Targeted expression of regeneration factors in aged / senescent cells

Abstract

Provided are materials and methods for rejuvenating senescent cells. Senescent cells are transduced with a viral vector to express Oct4 and Sox2 proteins for partial cell reprogramming and / or to suppress a senescence-associated secretory phenotype. The materials and methods provided can be used to treat progeria syndrome, signs and symptoms of premature aging or natural aging or to rejuvenate tissue in subjects experiencing premature aging or having an agerelated disease.

Description

TARGETED EXPRESSION OF REGENERATION FACTORS IN AGED / SENESCENT CELLSREFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY VIA EFS-WEB

[0001] The content of electronically submitted sequence listing (Name: 4967_026PC02_Sequencelisting_ST26.XML; Size: 59,819 bytes; and Date of Creation: March 25, 2025), filed with the application, is incorporated herein by reference in its entirety.CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] The present application claims the priority benefit of U.S. Provisional Application No. 63 / 571,068, filed March 28, 2024, and U.S. Provisional Application No. 63 / 575,979, filed April 8, 2024, each of which is incorporated herein by reference in its entirety.BACKGROUND

[0003] Aging is a complex process associated with genomic and epigenomic alterations. Mouse genetic studies have shown that disruption of genes involved in genome maintenance can lead to a shortened lifespan, and genetic or pharmacological intervention of, e.g., the insulin signaling pathway extends longevity in multiple mouse models (Folgueras, A. R., Freitas-Rodriguez, S., Velasco, G. & Lopez-Otin, C. Mouse Models to Disentangle the Hallmarks of Human Aging. Circ Res 123, 905-924, 2018; Grunewald, M. et al. Counteracting age-related VEGF signaling insufficiency promotes healthy aging and extends life span. Science 373, 2021). Other methods, including caloric restriction and heterochronic parabiosis have shown the potential to improve health-span in mice and monkeys (Harrison, D. E. et al. Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. Nature 460, 392-395, 2009; Colman, R. J. et al. Caloric restriction delays disease onset and mortality in rhesus monkeys. Science 325, 201-204, 2009).

[0004] Besides a permanent growth arrest phenotype of senescent cells, chronic DNA damage signaling can drive the expression and secretion of several cytokines, chemokines, growth factors, and proteases; collectively, these features are termedsenescence-associated secretory phenotype (SASP) that have deleterious effects on the tissue microenvironment (Coppe, J. P., Desprez, P. Y., Krtolica, A. & Campisi, J. The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu Rev Pathol 5, 99-118, 2010; Kang, C. et al. The DNA damage response induces inflammation and senescence by inhibiting autophagy of GATA4. Science 349, 2015; Gorgoulis, V. et al. Cellular Senescence: Defining a Path Forward. Cell 179, 813-827, 2019; Herranz, N.& Gil, J. Mechanisms and functions of cellular senescence. J Clin Invest 128, 1238-1246, 2018). SASP can also lead to deterioration of the functional competence of stem cells, thus compromising their role in tissue renewal (Lopez-Otin, C., Blasco, M. A., Partridge, L., Serrano, M. & Kroemer, G. The hallmarks of aging. Cell 153, 1194-1217, 2013).

[0005] Limitations to developing clinical applications of treatments aimed at rejuvenation include understanding the appropriate cell types or cell states and reversal of a growth arrest phenotype of senescent cells. Further, there remains a need for targeted expression of transcription factors to, e.g., yield functional rejuvenation phenotypes at the organ and organism levels without depleting organs and organisms of senescent cells and, e.g., jeopardizing their structural integrities.BRIEF SUMMARY

[0006] Provided are polynucleotides comprising a kozak sequence and a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein, wherein the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0007] In some aspects, the CDKN2A promoter is operably linked to a nucleic acid sequence encoding an Oct4 protein and a Sox2 protein.

[0008] In some aspects, the CDKN2A promoter is a human or murine CDKN2A promoter.

[0009] In some aspects, the human CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

[0010] In some aspects, the murine CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0011] Also provided are polynucleotides comprising an Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein.

[0012] In some aspects, the Efl a promoter is operably linked to a nucleic acid sequence encoding an Oct4 protein and a Sox2 protein.

[0013] In some aspects, the Efl a promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 40.

[0014] In some aspects, the polynucleotide further comprises a CMV enhancer.

[0015] In some aspects, the CMV enhancer has a nucleotide sequence at least 85%, 86%,87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39.

[0016] In some aspects, the polynucleotide further comprises an Efl a intron A.

[0017] In some aspects, the Efl a intron A has a nucleotide sequence at least 85%, 86%,87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41.

[0018] In some aspects, the polynucleotide encodes a human Oct4 protein and a human Sox2 protein.

[0019] In some aspects, the nucleic acid sequence encoding Oct4 comprises SEQ ID NO: 3 and the nucleic acid sequence encoding Sox2 comprises SEQ ID NO: 4.

[0020] In some aspects, the polynucleotide further comprises at least one Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) sequence and at least one polyadenylation signal sequence.

[0021] In some aspects, the at least one polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.

[0022] In some aspects, the polynucleotide further comprises at least one internal ribosome entry site (IRES).

[0023] In some aspects, the polynucleotide further comprises at least one cleavage site.

[0024] In some aspects, the at least one cleavage site is a self-processing cleavage site or a furin cleavage site.

[0025] In some aspects, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.

[0026] In some aspects, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO: 6.

[0027] In some aspects, the polynucleotide further comprises a second promoter.

[0028] In some aspects, the second promoter is a CDKN2A promoter.

[0029] In some aspects, the second promoter is an Efl a promoter.

[0030] In some aspects, the first and the second promoter initiate transcription in the same direction.

[0031] In some aspects, the first and the second promoter initiate transcription in different directions.

[0032] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0033] In some aspects, the polynucleotide further comprises a WPRE sequence.

[0034] In some aspects, the polynucleotide further comprises a polyadenylation signal sequence.

[0035] In some aspects, the cleavage site is a P2A, E2A, F2A, or T2A peptide.

[0036] In some aspects, the cleavage site is a P2A peptide.

[0037] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polynucleotide signal sequence.

[0038] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polynucleotide signal sequence in the 5' to 3' orientation.

[0039] In some aspects, the polynucleotide comprises an Efl a promoter, a nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0040] In some aspects, the polynucleotide further comprises a WPRE sequence.

[0041] In some aspects, wherein the polynucleotide further comprises a polyadenylation signal sequence.

[0042] In some aspects, wherein the cleavage site is a P2A, E2A, F2A, or T2A peptide. In some aspects, wherein the cleavage site is a P2A peptide.

[0043] In some aspects, the polynucleotide further comprises a CMV enhancer.

[0044] In some aspects, the polynucleotide further comprises an Efl a intron A.

[0045] In some aspects, the polynucleotide comprises an CMV enhancer, an Efl a promoter, an Efl a intron A, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polyadenylation signal sequence.

[0046] In some aspects, the polynucleotide comprises an CMV enhancer, an Efl a promoter, an Efl a intron A, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polyadenylation signal sequence in the 5' to 3' orientation.

[0047] In some aspects, a polynucleotide described herein further comprises a reporter gene.

[0048] In some aspects, provided is a vector comprising a polynucleotide as described herein.

[0049] In some aspects, the vector is a viral vector, a non-viral vector, or a polymer.

[0050] In some aspects, the viral vector is an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

[0051] In some aspects, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrhlO, AAV10, AAVRH10, AAV1 1, AAV12, or AAV-DJ vector.

[0052] In some aspects, the AAV vector is an AAV-DJ vector.

[0053] In some aspects, the non-viral vector is a plasmid.

[0054] In some aspects, the polymer is a cationic polymer comprising a polyethyleneimine (PEI) backbone linked to a lipid or a polyethylene glycol (PEG).

[0055] In some aspects, provided is a cell comprising a polynucleotide as described herein or a vector as described herein.

[0056] In some aspects, the cell is a bacterial cell, an insect cell, or an animal cell.

[0057] In some aspects, the animal cell is a mammalian cell.

[0058] In some aspects, provided is a composition comprising the polynucleotide as described herein or the vector as described herein, and a carrier.

[0059] In some aspects, provided is a recombinant adeno-associated vector (rAAV) virus comprising the polynucleotide as described herein and an AAV capsid protein.

[0060] In some aspects, the rAAV comprises an AAV-DJ capsid.

[0061] Also provided are rAAVs comprising a polynucleotide comprising: (a) a 5' inverted terminal repeat; (b) a Kozak sequence; (c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; and (d) a 3' inverted terminal repeat; wherein the polynucleotide comprises a cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein.

[0062] In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein.

[0063] In some aspects, the cleavage site is a self-processing cleavage site or a furin cleavage site.

[0064] In some aspects, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.

[0065] In some aspects, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO: 6.

[0066] In some aspects, the CDKN2A promoter is a human or murine CDKN2A promoter.

[0067] In some aspects, the human CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

[0068] In some aspects, the murine CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0069] In some aspects, the polynucleotide comprises a WPRE sequence.

[0070] In some aspects, the polynucleotide comprises a polyadenylation signal sequence.

[0071] In some aspects, the 5' and 3' inverted terminal repeats are AAV serotype 2 inverted terminal repeats.

[0072] In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a Kozak sequence; (c) a CDKN2A promoter operably linked to a nucleic acid sequenceencoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a WPRE sequence; (e) a polyadenylation signal sequence; and (f) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide. In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a Kozak sequence; (c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a WPRE sequence; (e) a polyadenylation signal sequence; and (f) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide; and wherein the polynucleotide comprises (a)-(f) in the 5' to 3' orientation.

[0073] Also provided are rAAVs comprising a polynucleotide comprising: (a) a 5' inverted terminal repeat; (b) a CMV enhancer; (c) an Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) an Efl a intron A; and (e) a 3' inverted terminal repeat.

[0074] In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein.

[0075] In some aspects, the Efl a promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 40.

[0076] In some aspects, the CMV enhancer has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39.

[0077] In some aspects, the Efl a intron A has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41.

[0078] In some aspects, the polynucleotide comprises a WPRE sequence.

[0079] In some aspects, the polynucleotide comprises a polyadenylation signal sequence.

