Use of pluripotent stem cell-derived intestinal stromal cells as multipotent differentiation intermediate

Abstract

The present invention relates to a method for preparing organ-specific mesenchymal cells from pluripotent stem cell-derived intestinal organoid stromal cells. By using cells derived from stromal cell layers adjacent to intestinal organoids for differentiation into organ-specific mesenchymal cells, the present invention can greatly increase the efficiency of differentiation into stromal cells through the regulation of retinoic acid (RA) and hedgehog (HH) signaling pathways, and can increase the expression of organ-specific markers without exhibiting undifferentiated state cell characteristics, and thus mesenchymal cells having well-simulated biological characteristics can be prepared.

Description

Use of pluripotent differentiation intermediates from pluripotent stem cell-derived intestinal stromal cells

[0001] The present invention relates to a method for producing intestinal organ-specific mesenchymal cells from intestinal stromal cells derived from pluripotent stem cells.

[0002] The mesoderm is one of the three germ layers that appear during embryonic development. It is the intermediate layer between the ectoderm and endoderm, forming a wide range of tissues, including muscle, connective tissue, bone, and cartilage. The mesenchyme derived from the mesoderm supports various tissues for proper growth and development. In particular, organ-specific mesenchymal cells are attracting attention as a major cell source for the development of artificial organs. With the advancement of decellularization technology, they have become possible for clinical applications, and are also attracting attention as an extracellular matrix (ECM) that can mimic the in vivo environment.

[0003] In particular, the development of visceral organs such as the liver, stomach, esophagus, and lungs is orchestrated by interactions between the endothelium and adjacent mesenchymal cells in the embryonic progenitor. Recently, as part of ongoing efforts to recapitulate developmental cues in vitro, methods for differentiating human pluripotent stem cells (hPSCs) into endothelium within organs have been developed. However, the generation and development of organ-specific mesenchymal cells from hPSCs has been limited.

[0004] Specifically, organ-specific mesenchymal cells produced from hPSCs have been found to have low expression of key markers identified in vivo and low differentiation rates, making them insufficient as materials for mesenchymal cell-specific disease modeling and regenerative medicine research, and thus, a new platform for studying actual mesenchymal development is needed.

[0005] Accordingly, the present inventors isolated stromal cells surrounding hPSC-derived intestinal organoids and confirmed that various intestinal organ-specific mesenchymal cells can be differentiated from these stromal cells. Furthermore, they confirmed that these mesenchymal cells can overcome the shortcomings of existing techniques by expressing key in vivo markers at higher levels compared to hPSC-derived mesenchymal cells.

[0006] The present invention provides a method for differentiating stromal cells derived from intestinal organoids into lateral plate mesoderm.

[0007] The present invention provides a method for differentiating stromal cells derived from intestinal organoids into splanchnic mesoderm.

[0008] The present invention provides a method for producing intestinal organ-specific mesenchymal cells from intestinal organoid-derived stromal cells.

[0009] The present invention is susceptible to various modifications and embodiments. Specific embodiments are illustrated and described in detail in the drawings. However, this is not intended to limit the present invention to specific embodiments, but rather to encompass all modifications, equivalents, and alternatives falling within the spirit and technical scope of the present invention.

[0010] The terminology used in this application is only used to describe specific embodiments and is not intended to limit the present invention. The singular expression includes the plural expression unless the context clearly indicates otherwise. In this application, it should be understood that the terms "comprise" or "have" indicate the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but do not exclude in advance the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0011] When amounts, concentrations, or other values ​​or parameters are given herein as a range, preferred range, or enumeration of an upper preferred value and a lower preferred value, it should be understood that this specifically discloses any range formed by any pair of any upper range limit or preferred value and any lower range limit or preferred value, regardless of whether ranges are separately disclosed.

[0012] When a range of numerical values ​​is mentioned in this specification, unless otherwise stated, it is intended that the endpoints of the range and the scope of the invention within the range are not limited to the specific values ​​mentioned in defining the range.

[0013] pluripotent stem cells

[0014] As used herein, the term "pluripotent stem cell (PSC)", also commonly known as PS cell, includes any cell that can differentiate into virtually any cell, i.e., a cell derived from any of the three germ layers (germinal epithelium), including endoderm (inner stomach lining, gastrointestinal tract, lung), mesoderm (muscle, bone, blood, urogenital), and ectoderm (epithelial tissues and nervous system). PSCs may be derived from embryonic stem cells (including embryonic germ cells) or may be the descendants of totipotent cells obtained by inducing non-pluripotent cells, such as adult somatic cells, by forcing the expression of specific genes.

[0015] The term "induced pluripotent stem cell (iPSC)" as used herein, also commonly abbreviated as iPS cell, refers to a type of pluripotent stem cell that is artificially induced from a normally non-potent cell, such as an adult somatic cell, by inducing the "forced" expression of specific genes.

[0016] As used herein, the term "embryonic stem cell (ESC)", also commonly abbreviated as ES cell, refers to a pluripotent cell derived from the inner cell mass of a blastocyst, an early-stage embryo. For the purposes of the present invention, the term "ESC" is also sometimes used broadly to include embryonic germ cells.

[0017] Basic badge

[0018] The differentiation medium used in the method of the present invention comprises a basal medium. The basal medium is any basal medium suitable for animal or human cells, subject to the limitations provided herein.

[0019] A basal medium for animal or human cell culture typically contains a number of components necessary to support the maintenance of the cultured cells. Suitable combinations of components can be readily formulated by a skilled practitioner, taking into account the following. A basal medium for use in the present invention will generally comprise a nutrient solution containing standard cell culture components, such as amino acids, vitamins, lipid supplements, mineral salts, carbon energy sources, and buffers, as described in the literature and in more detail above. In some embodiments, the culture medium is further supplemented with one or more standard cell culture components selected from, for example, amino acids, vitamins, liquid supplements, mineral salts, carbon energy sources, and buffers.

[0020] The skilled person will understand from common general knowledge the types of culture media that may be used as the basic medium among the differentiation media of the present invention. Potentially suitable cell culture media are commercially available and include, but are not limited to, Dulbecco's Modified Eagle's Medium (DMEM), Minimum Essential Medium (MEM), Knockout-DMEM (KO-DMEM), Glasgow's Minimum Essential Medium (G-MEM), Basal Eagle's Medium (BME), DMEM / Hamm's F12, Advanced DMEM / Hamm's F12, Iscove's Modified Dulbecco's Media and Minimum Essential Medium (MEM), Ham's F-10, Ham's F-12, Medium 199, and RPMI 1640 media.

[0021] For example, the base medium may be DMEM / F12 and / or RPMI 1640.

[0022] If necessary, Advanced DMEM / F12 or Advanced RPMI, which are optimized for serum-free culture and already contain insulin, are used.

[0023] Differentiation of intestinal organoids

[0024] Differentiation of intestinal organoids from pluripotent stem cells involves 1) differentiation from pluripotent stem cells into definitive endoderm (DE) cells, 2) differentiation from definitive endoderm (DE) cells into hindgut (HG), and 3) differentiation from hindgut (HG) into intestinal organoids or mature intestinal organoids.

[0025] 1) Differentiation from pluripotent stem cells into definitive endoderm (DE) cells

[0026] One or more growth factors are used in the differentiation process from pluripotent stem cells to definitive endoderm (DE) cells.

[0027] Specifically, growth factors that can affect Activin A / nodal signaling activation or Phosphatidylinositol 3-kinase (PI3K) signaling inhibition can be used.

[0028] For example, one or more growth factors used in the differentiation process may include growth factors from the TGF-β superfamily. The one or more growth factors may include the Nodal / Activin and / or BMP subgroups of the TGF-beta superfamily of growth factors.

[0029] In some aspects, the one or more growth factors are selected from the group consisting of Nodal, Activin A, Activin B, BMP4, Wnt3a, bFGF, or any combination of these growth factors. In some aspects, the pluripotent stem cells are treated with the one or more growth factors for at least 6 hours; at least 12 hours; at least 18 hours; at least 24 hours; at least 36 hours; at least 48 hours; at least 60 hours; at least 72 hours; at least 84 hours; at least 96 hours; at least 120 hours; at least 150 hours; at least 180 hours; or at least 240 hours. In some aspects, the embryonic stem cells or iPSCs are treated with the one or more growth factors at least 10 ng / ml; at least 20 ng / ml; at least 50 ng / ml; at least 75 ng / ml; at least 100 ng / ml or more; at least 120 ng / ml or more; at least 150 ng / ml; at least 200 ng / ml; Treated with one or more growth factors at a concentration of 500 ng / ml or more; 1,000 ng / ml or more; 1,200 ng / ml or more; 1,500 ng / ml or more; 2,000 ng / ml or more; 5,000 ng / ml or more; 7,000 ng / ml or more; 10,000 ng / ml or more; or 15,000 ng / ml or more. In some aspects, the concentration of the growth factor is maintained at a constant level during the treatment. The concentration of the growth factor may vary during the treatment.

[0030] That is, it may include a step of treating a pluripotent stem cell with at least one selected from the group consisting of Nodal, Activin A, Activin B, BMP4, bFGF, and Wnt3a to differentiate it into a complete endoderm cell. More specifically, it may include a step of treating an embryonic stem cell or an induced pluripotent stem cell with Activin A to differentiate it into a complete endoderm cell.

[0031] According to one embodiment of the present invention, differentiation from pluripotent stem cells into definitive endoderm (DE) cells can use Activin A. For this differentiation, for example, but not limited to, 10 ng / ml to 500 ng / ml of Activin A can be used. More specifically, 10, 20, 30, 40, 50, 60, 70 80, 90, 100, 200, 300, 400, 500 ng / ml of Activin A can be used. More specifically, but not limited to, culture can be performed for 6 hours to 120 hours, or 12 hours to 100 hours.

[0032] According to one embodiment of the present invention, the growth factor is suspended in a medium containing fetal bovine serum (FBS) at various concentrations, as needed. For example, any fetal bovine serum (FBS or FCS) suitable for growth may be included, such as 0.1, 0.2, 0.3, 0.5, 1.0, 2.0, 3.0, 4.0, or 5.0%.

[0033] If necessary, the cells can be cultured in contact with an extracellular matrix (ECM). The extracellular matrix can be applied to the present differentiation method, including all of the items described herein.

[0034] 2) Differentiation from definitive endoderm (DE) cells into hindgut (HG) cells

[0035] Definitive endoderm (DE), induced by activin, preferably activin A, can undergo differentiation steps into hindgut (HG) by FGF / Wnt signaling.

[0036] FGF and Wnt ligands can direct differentiation of DE developed from iPSCs or ESCs into hindgut.

[0037] Differentiation into the hindgut or mid-hindgut can be performed on micropatterned substrates / plates (e.g., Aggrewell, EZSPHERE) in the form of aggregates, or through three-dimensional culture (e.g., suspension) in a bioreactor. For serum-free differentiation, B-27 is added instead of fetal bovine serum (FBS or FCS), and additionally, Activin A, FGF, bFGF, BMP-4, LY294002 (PI3K inhibitor), CHIR99021 (GSK3 inhibitor), and retinoic acid can be added.

[0038] Altering the expression of any Wnt signaling protein in combination with any FGF ligand can lead to directed differentiation as described herein.

