Compositions for reducing SMAD3 expression in a blood vessel and methods of using
By administering a vector to reduce SMAD3 expression in blood vessels, the method addresses the failure of blood vessel grafts and AVFs by inhibiting neointimal hyperplasia and enhancing patency, as shown in a large animal model.
Patent Information
- Application Number
- PCT/US2025/020843
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-03-25
- Filing Date
- 2025-03-21
- Publication Date
- 2025-10-02
AI Technical Summary
Blood vessel grafts and arterio-venous fistulas (AVFs) experience high failure rates due to thrombosis, neointimal hyperplasia, and adverse remodeling, with existing medical and surgical therapies failing to maintain optimal patency.
Administer a vector containing a payload that reduces SMAD3 expression in blood vessels or blood vessel grafts by using nucleic acids or proteins, such as siRNA or shRNA, to inhibit SMAD3 expression, thereby reducing neointimal hyperplasia, increasing endothelization, and enhancing patency.
The method effectively reduces SMAD3 expression, leading to decreased neointimal hyperplasia, increased endothelization, and improved patency in blood vessel grafts and AVFs, as demonstrated in a large animal model.
Smart Images

Figure US2025020843_02102025_PF_FP_ABST
Abstract
Description
COMPOSITIONS FOR REDUCING SMAD3 EXPRESSION IN A BLOOD VESSEL AND METHODS OF USINGFIELD
[0001] The disclosure relates to compositions and methods in the field of molecular biology and medicine. Specifically, the disclosure relates to compositions and methods for reducing SMAD3 expression in a blood vessel in a patient in need thereof.STATEMENT REGARDING FEDERALLY FUNDED RESEARCH AND DEVELOPMENT
[0002] This invention was made with government support under grants R01HL130423 and R01HL135093 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND
[0003] Blood vessel grafts are used for many indications, including bypass graft surgery and arterio-venous fistula (AVF) formation. However, blood vessel patency following blood vessel grafting or AVF formation is suboptimal for various reasons, including the occurrence of thrombosis, neointimal hyperplasia, and adverse blood vessel remodelling.
[0004] Despite significant advances in medical and surgical therapies, changes in global disease prevalence and population demographics are driving an epidemic of cardiometabolic disease. As a treatment that has been practiced for decades, various forms of blood vessel graft surgery, including interposition vein grafting into the arterial circulation, remain mainstay surgical options for the treatment of occlusive atherosclerotic disease. However, the prognosis of grafted blood vessels is far from ideal. For example, it has been reported that at 12-18 months after surgery, up to 42% of vein grafts experience some level of failure and up to 25% of vein grafts may fail completely. In addition, for saphenous veins that are used for coronary artery bypass graft surgery that does not involve the left anterior descending coronary artery, up to 50% of these grafts are reported to be occluded within 10 years.
[0005] As a closely related issue, the incidence of end-stage kidney disease is also increasing, and approximately half a million US-Americans were undergoing dialysis at the end of 2018. In order to undergo dialysis, the creation of an arterio-venous fistula (AVF) is often required. Like interposition vein grafting, the creation of an AVF exposes a segment of vein to arterial shear forces and pressures. Consistent with this, AVFs also have a high failurerate during both the ‘maturation’ period after creation, and also during ongoing use for dialysis. Specifically, during the first 1-2 months after AVF creation, about 30-50% AVFs fail to mature to an optimally usable state, while for matured AVFs that are used for dialysis the additional failure rate is around 30-40% at 6-12 months.
[0006] Accordingly, new compositions and methods that maintain desirable blood vessel patency in blood vessel grafts and AVFs are urgently needed.SUMMARY
[0007] Provided herein are compositions and methods for reducing SMAD3 expression in a blood vessel or blood vessel graft in a patient in need thereof.
[0008] Provided is a method of reducing blood vessel graft stenosis in a subject in need thereof, the method comprising: (a) partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft. Provided herein is a method of reducing stenosis in a blood vessel in an arterio-venous fistula (AVF) in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In one embodiment, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 min. In some embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 40 min, at least 45 min, at least 50 min, at least 60 min, at least 70 min, at least 80 min, at least 90 min, at least 100 min, at least 110 min, at least 120 min, at least 130 min, at least 140 min, at least 150 min, at least 160 min, at least 170 min, or at least at least 180 min. In oneembodiment, the method reduces neointimal hyperplasia in the blood vessel. In one embodiment, the method increases endothelization in the blood vessel. In one embodiment, the method comprising fully removing the portion of the blood vessel from the subject. Provided herein is a method of reducing neointimal hyperplasia and / or increasing endothelization in a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In one embodiment, the method increases blood vessel patency. In one embodiment, the method reduces endothelial to mesenchymal transition (EndMT) in the blood vessel. In one embodiment, the method reduces thrombosis in the blood vessel. In one embodiment, the method reduces TGF-beta signaling in the blood vessel.
[0009] In one embodiment, the subject has a cardiovascular disease. In one embodiment, the subject has occlusive atherosclerotic disease. In one embodiment, the blood vessel is a vein, and wherein the subject is receiving vein graft surgery. In one embodiment, the vein graft surgery is interposition vein grafting into the arterial circulation, or bypass surgery. In one embodiment, the method reduces adverse vein graft remodeling.
[0010] In one embodiment, the blood vessel is a vein. In one embodiment, the blood vessel is an artery.
[0011] In one embodiment, the subject has kidney disease. In one embodiment, the subject is undergoing dialysis.
[0012] In some embodiments, the payload is a nucleic acid or a protein. In one embodiment, the payload is a nucleic acid. In some embodiments, the nucleic acid is (i) a DNA molecule encoding an RNA molecule that reduces expression of SMAD3 or (ii) an RNA molecule that reduces expression of SMAD3. In some embodiments, the RNA is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA). In some embodiments, the payload comprises (a) (i) a DNA molecule encoding a guide RNA (gRNA) that is substantially complementary to the SMAD3 gene or (ii) a gRNA that is substantially complementary to the SMAD3 gene; and (b) one or more nucleic acid sequences encoding one or more RNA-guided DNA endonucleases. In some embodiments, the one or more RNA-guided DNA endonucleases are selected from Cas9, CasX, CasY, Cast 3, or Cpfl.
[0013] In one embodiment, the vector is a non-viral vector. In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is a lentiviral vector.
[0014] In one embodiment, the subject is human.BRIEF DESCRIPTION OF THE FIGURES
[0015] Figs. 1A and IB illustrate results from a pilot study designed to assess the efficacy of EndMT inhibition in a preclinical, large animal AVF model (Phase 0). In this Phase 0 pilot study, the objective was to prove that this AVF model exhibited robust EndMT (thus providing the subsequent rationale and justification to inhibit EndMT). Representative immunofluorescence staining of EndMT 15 days after AVF creation. Analyses were performed using a paired Student’s t test. n=3 pigs per group, where each pig was in both the control (untouched left femoral vein) and AVF (right femoral vein) groups. Fig. 1A. Percentage of CD31+SM22a+cells. Fig. IB. Percentage of VE-Cad+aSMA+cells.
[0016] Figs. 2 illustrates the efficacy of a SMAD3 knockdown in pig endothelial cells using lentiviral construct (Phase 1). Shown are the results of Real-Time Quantitative Reverse Transcription PCR (qRT-PCR) analysis of the efficacy of SMAD3 knockdown using a lentiviral construct containing SMAD3 shRNA versus the same lentiviral construct containing scramble shRNA control. The lentiviral constructs were transfected into pig coronary artery endothelial cells (PCAECs) cultured in vitro. Analysis was performed using an unpaired Student’s t test, n = 3 per group. For all Figures: ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001.
[0017] Figs. 3A, 3B, 3C, 3D, and 3E illustrate the efficacy of a SMAD3 knockdown and inhibition of EndMT in a preclinical, large animal AVF model (Phase 1). Fig. 3A. Schematic representation of the surgical method including dwelling of lentivirus. Here in Phase 1, the AVF in the right leg was harvested from six pigs eight days after AVF creation, where three pigs were randomized to receive lentivirus carrying scramble shRNA (Scr; controls) and three pigs received lentivirus carrying SMAD3 shRNA (SMAD3 KD). Arrowheads indicate the section of vein where the lentivirus was allowed to dwell. Figs. 3B, 3C, 3D, and 3E. Quantitation of SMAD3 and pSMAD3 in endothelial cells 8 days after AVF creation as determined by quantitative immunofluorescence staining. CD31 and VE-Cad are endothelial markers. SM22a and aSMA are mesenchymal markers. Analyses performed using unpaired Student’ s t test. *p < 0.05; **p < 0.01; ***p < 0.001. n=3 pigs per group for all analyses. Fig. 3B. Percentage of cells expressing SMAD3. Fig. 3C. Percentage of cells expressing phospho-SMAD3 (pSMAD3). Fig. 3D. Percentage of CD31+SM22a+cells. Fig. 3E. Percentage of VE- Cad+aSMA+cells.
[0018] Figs. 4A, 4B, 4C, 4D, and 4E illustrate the ultrasound and angiographic evaluation of the efficacy of EndMT inhibition by SMAD3 knockdown in a preclinical, large animal AVF model at 30 days (Phase 2). Fig. 4A. Ultrasound measurement at 30 days after AVF creation to assess the surgical anastomotic site and equivalence of AVF creation between groups. Shown is the orientation of the ultrasound probe during scanning with respect to the AVF. Arrowheads indicate the section of vein where the lentivirus was allowed to dwell. The frame indicates the ultrasound scanning window. Fig. 4B. Shown are representative ultrasound images from scramble (control) and SMAD3 knockdown pigs, respectively. The line indicates the diameter of anastomosis; A indicates artery; V indicates vein. Scale bar = 5 mm. Fig. 4C. Quantifications of the anastomosis diameter, vein area and artery area as measured by ultrasound (as acquired at the anastomosis site in the image plane as shown). Anastomosis diameter and artery area were compared using an unpaired Student’s t test, while vein area was compared using a Mann -Whitney test. These images indicate that the AVFs were created equally between groups. Fig. 4D. Angiographic measurement of AVF diameter, stenosis and patency 30 days after creation. “Minimum vein diameter” represents the minimum diameter of the lentivirus-treated segment of the venous limb of the AVF. “Maximum vein diameter” represents the maximal diameter of the lentivirus-treated segment of the venous limb of the AVF. “Reference vein diameter” represents the diameter of the reference vein segment from the adjacent untreated portion of the vein (cranial from the site of lentivirus dwelling). Fig. 4E. “Stenosis of grafted vein” represents the stenosis of the lentivirus-treated segment of the venous limb of the AVF (determined by comparing the minimum with the reference diameters) presented as either % stenosis or the proportion with stenosis <70% (lower portion of each bar) versus >70% (upper portion of each bar). Minimum and maximum vein diameter were compared using a Mann-Whitney test. Reference vein diameter and % stenosis of grafted vein were compared using an unpaired Student’s t test. Stenosis of grafted vein (<70% versus >70%) was compared using a Chi-square test. (Figs. 4C, 4D, 4E: *p < 0.05; **p < 0.01; ns, not significant. n=8 pigs per group for all analyses).
