Prediction of response to immune therapy in triple negative breast cancer patients.

Abstract

The invention relates to methods for typing a sample comprising triple negative breast cancer cells or comprising gene expression products from these cells, of an individual with breast cancer. The invention further relates to methods of treating an individual with breast cancer who is typed according to the methods of the invention.

Description

[0001] Title: Prediction of response to immune therapy in triple negative breast cancer patients. FIELD: The invention relates to methods for typing of cancer, especially breast cancer. The invention is directed to a set of marker genes to predict response to cancer therapy in triple negative breast cancer patients. 1 INTRODUCTION Early detection and treatment of breast cancer can effectively reduce cancer- associated mortality and significantly improve the lives of cancer patients. The overall 5-year relative survival rate of breast cancer patients is about 85%, meaning that 85% of the diagnosed breast cancer patients survive for at least five years. For patients diagnosed with early stage localized breast cancer that is not spread to the lymph nodes, the 5-year survival rate is about 99%, while for patients diagnosed with metastasized breast cancer the 5-year survival rate is about 28% (Howlader et al. (editors). Cancer Statistics Review, 1975-2017. Table 4.13. National Cancer Institute). Once a diagnosis of breast cancer is established and a stage of the cancer is known, an appropriate therapy can be determined. Breast cancers detected at an early stage are typically treated by surgery, often followed by radiotherapy, while metastasized cancers, even when detected at an early stage, are treated systemically by chemotherapy (Maughan et al., 2010. Am Fam Physician 81: 1339- 1346). Adjuvant (i.e., additional) therapy is often administered as well, depending on the type of breast cancer diagnosed, to increase survival rates. As an example, for estrogen receptor (ER)-positive breast cancer, adjuvant hormone-therapy is often recommended, including either, for example, an aromatase such as anastrozole or letrozole, and / or a selective estrogen receptor modulator (SERM) such as tamoxifen or an anti-estrogen drug, such as fulvestrant. Several gene signature tests have been developed to determine gene expression profiles of breast cancer samples aiming to stratify the cancer into subtypes and / or into risk groups. An example of the former is the BluePrint® test (US patent numbers 9,175,351; 10,072,301; Krijgsman et al., 2012. Br Can Res Treatm 133: 37–47), a molecular subtyping test, analyzing the activity of 80 genes to enable stratification of a breast cancer into one of the three following subtypes: Luminal-type, HER2-type and Basal-type (Perou et al., 2000. Nature 406: 747-752). An example of the latter is, the MammaPrint® (MP; also termed “Amsterdam gene signature test”) test for the stratification of breast cancer patients in Low- and High risk for developing distant metastases within 5 years after diagnosis. Therapy that is administered before surgery is termed neoadjuvant therapy and is a commonly used therapeutic approach for breast cancer patients (Untch et al., 2014. The Breast 23: 526-537). Neoadjuvant therapy improves success rates of breast-conserving surgery due to downstaging of the tumor and allows for assessment of the tumor biology which is useful to predict long-term clinical outcomes (Fisher et al., 1998. J Clin Oncol 16: 2627-2685; De Mattos-Arruda et al., 2016. Nat Rev Clin Oncol 13: 566-579). In particular neoadjuvant immune therapy, including treatment with one or more immunotherapeutic agents (often in combination with a chemotherapeutic drug) before surgery, has been shown to improve the progression-free survival of breast cancer patients and is a promising new treatment tool (Schmid et al., 2018. N Engl J Med 379: 2108–2121). Since not all breast cancer patients benefit from a combination with immune therapy and some even experience severe side effects, the identification of predictive markers of response is critical (Fountzila and Ignatiadis, 2020. Ecancer 14: 1147). The I-SPY 2 TRIAL (NCT01042379), sponsored by Quantum Leap Healthcare Collaborative, is a standing Phase 2 randomized, controlled, multi-center trial for women with newly diagnosed, locally advanced breast cancer (Stage II / III), and is designed to screen promising new treatments and identify which therapies are most effective in specific patient subgroups based on molecular characteristics, including biomarker signatures. The trial is an adaptive study design assessing a combination of biologically targeted investigational drugs with standard chemotherapy, compared to standard chemotherapy alone. The primary endpoint is to determine whether a combination of certain therapies increases the probability of a pathological complete response (pCR) for breast cancer patients at the time of surgery (Barker et al., 2009. Clin Pharmacol Ther 86: 97-100). In one of the treatment arms in the I-SPY 2 TRIAL immune therapy, comprising a combination of paclitaxel and pembrolizumab, an immune check point inhibitor, was tested on HER2-negative patients with a MammaPrint High Risk profile and with either basal or luminal subtype by the BluePrint test. The addition of pembrolizumab to the standard chemotherapy paclitaxel resulted in a more than two-fold increase of the pCR rates compared to chemotherapy alone for both HR- positive / HER2-negative and triple negative breast cancer (Nanda et al., 2020. JAMA Oncol 6: 676-684). Previous research showed that pCR to this therapy can be predicted with a microarray gene expression analysis of marker genes (Pusztai et al., 2021. Cancer Cell 39: 989–998). In addition, ImPrint, a 53-gene signature has been independently validated to predict the likelihood of pCR following immune check point inhibition with high sensitivity and specificity (Brufsky et al., 2023. Cancer Res 83: Abstract PD9-08; international patent application WO2023 / 224487). However, not all patients may benefit from immune checkpoint blockade and immune check point inhibitors come with additional financial burden and significant long-lasting side effects such as adrenal insufficiency. Thus, it is imperative to better understand who may benefit from immune therapy, by typing of breast cancer samples. 2 BRIEF DESCRIPTION OF THE INVENTION The invention provides a method of typing a sample comprising breast cancer cells or comprising gene expression products from breast cancer cells, of an individual who is diagnosed with breast cancer, comprising (i) isolating RNA fromthe sample obtained from the individual; (ii) determining an expression level of atleast 10 marker genes in the isolated RNA to thereby provide an expression profile of said marker genes, wherein the marker genes are selected from the genes listed in Table 1; (iii) comparing the individual’s expression profile to a reference expression profile of the at least 10 marker genes; thereby typing the sample for a response to auxiliary immune therapy. Said sample preferably is a fresh frozen sample or a formalin-fixed, paraffin- embedded sample. In a preferred method of the invention, an individual who is typed as positively responding to auxiliary immune therapy is treated with an immune checkpoint inhibitor such as programmed cell death protein 1 (PD1) or programmed cell death ligand 1 (PDL1) inhibitor, preferably a programmed cell death protein 1 (PD1) binding antibody. Said immune checkpoint inhibitor may be combined with a platinum-based compound and / or a taxane for treatment of said individual. The determination of an expression profile is preferably performed using RNA-sequencing or microarray gene expression analysis. The expression profile in preferred methods of the invention comprises at least 12 different marker genes, preferably at least 15 different marker genes, more preferably at least 20 different marker genes, wherein the marker genes are selected from the genes listed in Table 1. In a most preferred method according to the invention, the expression profile all marker genes is determined, whereby the marker genes are the genes listed in Table 1. In methods of the invention, a reference expression profile may be composed of the average expression levels of the marker genes specified in step (ii) of individuals having a positive response to auxiliary immune therapy, of individuals not having a positive response to auxiliary immune therapy, or of a mixture of individuals having a positive response to auxiliary immune therapy and individuals not having a positive response to auxiliary immune therapy. In methods of the invention, the individual’s expression profile may be compared to two reference expression profiles, wherein a first reference expression profile is composed of the average expression levels of the marker genes specified in step (ii) of individuals having a positive response to auxiliary immune therapy and a second reference expression profile is composed of the average expression level of the marker genes specified in step (ii) of individuals not having a positive response to auxiliary immune therapy. A preferred positive response to auxiliary immune therapy is a pathologic complete response (pCR). The invention further provides a method of treating an individual with breast cancer, comprising typing a sample from said individual using a method of typing according to the invention; treating an individual that is typed as having a positive response to auxiliary immunotherapy with auxiliary immunotherapy, optionally in combination with chemotherapy; and treating an individual that is typed as not having a positive response to auxiliary immunotherapy with chemotherapy. Said auxiliary immunotherapy preferably comprises an immune checkpoint inhibitor, preferably a programmed cell death protein 1 (PD1) binding antibody. In methods of treatment according to the invention, the auxiliary immunotherapy may be combined with chemotherapy such as a platinum-based compound and / or a taxane. Said platinum-based compound preferably is or comprises carboplatin. Said taxane preferably is or comprises paclitaxel. 3 BRIEF DESCRIPTION OF THE FIGURES Figure 1. Dose response curves, comparing ImPrint TN with other published signatures in triple negative breast cancer patients Reference to the following studies is made; Chemokine 12 (Rody et al., 2009. Breast Cancer Res 11:R15), STAT1 (Coppola et al., 2011. Am J Pathol 179: 37-45), ICS5 (Yau et al., 2013. Breast Cancer Res 15: R103), B cells and Dendritic cells (Danaher et al., 2017. J Immunother Cancer 5: 18) and ImPrint (WO2023 / 224487) in triple negative breast cancer patients. Figure 2. Average accuracy ±1.96 * standard deviation for 100,000 random sets of the indicated number of different probes from Table 1. 4 DETAILED DESCRIPTION OF THE INVENTION 4.1 Definitions As is used herein, the term “cancer”, refers to a disease or disorder resulting from the proliferation of oncogenically transformed cells. As is used herein, the term “ breast cancer”, refers to a cancer originating from cells of the breasts. As is used herein, the term “sample”, refers to any sample that can be completely or partly obtained from a cancerous growth of an individual by various means including, for example, biopsy such as needle biopsy and surgery. The term comprises any sample comprising breast cancer cells from an individual, or suspected to comprise breast cancer cells from an individual, such as a tumor or liquid biopsy. Preferably, at least 5% of the sample comprises breast cancer cells. More preferably at least 10%, 20% or 30% of the sample comprises breast cancer cells. The term “sample” further comprises any sample that may comprise gene expression products from breast cancer cells from an individual, such as blood and educated thrombocytes and / or erythrocytes (Nilsson et al., 2011. Blood 118: 3680– 3683). As is used herein, the term “biopsy” refers to a biopsy derived from a primary breast cancer. As is used herein, the term “liquid biopsy” refers to a biopsy obtained from a bodily fluid comprising circulating breast cancer cells or cells that have absorbed nucleic acids derived therefrom such as educated thrombocytes and / or erythrocytes (Best et al., 2015. Cancer Cell 28: 666-676; Heinhuis et al., 2020. Cancers 12: 1372). As is used herein, the term “fresh frozen”, refers to a sample that was frozen after collection, preferably immediately frozen after collection, and conserved in frozen state thereafter. As is used herein, the term “formalin-fixed, paraffin-embedded”, refers to a tissue sample that is processed by fixation in formalin and embedding in paraffin upon collection. As is used herein, the term “typing of a sample”, refers to the classification of a sample based on characterized features. In this invention typing includes the characterisation of expression levels of genes in a sample assisting in the prediction of a response to auxiliary immune therapy. As is used herein, the term “response to therapy” is considered to have the same meaning as the term “response following therapy”. As is used herein, the term “auxiliary immune therapy” refers to the inclusion of immune therapy as neoadjuvant therapy and / or as adjuvant therapy. As is used herein, the term “individual”, refers to a human. Said individual preferably is a woman. As is used herein, the term “primary therapy”, refers to a treatment aiming to remove a cancer, here breast cancer, from an individual, as complete as possible. Said primary therapy preferably is surgery. During surgery, axillary lymph nodes may also be removed. As is used herein, the term “adjuvant therapy”, refers to treatment given following a primary treatment such as surgery. An aim of adjuvant therapy is, for example, to remove cancer cells that remained after primary treatment and / or to reduce the chance of recurrence of cancer cells. Adjuvant therapy in breast cancer, in addition to surgery, involves treatment including one or more of chemotherapy, radiotherapy, immune therapy, targeted therapy and hormone therapy. As is used herein, the term “neoadjuvant therapy”, refers to treatment that is administered prior to primary treatment such as surgery. The main aim of neoadjuvant therapy in breast cancer is to render the primary treatment easier or more effective, for example by reducing the tumor size before surgery. Neoadjuvant therapy in breast cancer involves treatment including one or more of chemotherapy, radiotherapy, immune therapy, targeted therapy and hormone therapy. As is used herein, the term “immune therapy”, or immunotherapy, refers to treatment with one or more immunotherapeutic agents that activate or suppress the immune system. In relation to auxiliary immune therapy, immune therapy includes a wide range of treatments such as immune check point inhibitors, vaccines, cytokines and monoclonal antibodies. As is used herein, the term “immune checkpoint inhibitor”, refers to an inhibitor of an immune checkpoint molecule, a regulator of the immune system. Immune checkpoint molecules include CTLA4, PD-1 and PD-L1, A2AR, CD276, B7- H4, CD272 and Herpesvirus Entry Mediator (HVEM), LAG3, NOX2, TIM-3, V- domain Ig suppressor of T cell activation (VISTA), and CD328. A preferred immune checkpoint inhibitor is selective for at least one of CTLA4, PD-1 and PD-L1, A2AR, CD276, B7-H4, CD272 and Herpesvirus Entry Mediator (HVEM), LAG3, NOX2, TIM-3, V-domain Ig suppressor of T cell activation (VISTA), and CD328, when compared to other surface molecules, meaning that the inhibitor is at least two times more potent, preferably at least five times more potent, in inhibiting at least one of CTLA4, PD-1 and PD-L1, A2AR, CD276, B7-H4, CD272 and Herpesvirus Entry Mediator (HVEM), LAG3, NOX2, TIM-3, V-domain Ig suppressor of T cell activation (VISTA), and CD328, when compared to other molecules. As is used herein, the term “Poly [ADP-ribose] polymerase (PARP) inhibitor”, refers to an inhibitor of a poly [ADP-ribose] polymerase. PARP is a key factor in the initiation of a repair response to single-strand DNA breaks (SSB). A preferred PARP inhibitor is selective for PARP1 and / or PARP2, when compared to other polymerases, meaning that the inhibitor is at least two times more potent, preferably at least five times more potent, in inhibiting PARP1 and / or PARP2, when compared to other polymerases. As is used herein, the term “chemotherapy”, as used herein, refers to treatment with one or more chemotherapeutic agents such as alkylating agents, anthracyclines, taxanes, histone deacetylase inhibitors, topoisomerase inhibitors and platinum-based agents. Traditional chemotherapeutic agents, as used in cancer treatment, are cytotoxic and primarily kill cancer cells by inhibiting cell division. As is used herein, the term “neoadjuvant chemotherapy”, as used herein, refers to chemotherapy that is administered prior to primary treatment such as surgery. As is used herein, the term “pathologic complete response (pCR)”, refers to the absence of any sign of cancer in an individual with breast cancer. The term pCR may be defined as the absence of residual invasive and in situ cancer on hematoxylin and eosin evaluation of a resected breast specimen and all sampled regional lymph nodes following completion of neoadjuvant systemic therapy. As is used herein, the term “residual disease (RD)”, refers to the presence of a sign of cancer in an individual with cancer, i.e. the absence of pCR. As is used herein, the term “RNA”, refers to ribonucleic acid. As is used herein, the term “isolating RNA”, refers to the extraction of RNA from a biological sample. The term “isolating” may refer to the removal of other components, such as proteins and DNA, at least to some extent. As is used herein, the term “gene expression level”, refers to a quantifiable level of expression of a gene of interest. A gene’s expression level is often inferred by measuring a level of a gene product, such as mRNA or protein, of that gene in a sample. Said gene expression level can be determined relatively, in relation to the expression levels of other genes, such as household genes or normalization genes as described in, for example, international patent application WO2008 / 039071; or absolutely, for example by comparing a determined level of expression to a calibration curve of the expression product of the gene. As is used herein, the term “expression profile”, refers to the expression levels of two or more genes in a sample. An expression profile can be obtained, for example, by analysing the hybridisation pattern of a sample on a microarray, and by techniques such as RNA-sequencing or multiplex qPCR. As is used herein, the term “marker gene”, refers to a gene whose sequence or expression level, alone or in combination with other genes, is correlated with an effect, in this application a probability of a positive or negative response to auxiliary immune therapy. As is used herein, the term “oestrogen-receptor (ER) positive breast cancer”, refers to a breast cancer that detectably expresses oestrogen receptor (ER). ER status may be determined, for example, by IHC and / or by TargetPrint® analysis as previously reported (Roepman et al., 2009. Clin Cancer Res 15: 7004-7011). As is used herein, the term “oestrogen-receptor (ER) negative breast cancer”, refers to a breast cancer that does not detectably express oestrogen receptor (ER). ER status may be determined, for example, by IHC and / or by TargetPrint® analysis as previously reported (Roepman et al., 2009. Clin Cancer Res 15: 7004- 7011). As is used herein, the term “progesterone-receptor (PR) positive breast cancer”, refers to a breast cancer that detectably expresses progesterone receptor (PR). PR status may be determined, for example, by IHC and / or by TargetPrint® analysis as previously reported (Roepman et al., 2009. Clin Cancer Res 15: 7004- 7011). As is used herein, the term “progesterone-receptor (PR) negative breast cancer”, refers to a breast cancer that does not detectably express progesterone receptor (PR). PR status may be determined, for example, by IHC and / or by TargetPrint® analysis as previously reported (Roepman et al., 2009. Clin Cancer Res 15: 7004-7011). As is used herein, the term “human epidermal growth factor receptor 2 (HER2) negative breast cancer”, refers to a breast cancer that does not detectably express human epidermal growth factor receptor 2 (HER2). HER2 is also termed v- Erb-B2 avian erythroblastic leukaemia viral oncogene homolog 2 (ERBB2) or NEU. HER2 status may be determined, for example, by immunohistochemistry, chromogenic or fluorescence in situ hybridization, and / or by TargetPrint® analysis as previously reported (Roepman et al., 2009. Clin Cancer Res 15: 7004-7011). As is used herein, the term “triple negative (TN) breast cancer”, refers to a breast cancer that does not detectably express ER, PR and HER2. Whether or not a breast cancer is TN may be determined, for example, by BluePrint analyses or TargetPrint® analyses as previously reported (Roepman et al., 2009. Clin Cancer Res 15: 7004-7011). As is used herein, the term “molecular subtypes” refers to a hierarchical clustering of breast tumors according to their gene expression patterns (Perou et al., 2000. Nature 406: 747-752). The different molecular subtypes of breast cancer include luminal A, luminal B, basal, and HER2 subtypes. The basal subtype may resemble triple negative breast cancer. As is used herein, the term “microarray gene expression analysis”, refers to the analysis of gene expression levels of a predefined gene set through hybridization on a microarray. Microarrays, also known as chips, are microscopic slides containing microscopic spots of nucleic acid molecules from a specific gene. The nucleic acid molecules attached to the microarray act as probes for a nucleic acid molecule such as RNA or copy-DNA (cDNA) molecule, from an experimental sample. These cDNA molecules may be labelled, for example fluorescently labelled, prior to hybridization to the microarray. The term “hybridization”, as is used herein, refers to the binding of a nucleic acid molecule such as RNA or cDNA molecule to a (partially) complementary nucleic acid probe on the microarray. Hybridization of a labelled nucleic acid molecule may result in a signal, for example a fluorescent signal, that can be detected and quantified, yielding information about the abundance of the labelled nucleic acid molecule in the experimental sample. Microarray analysis allows for the simultaneous detection of gene expression levels of a large number of genes. As is used herein, the term “amplification”, refers to an increase in the number of copies of a particular DNA fragment through replication using at least one primer and a DNA polymerase. Known amplification methods include polymerase chain reaction (PCR) and isothermal amplification including, for example, helicase-dependent amplification (HDA) (Vincent et al., 2004. EMBO Rep 5: 795–800), loop-mediated amplification (LAMP) (Notomi et al., 2000. Nucleic Acids Res 28: E63), nucleic acid sequences-based amplification (NASBA) (Guatelli et al., 1990. Proc Natl Acad Sci U S A 87: 1874-1878), rolling circle amplification (Ali et al., 2014. Chem Soc Rev 43: 3324-3341), strand-displacement amplification (SDA) (Walker et al., 1992. Nucleic Acids Res 20: 1691-6) and recombinase polymerase amplification (RPA) (Piepenburg et al., 2006. PLoS Biology 4: e204). As is used herein, the term “RNA-Seq”, also termed “RNA-sequencing”, refers to a sequencing technique, such as a high-throughput sequencing technique, preferably using next-generation sequencing (NGS), to characterize the quantity and / or sequence of a nucleic acid molecule such as RNA in a sample. RNA-Seq can be used for gene expression analysis. As is used herein, the term “normalisation”, refers to methods for correcting experimental variation and bias. Normalisation processes are for example important for analysis of large scale expression data, as collected using microarray or RNA-seq gene expression analysis, to preserve biological variation and eliminate experimental bias or technical variation. As is used herein, the term “combination” refers to the administration of effective amounts of compounds to a patient in need thereof. Said compounds may be provided in one pharmaceutical preparation, or as two or more distinct pharmaceutical preparations. Said compounds may be administrated simultaneously, separately, or sequentially to each other. Said compounds may be administrated by the same route of administration, or by different routes of administration, such as oral administration and parenteral administration. When administered as two or more distinct pharmaceutical preparations, they may be administered on the same day or on different days to a patient in need thereof, and using a similar or dissimilar administration protocol, e.g. daily, twice daily, biweekly, orally and / or by infusion. Said combination is preferably administered repeatedly according to a protocol that depends on the patient to be treated (age, weight, treatment history, etc.), which can be determined by a skilled physician. Said protocol may include daily administration for 1-30 days, such as 2 days, 10 days, or 21 days, followed by period of 1-14 days, such as 7 days, in which no compound is administered. 4.2 Sample collection and pre-processing According to the invention, RNA molecules are isolated from a sample comprising breast cancer cells or breast cancer derived nucleic acids of an individual with breast cancer. The sample may be obtained from any individual with breast cancer. The individual may be a woman. Said individual with breast cancer is an individual suffering from breast cancer or likely to suffer from breast cancer. The sample may comprise any sample comprising breast cancer cells or breast cancer derived nucleic acids from said individual such as a tumor or liquid biopsy. Said tumor biopsy can be obtained by in numerous ways, as is known to a person skilled in the art. For example, the biopsy may be obtained using needle biopsy or surgical biopsy. During needle biopsy, cancer cells are extracted from the breast cancer using a needle. During surgical biopsy, cells are extracted from the breast cancer after making an incision in the skin. In individuals with breast cancer, surgical biopsy is often part of the primary treatment, in which the cancer, or at least a part thereof, is removed from the body. It is explicitly stated that the act of removing a breast cancer, or a part of a breast cancer, from an individual is not part of this invention. Several body fluids can potentially contain circulating breast tumor cells such as blood, plasma, serum, lymphatic fluid, saliva, faeces, urine and cerebrospinal fluid. Preferably, blood or plasma may be used as bodily fluid to provide a liquid biopsy of breast cancer. The sample may be collected in any clinically acceptable manner. Said sample may be collected and conserved upon isolation such as to preserve at least RNA. RNA can be obtained from a sample immediately upon harvesting, or from a conserved sample. A sample can be conserved by fixation e.g. in formalin and / or by treating the sample with an RNase inhibitor, such as RNasin (Promega) and RNasecure (Invitrogen), or an RNA stabilisation agent, such as RNAlater (Invitrogen). Preferred conservation methods of samples include fresh frozen (FF) conservation, for example in dry ice or in liquid nitrogen, and formalin-fixed paraffin-embedded (FFPE) conservation. RNA can be isolated from a sample by methods known in the art. There are three main categories of RNA extraction techniques known to date: organic extraction involving a chaotropic agent such as guanidinium thiocyanate or guanidinium isothiocyanate, followed by, for example, phenol-chloroform extraction; silica-based column techniques (e.g. RNeasy Kit by Qiagen); and magnetic beads-based techniques (e.g. Dynabeads by Invitrogen). A preferred method involves guanidinium thiocyanate- extraction such as, e.g. TRIzol® Kit by Invitrogen. Several methods are known to generate total RNA that is depleted from ribosomal RNA (rRNA). Depletion of the highly abundant rRNA fraction (80-90%) may be desirable, for example, prior to performing an RNA-seq reaction, so that sequencing can be directed to sequencing of messenger RNAs, also termed “transcriptome”. Conventional methods for eliminating rRNA from total RNA samples include enrichment of polyadenylated (poly(A)) transcripts, and targeted depletion of rRNA. Targeted depletion is usually achieved by either rRNA pull-out using biotinylated sequence-specific probes (e.g., Illumina’s Ribo-Zero and Thermo Fisher’s RiboMinus), or RNase H-mediated degradation (e.g., NEB’s NEBNext). The step of isolating RNA from a sample obtained from an individual may be replaced by the provision of an RNA sample from an individual, thereby providing a method of typing a sample comprising gene expression products from breast cancer cells of an individual who is diagnosed with breast cancer, comprising (i)determining an expression level of at least 10 marker genes in the RNA sample tothereby provide an expression profile of said marker genes, wherein the marker genes are selected from the genes listed in Table 1; and (ii) comparing the individual’s expression profile to a reference expression profile of the at least 10 marker genes; thereby typing the sample for a response following auxiliary immune therapy. 4.3. Marker Genes The invention provides a set of at least 10 marker genes whose expression is correlated with a response, here pCR, to auxiliary immune therapy in triple negative breast cancer patients. Preferably, a set of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 marker genes listed in Table 1 is used, such as all 22 marker genes listed in Table 1. Since not all triple negative breast cancer patients may benefit from auxiliary immune therapy, predicting a response before the actual start of the treatment may be part of an approach for optimal treating said individual. Said prediction may help a physician in selecting a treatment strategy for said individual. Preferably, a set of at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 probes of the marker genes listed in Table 1 is used, such as all 24 probes listed in Table 1. The probes are provided in Table 1 with corresponding marker gene name / symbol, sequence, Ensembl ID, Human Genome Nomenclature Committee (HGNC) ID and direction of expression in an immune-responsive patient. In case of a discrepancy in the identification of a marker gene, the sequence of the probe may be dominant. The term “induced” in the column entitled “Direction” in Table 1 means that the level of expression of a gene is increased in a patient that positively responded to auxiliary immune therapy, when compared to a control. Said level may be the same or decreased in a patient that did not respond to auxiliary immune therapy, when compared to a control. The term “repressed” in the column entitled “Direction” in Table 1 means that the level of expression of a gene is decreased in a patient that positively responded to auxiliary immune therapy, when compared to a control. Said level may be the same or increased in a Table 1. Overview of probes and corresponding gene markers to predict pathologic complete response (pCR) following auxiliary immune therapy. Induced means upregulated in immune-responsive patients; repressed means downregulated in immune-responsive patients. #Probe sequence (5’ – 3’) Gene name Abbreviation HGNC Ensembl DirectionATCTGCAAATCGTGACTAAGTACATCCTGA Indoleamine 2,3- 1 TTCCTGCAAGCCAGCAGCCAAAGGAGAATA IDO1 6059 ENSG00000131203 Induced dioxygenase 1 AACCATGAAACGCTACTAACTACAGGAAGC 2 AAACTAAGCCCCCGCTGTAATGAAACACCT Granzyme B GZMB 4709 ENSG00000100453 Induced C-X-C Motif CAAGAGGCAAAGGAATCCATGTAGTAGATA 3 TCCTCTGCTTAAAAACTCACTACGGAGGAG Chemokine CXCL13 10639 ENSG00000156234 Induced Ligand 13 C-X-C Motif TAAGAAAGGCTGGTTACCATCGGAGTTTAC 4 AAAGTGCTTTCACGTTCTTACTTGTTGTAT Chemokine CXCL11 10638 ENSG00000169248 Induced Ligand 11 CATCGGAGGCCTTACCACTCCTATGACTCC SRY-Box 5 TGTTTTCTCTCTCACAGATAGTGAGGGTCT Transcription SOX10 11190 ENSG00000100146 Repressed Factor 10 TGTGACCCACTTACCTTGCATCTCACAGGT C-X-C Motif 6 AGACAGTATATAACTAACAACCAAAGACTA Chemokine CXCL9 7098 ENSG00000138755 Induced Ligand 9 GTTTTAACTCTATCTGTCATACATCCTAGT C-C Motif 7 GAATGTAAAATGCAAAATCCTGGTGATGTG Chemokine CCL8 10635 ENSG00000108700 Induced Ligand 8 GAGTTTTTCCTATTTATTTTGAGTCTGTGA Programmed Cell 8 GGTCTTCTTGTCATGTGAGTGTGGTTGTGA CD274 17635 ENSG00000120217 Induced Death 1 Ligand 1 GTTCCCCGAGAACTTTCTGATTCACAGTCT Carbonic 9 CATTTTGACAGCATGAAATGTCCTCTTGAA CA12 1371 ENSG00000074410 Repressed Anhydrase 12