[0039] Modulators / activators of the Wnt signaling pathway include Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, and Wnt16. In some aspects, modulation of the pathway can be achieved through the use of small molecule modulators or protein modulators that activate the aforementioned pathways or proteins that activate the pathways. For example, small molecule modulators of the Wnt pathway include, but are not limited to, lithium chloride; 2-amino-4,6-disubstituted pyrimidine(hetero)arylpyrimidines; IQ1; QS11; NSC668036; DCA beta catenin; 2-amino-4-[3,4-(methylenedioxy)-benzyl-amino]-6-(3-methoxyphenyl) pyrimidine is included. Exemplary natural inhibitors of Wnt signaling include, but are not limited to, Dkk1, SFRP proteins, and FrzB. In some aspects, exogenous molecules include, but are not limited to, small molecules such as WAY-316606; SB-216763; or BIO (6-bromo indirubin-3'-oxime).

[0040] Additionally, molecules or proteins that inhibit GSK3, which activates the Wnt signaling pathway, are included.

[0041] Exemplary GSK3 inhibitors include, but are not limited to, LY2090314, BIO (6-bromoindirubin-3'-oxime), SB216763 (3-(2,4-dichlorophenyl)-4-(1-methyl-1H-indol-3-yl)-1H-pyrrole-2,5-dione), GSK-3β inhibitor VII (α,4-dibromoacetophenone), L803-mts (Myr-N-GKEAPPAPPQSpP-NH2), and CHIR99021.

[0042] Specifically, Chiron / CHIR99021, which inhibits GSK3, is included. The GSK3 inhibitor may be administered in an amount of about 0.1 uM to about 100 uM, or about 0.2 uM to about 50 uM, or about 0.3 uM to about 10 uM.

[0043] Fibroblast growth factors (FGFs) are a family of growth factors involved in angiogenesis, wound healing, and embryonic development. Those skilled in the art will appreciate that any FGF can be used in conjunction with proteins derived from the Wnt signaling pathway.

[0044] In some embodiments, the FGF signaling pathway is activated by contacting a cell with one or more molecules selected from the group consisting of FGF1, FGF2, FGF3, FGF4, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22, and FGF23.

[0045] In some aspects, the DE cells are treated with one or more modulators of a signaling pathway described herein for at least 6 hours; at least 12 hours; at least 18 hours; at least 24 hours; at least 36 hours; at least 48 hours; at least 60 hours; at least 72 hours; at least 84 hours; at least 96 hours; at least 120 hours; at least 150 hours; at least 180 hours; at least 200 hours, at least 240 hours; at least 270 hours; at least 300 hours; at least 350 hours; at least 400 hours; at least 500 hours; at least 600 hours; at least 700 hours; at least 800 hours; at least 900 hours; at least 1,000 hours; at least 1,200 hours; or at least 1,500 hours.

[0046] In some aspects, the DE cells are treated with one or more molecules of the FGF signaling pathway described herein at a concentration of greater than or equal to 10 ng / ml; greater than or equal to 20 ng / ml; greater than or equal to 50 ng / ml; greater than or equal to 75 ng / ml; greater than or equal to 100 ng / ml; greater than or equal to 120 ng / ml; greater than or equal to 150 ng / ml; greater than or equal to 200 ng / ml; greater than or equal to 500 ng / ml; greater than or equal to 1,000 ng / ml; greater than or equal to 1,200 ng / ml; greater than or equal to 1,500 ng / ml; greater than or equal to 2,000 ng / ml; greater than or equal to 5,000 ng / ml; greater than or equal to 7,000 ng / ml; greater than or equal to 10,000 ng / ml; or greater than or equal to 15,000 ng / ml.

[0047] In some respects, the concentration of signaling molecules remains constant during the processing process. In other respects, the concentration of molecules in the signaling pathway changes during the processing process.

[0048] In some aspects, the signal transduction molecules according to the present invention are suspended in DMEM medium.

[0049] In some aspects, the signal transduction molecule according to the present invention is suspended in a medium containing fetal bovine serum (FBS or FCS).

[0050] Any known molecule of the signaling pathways described herein, including any molecule of the Wnt and FGF signaling pathways, may be applied alone or in combination.

[0051] That is, it includes a step of differentiating from a complete endoderm cell to the hindgut by treating with FGF and Wnt ligand. More specifically, it includes a step of differentiating from a complete endoderm cell to the hindgut by treating with FGF and CHIR99021.

[0052] According to one embodiment of the present invention, differentiation from definitive endoderm (DE) into hindgut can be achieved using a GSK3 inhibitor and a fibroblast growth factor. More specifically, differentiation into hindgut can be achieved through three-dimensional culture using CHIR99021 and FGF4.

[0053] In such differentiation, FGF4 can be used at concentrations of, but not limited to, 100 ng / ml, 120 ng / ml, 150 ng / ml, 200 ng / ml, 500 ng / ml, 1,000 ng / ml; 1,200 ng / ml. Additionally, CHIR99021 can be used in an amount of about 0.3 uM to about 10 uM. If necessary, it is suspended in a medium containing fetal bovine serum (FBS or FCS). For example, any fetal bovine serum (FBS or FCS) suitable for growth can be included, such as 0.1, 0.2, 0.3, 0.5, 1.0, 2.0, 3.0, 4.0, 5.0%.

[0054] More specifically, it can be cultured for, but is not limited to, 24 hours or more; 36 hours or more; 48 hours or more; 60 hours or more; 72 hours or more; 84 hours or more; 96 hours or more; 120 hours or more; 150 hours or more; and 180 hours or more.

[0055] Hindgut (HG) differentiated according to the above method can be differentiated into immature or mature organoids as follows, depending on the type of differentiation factor added.

[0056] 3-1) Differentiation of intestinal organoids from hindgut (HG)

[0057] For differentiation from hindgut (HG) to intestinal organoids, a BMP inhibitor, a Wnt agonist, and a receptor tyrosine kinase ligand are essential. In addition, one or more additional components selected from Rock inhibitor, B27, N-acetylcysteine, N2, nicotinamide, gastrin, IGF-1, heregulin-1β, bFGF, A-83-01, and / or SB202190 may be included.

[0058] A BMP inhibitor is an agent that binds to a BMP molecule and forms a complex. The inhibitor may be an agent that binds to a BMP receptor and prevents the binding of a BMP ligand to the receptor, such as an antibody that binds to the receptor. The BMP inhibitor may be a protein or a small molecule and may be natural, modified, and / or partially or fully synthetic. The BMP inhibitor may be Noggin, DAN, or a DAN-like protein, including Cerberus and Gremlin (R&D systems). A preferred BMP inhibitor is Noggin. Noggin may be used at any suitable concentration. The culture medium may contain from about 10 ng / ml to about 100 ng / ml of Noggin. For example, the culture medium may contain about 10 ng / ml, 20 ng / ml, 30 ng / ml, 40 ng / ml, 50 ng / ml, or more of Noggin. Preferably, the culture medium may contain from about 10 to about 100 ng / ml of Noggin.

[0059] The Wnt agonist may preferably be R-spondin 1, R-spondin 2, R-spondin 3 or R-spondin 4. It may be included in the culture medium at a concentration of 50 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, 1 ug / ml, 1.5 ug / ml or 2 ug / ml or more. Preferably, it may include about 50 to 800 ng / ml of R-spondin 1.

[0060] The receptor tyrosine kinase ligand is a mitogenic growth factor selected from among growth factors, for example, epidermal growth factor (EGF), transforming growth factor-alpha (TGF-alpha), basic fibroblast growth factor (bFGF), brain-derived neurotrophic factor (BDNF), hepatocyte growth factor (HGF), and keratinocyte growth factor (KGF).

[0061] Preferably, EGF. EGF is a potent mitogen for various cultured ectodermal and mesodermal cells and has sufficient effects on differentiation of certain cells and some fibroblasts in cell cultures in vivo and in vitro. Preferred concentrations are 10 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 40 ng / ml, 45 ng / ml, or 50 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml or more. A more preferred concentration is 50 ng / ml or more and 300 ng / ml or less.

[0062] In addition to the essential components of the BMP inhibitor, Wnt agonist, and receptor tyrosine kinase ligand described above, the additional factors may be interpreted as including the addition of any known factor of intestinal organoids. Preferably, depending on the desired differentiation type, one or more additional components selected from Rock inhibitor, B27, N-acetylcysteine, N2, nicotinamide, gastrin, IGF-1, heregulin-1β, bFGF, A-83-01, and / or SB202190 may be included.

[0063] The Rock inhibitor is preferably selected from R-(+)-trans-4-(1-aminoethyl)-N-(4-pyridyl)cyclohexanecarboxamide dihydrochloride monohydrate (Y-27632, Sigma-Aldrich), 5-(1,4-diazepan-1-ylsulfonyl)isoquinoline (Fasudil or HA1077, Cayman Chemical), and (S)-(+)-2-methyl 1-[(4-methyl-5-isoquinolinyl)sulfonyl]-hexahydro-1H-1,4-diazepine dihydrochloride (H-1 152, Tocris Bioschience). B27, N-acetylcysteine, N2, nicotinamide, gastrin, IGF-1, heregulin-1β, bFGF, A-83-01 and / or SB202190 may be added as needed, for example, to improve the culture efficiency and lifespan of organoids, regulate cell proliferation, and help with DNA stability.

[0064] Preferably, B27 may be additionally included. More specifically, the B27 supplement is a 'B27 supplement minus vitamin A' (also referred to herein as "B27 without vitamin A" or "B27 wo VitA"; available from Invitrogen, Carlsbad, CA; www.invitrogen.com; current catalog number 12587010; and PAA Laboratories GmbH, Paasing, Austria; www.paa.com; catalog number F01-002; Brewer et al. (1993) J Neurosci Res. 35(5):567-76). In some embodiments, the B27 supplement may be replaced with a generic formulation comprising one or more of the following ingredients: biotin, cholesterol, linoleic acid, linolenic acid, progesterone, putrescine, retinyl acetate, sodium selenite, tri-iodothyronine (T3), DL-alpha tocopherol (vitamin E), albumin, insulin, and transferrin.

[0065] If necessary, the intestinal organoids can be cultured in contact with extracellular matrix (ECM) during differentiation from the Hindgut.

[0066] In some embodiments, the ECM is a three-dimensional matrix. In some embodiments, the intestine is embedded in the ECM. The culture medium of the present invention can diffuse into the three-dimensional ECM.

[0067] The ECM disclosed in Polymer Hydrogels to Guide Organotypic and Organoid Cultures (Adv Funct Mater, 2020, Valentina Magno et al.) and Engineering the Extracellular Matrix for Organoid Culture (Int J Stem Cells. 2022 Feb 28;15(1):60-69) are incorporated herein by reference.

[0068] The extracellular matrix includes, but is not limited to, fibrin, laminin, collagen, and / or alginate. Examples of extracellular matrix-producing cells include chondrocytes, which primarily produce collagen and proteoglycans; fibroblasts, which primarily produce type IV collagen, laminin, interstitial procollagen, and fibronectin; and colonic myofibroblasts, which primarily produce collagen (types I, III, and V), chondroitin sulfate proteoglycans, hyaluronic acid, fibronectin, and tenascin-C. These are “naturally occurring ECMs.” Naturally occurring ECMs may be commercially available. Examples of commercially available extracellular matrices include extracellular matrix proteins (Invitrogen) and basement membrane preparations from Angelbreth-Holm-Swarm (EHS) mouse sarcoma cells (e.g., Cultrex® basement membrane extract (Trevigen, Inc.), type I collagen (Invitrogen), Vitrogel® (TheWell Bioscience Inc.), or Matrigel® (BD Biosciences)).