[0019] Figs. 5A, 5B, 5C, 5D, 5E, 5F, and 5G illustrate the histologic and immunofluorescence evaluation of the efficacy of EndMT inhibition by SMAD3 knockdown in a preclinical, large animal AVF model at 30 days (Phase 2). Lumen area (Fig. 5B) was calculated from the inner perimeter (z.e., inner circumference, Fig. 5A) and assuming the vessel was circular in cross-section. Images were obtained from the narrowestportion of the venous limb of the AVF. Fig. 5C. Elastic van Gieson (EVG) stain was used to identify the inner elastic lamina that demarcates the intima-media boundary, with quantitation of overall neointimal thickness (from the intima-media boundary to the intima) for each AVF determined by averaging the neointimal thickness measurement from three sites per AVF from a single section. Fig. 5D. Immunofluorescence staining was performed for CD31 and eNOS and quantified. Fig. 5E. Immunofluorescence staining of DAPI-stained nuclei for the cells of Fig. 5D was quantified. Fig. 5F. Immunofluorescence staining was performed for VE-Cad and eNOS (Endothelial NOS, also known as nitric oxide synthase 3 (NOS3)) and quantified. Fig. 5G. Immunofluorescence staining of DAPI-stained nuclei for the cells of Fig. 5F was quantified. n=8 pigs per group for all analyses.
[0020] Figs. 6A, 6B, 6C, and 6D illustrate the effect of EndMT inhibition by SMAD3 knockdown on cell proliferation, apoptosis and immune cell infiltration in a preclinical, large animal AVF model at 30 days (Phase 2). Fig. 6A. Assessment of cell proliferation with representative immunofluorescence staining for CD31 and ki67, as well as DAPI-staining of nuclei. Fig. 6B. Assessment of apoptosis by TUNEL assay and assessment of DAPI-stained nuclei. Fig. 6C. Assessment of immune cell infiltration by immunofluorescence staining for CD45 as well as DAPI-staining of nuclei. Fig 6D. Assessment of immune cell infiltration by immunofluorescence staining for CD68 as well as DAPI-staining of nuclei. All analyses performed using a Mann-Whitney test except for in Fig. 6C; CD45+cell / total DAPI analysis was performed with an unpaired Student’s t test, ns = not significant. n=8 pigs per group for all analyses.DETAILED DESCRIPTION
[0021] Provided herein are compositions and methods for reducing SMAD3 expression in a blood vessel or blood vessel graft in a subject in need thereof. Also provided herein are compositions and methods for reducing blood vessel graft stenosis in a subject, preventing occlusion of a blood vessel or a blood vessel graft, reducing neointimal hyperplasia in a blood vessel or a blood vessel graft, increasing endothelization in a blood vessel or a blood vessel graft, increasing patency in a blood vessel or a blood vessel graft, reducing endothelial to mesenchymal transition (EndMT) in a blood vessel or a blood vessel graft, reducing thrombosis in a blood vessel or a blood vessel graft and / or reducing TGF-beta signaling in a blood vessel or a blood vessel graft.
[0022] Blood vessels are channels or conduits through which blood is distributed to body tissues. A blood vessel can be an artery or a vein. Arteries comprise three layers. The tunicaintima (also called tunica interna) is the innermost layer and consists of simple squamous epithelium surrounded by a connective tissue basement membrane with elastic fibers. The tunica media constitutes the middle layer and is primarily composed of smooth muscle, which provides structural support and changes vessel diameter to regulate blood flow and blood pressure. The tunica externa or tunica adventitia is the outermost layer, comprises connective tissue, and attaches the vessel to the surrounding tissue. Veins comprise the same three layers as the arteries, but contain less smooth muscle and connective tissue.
[0023] As used herein, a blood vessel graft or vascular graft is a blood vessel that is implanted into the patient, for example, to bridge an obstruction in the patient’s blood vessel(s) or as part of a arterio-venous fistula (AVF) (z.e., a connection between an artery and a vein). In some embodiments, the blood vessel graft is an autologous graft from the patient, which can, for example, be taken from the saphenous vein from the leg or the internal thoracic artery in the chest wall. A blood vessel graft may also be obtained from another human (z.e., an allogeneic donor) or a non-human donor animal (if compatible). A blood vessel graft can be bio-engineered using a method known to a person skilled in the person, including, but not limited to grafts made of out polyester fibers such as Dracon, or grafts generated by 3D- printing). In one embodiment, the blood vessel graft is a vein graft (z.e., a portion of a vein is grafted). In one embodiment, the blood vessel graft is an artery graft. In one embodiment, the blood vessel graft is the graft of a saphenous vein. In one embodiment, the blood vessel graft is an internal mammary artery graft. In some embodiments, the blood vessel graft is a graft of a radial artery, an internal thoracic artery, or a gastroepiploic artery. The final surgical graft created may be achieved using a variety of approaches including, but not limited to, interpositional grafting, grafting where the proximal end of the graft remains naturally attached to the arterial system but the distal end is anastomosed onto the arterial tree beyond a blockage (classically an internal mammary artery graft), the direct connection of a vein to an artery such as with an AVF, or various other approaches.
[0024] In one embodiment, the subject receiving the blood vessel graft has a cardiometabolic disease. In some embodiments, the subject receiving the vein graft is receiving bypass surgery. In one embodiment, the subject is receiving coronary artery bypass surgery. In one embodiment, the subject is receiving peripheral artery bypass surgery. In one embodiment, the subject is receiving interposition vein grafting surgery.
[0025] In some embodiments, the subject receiving the blood vessel graft has end-stage kidney disease and / or is undergoing dialysis. In one embodiment, the subject is receiving surgery involving the creation of a AVF.
[0026] SMAD3 and Reduction of SMAD3 Expression
[0027] SMAD3
[0028] SMAD proteins are a group of intracellular signal transducer proteins that are similar to the gene products of the Drosophila gene “mothers against decapentaplegic” (Mad) and the C. elegans gene Sma. SMAD3, also referred to as mothers against decapentaplegic homolog 3, regulates gene activity and cell proliferation. SMAD3 is a mediator of TGF-beta signaling. SMAD3 can be activated by TGF-beta 1, but also by stress molecules such as angiotensin II (Ang II), advanced end products (AGEs), and C-reactive protein (CRP). SMAD3 interacts with other signaling pathways, including the ERK / p38 MAPK and NF-kappaB pathway.
[0029] Provided herein are methods of reducing or abolishing local SMAD3 expression in a blood vessel. As used herein, “reducing SMAD3 expression” can refer to a reduction in SMAD3 expression by at least 5%, by at least 10%, by at least 20%, by at least 30%, by at least 40%, by at least 50%, by at least 60%, by at least 70%, by at least 80%, by at least 90%, by at least 95%, or by 100% as compared to a control. “Reducing SMAD3 expression” can refer to a reduction in SMAD3 expression by at least 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, 100- fold, or 10,000-fold, as compared to a control. The control may be SMAD3 expression in the same blood vessel before receiving treatment resulting in a reduction in SMAD3 expression. The control may be a control value for SMAD3 expression obtained from one or more blood vessels from one or more subjects defined as a control group. In some embodiments, SMAD3 expression is measured in the same blood vessel before (control) and after intervention. As used herein, reducing or abolishing SMAD3 expression includes interference with SMAD3 on the nucleic acid level (e.g., by interfering with the SMAD 3 gene or by interfering with SMAD 3 mRNA) as well as interference with SMAD3 on a protein level (e.g., by increasing degradation of the SMAD3 protein, by reducing or inhibiting activity of the SMAD3 protein, and / or by interfering with the structural integrity of the SMAD3 protein).
[0030] Agents for Knocking Down SMAD 3
[0031] In one embodiment, a method disclosed herein results in a SMAD3 knockdown. As used herein, a gene knockdown refers to a process in which the expression of a gene in a cell is reduced partially (opposed to silenced fully) and / or temporarily (opposed to permanently). In some embodiments, the gene knockdown does not affect or even involve host DNA. A gene knockdown can be achieved, for example, by degrading the mRNA corresponding to a gene of interest or by blocking translation of the mRNA.
[0032] In some embodiments, the SMAD3 knockdown is achieved by RNA interference (RNAi), a biological process in which RNA molecules are used to inhibit gene expression. Typically, short RNA molecules are created that are complementary to endogenous mRNA and when introduced into cells, bind to the target mRNA. Binding of the short RNA molecule to the target mRNA functionally inactivates the target mRNA and may lead to degradation of the target mRNA.
[0033] In some embodiments, provided is a method of reducing SMAD3 expression in a cell by delivering into the cell a shRNA (small hairpin RNA). “Small hairpin RNA” or “shRNA”, as interchangeably used herein, are polynucleotides having a sugar phosphate backbone comprising ribose units and comprising the nucleobases adenine, guanine, uracil and cytosine. Although RNA is typically single-stranded, the self-complementarity of the 5' and 3'- ends of a shRNA molecule leads to the formation of secondary structures, conventionally termed as “hairpin structures” that consist of a stem region of two complementary arms, the 5' and 3' arm, that are typically connected by a loop structure. The shRNA molecules described herein typically comprise up to 80 nucleotides, preferably 21 to 65 nucleotides, more preferably about 25 nucleotides. In embodiments, shRNA molecules disclosed herein are expressed from a vector introduced into the cell. These shRNA molecules are processed within the cell into short (e.g., 20-25 nucleotides) double-stranded RNA molecules, which are then processed and incorporated into the RNA-induced silencing complex (RISC), which then complexes with target mRNAs to mediate RNA degradation or translation inhibition. The end result is downregulation of gene expression, without any change to the gene itself. shRNA may be incorporated into plasmid vectors and / or integrated into genomic DNA for longer-term or stable expression, and thus longer knockdown of the target mRNA.
[0034] In embodiments, provided is a DNA sequence encoding an shRNA molecule, wherein the DNA sequence has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to GATCCCAGAGGTGGATGTTATGAATTCAAGAGATTCATAACATCCACCTCTGTTT TT (SEQ ID NO: 1). As will be appreciated by a person skilled in the art, the transcribed shRNA and the resulting siRNA will contain U instead of T.
[0035] In some embodiments, provided is a method of reducing SMAD3 expression in a cell by delivering into the cell a siRNA (small interfering RNA). siRNA molecules are typically double-stranded RNA molecules. When transfected into cells, siRNA inhibit the target mRNA transiently until they are also degraded within the cell. siRNA molecules are often of about 15 to about 40 nucleotides in length, of about 15 to about 28 nucleotides, of about 19 to about 25nucleotides in length, or about 19, 20, 21, or 22 nucleotides in length. In one embodiment, the siRNA molecule comprises a core RNA duplex, e.g., about 15 to about 28 nucleotides in length, with a 3' overhang of, for example, one or two nucleotides, on, independently, either one or both strands.
[0036] It is understood that modified derivatives of the RNA molecules disclosed herein may be provided, which may be modified with any of the known modifications in the art to improve efficacy and / or resistance to nuclease degradation. For example, the sugar phosphate backbone may be modified. Illustrative modifications include, without limitation, phosphorothioate usage instead of the native backbone or 2'-fluoro modifications. RNA molecules disclosed herein be chemically synthesized, can be produced by in vitro transcription, or can be produced within a host cell.
[0037] Agents for Knocking Out SMAD3
[0038] In other embodiments, a method disclosed herein results in a SMAD3 knockout. As used herein, a gene knockout refers to a process in which the expression of a gene in a cell is permanently and fully silenced. This can be achieved by several methods known to a person skilled in the art, including excision of a portion or the entire gene from the genome, introduction of a frameshift mutation, or introduction of a mutation that results in the introduction of a stop codon.
