Covalent inhibition of SARS-cov-2 RNA methylation for treatment of pan-coronaviral infections

The small molecule inhibitor AT501 targets the SARS-CoV-2 Nspl6/Nspl0 complex to inhibit RNA methylation, addressing the lack of effective treatments for COVID-19 by blocking viral replication and immune evasion, offering a broad-spectrum therapeutic option.

WO2025207791A1PCT designated stage Publication Date: 2025-10-02BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/021585
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-03-26
Filing Date
2025-03-26
Publication Date
2025-10-02

AI Technical Summary

Technical Problem

Current treatments for COVID-19 are limited, and there is a need for additional therapeutic options to manage or reduce symptoms of viral infections, particularly targeting the SARS-CoV-2 virus by inhibiting its RNA methylation process to trigger an immune response.

Method used

A small molecule inhibitor, AT501, is designed to covalently bind to the SARS-CoV-2 Nspl6/Nspl0 complex, blocking the SAM binding pocket and disrupting the RNA cap binding, thereby inhibiting the 2’-O-ribose RNA methylation essential for viral infections and host immune evasion.

Benefits of technology

AT501 effectively blocks the enzymatic activity of Nspl6, slowing down viral replication and triggering an immune response, potentially serving as a pan-coronaviral therapeutic.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025021585_02102025_PF_FP_ABST
    Figure US2025021585_02102025_PF_FP_ABST
Patent Text Reader

Abstract

Aspects are directed to a novel small molecule inhibitor of Nsp16 having a chemical formula of (N-[9-[(2R,3R,4S,5S)-5-(chloromethyl)-3,4-dihydroxy-tetrahydrofuran-2-yl]purin-6-yl]prop-2-enamide) (AT501) or analogs thereof. Other aspects are directed to a therapeutic composition comprising AT501 or analogs thereof, further including antiviral compounds or anticancer compounds. Certain aspects are directed to a method of treating Coronavirus infection by administering AT501 or a composition thereof to a subject having or at risk of obtaining a Coronavirus infection caused by SARS-CoV-1 or SARS-CoV-2 virus. Certain aspects are directed to methods of treating cancer by administering AT501 or a composition thereof to a subject having or at risk of developing cancer, such as leukemia.
Need to check novelty before this filing date? Find Prior Art

Description

COVALENT INHIBITION OF SARS-CoV-2 RNA METHYLATION FOR TREATMENT OF PANCORONA VIRAL INFECTIONSRELATED APPLICATIONS

[0001] This Application is an International Application claiming priority to U.S. Provisional Patent Application 63 / 570,204 filed 3 / 26 / 2024 which is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY FUNDED RESEARCH

[0002] This invention was made with government support under 1R01 All 61363 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD OF THE INVENTION

[0003] Embodiments are generally directed to the field of medicine and infectious diseases. Particular embodiments are directed to the field of treating viral infections.BACKGROUND

[0004] Coronaviruses (CoVs) enzymatically modify 2’ -OH of ribose sugar of the first transcribed nucleotide (Ni) to protect their mRNA from degradation and escape from the host innate immune recognition (Daffis et al., Nature 468, 452-6, 2010). The 5’-end of Ni base (usually Ai in CoVs, Ai / Gi in other RNA viruses) is enzymatically modified with the sequential attachment of an RNA cap and its subsequent methylation by S-adenosyl-Z-methionine (SAM)- dependent methyltransferases (Ramanathan et al., Nucleic Acids Res 44, 7511-26, 2016; Nencka et al., Nucleic Acids Res 50, 635-50, 2022). The capping of SARS-CoV-2 mRNA includes a combinatorial action of the nidovirus RdRp-associated nucleotidyltransferase (NiRAN) domain of nonstructural protein 12 (Nspl2); Nspl3, a terminal GTP hydrolase; Nsp9, a substrate for AMPylation activity during RNA cap formation (Park et al., Nature 609, 793-800, 2022)(FIG. la). Consistent with its predecessors, the 2’ -OH methylation of Ai base in SARS-CoV-2 is embodied in nonstructural protein 16 (Nspl6), which acts as a SAM-dependent 2’-O- methyltransferase (2’-<9-MTase) in conjunction with its noncatalytic stimulator Nsp 10 (Bouvet et al., PLoS Pathog 6, el000863, 2010; Chen et al., PLoS Pathog 7, el002294, 2011; Decroly et al., PLoS Pathog 7, el002059, 2011; Viswanathan et al., Nat Commun 11, 3718, 2020; Rosas-Lemus et al, Sci Signal 13, 2020; Wilamowski et al., PNAS USA 118, 2021; Krafcikova et al., Nat Comrnun 11, 3717, 2020; Viswanathan et al., Nat Comrnun 12, 3287, 2021; Minasov et al., Sci Signal 14, 2021). The Nspl6 / Nspl0 complex converts the status of the mRNA cap from Cap- 0 (mvGpppA) to Cap-1 (mAipppAm). Previous studies on SARS-CoV, MERS-CoV, and even SARS-CoV-2 proteins suggest Nspl6 / Nspl0 heterodimer to be an active 2’-O-Mtase (Decroly et al., PLoS Pathog 7, el002059, 2011; Viswanathan et al., Nat Comrnun 11, 3718, 2020; Rosas- Lemus et al., Sci Signal 13, 2020; Wilamowski et al., PNAS USA 118, 2021; Krafcikova et al., Nat Comrnun 11, 3717, 2020; Viswanathan et al., Nat Comrnun 12, 3287, 2021; Minasov et al., Sci Signal 14, 2021). The Cap-1 formation by Nspl6 / Nspl0 can avert the recognition of SARS- CoV-2 mRNA by melanoma differentiation-associated protein 5 (MDA5) and shields it from type I interferon (IFN-I)-induced antiviral response (Russ et al., EMBO Rep, e55648, 2022). Consistently, genetic perturbation of Nspl6 activity leads to induction of IFN-I via the MDA5 RNA sensor (Russ et al., EMBO Rep, e55648, 2022; Zust et al., Nat Immunol 12, 137-43, 2011; Schindewolf et al., J Virol 97, e0153222, 2023; Schindewolf and Menachery, Virus Res 336, 199211, 2023).

[0005] Clinical studies have reported the lack or a significant delay in the production of IFN- I and IFN-III in patients with severe COVID-19 disease (Park and Iwasaki, Cell Host Microbe 27, 870-78, 2020). Hence, the ablation of Nspl6 activity should trigger an immune response to CoV infection to limit pathogenesis (Daffis et al., Nature 468, 452-6, 2010; Zust et al., Nat Immunol 12, 137-43, 2011). Genomic disruption of SARS-CoV Nspl6 reduces the synthesis of viral RNA replication (Schindewolf et al., J Virol 97, e0153222, 2023; Almazan et al., J Virol 80, 10900-6, 2006). Absence of 2’-(9-methylation activity strongly enhances IFN-I responses against viral infections (Daffis et al., Nature 468, 452-6, 2010; Russ et al., EMBO Rep, e55648, 2022; Zust et al., Nat Immunol 12, 137-43, 2011) and attenuates viral replication (Schindewolf et al., J Virol 97, e0153222, 2023; Menachery et al., J Virol 88, 4251-64, 2014). Thus, Nspl6 / Nspl0 complex has emerged as an attractive therapeutic target (Schindewolf and Menachery, Virus Res 336, 199211, 2023; Tsukamoto et al., Cell Chem Biol, 2023). Consistently, short peptides of NsplO encompassing the region that interacts with Nspl6 could block the Nspl6 / Nspl0 interface, thereby reducing viral replication and pathogenesis in vitro and animal models (Wang et al., J Virol 89, 8416-27, 2015).