[0069] 3-2) Differentiation from hindgut (HG) into mature intestinal organoids (mature hIO)

[0070] In the present invention, the term “mature” or “mature” intestinal organoid (mature hIO) is used in contrast to immature intestinal organoids, and refers to intestinal organoids that express genes necessary for digestive function, transport system, immune function, and host defense, which are present in the adult small intestine. Specifically, mature small intestines have unique characteristics, including enhanced expression of genes necessary for small intestinal stem cell marker genes, digestive function, transport system, extensive immune function, and host defense. In particular, appropriate expression and activity of transporters involved in physiological and pharmacodynamic roles are prerequisites for normal small intestinal functions, such as drug absorption, distribution, and excretion. In particular, mature intestinal organoids according to the present invention have improved efficacy in terms of engraftment. More specifically, this may be due to the high expression of vascular endothelial-related factors possessed by the stromal cell layer surrounding the intestinal epithelial cell layer constituting the mature intestinal organoids, and various secreted factors that are characteristic of stromal cells.

[0071] Furthermore, mature intestinal organoids can exhibit the characteristic development of budding structures present on the intestinal organoids. Furthermore, they exhibit higher development of goblet cells, indicating high efficiency in terms of intestinal stem cell differentiation potential.

[0072] Differentiation from hindgut into mature intestinal organoids essentially involves the use of co-culture to mimic the in vivo intestinal environment in addition to the factors mentioned above for differentiation into intestinal organoids, or treatment with cytokines secreted by T-lymphocytes in co-culture (i.e., treatment with cytokines secreted by T-lymphocytes and / or treatment with activators of STAT3 and mTOR signaling pathways).

[0073] More specifically, the cytokine secreted by the T-lymphocyte may be at least one selected from the group consisting of interleukin-2 (IL-22), interleukin-22 (IL-6), interleukin-1β (IL-1β), interleukin-11 (IL-11), epidermal growth factor (EGF), oncostatin M (OSM), and interleukin-10 (IL-10), and more specifically, may be IL-2.

[0074] Additionally, differentiation from hindgut cells into mature intestinal organoids can be achieved by treating them with STAT3 and mTOR signaling pathway activators in addition to the factors mentioned above for differentiation into intestinal organoids. For example, maturation of intestinal organoids can be achieved by treating them with coliberin.

[0075] Additionally, maturation of intestinal organoids can be achieved by treatment with NRG-1 (Neuregulin-1).

[0076] That is, one or more cytokines selected from the group consisting of IL-2, IL-22, IL-6, IL-1β, IL-11, EGF, OSM, NRG-1, and IL-10, NRG-1, and / or coliberin may be included as medium components.

[0077] In the present invention, immature intestinal organoids refer to intestinal organoids that are co-cultured to mimic the in vivo intestinal environment, or that have not been treated with cytokines secreted in T-lymphocyte co-cultures, or with STAT3 and mTOR signaling pathway activators. Preferred concentrations are 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0 ng / ml or more. More preferably, the concentration may be 0.3 to 2.0 ng / ml.

[0078] That is, it includes a step of maturing intestinal organoids by treating the hindgut with a BMP inhibitor, a Wnt agonist, a receptor tyrosine kinase ligand, and a T-lymphocyte-secreted cytokine. More specifically, Noggin as a BMP inhibitor;

[0079] At least one selected from the group consisting of R-spondin 1, R-spondin 2, R-spondin 3 and R-spondin 4 as a Wnt agonist;

[0080] Epidermal growth factor (EGF) as a receptor tyrosine kinase ligand; and

[0081] A step of maturing intestinal organoids by treating the hindgut with at least one NRG-1 and / or coliberin selected from the group consisting of IL-2, IL-22, IL-6, IL-1β, IL-11, EGF, OSM, and IL-10, which are cytokines secreted by T lymphocytes;

[0082] According to one embodiment of the present invention, differentiation of hindgut into mature intestinal organoids essentially includes Noggin, EGF and R-spondin 1, and may be cultured by adding cytokines and / or coliberin for differentiation into mature intestinal organoids. The addition of these cytokines and / or coliberin may be performed at the time of medium exchange during the culture step of intestinal organoids after culturing hindgut, within 24 hours, within 20 hours, within 16 hours, within 12 hours, within 8 hours, within 4 hours, within 2 hours, within 1 hour, or simultaneously with the addition of cytokines. The rapid addition of cytokines as described above may have greater advantages in maturation of intestinal organoids, particularly in enhancing expression of vascular endothelial factors for promoting engraftment.

[0083] Additionally, it may include one or more additional ingredients selected from the aforementioned additional Rock inhibitors, B27, N-acetylcysteine, N2, nicotinamide and gastrin.

[0084] Peripheral stromal cell layer derived from intestinal organoids

[0085] In existing technologies related to intestinal organoids, there has been insufficient research on the necessity of the surrounding environment of intestinal organoids and their interactions with stromal cells / immune cells.

[0086] In particular, in the case of adult stem cell-derived organoid technology, which is undergoing extensive research and development, the surrounding stromal cell layer is either absent or insufficiently formed in the organoid environment. Furthermore, even when utilizing pluripotent stem cells, no technology has been identified or reported that aims to control this surrounding microenvironment, particularly the surrounding stromal cell layer.

[0087] In the present invention, the surrounding stromal cell layer of the above-mentioned intestinal organoid has the characteristics of mesenchymal cells (mesoderm), and more specifically, may further include one or more cells selected from the group consisting of smooth muscle cells, fibroblasts, myofibroblasts, telocytes, and pericytes.

[0088] Immature or mature intestinal organoid-derived stromal cells and their isolation and culture

[0089] The present invention provides stromal cells isolated (or derived) from a surrounding stromal cell layer derived from immature or mature intestinal organoids and a method for isolating and / or culturing the same.

[0090] The mesenchymal stromal cell according to the present invention is a cell derived from the surrounding stromal cell layer of an early intestinal organoid differentiated from a pluripotent stem cell (PSC), and the intestinal organoid may be an immature intestinal organoid or a mature intestinal organoid, and preferably, a mature intestinal organoid.

[0091] A method for culturing cells derived from the surrounding stromal cell layer of immature or mature intestinal organoids differentiated from pluripotent stem cells (PSCs) can be performed through the following steps:

[0092] (a) dissociating immature or mature intestinal organoids into single cells or small cell clumps;

[0093] (b) seeding the isolated single cells or small cell clumps on a culture medium coated with any one selected from the group consisting of gelatin, fibrin, and collagen I; and

[0094] (c) A step of obtaining only cells that have been attached and cultured from the seeded cells.

[0095] In step (a), intestinal organoids are separated into single cells or small cell clusters using a conventional method. According to one embodiment of the present invention, immature or mature intestinal organoids are separated from the extracellular matrix, cells are obtained from the cell layer surrounding the intestinal organoids, and these are treated with trypsin-EDTA or the like to separate single cells.

[0096] In the above step (b), the separated single cell or small cell clump may be seeded on a coating medium selected from the group consisting of gelatin, fibrin, and collagen I, and then cultured.

[0097] In the step (c) above, when a single cell or a small cell mass is cultured on a coating medium selected from the group consisting of gelatin, fibrin, and collagen I, only cells exhibiting the characteristics of stromal cells are attached to the coating medium and cultured.

[0098] The intestinal organoid-derived stromal cells according to the present invention may further include one or more cells selected from the group consisting of smooth muscle cells, fibroblasts, myofibroblasts, telocytes, trophocytes, pericytes, and endothelial cells (lymphatic endothelial cells or vascular endothelial cells), and specifically, may exhibit at least one or more characteristics selected from the following:

[0099] (a) Immature intestinal organoids and mature intestinal organoid-derived stromal cells maintain expression of at least one selected from the group consisting of αSMA, VIM, and DESMIN;

[0100] (b) maintains the expression level of one or more selected from the group consisting of CD34, FOXL1, NG2, PDGFRA, CD81, DLL1, GREM1, and Gli1.

[0101] In particular, mature intestinal organoid-derived stromal cells do not exhibit fibroblast morphology and have different characteristics from mesenchymal stem cells differentiated from human mesenchymal stem cells and induced pluripotent stem cells.

[0102] Additionally, early passage intestinal organoid-derived stromal cells may exhibit the following additional characteristics:

[0103] (i) Reduced expression levels of Brachyury and NODAL compared to human pluripotent stem cells (hPSCs);

[0104] (ii) an increased expression level of at least one gene selected from the group consisting of EOMES, MIXL1, GSC and MESP1, which are expressed at the mesendoderm specification stage compared to human pluripotent stem cells (hPSCs);

[0105] (iii) Enhanced expression levels of HAND1 and / or TBX3, genes expressed at the stage of transition to lateral plate mesoderm (LPM) compared to human pluripotent stem cells (hPSCs);

[0106] (iv) enhanced expression levels of BMP responsive genes ID1 and / or ID3 compared to human pluripotent stem cells (hPSCs);

[0107] (v) enhanced expression levels of RA-responsive genes HOXA5 and / or CYP26A1 compared to human pluripotent stem cells (hPSCs); and

[0108] (vi) Enhanced expression levels of HH-responsive genes GLI1 and / or PTCH1 compared to human pluripotent stem cells (hPSCs).

[0109] These initial passages can be, for example, P0, P1, P2, P3 or P4.

[0110] Meanwhile, in the present invention, immature intestinal organoid-derived stromal cells are used in co-culture to mimic the in vivo intestinal environment, or are stromal cells derived from intestinal organoids that are not treated with cytokines secreted in T-lymphocyte co-culture, NRG-1, and / or STAT3 and mTOR signaling pathway activator coliberin. More specifically, unlike mature intestinal organoids, they refer to stromal cells derived from intestinal organoids that are not supplemented as a medium component at least one selected from the group consisting of IL-2, IL-22, IL-6, IL-1β, IL-11, EGF, OSM, and IL-10, or NRG-1, or coliberin, or are not supplemented.

[0111] Differentiation into lateral plate mesoderm

[0112] The present invention provides a method for differentiating stromal cells derived from intestinal organoids into lateral plate mesoderm.

[0113] In the present invention, “mesoderm” refers to an intermediate layer located between the ectoderm and endoderm, one of the three germ layers that appear during embryonic development, and is divided into axial, paraxial, intermediate, and lateral plate mesoderm.

[0114] In the present invention, “lateral plate mesoderm” refers to the mesoderm found in the periphery of a developing vertebrate embryo. The mesoderm is located laterally to the paraxial mesoderm, away from the axial mesoderm, and can be subdivided into the somatic mesoderm and the splanchnic mesoderm.

[0115] The above lateral plate mesoderm may be the posterior foregut lateral plate mesoderm or the anterior foregut lateral plate mesoderm.

[0116] The method for differentiating stromal cells derived from intestinal organoids of the present invention into posterior foregut lateral plate mesoderm comprises a step of culturing in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator.

[0117] The above TGFβ signaling pathway inhibitor is any substance that inhibits the function of a TGFβ receptor, for example, a protein, a peptide, or a small molecule, and may be any one selected from the group consisting of A83-01, RepSox (SJN-2511), SB-431542, SB-505124, SB-525334, SD-208, and LY-364947. The TGFβ signaling pathway inhibitor may be included in the medium at a concentration of 0.1 μM to 2 μM. For example, it can be included at a concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 μM. Preferably, 1 μM of A83-01 can be included.

[0118] The above BMP activator refers to a protein that activates the BMP pathway, and may be any one selected from the group consisting of BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP11, BMP15, IDE1, and IDE2. The BMP activator may be included in the medium at a concentration of 15 ng / ml to 45 ng / ml. For example, it may be included at a concentration of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45 ng / ml. Preferably, 30 ng / ml of BMP4 may be included.