[0039] In some embodiments, one or more of a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-associated (Cas) nuclease, Argonaute family of endonuclease, CRISPR nuclease, zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, other endo- or exo-nuclease, or combinations thereof are used to achieve the SMAD3 knockout.
[0040] In one embodiment, a CRISPR genome editing system is used to knockout the SMAD3 gene. Many CRISPR methodologies employ a nuclease, CRISPR-associated (Cas), that complexes with small RNAs as guides (gRNAs) to cleave DNA in a sequence-specific manner upstream of the protospacer adjacent motif (PAM) in a user-defined cut site. Once a double stranded break has been made to the DNA at the target site, the event triggers one of two repair pathways: either Non-Homologous End Joining (NHEJ) or Homology Directed Repair (HDR) (if a repair template is provided). If the double stranded break was made in the coding region of a gene, this process can result in the knockout of the gene.
[0041] The CRISPR system may use separate guide RNAs known as the crRNA and tracrRNA. These two separate RNAs have been combined into a single RNA to enable sitespecific mammalian genome cutting through the design of a short guide RNA. In certainembodiments, the CRISPR / Cas-like protein can be a wild type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter an enzymatic activity, and / or change another property of the protein. For example, nuclease (z.e., DNase, RNase) domains of the CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the fusion protein. The CRISPR / Cas-like protein can also be truncated or modified to optimize the activity of the effector domain of the fusion protein. In some embodiments, the CRISPR / Cas system used herein can be a type I, a type II, or a type III system. Non-limiting examples of suitable CRISPR / Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, CaslO, CaslOd, CasF, CasG, CasH, CasX, Cas , Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966. By way of further example, in some embodiments, the CRISPR-Cas protein is a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csfl, Csf4, Cas9, Casl2 (e.g., Casl2a, Casl2b, Casl2c, Casl2d, Casl2k, Casl2j / Cas , Casl2L etc.), CasB (e.g, Casl3a, Casl3b (such as Casl3b-tl, Casl3b-t2, Casl3b-t3), Casl3c, Casl3d, etc.), Casl4, CasX, CasY, or an engineered form of the Cas protein. In some embodiments, the CRISPR / Cas protein or endonuclease is Cas9. In some embodiments, the CRISPR / Cas protein or endonuclease is Casl2. In certain embodiments, the Casl2 polypeptide is Casl2a, Casl2b, Cas 12c, Casl 2d, Casl2e, Cas 12g, Casl2h, Casl2i, Casl2L or Cas 12 J. In some embodiments, the CRISPR / Cas protein or endonuclease is CasX. In some embodiments, the CRISPR / Cas protein or endonuclease is CasY. In some embodiments, the CRISPR / Cas protein or endonuclease is Cas . The guide RNA sequences can be configured as a single sequence or as a combination of one or more different sequences, e.g, a multiplex configuration. Multiplex configurations can include combinations of two, three, four, five, six, seven, eight, nine, ten, or more different guide RNAs. In some embodiments, the RNA molecules, e.g., crRNA, tracrRNA, and / or gRNA, are engineered to comprise one or more modified nucleobases. In some embodiments, a modified mRNA (modRNA)-based CRISPR system is used. See, e.g., Haideri T, Howells A, Jiang Y, Yang J, Bao X, Lian XL. Robust genome editing via modRNA-based Cas9 or base editor in human pluripotent stem cells. Cell Rep Methods. 2022 Sep 7;2(9): 100290.
[0042] Agents that Interfere with SMAD3 Protein Levels
[0043] Also contemplated here are agents that interfere with cellular SMAD3 levels by, for example, increasing degradation of the SMAD3 protein, by reducing or inhibiting activity of the SMAD3 protein, and / or by interfering with the structural integrity of the SMAD3 protein. Such agents can, for example, include peptides, polypeptides (including, but not limited to antibodies and proteases), and small molecules.
[0044] Large animal preclinical model for reducing SMAD3 expression
[0045] It has previously been shown in mice that EndMT plays a role in neointimal hyperplasia and atherosclerosis and that knocking down SMAD3 can reduce EndMT. However, the vast majority of studies examining EndMT in cardiovascular disease use small animal models, such as mice. While convenient and relatively inexpensive to use in a basic research setting, rodent model systems show limited usefulness when seeking to assess the efficacy of therapies aimed at treating human cardiovascular disease. This is because vast differences exist between mouse and humans with respect to the biology, physiology, and anatomy of their cardiovascular systems. These differences include metabolic requirements, resting heart rates, prevalence of myosin isoforms (which have a significant impact on many of the physiological and energetic properties of an organism’s cardiovascular system), myocardial energetics, basal rate of cardiac tissue, thermoneutrality, heart beats per life span, energy per heartbeat, physiology of torpor (a state in which the metabolic rate can be reduced drastically), etc. See Hamlin RL, Altschuld RA. Extrapolation from mouse to man. Circ Cardiovasc Imaging. 2011 Jan;4(l):2-4. In addition, with respect to differences in the vascular system between mice and humans, there are vast differences that include vascular diameter, vessel wall thickness, shear forces, vascular tone, Laplace’s forces, geometry, and other factors. Further, mice differ significantly from humans with respect to lipid profiles and are significantly more resistant to atherosclerosis. For example, the major circulating lipoprotein in the mouse is high-density lipoprotein, opposed to low-density lipoprotein, a large contributor to atherosclerosis progression in humans. Further, in humans, low levels of cholesteryl ester transfer protein (CETP) activity are associated with a decreased risk for cardiovascular disease. However, mice lack CETP. Additionally, inflammation plays a significant role in many types of cardiovascular disease. However, humans are five times more responsive to bacterial lipopolysaccharides, a difference that has been attributed to the differential composition of human vs. mouse blood serum. Finally, mice differ from humans in the location of atherosclerotic plaques and rarelyexperience advanced coronary lesions that progress to rupture and thrombosis. See Tsang HG, Rashdan NA, Whitelaw CB, Corcoran BM, Summers KM, MacRae VE. Large animal models of cardiovascular disease. Cell Biochem Funct. 2016 Apr;34(3): 113-32.
[0046] In contrast, pigs are much better models of human cardiovascular disease due to the significant similarities between the cardiovascular systems of these two species. To start, due to the closer similarities in anatomy and size, pig models allow the use of human clinical equipment and surgical methods. Further, pigs have a similar heart anatomy as compared to humans, including tri-layered aortic valve leaflets. Pigs also share similar lipoprotein metabolism and lipid profiles with humans. Further, like humans, pigs develop spontaneous atherosclerosis and can develop atherosclerotic lesions that share similar pathologies feature as compared to the lesions developed by humans and develop in similar locations in the cardiovascular system as compared to humans. Likewise, pigs respond to injury of the coronary arteries in a similar fashion to humans. Further, the size and forces of the vascular system in pigs approximate those in humans.
[0047] Until now, there have been no large animal studies assessing the potential of targeting EndMT as a potential treatment option for human subjects. In accordance with the present disclosure, it has been shown herein for the first time in a preclinical, large animal model (a pig) that local reduction of SMAD3 expression in a blood vessel can be used as a viable clinical strategy to achieve a number of desirable therapeutic outcomes, including reducing EndMT in a blood vessel or a blood vessel graft, reducing neointimal hyperplasia in a blood vessel or a blood vessel graft, increasing endothelization in a blood vessel or a blood vessel graft and increasing patency in a blood vessel or a blood vessel graft.
[0048] Vectors
[0049] In one aspect, provided are vectors and their use for reducing or abolishing expression of SMAD3. “Vector,” as used herein, means a vehicle that comprises a payload (e.g., a nucleic acid or a polypeptide) to be delivered into a host cell, either in vitro, ex vivo or in vivo. Non-limiting examples of vectors include a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini-circle, or a viral vector (including virus derived sequences). A vector may also refer to a virion comprising a nucleic acid to be delivered into a host cell, either in vitro, ex vivo or in vivo. A vector may be a non-viral vector system using, for example, cationic lipids, polymers, or both as carriers to deliver the payload. Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems canalso be used to deliver a payload to cells. Alternatively, hydrodynamic injection, electroporation or ultrasound may be used to deliver the payload.
[0050] In one embodiment, the payload that reduces expression of SMAD3 is an agent for achieving a SMAD3 knockdown, including, for example, an agent for achieving a SMAD3 knockdown described herein. In one embodiment, the payload that reduces expression of SMAD3 is an agent for achieving a SMAD3 knockout, including, for example, an agent for achieving a SMAD3 knockout described herein. In one embodiment, the payload that reduces expression of SMAD3 is an agent that interferes with SMAD3 protein levels, including, for example, an agent that interferes with SMAD3 protein levels described herein. Payloads that reduce expression of SMAD3 include payloads that abolish expression of SMAD3. In embodiments, the payload is an RNA molecule, including, but not limited to a shRNA or siRNA molecule. In one embodiment, the payload is a DNA molecule. The DNA molecule may encode for an RNA molecule. The DNA molecule may encode for a polypeptide. In embodiments, the payload is a polypeptide. In embodiments, the payload is small molecule.
[0051] Viral vectors for the delivery of a payload to a target cell, tissue, or organism are known in the art and include, for example, an AAV vector, adenovirus vector, lentivirus vector, retrovirus vector, poxvirus vector, baculovirus vector, herpes simplex virus vector, vaccinia virus vector, or a synthetic virus vector (e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule).
[0052] In one embodiment, the viral vector is a lentivirus vector. A “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviral systems offers stable, long-term presence of genetic information in dividing and non-dividing cells with broad tropism and the capacity for large DNA inserts. (Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L. A third-generation lentivirus vector with a conditional packaging system. J Virol. 1998 Nov;72(l 1) : 8463-71 ). Human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), and feline immunodeficiency virus (FIV) are all examples of lentiviruses. Lentiviral particles are made of viral envelope proteins (encoded by an Env gene) as well as structural proteins (encoded by a Gag gene). Inside the particles, a viral core (or capsid) contains enzymes (encoded and genetic material (lentiviral genome)). Previously, there had been concern regarding lentiviral and other retroviral systems with respect to the risk of insertional oncogenesis. Specifically, the concern was that the lentivirus or retrovirus (which permanently integrate into host DNA) could insert into the promoter region of an oncogene,thereby activating that oncogene and causing malignant cell transformation. However, this concern appears to have been largely overcome by advances in gene therapy technologies, whereby lentiviral integration is now understood to largely occur in intronic regions, not promoter sites. Accordingly, lentiviral gene therapy products have recently been licensed for human use in the USA. Furthermore, in embodiments disclosed herein, lentiviral approaches are used in humans during AVF creation or other vein graft surgery. In embodiments, the genetic modification of blood vessel cells is performed only locally. Thus, any theoretical risk of insertional oncogenesis in the genetically modified cells is limited to the treated segment of blood vessel.
[0053] Methods of using lentiviral vectors and generation of lentiviral vectors are known in the art. Different lentiviral systems are available to the person skilled in the art. Second- generation lentiviral systems contain a single packaging plasmid comprising the Gag (structural precursor protein), Pol (polymerase), Rev (facilitates nuclear export of transcripts), and Tat (viral transactivator for transcriptional activation from the 5’ long terminal repeat (LTR)) genes. Without an internal promotor, transgene expression is driven by the genomic 5' LTR, which is a weak promotor and requires the presence of Tat to activate expression. Third- generation systems improve on the safety of the second-generation system in two ways. First, the packaging system is split into two packaging plasmids: one encoding Rev and one encoding Gag and Pol. Second, Tat is eliminated from the third-generation system, and therefore expression of the transgene from this promoter is no longer dependent on Tat transactivation. A third-generation transfer plasmid can be packaged by either a second or a third- generation packaging system. The lentiviral system may also employ a self-inactivating lentiviral transfer vector plasmid. Here, a U3 region of 3' LTR in the viral genome transcriptional cassette is deleted. As a result, the lentiviral vector permanently loses the enhancer and promoter fragments of the U3 region of 5' LTR and 3' LTR after completion of the reverse transcription reaction. As such, even if all the viral proteins are present at the time, the virus cannot be successfully packaged because the viral genomic RNA cannot be transcribed. Deleting the U3 region also greatly reduces the carcinogenicity of the vector gene inserted into the host cell.