[0080] In some aspects, the 5' and 3' inverted terminal repeats are AAV serotype 2 inverted terminal repeats.

[0081] In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a CMV enhancer; (c) an Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a Efl aintron A; (e) a WPRE sequence; (f) a polyadenylation signal sequence; and (g) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide.

[0082] In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a CMV enhancer; (c) a Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) an Efl a intron A; (e) a WPRE sequence; (f) a poly adenylation signal sequence; and (g) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide and wherein the polynucleotide comprises (a)-(g) in the 5' to 3' orientation.

[0083] In some aspects, the 5' and 3' inverted terminal repeats are AAV serotype 2 inverted terminal repeats.

[0084] In some aspects, the AAV vector is a AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrhlO, AAV10, AAVRH10, AAV1 1, AAV 12, or AAV-DJ vector. In some aspects, the AAV vector is a AAV-DJ vector. In some aspects, the rAAV comprises an AAV-DJ capsid.

[0085] In some aspects, provided is a pharmaceutical composition comprising the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, or the rAAV as described herein, and a pharmaceutically acceptable carrier.

[0086] In some aspects, provided is a kit comprising the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, or the rAAV as described herein.

[0087] In some aspects, provided is a method for making a rAAV.

[0088] In some aspects, the method comprises providing a cell with (a) AAV rep genes,(b) AAV cap genes, (c) the nucleic acid comprising the polynucleotide as described herein or the vector as described herein, and (d) at least one AAV serotype 2 inverted terminal repeat.

[0089] In some aspects, the method further comprises providing helper functions for generating a productive AAV infection.

[0090] In some aspects, the method further comprises allowing assembly of the AAV and collecting the rAAV.

[0091] In some aspects, the AAV rep genes and AAV cap genes are provided by a plasmid.

[0092] In some aspects, the AAV rep genes and AAV cap genes are stably integrated into the genome of the cell.

[0093] In some aspects, the helper functions are provided by a plasmid.

[0094] In some aspects, the helper functions are provided by an adenovirus vector.

[0095] In some aspects, provided is a rAAV produced by the method described herein.

[0096] In some aspects, provided is a method of reprogramming a senescent cell to a nonsenescent stage phenotype. In some aspects, the method comprises contacting a senescent cell with the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to partially reprogram the senescent cell to a non-senescent stage phenotype.

[0097] In some aspects, provided is a method for reprogramming senescent cells in a subject to a non-senescent stage phenotype. In some aspects, the method comprises administering to the subject in need thereof a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, and partially reprogramming senescent cells of the subject to a non-senescent stage phenotype. In some aspects, the administering is by systemic administration. In some aspects, provided is a method for fully or partially reverting immune senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to fully or partially revert immune senescence in the subject. In some aspects, the administering is by systemic administration.

[0098] In some aspects, the immune senescence is characterized by a decrease in a homing ability of a hematopoietic stem cell (HSC) and the amount effective to partially or fully revert immune senescence in the subject is an amount that is effective to increase the homing ability of the HSC to a level of HSC homing ability found in a HSC of a nonsenescent subject.

[0099] In some aspects, the immune senescence is characterized by a decrease in per-cell repopulating self-renewal activity of a HSC and the amount effective to partially or fully revert immune senescence in the subject is an amount effective to increase the per-cell repopulating self-renewal activity of the HSC to a level of HSC per-cell repopulating selfrenewal activity found in a HSC of a non-senescent subject.

[0100] In some aspects, the immune senescence is characterized by a bias towards myeloid differentiation of a HSC and the amount effective to partially or fully revert immune senescence in the subject is an amount effective to reduce the bias towards myeloid differentiation of the HSC to a level of bias towards myeloid differentiation found in a HSC of a non-senescent subject.

[0101] In some aspects, the immune senescence is characterized by an increase in apoptosis of a HSC upon stress stimuli and the amount effective to partially or fully revert immune senescence in the subject is an amount effective to reduce apoptosis of the HSC upon stress stimuli to a level of apoptosis upon stress stimuli found in a HSC of a nonsenescent subject.

[0102] In some aspects, provided is a method for reducing the number of senescent cells in a subject, the method comprising: administering to the subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to reduce the number of senescent cells in the subject. In some aspects, the administering is by systemic administration.

[0103] In some aspects, provided is a method for extending organismal lifespan of a subject, the method comprising: administering to the subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to extend organismal lifespan of the subject. In some aspects, the administering is by systemic administration.

[0104] In some aspects, provided is a method for reducing progressive body weight loss in a senescent subject, the method comprising: administering to the senescent subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as describedherein, or the pharmaceutical composition as described herein in an amount effective to reduce progressive body weight loss in the senescent subject. In some aspects, the administering is by systemic administration.

[0105] In some aspects, provided is a method for increasing physical fitness in a senescent subject, the method comprising: administering to the senescent subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to increase physical fitness in the senescent subject. In some aspects, the administering is by systemic administration.

[0106] In some aspects, provided is a method for reducing an inflammatory response in a subject, the method comprising: administering to the subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to reduce an inflammatory response in the subject.

[0107] In some aspects, provided is a method for reducing replicative senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to reduce replicative senescence in the subject. In some aspects, the administering is by systemic administration.

[0108] In some aspects, provided is a method for reducing DNA damage induced senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to reduce DNA damage induced senescence in the subject. In some aspects, the administering is by systemic administration.

[0109] In some aspects, provided is a method of reducing oncogene induced senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide as described herein, the vector as described herein, the cell as describedherein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to reduce oncogene induced senescence in the subject. In some aspects, the administering is by systemic administration.

[0110] In some aspects, provided is a method for inhibiting Senescence- Associated Secretory Phenotype (SASP) activity in a cell. In some aspects, the method comprises contacting the cell with the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, in an amount effective to inhibit SASP activity in the cell.[OHl] In some aspects, provided is a method for rejuvenating a senescent cell to a nonsenescent stage phenotype. In some aspects, the method comprises contacting a senescent cell with the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to partially reprogram the senescent cell. In some aspects, the method further comprises contacting the senescent cell the polynucleotide as described herein, or the vector as described herein in an amount effective to inhibit SASP activity in the senescent cell.

[0112] In some aspects, provided is a method for rejuvenating senescent cells in a subject to a non-senescent stage phenotype. In some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, to partially reprogram the senescent cells; and administering to the subject a therapeutically effective amount of the polynucleotide as described herein, or the vector as described herein, to inhibit SASP activity. In some aspects, the administering is by systemic administration.

[0113] In some aspects, provided is a method for increasing age-related survival of a subject. In some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, andreprogramming senescent cells in the subject, whereby the age-related survival of the subject is increased. In some aspects, the administering is by systemic administration.

[0114] In some aspects, provided is a method for treating cellular senescence-related aging in a subject in need thereof. In some aspects, the method comprises administering to subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein. In some aspects, the administering is by systemic administration.

[0115] In some aspects, provided is a method of treating Hutchinson-Gilford Progeria Syndrome in a subject in need thereof. In some aspects, the method comprises administering to subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein. In some aspects, the administering is by systemic administration.

[0116] In some aspects, the subject is a human.

[0117] In some aspects, provided is a method of increasing dermal thickness in a subject in need thereof. In some aspects, the method comprises administering to subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein. In some aspects, the administering is by intradermal injection. In some aspects, the administering is by systemic administration.

[0118] In some aspects, the subject is a human.

[0119] In some aspects, provided is a method of inducing hair growth in a subject in need thereof. In some aspects, the method comprises administering to subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein. In some aspects, the administering is by intradermal injection. In some aspects, the administering is by systemic administration.

[0120] In some aspects, the subject is a human.

[0121] In some aspects, the administration induces increased epidermal thickness, reduced mesangial area in the kidney, increased structural arrangement of hepatocytes in the liver, rescued lymphoid depletion in germinal centers of the spleen, reduced level of inflammatory markers, increased number of hematopoietic stem cells, restoration of bone marrow tissue, and / or an increased activation of DNA repair pathways in the subject.

[0122] In some aspects, the reduced level of inflammatory markers comprises reduced neutrophil invasion in the liver and a reduced inflammatory signature in the spleen.

[0123] In some aspects, a method of treatment is provided, the method comprising contacting a cell with a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, a rAAV as described herein, or a pharmaceutical composition as described herein in an amount effective to partially reprogram the cell. In some embodiments, the method further comprises administering the cell to a subject in need of a partially reprogrammed cell. In some aspects, the cell is a fibroblast. In some aspects, the fibroblast is a mammalian fibroblast. In some aspects, the fibroblast is a human fibroblast.

[0124] In some aspects, provided is a use of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein for treating cellular senescence-related aging.

[0125] In some aspects, provided is a use of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in the manufacture of a medicament for treating cellular senescence-related aging.

[0126] In some aspects, provided is an article of manufacture comprising the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein.BRIEF DESCRIPTION OF THE FIGURES

[0127] FIGs. 1A-1B. Senescence cell specific cellular reprogramming improves health and life span in LAKI / _mice. FIG. 1A: Graphical representation of mouse experiments to evaluate the effect of EFla-OS, mCdkn2a-OS, and mCdkn2a-OSKexpression in mouse health and life span. FIG. IB: Survival curves of LAKI- / - mice injected with no treatment, control GFP, mCdkn2a-OSK, mCdkn2a-OS, EFla-OS, or AAV DJ particles, (no treatment, n>15; GFP, n>15; mCdkn2a-OSK n>18; mCdkn2a-OS, n>15; EFla-OS, n>15).

[0128] FIG. 2. Bulk RNA sequencing analyses of in vitro cultured IMR90 cells (primary human lung fibroblasts) treated with AAV-DJ containing control and the h-CDKN2a-OS constructs. The mRNA levels of CDKN2A (top left), POUF51 (top right), SOX2 (bottom left), and KLF4 (bottom right) in IMR90 cells (primary human lung fibroblast cell line) of various ages at 12 days post- AAV treatment. A and B are 2 replicates of control AAV-treated IMR90 cells that have been in culture for 20 days total. C and D are 2 replicates of hCDKN2A-OS AAV-treated IMR90 cells that have been in culture for 20 days total. E and F are 2 replicates of control AAV-treated IMR90 cells that have been in culture for 50 days total. G and H are 2 replicates of hCDKN2A-OS AAV- treated IMR90 cells that have been in culture for 50 days total. I and J are 2 replicates of AAV-treated IMR90 cells that have been in culture for 85 days total. K and L are 2 replicates of hCDKN2A-OS AAV-treated IMR90 cells that have been in culture for 85 days total. M and N are 2 replicates of control AAV-treated IMR90 cells that have been in culture for 125 days total. O and P are 2 replicates of hCDKN2A-OS AAV-treated IMR90 cells that have been in culture for 125 days total. The mRNA levels are shown normalized to tag counts.