[0119] The above Wnt signaling pathway inhibitor is a substance that antagonizes Wnt signaling by preventing ligand-receptor interaction or maturation of Wnt receptors, and may be any one selected from the group consisting of Wnt-C59, IWP-2, IWP-3, IWP-4 PNU 74654, KY-02111, PRI-724, FH-535, DIF-1, and XAV939. The Wnt signaling pathway inhibitor may be included in the medium at a concentration of 0.1 μM to 2 μM. For example, it can be included at a concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 μM. Preferably, 1 μM of Wnt-C59 can be included.

[0120] The RA (Retinoic Acid) signaling pathway activator may be any one selected from the group consisting of RA (Retinoic Acid), all-trans retinoic acid (ATRA), 9-cis-retinoic acid, CD437, EC23, BS493, TTNPB, and AM580. The RA (Retinoic Acid) signaling pathway activator may be included in the medium at a concentration of 1 μM to 3 μM. For example, the RA (Retinoic Acid) signaling pathway activator may be included at a concentration of 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3 μM. Preferably, 2 μM RA (Retinoic Acid) may be included.

[0121] According to one embodiment, intestinal organoid-derived stromal cells can be cultured in a medium containing A83-01, BMP4, Wnt-C59, and retinoic acid (RA) to differentiate into posterior foregut lateral plate mesoderm.

[0122] The method for differentiating stromal cells derived from intestinal organoids of the present invention into anterior foregut lateral plate mesoderm comprises a step of culturing in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and a hedgehog (HH) signaling pathway activator.

[0123] Descriptions of the above-described TGFβ signaling pathway inhibitors, BMP activators, Wnt signaling pathway inhibitors, and RA (Retinoic Acid) signaling pathway activators are omitted to avoid excessive complexity of the present specification.

[0124] The HH (Hedgehog) signal transduction pathway activator is a substance that activates the HH (Hedgehog) signal transduction pathway, which is an essential metabolic pathway in embryonic development, and may be any one selected from the group consisting of PMA, SHH, IHH, DHH, GSA10, and SAG. The HH (Hedgehog) signal transduction pathway activator may be included in the medium at a concentration of 0.1 μM to 2 μM. For example, it may be included at a concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2 μM. Preferably, 1 μM of PMA may be included.

[0125] According to one embodiment, intestinal organoid-derived stromal cells can be cultured in a medium containing A83-01, BMP4, Wnt-C59, retinoic acid (RA), and PMA to differentiate into anterior foregut lateral plate mesoderm.

[0126] In one embodiment, the time sufficient to differentiate lateral plate mesoderm from intestinal organoid-derived stromal cells may be 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 hours, and preferably 24 hours.

[0127] Lateral plate mesoderm differentiated from intestinal organoid-derived stromal cells according to the above differentiation method has the characteristic of showing higher expression levels of FOXF1, PDGFRA, and DLL1 compared to mesoderm cells differentiated from pluripotent stem cells.

[0128] Differentiation into splanchnic mesoderm

[0129] The present invention provides a method for differentiating stromal cells derived from intestinal organoids into splanchnic mesoderm.

[0130] In the present invention, the “splanchnic mesoderm” is formed from lateral plate mesoderm cells, develops closely with the endoderm, and plays a role in generating various types of tissues such as blood vessels, heart muscles, and connective tissue of the gastrointestinal system.

[0131] The above splanchnic mesoderm may be the posterior foregut splanchnic mesoderm or the anterior foregut splanchnic mesoderm.

[0132] The method for differentiating stromal cells derived from intestinal organoids according to the present invention into posterior foregut splanchnic mesoderm comprises the following steps:

[0133] (a) a step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm; and

[0134] (b) A step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator.

[0135] The FGF activator of the step (b) may be any one selected from the group consisting of FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22, and FGF23. The FGF activator may be included in the medium of the step (b) at a concentration of 10 ng / ml to 30 ng / ml. For example, it may be included at a concentration of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 ng / ml. Preferably, 20 ng / ml of FGF2 (bFGF) may be included.

[0136] According to one embodiment, posterior foregut lateral plate mesoderm differentiated from intestinal organoid-derived stromal cells can be cultured in a medium containing A83-01, BMP4, Wnt-C59, retinoic acid (RA), and FGF2 (bFGF) to differentiate into posterior foregut splanchnic mesoderm.

[0137] The posterior foregut splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells according to the above differentiation method has the characteristic of showing a higher expression level of RA-responsive genes, HOXA5 and CYP26A1, compared to mesoderm cells differentiated from pluripotent stem cells.

[0138] The method for differentiating intestinal organoid-derived stromal cells according to the present invention into anterior foregut splanchnic mesoderm comprises the following steps:

[0139] (a) a step of differentiating intestinal organoid-derived stromal cells into anterior foregut lateral plate mesoderm by culturing them in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and a hedgehog (HH) signaling pathway activator; and

[0140] (b) A step of differentiating the lateral plate mesoderm of step (a) into anterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a RA (Retinoic Acid) signaling pathway activator, a HH (Hedgehog) signaling pathway activator, and an FGF activator.

[0141] According to one embodiment, anterior foregut lateral plate mesoderm differentiated from intestinal organoid-derived stromal cells can be cultured in a medium containing A83-01, BMP4, Wnt-C59, RA (Retinoic Acid), FGF2 (bFGF), and PMA to differentiate into anterior foregut splanchnic mesoderm.

[0142] Anterior foregut splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells according to the above differentiation method has a characteristic of showing a higher expression level of HH-responsive genes, GLI1 and PTCH1, compared to mesoderm cells differentiated from pluripotent stem cells.

[0143] In one embodiment, the time sufficient to differentiate lateral plate mesoderm differentiated from intestinal organoid-derived stromal cells into splanchnic mesoderm may be 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 hours, preferably 48 hours.

[0144] Differentiation into visceral organ-specific mesenchyme

[0145] The present invention provides a method for producing intestinal organ-specific mesenchymal cells from intestinal organoid-derived stromal cells.

[0146] In the present invention, “mesenchyme” refers to a type of embryonic connective tissue of undifferentiated cells that produce most tissues such as skin, blood, or bone, which is derived from the mesoderm and is formed by the epithelial-mesenchymal transition (EMT) that occurs during embryonic development.

[0147] The above mesenchymal cells may be any one selected from the group consisting of septum transversum and mesothelium cells, liver-like fibroblasts, gastric-like mesoderm cells, esophageal-like mesoderm cells, and respiratory-like mesoderm cells.

[0148] The production of septum transversum and mesothelium cells according to the present invention is performed through the following steps:

[0149] (a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm;

[0150] (b) a step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator; and

[0151] (c) A step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator and a BMP activator.

[0152] According to one embodiment, posterior foregut splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells can be cultured in a medium containing RA (Retinoic Acid) and BMP4 to differentiate into septum transversum and mesothelium cells.

[0153] The production of liver-like fibroblasts according to the present invention is performed through the following steps:

[0154] (a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm;

[0155] (b) a step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator; and

[0156] (c) A step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator, a BMP activator, and a Wnt signaling pathway activator.

[0157] The Wnt signaling pathway activator of the step (c) may be any one selected from the group consisting of Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, Wnt16, BML284, IQ-1, WAY262611, CHIR99021, CHIR98014, AZD2858, BIO, AR-A014418, SB216763, and SB415286. The Wnt signaling pathway activator may be included in the medium of the step (c) at a concentration of 3 μM to 9 μM. For example, it may be included at concentrations of 3, 4, 5, 6, 7, 8, 9 μM. Preferably, 6 μM of CHIR99021 may be included.

[0158] According to one embodiment, posterior foregut splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells can be cultured in a medium containing retinoic acid (RA) and bone marrow plasma membrane 4 (BMP4) to differentiate into liver-like fibroblasts.

[0159] Liver-like fibroblasts differentiated from intestinal organoid-derived stromal cells according to the above differentiation method have a characteristic of exhibiting a higher level of MSX2 expression compared to mesenchymal cells differentiated from pluripotent stem cells.

[0160] The production of gastric-like mesoderm cells according to the present invention is performed through the following steps:

[0161] (a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm;

[0162] (b) a step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator;

[0163] (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator and a hedgehog (HH) signaling pathway activator; and

[0164] (d) A step of culturing the splanchnic mesoderm of step (c) in a medium containing a retinoic acid (RA) signaling pathway activator, a hedgehog (HH) signaling pathway activator, and a BMP inhibitor.

[0165] The BMP inhibitor of step (d) may be any one selected from the group consisting of Noggin, Dorsomorphin, DMH1, and LDN-193189. The BMP inhibitor may be included in the medium of step (d) at a concentration of 50 ng / ml to 200 ng / ml, and preferably, 50 ng / ml of Noggin may be included.

[0166] According to one embodiment, posterior foregut splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells can be differentiated into gastric-like mesoderm by (i) culturing in a medium containing retinoic acid (RA) and PMA, and then (ii) culturing in a medium containing retinoic acid (RA), PMA, and Noggin.

[0167] Gastric-like mesoderm differentiated from intestinal organoid-derived stromal cells according to the above differentiation method has the characteristic of showing higher expression levels of FOXF1, BARX1, and NKX3-2 compared to mesenchymal cells differentiated from pluripotent stem cells.

[0168]

[0169] The production of esophageal-like mesoderm cells according to the present invention is performed through the following steps:

[0170] (a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and a hedgehog (HH) signaling pathway activator to differentiate them into anterior foregut lateral plate mesoderm;

[0171] (b) a step of differentiating the lateral plate mesoderm of step (a) into anterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a RA (Retinoic Acid) signaling pathway activator, a HH (Hedgehog) signaling pathway activator, and an FGF activator;

[0172] (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator and a hedgehog (HH) signaling pathway activator; and

[0173] (d) A step of culturing the splanchnic mesoderm of step (c) in a medium containing a retinoic acid (RA) signaling pathway activator, a hedgehog (HH) signaling pathway activator, and a BMP inhibitor.

[0174] According to one embodiment, anterior foregut splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells can be differentiated into esophageal-like mesoderm by (i) culturing in a medium containing retinoic acid (RA) and PMA, and then (ii) culturing in a medium containing retinoic acid (RA), PMA, and Noggin.

[0175] Esophageal-like mesoderm differentiated from intestinal organoid-derived stromal cells according to the above differentiation method has the characteristic of showing higher expression levels of FOXF1, NKX3-2, and MSC compared to mesenchymal cells differentiated from pluripotent stem cells.

[0176] The production of respiratory-like mesoderm cells according to the present invention is performed through the following steps:

[0177] (a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and a hedgehog (HH) signaling pathway activator to differentiate them into anterior foregut lateral plate mesoderm;

[0178] (b) a step of differentiating the lateral plate mesoderm of step (a) into anterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a RA (Retinoic Acid) signaling pathway activator, a HH (Hedgehog) signaling pathway activator, and an FGF activator;

[0179] (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator, a BMP activator, and a hedgehog (HH) signaling pathway activator; and

[0180] (d) A step of culturing the splanchnic mesoderm of step (c) in a medium containing a retinoic acid (RA) signaling pathway activator, a BMP activator, a Hedgehog (HH) signaling pathway activator, and a Wnt signaling pathway activator.

[0181] According to one embodiment, anterior foregut splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells can be differentiated into respiratory-like mesoderm by (i) culturing in a medium containing RA (Retinoic Acid), PMA, and BMP4, and then (ii) culturing in a medium containing RA (Retinoic Acid), PMA, BMP4, and CHIR99021.

[0182] Respiratory-like mesoderm differentiated from intestinal organoid-derived stromal cells according to the above differentiation method has the characteristic of showing higher expression levels of SMA and TBX5 compared to mesenchymal cells differentiated from pluripotent stem cells.