[0002] Small Integral AGAAGATAGCACAGATATCGGGATATTATT GTGTGAAAATGCTGCTTTTACTTTGATGTG Membrane Protein SMIM3 30248 ENSG00000256235 Repressed 3 TGAGAAAGCCTCCATAATGTACCCAAGTAA C-X-C Motif CAACTGTGACAAAATAGAAGTGATTATTAC Chemokine CXCL11 10638 ENSG00000169248 Induced Ligand 11 GGAAATTGGCGATGTCACCCGTGTACGGTA Interleukin 21 CGCAGCCCAGAGCAGACCCTCAATAAACGT IL21R 6006 ENSG00000103522 Induced Receptor Signal TTGAACCCTACACGAAGAAAGAACTTTCTG Transducer And CTGTTACTTTCCCTGACATCATTCGCAATT STAT1 11362 ENSG00000115415 Induced Activator Of Transcription 1 GTCAAGCCATAATTGTTCTTAGTTTGCAGT C-X-C Motif TACACTAAAAGGTGACCAATGATGGTCACC Chemokine CXCL10 10637 ENSG00000169245 Induced Ligand 10 Teneurin TACTGAAAATGAAGCAGTGATGTCCCCAGA GCATGCCATGAGACTTTGGGGCAGGGGGGT Transmembrane TENM3 29944 ENSG00000218336 Repressed Protein 3 Cellular Retinoic TCCCCTGAGGAATATGTCATAGTTCTGAGC TGCCAGTGGACCGCCCTTTTCCCCTACCAA Acid Binding CRABP1 2338 ENSG00000166426 Repressed Protein 1 CTTCCAGAGAAATCTAAGCAGCAGGAGATC TACCAGGAGCTGACCCAGCTGAAGGCTGCA DC-SIGN1 CD209 1641 ENSG00000090659 Repressed CCCTTCCTCTTTCCATCTACCCTCCGATTG Interleukin 2 TTCCTGAACCGATGAGAAATAAAGTTTCTG Receptor Subunit IL2RG 6010 ENSG00000147168 Induced Gamma