[0054] Retroviral / lentiviral vectors can have different pseudotypes by replacement with different heterologous envelope glycoproteins, for example, replacement with envelope protein of lentivirus (such as human, ape, feline or bovine immunodeficiency virus, goat arthritisencephalitis virus, equine infectious anemia virus, etc.), envelope protein of retrovirus (such as murine leukemia virus (10A1, 4070A), gibbon ape leukemia virus, feline leukemia virus(RD114), amphotropic retrovirus, ecotropic retrovirus, baboon ape leukemia virus, etc.), envelope protein of paramyxoviruses (such as measles virus, nipah virus, etc.), envelope protein of rhabdoviruses (such as rabies virus, mokola virus, etc.), envelope protein of filoviruses (such as Ebola Zaire virus, etc.), envelope protein of arenaviruses (such as lymphocytic choriomeningitis virus, etc.), envelope protein of baculovirus, envelope protein of alphaviruses (such as chikungunya virus, Ross River virus, Semliki Forest virus, Sindbis virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus, etc.), envelope protein of Orthomyxoviruses (such as Influenza virus and Fowl plague virus, etc.), envelope protein of Vesiculoviruses (such as Vesicular stomatitis virus, Chandipura virus and Piry virus, etc.). Most lentiviral vectors are currently prepared by using the vesicular stomatitis virus envelope glycoprotein (VSV-G), since this glycoprotein makes the lentiviral vector have a wide range of transduction spectrum and a better stability during downstream processing.
[0055] Provided herein are cells comprising a vector described herein. The cell may be a mammalian cell. The cell may be a human cell. The cell may be isolated.
[0056] Methods
[0057] Provided herein are methods that are useful, for example, for treating both blood vessels that are transplanted from one location to another location (e.g., from one location in the patient to another location in the same patient or from a donor to a recipient) or for treatment of blood vessels in situ.
[0058] As used herein, the term subject and patient may be used interchangeably. In some embodiments, the subject is a mammal. The term “mammal” as used herein is intended to include, but is not limited to, humans, laboratory animals, domestic pets, and farm animals. Mammals, include, but are not limited to, a human or non-human mammal, such as a bovine, porcine, equine, canine, ovine, or feline, etc. Donors and recipients are also subjects herein.
[0100] In embodiments, the methods disclosed herein are useful for treating or preventing disease in a subject. The terms “treat,” “treated,” “treating,” or “treatment” as used herein refer to therapeutic treatment, wherein the object is to slow down (lessen) an undesired physiological condition, disorder or disease, or to obtain beneficial or desired clinical results. For the purposes of this disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of the condition, disorder or disease; stabilization (z.e., not worsening) of the state of the condition, disorder or disease; delay in onset or slowing of the progression of the condition, disorder or disease; amelioration of one or more symptoms of the condition, disorder or disease state; and remission (whether partial ortotal), or enhancement or improvement of the condition, disorder or disease. Treatment includes eliciting a clinically significant response without excessive levels of side effects. Treatment also includes prolonging survival as compared to expected survival if not receiving treatment. The terms “prevent”, “prevention”, and the like refer to acting prior to overt disease or disorder onset, to prevent the disease or disorder from developing or to minimize the extent of the disease or disorder or slow its course of development. In some embodiments, treatment refers to increased survival (e.g., survival time). For example, treatment can result in an increased life expectancy of a patient. In some embodiments, treatment results in an increased life expectancy of a patient by more than about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150%, about 155%, about 160%, about 165%, about 170%, about 175%, about 180%, about 185%, about 190%, about 195%, about 200% or more, as compared to the average life expectancy of one or more control individuals with a disease or disorder without treatment. In some embodiments, treatment results in an increased life expectancy of a patient by more than about 6 months, about 7 months, about 8 months, about9 months, about 10 months, about 11 months, about 12 months, about 2 years, about 3 years, about 4 years, about 5 years, about 6 years, about 7 years, about 8 years, about 9 years, about10 years or more, as compared to the average life expectancy of one or more control individuals with a disease or disorder without treatment. In some embodiments, treatment results in long term survival of a patient. As used herein, the term “long term survival” refers to a survival time or life expectancy longer than about 40 years, 45 years, 50 years, 55 years, 60 years, or longer.
[0059] In one aspect, provided is a method of reducing stenosis and / or of preventing occlusion of a blood vessel graft or a blood vessel. Blood vessel stenosis refers to the narrowing of a blood vessel. Complete narrowing of a blood vessel is also referred to as blood vessel occlusion. Methods of measuring stenosis are known in the art and include, for example, duplex ultrasound, magnetic resonance angiography (MRA), computed tomography angiography (CTA), conventional catheter-based angiography, catheter-based digital subtraction angiography, direct measurement of an excised vessel or at surgery or post-mortem, histopathology, and any methods described herein. Methods of measuring occlusion are known in the art and include, for example, measurement of optical reflection and temperature changes, the use of Doppler ultrasound or pulse wave measurements, duplex ultrasound, magneticresonance angiography (MRA), computed tomography angiography (CTA), conventional catheter-based angiography, catheter-based digital subtraction angiography, direct measurement of an excised vessel or at surgery or post-mortem, histopathology, and any methods described herein.
[0060] Provided herein is a method of reducing stenosis and / or of preventing occlusion of a blood vessel graft in a subject in need thereof, the method comprising: (a) partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0061] Provided herein is a method of reducing stenosis and / or of preventing occlusion of a blood vessel graft in a recipient in need thereof, the method comprising: (a) removing a portion of a blood vessel from a donor; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the recipient’s cardiovascular system, creating a blood vessel graft. In one embodiment, the donor and the recipient are two different individuals. In one embodiment, the donor and the recipient are the same individual. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0062] Provided herein is a method of reducing stenosis and / or of preventing occlusion of a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising apayload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0063] Provided herein is a method of reducing stenosis and / or of preventing occlusion of a blood vessel in a AVF in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0064] Provided herein are methods of reducing neointimal hyperplasia in a blood vessel graft or a blood vessel. Neointimal hyperplasia, a major factor vein graft failure and other settings such as angioplasty, refers to post-intervention, pathological, vascular remodeling due to the proliferation and migration of vascular smooth muscle cells in the tunica intima layer. This vascular remodeling can in some embodiments result in vascular wall thickening and the gradual loss of luminal patency. In the case of arterial blockages causing ischemic symptoms, neointimal hyperplasia may lead to the return of vascular insufficiency symptoms postintervention. Pathogenesis of intimal hyperplasia in a vein graft may involve increase in arterial pressure, overstretching of the vein to maximum capacity, disruption of borders of endothelial cells, rupture of internal elastic membranes, migration of smooth muscle cells into the intimal layer and resultant unbalanced proliferation, atrophy of media and further consolidation of stiffness, and graft arteriosclerosis with traumatic media necrosis and atrophy, as well as pathological surface and wall stress and strain. Methods of measuring neointimal hyperplasia are known in the art and include any methods described herein, including by histopathological staining, intra-vascular ultrasound, optical coherence tomography staining and other imaging modalities.
[0065] Provided herein is a method of reducing neointimal hyperplasia in blood vessel graft in a subject in need thereof, the method comprising: (a) partially or fully removing a portion ofa blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the portion of the blood vessel is fully removed from the subject.
[0066] Provided herein is a method of reducing neointimal hyperplasia in blood vessel graft of a blood vessel graft in a recipient in need thereof, the method comprising: (a) removing a portion of a blood vessel from a donor; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the recipient’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the donor and the recipient are two different individuals. In one embodiment, the donor and the recipient are the same individual.
[0067] Provided herein is a method of reducing neointimal hyperplasia in a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0068] Provided herein is a method of reducing neointimal hyperplasia in a blood vessel in an AVF in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0069] Provided herein are methods of reducing endothelial to mesenchymal transition (EndMT) and / or increasing endothelization in a blood vessel graft or a blood vessel. During EndMT, endothelial cells (ECs) lose their polarity and cell-to-cell contacts, and undergo a dramatic remodeling of the cytoskeleton. During this transition process from ECs to mesenchymal cells, there is a marked decrease in the expression of endothelial markers and concurrent increase in the expression of mesenchymal markers including smooth muscle a- actin (SMA), fibroblast-specific protein 1 (FSP1; also known as S100A4), fibronectin, and collagens. Furthermore, the newly transformed mesenchymal cells manifest migratory and proliferative phenotypes. As a result, the ECs become mesenchymal-like in their phenotype. It has been observed during neointimal hyperplasia that arises after a vein is exposed to arterial pressure, -50% of neointimal cells were EndMT-derived. See Cooley BC, Nevado J, Mellad J et al. TGF-beta signaling mediates endothelial-to-mesenchymal transition (EndMT) during vein graft remodeling. Sci Transl Med 2014;6:227ra34. Methods of measuring EndMT and / or endothelization are known in the art and include any methods disclosed herein, including measuring expression of endothelial and / or mesenchymal markers, or other systems including using lineage tracking of endothelial cells.
[0070] Provided herein is a method of increasing endothelization in a blood vessel graft in a subject in need thereof, the method comprising: (a) partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarilyblocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft . In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the portion of the blood vessel is fully removed from the subject.
[0071] Provided herein is a method of increasing endothelization in a blood vessel graft in a recipient in need thereof, the method comprising: (a) removing a portion of a blood vessel from a donor; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the recipient’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the donor and the recipient are two different individuals. In one embodiment, the donor and the recipient are the same individual.
[0072] Provided herein is a method of increasing endothelization in a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0073] Provided herein is a method of increasing endothelization in a blood vessel in an AVF in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vesselsegment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0074] Provided herein is a method of reducing EndMT in a blood vessel graft in a subject in need thereof, the method comprising: (a) partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the portion of the blood vessel is fully removed from the subject.
[0075] Provided herein is a method of reducing EndMT in a blood vessel graft in a recipient in need thereof, the method comprising: (a) removing a portion of a blood vessel from a donor; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the recipient’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the donor and the recipient are two different individuals. In one embodiment, the donor and the recipient are the same individual.
[0076] Provided herein is a method of reducing EndMT in a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reducesexpression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0077] Provided herein is a method of reducing EndMT in a blood vessel in an AVF in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0078] Provided herein are methods of increasing patency of a blood vessel or a blood vessel graft. Blood vessel patency relates to the degree to which a blood vessel is not blocked or obstructed. Greater patency indicates a lesser degree of blockage or obstruction. Methods of measuring patency are known in the art and include any methods disclosed herein.
[0079] Provided herein is a method of increasing patency of a blood vessel graft in a subject in need thereof, the method comprising: (a) partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft and / or AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the portion of the blood vessel is fully removed from the subject.