[0129] FIGs. 3A-3E. Heatmap of differentially expressed genes with function related to cell cycle during replicative senescence. IMR90 cells (primary human lung fibroblast cell line) of various ages were treated with AAV-DJ containing a control vector, hCDKN2A-OS, and hCDKN2A-OSK. RNA was collected at 12 days post-AAV treatment, which correlates with 20, 50, 85, and 125 days total in culture. Bulk RNA sequencing analysis was performed for 158 genes associated with cell cycle control.

[0130] FIGs. 4A-4F. Heatmap of differentially expressed genes with function related to inflammation during replicative senescence. IMR90 cells (primary human lung fibroblast cell line) of various ages were treated with AAV-DJ containing a control vector, hCDKN2A-OS, and hCDKN2A-OSK. RNA was collected at 12 days post-AAV treatment, which correlates with 20, 50, 85, and 125 days total in culture. Bulk RNA sequencing analysis was performed for 181 genes associated with inflammation.

[0131] FIG. 5. Map of plasmid construct AAV m-CDKN2A-OS-short WPRE (no GFP)

[0132] FIG. 6. Map of plasmid construct AAV-m-EFla-OS

[0133] FIG. 7. Map of plasmid construct AAV h-CDKN2A-OS-GFP

[0134] FIGs. 8A-8C. Dermal tissue collection using the splint method. FIG. 8A: The plastic splint was fabricated using base molds (Fisherbrand™ Disposable Base Molds, Catalog No. 22-363-555). FIG. 8B: After creating and testing several sizes, an inner diameter of 12 mm and an outer frame of 4 mm were selected as optimal. FIG. 8C: After shaving the tissue collection site, a splint was attached using glue (KRAZY GLUE KG58248SN) after designing the exact area where the splint would be attached. Skin was harvested along with the splints and proceeded to fixation and tissue processing (Tissue- Tek VIP® 6 Al Tissue Processor, Sakura Finetek USA).

[0135] FIGs. 9A-9B. Dermal thickness decreases with age in mice. FIG. 9A: Representative H&E-stained histological findings of mice back skin of 4-, 14-, and 24- months of age. FIG. 9B: Dermal thickness of mice back skin in mice 4-, 14-, and 24- months of age.

[0136] FIGs. 10A-10C. AAVDJ- CDKN2A-OS increases dermal thickness in aged mice abdominal skin. FIG. 10A: Schema of experiment. FIG. 10B: Representative appearance on AAV injection and tissue collection. FIG. 10C: Thirty-three sections (for CDKN2A-OS) and 29 sections (for CDKN2A-GFP) (from 3 animals for each virus) were analyzed for dermal thickness.

[0137] FIGs. 11A-11B. AAVDJ- CDKN2A-OS enhances hair regrowth after hair depilation in aged mice abdominal skin. FIG. 11A: Schema of experiment. FIG. 11B: Appearance of abdominal skin 8 days after depilation in 5 AAVDJ- CDKN2A-OS-treated and 4 AAVDJ- CDKN2A-GFP-treated animals.DETAILED DESCRIPTION

[0138] Provided are materials and methods for rejuvenating senescent cells by expressing rejuvenation factors, e.g., Oct4 and Sox2(OS) proteins in senescent cells. In some aspects, the expression of OS results in partial reprogramming in senescent cells. In some aspects, the expression of OS results in full or partial reversal of aging in aged cells. In some aspects, provided are polynucleotides and vectors comprising OS under the control of aCDKN2A promoter. The polynucleotides and vectors enable expression of OS specifically in senescent cells for targeted phenotype changes in senescent cells while avoiding systemic changes in non-senescent cells. The polynucleotides and vectors also enable expression of OS specifically in aged and / or aging cells for targeted phenotype changes while avoiding systemic changes in non-aged cells.

[0139] Without being bound by theory, applicants believe that expression of reprogramming factors, e.g., OS, driven by the CDKN2A promoter decreases or attenuates as the senescent cells are rejuvenated and / or partially reprogrammed. Without being bound by theory, applicants believe that expression of reprogramming factors, e.g., OS, driven by the CDKN2A promoter decreases or attenuates aging in aged cells. The aged cells can be naturally aged cells or prematurely aged cells.

[0140] Without being bound by theory, expression of reprogramming factors, e.g., OS, driven by the CDKN2A promoter should decrease as the senescent cells are rejuvenated and / or partially reprogrammed, such that the OS expression may serve as a marker of rejuvenation and / or partial reprogramming. Other markers of rejuvenation and / or partial reprogramming such as downregulation of inflammatory / SASP / Stress response / DNA damage / Reactive oxygen species (ROS) genes are disclosed herein.I. Definitions

[0141] In order that the present disclosure can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed disclosure.

[0142] It is to be noted that the term “a” or “an” entity refers to one or more of that entity; for example, “a nucleic acid sequence,” is understood to represent one or more nucleic acid sequences, unless stated otherwise. As such, the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.

[0143] Furthermore, “and / or”, where used herein, is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0144] It is understood that wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of’ and / or “consisting essentially of’ are also provided.

[0145] The term “about” is used herein to mean approximately, roughly, around, or in the regions of. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower).

[0146] The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least,” and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 18 nucleotides of a 21 -nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range. “At least” is also not limited to integers (e.g., “at least 5%” includes 5.0%, 5.1%, 5.18% without consideration of the number of significant figures).

[0147] As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.

[0148] The terms “polynucleotide,” “nucleic acid,” and “polynucleotide,” are used interchangeably in the present application. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. The terms “nucleic acid,” “polynucleotide,” and “polynucleotide,” as used herein, are defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides can also be referred to as nucleic acid molecules or oligomers. Polynucleotides can be made recombinantly, enzymatically, or synthetically, e.g., by solid-phase chemical synthesis followed by purification. When referring to a sequence of the polynucleotide or nucleic acid, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides.

[0149] The term “polypeptide,” as used herein, is intended to encompass a singular “polypeptide” as well as plural “polypeptides,” and comprises any chain or chains of two or more amino acids. Thus, as used herein, a “peptide,” a “peptide subunit,” a “protein,” an “amino acid chain,” an “amino acid sequence,” or any other term used to refer to a chain or chains of two or more amino acids, are included in the definition of a “polypeptide,” even though each of these terms can have a more specific meaning. The term “polypeptide” can be used instead of, or interchangeably with, any of these terms. The term further includes polypeptides which have undergone post-translational or postsynthesis modifications, for example, conjugation of a palmitoyl group, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. The term “peptide,” as used herein, encompasses full length peptides and fragments, variants or derivatives thereof. A “peptide” as disclosed herein can be part of a fusion polypeptide comprising additional components such as, e.g., an albumin or PEG moiety, to increase half-life. A peptide as described herein can also be derivatized in a number of different ways. A peptide described herein can comprise modifications including e.g., conjugation of a palmitoyl group.

[0150] The term “zzz vitro ” as used herein, refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0151] The term “zzz vivo ” as used herein, refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).

[0152] The term “transfection,” as used herein, refers to methods to introduce exogenous nucleic acids into a cell. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures. The list of agents that can be transfected into a cell is large and includes, e.g., siRNA, shRNA, sense and / or anti-sense sequences, DNA encoding one or more genes and organized into an expression plasmid, e.g., a vector.

[0153] The term “percent (%) sequence identity,” as used herein, with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequenceidentity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values can be generated using the sequence comparison computer program BLAST.

[0154] The term “level,” as used herein, refers to an amount or activity of a protein, or mRNA encoding the protein, optionally as compared to a reference. The reference can be any useful reference, as defined herein. By a “decreased level” or an “increased level” of a protein or RNA is meant a decrease or increase in protein or RNA level, as compared to a reference. A level of a protein or RNA can be expressed in mass / vol (e.g., g / dL, mg / mL, pg / mL, ng / mL) or percentage relative to total protein or RNA in a sample.

[0155] The term “promoter,” as used herein, refers to a DNA sequence recognized by the machinery of a cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The term “promoter” is also meant to encompass those nucleic acid elements sufficient for promoter-dependent gene expression controllable for celltype specific, tissue-specific or inducible expression by external signals or agents; such elements can be located in the 5' or 3' regions of the native gene. In some aspects, the promoter can be a constitutively active promoter, a cell-type specific promoter, or an inducible promoter.

[0156] The term “senescent-cell specific promoter,” as used herein, refers to a promoter that is expressed in a senescent cell but not, or in a significantly reduced manner, in a non-senescent cell. Examples of senescent-cell specific promoters include, but are not limited to, a CDKN2A promoter.

[0157] The term “CDKN2A promoter” as used herein, refers to the promoter of the human or mouse cyclin-dependent kinase inhibitor 2A (CDKN2A) gene. The human CDKN2A promoter is provided in SEQ ID NO: 1. The mouse CDKN2A promoter is provided in SEQ ID NO: 2.

[0158] The term “WPRE,” as used herein, refers to a Woodchuck Hepatitis Virus Post- translational Regulatory Element that is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression of genes of a viral vector.

[0159] The term “IRES,” as used herein, refers to an element that promotes direct internal ribosome entry to the initiation codon, such as ATG, of a cistron (a protein encoding region), thereby leading to the cap-independent translation of the gene. See, e.g., Jackson R J et al., Trends Biochem Sci 15(12):477-83 (199); Jackson R J and Kaminski, A. RNA l(10):985-1000 (1995). Under translational control of an IRES translation proceeds in a cap-independent manner.