[0003] C-X-C Motif GATGTCTGAATCCAGAATCGAAGGCCATCA AGAATTTACTGAAAGCAGTTAGCAAGGAAA Chemokine CXCL10 10637 ENSG00000169245 Induced Ligand 10 ACATCGTGAGGAACTTCCACTACCTTCTCA C-C Motif TCAAGGATGGCTGCAGGGTGCCTGCTGTAG Chemokine CCL19 10617 ENSG00000172724 Repressed Ligand 19 GTTTAGCTCTTACACTCTATCCTTCCTAGA Phospholipid AAATGGTAATTGAGATTACTCAGATATTAA PLSCR1 9092 ENSG00000188313 Induced Scramblase 1 Ubiquinol- TGCAGGGCTACTTCATGCTGTATAAAAATG Cytochrome C ACCCTGTAGGGGCAATTCACAATGCTGAGT BCS1L 1020 ENSG00000074582 Repressed Reductase Complex TAACCTATGGGGGGATGGCCAAGCAGCCCG Mitochondrial TCGTAGCCTCTGTGAGCCTGCTCATTTTTA Trans-2-Enoyl- MECR 19691 ENSG00000116353 Repressed CoA Reductase 2 Methionyl GACAGTTACAATGATCTTTGTATCTGAACT Aminopeptidase TTGCACGTCTGCCGAAAAATCCGAACCTGT METAP1D 32583 ENSG00000172878 Repressed Type 1D, Mitochondrial