[0006] According to a conventional model of 2 ’-( -m ethylation in CoVs, Nspl6 interacts with NsplO through a conserved hydrophobic interface and stabilizes the Nspl6 / Nspl0 heterodimer, potentially extending the RNA binding groove. The allosteric stimulation of the 2’- (9-MTase activity of Nspl6 by NsplO, as a universally conserved mechanism for all coronaviruses, including SARS-CoV-2, was postulated to occur through the canonical Nspl6 / Nspl0 heterodimeric interface (Viswanathan et al., Nat Commun 11, 3718, 2020; Rosas- Lemus et al., Sci Signal 13, 2020; Viswanathan et al., Nat Commun 12, 3287, 2021; Minasov et al., Sci Signal 14, 2021). Previous work postulated the existence of a putative allosteric site on the opposite face of Nspl6 that contains a cysteine residue (Cys209), which is only present in Nspl6 of CoV-2, but not of any other P-coronavirus family member (Viswanathan et al., Nat Commun 11, 3718, 2020).

[0007] The massive global COVID-19 pandemic with high morbidity and mortality makes SARS-CoV-2 one of the deadliest viruses in recent history. Moreover, the highly transmissible nature of emerging SARS-CoV-2 variants of concern (VoC) pose an immediate threat to the public from becoming ill of COVID-19 especially in the geographic regions with specific VoC. mRNA vaccines against coronavirus have been the most successful prevention strategy for COVID-19. However, very few treatment options are available to manage or reduce the symptoms of COVID-19 once people become infected. While some small molecules and monoclonal antibodies have been shown to be useful for patients with active COVID-19 infection, there are nonetheless opportunities for improvement.

[0008] There remains a need for additional therapeutic options for treating current and future viral epidemics or pandemics.SUMMARY

[0009] The inventors have discovered a solution to the above referenced problems by (a) identifying a fully-exposed cysteine residue Cysl 15 near the SAM binding region of the catalytic pocket and a partially exposed Cys209 residue within the putative allosteric pocket, (b) designing a small molecule to effectively inhibit enzymatic mechanisms of the viral capping machinery using several high-resolution structures of SARS-CoV-2 Nspl6 / Nspl0 in the substrate and product bound forms, which provided rationale to design a molecule to occupy and block the SAM (methyl donor) pocket of Nspl6.

[0010] A novel small molecule inhibitor AT501 (N-[9-[(2R,3R,4S,5S)-5-(chloromethyl)-3,4- dihydroxy-tetrahydrofuran-2-yl]purin-6-yl]prop-2-enamide) was conceptualized and synthesized with high purity. The co-crystal structure of SARS-CoV-2 Nspl6 / Nspl0 in complex with AT501 revealed two binding sites for the covalent linkage. The structure was refined with two AT501 covalently bound in two different pockets of Nspl6 (FIG. 2e). The final structure reveals that one molecule of AT501 forms a covalent bond with Cysl 15 (the primary binding site, FIG. 2f) whereas a second AT501 engages with Cys25 (the secondary binding site, FIG. 2g). AT501 in primary binding site completely occupies the adenosine base pocket of SAM (methyl donor) and penetrates an adjacent cryptic pocket of SARS-CoV-2 Nspl6. The AT501 rotates -86° about a perpendicular axis passing through the purine ring, orienting ribose sugar towards the 3 io helix of the gate loop-2; thus, the purine ring and ribose sugar assume a radically different position than in SAM. AT501 in the secondary binding site partially occupies the cap-0 binding pocket, which is critical for binding of terminal guanine (m7G) base of the RNA cap. This unique mode of binding allows AT501 to serve as a ‘chemical glue’ by blocking the entry of S-adenosyl methionine (SAM) into the catalytic pocket and perturbing the RNA cap binding and its conformation, thereby effectively blocking the activity of Nspl6, the 2’-O-ribose RNA methyltransferase that is essential for infections and host immune escape by SARS-CoV-2. The Inventors resolved two additional structures of Nspl6 / Nspl0 / AT501 complexes in the presence of substrate (m7GpppA) and product (m7GpppArnU) mimics of the RNA cap (FIG. 2h-k). In both these structures AT501 occupies only the primary site of binding within the SAM pocket thereby, engaging Cysl 15 covalently akin to Nspl6 / Nspl0 / AT501 structure. These results suggest that AT501 can bind to an empty (unoccupied) secondary site while strongly binding to the primary site concomitantly with both RNA cap-0 and cap-1. Thus, the binding mode of AT501 at primary site remain conserved in all three structures suggestive of AT501’s ability to block Cysl 15 and surrounding area in all three apo, RNA cap-0 and RNA cap-1 bound states of Nspl6, sufficient to evict the methyl donor SAM from this pocket.

[0011] Certain aspects are directed to a small molecule inhibitor of Nspl6 having a chemical formula of N-[9-[(2R,3R,4S,5S)-5-(chloromethyl)-3,4-dihydroxy-tetrahydrofuran-2-yl]purin-6- yl]prop-2-enamide (AT501) or analogs thereof.

[0012] Other aspects are directed to a therapeutic composition comprising the small molecule inhibitor AT501 or analogs thereof The composition can further include antiviral compounds or anticancer compounds.

[0013] Certain aspects are directed to a method of treating Coronavirus infection by administering AT501 or analogs thereof or a composition comprising AT501 or analogs thereof to a subject having or at risk of obtaining a Coronavirus infection. The Coronavirus can be SARS-CoV-2 virus. In certain aspects Coronavirus is a novel coronavirus.

[0014] Certain aspects are directed to methods of treating cancer by administering AT501 or analogs thereof or a composition comprising AT501 or analogs thereof to a subject having or at risk of developing cancer. The cancer can be a blood cancer. In certain aspects the blood cancer is a leukemia.

[0015] Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well and vice versa. Each embodiment described herein is understood to be embodiments of the invention that are applicable to all aspects of the invention. It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions and kits of the invention can be used to achieve methods of the invention.

[0016] The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0017] Throughout this application, the term “about” is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0018] The use of the term “or” in the claims is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.”

[0019] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or“containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0020] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains”, “containing,” “characterized by” or any other variation thereof, are intended to encompass a non-exclusive inclusion, subject to any limitation explicitly indicated otherwise, of the recited components. For example, a chemical composition and / or method that “comprises” a list of elements (e.g., components or features or steps) is not necessarily limited to only those elements (or components or features or steps) but may include other elements (or components or features or steps) not expressly listed or inherent to the chemical composition and / or method.

