding claim, wherein the system is for detecting multiple target sequences, optionally wherein the system comprises a plurality of pairs of first and second nucleic acid probes, further optionally wherein each pair of nucleic acid probes binds to a different target nucleic acid sequence.
13. One or more displacing nucleic acid sequences comprising a sequence capable of hybridizing to a sequence in the first nucleic acid probe and / or the second nucleic acid probe according to any preceding claim and displacing a nucleic acid sequence bound thereto,optionally wherein: (a) a first displacing nucleic acid sequence comprises a sequence capableof hybridizing to the first nucleic acid probe and displacing a nucleic acid sequence bound thereto, optionally wherein the first displacing nucleic acid sequence displaces the signaloligonucleotide; and / or(b) wherein a second displacing nucleic acid sequence comprises a sequence capable of hybridizing to the second nucleic acid probe and displacing a nucleic acid sequence bound thereto, optionally wherein the second displacing nucleic acid sequence comprises a sequence capable of hybridizing to a sequence within the head region of the second nucleic acid probe, optionally wherein the one or more displacing nucleic acid sequences comprise one or more nucleic acid analogues or modifications to increase the stability of the interaction between the one or more displacing nucleic acid sequences and the sequence in the first nucleic acid probe and / or the second nucleic acid probe which the one or more displacing nucleic acid sequences are capable of hybridizing to, preferably wherein the one or more nucleic acid analogues is a bridged nucleic acid or locked nucleic acid.
14. A method of performing loop-mediated isothermal amplification (LAMP) of a target nucleic acid sequence, the method comprising: (a) contacting the target nucleic acid sequence with a nucleic acid probe system so as to form a three-way junction; (b) generating a signal oligonucleotide from the three-way junction; (c) generating LAMP amplification products that comprise at least a portion of the signal oligonucleotide and / or comprise a sequence complementary to at least a portion of the signal oligonucleotide; (d) optionally detecting the amplification products generated in step (c), (e) optionally wherein the nucleic acid probe system is a nucleic acid probe system according to any one of claims 1 to 12.
15. The method according to claim 14, wherein the LAMP amplification product is generatedvia extension of one or more primers capable of hybridising to the signal oligonucleotide and / or to a synthesised strand comprising a region complementary to the signal oligonucleotide,optionally wherein LAMP amplification product is generated via extension of one primer, twoprimers, three primers, or four primers, or optionally wherein the LAMP amplification product is generated by self-primed extension of the signal oligonucleotide followed by extension of one or more primers capable of hybridising to the signal oligonucleotide and / or to a synthesised strand comprising a region complementary to the signal oligonucleotide, optionally wherein the one or more primers have the same sequence or different sequences.
16. A method of detecting a target nucleic acid sequence, the method comprising: (a) contacting the target nucleic acid sequence with the nucleic acid probe system according to any one of claims 1 to 12 to form a three-way junction;(b) generating a signal oligonucleotide from the three-way junction;(c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product comprising at least a portion of the signal oligonucleotide and / or comprising a sequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) or the signal oligonucleotide and / or amplification product generated in step (c), optionally wherein detection of the signal oligonucleotide and / or amplification product is indicative of the presence of the target nucleic acid sequence.
17. A method of detecting a disease or infection in a subject, the method comprising(a) contacting a sample obtained from the subject with a nucleic acid probe system according to any one of claims 1-12 of the invention to form a three-way junction witha target nucleic acid sequence present in the sample; (b) generating a signal oligonucleotide from the three-way junction; (c) optionally creating multiple copies of the signal oligonucleotide and / or generating an amplification product comprising at least a portion of the signal oligonucleotide and / or comprising a sequence complementary to at least a portion of the signal oligonucleotide; (d) detecting the signal oligonucleotide produced in step (b) or the signal oligonucleotide and / or amplification product generated in step (c); and optionally (e) diagnosing the presence of a disease or infection based upon said detection, optionally wherein detection of the signal oligonucleotide and / or amplification product is indicative of the presence of the disease or infection.
18. The method according to any one of claims 14 to 17, wherein the signal oligonucleotide isgenerated by extension of the second nucleic acid probe following formation of the three-way junction, wherein the signal region of the first nucleic acid probe acts as a template for extension of the second nucleic acid probe by polymerisation, optionally wherein thepolymerisation is carried out by a DNA polymerase, preferably wherein the DNA polymeraseis suitable for use in isothermal reactions, and / or wherein the DNA polymerase is a strand-displacement DNA polymerase.
19. The method according to any one of claims 14 to 18, wherein extension of the signaloligonucleotide is limited by the presence of a modification in the first nucleic acid probe, optionally wherein the modification is capable of disrupting polymerase activity and further optionally wherein the modification is a multicarbon linker or an abasic site.
20. The method according to any one of claims 14-19, wherein a displacing nucleic acid aids release of the signal oligonucleotide, suitably wherein the displacing nucleic acid is a displacing nucleic acid according to claim 13.
21. The method according to any one of claims 14 to 20, wherein the detection is via ameasurable signal, optionally wherein the signal is fluorescent, colorimetric or electrochemicalor wherein the detection is via a reporting agent, optionally wherein the reporting agent is anintercalated dye.
22. The method according to any one of claims 14 to 21, wherein the target nucleic acidsequence is a sequence associated with a particular disease or infectious agent.
23. The method according to claim 22, wherein the disease is selected from mastitis, classicalswine fever, bovine viral diarrhoea virus and Johne’s disease or wherein the infectious agentis selected from a bacteria, a virus or a eukaryote.
24. One or more primers comprising a nucleic acid sequence substantially complementary to a signal oligonucleotide and / or amplification product, preferably a LAMP amplification product, wherein the signal oligonucleotide is complementary to a first nucleic acid probe; and / or wherein the amplification product comprises at least a portion of the signal oligonucleotideand / or a sequence complementary to at least a portion of the signal oligonucleotide, optionallywherein the first nucleic acid probe is a first nucleic acid probe of the nucleic acid probe system according to any one of claims 1 to 12.
25. The one or more primers according to claim 24, wherein the one or more primers is one primer, two primers, three primers, or four primers, optionally wherein the primers have the same sequence or different sequences, optionally wherein the one or more primers are F3, FIP, B3 and / or BIP primers.
26. A kit for use in detecting the presence of a target nucleic acid sequence in a sample, wherein the kit comprises the nucleic acid probe system according to any one of claims 1 to 12, the displacing nucleic acid sequences according to claim 13, and / or the one or moreprimers according to claim 24, and / or wherein the kit is for performing the method of any oneof claims 14 to 23.
27. A substrate comprising reagents attached thereto, wherein the reagents comprise the nucleic acid probe system according to any one of claim 1 to 12, the displacing oligonucleotideaccording to claim 13, and / or the one or more primers according to claim 24, and / or whereinthe reagents comprise the reagents necessary for performing the method of any one of claims14 to 23.
Citation Information
Patent Citations
Nucleic acids extension assay
WO1993006240A1
Means and methods for nucleic acid target detection
US20210102237A1
Modified nucleic acid probes and use thereof
US6391593B1