[0004] patient that did not respond to auxiliary immune therapy, when compared to a control. 4.4 Determining expression levels of marker genes The determination of an expression level of one or more marker genes can be accomplished by means known in the art such as Northern blotting, quantitative PCR (qPCR), microarray analysis or RNA-seq. Preferably, the expression levels of multiple marker genes are assessed simultaneously, by methods such as multiplex qPCR, microarray analysis, and RNA-seq. Microarray analysis involves the use of selected probes that are immobilized on a solid surface, an array. Said probes are able to hybridize to gene expression products such as mRNA, or derivates thereof such as cDNA. The probes are exposed to labeled sample gene expression products, or labelled derivates thereof, hybridized, washed, where after the abundance of gene expression products or derivates thereof in the sample that are complementary to a probe is determined by determining the amount of label that remains associated to a probe. The probes on a microarray may comprise DNA sequences, RNA sequences, or copolymer sequences of DNA and RNA. The probes may also comprise DNA and / or RNA analogues such as, for example, nucleotide analogues or peptide nucleic acid molecules (PNA), or combinations thereof. The sequences of the probes may be full or partial fragments of genomic DNA. The sequences may also be in vitro synthesized nucleotide sequences, such as synthetic oligonucleotide sequences. In the context of the invention, a probe preferably is specific for a gene expression product of a gene as listed in Table 1. A probe is specific when it comprises a continuous stretch of nucleotides that are completely complementary, over the whole length, to a nucleotide sequence of a gene expression product, or a cDNA product thereof. A probe can also be specific when it comprises a continuous stretch of nucleotides that are partially complementary to a nucleotide sequence of a gene expression product of said gene, or a cDNA product thereof. Partially means that a maximum of 5 nucleotides, more preferable 4 nucleotides, more preferable 3 nucleotides, more preferable 2 nucleotides and most preferable one nucleotide differs from the corresponding nucleotide sequence of a gene expression product of said gene. The term complementary is known in the art and refers to a sequence that is related by base-pairing rules to the sequence that is to be detected. It is preferred that the sequence of the probe is carefully designed to minimize nonspecific hybridization to said probe. The specificity of a probe may further be determined by the hybridization and / or washing conditions. The hybridization and / or washing conditions are preferably stringent, which are determined by inter alia the temperature and salt concentration of the hybridization and washing conditions, as is known to a person skilled in the art. An increased stringency will substantially reduce non-specific hybridization to a probe, while specific hybridization is not substantially reduced. Stringent conditions include, for example, washing steps for five minutes at room temperature 0.1x sodium chloride-sodium citrate buffer (SSC) / 0.005% Triton X- 102. More stringent conditions include washing steps at elevated temperatures, such as 37 °Celsius, 45 °Celsius, or 65 °Celsius, either or not combined with a reduction in ionic strength of the buffer to 0,05x SSC or even 0,01x SSC, as is known to a skilled person. It is preferred that the probe is, or mimics, a single stranded nucleic acid molecule. The length of a probe can vary between 15 bases and several kilo bases, and is preferably between 20 bases and 1 kilobase, more preferred between 40 and 100 bases, and most preferred about 60 nucleotides. A most preferred probe comprises about 60 nucleotides. Said probe is preferably identical over the whole length to a nucleotide sequence of a gene expression product of a gene, or a cDNA product thereof. In a method of the invention, probes comprising probe sequences as indicated in Table 1 can be employed. To determine an RNA expression level by micro arraying, gene expression products in the sample are preferably labeled, either directly or indirectly, and contacted with probes on the array under conditions that favor duplex formation between a probe and a complementary molecule in the labeled gene expression product sample. The amount of label that remains associated with a probe after washing of the microarray can be determined and is used as a measure for the gene expression level of a nucleic acid molecule that is complementary to said probe. Image acquisition and data analysis can subsequently be performed to produce an image of the surface of the hybridized array. For this, the array may be dried and placed into a laser scanner to determine the amount of labeled sample that is bound to a probe at a predetermined spot. Laser excitation will yield an emission with characteristic spectra that is indicative of the labelled sample that is hybridized to a probe molecule. An array preferably comprises multiple spots encompassing a specific probe. A probe preferably is present in duplicate, in triplicate, in quadruplicate, in quintuplicate, in sextuplicate or in octuplicate on an array. The multiple spots preferably are at randomized opposition on an array to minimize bias. The amount of label that remains associated with the probe at each spot may be averaged, where after the averaged level can be used as a measure for the gene expression level of a nucleic acid molecule that is complementary to said probe. In addition, a gene product may be hybridized to two or more different probes that are specific for that gene product. The determined RNA expression level can be normalized for differences in the total amounts of nucleic acid expression products between two separate samples by comparing the level of expression of one or more genes that are presumed not to differ in expression level between samples such as glyceraldehyde-3-phosphate- dehydro-genase, β-actin, and ubiquitin. Conventional methods for normalization of array data include global analysis, which is based on the assumption that the majority of genetic markers on an array are not differentially expressed between samples (Yang et al., 2002. Nucl Acids Res 30: l5). Alternatively, the array may comprise specific probes that are used for normalization. These probes preferably detect RNA products from housekeeping genes such as glyceraldehyde-3-phosphate dehydrogenase and 18S rRNA levels, of which the RNA level is thought to be constant in a given cell and independent from the developmental stage or prognosis of said cell. As an alternative, a dedicated set of normalization probes may be used (Glas et al., 2006. BMC Genomics 7: 278). Another preferred method for determining RNA expression levels is by sequencing, preferably next-generation sequencing (NGS), of RNA samples, with or without prior amplification of the RNA expression products. High throughput sequencing techniques for sequencing RNA, or RNA-seq, have been developed. NGS platforms, including Illumina® sequencing; Roche 454 pyrosequencing®, ion torrent and ion proton sequencing, and ABI SOLiD® sequencing, allow sequencing of fragments of DNA in parallel. Bioinformatics analyses are used to piece these fragments together by mapping the individual reads. Each base is sequenced multiple times, providing high depth to deliver accurate data and an insight into unexpected DNA variation. NGS can be used to sequence a complete exome including all genes or alternatively to sequence a number of individual genes. NGS also includes so called third generation sequencing platforms, for example nanopore sequencing on an Oxford Nanopore Technologies platform, and single-molecule real-time sequencing (SMRT sequencing) on a PacBio platform, with or without prior amplification of the RNA expression products. Further high throughput sequencing techniques include, for example, sequencing-by-synthesis. Sequencing-by-synthesis or cycle sequencing can be accomplished by stepwise addition of nucleotides containing, for example, a cleavable or photobleachable dye label as described, for example, in U.S. Patent No. 7,427,673; U.S. Patent No. 7,414,116; WO 04 / 018497; WO 91 / 06678; WO 07 / 123744; and U.S. Patent No.7,057,026, all of which are incorporated herein by reference. Sequencing techniques also include sequencing by ligation techniques. Such techniques use DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides and are inter alia described in U.S. Patent No 6,969,488 ; U.S. Patent No. 6,172,218 ; and U.S. Patent No.6,306,597. Other sequencing techniques include, for example, fluorescent in situ sequencing (FISSEQ), and Massively Parallel Signature Sequencing (MPSS). Sequencing techniques can be performed by directly sequencing RNA, or by sequencing a RNA-to-cDNA converted nucleic acid library. Most protocols for sequencing RNA samples employ a sample preparation method that converts the RNA in the sample into a double-stranded cDNA format prior to sequencing. Conversion of RNA into cDNA and / or cRNA using a reverse-transcriptase enzyme such as M-MLV reverse-transcriptase from Moloney murine leukemia virus, or AMV reverse-transcriptase from avian myeloblastosis virus, is known to a person skilled in the art. Quantitative PCR (qPCR), or real-time PCR (RT-PCR), is a technique which is used to amplify and simultaneously quantify a template nucleic acid molecule such as an RNA. The detection of the amplification product can in principle be accomplished by any suitable method known in the art. The amplified products may be directly stained or labelled with radioactive labels, antibodies, luminescent dyes, fluorescent dyes, or enzyme reagents. Direct DNA stains include for example intercalating dyes such as acridine orange, ethidium bromide, ethidium monoazide or Hoechst dyes. These intercalating dyes are non-specific and bind to all double stranded DNA in the PCR. An increase in DNA products during amplification, results in an increased fluorescence intensity being measured. Another direct DNA detection method includes the use of sequence specific DNA probes consisting of a fluorescent reporter and quencher. Upon binding of the probe to its complementary sequence, polymerases of the PCR break the proximity of the reporter and the quencher, resulting in the emission of fluorescence. Commonly used reporter dyes include FAM (Applied Biosystems), HEX (Applied Biosystems), ROX (Applied Biosystems), YAK (ELITech Group) or VIC (Life Technologies) and commonly used quenchers include TAMRA (Applied Biosystems), BHQ (Biosearch Technologies) and ZEN (Integrated DNA Technologies). Alternatively, the amplified product may be detected by incorporation of labelled dNTP bases into the synthesized DNA fragments. Detection labels which may be associated with nucleotide bases include, for example, fluorescein, cyanine dye and BrdUrd. For simultaneous detection of multiple nucleic acid gene expression products, a multiplex qPCR can be used. In multiplex qPCRs, two or more template nucleic acid molecules are amplified and quantified in the same reaction. A commonly used method of achieving the simultaneously detection of multiple targets, is by using probes with different fluorescent dyes to distinguish distinct nucleic acid targets. It is preferred in methods of the invention that genes are selected for normalization of the raw data. Preferred genes are genes of which the RNA expression levels are largely constant between individual samples comprising breast cancer cells from one individual, and between samples comprising breast cancer cells from different individuals. It will be clear to a skilled artisan that the RNA levels of said set of normalization genes preferably allow normalization over the whole range of RNA levels. An example of such a set of normalization genes is provided in WO 2008 / 039071, which is hereby incorporated by reference. Normalization methods that may be employed include, for example, mean correction, linear combination of factors, Bayesian methods and non-linear normalization methods such quantile normalization. Preferred methods include non-parametric regression methods such as locally estimated scatterplot smoothing (LOESS; Jacoby, 2000. Electoral Studies 19: 577–613) and locally weighted scatterplot smoothing (LOWESS; Cleveland et al., 1988. J Amer Statist Assoc 83: 596–610). 4.5 Prediction of an individual’s response following auxiliary immune therapy The invention provides a method for typing a sample to predict an individual’s response to auxiliary immune therapy. Typing of a sample can be performed in various ways. In one method, the difference or similarity between a sample’s expression profile and a previously established reference expression profile is determined. The sample’s expression profile is composed of the expression levels of a set of marker genes in said sample. The reference expression profile is composed of the average expression levels of the same set of marker genes in a sample from a reference group. The reference group may comprise a single individual with TN breast cancer. Preferably the reference group comprises the average expression levels of at least 10, 25, 50, 100, 200 or 300 individuals with TN breast cancer. The reference group may include individuals with different responses to auxiliary immune therapy. The reference group may also include individuals with TN breast cancer that all show a response following auxiliary immune therapy (i.e. response reference group) or individuals with TN breast cancer not showing a response to auxiliary immune therapy (i.e. no response reference group). Alternatively, an expression profile of an individual can also be typed by comparing the individual’s expression profile to multiple reference profiles. For example, the individual’s expression profile can be compared to both reference profiles identified above (i.e. the response reference group and the no response reference group). If the expression profile of the individual’s sample is substantially more similar to response reference group, when compared to the no response reference group, it will be predicted responsive. The difference or similarity between an expression profile and one or more reference profiles can be determined by determining a correlation of the expression levels of marker genes in the profiles. For example, one can determine whether the expression levels of marker genes in a sample correlate to the expression levels of the same marker genes in a reference profile. This correlation can be numerically expressed using a correlation coefficient. Several correlation coefficients can be used. Preferred methods are parametric methods which assume a normal distribution of the data. One of these methods is the Pearson product-moment correlation coefficient, which is obtained by dividing the covariance of the two variables by the product of their standard deviations. Said correlations between the expression levels of marker genes in the individual’s sample and the reference group, can be used to produce an overall similarity score for the set of marker genes used. A similarity score is a measure of the average correlation of gene expression levels of a set of genes in a sample from an individual with breast cancer and a reference profile. Said similarity score can, but does not need to be, a numerical value between +1, indicative of a high correlation between the gene expression level of the set of genes in a sample of said individual and said reference profile, and -1, which is indicative of an inverse correlation. A threshold can be used to differentiate between samples having a response, and samples having no response. Said threshold is an arbitrary value that allows for discrimination between samples from individuals with no response, and samples of individuals with a response. If a similarity threshold value is employed, it is preferably set at a value at which an acceptable number of patients with response would score as false negatives, and an acceptable number of patients with no response would score as false positives. Based on the predictions made by the methods of the invention, one can determine a course of treatment of the individual with breast cancer. For example if the individual’s expression profile is not substantially different from the no response group, or alternatively substantially different from the response group, this indicates that the individual is predicted to not show response to auxiliary immune therapy. In that case, it is not recommended to provide auxiliary immune therapy. Preferably, the response to auxiliary immune therapy to be predicted is pCR. Alternatively, other responses to auxiliary immune therapy could be assessed such as residual cancer burden (RCB), (3-year) event-free survival (EFS) and distant recurrence-free survival (DRFS). A prediction of an individual’s response following auxiliary immune therapy may be combined with other predictive or prognostic signatures, such as MAMMAPRINT®, BLUEPRINT® (US 9,175,351 and US 10,072,301, OncotypeDX®, MapQuantDX™ ProSigna® and EndoPredict®, and / or with presence or absence of biomarkers such as Oestrogen Receptor (ER), Progesterone Receptor (PR) and Human Epidermal Growth factor Receptor 2 (HER2 / ERBB2). 