[0183] According to one embodiment, the time sufficient to differentiate splanchnic mesoderm differentiated from intestinal organoid-derived stromal cells into splanchnic organ-specific mesenchymal cells may be 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 or 84 hours, preferably 72 hours.

[0184] Unless otherwise defined, all technical terms used in this invention have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of the present invention. The contents of all publications cited as references herein are incorporated herein by reference.

[0185] The visceral organ-specific mesenchymal cells of the present invention can be used to produce developed organoid models, and thus can be used for developmental studies and disease modeling.

[0186] Specifically, the foregut mesoderm differentiated from stromal cells with an improved differentiation rate using the differentiation method according to the present invention can provide a new platform for developmental research by more closely mimicking the characteristics of human foregut mesoderm compared to liver-like fibroblasts, stomach-like mesoderm, esophageal-like mesoderm, and respiratory-like mesoderm derived from pluripotent stem cells. Furthermore, the mesoderm can be used to create more complex foregut tissues for disease modeling and regenerative medicine.

[0187] Furthermore, while most protocols to date have resulted in pluripotent stem cell-derived foregut organoids composed primarily of epithelial cells with minimal mesenchymal content, the present invention provides a developed organoid model by co-culturing the intestinal organ-specific mesoderm with digestive organoids. Specifically, this co-culturing can increase the complexity of the organoids and generate in vitro tissues with enhanced organoid growth and maturation.

[0188] Organoid models produced through co-culture with organ-specific mesenchymal cells, as described above, can be used to model diseases such as fibrosis. Specifically, the interactions and pathophysiology of epithelial and mesenchymal cells in the visceral organ can be examined.

[0189] The present invention uses cells derived from the stromal cell layer surrounding an intestinal organoid for differentiation into visceral organ-specific mesenchymal cells, thereby significantly increasing the efficiency of differentiation into stromal cells through regulation of the RA (Retinoic Acid) and HH (Hedgehog) signaling pathways, and while enhancing the expression of visceral organ-specific markers, it does not exhibit the characteristics of cells in an undifferentiated state, thereby producing mesenchymal cells that well mimic biological characteristics.

[0190] Figure 1 is a diagram illustrating a technique for isolating, culturing, and freezing-thawing stromal cells from intestinal organoids derived from pluripotent stem cells for the production of organ-specific mesenchymal cells.

[0191] (a) Schematic diagram illustrating the isolation, culture, and freeze-thawing protocol of stromal cells from intestinal organoids. Differentiated human intestinal organoids (hIO) derived from pluripotent stem cells are immature or mature intestinal organoids, and in the case of mature intestinal organoids, they are matured through IL-2 treatment from P0. Stromal cells (MSCs) isolated from the pluripotent stem cell-derived human intestinal organoids (hIO (P0-P3)) can be cultured for 3-7 days, and then passaged, frozen, and thawed.

[0192] (b) Phenotypes of immature intestinal organoids (Cont-hIO), mature intestinal organoids (Mat-hIO) differentiated from pluripotent stem cells and stromal cells isolated therefrom (MSC Cont-hIO , MSC Mat-hIO ) is shown. It shows representative images of subculture from P0 to P3 after separation.

[0193] (c) Stromal cells are isolated from intestinal organoids (P0-P2) and used for differentiation. After differentiating hPSCs in a 35 mm culture dish, at least 1 x 10 cells are isolated from 200 organoids at passage 1 (P1). 7 It was shown that cells (P0) can be obtained and can be proliferated at a ratio of 1:3 during passage culture. At least 3 x 10 cells can be isolated from intestinal organoids Passage 2 (P2). 7 After obtaining cells (P0) and subculturing them, they can be used for differentiation.

[0194] Figure 2 shows immature intestinal organoid-derived stromal cells (MSCs) Cont-hIO ), mature intestinal organoid-derived stromal cells (MSCs) Mat-hIO ), mesenchymal stem cells (MSCs) differentiated from pluripotent stem cellsPSC ), and a diagram showing the genetic level characteristics of human mesenchymal stem cells (hMSCs) that are sold.

[0195] (a) MSC PSC Compared with hMSCs, intestinal organoid-derived stromal cells (MSCs) Cont-hIO , MSC Mat-hIO ) was confirmed using a bright-field (BF) microscope.

[0196] (b) A heatmap showing the significant correlation between each sample using Spearman correlation. Higher sample similarity is indicated by a red color, while lower sample similarity is indicated by a blue color.

[0197] (c) MDS plot confirmed through gene expression analysis of fold >2 or higher from RNAseq data. Intestinal organoid-derived stromal cells (MSCs) Cont-hIO , MSC Mat-hIO ) is MSC PSC , hMSC, hPSC (hiPSC, hESC) show different characteristics.

[0198] Figure 3 shows the differentiation of pluripotent stem cells (PSCs) and intestinal organoid-derived stromal cells (MSCs) before the start of differentiation. hIO ) and PSC or MSC hIO A schematic diagram illustrating a method for differentiating visceral organ-specific mesenchymal cells from

[0199] PSC is day0, MSC hIOBegins differentiation at day 1 stage, and subsequent differentiation stages are identical. (Mid-PS: Middle region of the primitive streak, LPM: Lateral plate mesoderm, CG-LPM: Cardiogenic-LPM, aFG-LPM: Anterior foregut-LPM, pFG-LPM: Posterior foregut-LPM, SpM: inner splanchnic mesoderm, CG-SpM: Cardiogenic-SpM, aFG-SpM: Anterior foregut-SpM, pFG-SpM: Posterior foregut-SpM, CM: cardiac mesoderm, STM Mesothelium: liver septum transversum / mesothelium-like (STM / mesothelium), LF: Liver-like fibroblasts, GM: Gastric-like mesoderm, EM: Esophageal-like mesoderm, RM: Respiratory-like mesoderm)

[0200] Figure 4 shows intestinal organoid-derived stromal cells (MSCs) hIO ) to confirm the expression levels and characteristics of Mid-PS and LPM-related genes in early and late passages of Early MSC. hIO (P1~P3) and Late MSC hIO (≥P6) Brachyury and NODAL, which are expressed during early PS formation, are lower than in hPSC, genes (EOMES, MIXL1, GSC, MESP1) expressed at the stage of mesendoderm specification are highly expressed, and expression of HAND1 and TBX3 genes, which are highly expressed at the stage of transition to lateral plate mesoderm (LPM), is also confirmed to be higher than in hPSC. In addition, Early MSC hIO is Late MSC hIOCompared to , expression is maintained at a high level in all genes.

[0201] Figure 5 shows intestinal organoid-derived stromal cells (MSCs) hIO ) This figure confirms the differences between early and late passages.

[0202] (a) PSC, Early MSC hIO , Late MSC hIO The expression of BMP responsive genes (ID1, ID3), RA responsive genes (HOXA5, CYP26A1), and HH responsive genes (GLI1, PTCH1) was confirmed in Early MSC. Each marker hIO It is most highly expressed in the , which means that it can respond efficiently to BMP, RA, and HH signaling.

[0203] (b) Early MSC hIO Cells differentiated from (P1~P3) and Late MSC hIO (≥P6) The phenotype of differentiated cells was confirmed using bright-field (BF) microscopy. Late MSC hIO It has a lot of fibroblast morphology before differentiation, and there is no change in phenotype after differentiation, showing that the ability to differentiate into mesoderm is low.

[0204] Figure 6 shows pluripotent stem cells (PSCs) or intestinal organoid-derived stromal cells (MSCs). hIO ) is a diagram analyzing the phenotype and gene expression level characteristics of cells differentiated from the lateral plate mesoderm (LPM).

[0205] (a) PSC or MSC hIO This figure confirms the phenotype (BF) of cardiogenic-LPM (CG-LPM), posterior foregut-LPM (pFG-LPM), and anterior foregut-LPM (aFG-LPM) differentiated from the cerebral cortex.

[0206] (b) PSC, hIO-derived MSC(MSC hIO ) and the expression of lateral mesoderm markers (FOXF1, PDGFRA, DLL1) in CG-LPM, pFG-LPM, and aFG-LPM differentiated from each cell was confirmed through qPCR. MSC hIO LPMs differentiated from PSCs retain characteristics of the lateral mesoderm at a higher level than LPMs differentiated from PSCs.

[0207] (c) PSC or MSC hIO This figure shows the expression of RA responsive genes (HOXA5, CYP26A1) and HH responsive genes (GLI1, PTCH1) in CG-LPM, pFG-LPM, and aFG-LPM differentiated from PSCs. In pFG-LPM and aFG-LPM treated with RA, HOXA5, one of the RA responsive genes, is expressed at a higher level than in LPM differentiated from PSCs, and CYP26A1 expression is confirmed to have increased, although lower, compared to PSC-derived LPMs. This figure shows that the expression of HH responsive genes (GLI1, PTCH1) is high in aFG-LPM treated with PMA.

[0208] Figure 7 shows pluripotent stem cells (PSCs) or intestinal organoid-derived stromal cells (MSCs). hIO ) to analyze the phenotypic and gene expression level characteristics of cells differentiated from the visceral mesoderm (SpM).

[0209] (a) PSC or MSC hIOThis figure confirms the phenotypes of cardiogenic-SpM (CG-SpM), posterior foregut-SpM (pFG-SpM), and anterior foregut-SpM (aFG-SpM) differentiated from the cerebellum.

[0210] (b) PSC, hIO-derived MSC(MSC hIO ) and the expression of mesoderm markers (VIM, FOXF1) in Mid PS (Primitive streak), CG-SpM, pFG-SpM, and aFG-SpM differentiated from each cell was confirmed through qPCR. MSC hIO SpM differentiated from PSCs express VIM (pan-mesodermal marker) at higher levels than SpM differentiated from PSCs.

[0211] (c) PSC, MSC hIO In order to analyze the characteristics of CG-SpM, pFG-SpM, and aFG-SpM differentiated from MSC, the expression of RA responsive genes (HOXA5, CYP26A1), HH responsive genes (GLI1, PTCH1), and BMP responsive genes (precursor maintenance, BMP signal mediation: ID1, ID3 / BMP4 signal transduction: SMAD1, SMAD4 / cardiac precursor determination: NKX2-5, ISL1) was confirmed through qPCR. hIO SpM differentiated from are sensitive to RA, expressing pFG-SpM and aFG-SpM-related markers at higher levels than SpM differentiated from PSCs. They are also highly responsive to HH, showing higher expression levels in aFG-SpM than in PSC-derived SpM, as in the LPM stage.

[0212] (d) To confirm the responsiveness to BMP4, the expression levels of BMP responsive genes (ID1, ID3, SMAD1, SMAD4, NKX2-5, ISL1) were analyzed. MSC hIO In SpM differentiated from PSCs, the expression of ID1 and ID3, which are direct targets of precursor maintenance and BMP4-SMAD signaling, is high, SMAD1 and SMAD4, known as BMP signaling transducers, are expressed at similar levels, and NKX2-5 and ISL1, known as early cardiac precursor or cardiac mesoderm markers, are expressed at lower levels compared to PSC-derived SpMs.

[0213] Figure 8 shows pluripotent stem cells (PSCs) or intestinal organoid-derived stromal cells (MSCs). hIO ) to analyze the phenotype, gene and protein expression levels of cells differentiated into visceral organ-specific mesenchyme.

[0214] (a) PSC, MSC hIO This figure confirms the phenotype of organ-specific mesenchymal cells differentiated from the liver (Liver septum transversum / mesothelium-like; STM / mesothelium, Liver-like fibroblasts; LF, Gastric-like mesoderm; GM, Esophageal-like mesoderm; EM, Respiratory-like mesoderm; RM).