[0021] As used herein, the transitional phrases “consists of’ and “consisting of’ exclude any element, step, or component not specified. For example, “consists of’ or “consisting of’ used in a claim would limit the claim to the components, materials or steps specifically recited in the claim except for impurities ordinarily associated therewith (i.e., impurities within a given component). When the phrase “consists of’ or “consisting of’ appears in a clause of the body of a claim, rather than immediately following the preamble, the phrase “consists of’ or “consisting of’ limits only the elements (or components or steps) set forth in that clause; other elements (or components) are not excluded from the claim as a whole.

[0022] As used herein, the transitional phrases “consists essentially of’ and “consisting essentially of’ are used to define a chemical composition and / or method that includes materials, steps, features, components, or elements, in addition to those literally disclosed, provided that these additional materials, steps, features, components, or elements do not materially affect the basic and novel character! stic(s) of the claimed invention. The term “consisting essentially of’ occupies a middle ground between “comprising” and “consisting of’.

[0023] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.DESCRIPTION OF THE DRAWINGS

[0024] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specification embodiments presented herein.

[0025] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of the specification embodiments presented herein.

[0026] FIG. la- If. Target RNA length and overall structure, (a) Schematic of RNA capping and modification, (b) Sequence and secondary structure of the 5' leader sequence of SARS-CoV- 2 RNA (SEQ ID No:l) depicting the three stem loop (SL1, SL2 and SL3) regions. Cap-0-RNA 10-mer, 16-mer and 30-mer were used to assess its substrate preference of Nspl6 / Nspl0 for methyltransferase activity, (c) A radiometric assay exhibiting enzyme activity on RNA substrates with varied length (n=3). (d) Crystal structure of SARS-CoV-2 Nspl6 / Nspl0 in the presence of SAM (blue), Adenosine (magenta stick), and Cap-0 analog (red stick) (PDB ID: 6WKS). (e) the catalytic pocket of Nspl6 showing hydrogen bonding network (dashed line) within the ‘KDKE’ motif and alignment of methyl group of SAM and the acceptor atom 2 ’-OH of the first transcribed nucleotide (Ai). (!) SAM (blue stick) and its interaction network that include Cysl 15 in the vicinity of N6 amino group of SAM.

[0027] FIG. 2a-2k. chemical structure of SAM. (b) crystal structure of SAM (green stick) bound SARS-CoV-2 Nspl6-Nspl0 complex (grey cartoon), (c) a close up of SAM binding pocket and arrangement of free cysteine 115 (blue stick), (d) chemical structure of AT501 covalent inhibitor, (e) crystal structure of SARS-CoV-2 Nspl6 (cyan)-NsplO (light blue) complex with AT501 (red stick). Two molecules of AT501 covalently engage two cysteine residues, Cysl 15 (primary site) and Cys25 (secondary site), (f) a close up of Nspl6 catalytic pocket occupied by AT501 that forms a covalent bond with Cysl 15 (primary site of binding), (g) a closeup view of secondary binding site where AT501 covalently linked to Cys25 and occupies m7G binding site of the cap-0 binding pocket, (h) crystal structure of SARS-Cov-2 Nspl6 (orange)-NsplO (light blue) complex with bound AT501 (green stick) and Cap-0 analog (magenta stick), (i) a close up of Nspl6 catalytic pocket occupied by AT501 that forms acovalent bond with Cysl 15 (primary site of binding), (j) crystal structure of SARS-Cov-2 Nspl6 (green)-NsplO (light blue) complex with bound AT501 (black stick) and Cap-1 analog (yellow stick), (k) a close up of Nspl6 catalytic pocket occupied by AT501 that forms a covalent bond with Cysl 15 (primary site of binding).

[0028] FIG. 3. A radiometric biochemical assay shows AT501-mediate inhibition of 2’0- methyltransferase activity of Nspl6 / Nspl0 in pH range from 5.5 to 8.5.

[0029] FIG. 4. Secondary structural elements forming the allosteric site on back side of Nspl6 for nucleotides binding whereas they form catalytic surface on the front side of Nspl6.

[0030] FIG. 5a-5c. Allosteric pocket of Nspl6 that works in trans, (a) Snapshots of various ligands that bind to the allosteric pocket in different Nspl6 / Nspl0 crystal structures: Adenosine (PDB ID:617 6WKS), m7GDP (PDB ID: 6WQ3), m7GTP (PDB ID: 6WVN), m7GpppA (PDB ID: 7K0A), 0-D618 Fructose (PDB ID: 6W4H), a-D-Glucose (PDB ID: 7L6R), MES (PDB ID: 8BSD). Last panel: overlay of ligands in the allosteric pocket represented 619 within a triangular boundary formed by Asnl3, Ser276, and Thr56. (b) Multiple sequence alignment of Nspl6 from different CoV members (SARS-CoV-2 (NC_045512), SARS-CoV-1 (NC_004718), MERS-CoV (NC_019843), BCoV-HKU4 (NC_009019), (HCoV-OC43 (KX344031), HCoV-HKUl (KF686346.1), MCoV-JHM (JX169867.1), BCoV-HKU9 (NC_009021.1), HCoV-NL63 (PP187314.1), HCoV-229E (NC_002645), BCoV-2006 (HQ728482.1), PCoV-CV777 (LT906620.1), FCoV (DQ848678.1), TCoV (OQ725698.1), AIBV-M41 (DQ834384.1). The alignment for key residues that form the Nspl6 allosteric pocket and participate in ligand binding is shown (Asnl3, Thr56, Leu57, Thr58, Trpl89, Cys209, Ser276). (c) A radiometric assay shows reduced methyltransferase activity to varying degree of Nspl6 / Nspl0 mutants (n=3).

[0031] FIG. 6. AT501 kills acute myeloid leukemia cells (MOLM-13 cells). IC50=6.7 pm.DESCRIPTION

[0032] The following discussion is directed to various embodiments of the invention. The term “invention” is not intended to refer to any particular embodiment or otherwise limit the scope of the disclosure. Although one or more of these embodiments may be preferred, the embodiments disclosed should not be interpreted, or otherwise used, as limiting the scope of the disclosure, including the claims. In addition, one skilled in the art will understand that thefollowing description has broad application, and the discussion of any embodiment is meant only to be an example of that embodiment, and not intended to imply that the scope of the disclosure, including the claims, is limited to that embodiment.

[0033] 2’-O-ribose methylation of the first transcribed base of RNA viruses, including SARS-CoV-2, serves as a molecular signature to mimic host mRNAs and hijack protein translation machinery during infection. It subverts the innate host antiviral response to help RNA viruses grow inside the host. In SARS-CoV-2, a catalytically active methyltransferase (Nspl6) with its obligate non-catalytic partner NsplO modifies the 2’-OH of the ribose of the first nucleotide (adenine). The very 5 ’-end of the SARS-CoV-2 RNA genome folds into an intricate array of secondary structures, but the assembly of Nspl6 / Nspl0 on longer RNA has been unclear. We show that AT501 can covalently bind to Cysl 15 thereby blocking the entry of SAM and trapping the enzyme into Cap-0 or Cap-1 bound states. Additionally, the secondary site of AT501 binding will completely abolish the enzymatic function of Nspl6-Nspl0 with blocked SAM and substrate pockets. Such unique mode of binding will significantly slow down enzymatic turnover.