[0160] The terms “operatively linked,” “operatively inserted,” “operatively positioned,” “under control” or “under transcriptional control” mean that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term “operably linked” means that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s). The term “operably inserted” means that the DNA of interest introduced into the cell is positioned adjacent a DNA sequence which directs transcription and translation of the introduced DNA (i.e., facilitates the production of, e.g., a polypeptide encoded by a DNA of interest).

[0161] The term “cleavage site,” as used herein, refers to a polynucleotide encoding an amino acid sequence that can be proteolytically cleaved or cleaved via ribosome skipping and includes, but is not limited to, a self-processing cleavage site and a furin cleavage site.

[0162] The term “self-processing cleavage site,” as used herein, refers to a post- translational or co-translational processing cleavage site or sequence that can be a DNA or amino acid sequence, exemplified herein by a 2A site, sequence or domain or a 2A-like site, sequence or domain. The self-processing peptide is the peptide expression product of the DNA sequence that encodes a self-processing cleavage site or sequence, which upon translation, functions by causing the ribosome to skip the formation of a peptide bond at the cleavage site, creating two unlinked proteins.

[0163] The term “furin cleavage site,” as used herein, refers to a nucleic acid encoding an amino acid sequence that can be cleaved by endogenous subtili sin-like proteases, such as furin and other serine proteases within the protein secretion pathway. In some aspects, the furin cleavage site includes a consensus sequence RXK(R)R of SEQ ID NO: 6.

[0164] The term “termination signal sequence,” as used herein, can be any genetic element that causes RNA polymerase to terminate transcription, such as for example apolyadenylation signal sequence. A polyadenylation signal sequence is a recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a “poly A site,” i.e., a site on a RNA transcript to which adenine residues will be added by post-transcriptional polyadenylation.

[0165] The term “LAK"7' mouse,” as used herein, refers to a premature aging mouse model with a point mutation in the Lmn gene, which mouse model manifests symptoms reminiscent of accelerated aging in Hutchinson-Gilford Progeria (HGPS) patients.

[0166] The term “aged cell,” as used herein refers to a cell in which complex processes associated with genomic and epigenomic alterations occur that eventually result in permanent growth arrest of the cell.

[0167] The term “senescence,” as used herein refers to the gradual deterioration of functional characteristics of a cell or organism.

[0168] The term “cellular senescence,” as used herein refers to a permanent growth arrest phenotype and chronic DNA damage signaling of a cell; both the permanent growth arrest and chronic DNA damage signaling can drive, among others, the expression and secretion of several cytokines, chemokines, growth factors, and proteases; genomic instability; telomeric attrition; epigenetic alterations; and mitochondrial dysfunction.

[0169] The term “senescence-associated secretory phenotype (SASP),” as used herein refers to the expression and secretion of cytokines, chemokines, growth factors, and proteases by senescent cells, which can lead, among others, to a deterioration of the functional competence of stem cells thereby compromising their role in tissue renewal.

[0170] The term “organismal senescence,” as used herein refers to the aging of a whole organism and includes a decline in the ability to respond to stress, decrease in rejuvenation capacity, stem cell exhaustion, increase in homeostatic imbalance, loss of proteostasis, and increase in age-associated diseases.

[0171] The term “immune senescence,” as used herein refers to an age-related immune dysfunction that includes, among others, thymic involution, an increase in the number of memory T cells, a loss of adaptive diversity, a loss of the ability to respond to antigen and a lingering level of low-grade inflammation.

[0172] The term “replicative senescence,” as used herein refers to cellular senescence induced by excessive cell replication.

[0173] The term “DNA damage induced senescence,” as used herein refers to senescence induced by DNA damage.

[0174] The term “oncogene induced senescence,” as used herein refers to senescence induced by oncogenic signaling resulting from an activating mutation of an oncogene, or the inactivation of a tumor-suppressor gene. The oncogene, for example, can be the Ras GTPase (RAS).

[0175] The term “vector,” as used herein, refers to any vehicle for the cloning of and / or transfer of a nucleic acid into a host cell, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc. A vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment. A “replicon” refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., is capable of replication under its own control. The term “vector” includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo. A large number of vectors are known and used in the art including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. In some aspects, insertion of a polynucleotide into a suitable vector can be accomplished by ligating the appropriate polynucleotide fragments into a chosen vector that has complementary cohesive termini. Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and / or selection of host cells that incorporate and express other coding regions contained on the vector. Examples of selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and the like. Examples of reporters known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), P-galactosidase (LacZ), P- glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. In some aspects, the delivery vector is selected from the group consisting of a viral vector (e.g., an AAV vector), a plasmid, a lipid, a cationic polymer, a protein particle, a bacterial vector, and a lysosome. Some aspects of the disclosure are directed to biological vectors, which can include viruses, particularly attenuated and / or replication-deficient viruses. In some aspects, a vector can include microRNA targeting sequences to increase specificity of vector-mediated transgene expression. In some aspects, the microRNA targeting sequences are incorporated into a 3’ UTR of the polynucleotide or vector. In some aspects, the delivery vector of the disclosure is a viral vector selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

[0176] The terms “adeno-associated virus vector” or “AAV vector,” as used herein, refer to any vector that comprises or derives from components of an adeno-associated vector and is suitable to infect mammalian cells, preferably human cells. The term AAV vector typically designates an AAV-type viral particle or virion comprising a payload. The AAV vector can be derived from various serotypes, including combinations of serotypes (i.e., “pseudotyped” AAV) or from various genomes (e.g., single stranded or self- complementary). In addition, the AAV vector can be replication defective and / or targeted. As used herein, the term “adeno-associated virus” (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAV-DJ, AAVrh8, AAVrhlO, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33:375 (2004)), and any other AAV now known or later discovered. See, e.g., FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). In some aspects, an “AAV vector” includes a derivative of a known AAV vector. In some aspects, an “AAV vector” includes a modified or an artificial AAV vector. The terms “AAV genome” and “AAV vector” can be used interchangeably. In some aspects, the AAV vector is modified relative to the wild-type AAV serotype sequence.

[0177] The term “AAV particle,” as used herein, refers to an AAV virus that comprises an AAV vector having at least one payload region (e.g., a polynucleotide encoding a therapeutic protein or peptide) and at least one inverted terminal repeat (ITR) region. In some aspects, the term “AAV vectors” refers to AAV vectors comprising a polynucleotide encoding an Oct4 protein and / or Sox2 protein.

[0178] The term “AAV rep gene,” as used herein, refers to the large open reading frame (ORF), known as the AAV replication (rep) region, of an AAV genome. This ORFencodes replication gene products Rep78, Rep 68, Rep 52, and Rep 40, which are named for their apparent molecular weights and which allow for the replication, assembly, and packaging of a complete AAV virions.

[0179] The term “AAV cap gene,” as used herein, refers to the large open reading frame (ORF), known as the AAV capsid (cap) region, of an AAV genome. This ORF encodes at least three capsid proteins: VP1, VP2, and VP3, which allow for the assembly of AAV capsids into which AAV genomes are packaged with the aid of AAV Rep proteins to generate AAV viruses.

[0180] The phrase “AAV helper functions for generating a productive AAV infection,” as used herein, refers to AAV rep and AAV cap genes provided by a source other than the nucleic acid comprising the payload region and the at least one ITR, such that AAV capsid production, AAV payload / ITR nucleic acid replication and AAV payload / ITR insertion into the assembled AAV capsid can occur. AAV helper functions can be provided by co-infection of the AAV producer cells with wild-type AAV virions, by providing one or more plasmids comprising the AAV rep and AAV cap genes to the AAV producer cell, or by infecting the AAV producer cell with a non- AAV virus carrying the AAV rep and AAV cap genes. AAV particles produced according to the methods described herein lack AAV rep and AAV cap genes and contain the AAV payload / ITR nucleic acid. When administered to a cell of a subject, the AAV virion, in the absence of AAV rep and AAV cap genes, cannot replicate or form more AAV virions in the subject’s cell. Instead, the AAV virions release their pay load / ITR nucleic acid upon entry into a subject’s cells and the payload gene is transcribed in the subject’s cell to produce the payload protein.

[0181] The phrase “contacting a cell” (e.g., contacting a cell with an AAV vector, an AAV capsid, or the pharmaceutical composition of the disclosure) as used herein, includes contacting a cell directly or indirectly. In some aspects, contacting a cell with an AAV vector, an AAV capsid, or a composition includes contacting a cell in vitro with the composition, the AAV vector, or the AAV capsid or contacting a cell in vivo with the AAV vector, the AAV capsid, or composition. Thus, for example, the AAV vector, AAV capsid, or composition can be put into physical contact with the cell by the individual performing the method, or alternatively, the AAV vector, AAV capsid, or composition can be put into a situation that will permit or cause it to subsequently come into contact with the cell. In some aspects, contacting a cell in vitro can be done, e.g., by incubatingthe cell with the AAV vector, AAV capsid, or composition. In some aspects, contacting a cell in vivo can be done, e.g., by injecting the AAV vector, AAV capsid, or composition of the disclosure into or near the tissue where a target cell is located, or by injecting the AAV vector, AAV capsid, or composition into an area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. Further, an AAV vector or AAV virus can be encapsulated and / or coupled to a ligand that directs the AAV vector or AVA virus to a site of interest. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell can be contacted in vitro with an AAV vector, an AAV capsid, or a composition and subsequently transplanted into a subject.

[0182] In some aspects, contacting a cell with an AAV vector, an AAV capsid, or a composition of the present disclosure includes “introducing” or “delivering” (directly or indirectly) the AAV vector, the AAV capsid, or the composition into the cell by facilitating or effecting uptake or absorption into the cell. Introducing an AAV vector, an AAV capsid, or a composition into a cell can be in vitro and / or in vivo. For example, for in vivo introduction, an AAV vector, an AAV capsid, a composition can be injected into a specific tissue site (e.g., the locus where a therapeutic effect is desired) or administered systemically (e.g., administering an AAV vector targeted to a locus where a therapeutic effect is desired). In vitro introduction of an AAV genome or a payload / ITR polynucleotide into a cell includes methods known in the art such as electroporation and lipofection.