[0215] (b) PSC, MSC hIO This figure shows the gene expression of each visceral organ-specific marker (WT1, MSX2, FOXF1, NKX3-2, BARX1, MSC, NKX6-1) of CM (Cardiac mesoderm), STM, LF, GM, EM, and RM differentiated from MSC using qPCR. hIOLF, GM, EM, and RM differentiated from NK cells express markers at higher levels than cells differentiated from PSCs.

[0216] (c) PSC, MSC hIO In order to analyze the characteristics of LF, GM, EM, and RM differentiated from , the expression of LF genes (PITX1, TBX5), GM, RM genes (FOXF1), and RM genes (SMA, TBX5) was confirmed through immunofluorescence staining.

[0217] Figure 9 shows pluripotent stem cells (PSCs) or intestinal organoid-derived stromal cells (MSCs). hIO ) to analyze the phenotypic, genetic, and protein level characteristics of cells differentiated from SpM into cardiac mesenchymal cells (cardiac mesoderm; CM).

[0218] (a) PSC or MSC hIO This figure confirms the gene expression of cardiac-specific markers (NKX2-5, ISL1) in SpM differentiated from PSC. SpM differentiated from PSC is MSC hIO It expresses markers at a higher level than SpM differentiated from ISL1. This figure confirms the difference in expression of ISL1 through immunofluorescence staining.

[0219] (b) PSC or MSC hIO This is a diagram confirming the phenotype of CM differentiated from .

[0220] (c) PSC or MSC hIO The gene expression of organ-specific markers (NKX2-5) of CM differentiated from MSC was confirmed through qPCR. For each marker, MSC hIO CMs differentiated from show lower expression levels than CMs differentiated from PSCs.

[0221] Figure 10 shows pluripotent stem cells (PSCs) or intestinal organoid-derived stromal cells (MSCs). hIO ) is a diagram analyzing the gene expression levels of pluripotency markers (OCT3 / 4, SOX2) in cells differentiated from the .

[0222] To aid in understanding the present invention, examples and manufacturing examples are presented. The following examples and manufacturing examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by these examples and manufacturing examples.

[0223] Experimental Example 1. Cell Culture and iPSC Production

[0224] Human pluripotent stem cells (hPSCs), including human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs), were cultured using a known method (Molecular carcinogenesis55, 387-396 (2016), Proteomics15, 2220-2229 (2015)). Non-integrated hiPSCs were reprogrammed by electroporation transfection with an Episomal iPSC reprogramming vector (Cat. No. A14703. Invitrogen, Carlsbad, CA, USA) according to a known method.

[0225] Five days after electroporation, fibroblasts were seeded at 1 x 10 in Matrigel (BD Biosciences, San Diego, CA, USA)-coated 6-well plates. 5 Cells were plated at 1 / well and cultured in E8 medium (Stem Cell Technologies, Vancouver, Canada). After 3 weeks, hiPSC colonies were selected and expanded for subculture and further characterization.

[0226] Experimental Example 2. Subculture and Maintenance of Pluripotent Stem Cells for the Production of Visceral Organ-Specific Mesenchymal Cells

[0227] When the pluripotent stem cells reached 70-90% confluence in a 6-well plate (Corning), 310 μl Matrigel (diluted in 25 ml of DMEM / F12) was added to each well for subculture, coating for 30-60 minutes. 1 ml of 1 mg / ml Dispase (Gibco, diluted in DMEM / F12) was added, and the cells were incubated for 6 minutes in a 37°C, 5% CO2 incubator (Thermo Fisher Scientific Inc., Waltham, MA, USA). The cells were detached and washed twice with DMEM / F12 to remove Dispase. The cells were placed on the coated plate with mTeSR1 (StemCell Technologies) and cultured. The mTeSR1 medium was changed daily, and subculture was performed every 4 days to maintain the cells.

[0228] Experimental Example 3. Differentiation of hPSCs into intestinal organoids (hIO) for the production of immature intestinal organoids (Cont-hIO).

[0229] Human intestinal organoids (hIOs) were prepared using a previously described method (Nature 470, 105-109 (2011)). To induce complete endoderm formation, hPSCs were plated on culture dishes coated with Matrigel or ECMatrix™-511 and treated with 100 ng / ml Activin A (R&D Systems, Minneapolis, MN, USA) for 3 days in RPMI 1640 medium containing 0%, 0.2%, and 2% purified fetal bovine serum (dFBS; Gibco, Thermo). Additionally, to differentiate into 3D hindgut spheroids, hIOs were treated with 500 ng / ml FGF4 (R&D Systems) and 3 μM CHIR99021 (Tocris) in RPMI 1640 medium containing 2% dFBS for 4–6 days. From day 4 after induction of hindgut spheroids, the spheroids were inserted into Matrigel (BD Biosciences) and cultured in hIO medium (2 mM L-glutamine, 1% Penicillin-Streptomycin, and 15 mM HEPES buffer in Advanced DMEM F12) containing 1× B27 (Invitrogen), 200–250 ng / ml R-Spondin 1 (R&D Systems), 100 ng / ml EGF (R&D Systems), and 40–50 ng / ml Noggin (R&D Systems), and then subcultured once every 10–14 days. In particular, from P1 onwards, the spheroids were cut using a McIlwain Tissue Chopper during subculture, inserted into Matrigel or Vitrogel, and cultured in hIO medium.

[0230] Experimental Example 4. Differentiation of hPSCs into intestinal organoids (hIO) for the production of mature intestinal organoids (Mat-hIO).

[0231] After hindgut differentiation, interleukin-2 (rhIL-2 (R&D Systems)) was added to the hIO medium at a concentration of 1 ng / ml (approximately 13 U / ml) to the hIO (P0) inserted into Matrigel every day. 1 ng / ml rhIL-2 was added to the hIO medium every day until hIO P2. In particular, to maintain the surrounding stromal cells, they were cut to a certain size level (500 um x 500 um) or more using a chopper, etc., and subcultured. By not randomly isolating the surrounding stromal cells, the characteristics of high-performance mature intestinal organoids can be maintained.

[0232] Experimental Example 5. Isolation and Culture of Stromal Cells Derived from Immature (Cont-hIO) or Mature Intestinal Organoids (Mat-hIO)

[0233] For stromal cell culture, 0.2% gelatin was coated on culture dishes for 1 hour. During passage culture of immature (Cont-hIO) and mature intestinal organoids (Mat-hIO) P0~P2, organoids were separated from the Matrigel dome, and stromal cells present on the Matrigel dome and the bottom were washed with ice-Advanced DMEM / F12. Afterwards, single cells were dissociated by treatment with Trypsin-EDTA (TE) for 3~5 min at 37℃, and the separated cells were washed once with hIO basal medium (Advanced DMEM / F12 medium supplemented with 1× B27 without vitamin A, 15 mM HEPES, 1% penicillin-streptomycin, and 2 mM L-glutamine). Cells harvested by centrifugation were cultured in hIO medium containing 100 ng / ml EGF on pre-gelatin-coated culture dishes. Mature intestinal organoid-derived stromal cells were treated with rhIL-2 (1 ng / ml) with the culture medium changed every two days. After 3–5 days, passage culture was performed in the same manner at a ratio of 1:3. Intestinal stromal cells can be cultured up to P10, but cells from early passages (P1–P3) were used for differentiation.

[0234] Experimental Example 6. Differentiation and culture techniques for intestinal organ-specific mesenchymal cells from pluripotent stem cells (PSCs) or intestinal organoid-derived stromal cells (MSC-hIO).

[0235] 6-1. Differentiation and culture of organ-specific mesenchymal cells from pluripotent stem cells (PSCs).

[0236] Stabilization of pluripotent stem cell-derived mesodermal cells after subculture (-1 day)

[0237] 500 ul of 1% Geltrex (Thermo) diluted in DMEM / F12 was added to a 4-well plate (Nunc) and coated by placing it in an incubator at 37°C, 5% CO2 for 30-60 minutes. Differentiated cells with a density of 70-90% in a 6-well plate were scraped and the medium was removed. Each well was washed with 2 ml of DMEM / F12, 0.6 ml of Accutase (Millipore) was added, and the cells were detached by incubation for 5 minutes under 37°C, 5% CO2 conditions. Accutase was neutralized by adding 2.4 ml of DMEM / F12 containing 1 uM Thiazovivin (Tocris), and the mixture was gently pipetted with a 1000 ul pipette, and centrifuged at 1300 g for 3 minutes. After removing the supernatant, the cells were well lysed with 1 ml of mTeSR1 medium containing 1 uM Thiazovivin. Geltrex was removed, and 500 μl of mTeSR1 medium containing 1 uM Thiazovivin was dispensed per well of a 4-well plate and cultured for approximately 24 hours at 37°C and 5% CO2.

[0238] Induction of mid-primitive streak (Mid-PS) differentiation (day 0-1)

[0239] The medium of pluripotent stem cells cultured at 30-40% confluence per well was removed and washed with DMEM / F12. Differentiation was induced by adding 30 ng / ml Activin A, 6 μM CHIR99021, 40 ng / ml BMP4 (Peprotech), 20 ng / ml bFGF (R&D Systems), and 100 nM PIK90 (Millipore) to Gut medium (Advanced DMEM / F12 medium supplemented with 1× B27, 15 mM HEPES, 1× GlutaMAX, 1% penicillin-streptomycin, and 1× N2 but no vitamin A), and then adding warmed Mid-PS medium.

[0240] 6-2. Differentiation and culture of gut organ-specific mesenchymal cells from immature or mature intestinal organoid-derived stromal cells (MSC-hIO).

[0241] Stabilization of human intestinal organoid-derived mesodermal cells after passage (-1 day)

[0242] 500 μl of 1% Geltrex diluted in DMEM / F12 was added to a 4-well plate and coated in an incubator at 37°C and 5% CO2 for 30–60 minutes. Culture dishes culturing mesoderm cells derived from human immature or mature intestinal organoids were washed with DPBS (Dulbecco's Phosphate Buffered Saline). TrypLE™-Express Enzyme (Gibco) was added and incubated for 3–5 minutes in an incubator at 37°C and 5% CO2. hIO basal media containing 1 μM Thiazovivin was added, cells were collected in a 50 ml tube, and centrifuged at 1300 g for 3 minutes. After removing the supernatant, the cells were well lysed with 1 ml of hIO basal media containing 1 uM Thiazovivin, washed with an additional 9 ml of media, and centrifuged at 1300 g for 3 minutes. Geltrex was removed, and 700 μl of hIO basal medium containing 1 uM Thiazovivin and 100 ng / ml EGF was dispensed per well of a 4-well plate. Cells were seeded at 80-90% confluency of a 4-well plate and cultured in a 37°C, 5% CO2 incubator for approximately 24 hours.

[0243] Induction of differentiation into lateral plate mesoderm (LPM) (day 1-2)

[0244] The wells were washed with 500 μl of pre-warmed DMEM / F12 medium per well, which was placed in the Mid-PS cells (40–50% density). Then, 500 μl of LPM-inducing medium, which was prepared by adding differentiation-inducing factors to gut medium and warming it, was added to each well. The cells were placed in a 37°C, 5% CO2 incubator and the medium was replaced daily.