[0080] Provided herein is a method of increasing patency of a blood vessel graft in a recipient in need thereof, the method comprising: (a) removing a portion of a blood vessel froma donor; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the recipient’s cardiovascular system, creating a blood vessel graft and / or AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the donor and the recipient are two different individuals. In one embodiment, the donor and the recipient are the same individual.
[0081] Provided herein is a method of increasing patency of a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0082] Provided herein is a method of increasing patency of a blood vessel in an AVF in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0083] Provided herein are methods for reducing thrombosis in a blood vessel graft or a blood vessel. Thrombosis refers to the formation of a blood clot (thrombus) in a vein or artery,wherein the thrombus can limit blood flow through the affected vein or artery. Acute venous and arterial thromboses are a common cause of death. Methods of detecting thrombosis are known in the art and can include point-of-care compression ultrasound, contrast venography, duplex ultrasonography, D-dimer blood test, Magnetic resonance imaging, and any methods described herein.
[0084] Provided herein is a method of reducing thrombosis in a blood vessel graft in a subject in need thereof, the method comprising: (a) partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the portion of the blood vessel is fully removed from the subject.
[0085] Provided herein is a method of reducing thrombosis in a blood vessel graft in a recipient in need thereof, the method comprising: (a) removing a portion of a blood vessel from a donor; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the recipient’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the donor and the recipient are two different individuals. In one embodiment, the donor and the recipient are the same individual.
[0086] Provided herein is a method of reducing thrombosis in a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarilyblocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0087] Provided herein is a method of reducing thrombosis in a blood vessel in an AVF in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0088] Provided herein are methods for reducing TGF-beta signaling in a blood vessel graft or a blood vessel. Methods of measuring TGF-beta signaling are known in the art and include measuring TGF-beta RNA levels (e.g., with PCR, RNA sequencing) or protein levels (e.g., with an ELISA, Western blot, or immune staining).
[0089] Provided herein is a method of reducing TGF-beta signaling in a blood vessel graft in a subject in need thereof, the method comprising: (a) partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the portion of the blood vessel is fully removed from the subject.
[0090] Provided herein is a method of reducing TGF-beta signaling in a blood vessel graft in a recipient in need thereof, the method comprising: (a) removing a portion of a blood vessel from a donor; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the recipient’s cardiovascular system, creating a blood vessel graft. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes. In one embodiment, the donor and the recipient are two different individuals. In one embodiment, the donor and the recipient are the same individual.
[0091] Provided herein is a method of reducing TGF-beta signaling in a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0092] Provided herein is a method of reducing TGF-beta signaling in a blood vessel in an AVF in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF. In certain embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 minutes.
[0093] In some embodiments, the temporarily blocked blood vessel segment is incubated with the vector for at least 30 min, at least 40 min, at least 45 min, at least 50 min, at least 60 min, at least 70 min, at least 80 min, at least 90 min, at least 100 min, at least 110 min, at least 120 min, at least 130 min, at least 140 min, at least 150 min, at least 160 min, at least 170 min, or at least at least 180 min.
[0094] In some embodiments, the proximal and distal ends of a segment of the blood vessel are blocked for at least 30 min, at least 40 min, at least 45 min, at least 50 min, at least 60 min, at least 70 min, at least 80 min, at least 90 min, at least 100 min, at least 110 min, at least 120 min, at least 130 min, at least 140 min, at least 150 min, at least 160 min, at least 170 min, or at least at least 180 min.
[0095] The amount of the vector comprising a payload, wherein the payload reduces expression of SMAD3, that is effective for achieving the desired therapeutic outcome in a given patient can be determined using standard clinical techniques known to those with skill in the art. In addition, in vitro or in vivo assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed can also depend on the route of administration, the condition, the seriousness of the condition being treated, as well as various physical factors related to the individual being treated, and can be decided according to the judgment of a health-care practitioner.
[0096] In one embodiment, the patient has atherosclerosis or other arterial disease resulting in arterial obstruction or blockage. In some embodiments, the patient has coarctation of the aorta, an aortic aneurysm, aortic dissection . In some embodiments, the patient arterial aneurysm, arterial dissection, extrinsic arterial compression or other arterial issues resulting in partial or complete arterial occlusion. In some embodiments, the patient venous disease, venous insufficiency or extrinsic venous compression resulting in partial or complete venous occlusion. In one embodiment, the patient requires ongoing hemodialysis access via an AVF. In one embodiment, the patient requires ongoing access to the vascular system via an AVF for purposes other than hemodialysis.
[0097] Pharmaceutical Compositions
[0098] Provided herein are pharmaceutical compositions comprising an agent that reduces or abolishes SMAD3 expression. Provided herein are pharmaceutical compositions comprising a vector comprising an agent that reduces or abolishes SMAD3 expression and a pharmaceutically acceptable excipient. Provided herein are pharmaceutical compositions comprising a vector disclosed herein and a pharmaceutically acceptable excipient. The agentor vector disclosed herein is preferably assessed for contamination by conventional methods and then formulated into a pharmaceutical composition suitable for storage and / or administration to a patient.
[0099] Formulations of the agents or vectors disclosed herein involve the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly one suitable for injection, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels. The agents or vectors disclosed herein can be formulated into pharmaceutical compositions. These compositions may comprise, in addition to the agent or vector, a pharmaceutically and / or physiologically acceptable excipient, carrier, buffer, stabilizer, antioxidants, preservative, or other additives well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may be determined by the skilled person according to the route of administration. The pharmaceutical composition is typically in liquid form. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Additional carriers are provided in International Patent Publication No. WO 00 / 15822, incorporated herein by reference. Physiological saline solution, magnesium chloride, dextrose or other saccharide solutions or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included. In some cases, a surfactant, such as pluronic acid (PF68) 0.001% may be used. In some cases, Ringer's Injection, Lactated Ringer's Injection, or Hartmann's solution is used. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included, as required.
[0100] Pharmaceutical compositions comprising an agent or vector disclosed herein may be formulated with one or more pharmaceutically-acceptable excipients, which can be a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, carrier, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), solvent or encapsulating material, involved in carrying or transporting therapeutic compound for administration to the subject, bulking agent, salt, surfactant and / or a preservative. Some examples of materials which can serve as pharmaceutically-acceptable excipients include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol;esters, such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic saline; pH buffered solutions; and other non-toxic compatible substances employed in pharmaceutical formulations.
[0101] A bulking agent is a compound which adds mass to a pharmaceutical formulation and contributes to the physical structure of the formulation in lyophilized form. Suitable bulking agents can include mannitol, glycine, polyethylene glycol and sorbitol.
[0102] The use of a surfactant can reduce aggregation of the reconstituted protein and / or reduce the formation of particulates in the reconstituted formulation. The amount of surfactant added is such that it reduces aggregation of the reconstituted protein and minimizes the formation of particulates after reconstitution. Suitable surfactants caninclude polysorbates (e.g. polysorbates 20 or 80); pol oxamers (e.g. pol oxamer 188); Triton; sodium dodecyl sulfate (SDS); sodium laurel sulfate; sodium octyl glycoside; lauryl-, myristyl-, linoleyl-, or stearyl- sulfobetaine; lauryl-, myristyl-, linoleyl-or stearyl -sarcosine; linoleyl-, myristyl-, or cetylbetaine; lauroamidopropyl-, cocamidopropyl-, linoleamidopropyl-, myristamidopropyl-, palmidopropyl-, or isostearamidopropyl-betaine (e.g. lauroamidopropyl); myristamidopropyl- , palmidopropyl-, or isostearamidopropyl-dimethylamine; sodium methyl cocoyl-, or disodium methyl oleyl-taurate; and polyethyl glycol, polypropyl glycol, and copolymers of ethylene and propylene glycol (e.g. Pluronics, PF68, etc.).
[0103] Preservatives may be used in the formulations disclosed herein. Suitable preservatives for use in the formulations disclosed herein include octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride (a mixture of alkylbenzyl-dimethylammonium chlorides in which the alkyl groups are long-chain compounds), and benzethonium chloride. Other types of preservatives include aromatic alcohols such as phenol, butyl and benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3 -pentanol, and m-cresol. Other suitable excipients can be found in standard pharmaceutical texts, e.g., in "Remington's Pharmaceutical Sciences", The Science and Practice of Pharmacy, 19th Ed. Mack Publishing Company, Easton, Pa., (1995).
[0104] If an agent or vector is to be stored long-term, it may be frozen in the presence of glycerol.
[0105] The following embodiments illustrate, but do not limit, the invention disclosed herein.
[0106] Embodiment 1. A method of reducing blood vessel graft stenosis in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject,or partially or fully removing a portion of a blood vessel from the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject's cardiovascular system, creating a blood vessel graft.
[0107] Embodiment 2. A method of reducing stenosis in a blood vessel in an arterio-venous fistula (AVF) in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from the temporarily blocked blood vessel segment; (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and (g) connecting the blood vessel to the subject's cardiovascular system, creating an AVF.
[0108] Embodiment 3. The method of embodiment 1 or 2, wherein the temporarily blocked blood vessel segment is incubated with the vector for at least 30 min.
[0109] Embodiment 4. The method of any one of embodiments 1-3, wherein the method reduces neointimal hyperplasia in the blood vessel.
[0110] Embodiment 5. The method of any one of embodiments 1-4, wherein the method increases endothelization in the blood vessel.[OHl] Embodiment 6. The method of any one of embodiments 1-5, the method comprising fully removing the portion of the blood vessel from the subject.
[0112] Embodiment 7. A method of reducing neointimal hyperplasia and / or increasing endothelization in a blood vessel in a subject in need thereof, the method comprising: (a) exposing at least a portion of a blood vessel of the subject; (b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment; (c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3; (d) incubating the temporarily blocked blood vessel segment with the vector; (e) removing the vector from thetemporarily blocked blood vessel segment; and (f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel.
[0113] Embodiment 8. The method of embodiment 7, wherein the temporarily blocked blood vessel segment is incubated with the vector for at least 30 min.
[0114] Embodiment 9. The method of any one of the preceding embodiments, wherein the method increases blood vessel patency.
[0115] Embodiment 10. The method of any one of the preceding embodiments, wherein the method reduces endothelial to mesenchymal transition (EndMT) in the blood vessel.
[0116] Embodiment 11. The method of any one of the preceding embodiments, wherein the method reduces thrombosis in the blood vessel.
[0117] Embodiment 12. The method of any one of the preceding embodiments, wherein the method reduces TGF-beta signaling in the blood vessel.
[0118] Embodiment 13. The method of any one of the preceding embodiments, wherein the subject has a cardiovascular disease.
[0119] Embodiment 14. The method of embodiment 13, wherein the subject has occlusive atherosclerotic disease.
[0120] Embodiment 15. The method of embodiments 13 or 14, wherein the blood vessel is a vein, and wherein the subject is receiving vein graft surgery.
[0121] Embodiment 16. The method of embodiment 15, wherein the vein graft surgery is interposition vein grafting into the arterial circulation of the subject, or bypass surgery.
[0122] Embodiment 17. The method of embodiments 15 or 16, wherein the method reduces adverse vein graft remodeling.
[0123] Embodiment 18. The method of any one of embodiments 1-13, wherein the blood vessel is a vein.
[0124] Embodiment 19. The method of any one of embodiments 1-13, wherein the blood vessel is an artery.
[0125] Embodiment 20. The method of any one of embodiments 2-5, 9-12, 18, and 19, wherein the subject has kidney disease.
[0126] Embodiment 21. The method of any one of embodiments 2-5, 9-12, and 18-20, wherein the subject is undergoing dialysis.