4.6 Methods of treating an individual with triple negative breast cancer A method of treatment of a patient with triple negative breast cancer is usually determined based on the grade of the cancer and / or the stage of the cancer. Classification of a breast cancer into a molecular subtype may be based on the Luminal-type, HER2-type and Basal-type (Perou et al., 2000. Nature 406: 747-752; Krijgsman et al., 2012. Br Can Res Treatm 133: 37–47), for example by using the BluePrint signature as described in US 9,175,351 and US 10,072,301. For a non-metastatic breast cancer, primary treatment involves local treatment including surgery and often adjuvant post-operative radiotherapy. Surgery may aim at the complete removal of the cancer tissue. In some instances, one or more of the axillary lymph nodes may be removed as well. Treatment of a nonmetastatic breast cancer may also involve systemic treatment depending on the molecular subtype of the breast cancer and is administered in addition to surgery. For triple negative breast cancer, adjuvant therapy is mainly limited to chemotherapy. Neoadjuvant immune therapy, including treatment with immunotherapeutic agents (often in combination with a chemotherapeutic drug) before surgery, has been shown to improve the progression-free survival of breast cancer patients and is a promising new treatment tool (Schmid et al., 2018. N Engl J Med 379(22):2108–2121). An auxiliary immune therapy according to the invention may be combined with chemotherapy and / or targeted therapy. Preferably said targeted therapy comprises treatment with a PARP inhibitor, with a PI3K / AKT / mTOR inhibitor, or with both a PARP inhibitor and a PI3K / AKT / mTOR inhibitor. Furthermore, in a method of treating an individual having TN breast cancer with auxiliary immune therapy provided by the invention, said auxiliary immune therapy may be combined with chemotherapy and / or targeted therapy. Preferably said targeted therapy is treatment with a PARP inhibitor and / or PI3K / AKT / mTOR inhibitor. Furthermore, in the use of auxiliary immune therapy according to the invention, said auxiliary immune therapy can by combined with chemotherapy and / or targeted therapy. Preferably said targeted therapy is treatment with a PARP inhibitor and / or PI3K / AKT / mTOR inhibitor. A PARP inhibitor preferably is selected from olaparib (3-aminobenzamide, 4- (3-(1-(cyclopropanecarbonyl)piperazine-4-carbonyl)-4-fluorobenzyl)phthalazin- 1(2H)-one; AZD-2281; AstraZeneca), rucaparib (6-fluoro-2-[4- (methylaminomethyl)phenyl]-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13)- tetraen-9-one; Clovis Oncology, Inc.); niraparib tosylate ((S)-2-(4-(piperidin-3- yl)phenyl)-2H-indazole-7-carboxamide hydrochloride; MK-4827; GSK); talazoparib (11S,12R)-7-fluoro-11-(4-fluorophenyl)-12-(2-methyl-1,2,4-triazol-3-yl)-2,3,10- triazatricyclo[7.3.1.05,13]trideca-1,5(13),6,8-tetraen-4-one; BMN-673; Pfizer); veliparib (2-[(2R)-2-methylpyrrolidin-2-yl]-1H-benzimidazole-4-carboxamide dihydrochloride benzimidazole carboxamide; ABT-888; Abbvie); pamiparib (2R)-14- fluoro-2-methyl-6,9,10,19-tetrazapentacyclo[14.2.1.02,6.08,18.012,17]nonadeca- 1(18),8,12(17),13,15-pentaen-11-one; BGB-290; BeiGene); CEP-8983, and CEP 9722, a small-molecule prodrug of CEP-8983, a 4-methoxy-carbazole inhibitor (CheckPoint Therapeutics); E7016 (Eisai), PJ34 (2-(dimethylamino)-N-(6-oxo-5H- phenanthridin-2-yl)acetamide;hydrochloride) and 3-aminobenzamide. A preferred PARP inhibitor is selected from the group consisting of olaparib, rucaparib, niraparib, talazoparib, and pamiparib. Said PARP inhibitor preferably is administered orally, as a tablet or as a capsule. Said PARP inhibitor preferably is administered once or twice per day for a period of 1-24 weeks, for example once or twice daily for a 12 weeks period. The preferred dosage of selected PARP inhibitors is 100-500 mg twice daily, preferably 300-400 mg twice daily for olaparib; 200-1000 mg twice daily, preferably 400-600 mg twice daily for rucaparib; 50-500 mg twice daily, preferably 100-300 mg twice daily for niraparib tosylate; 0.2-2 mg twice daily, preferably 0.5-1 mg twice daily for talazoparib; 100-600 mg twice daily, preferably 200-400 mg twice daily for veliparib; and 300-100 mg twice daily, preferably 40-60 mg twice daily for pamiparib. A person skilled in the art will understand that the dosage in a combination according to the invention, may be at the low range of the indicated dosages, or even below the indicated dosages. A PI3K / AKT / mTOR inhibitor is an inhibitor of the phosphoinositide 3-kinase (PI3K) / protein kinase (AKT) / mammalian target of rapamycin (mTOR) signalling pathway. This pathway regulates survival, proliferation, differentiation, apoptosis and other processes of breast cancer cells, and performs a pivotal function in the occurrence and development. Abnormal activation of this pathway is the most common pathogenesis of breast cancer (Martini et al., 2014. Ann Med 46: 372-383). A large number of targeted drugs that act on various proteins of PI3K / AKT / mTOR pathway have been developed, providing a valuable tool for targeted therapy of HER2-negative breast cancer. A PI3K inhibitor is preferably selected from buparlisib, pictilisib, alpelisib, idelalisib, copanlisib, duvelisib, parsaclisib, zandelisib (ME-401), NVP-BBD130, dactolisib (BEZ-235), NVP- BEZ-235 and gedatolisib (PKI-587). An AKT inhibitor (AKTi) is preferably selected from miransertib, ARQ 751, MK-2206, perifosine (KRX-0401), ATP competitive inhibitors such as ipatasertib, uprosertib, capivasertib and afuresertib. An mTOR inhibitor is preferably selected from everolimus, temsirolimus and sirolimus. The invention provides a method of treating an individual with triple negative breast cancer comprising typing the individual according to the invention and treating the individual that is typed as having a response to auxiliary immune therapy, with auxiliary immune therapy, and treating the individual that is typed as not having a response to auxiliary immune therapy with chemotherapy, without the addition of immunotherapeutic agents. The invention provides a method of treating an individual with triple negative breast cancer comprising typing the individual according to the invention and treating the individual that is typed as having a response to auxiliary immune therapy, with a combination of chemotherapy and immune therapy, and treating the individual that is typed as not having a response to auxiliary immune therapy with chemotherapy, without the addition of immunotherapeutic agents. Said auxiliary immune therapy may be provided as adjuvant therapy or as neoadjuvant therapy. The invention provides a use of auxiliary immune therapy for the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy. The invention provides a use of a combination of auxiliary immune therapy and chemotherapy for the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy. The invention further provides a use of auxiliary immune therapy for the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy, wherein said treatment further comprises chemotherapy such as a platinum-based compound and / or a taxane. The invention provides auxiliary immune therapy for use in the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy. The invention provides a combination of auxiliary immune therapy and chemotherapy for use in the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy. The invention further provides auxiliary immune therapy for use in the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy, wherein said treatment further comprises chemotherapy such as a platinum-based compound and / or a taxane. The invention provides a use of auxiliary immune therapy in the preparation of a medicament for the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy. The invention provides a use of a combination of auxiliary immune therapy and chemotherapy in the preparation of a medicament for the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy. The invention provides a use of auxiliary immune therapy in the preparation of a medicament for the treatment of an individual with triple negative breast cancer that is typed according to the invention as having response to auxiliary immune therapy, wherein said medicament further comprises a chemotherapy such as a platinum-based compound and / or a taxane. Chemotherapeutic agents used in the treatment of individuals with cancer can be selected from following non-limiting examples: alkylating compounds such as bendamustine (Mundipharma Pharmaceuticals), busulfan (Pierre Fabre), carmustine (Bristol-Myers Squibb), chlorambucil (Aspen), cyclophosphamide (Baxter), dacarbazine (Pfizer), estramustine (Pfizer), ifosfamide (Baxter), lomustine (Kyowa Kirin Pharma), melphalan (GlaxoSmithKline), nimustine (Sankyo), procarbazine (Leadiant Biosciences), streptozotocin (Keocyt), temozolomide (Merck & Co), thiotepa (Adienne), treosulfan (Lamepro) and trofosfamide (Baxter); anthracyclines such as daunorubicin (Medac), doxorubicin (Pfizer), epirubicin (Pfizer), idarubicin (Pfizer), mitoxantrone (Pfizer), pirarubicin (Sanofi), pixantrone (Servier) and valrubicin (Endo Pharmaceuticals); anti-tumor antibiotics (not anthracyclines) such as bleomycin (Inovio Pharmaceuticals), dactinomycin (Ovation Pharmaceutical) and mitomycin (UroGen Pharma); platinum compounds such as cisplatin (Bristol Myers Squibb), carboplatin (Bristol Myers Squibb), oxaliplatin (Pfizer) and satraplatin (Yakult Honsha), antimetabolites such as azacitidine (Pfizer), capecitabine (Roche), cytarabine (Pfizer), cladribine (Janssen Pharmaceutica), clofarabine (Sanofi), decitabine (Janssen Pharmaceutica), fludarabine (Bayer), (5-)fluorouracil (FivepHusion), 5-fluoro-2´-deoxyuridine (Sigma-Aldrich), gemcitabine (Eli Lilly and Company), (6-)mercaptopurin (Aspen), methotrexate (Aldeyra Therapeutics), nelarabine (Novartis), pemetrexed (Eli Lilly and Company), pentostatin (Pfizer) and (6-)tioguanine (Aspen); anti-mitotic cytostatics such as vinblastine (Teva), vincristine (Teva), vindesine (EG), vinflunine (Pierre Fabre) and vinorelbine (Pierre Fabre), taxanes such as cabazitaxel (Sanofi), docetaxel (Sanofi), paclitaxel (Celgene) and tesetaxel (Odonate Therapeutics); non-taxane microtubule inhibitors such as eribulin (Eisai), indibulin (Baxter), ixabepilone (R-PHARM), patupilone (Novartis) and sagopilone (Bayer HealthCare); topo-isomerase inhibitors such as camptothecin (RTI International), etoposide (Bristol-Myers Squibb), irinotecan (Pfizer), teniposide (Bristol-Myers Squibb), tretinoin (Roche) and topotecan (Novartis); and histone deacetylase inhibitors such as chidamide (Chipscreen Bioscience, HUYA Bioscience International), entinostat (Syndax), mocetinostat (Mirati therapeutics), tacedinaline (Pfizer), domatinostat (4SC), romidepsin (Celgene), abexinostat (Xynomic Pharmaceuticals), belinostat (Onxeo), nanatinostat (CHR-3996, Chroma Therapeutics, Viracta Therapeutics), givinostat (ITALFARMACO), MPT0E028 (3- (1-benzenesulfonyl-2,3-dihydro-1H-indol-5-yl)-N-hydroxy-acrylamide), panobinostat (Secura Bio Limited), pracinostat ((E)-3-[2-butyl-1-[2- (diethylamino)ethyl]benzimidazol-5-yl]-N-hydroxyprop-2-enamide), quisinostat (Janssen Pharmaceuticals, NewVac), resminostat (4SC, Yakult Honsha), ricolinostat (Regenacy Pharmaceutica), trichostatin A (Vanda Pharmaceuticals), vorinostat (suberanilohydroxamic acid or SAHA, Merck & Co), butyric acid, 4- phenylbutyric acid, pivanex (pivaloyloxymethyl butyrate), valproic acid (2- propylpentanoic acid), cambinol (5-[(2-Hydroxynaphthalen-1-yl)methyl]-6-phenyl-2- thioxo-2,3-dihydropyrimidin-4(1H)-one), selistat (EX-527, AOP Orphan Pharmaceuticals AG), nicotinamide (pyridine-3-carboxamide) and sirtinol (2-[[(2- hydroxy-1-naphthalenyl)methylene]amino]-N-(1-phenylethyl)-benzamide). Chemotherapy used in the treatment of individuals with triple negative breast cancer and typed according to the invention may comprise a therapeutically effective amount of any of the chemotherapeutic agents known to treat cancer patients. Said chemotherapeutic agent preferably includes a taxane, a platinum compound, an anthracycline or alkylating compound. Said taxane preferably is paclitaxel, docetaxel or cabazitaxel. Said taxane is preferably administered intravenously, preferably by infusion. Said taxane preferably is repeatedly administered, for example once every week, once every two weeks, or once every three weeks. For example, paclitaxel may be administered at a dosage of 75-200 mg / m2, such as about 80 mg / m2, every 1-4 weeks; docetaxel may be administered at a dosage of 40-100 mg / m2, such as about 60 mg / m2, every 1-4 weeks; and cabazitaxel may be administered at a dosage of 5-75 mg / m2, such as about 20 mg / m2, every 1-4 weeks. Said platinum compound is preferably administered intravenously, preferably by infusion. For example, carboplatin may be administered at a dosage of 100-600 mg / m2, such as about 360 mg / m2, every 1-4 weeks and cisplatin may be administered at a dosage of 10-120 mg / m2, such as about 75 mg / m2, every 1-4 weeks. Said anthracycline is preferably administered intravenously, preferably by infusion. Said anthracycline preferably is repeatedly administered, for example once every week, once every two weeks, or once every three weeks. Said anthracycline is preferably administered intravenously, preferably by infusion. For example, doxorubicin may be administered at a dosage of 20-400 mg / m2, such as about 60-75 mg / m2, every 1-4 weeks and epirubicin may be administered at a dosage of 20-140 mg / m2, such as about 60-90 mg / m2, every 1- 4 weeks. Said alkylating compound is preferably cyclophosphamide. Said alkylating compound is preferably administered per oral or intravenously, preferably by infusion. Said alkylating compound preferably is repeatedly administered, for example once every week, once every two weeks, or once every three weeks. For example, cyclophosphamide may be administered at a dosage of 30-800 mg / m2, such as about 600 mg / m2, every 1-4 weeks. A person skilled in the art will understand that the dosage in a combination according to the invention, may be at the low range of the indicated dosages, or even below the indicated dosages. Another preferred chemotherapy used in the treatment of individuals with triple negative breast cancer and typed according to the invention, comprises a combination of two or more chemotherapeutic agents. Examples of a preferred combination of chemotherapeutic agents include a combination of paclitaxel and carboplatin, a combination of paclitaxel and gemcitabine, a combination of doxorubicin and cyclophosphamide (often referred to as “AC”), a combination of doxorubicin, cyclophosphamide and paclitaxel (often referred to as “AC-P”), a combination of doxorubicin, cyclophosphamide and docetaxel (often referred to as “AC-T”), a combination of doxorubicin and docetaxel (often referred to as “AT”), a combination of cyclophosphamide, methotrexate and fluorouracil (often referred to as “CMF”), a combination of epirubicin, cyclophosphamide, methotrexate and fluorouracil (often referred to as “E-CMF”), a combination of epirubicin and cyclophosphamide (often referred to as “EC”), a combination of epirubicin, cyclophosphamide and paclitaxel (often referred to as “EC-P”), a combination of epirubicin, cyclophosphamide and docetaxel (often referred to as “EC-T”), a combination of fluorouracil, doxorubicin and cyclophosphamide (often referred to as “FAC” or “CAF”), a combination of fluorouracil, epirubicin and cyclophosphamide (often referred to as “FEC”), a combination of fluorouracil, epirubicin, cyclophosphamide