[0245] CG-LPM: 1 μM A83-01 (Tocris), 30 ng / ml BMP4 and 1 μM Wnt-C59 (Selleckchem)

[0246] pFG-LPM: 1 μM A83-01, 30 ng / ml BMP4, 1 μM Wnt-C59, and 2 μM RA (Sigma)

[0247] aFG-LPM: 1 μM A83-01, 30 ng / ml BMP4, 1 μM Wnt-C59, 2 μM RA, and 1 μM PMA (Sigma)

[0248] Induction of differentiation into visceral mesoderm (SpM) (days 2-4)

[0249] After confirming that the cell density was 80-90%, the medium was removed. 500 μl of the SpM induction medium, which was warmed with differentiation-inducing factors added to gut medium, was added to each well.

[0250] CG-SpM: 1 μM A83-01, 30 ng / ml BMP4, 1 μM Wnt-C59 and 20 ng / ml bFGF

[0251] pFG-SpM: 1 μM A83-01, 30 ng / ml BMP4, 1 μM Wnt-C59, 20 ng / ml bFGF and 2 μM RA.

[0252] aFG-SpM: 1 μM A83-01, 30 ng / ml BMP4, 1 μM Wnt-C59, 20 ng / ml bFGF, 2 μM RA and 1 μM PMA

[0253] Induction of differentiation into visceral organ-specific mesenchymal cells (days 4-7)

[0254] After observing the cell morphology under a microscope (IX51, Olympus, Japan), the medium was removed and each well was washed with 500 μl of pre-warmed DMEM / F12 medium. Depending on the conditions for induction of gut-specific mesenchymal cells, pre-warmed Gut medium containing various factors was added to each well at 500 μl. The medium suitable for each differentiation condition was replaced every 24 hours.

[0255] CM: 1 μM XAV-939 (Selleckchem), 30 ng / ml BMP4 and 200 μg / ml Ascorbic acid (Sigma) (days 4-7)

[0256] STM: 2 μM RA and 30 ng / ml BMP4 (day 4-7)

[0257] LF: 2 μM RA, 30 ng / ml BMP4 and 6 μM CHIR (days 4-7)

[0258] GM, EM: 2 μM RA and 2 μM PMA (days 4-6) / 2 μM RA, 2 μM PMA and 50-200 ng / ml Noggin (days 6-7)

[0259] RM: 2 μM RA, 30 ng / ml BMP4 and 2 μM PMA (day 4-6) / 2 μM RA, 30 ng / ml BMP4, 2 μM PMA and 1 μM CHIR (day 6-7)

[0260] Experimental Example 7. Quantitative Real-Time RT-PCR (qRT-PCR)

[0261] Total RNA was extracted from cells using the Easy-BLUE™-Total RNA Extraction Kit (Intronbio) and reverse transcribed using the TOPscript™-RT DryMIX (dT18) cDNA Synthesis Kit (Enzynomics). qRT-PCR was performed using a PCR system (Thermo) of the QuantStudio 5 Real-Time PCR Instrument according to a published method. All experiments were repeated three times, and the CT value of each target gene was calculated using software provided by the manufacturer. The base sequences of the primers used are shown in Table 1.

[0262] <h2 style=";text-align:left;direction:ltr">Gene프라이머 (Forward)서열번호프라이머 (Reverse)서열번호GAPDHGAAGGTGAAGGTCGGAGTC1GAAGATGGTGATGGGATTTC2T (Brachyury)TATGAGCCTCGAATCCACATAGT3CCTCGTTCTGATAAGCAGTCAC4NODALCTG CTT AGA GCG GTT TCA GAT G5CGA GAG GTT GGA GTA GAG CAT AA6EOMESCAA CAT AAA CGG ACT CAA TCC CA7ACC ACC TCT ACG AAC ACA TTG T8MIXL1GGC GTC AGA GTG GGA AAT CC9GGC AGG CAG TTC ACA TCT ACC10GSCAAC GCG GAG AAG TGG AAC AAG11CTG TCC GAG TCC AAA TCG C12MESP1AGC TGC ACC CGA GCC GCG C13ATC CAG GTC TCC AAC AGA GCC A14HAND1GAG AGC ATT AAC AGC GCA TTC G15CGC AGA GTC TTG ATC TTG GAG AG16TBX3CCC GGT TCC ACA TTG TAA GAG17GTA TGC AGT CAC AGC GAT GAA T18ID1CTG CTC TAC GAC ATG AAC GG19GAA GGT CCC TGA TGT AGT CGA T20ID3GAG AGG CAC TCA GCT TAG CC21TCC TTT TGT CGT TGG AGA TGAC22HOXA5CGCCCAACCCCAGATCTAC23CGGGCCGCCTATGTTGT24CYP26A1GCTGCCTCTCTAACCTGCAC25TGCTTTAGTGCCTGCATGTC26GLI1GGGATGATCCCACATCCTCAGTC27CTGGAGCAGCCCCCCCAGT28PTCH1CCACAGAAGCGCTCCTACA29CTGTAATTTCGCCCCTTCC30FOXF1AGCAGCCGTATCTGCACCAGAA31CTCCTTTCGGTCACACATGCTG32PDGFRATTGAAGGCAGGCACATTTACA33GCGACAAGGTATAATGGCAGAA34DLL1TGTGACGAGTGTATCCGCTAT35GTGTGCAGTAGTTCAGGTCCT36VIMATTCCACTTTGCGTTCAAGG37CTTCAGAGAGAGGAAGCCGA38SMAD1CTC ATG TCA TTT ACT GCC GTG T39TAT TCG CTG TGT CTT GGA ACC40SMAD4CTC ATG TGA TCT ATG CCC GTC41AGG TGA TAC AAC TCG TTC GTAGT42NKX2-5TGGAGAAGACAGAGGCGGACAA43ATAGACCTGCGCCTGCGAGAA44ISL1AGATTATATCAGGTTGTACGGGATCA45ACACAGCGGAAACACTCGAT46WT1ATAGGCCAGGGCATGTGTATGTGT47AGTTGCCTGGCAGAACTACATCCT48MSX2CGCCAAGACATATGAGCCCT49GTTCTGCCTCCTGCAGTCTT50NKX3-2CAACACCGTCGTCCTCG51CCGCTTCCAAAGACCTAGAG52BARX1CCAGTGGGAACTTGAACACC53CTGAAGTTCGGCGTGCAG54MSCTATGAGAACGGCTACGTGCAC55AGTCCGATTTAAGCGGTGGTT56NKX6-1ATGACAGAGAGTCAGGTCAAGG57CTCCGAGTCCTGCTTCTTCTT58NKX2-5TGGAGAAGACAGAGGCGGACAA59ATAGACCTGCGCCTGCGAGAA60OCT3 / 4TGAGAGGCAACCTGGAGAATT61TTTCTTTCCCTAGCTCCTCCC62SOX2GCTTAGCCTCGTCGATGAAC63AACCCCAAGATGCACAACTC64

[0263] 실험예 8. 세포 면역형광화학검사

[0264] Immunofluorescence was performed according to a previously described method (Kwak et al., Biochemical and Biophysical Research Communications 457, 554-560, 2015). Specifically, differentiated cells were fixed with 4% paraformaldehyde (PFA) and permeabilized with 0.1% Triton X-100 in PBS. After blocking with 4% BSA, cells were reacted with primary antibodies overnight at 4°C. Subsequently, they were reacted with secondary antibodies for 1 h at room temperature. The primary antibodies used are listed in Table 2. DAPI was added to visualize nuclei. Slides were observed using an EVOS FL Auto2 (Thermo) and an Axiovert 200M microscope (Carl Zeiss, Göttingen, Germany) or a fluorescence microscope (IX51, Olympus, Japan).

[0265] Antibody Catalog No. Company Dilutionanti-α-SMAA5228Sigma1:500 for IHCanti-PITX1PA5-52600Thermo Scientific1:100 for IHCanti-TBX5sc-17865Santa Cruz1:50 for IHCanti-FOXF1BS2585RBioss1:100 for IHCanti-ISL1ab109517abcam1:200 for IHC

[0266] *IHC: Immunohistochemistry

[0267] Experimental Example 9. RNA Sequencing and RNA Quantification

[0268] First, RNA samples were prepared using the Agilent 2100 Bioanalyzer system (Agilent Biotechnologies, Palo Alto, USA) to ensure that the RNA Integrity Number (RIN) value was 7.5 or higher. mRNA libraries were prepared using the Illumina TruSeq kit, and sequenced using Illumina HiSeq2500 machines (Illumina, San Diego, CA, USA). The quality of the sequencing data was determined using the FastQC package, and reads with a trimmed length of 50 bases or less were excluded. Mapping was then performed using HISAT2 (v2.0.5), and hg19 was used as the human genome information. Finally, differentially expressed genes (DEGs) between samples were analyzed using Cuffquant and Cuffnorm (Cufflinks v2.2.1).

[0269] Experimental Example 10. Bioinformatic Analysis

[0270] Bioinformatic analysis was performed using IPA analysis software (Ingenuity systems, Redwood City, CA, USA), PANTHER (Protein Analysis Through Evolutionary Relationships, http: / www.pantherdb.org) database, and DAVID bioinformatics resource 6.7 (http: / david.abcc.ncifcrf.gov). In addition, gene ontology (GO) / pathway to identify cell types was analyzed using EnrichR (https: / maayanlab.cloud / Enrichr / ). Functionally grouped gene ontology (GO) / pathway was analyzed using the Cytoscape software platform (version 3.3.0, http: / www.cytoscape.org / what_is_cytoscape.html) with the ClueGO plug-in (Version 2.2.5, http: / apps.cytoscape.org / apps / cluego).

[0271] Experimental Example 11. Statistical Analysis

[0272] All in vitro experimental results are expressed as the mean ± standard error of the mean (SEM) and were repeated at least three times. Quantitative analysis was performed using ImageJ software. P values ​​were determined using a two-tailed Student's t-test or one-tailed ANOVA.

[0273] Example 1. Isolation and culture of stromal cells from intestinal organoids derived from pluripotent stem cells.

[0274] As described above, hIOs were prepared from hPSCs, including hESC lines or non-injection-type hiPSC lines, using the hIO differentiation protocol. Subsequently, stromal cells were isolated from mature organoids co-cultured with 1 ng / ml rhIL-2 from P0 and existing immature organoids P0 to P3, and the freezing and thawing process during passage is schematically shown in Fig. 1a. Stromal cells (P0) isolated from intestinal organoids (P0 to P2) were cultured in hIO medium containing 1× B27 and 100 ng / ml EGF. Stromal cells (P0) isolated from Cont-hIO and Mat-hIO (P2) were cultured in hIO medium containing 1× B27 and 100 ng / ml EGF and maintained until P3 for differentiation (Fig. 1b). Additionally, the number of intestinal organoids differentiated from PSCs and the minimum cell number of intestinal stromal cells isolated therefrom were calculated and indicated (Fig. 1c).

[0275] Example 2. Characterization of stromal cells derived from immature or mature intestinal organoids.

[0276] To compare and analyze the isolated stromal cells, mesenchymal stem cells differentiated from pluripotent stem cells (hESC-H9, hiPSC-CRL), human mesenchymal stem cells (hMSC) and induced pluripotent stem cells (MSC) were used. iPSC ) were used as a control group. As a result of observation through bright field microscopy, hMSC, MSC iPSC In contrast, hIO-derived MSCs (MSCs) were confirmed to not have the morphology of fibroblasts (Fig. 2a). For genome information analysis, RNA sequencing was performed, and differential genes between groups were selected through similarity between samples and DEG analysis (Fig. 2b). As a result, intestinal organoid-derived stromal cells (MSCs) were identified through MDS plot. Cont-hIO , MSC Mat-hIO ) is hPSC (hiPSC, hPSC), hMSC, MSC iPSCIt was confirmed that there was a difference (Fig. 2c). From the above results, it was confirmed that the stromal cells (MSCs) derived from hIO have different characteristics from the human mesenchymal stem cells and mesenchymal stem cells differentiated from induced pluripotent stem cells.