[0127] Embodiment 22. The method of any one of the preceding embodiments, wherein the payload is a nucleic acid or a protein.
[0128] Embodiment 23. The method of embodiment 22, wherein the payload is a nucleic acid.
[0129] Embodiment 24. The method of embodiment 23, wherein the nucleic acid is (i) a DNA molecule encoding an RNA molecule that reduces expression of SMAD3 or (ii) an RNA molecule that reduces expression of SMAD3.
[0130] Embodiment 25. The method of embodiment 24, wherein the RNA molecule is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).
[0131] Embodiment 26. The method of embodiment 22, wherein the payload comprises: (a) (i) a DNA molecule encoding a guide RNA (gRNA) that is substantially complementary to the SMAD3 gene or (ii) a gRNA that is substantially complementary to the SMAD3 gene; and (b) one or more nucleic acid sequences encoding one or more RNA-guided DNA endonucleases.
[0132] Embodiment 27. The method of embodiment 26, wherein the one or more RNA- guided DNA endonucleases are selected from Cas9, CasX, CasY, Cast 3, or Cpfl.
[0133] Embodiment 28. The method of any one of embodiments 1-27, wherein the vector is a non-viral vector.
[0134] Embodiment 29. The method of any one of embodiments 1-27, wherein the vector is a viral vector.
[0135] Embodiment 30. The method of embodiment 29, wherein the viral vector is a lentiviral vector.
[0136] Embodiment 31. The method of any one of the preceding embodiments, wherein the subject is human.
[0137] It is to be understood that this invention is not limited to the particular molecules, compositions, methodologies, or protocols described, as these may vary. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention. It is further to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features. For example, where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention, or a particular claim, that feature can also be used, to the extent possible, in combination with and / or in the context of other particular aspects and embodiments of the invention, and in the invention generally.
[0138] Where reference is made herein to a method comprising two or more defined steps, the defined steps can be carried out in any order or simultaneously (except where the context excludes that possibility), and the method can include one or more other steps which are carried out before any of the defined steps, between two of the defined steps, or after all the defined steps (except where the context excludes those possibilities).
[0139] All other literature references, patents and applications are incorporated herein by reference in their entireties. Furthermore, where a definition or use of a term in a reference, which is incorporated by reference herein is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.
[0140] To facilitate a better understanding of the present invention, the following Examples of specific embodiments are given. The following examples should not be read to limit or define the entire scope of the invention.EXAMPLES
[0141] Example 1: Materials and Methods for Examples 2-4
[0142] In vitro evaluation of a lentiviral construct for SMAD3 knockdown
[0143] Pig coronary artery endothelial cells (PCAEC; purchased as PP30005K from Genlantis, San Diego, CA; now sold as AMS.PP30005 by Amsbio, Cambridge, MA) were cultured at 37 °C in 5 % CO2 in custom media (purchased as PMP211500 from Genlantis; now sold as AMS. PMP211500 by Amsbio). To evaluate lentiviral constructs for knockdown of SMAD3, lentiviral particles containing differing strands of SMAD3 shRNA or scramble shRNA at 5 x 106infectious units (IFU) / ml were transfected into PCAECs using polybrene (sc- 134220, Santa Cruz), according to the manufacturer’s instructions, with approximately 5000 IFU (10 pl) applied to each well of a 6-well plate for 48 hours. SMAD3 shRNA construct was directed against human SMAD3. The SMAD3 shRNA lentiviral particles (sc-38376-V) were provided as a pool of concentrated viral particles containing several target-specific constructs that encode 19-25 nt (plus hairpin) shRNA designed to knock down SMAD3 gene expression.
[0144] To assess SMAD3 knockdown efficacy in vitro, PCAECs were harvested after 48 hours of transfection and the level of SMAD3 was determined by quantitative real time- polymerase chain reaction (qRT-PCR). In detail, RNA was first extracted using a RNeasy Mini Kit (#74104, QIAGEN, Germantown, MD) and quantified by a NanoDrop 2000c Spectrophotometer (Thermo Scientific, Waltham, MA). qRT-PCR was performed after obtaining cDNA using an iScript™ cDNA Synthesis Kit (1708891, Bio-Rad, Hercules, CA). Conditions for qRT-PCR were: 95 °C for 5 minutes, 40 cycles of 95 °C for 5 seconds and 60 °C for 30 seconds. 18s rRNA was used as a control and gene expression analyzed using the AACt method. Primer sequences are provided in Table 1.Table 1. List of primers used for qRT-qPCR.
[0145] Lentiviral construct for ex vivo and in vivo SMAD3 knockdown in pigs
[0146] Following the above in vitro studies proving efficacy in PCAECs, the lentiviral construct used for all ex vivo and in vivo experiments in pigs comprised a single human strand of SMAD3 shRNA lentiviral particles and was provided at a high-titer (> 109IFU / ml). In this construct, SMAD3 shRNA was under the control of an Hl promoter. The lentiviral sequence also contained green fluorescent protein (GFP). The control construct consisted of the identical lentiviral construct that contained a scramble shRNA sequence. In pilot studies, it was determined that the GFP could only be visualized by using an anti-GFP antibody. Nevertheless, except for anti-GFP staining, all other immunofluorescence staining for the following examples was performed in fluorescence channels with excitation at 546 nm and 633 nm to avoid any potential confounding of this GFP signal.
[0147] Ex vivo evaluation of lentiviral transfection
[0148] A series of ex vivo pilot studies was conducted to evaluate the ability of the lentiviral construct to transfect endothelial cells of pig veins, and the time required for this to occur. Initially, the freshly harvested femoral vein ex vivo from pigs were used that were undergoing other procedures. By developing the AVF model and the procedure to dwell the lentivirus in vivo (see below) in parallel, a lentiviral article suspension for in vivo dwelling was developed, which comprised 8 pl polybrene (sc-134220, Santa Cruz), 10 pl unfractionated heparin (at 1000 USP units / ml), 500 pl nitroglycerin (at 100 pg / ml), 80 pl lentiviral particles (at ~5 x 109IFU / ml) and 202 pl lx PBS, for a total volume of 800 pl. Therefore, for the final ex vivo testing of lentiviral transfection, the untouched femoral vein was harvested from two separate pigs that had not undergone any prior procedures. After very gentle washing, the veins were pinned out on a moist, flat surface with the intima facing upwards. The lentiviral article suspension (with heparin, polybrene and nitroglycerin) was immediately dwelled on the intimal surface of the freshly harvested vein for either 30 or 60 minutes at 37 °C. As a control, sections from these same freshly harvested veins were dwelled for 30 min at 37 °C using the same ex vivo techniques with a sham suspension containing all the components described above but withoutthe lentiviral particles. After gentle but repeated washing to completely remove the article, veins were embedded in OCT and frozen at -80 °C.
[0149] Overview of project phases
[0150] Phase 0: Pilot evaluation of EndMT induction
[0151] Three pigs received AVF surgery in the surgical leg on Day 0. An untouched leg served as a control. No lentivirus or other article was dwelled during AVF creation. A loading dose of clopidogrel (300 mg) was administered on Day 0. After that, the animals received aspirin 81 mg daily and clopidogrel 75 mg daily. Post-operative analgesia was provided by administering buprenorphine (0.02 mg / kg) intramuscularly twice daily for 3 days. Intramuscular cefazolin 25 mg / kg was also given twice daily for 10 days after the procedure. Pigs were euthanized and the femoral vein in the untouched left leg (control) and the AVF in the right leg were harvested at 15-days post AVF creation.
[0152] Phase 1 : Evaluation of SMAD3 knockdown efficacy and EndMT inhibition
[0153] Three pigs were subjected to AVF surgery and lentivirus dwelling on Day 0. Three pigs received lentivirus carrying scramble shRNA and three pigs received lentivirus carrying SMAD3 shRNA. A loading dose of clopidogrel (300 mg) was administered on Day 0. After that, the animals received aspirin 81 mg daily and clopidogrel 75 mg daily. Post-operative analgesia was provided by administering buprenorphine (0.02 mg / kg) intramuscularly twice daily for 3 days. Intramuscular cefazolin 25 mg / kg was also given twice daily for 8 days after the procedure. Pigs were euthanized and tissues harvested at 8-days post AVF creation.
[0154] Phase 2: Investigation of the effect of EndMT inhibition by SMAD3 knockdown
[0155] Sixteen pigs were subjected to AVF surgery and lentivirus dwelling on Day 0. Eight pigs received lentivirus carrying scramble shRNA and eight pigs received lentivirus carrying SMAD3 shRNA. A loading dose of clopidogrel (300 mg) was administered on Day 0. After that, the animals received aspirin 81 mg daily and clopidogrel 75 mg daily. Post-operative analgesia was provided by administering buprenorphine (0.02 mg / kg) intramuscularly twice daily for 3 days. Intramuscular cefazolin 25 mg / kg was also given twice daily for 10 days after the procedure. Pigs were euthanized and tissues harvested at 30-days post AVF creation.
[0156] A single pig was harvested 24 hours after AVF creation.
[0157] Pig use, housing, and tissue harvestins
[0158] Female Yorkshire pigs at approximately 40 kg body weight were purchased from Animal Biotech Industries, Inc. (Doylestown, PA). Pigs were housed in the animal facility at the Icahn School of Medicine at Mount Sinai and were fed a standard diet (# 5081, LabDiet Inc, St. Louis, MO) with water being freely available. Animal experiments were approved bythe Institutional Animal Care and Use Committee of the Icahn School of Medicine at Mount Sinai.
[0159] Creation of a preclinical pig AVF model with lentiviral article dwelling
[0160] On the day of AVF creation, initial anesthesia was administered as a single intramuscular dose of Telazol® 8 mg / kg, as well as a dose of pre-operative analgesia with buprenorphine (0.02 mg / kg) intramuscularly. When immobilized, the animal was placed in a supine position and then intubated and ventilated with 100% oxygen. General anesthesia was maintained with isoflurane inhalation throughout the procedure. The abdomen and pelvis were prepped with betadine. An incision was made over the right femoral triangle to expose the femoral vein and artery which lie in a groove between the gracilis and sartorius muscles. The fascia overlying the muscles was entered using sharp dissection. The artery and vein were individually dissected free and controlled with silastic vessel loops. Great care was taken in handling the vessels to avoid vasospasm. To allow further mobilization of the vessels, branches of the artery and tributaries of the femoral vein were ligated using 4-0 silk ties. A dose of 5,000 U unfractionated heparin was given intravenously (systemically), prior to clamping the vessels. An atraumatic vascular clamp was then applied to the proximal femoral vein, causing the vein to become distended, which facilitated advancement of a 24 gauge x3 / 4 inch soft angiocatheter (#SR*FF2419, Terumo, Somerset, NJ) into the vein, 3 cm distal to the vascular clamp. This distance from the vascular clamp to the venipuncture site was standardized, as this segment was designated the treatment area. The angiocatheter was advanced over the needle into the vein until there was blood return. A 1 ml syringe was then carefully attached to the catheter and saline was gently flushed into the vein. A second non-traumatic vascular clamp was then applied to the distal aspect of the vein to control inflow. The occluded segment of vein was gently flushed multiple times with saline ensuring that there was no leakage of saline from the vein segment and to flush out residual blood. 800 pl of the lentiviral article suspension, as described above, was then injected into the vein via the catheter and allowed to dwell for 60 minutes. The vein remained mildly distended with the article suspension to ensure contact of the article with the endothelium of the vein. After 60 minutes, the clamped vein segment was aspirated and gently flushed with saline to prevent systemic circulation of the article. The angiocatheter was removed from the vein and Potts scissors were used to make a venotomy measuring 1.0 cm. Two 7-0 proline BV-1 sutures were then used as stay sutures to facilitate transposition of the femoral artery to femoral vein. An atraumatic vascular clamp was applied to the proximal end of the femoral artery. The distal end of the artery was ligated with a 4-0 silk tie. The artery was transected and spatulated to the size of the corresponding venotomy.Using 6-0 proline BV-1 suture, an arteriovenous anastomosis was created by transposing the femoral artery to the femoral vein. Prior to completion of the anastomosis, the vascular clamps were removed from the vein and artery to allow back and forward bleeding. After completion of the arteriovenous anastomosis the vein was evaluated for a thrill. The surgical site was irrigated with saline and the skin incision closed with 3-0 vicryl deep dermal sutures and the skin closed with 3-0 monocryl suture in a subcuticular fashion. Animals were then extubated and allowed to recover in a designated recovery room.