[0034] Aspects of the embodiments described a mechanism for blocking the function of SARS-CoV-2 and other coronaviruses. It is contemplated that AT501 has potential utility as a “pan-coronaviral therapeutic”. The well-defined fit of AT501 into the enzymatic pocket of Nspl6 serves as a “chemical glue” covalently modifying the target. AT501 has the following chemical structure and name:N-[9-[(2R,3R,4S,5S)-5-(chloromethyl)-3,4-dihydroxy-tetrahydrofuran-2-yl]purin-6-yl]prop-2- enamide (intermediate 3-7 or AT501)

[0035] Synthetic Scheme:yleid: 3.76% intermediate 3-7 10.0 mg, 90-95% purity

[0036] 1. General procedure for preparation of compound 2.To a solution of (2R,3R,4S,5S)-2-(6-aminopurin-9-yl)-5-(chloromethyl)tetrahydrofuran-3,4-diol (10 g, 35.00 mmol, 1 eq) in DMF (100 mL) was added TBSC1 (15.83 g, 105.01 mmol, 12.87 mL, 3 eq) and imidazole (11.92 g, 175.02 mmol, 5 eq). The mixture was stirred at 50 °C for 16 hr. LC-MS (EW33864-65-P1B) showed the product was detected (RT=1.201, MS=514.1). The reaction mixture was distributed in MTBE (50 mL) and H2O (50 mL). The organic layer was separated, and the aqueous phase was extracted with MTBE (50 mL * 2), the combined organic layers were dried with Na2SO4 and filtered, filtrate was concentrated to give crude product. The crude product was purified by prep-HPLC (NH4OH) to give product. 9-[(2R,3R,4R,5S)-3,4- bis[[tert-butyl(dimethyl)silyl]oxy]-5-(chloromethyl)tetrahydrofuran-2-yl]purin-6-amine (13.1 g, 25.48 mmol, 72.78% yield) was obtained as white solid. LC-MS: EW33864-65-P1B, product: RT = 1.201 min, (M)+= 514.1, purity: 88.2%.

[0037] 2. General procedure for preparation of compound 4To a solution of 9-[(2R,3R,4R,5S)-3,4-bis[[tert-butyl(dimethyl)silyl]oxy]-5- (chloromethyl)tetrahydrofuran-2-yl]purin-6-amine (3 g, 5.83 mmol, 1 eq) in DCM (10 mL) was added TEA (1.77 g, 17.50 mmol, 2.44 mL, 3 eq) and prop-2-enoyl chloride (528.05 mg, 5.83 mmol, 475.72 uL, 1 eq) at -10 C. The mixture was stirred at 20 °C for 2 hr. LC-MS (EW33864- 70-P1A) showed product was detected (RT=1.105, MS=568.1 [M+H]+). The mixture was concentrated to give a residue. The residue was purified by prep-HPLC (FA) to give product. HPLC (EW33864-70-P1F). N-[9-[(2R,3R,4R,5S)-3,4-bis[[tert-butyl(dimethyl)silyl]oxy]-5- (chloromethyl)tetrahydrofuran-2-yl]purin-6-yl]prop-2-enamide (1.2 g, 2.11 mmol, 36.20% yield) was obtained as white solid. LC-MS: EW33864-70-P1A, product: RT = 1.105 min, (M)+= 568.1, purity: 25.0%.

[0038] 3. General procedure for preparation of 5 (intermediate 3-7, AT501).To a solution of N-[9-[(2R,3R,4R,5S)-3,4-bis[[tert-butyl(dimethyl)silyl]oxy]-5 (chloromethyl) tetrahydrofuran-2-yl]purin-6-yl]prop-2-enamide (1 g, 1.76 mmol, 1 eq) in THF (5 mL) was added TBAF (4.60 g, 17.60 mmol, 10 eq). The mixture was stirred at 20 C for 1 hr. LCMS (EW33864-73-P1F) showed product was detected (RT=0.707, MS=340.0 [M+H]+). The mixture was concentrated to give a residue. The residue was purified by prep-HPLC (FA) to give the product. N-[9-[(2R,3R,4S,5S)-5-(chloromethyl)-3,4-dihydroxy-tetrahydrofuran-2-yl]purin-6- yl]prop-2-enamide (25 mg, 66.23 umol, 3.76% yield, 90.0% purity) was obtained as white solid. It was confirmed by LCMS (EW33864-73-P1G), HPLC (EW33864-73-P1D) and HNMR (EW33864-73-P1D). ’H NMR: EW33864-73-P1D (400 MHz, CDC13) 5 8.77 - 8.70 (m, 1H), 8.68 (s, 1H), 8.25 (s, 1H), 6.63 (d, J = 16.9 Hz, 1H), 6.05 (d, J = 5.6 Hz, 1H), 5.96 (d, J= 10.4 Hz, 1H), 4.75 - 4.70 (m, 1H), 4.60 - 4.50 (m, 2H), 3.83 (dd, J = 4.2, 12.7 Hz, 2H). LC-MS: EW33864-73-P1F, product: RT = 0.707 min, (M-55)+=340.0, purity: 100.0%. HPLC: EW33864-73-P1D, purity: 90.03%.I. Compositions for Treating Viral Infection and Cancer

[0039] In light of the current specification, compounds of the invention are appropriate for treating viral infection (e.g., Coronavirus infection) or cancer (e.g., leukemia). For administration, the components described herein will be formulated in a unit dosage form (solution, suspension, emulsion, etc.) in association with a pharmaceutically acceptable carrier. Such vehicles are usually nontoxic and non-therapeutic. Examples of such vehicles are water, saline, Ringer's solution, dextrose solution, and Hank's solution. Non-aqueous vehicles such as fixed oils and ethyl oleate may also be used. A preferred vehicle is 5% (w / w) human albumin in saline. The vehicle may contain minor amounts of additives, such as substances that enhance isotonicity and chemical stability, e.g., buffers and preservatives.

[0040] The therapeutic compositions described herein, as well as their biological equivalents, can be administered independently or in combination by any suitable route. Examples of parenteral administration include intravenous, intraarterial, intramuscular, intraperitoneal, and the like. The routes of administration described herein are merely an example and in no way limiting.

[0041] The dose of the therapeutic compositions administered to an animal, particularly in a human, in accordance with embodiments of the invention, should be sufficient to result in a desired response in the subject over a reasonable time frame. It is known that the dosage of therapeutic compositions depends upon a variety of factors, including the strength of the therapeutic composition employed, the age, species, condition or disease state, and the body weight of the animal. Moreover, dose and dosage regimen will depend mainly on the type of biological damage to the host, the type of subject, the history of the subject, and the type of therapeutic composition being administered. The size of the dose will be determined by the route, timing, and frequency of administration as well as the existence, nature and extent of any adverse side effects that might accompany the administration of a particular therapeutic composition and the desired physiological effect. It is also known that various conditions or disease states, in particular, chronic conditions or disease states, may require prolonged treatment involving multiple administrations.