and paclitaxel (often referred to as “FEC-P”), , a combination of fluorouracil, epirubicin, cyclophosphamide and docetaxel (often referred to as “FEC-T”), a combination of docetaxel, doxorubincin and cyclophosphamide (often referred to as “TAC”) and a combination of docetaxel and cyclophosphamide (often referred to as “TC”). In said combination, chemotherapeutic agents are preferably administered intravenously, preferably by infusion. In said combination chemotherapeutic agents preferably are repeatedly administered, for example once every week, once every two weeks, or once every three weeks. In said combination chemotherapeutic agent have dosages preferably as follows: paclitaxel may be administered at a dosage of 75-200 mg / m2, such as about 80 mg / m2, every 1-4 weeks; carboplatin may be administered at a dosage of 100-300 mg / m2, such as about 300 mg / m2, every 1-4 weeks; carboplatin may be administered at a dosage of 100-300 mg / m2, such as about 300 mg / m2, every 1-4 weeks; gemcitabine may be administered at a dosage of 500-3500 mg / m2, such as about 1250 mg / m2, every 1-4 weeks; cyclophosphamide may be administered at a dosage of 30-800 mg / m2, such as about 600 mg / m2, every 1-4 weeks; methotrexate may be administered at a dosage of 10-100 mg / m2, such as about 40 mg / m2, every 1-4 weeks; doxorubicin may be administered at a dosage of 10-100 mg / m2, such as about 50 mg / m2, every 1-4 weeks; fluorouracil may be administered at a dosage of 100-4000 mg / m2, such as about 500 mg / m2, every 1-4 weeks; epirubicin may be administered at a dosage of 50-200 mg / m2, such as about 100 mg / m2. In said combination methotrexate and cyclophosphamide, can be administered per oral or intravenously. Immunotherapeutic agents used in the treatment of individuals with triple negative breast cancer can be selected from a cancer vaccine, adoptive cell therapy, one or more cytokines and one or more immune check point inhibitors. A most common type of immune therapy involves immune checkpoint inhibitors. An immune checkpoint inhibitor is an inhibitor of CTLA4, PD-1 and PD- L1, A2AR, CD276, B7-H4, CD272 and Herpesvirus Entry Mediator (HVEM), LAG3, NOX2, TIM-3, V-domain Ig suppressor of T cell activation (VISTA), and CD328. Said inhibitor preferably is a PD1 / PDL1 inhibitor and / or an inhibitor of CTLA-4. Suitable immune checkpoint inhibitors are CTLA-4 inhibitors such as antibodies, including ipilimumab (Bristol-Myers Squibb) and tremelimumab (AstraZeneca); PD1 / PDL1 inhibitors such as antibodies, including pembrolizumab (Merck), sintilimab (Eli Lilly and Company), tislelizumab (BeiGene), toripalimab (Coherus / Junshi Biosciense Company), spartalizumab (Novartis), camrelizumab (Jiangsu HengRui Medicine C), nivolumab (Bristol-Myers Squibb), pidilizumab (Medivation / Pfizer), MEDI0680 (AMP-514; AstraZeneca), cemiplimab (Regeneron) and PDR001 (Novartis); fusion proteins such as a PD-L2 Fc fusion protein (AMP- 224; GlaxoSmithKline); atezolizumab (Roche / Genentech), avelumab (Merck / Serono and Pfizer), durvalumab (AstraZeneca), KN035 (Jiangsu Alphamab Biopharmaceuticals Company), Cosibelimab (CK-301; Checkpoint Therapeutics), BMS-936559 (Bristol-Myers Squibb), BMS-986189 (Bristol-Myers Squibb); and small molecule inhibitors such as PD-1 / PD-L1 Inhibitor 1 (WO2015034820; (2S)-1- [[2,6-dimethoxy-4-[(2-methyl-3-phenylphenyl)methoxy]phenyl] methyl]piperidine- 2-carboxylic acid), BMS202 (PD-1 / PD-L1 Inhibitor 2; WO2015034820; N-[2-[[[2- methoxy-6-[(2-methyl[1,1'-biphenyl]-3-yl)methoxy]-3-pyridinyl]methyl]amino] ethyl]-acetamide), PD-1 / PD-L1 Inhibitor 3 (WO / 2014 / 151634; (3S,6S,12S,15S,18S,21S,24S,27S,30R,39S,42S,47aS)-3-((1H-imidazol-5-yl)methyl)- 12,18-bis((1H-indol-3-yl)methyl)-N,42-bis(2-amino-2-oxoethyl)-36-benzyl-21,24- dibutyl-27-(3-guanidinopropyl)-15-(hydroxymethyl)-6-isobutyl-8,20,23,38,39- pentamethyl-1,4,7,10,13), CA-170 (Curis) and ladiratuzumab vedotin (Merck). The auxiliary immune therapy used in the treatment of individuals with triple negative breast cancer and typed according to the invention can comprises any of the immunotherapeutic agents known to treat cancer patients. Said immunotherapeutic agent preferably includes an immune checkpoint inhibitor. Said immune checkpoint inhibitor is preferably administered intravenously, preferably by infusion. Said immune checkpoint inhibitor preferably is administered once every 2-4 weeks for a period of 1-24 weeks. The preferred dosage of selected immune checkpoint inhibitors is 2-4 mg / kg. preferably about 3 mg / kg every 2-4 weeks, or 240-480 mg every 2-4 weeks for ipilimumab; 100-400 mg, preferably about 200 mg every 2-4 weeks, preferably every 3 weeks for pembrolizumab; 100-500 mg, preferably 240-480 mg every 2-4 weeks, preferably every 2 weeks for nivolumab; 2-12 mg / kg. preferably 4-8 mg / kg every 2-4 weeks, preferably every 4 weeks for pidilizumab; 100-500 mg, preferably about 350 mg every 2-4 weeks, preferably every 3 weeks for cemiplimab; 600-1800 mg, preferably about 1200 mg every 2-4 weeks, preferably every 3 weeks for atezolizumab; 400- 1200 mg, preferably about 800 mg, every 2-4 weeks, preferably every 2 weeks for avelumab; and 5-15 mg / kg, preferably about 10 mg / kg, or 1000-2000 mg, preferably about 1500 mg, every 2-4 weeks, preferably every 2 weeks for durvalumab. A person skilled in the art will understand that the dosage in a combination according to the invention, may be at the low range of the indicated dosages, or even below the indicated dosages. In this invention, preferably, the auxiliary immune therapy includes a monoclonal antibody targeting programmed cell death protein 1 (PD-1) receptors of lymphocytes such as pembrolizumab. For the purpose of clarity and a concise description, features are described herein as part of the same or separate aspects and preferred embodiments thereof, however, it will be appreciated that the scope of the invention may include embodiments having combinations of all or some of the features described. The invention will now be illustrated by the following examples, which are provided by way of illustration and not of limitation and it will be understood that many variations in the methods described and the amounts indicated can be made without departing from the spirit of the invention and the scope of the appended claims. 5 EXAMPLES Example 1: Identification and performance of 24 probes for the prediction of pCR following neoadjuvant immune therapy in triple negative breast cancer patients Materials and methods Sample collection and processing Tumor samples were collected from 55 TN patients from 4 pooled IO arms (anti-PDL1 / PARPi, anti-PD1 / TLR9 dual-IO, and anti-PD1 + / - LAG3 dual-IO, all plus taxane / anthracycline) of the I-SPY 2 TRIAL (NCT01042379). All the included patients have HR - and HER2 – negative (TN) tumors and a MammaPrint High Risk profile. From these 55 patients, 30 patients had pCR, while 25 did not (Table 2) (here referred as “Train” dataset). From these tumor samples RNA was extracted (Qiagen RNeasy Mini Kit) from FFPE tissue and hybridized to single channel full genome microarrays (Agilent). Furthermore, an independent treatment- and response-comparable data set comprising pre-treatment, FFPE samples of a total of 56 breast cancer patients was selected. Sample collection and processing was performed similarly as for the Train dataset. From these 56 patients, 31 patients had pCR, while 25 did not (Table 2) (here referred as “Test” dataset) Table 2: Description of the Train- and Test datasets. All patients enrolled were triple negative (TN) breast cancer patients. Abbreviations: pCR: pathological Complete Response; RD: Residual Disease; FFPE: Formalin-Fixed Paraffin- Embedded. Dataset N tumor pCR RD samples Train dataset 55 FFPE 30 25Test dataset 56 FFPE 31 25To evaluate the stability (precision) a set of FFPE samples that were analyzed multiple times was used: In total six samples were included, two at the lower end of the dynamic range, two at the upper end and two near the threshold (here referred as “Stability” dataset). Each of the six samples were analyzed multiple times in a similar way as the Train- and Test datasets, on different days and the measurements included different laboratory variables such as lot numbers of reagents / kits used, operators and equipment (Table 5). Analysis methods The probes were selected from a list of 96 probes mapped to genes, representing STAT-1, chemokine, cytokine, and dendritic cell biology and templates were determined by use of the function “nearestCentroidPredictor” in the R package ‘WGCNA’, the R package ‘matrixStats’ and base R in the Train dataset. To identify the probes that are most predictive of immune sensitivity and to determine the templates, selection was performed by comparing pCR and RD groups by iteratively splitting the dataset in training (n-1) and test (1), balancing them on response (pCR versus RD) status. This process was repeated for 100 iterations for all 55 FFPE samples. The index of the created gene classifier ImPrint-TN was calculated using the same classifier as for MammaPrint. In short, a correlation (Pearson correlation coefficient) was determined between the centroids of the pCR group and RD group, resulting in a correlation based prediction index. Next, this correlation based index was scaled between 0 and 100 using a sigmoid function (M Bakr and M Negm, 2012. Elsevier 174: 223-260), the numerical result of this algorithm is here referred to as the “ImPrint-TN Score”. The ImPrint-TN Score can be compared to a threshold value to obtain the binary classification of samples into ImPrint-TN Positive or ImPrint-TN Negative class. The natural (midpoint-) threshold for classification is at a value of 50. The clinical utility of the ImPrint-TN algorithm will be to predict which patients are unlikely to respond to immunotherapy (IO); these patients can forgo this type of therapy to avoid the risk of sometimes life-long irreversible adverse effects. However, special care must be taken to avoid predicting ImPrint-TN Negative for patients that actually would have benefitted from IO therapy (False Negatives). Therefore, the threshold was further optimized for higher NPV (i.e. to minimize the number of false negatives) while keeping the prevalence of ImPrint-TN Positive outcomes within an acceptable range. This optimization was done within the Train dataset, using a cross-validation method that iterated on random partitions into 2 / 3 – 1 / 3 splits of the samples: In each iteration the objective was to achieve NPV of at least 85% and prevalence of ImPrint-TN Positive no higher than 65% within the 2 / 3-portions. The final threshold was determined as the average of the thresholds that obtained most favorable results on these objectives in the independent 1 / 3- portions. The optimized threshold according to this strategy was found to be 32.4. Validation To assess the clinical performance of the ImPrint-TN classifier, the predictions were compared to the true class labels (pCR / RD) in the Train dataset (using Leave-One-Out Cross Validation (LOOCV)), and in the independent Test dataset. The performance was measured using accuracy, prevalence, Positive Predictive Value (PPV) and Negative Predictive Value (NPV). The stability of ImPrint-TN was assessed by calculating standard deviation (SD) and standard deviation relative to the dynamic range (RSD) in the Stability dataset. Results Selected probes For the list of candidate probes, a selection was made from 96 probes mapping to genes known to represent the following biology: STAT-1, cytokines, chemokines and dendritic cell biology. This resulted in a signature of in total 24 probes mapping to 24 unique exons of 22 genes. The probes and corresponding genes are shown in Table 1. The predictive value was firstly assessed using LOOCV in the Train dataset: The responders to treatment were predicted with overall accuracy of 80%. NPV, PPV and prevalence in this cohort were 89%, 76% and 67% respectively (Table 3). Next, the same performance indicators were measured in the independent Test dataset; here the overall accuracy was 73%, NPV and PPV were 78% and 71% and prevalence was 68% (Table 4). In the Stability dataset the relative stability of repeated measurements was between 96.5% and 99.0% (Table 5). Table 3: Performance of ImPrintTN in the train dataset with leave on out cross- validation (LOO-CV) and FFPE templates. Abbreviations, NPV: Negative Predicted Value; PPV: Positive Predicted Value; RD: Residual Response; pCR: pathological Complete Response. Train dataset (LOO-CV) ImPrint-TN predictionImPrint-TN Negative ImPrint-TN Positive PathologicaRD 16 9l response pCR 2 28Accuracy: 80% NPV: 89%PPV: 76% Prevalence: 67% Table 4: Performance of ImPrint-TN in the test dataset with FFPE templates. Abbreviations, NPV: Negative Predicted Value; PPV: Positive Predicted Value; RD: Residual Response; pCR: pathological Complete Response. Test dataset ImPrint-TN predictionImPrint -TN Negative ImPrint -TN Positive PathologicaNo pCR 14 11l response pCR 4 27Accuracy: 73% NPV: 78%PPV:71% Prevalence:68% Table 5: Stability of ImPrint-TN. Sample name Count Mean SD RSD (%) Stability (%)Sample 1 21 9.62 0.97 0.97 99.03Sample 2 21 9.81 1.87 1.87 98.13Sample 3 21 33.51 3.52 3.52 96.48Sample 4 11 21.75 3.11 3.11 96.89Sample 5 21 89.92 1.70 1.70 98.30Sample 6 33 90.82 1.44 1.44 98.56Conclusion A 24 probe classifier, called ImPrint-TN, was identified that can accurately predict if a patient with triple negative breast cancer is likely to achieve pCR or not upon IO treatment. Example 2. Comparison with other signatures To assess the added value of ImPrint-TN, the predictions of the independent Test dataset were compared to those of ImPrint and several other published immune- related signatures that have been used in the Durvalumab / Olaparib validation dataset. As can be seen in Figure 1 and Table 6 the ImPrint-TN signature outperforms all the signatures in the comparison. Table 6. Multiple statistics on performance in the Test dataset comparing ImPrint- TN to ImPrint and other published signatures. Reference to the following studies is made, Ref 1: Rody et al., 2009. Breast Cancer Res 11:R15; Ref 2: Coppola et al., 2011. Am J Pathol 179: 37-45; Ref 3: Yau et al., 2013. Breast Cancer Res 15: R103; Ref 4: Danaher et al., 2017. J Immunother Cancer 5: 18 and Ref 5: WO2023 / 224487. Accuracy Sensitivity SpecificityF1- score ImPrint-TN 0.75 0.77 0.72 0.77ImPrint Ref 5 0.55 0.87 0.16 0.68Chemokine 12 Ref 1 0.57 0.65 0.48 0.63STAT1 Ref 2 0.50 0.58 0.40 0.56ICS5 Ref 3 0.46 0.55 0.36 0.53B Cells Ref 4 0.59 0.68 0.48 0.65Dendritic cells Ref 4 0.57 0.42 0.76 0.52Example 3. Determination of minimal number of probes To assess how many probes are minimally needed for a meaningful classification the performance of the signature was evaluated for different amounts of randomly selected probes: The number of probes was initially set to 3 and then stepwise incremented to 23. For each number of probes, 100,000 random selections of that amount of probes were selected and for each selection the performance of the signature was evaluated using the accuracy of the classifications in the Test dataset. An average accuracy of at least 0.7 was deemed necessary for a meaningful classification: Figure 2 shows that this objective was satisfied when at least 10, preferably 12 probes were selected, corresponding to at least 10, preferably 12 unique exons of marker genes. Example 4. Prevalence of ImPrint-TN The prevalence of the ImPrint-TN score was determined by dividing the number of positive outcomes over the total number of outcomes (Table 7) for the train, test and FLEX datasets. FLEX (NCT03053193) is an ongoing registry trial with 97 sites open in the United States and 2 international sites. Patients enrolled in FLEX have early- stage breast cancer and receive standard of care MammaPrint (MP) testing with or without BluePrint (BP) molecular subtyping and consent to clinically annotated full genome data collection. MP is a 70-gene risk of distant recurrence signature that classifies patients as Low Risk or High Risk. BP, a 80-gene molecular subtyping signature, categorizes patients’ tumors as Luminal-, HER2- or Basal- Type. Table 7: Prevalence for ImPrint-TN in train dataset, test dataset, and FLEX datasets, separately shown for BluePrint and clinical subtype. Number Immune- Immune- Prevalence of sensitive insensitive 10 samples Train dataset 55 37 18 67.27%Test dataset 56 38 18 67.86%FLEX 588 327 261 55.61%