[0161] While the above steps were followed for Phases 1 and 2 of this study, during the pilot studies in Phase 0 the steps relating to dwelling of the lentiviral article were omitted. In Phases 1 and 2, the treatment allocation was randomized to either SMAD3 knockdown or the control group. The primary surgeon for all surgeries in Phase 1 and 2 was fully blinded to the treatment allocation. For logistical reasons, it was necessary that the surgical assistant was aware of the treatment allocation.
[0162] A limited number of surgical complications arose in Phase 2 (but not Phase 1) of this study. In phase 2, it had been planned to randomize eight pigs to receive lentivirus containing SMAD3 shRNA, and another eight pigs to receive control lentivirus. However, four of the originally randomized pigs (two per group) were excluded from the study within the first 24 hours after surgery due to procedure-related complications. Three of these pigs were immediately excluded due to surgical complications related to creation of the AVF (two in the SMAD3 knockdown group, 1 in the control group), while one pig was excluded the morning after AVF creation due to acute hindlimb ischemia (control group). Therefore, ultimately ten pigs were randomized into each group, but only 8 pigs per group were evaluated. The sixteen pigs (eight per group) that were free of procedure-related complications were housed for 30 days after AVF creation, and comprise the animals presented in the Phase 2 analyses. The rate of technical complications and failure related to the surgical procedure is comparable to the human experience.
[0163] Ultrasound of A VF
[0164] In Phase 2, on the day of planned euthanasia and tissue harvest, animals were placed under general anesthesia and ultrasound was performed in the supine position. The femoral artery and vein were examined with B mode to evaluate diameter and compressibility. The direction of blood flow was assessed with color Doppler. Due to signal interference from scar tissue and also because the arterial limb was typically overlying the venous limb, it was not possible to reliably assess the diameter of the venous limb of the AVF by ultrasound.
[0165] Angiographic assessment and AVF harvesting
[0166] After the ultrasound in Phase 2, and also in Phase 0 and Phase 1, vascular access was obtained in the right carotid artery and external jugular vein using an ultrasound-guided Seidinger technique, followed by the administration of 5,000 U unfractionated heparin intravenously. A 5 Fr Judkins right or Hockey-stick catheter was advanced to the right external iliac artery under fluoroscopic guidance. Contrast agent was injected to visualize the AVF from multiple directions, with the beam projection angle optimized to achieve separation between arterial and venous limbs of the AVF.
[0167] After angiography and following humane euthanasia under general anesthesia, AVF sites were isolated, trimmed of fat and other superfluous tissues, and samples were embedded in both paraffin and OCT. For the Phase 0 studies, the left femoral vein was also harvested and embedded in paraffin and OCT.
[0168] Histopathology staining
[0169] An initial evaluation of sections of the venous limb of the AVF was made to identify differing diameter regions, including the narrowest portion. Histopathology (and immunostaining) of differing regions of the venous limb of the AVF was prioritized, with the narrowest portion used to quantify inner perimeter and calculated lumen area by histopathology (see Figs. 5 and 6 for full details). Paraffin embedded sections were stained Masson’ s trichrome (HT15, Sigma, St. Louis, MO) or elastic van Gieson (EVG) stain (ab 150667, Abeam, Waltham, MA) according to the manufacturer’s instructions. Images were acquired using a DMi8 microscope (Leica Microsystems Inc., Deerfield, IL). Fiji software (version 2.0.0-rc-68 / 1.52w for Mac) was used for image analysis and quantification of inner lumen perimeter, calculated lumen area, vessel wall area, collagen occupied area, and neointimal thickness. Lumen area was calculated from the inner lumen perimeter (z.e., inner lumen circumference) assuming the vessel was circular in cross-section. For lumen area, because it was desired to measure the narrowest portion of the venous limb of the AVF, only one section was used for this measurement. In addition, measurements of vessel wall area were performed on Masson’s trichrome stained slides, but we also used EVG stained sections for guidance to identify the outer boundary of the vessel wall. For measurement of neointimal thickness, three different sites were recorded and averaged from a single section.
[0170] Immunostaining
[0171] For immunofluorescence staining including the ex vivo lentiviral article dwelling experiments, frozen sections were initially thawed at room temperature and then fixed by incubating with 4% paraformaldehyde for 10 minutes. Slides were then washed twice in PBS and permeabilized by applying 0.3 % Triton X-100 for 5 minutes, followed by blocking in 5% bovine serum albumin for 60 minutes at room temperature. Next, samples were incubated overnight at 4 °C with primary antibodies in antibody diluent (S080983-2, DAKO, Carpinteria, CA) at dilutions of 1 : 100 or 1 :200. Sections were then washed 3 times in PBS and incubated for 1 hour at room temperature with Invitrogen Alexa Fluor™ 546 and / or Alexa Fluor™ 633 secondary antibodies. As a single exception, for anti-GFP staining, Alexa Fluor™ 488 was used. Finally, slides were washed 3 times with PBS and mounted with mounting medium containing DAPI (H-1200, Vector Laboratories, Newark, CA). Images were acquired using a confocal microscope (LSM780, Zeiss, White Plains, NY). Data were averaged from at least 2 - 3 separate locations per animal. Zen software from Zeiss was used for image analysis.
[0172] Terminal deoxynucleotidyl transferase-mediated dUTP nick end labelins (TUNED Assay
[0173] OCT sections were stained with a TUNEL Assay kit (#12156792910, Roche, Pleasanton, CA) according to the manufacturer’s instructions. Images were acquired using a DMi8 microscope (Leica). Data were averaged from at least 2 - 3 separate sections per animal.
[0174] Statistics
[0175] For the power calculations for Phase 2, a 30% difference in neointimal area between the control and SMAD3 knockdown groups was assumed, then based on pig femoral AVF dimensions. Seven pigs were required per group to have 80% power to detect a difference at the p < 0.05 level. Cross-sectional neointimal area was not reported, because due to the extensive vascular remodeling that arose in this AVF model, it was not possible to confidently identify the inner elastic lamina that demarcates the intima-media boundary from the entire cross-section of all samples. Rather, mean neointimal thickness from regions where the intimamedia boundary could be confidently identified was reported (Fig. 5C).
[0176] All analyses and quantifications were done in a blinded fashion, and no outliers or data points were excluded. For in vitro experiments, an unpaired Student’s t test was used. For in vivo experiments, normality of distribution was first tested by Shapiro-Wilk test. For normal distributed data, an F test was used to test for equal variance. If data were equal in variance, an unpaired Student’s t test was used. If data were not equal in variance, an unpaired Student’s t test with Welch’s correction was used. For data that was not normally distributed, a Mann- Whitney U test was used. For comparisons in Phase 0 comparing the venous limb of the AVF with the contralateral femoral vein, a paired Student’s t test was used. For categorical data, a Fisher's Exact test was used. Statistical analyses were performed using Prism 9 for macOS, and a 2-sided p value < 0.05 was considered significant. All data are presented as mean ± SD.
[0177] Example 2: Development of a preclinical, large animal model of EndMT induction (Phase 0)
[0178] A preclinical, large animal model of EndMT was developed by using a surgically created right-femoral AVF in pigs, z.e., a dialysis fistula. Specifically, the AVF model in pigs was developed by anastomosing the ligated end of the femoral artery to the side of the femoral vein. First, the extent of EndMT in this model was assessed by comparing the venous limb of the AVF to the untouched contra-lateral femoral vein. An AVF was created in three pigs. After 15 days, once AVF patency was confirmed by angiography, pigs were sacrificed and both the AVF and the untouched (control) left femoral vein were harvested. After tissue processing and mounting, the extent of EndMT was assessed by evaluating the co-expression of a set of faithful endothelial and mesenchymal markers. In the untouched (control) left femoral vein, only rare cells were observed that co-expressed endothelial and mesenchymal markers, indicating that EndMT does not play a major role in normal vein homeostasis in adult pigs. However, compared to the untouched (control) left femoral vein from the same pigs, the venous limb of the AVF showed a significantly increased proportion of endothelial cells that were co-positive for the combinations of either CD31+SM22a+(Fig. 1A) or VE-Cad+aSMA+(Fig IB). The proportion of co-positive cells undergoing EndMT ranged from ~20 - 30%.
[0179] Example 3: Evaluation of SMAD3 knockdown efficiency and EndMT inhibition(Phase 1)
[0180] After creating the large animal model of EndMT model (see Example 2) a robust gene delivery system was developed to enable a local in vivo SMAD3 knockdown in this AVF model and to validate that a SMAD3 knockdown causes inhibition of EndMT.
[0181] First, lentiviral particles containing shRNAs directed against SMAD3 were tested in vitro. A lentiviral construct that achieved an approximate 90% knockdown of SMAD3 in cultured porcine endothelial cells was chosen for subsequent in vivo experiments (Fig. 2).
[0182] In ex vivo studies using freshly harvested pig femoral veins, it was found that a dwell time of 60 min was sufficient to achieve lentiviral transfection of endothelial cells.
[0183] Returning to the AVF model, a protocol for injection and dwelling of the lentiviral construct (containing either shRNA against SMAD3 or scrambled control shRNA) was developed (Fig. 3A). In brief, once a section of femoral artery and vein were dissected free, the proximal and distal ends of a 1.5 -inch segment of femoral vein were temporarily occluded and gently irrigated to flush out residual blood. Lentivirus was then administered as a single-dose intra-vessel injection and allowed to dwell in situ for 60 minutes. After this time, the segmentof occluded vein was aspirated and gently flushed with saline to remove any residual viral article, and the AVF was created.