[0042] Therefore, the amount of the therapeutic composition must be effective to achieve an enhanced therapeutic index. If multiple doses are employed, the frequency of administration will depend, for example, on the type of subject. One skilled in the art can ascertain upon routineexperimentation the appropriate route and frequency of administration for a subject that are most effective in a case. Suitable doses and dosage regimens can be determined by conventionally known range-finding techniques. Generally, treatment is initiated with smaller dosages, which are less than the optimal dose of the compound. Thereafter, the dosage is increased by small increments until the optimal effect under the circumstances is obtained.

[0043] The therapeutic compositions for use in embodiments of the invention generally include carriers. These carriers may be any of those conventionally used and are limited only by the route of administration and chemical and physical considerations, such as solubility and reactivity with the therapeutic agent. In addition, the therapeutic composition may be formulated as polymeric compositions, inclusion complexes, such as cyclodextrin inclusion complexes, liposomes, microspheres, microcapsules, and the like, without limitation.

[0044] The pharmaceutically acceptable excipients described herein, for example, vehicles, adjuvants, carriers, or diluents, are well known and readily available. It is preferred that the pharmaceutically acceptable carrier be one which is chemically inert with respect to the therapeutic composition and one that has no detrimental side effects or toxicity under the conditions of use.

[0045] The choice of excipient will be determined, in part, by the therapeutic composition, as well as by the particular method used to administer the composition. Accordingly, there are a wide variety of suitable formulations of a pharmaceutical composition used in the embodiments of the invention. For example, the non-limiting formulations can be injectable formulations such as, but not limited to, those for intravenous, subcutaneous, intramuscular, intraperitoneal injection, and the like; and oral formulations such as, but not limited to, liquid solutions, including suspensions and emulsions, capsules, sachets, tablets, lozenges, and the like. Nonlimiting formulations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions, including non-active ingredients such as antioxidants, buffers, bacteriostats, solubilizers, thickening agents, stabilizers, preservatives, surfactants, and the like. The solutions can include oils, fatty acids, including detergents and the like, as well as other known and common ingredients in such compositions, without limitation.

[0046] Compounds or a salts thereof used in the present invention can be formulated as pharmaceutical formulations such as oral agents (e.g., tablets, capsules, powders, granules,subtilized granules, pills, suspensions, emulsions, solutions, syrups), injections, eye drops, nasal agents, and percutaneous agents by adding various pharmaceutical additives, such as excipients, binders, disintegrating agents, disintegration-inhibiting agents, hardening / adhesi on-preventing agents, lubricants, carriers for absorption / adsorption, solvents, extenders, isotonizing agents, dissolving aids, emulsifiers, suspending agents, thickeners, coating agents, absorption-promoting agents, gelatinization / coagulation-promoting agents, photostabilizers, preservatives, desiccants, emulsification / suspension / dispersion-stabilizing agents, discoloration-preventing agents, deoxygenation / anti oxidation agents, flavoring / odor-improving agents, coloring agents, foaming agents, defoaming agents, soothing agents, antistatic agents, and buffers / pH modifiers. Preparations administered to patients with novel coronavirus infection are preferably oral agents or injections, more preferably oral agents, yet more preferably tablets.

[0047] The compound(s) can be administered to adults (in one or more doses) at 100, 500, 1000, 1500, 2000 to 2,500 mg a day, including all values and ranges there between. The duration of administration is suitably determined depending on changes in symptoms over time, and for example, can be selected from up to 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, and 22 days. The durations of up to 10 days, 13 days, 14 days, and 22 days are preferred, and in certain aspects the duration is up to 13 days or 14 days.

[0048] In the present invention, the administration of a compound or a salt thereof can include administration of a concomitant drug and / or performing a concomitant therapy. Specifically, the standard of care for a particular condition (e.g., coronavirus infection or cancer) can be included.

[0049] The terms “treating” or “treatment” refer to any success or indicia of success in the attenuation or amelioration of an injury, pathology, or condition, including any objective or subjective parameter such as abatement, remission, diminishing of symptoms or making the injury, pathology, or condition more tolerable to the patient, slowing in the rate of degeneration or decline, making the final point of degeneration less debilitating, improving a subject's physical or mental well-being, or prolonging the length of survival. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neurological examination, and / or psychiatric evaluations.

[0050] “Effective amount” and “therapeutically effective amount” are used interchangeably and refer to an amount of a compound or composition effective to achieve a particular biological or therapeutic result such as, but not limited to, the biological or therapeutic results disclosed herein. A therapeutically effective amount of the compound or composition may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody or functional fragment thereof to elicit a desired response in the individual. Such results may include, but are not limited to, the treatment of coronavirus or the treatment of cancer, as determined by any means suitable in the art.A. Treating Coronavirus Infection

[0051] The term “coronavirus” used in this specification means an RNA virus belonging to the family coronaviridae. order nidovirales. Coronavirus infection is an infectious disease caused by coronavirus. The term “novel coronavirus” means a newly identified and reported novel coronavirus among coronaviruses, and examples thereof include SARS-CoV-2 reported at the end of 2019. The infectious disease caused by SARS-CoV-2 is also called COVID-19. The term “novel coronavirus” naturally encompasses mutants and variants of known coronavirus.

[0052] Treatment means relieving or improving one or more symptoms caused by a specific disease that affects a target patient, as well as delaying the progression of the disease. In an embodiment of the present invention, for example, treatment means relieving or improving symptoms, such as fever, cough, and pneumonia, in patients with coronavirus infection. It also means improving body temperature, percutaneous arterial blood oxygen saturation (SpCh), and chest image findings or achieving negative conversion of coronavirus.B. Treating Cancer

[0053] The present disclosure also relates to compositions or formulations which comprise the anti-cancer compounds or compositions comprising for example AT501 or analogs thereof. In general, the compositions of the present disclosure comprise: (a) an effective amount of one or more anti-cancer compounds for treating leukemia, pre-leukemic conditions, myelodysplastic syndrome or acute myelogenous leukemia. In certain aspects the compounds and compositions of the invention can be used to treat cancers including brain, non-small cell lung, breast, prostate, soft tissues and bone, pancreatic, ovarian, skin, renal, colon, and liver cancers.

[0054] Non-limiting examples of compositions according to the present disclosure include from about 0.001 mg to about 1000 mg of one or more anti-cancer agents according to the present disclosure.IL Examples

[0055] The following examples as well as the figures are included to demonstrate embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples or figures represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, can appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.EXAMPLE IA. Results and Discussion

[0056] RNA substrate preference. CoVs have the longest genome among all positivestrand RNA viruses. The first 394 nucleotides at the 5’-end of CoVs RNA fold into an array of secondary structural elements (stem loop; SLl-7)(Rangan et al., RNA 26, 937-59, 2020). This region harbors a leader sequence of ~75 nt at the 5’-end, which plays an essential role in the discontinuous synthesis of nine sub-genomic RNAs in the [3-CoVs, including SARS-CoV-2 (Sola et al., Annu Rev Virol 2, 265-88, 2015). The leader sequence folds into three distinct stemloops (SL1-3) with 6 nts, including target adenine (Al) that remains unpaired at the 5’-terminus (FIG. lb). The 3 ’-end of the leader sequence overlaps with SL3 and contains a 6 nt long (CUAAAC) transcription regulatory sequence (TRS-L) that fuses with the genome just upstream of the coding sequence for each transcription unit (TRSB (body)) during transcription (Sola et al., Annu Rev Virol 2, 265-88, 2015). On the other hand, the SL1 plays an equally important role in the viral life cycle (Yang and Leibowitz, Virus Res 206, 120-33, 2015). Previous structural studies for 2'-O-MTase activity in SARS-CoV-2 were performed with Cap-0 analog (m7GpppA) or a short 6-mer Cap-0 RNA (m7GpppAUUAAA)( Viswanathan et al., Nat Commun 11, 3718, 2020; Rosas-Lemus et al., Sci Signal 13, 2020; Viswanathan et al., Nat Commun 12, 3287, 2021; Minasov et al., Sci Signal 14, 2021).