[0183] The terms “effective amount,” “therapeutically effective amount,” and a “sufficient amount” of, e.g., an AAV vector, an AAV capsid, or a composition disclosed herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an “effective amount” or synonym thereto depends on the context in which it is being applied. In some aspects, a therapeutically effective amount of an agent (e.g., an AAV vector, an AAV capsid, a composition disclosed herein) is an amount that results in a beneficial or desired result in a subject as compared to a control. The amount of a given agent (e.g., an AAV vector, an AAV capsid, or a composition disclosed herein) will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and / or weight), or host being treated, and the like.

[0184] The term “gene therapy,” as used herein, refers to the insertion of nucleic acid sequences (e.g., a polynucleotide comprising a promoter operably linked to a nucleic acid encoding a therapeutic molecule as disclosed herein) into an individual’s cells and / or tissues to treat, reduce the symptoms of, or reduce the likelihood of a disease or aging- related condition. Gene therapy also includes insertion of transgene that are inhibitory in nature, i.e., that inhibit, decrease or reduce expression, activity or function of an endogenous gene or protein, such as an undesirable (e.g., senescence inducing) or aberrant (e.g., pathogenic) gene or protein. Such transgenes can be exogenous. An exogenous molecule or sequence is understood to be molecule or sequence not normally occurring in the cell, tissue, and / or individual to be treated.

[0185] The term “pharmaceutical composition,” as used herein, represents a composition comprising a compound or molecule described herein, e.g., an AAV vector disclosed herein, formulated with a pharmaceutically acceptable excipient, and can be manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of a disease in a mammal.

[0186] The term “pharmaceutically acceptable excipient,” as used herein, refers to any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient.

[0187] The term “subject,” as used herein, refers to any organism to which a composition disclosed herein, e.g., an AAV vector of the present disclosure, can be administered, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject can seek or be in need of treatment, require treatment, be receiving treatment, be receiving treatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.

[0188] The terms “treat,” “treated,” and “treating,” as used herein mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological, e.g., an age-related, condition, disorder, or disease, or obtain beneficial or desired clinical results. In some aspects, an age-related condition includes signs and / or symptoms associated with natural aging. In some aspects, treating reduces or lessens the symptoms associated with, e.g., an age-related disease or disorder. In some aspects, the treating results in a beneficial or desired clinical result.Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. In some aspects, treatment includes eliciting a clinically significant response without excessive levels of side effects. In some aspects, treatment includes prolonging survival as compared to expected survival if not receiving treatment. As used herein, the term “amelioration” or “ameliorating” refers to a lessening of severity of at least one indicator of a condition or disease. As used herein, the term “preventing” or “prevention” refers to delaying or forestalling the onset, development or progression of a condition or disease for a period of time, including weeks, months, or years. Ameliorating the disease or disorder includes slowing the course of the disease or disorder or reducing the severity of later-developing an age-related disease or disorder. The “prophylactically effective amount” can vary depending on the characteristics of the agent, e.g., an AAV vector, an AAV capsid, or a composition, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0189] The term “cellular reprogramming,” as used herein, refers to the process of altering a cell using reprogramming factors (e.g. reversing or preventing changes in cells that are causes of dysfunction, deterioration, cell death, senescence or aging). Cellular reprogramming may be complete reprogramming, such that a differentiated cell (e.g., somatic cell) is reprogrammed to a pluripotent stem cell. Cellular reprogramming may be incomplete, such that a differentiated cell (e.g., somatic cell) retains its cellular identity. Cellular reprogramming may be partial, e.g., a stem cell is not created, such that a cell is rejuvenated, or takes on more youthful attributes (e.g., increased survival, reduced inflammation). Cellular reprogramming may provide additional cellular functions, or prevent cellular senescence.

[0190] The term “rejuvenating a cell,” as used herein, is meant to include preventing or reversing the cellular causes of aging without inducing a pluripotent state.

[0191] A “pluripotent state” as used herein is meant to include a state in which the cell expresses at least one stem cell marker such as, but not limited to, Esrrb, Nanog, Lin28, TRA-1-60 / TRA-1-81 / TRA-2-54, SSEA1, or SSEA4. Methods of measuring the expression of stem cell markers on the cell are known in the art and include the methods described herein.IL Polynucleotides

[0192] Provided are polynucleotides for expression of cell rejuvenation promoting proteins in senescent cells. In some aspects, the polynucleotides comprise a promoter that is active in senescent cells. In some aspects, the promoter is a promoter of a cyclin- dependent kinase inhibitor 2 A (CDKN2A) gene. In some aspects, the promoter comprises a polynucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical the human CDKN2A promoter of SEQ ID NO: 1. In some aspects, the promoter comprises the nucleic acid sequence of SEQ ID NO: 1. In some aspects, the promoter comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical the mouse CDKN2A promoter of SEQ ID NO: 2. In some aspects, the promoter comprises the nucleic acid sequence of SEQ ID NO: 2.

[0193] In some aspects, the promoter is an Efl a promoter. In some aspects, the Efl a promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 40. In some aspects, the EFla promoter comprises the nucleic acid sequence of SEQ ID NO: 40.

[0194] In some aspects, the polynucleotide comprises a nucleic acid sequence encoding an Oct4 protein. In some aspects, the Oct4 protein is a human Oct4 protein. In some aspects, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical to the human Oct4 sequence of SEQ ID NO: 3. In some aspects, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 3.

[0195] In some aspects, the human Oct4 protein comprises an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical to the human Oct4 sequence of SEQ ID NO: 45. In some aspects, the human Oct4 protein comprises the amino acid sequence of SEQ ID NO: 45.

[0196] In some aspects, the polynucleotide comprises a nucleic acid sequence encoding a Sox2 protein. In some aspects, the Sox2 protein is a human Sox2 protein. In some aspects, the polynucleotide comprises a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical to the human Sox2 sequence of SEQ ID NO: 4. In some aspects, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 4.

[0197] In some aspects, the human Sox2 protein comprises an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical to the human Sox2 sequence of SEQ ID NO: 46. In some aspects, the human Sox2 protein comprises the amino acid sequence of SEQ ID NO: 46.

[0198] In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and a nucleic acid encoding a Klf4 protein.

[0199] In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Klf4 protein. In some aspects, the polynucleotide does not comprise a nucleic acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical to the human Klf4 sequence of SEQ ID NO: 5. In some aspects, the polynucleotide does not comprises the nucleic acid sequence of SEQ ID NO: 5.

[0200] In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein. In some aspects, the polynucleotide does not comprise a polynucleotide sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identical to the human Myc sequence of SEQ ID NOs: 42, 43, or 44. In some aspects, the polynucleotide does not comprises the nucleic acid sequence of SEQ ID NOs: 42, 43, or 44.

[0201] In some aspects, a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein are operably linked to a promoter that is active in senescent cells. In some aspects, the promoter is the CDKN2A promoter. In some aspects, the promoter is the Efl a promoter. In some aspects, the nucleic acid sequence encoding an Oct4 protein and the nucleic acid sequence encoding a Sox2 protein are operably linked to the CDKN2A promoter of SEQ ID NO: 1. In some aspects, the nucleic acidsequence encoding an Oct4 protein and the nucleic acid sequence encoding a Sox2 protein are operably linked to the Efl a promoter of SEQ ID NO: 40.

[0202] In some aspects, the polynucleotide further comprises a cleavage site. In some aspects, the cleavage site is a self-processing cleavage site or a furin cleavage site. In some aspects, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide. In some aspects, the furin cleavage site comprise the consensus sequence RXK(R)R of SEQ ID NO: 6. Thus, the polypeptide produced when the polynucleotide is transcribed in a cell can be cleaved by proteases in the cell to release the Oct4 and Sox2 proteins.

[0203] In some aspects, the nucleic acid sequence encoding an Oct4 and a Sox2 protein are ordered in the 5 ’-3’ direction on the polynucleotide such that a desired amount of each of Oct4 and Sox2 is produced in a cell transduced with the polynucleotide. The amount of Oct4 and Sox2 protein required in a specific cell type to induce partial reprogramming may vary and a polynucleotide can be chosen that provides optimal ratio of Oct4 and Sox2 protein levels for partial reprogramming of the respective cell type. In some aspects, the level of protein produced from a polynucleotide is highest the closest a protein encoding polynucleotide sequence is located to the promoter sequence. In some aspects, the nucleic acid sequence encoding an Oct4 and a Sox2 protein are located in the 5’ to 3’ order from the promoter sequence.

[0204] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0205] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a first cleavage site, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0206] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding a Sox2 protein, a first cleavage site, a nucleic acid sequence encoding an Oct4 protein in the 5 ’-3’ direction.

[0207] In some aspects, the polynucleotide comprises a EFla promoter, a nucleic acid sequence encoding an Oct4 protein, a first cleavage site, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0208] In some aspects, the polynucleotide comprises a Efl a promoter, a nucleic acid sequence encoding a Sox2 protein, a first cleavage site, a nucleic acid sequence encoding an Oct4 protein in the 5 ’-3’ direction.

[0209] In some aspects, the CDKN2A promoter is a human or murine CDKN2A promoter.

[0210] In some aspects, the first cleavage site is a P2A peptide, an E2A peptide, a F2A peptide, a T2A peptide or a RXK(R)R consensus sequence of SEQ ID NO: 6.

[0211] In some aspects, the second cleavage site is a P2A peptide, an E2A peptide, a F2A peptide, a T2A peptide or a RXK(R)R consensus sequence of SEQ ID NO: 6.

[0212] In some aspects, the polynucleotide further comprises a CMV enhancer. In some aspects, the CMV enhancer has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39. In some aspects, the CMV enhancer has the nucleotide sequence of SEQ ID NO: 39.

[0213] In some aspects, the polynucleotide comprises a CMV enhancer, EFla promoter, a nucleic acid sequence encoding an Oct4 protein, a first cleavage site, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0214] In some aspects, the polynucleotide comprises a CMV enhancer, a Efl a promoter, a nucleic acid sequence encoding a Sox2 protein, a first cleavage site, a nucleic acid sequence encoding an Oct4 protein in the 5 ’-3’ direction.

[0215] In some aspects, the polynucleotide further comprises a Efl a intron A. In some aspects, the Efl a intron A has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41. In some aspects, the Efla intron A has the sequence of SEQ ID NO: 41.