Claims

Claims 1. A method of typing a sample comprising triple negative breast cancer cells or comprising gene expression products from these breast cancer cells, of an individual with breast cancer for predicting a response to auxiliary immune therapy, comprising: (i) isolating RNA from the sample obtained from the individual; (ii) determining an expression level of at least 10 marker genes to therebyprovide an expression profile for the marker genes, wherein the marker genes are selected from the genes listed in Table 1; (iii) comparing the individual’s expression profile to a reference expression profile of the at least 10 marker genes; thereby typing the sample for predicting a response to auxiliary immune therapy.

2. The method according to claim 1, wherein the sample is either a fresh frozen or a formalin-fixed paraffin-embedded sample.

3. The method according to any one of claims 1-2, wherein the auxiliary immune therapy comprises treatment with an immune checkpoint inhibitor.

4. The method according to any one of claims 1-3, wherein the auxiliary immune therapy comprises treatment with an immune checkpoint inhibitor such as programmed cell death protein 1 (PD1) or programmed cell death ligand 1 (PDL1) inhibitor.

5. The method according to any one of claims 1-4, wherein the determination of the expression profile is performed using RNA-sequencing or microarray gene expression analysis.

6. The method according to any one of claims 1-5, wherein the expression profile comprises at least 12 different marker genes, preferably at least 15 different marker genes, preferably at least 20 different marker genes of the genes indicated in Table 1.

7. The method according to any one of claims 1-6, wherein the expression profile of all 22 different marker genes listed in Table 1 is determined.

8. The method according to any one of claims 1-7, wherein the reference expression profile is composed of the average expression levels of the marker genes specified in step (ii) of individuals having a positive response to auxiliary immunetherapy; of individuals not having a positive response to auxiliary immune therapy; or of a mixture of individuals having a positive response to auxiliary immune therapy and individuals not having a positive response to auxiliary immune therapy.

9. The method according to any one of claims 1-8, wherein the individual’s expression profile is compared to two reference expression profiles, wherein one reference expression profile is composed of the average expression levels of the marker genes specified in step (ii) of individuals having a positive response to auxiliary immune therapy and the other reference expression profile is composed of the average expression level of the marker genes specified in step (ii) of individuals not having a positive response to auxiliary immune therapy.

10. The method according to any one of claims 1-9, wherein the response is a pathologic complete response (pCR).

11. A method of treating an individual with breast cancer, comprising - typing of a sample from said individual using a method according to any one of claims 1-10; - treating the individual that is typed as predictive of having response to auxiliary immunotherapy with auxiliary immunotherapy, optionally in combination with chemotherapy; and - treating the individual that is typed as predictive of not having response to auxiliary immunotherapy with chemotherapy.

12. The method according to claim 11, wherein the auxiliary immunotherapy comprises an immune checkpoint inhibitor.

13. The method according to claim 12, wherein the immune checkpoint inhibitor is a programmed cell death protein 1 (PD1) or programmed cell death ligand 1 (PDL1) inhibitor.

Images