[0057] To determine the length of RNA required by Nspl6 / Nspl0 for optimal 2’-(9-MTase activity, three cognate Cap-0 RNA oligonucleotides were designed and synthesized encompassing varied lengths of SARS-CoV-2 mRNA: the 10-mer (m7GpppAUUAAAGGUU (SEQ ID NO: 2)) includes additional four nucleotides downstream of the six unpaired bases; the 16-mer (m7GpppAUUAAAGGUUUAUACC (SEQ ID NO: 3)) includes ten unpaired bases; and the 33-mer (m?GpppAUUAAAGGUUUAUACCUUCCCAGGUAACAAACC(SEQ ID NO:4)) has the entire SL1 sequence that follows the 6 unpaired bases (FIG. lb). An established radiometric assay was used to measure methyl transfer from iH3-labeled SAM (S-adenosyl-Z- methionine) to the 2’ -OH of the first adenine base (Ni) of RNA in the presence of Mg2' as a cofactor in the reaction buffer. Negligible methylation was detected with Cap-0 analog (Cap-0- Ni) but robust methylation with a 10-mer Cap-0 RNA (Cap-0-Nio) as a substrate, corroborating the previous observation (Cap-0-Ne) (Minasov et al., Sci Signal 14, 2021). Adding 6 more nucleotides to the 3 ’-end (Cap-0-Nie) further increased Nspl6 / npsl0 activity. However, the longest 33-mer RNA encompassing the entire 123 SL1 region (Cap-O-Nss) did not enhance methylation beyond what was achieved with the 16-mer RNA (FIG. 1c). The preference for longer substrates with partial or complete SL1 sequence highlights the importance of nucleotides from Ni to Nie for optimal methylation of Cap-0 RNA of SARS-CoV-2. A similar observation was made for an entirely different but critical enzymatic step during RNA capping (i.e., RNAylation of Nsp9 by NiRAN domain of Nspl2) where a 10-mer 5’-pppRNA corresponding to the first 10 bases of the leader sequence yielded robust RNAylation activity (Park et al., Nature 609, 793-800, 2022).

[0058] The Inventors previously resolved high-resolution structures of SARS-CoV-2 Nspl6 / Nspl0 in the substrate and product bound forms. These structures uncovered the network of specific residues that stabilize the methyl donor (SAM) and provided unique insights and paved the way for the rational design of small molecules (FIG. Id-f). It was contemplated that blocking the SAM-binding pocket by an innovative chemical moiety such as a chemical glue may have better antiviral activity by alleviating obstacles associated with peptide folding, permeability, and degradation issues.

[0059] Crystallization and structure determination. To better understand the mode of binding of AT501 we solved three co-crystal structure of SARS-CoV-2 Nspl6 / Nspl0 / AT501 in the presence of only AT501 and mRNA analogs representing Cap-0 (m7GpppA, the substrate)and Cap-1 (m7GpppAmU) to ~2.4 A resolution by X-ray crystallography (FIG. 2e-2k). We show that AT501 forms a covalent bond with Cysl l5 and partially occupies the SAM pocket of SARS-CoV-2 Nspl6 (FIG. 2d-g). Moreover, the tetrahydrofuran ring of AT501 rotates 86° from its original position in SAM-bound structure (PDB: 6WKS, FIG 2b-c) to occupy a cryptic pocket in Nspl6. (FIG. 2e, 2f, 2h, 2i, 2k). Additionally, a secondary binding site for AT501was observed in cap binding pocket. This unique mode of binding will prevent the SAM as well as substrate binding to their respective binding pockets. Given the success of covalent inhibitors in cancer therapy e.g., zanubrutinib72or the experimental G12C RAS inhibitor AMG51072, and paxlovid (Nirmatrelvir) for COVID- 19 therapy14, we are very excited to further develop AT501 for treatment of pan-coronaviral infections. AT501 appears to act as a ‘chemical glue’ by blocking the entry of S-adenosyl methionine (SAM) into the catalytic pocket (Figure 2). AT501 significantly reduces 2'-0 methylation of a 16-mer cognate Cap-0 RNA oligonucleotide encompassing the 5 ’-region of SARS-CoV-2 mRNA in a biochemical assay. Though, highest RNA methylation activity of Nspl6 / Nspl0 was observed at pH 6.5, consistent enzymatic inhibition by AT501 was observed at pH range from 5.5 to 8.5 (FIG. 3).

[0060] Allosteric site in Nspl6 regulates methylation. The existence of this putative allosteric pocket in Nspl6 at the opposite face of catalytic pocket has been reported. This pocket is formed by residues from 01 / al loop (Asnl3), C296 terminal sides of oc2 (Thr56, Leu57, Thr58), al (Ser276), 08 (Trpl89), and 09 (Cys209)(Viswanathan et al., Nat Commun 11, 3718, 2020). Interestingly, the N-terminals of a2, al, 08, and 09 participate in catalysis, RNA recognition, and oligomerization (FIG. 4 and FIG. 5). The 3 ’-end of the remaining nucleotides (Gs - Uio) points toward the allosteric pocket in opposing Nspl6s molecule mainly constituted by Leu57, Thr58, and Trpl89 that accommodates the pyrimidine ring of Uio (FIG. 2f). This pocket is known to bind a variety of nucleotides and ligands (FIG. 5a). Interestingly, the current structure in the presence of the longer RNA doesn’t show a clear electron density for any known ligands observed in the allosteric pocket. Such observation in the structure supports that the nucleotide at the 3’ end of the RNA will most likely get accommodated in the allosteric binding pocket. Single, double, and triple mutant enzymes with alanine as a replacement for residues that line this allosteric pocket showed a marked reduction in 2’-0 ribose methylation. Glul73 and Ser202 were mutated that stabilizes the terminalm7G. A similar reduction in enzymatic activity was observed for the triple (Leu57, Thr58, Cys209) or double (Leu57, Trpl89) mutantscorresponding to the allosteric pocket (FIG. 5c). Cys209 could also engage AT501. However, in our Cap-0 / AT501 and Cap-l / AT501 structures, a second binding site of the terminal region of the cap (m7Gppp) was observed (FIG. 2f-2g).