[0216] In some aspects, the polynucleotide comprises a CMV enhancer, EFla promoter, a Efla intron A, a nucleic acid sequence encoding an Oct4 protein, a first cleavage site, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0217] In some aspects, the polynucleotide comprises a CMV enhancer, a Efla promoter, a Efla intron A, a nucleic acid sequence encoding a Sox2 protein, a first cleavage site, a nucleic acid sequence encoding an Oct4 protein in the 5 ’-3’ direction,

[0218] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0219] In some aspects, the polynucleotide further comprises a WPRE sequence.

[0220] In some aspects, the polynucleotide further comprises a polyadenylation signal sequence.

[0221] In some aspects, the cleavage site is a P2A, E2A, F2A, or T2A peptide.

[0222] In some aspects, the cleavage site a P2A peptide.

[0223] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polynucleotide signal sequence. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0224] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polynucleotide signal sequence in the 5' to 3' orientation. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0225] In some aspects, the polynucleotide comprises an Efl a promoter, a nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0226] In some aspects, the polynucleotide further comprises a WPRE sequence.

[0227] In some aspects, wherein the polynucleotide further comprises a polyadenylation signal sequence.

[0228] In some aspects, wherein the cleavage site P2A, E2A, F2A, or T2A peptide. In some aspects, wherein cleavage site a P2A peptide.

[0229] In some aspects, the polynucleotide further comprises a CMV enhancer.

[0230] In some aspects, the polynucleotide further comprises an Efl a intron A.

[0231] In some aspects, the polynucleotide comprises an CMV enhancer, Efl a promoter,Efl a intron A, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polyadenylation signal sequence. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0232] In some aspects, the polynucleotide comprises an CMV enhancer, Efl a promoter, Efl a intron A, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polyadenylation signalsequence in the 5' to 3' orientation. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0233] In some aspects, the polynucleotide comprises a second CDKN2A promoter.

[0234] In some aspects, the polynucleotide comprises a first CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a second CDKN2A promoter, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0235] In some aspects, the polynucleotide comprises a first CDKN2A promoter, a nucleic acid sequence encoding an Sox2 protein, a second CDKN2A promoter, and a nucleic acid sequence encoding a Oct4 protein in the 5 ’-3’ direction.

[0236] In some aspects, the polynucleotide comprises a second Efl a promoter.

[0237] In some aspects, the polynucleotide comprises a first Efl a promoter, a nucleic acid sequence encoding an Oct4 protein, a second Efl a promoter, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0238] In some aspects, the polynucleotide comprises a first Efl a promoter, a nucleic acid sequence encoding an Sox2 protein, a second Efl a promoter, and a nucleic acid sequence encoding a Oct4 protein in the 5 ’-3’ direction.

[0239] In some aspects, the polynucleotide comprises a second Efl a promoter and a second CMV enhancer.

[0240] In some aspects, the polynucleotide comprises a first CMV enhancer, a first Efl a promoter, a nucleic acid sequence encoding an Oct4 protein, a second CMV enhancer, a second Efl a promoter, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0241] In some aspects, the polynucleotide comprises a first CMV enhancer, a first Efl a promoter, a nucleic acid sequence encoding an Sox2 protein, a second CMV enhancer, a second Efl a promoter, and a nucleic acid sequence encoding a Oct4 protein in the 5 ’-3’ direction.

[0242] In some aspects, the polynucleotide comprises a second Efl a promoter, a second CMV enhancer, and a second Efl a intron A.

[0243] In some aspects, the polynucleotide comprises a first CMV enhancer, first Efl a promoter, first Efl a intron A, a nucleic acid sequence encoding an Oct4 protein, a second CMV enhancer, a second Efl a promoter, a second Efl a intron A, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0244] In some aspects, the polynucleotide comprises a first CMV enhancer, a first Efl a promoter, first Efl a intron A, a nucleic acid sequence encoding an Sox2 protein, a second CMV enhancer, a second Efl a promoter, a second Efl a intron A, and a nucleic acid sequence encoding a Oct4 protein in the 5 ’-3’ direction.

[0245] In some aspects, the polynucleotide comprises at least one nucleic acid sequence encoding an Oct4 protein. In some aspects, the polynucleotide comprises at least two nucleic acid sequences encoding an Oct4 protein.

[0246] In some aspects, the polynucleotide comprises a first promoter, a first nucleic acid sequence encoding an Oct4 protein, a second promoter, and a second nucleic acid encoding an Oct4 protein. In some aspects, the first promoter is a CDKN2A promoter. In some aspects, the first promoter is a Efl a promoter. In some aspects, the second promoter is a CDKN2A promoter. In some aspects, the second promoter is a Efl a promoter.

[0247] In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Oct4 protein, and a second nucleic acid sequence encoding an Oct4 protein. In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a second nucleic acid sequence encoding an Oct4 protein. In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Oct4 protein, and a second nucleic acid sequence encoding an Oct4 protein. In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a second nucleic acid sequence encoding an Oct4 protein.

[0248] In some aspects, the polynucleotide comprises at least one nucleic acid sequence encoding a Sox2 protein. In some aspects, the polynucleotide comprises at least two nucleic acid sequences encoding a Sox2 protein.

[0249] In some aspects, the polynucleotide comprises a first promoter, a first nucleic acid sequence encoding an Sox2 protein, a second promoter, and a second nucleic acid encoding an Sox2 protein. In some aspects, the first promoter is a CDKN2A promoter. In some aspects, the first promoter is a Efl a promoter. In some aspects, the second promoter is a CDKN2A promoter. In some aspects, the second promoter is a Efl a promoter.

[0250] In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Sox2 protein, and a second nucleic acid sequence encoding an Sox2 protein. In some aspects, the polynucleotide comprises a CDKN2Apromoter, a first nucleic acid sequence encoding an Sox2 protein, a cleavage site, and a second nucleic acid sequence encoding an Sox2 protein. In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Sox2 protein, and a second nucleic acid sequence encoding an Sox2 protein. In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Sox2 protein, a cleavage site, and a second nucleic acid sequence encoding an Sox2 protein.

[0251] In some aspects, the polynucleotide comprises at least one nucleic acid sequence encoding a Oct4 protein and at least one nucleic acid sequence encoding a Sox2 protein. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0252] In some aspects, the polynucleotide comprises a first promoter, a nucleic acid sequence encoding an Oct4 protein, a second promoter, and a nucleic acid encoding a Sox2 protein. In some aspects, the polynucleotide comprises a first promoter, a nucleic acid sequence encoding an Sox2 protein, a second promoter, and a nucleic acid encoding a Oct4 protein. In some aspects, the first promoter is a CDKN2A promoter. In some aspects, the first promoter is a Efl a promoter. In some aspects, the second promoter is a CDKN2A promoter. In some aspects, the second promoter is a Efl a promoter.

[0253] In some aspects, the polynucleotide comprises at least two nucleic acid sequences encoding an Oct4 protein and at least one nucleic acid sequence encoding a Sox2 protein. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0254] In some aspects, the polynucleotide comprises a first promoter, a first nucleic acid encoding an Oct4 protein, a second nucleic acid encoding an Oct4 protein, a second promoter, and a nucleic acid encoding a Sox2 protein. In some aspects, the polynucleotide comprises a first promoter, a nucleic acid encoding a Sox2 protein, a second promoter, a nucleic acid encoding an Oct4 protein, and a second nucleic acid encoding an Oct4 protein. In some aspects, the first promoter is a CDKN2A promoter. In some aspects, the first promoter is a Efl a promoter. In some aspects, the second promoter is a CDKN2A promoter. In some aspects, the second promoter is a Efl a promoter.

[0255] In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Oct4 protein, a second nucleic acid sequence encoding an Oct4 protein, and a nucleic acid sequence encoding a Sox2 protein. In some aspects,the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Oct4 protein, a cleavage site, a second nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0256] In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Oct4 protein, a second nucleic acid sequence encoding an Oct4 protein, and a nucleic acid sequence encoding a Sox2 protein. In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Oct4 protein, a cleavage site, a second nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

[0257] In some aspects, the polynucleotide comprises at least one nucleic acid sequence encoding a Oct4 protein and at least two nucleic acid sequences encoding a Sox2 protein. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0258] In some aspects, the polynucleotide comprises a first promoter, a first nucleic acid encoding an Sox2 protein, a second nucleic acid encoding an Sox2 protein, a second promoter, and a nucleic acid encoding a Oct4 protein. In some aspects, the polynucleotide comprises a first promoter, a nucleic acid encoding a Oct4 protein, a second promoter, a nucleic acid encoding an Sox2 protein, and a second nucleic acid encoding an Sox2 protein. In some aspects, the first promoter is a CDKN2A promoter. In some aspects, the first promoter is a Efl a promoter. In some aspects, the second promoter is a CDKN2A promoter. In some aspects, the second promoter is a Efl a promoter.

[0259] In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Sox2 protein, a second nucleic acid sequence encoding an Sox2 protein, and a nucleic acid sequence encoding a Oct4 protein. In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Sox2 protein, a cleavage site, a second nucleic acid sequence encoding an Sox2 protein, a cleavage site, and a nucleic acid sequence encoding a Oct4 protein.

[0260] In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Sox2 protein, a second nucleic acid sequence encoding an Sox2 protein, and a nucleic acid sequence encoding a Oct4 protein. In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Sox2 protein, a cleavage site, a second nucleic acid sequence encoding an Sox2 protein, a cleavage site, and a nucleic acid sequence encoding a Oct4 protein.

[0261] In some aspects, the polynucleotide comprises at least two nucleic acid sequences encoding a Oct4 protein and at least two nucleic acid sequences encoding a Sox2 protein. In some aspects, the polynucleotide does not comprise a nucleic acid encoding a MYC protein and / or a nucleic acid encoding a Klf4 protein.

[0262] In some aspects, the polynucleotide comprises a first promoter, a first nucleic acid encoding an Oct4 protein, a second nucleic acid encoding an Oct4 protein, a second promoter, a first nucleic acid encoding a Sox2 protein, and a second nucleic acid encoding a Sox2 protein. In some aspects, the first promoter is a CDKN2A promoter. In some aspects, the first promoter is a Efl a promoter. In some aspects, the second promoter is a CDKN2A promoter. In some aspects, the second promoter is a Efl a promoter.