[0277] Example 3. Differentiation of intestinal organ-specific mesenchymal cells from pluripotent stem cells or intestinal organoid stromal cells-derived stromal cells.

[0278] Mesenchymal cells were prepared from pluripotent stem cells using a protocol for differentiation of organ-specific mesenchymal cells derived from pluripotent stem cells (PSCs) (Nat Protoc. 2022 Nov;17(11):2699-2719) (Fig. 3). In addition, hIO-derived stromal cells were differentiated using the same protocol at the Mid-PS stage, prior to RA and HH treatment.

[0279] Intestinal organoid-derived stromal cells (MSCs) hIO , P1~3, Early MSC hIO ) was confirmed to have characteristics of the PS-to-mesendoderm and lateral plate mesoderm (LPM) lineage by showing high expression of genes (EOMES, MIXL1, GSC, MESP1) expressed at the stage of mesendoderm specification and genes (HAND1, TBX3) expressed at the stage of transition to lateral plate mesoderm (LPM) unlike hPSC, but low expression of markers (Brachyury, NODAL) expressed at the stage of initial PS formation (Fig. 4).

[0280] In addition, early passage (P1~P3) intestinal stromal cells (Early MSC) hIO) also showed high expression of genes with high responsiveness to BMP / RA / HH signaling (BMP responsive genes: ID1, ID3 / RA responsive genes: HOXA5, CYP26A1 / HH responsive genes: GLI1, PTCH1) (Fig. 5a). Next, after mesenchymal cell differentiation, the cell phenotype was observed using a bright-field (BF) microscope, and the late passage (≥P6) intestinal stromal cells (Late MSC) hIO ) have little differentiation potential, whereas Early MSC hIO It was confirmed that cell phenotypic changes were clearly observed after differentiation (Fig. 5b).

[0281] After differentiation into lateral plate mesoderm (LPM), phenotypic changes and changes in markers at each stage were confirmed. Among the lateral plate mesoderm (LPM), the differentiation degree of posterior foregut lateral plate mesoderm (pFG-LPM) and anterior foregut lateral plate mesoderm (aFG-LPM) was higher than that of MSC, not PSC. hIO It was found to be higher when differentiated from MSC. This was confirmed by comparing the expression of lateral plate mesoderm markers (FOXF1, PDGFRA, DLL1) (Fig. 6a, b). In addition, MSC hIO pFG-LPM and aFG-LPM differentiated from were differentiated by RA treatment, and HOXA5, one of the RA responsive genes, was expressed at a higher level than LPM differentiated from PSCs. CYP26A1 was lower compared to PSC-derived LPMs, but its expression pattern itself was increased. In addition, aFG-LPM differentiated by PMA treatment showed significantly higher expression of HH responsive genes (GLI1, PTCH1) (Fig. 6c).

[0282] Next, compared with cells differentiated from PSCs, MSCs hIOIn cells differentiated from the embryonic stem cells, the expression of mesodermal markers (VIM, FOXF1) was generally high, confirming excellent differentiation efficiency into visceral mesoderm (SpM) (Fig. 7b). In addition, the expression of genes with high responsiveness to RA / HH signaling (RA responsive genes: HOXA5, CYP26A1 / HH responsive genes: GLI1, PTCH1) was also significantly high, confirming high differentiation efficiency into pFG-SpM and aFG-SpM (Fig. 7c).

[0283] To confirm the responsiveness to BMP signaling, we confirmed the expression of ID1 and ID3, which are direct targets of progenitor maintenance and BMP4-SMAD signaling, as well as SMAD1 and SMAD4, known as BMP signaling transducers, and NKX2-5 and ISL1, known as early cardiac progenitor or cardiac mesoderm markers. In addition, we confirmed that ID1 and ID3, which are related to BMP4-SMAD signaling, were highly expressed, and SMAD1 and SMAD4 were expressed in a similar pattern (Fig. 7d).

[0284] Finally, differentiation into each internal organ was confirmed on the 7th day of differentiation. Specifically, compared to PSC-derived mesenchymal cells, MSCs hIO We confirmed that the expression of liver (LF: MSX2), stomach (GM: FOXF1 / BARX1 / NKX3-2), esophageal (EM: FOXF1 / NKX3-2 / MSC), and respiratory (RM: FOXF1 / NKX6-1) specific genes was enhanced in derived mesenchymal cells (Fig. 8b). In addition, immunochemical staining verified the expression of markers of each visceral organ (LF: PITX1 / TBX5, GM, EM: FOXF1, RM: SMA / TBX5) at the protein level (Fig. 8c).

[0285] On the other hand, cardiac-specific genes (NKX2-5) are MSC hIOIt was confirmed that it was expressed lower in visceral mesoderm (SpM) and cardiac mesenchymal cells (CM) differentiated from PSCs (Fig. 9). Unlike PSCs and PSC-derived cells, MSCs hIO and MSC hIO Although the mesenchymal cells differentiated from the spleen do not have pluripotency (Fig. 10), it was confirmed that they have a high differentiation efficiency into internal organ-specific cells through the RA / HH signaling process.

[0286] That is, in the present invention, it is possible to produce highly efficient visceral mesoderm (SpM) from early intestinal organoid-derived stromal cells, and it was confirmed that various visceral organ-specific mesenchymal cells differentiated therefrom (Liver-like fibroblasts; LF, Gastric-like mesoderm; GM, Esophageal-like mesoderm; EM, Respiratory-like mesoderm: RM) exhibit higher bio-specific properties compared to conventional PSC-derived mesenchymal cells.

Claims

1. A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator; A method for differentiating stromal cells derived from intestinal organoids into posterior foregut lateral plate mesoderm, comprising:

2. A differentiation method according to claim 1, wherein the medium further comprises an HH (Hedgehog) signaling pathway activator.

3. A differentiation method in claim 1, wherein the TGFβ signaling pathway inhibitor is any one selected from the group consisting of A83-01, RepSox (SJN-2511), SB-431542, SB-505124, SB-525334, SD-208, and LY-364947.

4. A differentiation method in claim 1, wherein the BMP activator is any one selected from the group consisting of BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP11, BMP15, IDE1, and IDE2.

5. A differentiation method in the first paragraph, wherein the Wnt signaling pathway inhibitor is any one selected from the group consisting of Wnt-C59, IWP-2, IWP-3, IWP-4 PNU 74654, KY-02111, PRI-724, FH-535, DIF-1, and XAV939.

6. A differentiation method according to claim 1, wherein the RA (Retinoic Acid) signaling pathway activator is any one selected from the group consisting of RA (Retinoic Acid), all-trans retinoic acid (ATRA), 9-cis-retinoic acid, CD437, EC23, BS493, TTNPB, and AM580.

7. A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a RA (Retinoic Acid) signaling pathway activator, and a HH (Hedgehog) signaling pathway activator; A method for differentiating anterior foregut lateral plate mesoderm from intestinal organoid-derived stromal cells, including:

8. A differentiation method in claim 7, wherein the HH (Hedgehog) signaling pathway activator is any one selected from the group consisting of PMA, SHH, IHH, DHH, GSA10, and SAG. 9.(a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm; and (b) a step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator; A method for differentiating stromal cells derived from intestinal organoids into posterior foregut splanchnic mesoderm, comprising:

10. A differentiation method in claim 9, wherein the FGF activator of step (b) is any one selected from the group consisting of FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22 and FGF23. 11.(a) A step of differentiating intestinal organoid-derived stromal cells into anterior foregut lateral plate mesoderm by culturing them in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and a hedgehog (HH) signaling pathway activator; and (b) a step of differentiating the lateral plate mesoderm of step (a) into anterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a RA (Retinoic Acid) signaling pathway activator, a HH (Hedgehog) signaling pathway activator, and an FGF activator; A method for differentiating anterior foregut splanchnic mesoderm from intestinal organoid-derived stromal cells, including: 12.(a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm; (b) a step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator; and (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator and a BMP activator; A method for producing septum transversum and mesothelium cells, including: 13.(a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm; (b) a step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator; and (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator, a BMP activator, and a Wnt signaling pathway activator; A method for producing liver-like fibroblasts comprising:

14. A manufacturing method according to claim 13, wherein the Wnt signaling pathway activator is any one selected from the group consisting of Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, Wnt16, BML284, IQ-1, WAY262611, CHIR99021, CHIR98014, AZD2858, BIO, AR-A014418, SB216763, and SB415286.

15. A manufacturing method according to claim 13, wherein the liver-like fibroblasts are characterized in that they express MSX2. 16.(a) A step of culturing intestinal organoid-derived stromal cells in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, and a retinoic acid (RA) signaling pathway activator to differentiate them into posterior foregut lateral plate mesoderm; (b) a step of differentiating the lateral plate mesoderm of step (a) into posterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and an FGF activator; (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator and a hedgehog (HH) signaling pathway activator; and (d) a step of culturing the splanchnic mesoderm of step (c) in a medium containing a retinoic acid (RA) signaling pathway activator, a hedgehog (HH) signaling pathway activator, and a BMP inhibitor; A method for producing gastric-like mesoderm cells, comprising:

17. A manufacturing method according to claim 16, wherein the BMP inhibitor is any one selected from the group consisting of Noggin, Dorsomorphin, DMH1, and LDN-193189.

18. A manufacturing method according to claim 16, characterized in that the gastric-like mesoderm cells express at least one selected from the group consisting of FOXF1, BARX1, and NKX3-2. 19.(a) A step of differentiating intestinal organoid-derived stromal cells into anterior foregut lateral plate mesoderm by culturing them in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and a hedgehog (HH) signaling pathway activator; (b) a step of differentiating the lateral plate mesoderm of step (a) into anterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a RA (Retinoic Acid) signaling pathway activator, a HH (Hedgehog) signaling pathway activator, and an FGF activator; (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator and a hedgehog (HH) signaling pathway activator; and (d) a step of culturing the splanchnic mesoderm of step (c) in a medium containing a retinoic acid (RA) signaling pathway activator, a hedgehog (HH) signaling pathway activator, and a BMP inhibitor; A method for producing esophageal-like mesoderm cells, comprising:

20. A manufacturing method according to claim 19, characterized in that the esophageal-like mesoderm cells express at least one selected from the group consisting of FOXF1, NKX3-2, and MSC. 21.(a) A step of differentiating intestinal organoid-derived stromal cells into anterior foregut lateral plate mesoderm by culturing them in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a retinoic acid (RA) signaling pathway activator, and a hedgehog (HH) signaling pathway activator; (b) a step of differentiating the lateral plate mesoderm of step (a) into anterior foregut splanchnic mesoderm by culturing it in a medium containing a TGFβ signaling pathway inhibitor, a BMP activator, a Wnt signaling pathway inhibitor, a RA (Retinoic Acid) signaling pathway activator, a HH (Hedgehog) signaling pathway activator, and an FGF activator; (c) a step of culturing the splanchnic mesoderm of step (b) in a medium containing a retinoic acid (RA) signaling pathway activator, a BMP activator, and a hedgehog (HH) signaling pathway activator; and (d) a step of culturing the splanchnic mesoderm of step (c) in a medium containing a retinoic acid (RA) signaling pathway activator, a BMP activator, a Hedgehog (HH) signaling pathway activator, and a Wnt signaling pathway activator; A method for producing respiratory-like mesoderm cells, comprising:

22. A manufacturing method according to claim 21, characterized in that the respiratory-like mesoderm cells express at least one selected from the group consisting of SMA and TBX5.

Images