[0061] The correct chemical makeup and architecture of the 5 ’-end of viral RNA help SARS-CoV-2 evade the host immune restriction and hijack the host’s protein synthesis machinery for replication. SARS-CoV-2 genome encodes Nspl4 and Nspl6, two distinct methyltransferases that install a methylation mark on A of terminal guanine of RNA cap and 2’- OH of ribose of the first transcribed or Cap-adjacent nucleotide (Ai), respectively. The resulting RNA cap mimics the host RNA and avoids immune surveillance by host sensor MDA5 or IFN- stimulated genes IFIT1 and 3 that would otherwise recognize and sequester the uncapped viral RNA and trigger antiviral signaling pathways. A series of structures of the Nspl6 / Nspl0 in the presence of AT501 provide a strong platform for rational designing of covalent inhibitors and chemical glues for on-target inhibition of SARS-CoV-2 Nspl6 enzyme.B. Methods

[0062] Protein expression and purification. The coding sequences of Nspl6 (NCBI reference sequence YP 009725311.1) and NsplO (NCBI reference sequence: YP_0009725306.1) of the Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1 (NC_045512) were cloned into a single pETduet-1 vector downstream to a 6xHis-SUMO tag sequence. This plasmid was transformed into an E. coli expression strain NiCo21(DE3) (NEB C2529H) to co-express the Nspl6 / Nspl0 protein complex. The transformed cells were grown in Terrific Broth medium supplemented with ampicillin (100 pg ml’1) at 37 °C. Protein expression was induced by adding 0.4 mM isopropyl [3-D- l -thiogalactopyranoside (IPTG) at ODeoo = 0.6-0.8 followed by continued incubation of the cultures for 16 h at 18 °C. Cells from 2 liter culture were then harvested by centrifugation at 8983 x g for 20 min and re-suspended in ice cold lysis buffer (25 mM Tris-HCl pH 7.5, 0.5 M NaCl, 0.1 mM TCEP, 10% Glycerol, 5mM Imidazole) supplemented with a protease inhibitor tablet (Pierce). Cell lysis was accomplished using a microfluidizer (Analytik, UK) and the soluble fraction was separated by centrifugation at 158,000 x g for 40 min. The clarified soluble fraction, after passing through a 0.22 pm filter, was loaded on to a Nuvia IMAC column (Bio-Rad) pre-equilibrated in binding buffer containing 25 mM Tris-HCl pH 7.5, 0.5 M NaCl, 0.1 mM TCEP, 10% Glycerol, 5mM Imidazole. The proteinswere eluted by increasing the concentration of imidazole from 0 M to 1.0 M). The 6xHis-SUMO tag was then proteolytically removed and the tag-free sample was re-applied to the IMAC column to separate the un-cleaved protein fraction. The proteins were finally purified by passing through HiLoad 16 / 600 Superdex 75 column (GE Healthcare). The Nspl6 / Nspl0 complex was eluted as a single homogenous species in a final buffer containing 25 mM Tris-HCl pH 7.5, 0.2 M NaCl, 0.1 mM TCEP, and 5 mM MgSCh. The purified protein complex was concentrated to 6 mg / mL, and flash frozen in liquid nitrogen and stored at -80 °C. The same method was used for all mutant Nspl6 / Nsp 10 enzymes reported in this study. Each single point (N13A, L57A, T58A, W189A, C209A), double (L57A / W189A), triple (L57A / T58A / W189 and W5A / Y242A / F245A), and quintuple (W5A / T35A / Y242A / F245A / 413 Q238A) mutations were introduced and an N- terminal deletion mutant of NsplO (Nspl6 / Ai?NsplO) in the Nspl6 / Nspl0 plasmid.

[0063] Crystallization, X-ray data collection and structure determination. The purified Nspl6 / Nspl0 protein complex (13.5 mg / mL) was crystallized as reported previously (Viswanathan et al., Nat Commun 11, 3718, 2020; Viswanathan et al., Nat Commnn 12, 3287, 2021). The Nspl6 / Nspl0 heterodimer complex was co-crystallized with AT501 by mixing in 1 :5 molar ratio (protein : compound). The mixture was set for crystallization using sitting drop vapor diffusion method at 4 °C using commercially available crystallization screens. The hexagonal rood-shaped crystals were observed in one to two weeks in 0.2M magnesium formate crystallization condition. Additionally, these complex crystals were further transferred into the crystallization solution (mother liquor) supplemented with 2.5mM of AT501. For soaking experiments with RNA analogs, crystals of Nspl6 / Nspl0 / AT501 complex were grown in 0.1M MES pH 6.3,0.25M Calcium Acetate, 10% (v / v) 2-propanol. These crystals were soaked in 2.0mM Cap-0 or Cap-1 analogs. Crystals were flash frozen directly in a cryoprotectant solution with 20% Ethylene glycol. The best crystals of Nspl6 / Nspl0 / AT501, Nspl6 / Nspl0 / AT501 / Cap- 0, Nspl6 / Nspl0 / AT501 / Cap-l complexes diffracted X-rays in the range of ~ 1.9 - 2.4 A resolution with synchrotron radiation (Table 1). These crystals belong to space group P3121 with unit cell dimensions a = b = 170.176 A, c = 52.378 A , a = 0 = 90°, and y = 120°(Nspl6 / Nspl0 / AT501), a = b = 168.659 A, c = 52.117 A , a = 0 = 90°, and y = 120°(Nspl6 / Nspl0 / AT501 / Cap-0), a = b = 168.533 A, c = 52.168 A , a = 0 = 90°, and y = 120°(Nspl6 / Nspl0 / AT501 / Cap-l), and with single Nspl6 / Nspl0 heterodimer per asymmetric unit. The X-ray diffraction data measured at wavelength 0.9792 A were indexed, integrated, andscaled using XDS, aimless, and various ccp4 suite programs (truncate, freeflag, and mtz2various) integrated into the RAPD pipeline at the NECAT 24ID-E beamline (Collaborative Computational Project, Acta Crystallogr D Biol Crystallogr 50, 760-3, 1994). The structure was solved by molecular replacement using a Nspl6 / Nspl0 structure bound to SAM and Cap-0 analog (PDB ID:6WKS) as a template in Phaser. The resulting maps indicated clear electron densities for AT501 and Cap analogs. The inventors iteratively built and refined the model with good stereochemistry using the programs Coot and REFMAC, respectively (Table 1). The final models of Nspl6 / Nspl0 / AT501, Nspl6 / Nspl0 / AT501 / Cap-0, and Nspl6 / Nspl0 / AT501 / Cap-l were refined to 2.34 A, 1.97 A, 1.98 A, resolutions with Rfree / Rwork values of -19.93 / 22.46%, -17.76 / 20.41%, and -17.52 / 20.11%, respectively. Ligand topologies and geometrical restraints were generated using PRODRG (URL prodrgl.dyndns.org), GRADE (URL grade.globalphasing.org), and eLBOW (Phenix). All figures of structural models were generated using Pymol (The PyMOL Molecular Graphics System, Version 2.5.4 Schrodinger, LLC). The final figures were prepared using Adobe Illustrator (version 2023).Table 1 : Data collection and refinement statistics (molecular replacement)Nspl6 / Nspl0 / AT501 Nspl6 / Nspl0 / 3- Nspl6 / Nspl0 / AT501(PDB ID) 7int / m7GpppA / rn7GpppAmU(PDB ID) (PDB ID)Data Collection NECAT-24ID-E, NECAT -24ID-E, NECAT-24ID-E,APS APS APSWavelength 0.9792 0.9792 0.9792Resolution range (A)* 73.69-2.34 (2.40- 84.27-1.98 (2.01- 84.33-1.97 (2.00-2.34)* 1.98)* 1.97)*Space group P3121 P3121 P3121Unit cell (A) a, 170.176, 170.176, 168.533, 168.533, 168.659, 168.659, b, c (A) 52.378 52.168 52.117 d= p, y (°) 90, 120 90, 120 90, 120Total reflections 770738 (58260) 620454 (28138) 640951 (31895)Unique reflections 36886 (2818) 59201 (2772) 60280 (2926)Multiplicity 20.9 (20.7) 10.5 ( 10^2) 10.6 ( I ON)Completeness (%) 99.80 (99.18) 99.99 (99.96) 100.00 (100.00)Mean Esigma(I) 16.75 (1.10) 19.96 (1.89) 17.60 (1.91)Wilson B -factor 61.07 41.50 40.53R-merge 0.1177 (2.782) 0.06001 (1.067) 0.07138 (1.105)CCI / 2 0.888 (0.692) 0.999 (0.744) 0.999 (0.755)RefinementReflections used in 36812 (2795) 59194 (2779) 60274 (2924) retinementR-work 0.1993 (0.4282) 0.1752 (0.2917) 0.1776 (0.2801)R-free 0.2246 (0.4453) 0.2011 (0.2849) 0.2041 (0.3224)Number of non- 3307 3537 3528' hydrogen atoms macromolecules 3177 3170 3172 ligands 61 133 140 solvent 69 234 216Protein residues 413 413 413RMS (bonds) 0.005 0.015 0.018RMS (angles) 0.73 1.24 1.38Ramachandran 97.80 97.31 97.07 favored (%)Ramachandran 2.20 2.69 2.93 allowed (%)Ramachandran 0.00 0.00 0.00 outliers (%)Average B -factor 73.77 47.16 46.33(A2) macromolecules 73.74 46.21 45,42 ligands 91.55 61.76 61.41 solvent 65.63 52.44 50.44*Values for outermost shell are given in parentheses.