[0263] In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Oct4 protein, a second nucleic acid sequence encoding an Oct4 protein, a nucleic acid sequence encoding a Sox2 protein, and a second nucleic acid sequence encoding a Sox2 protein. In some aspects, the polynucleotide comprises a CDKN2A promoter, a first nucleic acid sequence encoding an Oct4 protein, a cleavage site, a second nucleic acid sequence encoding an Oct4 protein, a cleavage site, a nucleic acid sequence encoding a Sox2 protein, a cleavage site, and a second nucleic acid sequence encoding a Sox2 protein.

[0264] In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Oct4 protein, a second nucleic acid sequence encoding an Oct4 protein, a nucleic acid sequence encoding a Sox2 protein, a second nucleic acid sequence encoding a Sox2 protein. In some aspects, the polynucleotide comprises a Efl a promoter, a first nucleic acid sequence encoding an Oct4 protein, a cleavage site, a second nucleic acid sequence encoding an Oct4 protein, a cleavage site, a nucleic acid sequence encoding a Sox2 protein, a cleavage site, a second nucleic acid sequence encoding a Sox2 protein.

[0265] In some aspects, the first and the second promoter initiate transcription in the same direction.

[0266] In some aspects, the first and the second promoter initiate transcription in different directions.

[0267] In some aspects, the polynucleotide further comprises a polyadenylation signal sequence. In some aspects, the polyadenylation signal sequence is an SV40polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.

[0268] In some aspects, the polynucleotide further comprises a WPRE sequence.

[0269] In some aspects, the polynucleotide further comprises an IRES.

[0270] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a first IRES, a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0271] In some aspects, the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding a Sox2 protein, a first IRES, a nucleic acid sequence encoding an Oct4 protein in the 5 ’-3’ direction.

[0272] In some aspects, the polynucleotide comprises a first CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, an IRES, a second CDKN2A promoter, and a nucleic acid sequence encoding a Sox2 protein in the 5 ’-3’ direction.

[0273] In some aspects, the polynucleotide comprises a first CDKN2A promoter, a nucleic acid sequence encoding a Sox2 protein, an IRES, a second CDKN2A promoter, and a nucleic acid sequence encoding an Oct4 protein in the 5 ’-3’ direction.

[0274] In some aspects, the polynucleotide further comprises a nucleic acid sequence encoding a marker protein. In some aspects, the marker protein is a P-galactosidase protein, a green fluorescent protein, a red fluorescent protein, a yellow fluorescent protein, cyan fluorescent protein, or a blue fluorescent protein, a tdTomato protein, or a mCherry protein.

[0275] In some aspects, the polynucleotide comprises an intron sequence. In some aspects, the intron sequence comprises a CMV intronic sequence, a P-actin intronic sequence, a chicken P-actin intron, a SV40 enhancer sequence, or a combination thereof.III. Vectors and Cells

[0276] Also provided are vectors comprising a polynucleotide as described herein.

[0277] In some aspects, the vectors are viral vectors. In some aspects, the vectors are non-viral vectors. In some aspects, the vectors are lipids. In some aspects, the vectors polymers.

[0278] In some aspects, the viral vectors are vector is adeno-associated viral (AAV) vectors, adenoviral vectors, lentiviral vectors, or retroviral vectors. In some aspects, the AAV vector is a AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8,AAVRH8, AAVrh9, AAV9, AAVrhlO, AAV10, AAVRH10, AAV11, AAV12, or AAV- DJ vector.

[0279] In some aspects, an AAV vector with broad target spectrum is chosen to transduce various cell types. In some aspects, the AAV vector is an AAV-DJ vector.

[0280] In some aspects, an AAV vector with a specific target spectrum is chosen to transduce select cell types. The target specificity of different AAV vectors is known in the art (see, e.g., AAV Production Protocol, Genemedi Biotech, Inc. 2018.).

[0281] In some aspects, the AAV vector is modified to target a select cell type or select cell types. For example, an AAV cap sequence can be modified to remove a cell-targeting epitope from the capsid and introduce an alternative cell-targeting sequence in the capsid. AAV cap sequences modified in this manner are known in the art.

[0282] Also provided here in are rAAVs comprising a polynucleotide comprising: (a) a 5' inverted terminal repeat; (b) a Kozak sequence; (c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; and (d) a 3' inverted terminal repeat; wherein the polynucleotide comprises a cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein.

[0283] In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein.

[0284] In some aspects, the cleavage site is a self-processing cleavage site or a furin cleavage site.

[0285] In some aspects, the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.

[0286] In some aspects, the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO: 6.

[0287] In some aspects, the CDKN2A promoter is a human or murine CDKN2A promoter.

[0288] In some aspects, the human CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

[0289] In some aspects, the murine CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0290] In some aspects, the polynucleotide comprises a WPRE sequence.

[0291] In some aspects, the polynucleotide comprises a polyadenylation signal sequence.

[0292] In some aspects, the 5' and 3' inverted terminal repeats are AAV serotype 2 inverted terminal repeats.

[0293] In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a Kozak sequence; (c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a WPRE sequence; (e) a polyadenylation signal sequence; and (f) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide. In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein.

[0294] In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a Kozak sequence; (c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a WPRE sequence; (e) a polyadenylation signal sequence; and (f) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide; and wherein the polynucleotide comprises (a)-(f) in the 5' to 3' orientation. In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein.

[0295] Also provided herein are rAAVs comprising a polynucleotide comprising: (a) a 5' AAV serotype 2 inverted terminal repeat; (b) a CMV enhancer; (c) a Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a Efl a intron A; (e) a WPRE sequence; (f) a polyadenylation signal sequence; and (g) a 3' AAV serotype 2 inverted terminal repeat.

[0296] In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein.

[0297] In some aspects, the Efl a promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 40.

[0298] In some aspects, the CMV enhancer has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39.

[0299] In some aspects, the Efl a intron A has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41.

[0300] In some aspects, the polynucleotide comprises a WPRE sequence.

[0301] In some aspects, the polynucleotide comprises a polyadenylation signal sequence.

[0302] In some aspects, the 5' and 3' inverted terminal repeats are AAV serotype 2 inverted terminal repeats.

[0303] In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a CMV enhancer; (c) a Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a Efl a intron A; (e) a WPRE sequence; (f) a polyadenylation signal sequence; and (g) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide. In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein.

[0304] In some aspects, the polynucleotide comprises (a) a 5' inverted terminal repeat; (b) a CMV enhancer; (c) a Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; (d) a Efl a intron A; (e) a WPRE sequence; (f) a polyadenylation signal sequence; and (g) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding an Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide and wherein the polynucleotide comprises (a)-(g) in the 5' to 3' orientation. In some aspects, the polynucleotide does not comprise a nucleic acid sequence encoding a Myc protein and / or a nucleic acid sequence encoding a Klf4 protein. In some aspects, the AAV vector is a AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrhlO, AAV10, AAVRH10, AAV11, AAV12, or AAV-DJ vector. In some aspects, the AAV vector is a AAV-DJ vector. In some aspects, the rAAV comprises an AAV-DJ capsid.

[0305] In some aspects, the non-viral vector is a plasmid DNA, a RNA a cationic polymer, a lipid, a lipopolymer or a chemical derivative thereof.

[0306] In some aspects, the cationic polymer is present in an amount sufficient to produce a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector from about 0.1 : 1 to about 100: 1.

[0307] In some aspects, the cationic polymer is present in an amount sufficient to produce a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector from about 0.1 : 1 to about 10: 1.

[0308] In some aspects, the cationic polymer is present in an amount sufficient to produce a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid vector or RNA vector from about 0.1 : 1 to about 5: 1.

[0309] In some aspects, the non-viral vector comprises about 0.5 mg / ml to about 5.0 mg / ml polynucleotide complexed with the cationic polymer. In some aspects, the cationic polymer is a poly(ethylenimine) (PEI) polymer, poly-L-lysine, polyamidoamine, diethylaminoethyl dextrans, chitosan, poly(dimethyl-aminoethyl methacrylates), or derivatives thereof.

[0310] Further provided are cells comprising a polynucleotide as described herein or a vector as described herein. In some aspects, the cells can be bacterial cells, yeast cells, fungal cells, insect cells, or mammalian cells.

[0311] In some aspects, the cells comprising a polynucleotide as described herein can be used to manufacture a viral vector. In some aspects, the cells are insect cells comprising a polynucleotide as described herein and further viral vector production components and are used to prepare a viral vector as described herein. In some aspects, the cells are mammalian cells comprising a polynucleotide as described herein and further viral vector production components and are used to prepare a viral vector as described herein.

[0312] In some aspects, the cells are insect cells comprising a polynucleotide as described herein and AAV viral vector production components and are used to prepare AAV vectors.

[0313] In some aspects, the cells are mammalian cells comprising a polynucleotide as described herein and AAV viral vector production components and are used to prepare AAV vectors.

[0314] In some aspects, the cells comprising a polynucleotide as described herein can be used to treat a subject. In some aspects, the cells comprising a polynucleotide as described herein can be administered to a subject in need of reversing senescence, wherein the cells after being administered express the proteins encoded by the polynucleotides describedherein and the expressed proteins reverse cellular processes associated with a senescent phenotype. In some aspects, the cells comprising a polynucleotide as described herein after being administered to a subject replicate. In some aspects, the cells comprising a polynucleotide as described herein can be hematopoietic progenitor cells. In some aspects, the cells comprising a polynucleotide as described herein can be hematopoietic stem cells. In some aspects, the cells comprising a polynucleotide as described herein can be mesenchymal / stromal stem cells. In some aspects, the cells comprising a polynucleotide as described herein can be adipose stem cells.IV Compositions

[0315] Also provided are compositions comprising polynucleotides as described herein and / or vectors as described herein. In some aspects, the composition are gene therapy compositions. In some aspects, the compositions comprise a polynucleotide as described herein and a delivery agent or the vector as described herein.

[0316] In some aspects, the delivery agent is a cationic polymer. In some aspects, the delivery agent is a lipid, a lipopolymer or a chemical derivative thereof.