[0184] In Phase 1 of the study, six pigs were studied using the above protocol, with harvesting done at eight days after AVF creation to assess the effectiveness of SMAD3 knockdown (Figs. 3B and 3C) and inhibition of EndMT (Figs. 3D and 3E). During the surgical procedure to create the AVFs, three pigs were randomized to receive lentivirus containing SMAD3 shRNA (SMAD3 knockdown), while three pigs received the same lentivirus containing scramble shRNA (controls). Confirming the importance of the TGF-beta pathway and SMAD3 signalling during vein graft remodeling and the EndMT process, in the venous limb of control AVFs at this 8-day timepoint robust expression of both SMAD3 and phospho-SMAD3 (pSMAD3) in endothelial cells was observed (77.2 ± 10.0% and 49.3 ± 5.1% of CD31+cells expressed SMAD3 (Fig. 3B) and pSMAD3 (Fig. 3C). Compared to the control group, the SMAD3 knockdown group exhibited an approximate 75% reduction in the proportion of CD31+endothelial cells that expressed SMAD3 (77.2 ± 10.0 versus 19.5 ± 2.7%, / ? < 0.001) and a 68% reduction in the proportion of CD31+cells that expressed pSMAD3 (49.3 ± 5.1 versus 15.8 ± 2.3%, / ? < 0.001) (Figs. 3B and 3C). It was also confirmed that We SMAD3 knockdown does not affect the level of SMAD2 or pSMAD2 within the endothelium (data not shown). In addition, compared to the venous limb of control AVFs, the SMAD3 knockdown group showed a significant reduction in the extent of EndMT, as again assessed by the proportion of endothelial cells that were co-positive for the combinations of either CD3 l+SM22a+(Fig. 3D) or VE-Cad+aSMA+(Fig. 3E). The luminal endothelial cell coverage, however, was comparable in both groups at this 8-day timepoint, showing that the SMAD3 shRNA-containing lentivirus did not disturb endothelial cells in the acute phase (data not shown). These findings validate that SMAD3 can be effectively knocked down by dwelling SMAD3 shRNA-containing lentivirus in the femoral vein immediately before the creation of a femoral AVF, and that SMAD3 knockdown inhibits EndMT.
[0185] Example 4: Effect of EndMT inhibition by SMAD3 knockdown in a preclinical AVF model (Phase 2)
[0186] In Phase 2, the efficacy of EndMT inhibition via SMAD3 knockdown to improve AVF patency was evaluated in vivo. To that end, sixteen pigs were randomized to receive either lentivirus containing SMAD3 shRNA or lentivirus containing scramble shRNA (control) at the time of AVF creation (eight per group), and which were free of procedure-relatedcomplications, underwent analysis and are presented here (Fig. 3A). Terminal harvest of these sixteen animals and the AVFs was on day 30 post-AVF creation. During the 30-day period of phase 2, no obvious signs were observed that certain animals were doing any better (or any worse) than others from a systemic or overall perspective. Furthermore, at the time of tissue harvesting and euthanasia on day 30, the body weights of the pigs were identical between groups. In addition, in both the SMAD3 knockdown and control groups, pigs gained an average of 8 kgs in the 30 days from AVF creation and dwelling of lentivirus to the terminal harvest timepoint (data not shown). On day 30 post-surgery, ultrasound of the AVF was performed to evaluate patency and the size of the anastomosis (Fig. 4A). It was observed that three of the AVFs were totally occluded, which were subsequently identified as all being from the control group. Despite this, there was no difference in anastomosis size and vessel lumen area at the surgical anastomosis site between groups, confirming that the AVFs in the two groups were created equally (Figs. 4B and 4C).
[0187] To further evaluate the effect of EndMT inhibition by SMAD3 knockdown in the AVF model, the diameter and other features of the venous limb of the AVF were measured by femoral angiography (Figs. 4D and 4E). The ultrasound observation that three of the control AVFs were totally occluded was confirmed, whereas all of the eight AVFs in the SMAD3 knockdown group were patent. It was determined by angiography that the minimum diameter of the venous limb of the AVF was 1.56 ± 1.66 mm versus 4.26 ± 1.71 mm for the control versus SMAD3 knockdown groups respectively (p < 0.01) (Fig. 4D, left panel). The maximal diameter of the lentivirus-treated segment of the venous limb of the AVF was also greater in the SMAD3 knockdown group (4.22 ± 3.58 versus 8.42 ± 2.41 mm, respectively, / ? < 0.05) (Fig. 4D, middle panel). There was no difference in the mean diameter of the reference vein segments from the adjacent untreated portion of the vein (cranial from the site of lentivirus dwelling) (Fig. 4D, right panel). Correspondingly, the mean % stenosis of the venous limb of the AVF was 83.30 ± 15.08 % versus 52.52 ± 16.99 % for the control versus SMAD3 knockdown groups, respectively (p < 0.01) (Fig. 4E, left panel). Moreover, in the control group, seven out of eight pigs developed stenosis of the venous AVF limb of greater than 70%, while only two out of eight AVFs in the SMAD3 knockdown group developed this degree of stenosis (p < 0.05) (Fig. 4E, right panel).
[0188] Histopathological analysis of the venous limbs of these AVFs comparing the control versus SMAD3 knockdown groups confirmed significant increases in both the inner lumen perimeter (z.e., circumference; 4.83 ± 5.35 versus 12.26 ± 4.07 mm, respectively, / ? < 0.01, Fig. 5A) and the calculated lumen area (3.84 ± 6.12 versus 13.12 ± 8.00 mm2, respectively, p <0.05, Fig. 5B), but with no difference in collagen content of the vessel wall (data not shown). Correspondingly, as compared to controls, neointimal thickness was significantly reduced in veins from the SMAD3 knockdown group (0.88 ± 0.51 versus 0.45 ± 0.19 mm, respectively, / ? < 0.05) (Fig. 5C).
[0189] Because inhibition of EndMT was expected to preserve the endothelial phenotype and thus potentially improve endothelial integrity and AVF endothelialization, the proportion of luminal cells that expressed CD31 and eNOS was evaluated. Comparing the venous limbs of the AVFs between the control versus SMAD3 knockdown groups, improved endothelial integrity as determined by the proportion of luminal cells that expressed CD31 was observed (Figs. 5D and 5E). In addition, there was a borderline increase in the proportion of CD31+eNOS+co-positive endothelial cells (p = 0.065, Figs. 5D and 5E). Using VE-Cad as an alternate marker for endothelial cells, similar results were observed, with a significant increase in both the proportion of luminal cells that expressed VE-Cad and also the proportion of VE- Cad+eNOS+co-positive endothelial cells in the SMAD3 knockdown group (p < 0.05, Figs. 5F and 5G).
[0190] Additionally, cell proliferation (Ki67+cells, Fig. 6A), apoptosis (TUNEL assay; Fig. 6B), and immune cell infiltration (CD45+and CD68+cells; Figs. 6C and 6D, respectively) in the venous limb of AVFs between the control versus SMAD3 knockdown groups were compared. There were no differences observed for any of these parameters.
[0191] In sum, using a range of different readouts that included immunofluorescence staining, histopathology, angiography and ultrasound, the results herein are consistent with a showing that inhibition of EndMT by local knockdown of SMAD3 lead to a marked improvement in the patency and luminal dimensions of AVFs, while neointimal formation and stenosis severity were both reduced. Furthermore, the inhibition of EndMT was associated with improved endothelialization and an increase in the expression of eNOS. This data indicates that this therapeutic approach may be used in humans undergoing AVF. This approach is also readily adaptable to all other types of human vein graft surgery.
Claims
CLAIMSWe claim:
1. A method of reducing blood vessel graft stenosis in a subject in need thereof, the method comprising:(a) partially or fully removing a portion of a blood vessel from the subject;(b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment;(c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3;(d) incubating the temporarily blocked blood vessel segment with the vector;(e) removing the vector from the temporarily blocked blood vessel segment;(f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and(g) connecting the blood vessel to the subj ect’ s cardiovascular system, creating a blood vessel graft.
2. A method of reducing stenosis in a blood vessel in an arterio-venous fistula (AVF) in a subject in need thereof, the method comprising:(a) exposing at least a portion of a blood vessel of the subject;(b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment;(c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3;(d) incubating the temporarily blocked blood vessel segment with the vector;(e) removing the vector from the temporarily blocked blood vessel segment;(f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel; and(g) connecting the blood vessel to the subject’s cardiovascular system, creating an AVF.
3. The method of claim 1 or 2, wherein the temporarily blocked blood vessel segment is incubated with the vector for at least 30 min.
4. The method of any one of claims 1-3, wherein the method reduces neointimal hyperplasia in the blood vessel.
5. The method of any one of claims 1-4, wherein the method increases endothelization in the blood vessel.
6. The method of any one of claims 1-5, the method comprising fully removing the portion of the blood vessel from the subject.
7. A method of reducing neointimal hyperplasia and / or increasing endothelization in a blood vessel in a subject in need thereof, the method comprising:(a) exposing at least a portion of a blood vessel of the subject;(b) temporarily blocking the proximal and distal ends of a segment of the blood vessel, creating a temporarily blocked blood vessel segment;(c) administering into the temporarily blocked blood vessel segment a vector comprising a payload, wherein the payload reduces expression of SMAD3;(d) incubating the temporarily blocked blood vessel segment with the vector;(e) removing the vector from the temporarily blocked blood vessel segment; and(f) removing the temporary blockage of the proximal and distal ends of the segment of the blood vessel.
8. The method of claim 7, wherein the temporarily blocked blood vessel segment is incubated with the vector for at least 30 min.
9. The method of any one of the preceding claims, wherein the method increases blood vessel patency.
10. The method of any one of the preceding claims, wherein the method reduces endothelial to mesenchymal transition (EndMT) in the blood vessel.
11. The method of any one of the preceding claims, wherein the method reduces thrombosis in the blood vessel.
12. The method of any one of the preceding claims, wherein the method reduces TGF-beta signaling in the blood vessel.
13. The method of any one of the preceding claims, wherein the subject has a cardiovascular disease.
14. The method of claim 13, wherein the subject has occlusive atherosclerotic disease.
15. The method of claims 13 or 14, wherein the blood vessel is a vein, and wherein the subject is receiving vein graft surgery.
16. The method of claim 15, wherein the vein graft surgery is interposition vein grafting into the arterial circulation of the subject, or bypass surgery.
17. The method of claims 15 or 16, wherein the method reduces adverse vein graft remodeling.
18. The method of any one of claims 1-13, wherein the blood vessel is a vein.
19. The method of any one of claims 1-13, wherein the blood vessel is an artery.
20. The method of any one of claims 2-5, 9-12, 18, and 19, wherein the subject has kidney disease.
21. The method of any one of claims 2-5, 9-12, and 18-20, wherein the subject is undergoing dialysis.
22. The method of any one of the preceding claims, wherein the payload is a nucleic acid or a protein.
23. The method of claim 22, wherein the payload is a nucleic acid.
24. The method of claim 23, wherein the nucleic acid is (i) a DNA molecule encoding an RNA molecule that reduces expression of SMAD3 or (ii) an RNA molecule that reduces expression of SMAD3.
25. The method of claim 24, wherein the RNA molecule is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).
26. The method of claim 22, wherein the payload comprises:(a) (i) a DNA molecule encoding a guide RNA (gRNA) that is substantially complementary to the SMAD3 gene or (ii) a gRNA that is substantially complementary to the SMAD3 gene; and(b) one or more nucleic acid sequences encoding one or more RNA-guided DNA endonucleases.
27. The method of claim 26, wherein the one or more RNA-guided DNA endonucleases are selected from Cas9, CasX, CasY, Cast 3, or Cpfl.
28. The method of any one of claims 1-27, wherein the vector is a non-viral vector.
29. The method of any one of claims 1-27, wherein the vector is a viral vector.
30. The method of claim 29, wherein the viral vector is a lentiviral vector.
31. The method of any one of the preceding claims, wherein the subject is human.
Citation Information
Patent Citations
Compositions and methods for treatment of lymphatic and venous vessel arterialization
US20060025338A1
Use of recombinant adeno-associated virus vector (rAAV) for the prevention of smooth muscle cell proliferation in a vascular graft
US20060099183A1
Method to inhibit endothelial-to-mesenchymal transition
US20180311356A1