[0064] Enzyme activity assay. To access preference of RNA substrates for Nspl6 / Nspl0, radiometric assay was performed to test methyltransferase activity for each RNA. Three RNA substrates: Cap-0 10-mer (m7GpppAUUAAAGGUU, SEQ ID NO:2); Cap-0 16-mer (m7GpppAUUAAAGGUUUAUACC, SEQ ID NO:3); Cap-0 30-mer (m7GpppAUUAAAGGUUUAUACCUUCCCAGGUAACAAACC, SEQ ID NO:4), and an RNA Cap-0 analog (m7GpppA) were tested. Each reaction was carried out in a 5 pL mixture containing 50 mM Tris pH 8.0, 5 mM KC1, 1 mM dithiothreitol (DTT), ImM MgCh, 5 pM [methyl-3H] SAM (PerkinElmer), 10 pM substrate RNA, and 2 pM purified Nspl6 / Nspl0 enzyme complex. The reactions were incubated at 37 °C for 1 h and 4 pL of each reaction was quenched by blotting on Hybond-N+ membrane (Amersham). RNA probes were crosslinked to membrane by exposure to ultraviolet light (254 nm) for 2 min. The membranes were successively washed three times by IX PBS followed by three ethanol washes for 5 min each. The membranes were air-dried in the hood for 15 min and the counts per minute (c.p.m.) of the RNA probes were measured using a scintillation counter (Beckman LS6500). Results (FIG. lb, FIG. 3c) presented here are an average of three independent experiments (n = 3) with standard deviation (shown as error bars) for respective RNA substrates. Cap-0 16-mer RNA was used to probe the Nspl6 / Nspl0 inhibition by AT501. Different concentrations (10 pM, 50 pM, 100 pM) of AT501 was incubated at 37 °C for 1 hour in buffers of pH 5.5, 6.5, 7.5, and 8.5. Out of the 5 pL reaction, 4.5 pL of reaction was used to soak the product into the nitrocellulose membrane. Then the membrane was dried at room temperature for 25 minutes. The membrane was then UV exposed to crosslink the product RNA to the membrane and washed with lx PBS buffer three times followed by 95% ethanol wash three times. The membrane was then dissolved in scintillation liquid and radiation counts were taken using scintillation counter.

[0065] Cancer cell killing by AT501. IC50 (half-maximal growth inhibitory concentration) of AT501 for two leukemia cells, MOLM-13 and Kasumi-1, was measured. Cells were allowed to grow to 80% confluency in T75 flask using standard tissue culture procedures (Gibco RPMI, 10%FBS, Antibiotic-Antimycotic). Cells were washed with sterile IX PBS (ThermoFisher Scientific Cat. No. J61196.AP) and counted using a hematocytometer then diluted in warmed complete media to achieve 25,000 cells / well in a 24well plate (ThermoFisher Scientific Cat. No. 142475). Plates were incubated at 37°C, 5% CO2 for one hour. Two-fold serial dilutions of 3-7 Intermediate compounds were prepared in warmed complete media to achieve final concentrations from 50mM to 48.8nM and DMSO concentrations were kept constant throughout each dilution. 3-7 Intermediate compound dilutions were added to cells and allowed to incubate at 37°C, 5% CCh for 3 days, monitoring cell density until confluency was achieved in negative control well. PrestoBlue Cell Viability Reagent (ThermoFisher Scientific Cat. No. A13261) was then added to each well and gently mixed. Plates were incubated at 37°C, 5% CO2 for approximately 3 hours. Plates were protected from light and fluorescence was measured using a ClarioStar microplate reader, Excitation / Emission: 560 / 590. Values were collected and IC50 was calculated using a nonlinear regression model.

Claims

CLAIMS1. A small molecule inhibitor of Nspl6 having a chemical formula of N-[9-[(2R,3R,4S,5S)- 5-(chloromethyl)-3,4-dihydroxy-tetrahydrofuran-2-yl]purin-6-yl]prop-2-enamide (AT501).

2. A therapeutic composition comprising the small molecule inhibitor of claim 1.

3. The composition of claim 2, further comprising antiviral compounds.

4. The composition of claim 2, further comprising anticancer compounds.

5. A method of treating Coronavirus infection by administering the compound of claim 1 or a composition of claim 2 to a subject having or at risk of obtaining a Coronavirus infection.

6. The method of claim 5, wherein the Coronavirus is SARS-CoV-2 virus.

7. The method of claim 5, wherein the Coronavirus is a novel coronavirus.

8. A method of treating cancer by administering the compound of claim 1 or a composition of claim 2 to a subject having or at risk of developing cancer.

9. The method of claim 8, wherein the cancer is a blood cancer.

10. The method of claim 9, wherein the blood cancer is leukemia.

Citation Information

Patent Citations

  • Highly active compounds against covid-19

    US20220347200A1

  • NOVEL ADENOSYLMERCAPTANE DERIVATIVES AS VIRAL mRNA CAP METHYLTRANSFERASE INHIBITORS

    WO2022189846A1