[0317] In some aspects, the cationic polymer of the composition is present in an amount sufficient to produce a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid or RNA from about 0.1 : 1 to about 100: 1.

[0318] In some aspects, the cationic polymer of the composition is present in an amount sufficient to produce a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid or RNA from about 0.1 : 1 to about 10: 1.

[0319] In some aspects, the cationic polymer of the composition is present in an amount sufficient to produce a ratio of amine nitrogen in the cationic polymer to phosphate in the DNA plasmid or RNA from about 0.1 : 1 to about 5: 1.

[0320] In some aspects, the polynucleotide as described herein is present at about 0.5 mg / ml to about 5.0 mg / ml complexed with the cationic polymer of the composition. In some aspects, the cationic polymer of the composition is a poly(ethylenimine) (PEI) polymer, poly-L-lysine, poly amidoamine, diethylaminoethyl dextrans, chitosan, poly(dimethyl-aminoethyl methacrylates) or a derivative thereof.

[0321] Further provided are pharmaceutical compositions. In some aspects, the pharmaceutical compositions comprise a pharmaceutically acceptable carrier or excipient.V. Methods of Making Recombinant AA V particles

[0322] Provided are recombinant viral particles for administration to a subject in need of cellular reprogramming from a senescent stage phenotype to a non-senescent stage phenotype. In some aspects, the recombinant viral particles are AAV particles.

[0323] In some aspects, a method for making a rAAV comprises (i) providing a cell with (a) adeno-associated virus (AAV) rep genes, (b) AAV cap genes, (c) the nucleic acid comprising the polynucleotide as described herein or the vector as described herein, and (d) at least one AAV serotype 2 inverted terminal repeat, (ii) providing helper functions for generating a productive AAV infection; (ii) allowing assembly of the AAV; and (iii) collecting the rAAV.

[0324] In some aspects, a method for making a rAAV comprises (i) providing a cell with (a) adeno-associated virus (AAV) rep genes, (b) AAV cap genes, (c) the nucleic acid comprising the polynucleotide of any one of claims 1-40 and at least one AAV serotype 2 inverted terminal repeat or the vector of any one of claims 41-47 (ii) providing helper functions for generating a productive AAV infection; (iii) allowing assembly of the AAV; and (iv) collecting the rAAV.

[0325] In some aspects, the AAV rep genes and AAV cap genes are provided by a plasmid.

[0326] In some aspects, the AAV rep genes and AAV cap genes are provided by an adenovirus vector.

[0327] In some aspects, the AAV rep genes and AAV cap genes are stably integrated into the genome of the cell.

[0328] In some aspects, the helper functions are provided by a plasmid.

[0329] In some aspects, the helper functions are provided by an adenovirus vector.

[0330] In some aspects, provided are rAAV produced by the method described herein.VI. Methods of Treatment

[0331] Provided are methods of treating, preventing, or inhibiting premature aging or an age-related disease in a subject, the method comprising administering a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, a rAAV described herein, a pharmaceutical composition described herein to the subject in an amount effective to treat, prevent, or inhibit premature aging or an age-related disease in the subject.

[0332] In some aspects, the subject has a progeroid syndrome.

[0333] In some aspects, the progeroid syndrome is selected from the group consisting ofHutchinson-Gilford progeria syndrome; Werner syndrome; atypical progeria, mandibuloacral dysplasia type A; mandibuloacral dysplasia type B; mandibuloacral dysplasia associated to MTX2; mandibular hypoplasia, progeroid features and lipodystrophy syndrome (MDPL); Nestor-Guillermo progeria syndrome; and restrictive dermop athy.

[0334] In some aspects, the subject has a mutation in a LMNA gene, ZMPSTE24 gene, BANF1 gene, POLDI gene, MTX2 gene, or WRN gene.

[0335] In some aspects, the subject has signs and / or symptoms of aging.

[0336] In some aspects, methods of treating, preventing or inhibiting signs or symptoms of aging in a subject are provided, the methods comprising administering a therapeutically effective amount of a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, a rAAV described herein, a pharmaceutical composition described herein to the subject in an amount effective to treat, prevent, or inhibit signs and symptoms of aging in the subject.

[0337] In some aspects, a method for treating cellular senescence-related aging in a subject in need thereof is provided. In some aspects, the method comprises administering to subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein.

[0338] In some aspects, a method of reprogramming a senescent cell to a non-senescent stage phenotype is provided. In some aspects, provided is a method of reprogramming a CDKN2A-expressing cell to a non-CDKN2A-expressing cell. In some aspects, the CDKN2A-expressing cell is an aged cell. In some aspects, the CDKN2A-expressing cell is a naturally aged cell. In some aspects, the CDKN2A-expressing cell is a prematurely aged cell. In some aspects, provided is a method of reprogramming a CDKN2A- expressing cell in an aged organism. In some aspects, the method partially or fully reverses aging in the cell. In some aspects, the method partially or fully reverses aging in a naturally aged cell. In some aspects, the method partially or fully reverses aging in a prematurely aged cell. In some aspects, the method partially or fully reverses aging in a cell of an aged organism. In some aspects, the method comprises contacting a senescentcell and / or aged cell and / or aging cell with the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, or the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to partially reprogram the senescent cell to a non-senescent stage phenotype, and / or the aged cell to a non-aged or less-aged phenotype, and / or the aging cell to a non-aging phenotype.

[0339] In some aspects, a method for reprogramming senescent cells in a subject to a non-senescent stage phenotype is provided. In some aspects, the method comprises administering to the subject in need thereof a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, and partially reprogramming senescent cells of the subject to a non-senescent stage phenotype.

[0340] In some aspects, a method for inhibiting Senescence-Associated Secretory Phenotype (SASP) activity in a cell is provided. In some aspects, the method comprises contacting the cell with the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, in an amount effective to inhibit SASP activity in the cell.

[0341] In some aspects, a method for rejuvenating a senescent cell to a non-senescent stage phenotype is provided. In some aspects, the method comprises contacting a senescent cell with the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein in an amount effective to partially reprogram the senescent cell. In some aspects, the method further comprises contacting the senescent cell with the polynucleotide as described herein, or the vector as described herein in an amount effective to inhibit SASP activity in the senescent cell.

[0342] In some aspects, a method for rejuvenating senescent cells in a subject to a nonsenescent stage phenotype is provided. In some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, to partially reprogram the senescentcells; and administering to the subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, to inhibit SASP activity.

[0343] In some aspects, a method for rejuvenating aged cells in a subject to a non-aged or less aged phenotype is provided. In some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, to partially reprogram the aged cells. In some aspects, the aged cell is a naturally aged cell, a prematurely aged cell, and / or a cell in an aged organism. In some aspects, the aged cell is a CDKN2A-expressing cell. In some aspects, administration of the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein to an aged cell partially or fully reverts the aged cell to a non-aged or less aged cell. In some aspects, administration of the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein to a CDKN2A-expressing cell partially or fully reverts the CDKN2A-expressing cell to a non-CDKN2A-expressing cell. In some aspects, administration of the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein to a CDKN2A-expressing cell reduces CDKN2A expression in the cell.

[0344] In some aspects, provided is a method of increasing dermal thickness in a subject in need thereof. In some aspects, the method comprises administering to subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein. In some aspects, the administering is by intradermal injection. In some aspects, the administering is by systemic administration.

[0345] In some aspects, the subject is a human.

[0346] In some aspects, provided is a method of inducing hair growth in a subject in need thereof. In some aspects, the method comprises administering to subject a therapeutically effective amount of the polynucleotide as described herein, the vector as described herein, the cell as described herein, the composition as described herein, the rAAV as describedherein, or the pharmaceutical composition as described herein. In some aspects, the administering is by intradermal injection. In some aspects, the administering is by systemic administration.

[0347] In some aspects, the subject is a human.

[0348] In some aspects, the administration induces increased epidermal thickness, reduced mesangial area in the kidney, increased structural arrangement of hepatocytes in the liver, rescued lymphoid depletion in germinal centers of the spleen, reduced level of inflammatory markers, increased number of hematopoietic stem cells, restoration of bone marrow tissue, and / or an increased activation of DNA repair pathways in the subject.

[0349] In some aspects, the reduced level of inflammatory markers comprises reduced neutrophil invasion in the liver and a reduced inflammatory signature in the spleen.

[0350] In some aspects, a method for increasing age-related survival of a subject is provided. In some aspects, the method comprises administering to a subject in need thereof a therapeutically effective amount of the polynucleotide as described herein, the as described herein, the cell as described herein, the composition as described herein, the rAAV as described herein, or the pharmaceutical composition as described herein, and reprogramming senescent cells in the subject, whereby the age-related survival of the subject is increased.

[0351] In some aspects, the subject is a human.

[0352] In some aspects, provided are methods of treatment comprising contacting a cell with a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, a rAAV as described herein, or a pharmaceutical composition as described herein in an amount effective to partially reprogram the cell. In some aspects, the contacting takes place ex vivo, e.g., in a cell culture dish. In some aspects, the contacted cell is subsequently administered to a subject in need of a partially reprogrammed cell.

[0353] In some aspects, a method of treatment is provided, the method comprising contacting a cell with a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, a rAAV as described herein, or a pharmaceutical composition as described herein in an amount effective to partially reprogram the cell. In further aspects, the method comprises and administering the cell to a subject in need of a partially reprogrammed cell. In some aspects, the cell is a fibroblast.In some aspects, the fibroblast is a mammalian fibroblast. In some aspects, the fibroblast is a human fibroblast.

[0354] In some aspects, provided is a use of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, a rAAV as described herein, or a pharmaceutical composition as described herein for treating cellular senescence-related aging.

[0355] In some aspects, provided is a use of a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, a rAAV as described herein, or a pharmaceutical composition as described herein in the manufacture of a medicament for treating cellular senescence-related aging.

[0356] In some aspects, provided is an article of manufacture comprising a polynucleotide as described herein, a vector as described herein, a cell as described herein, a composition as described herein, a rAAV as described herein, or a pharmaceutical composition as described herein.

[0357] In some aspects, a polynucleotide described herein, a vector described herein, a cell described herein, a composition described herein, a rAAV described herein, a pharmaceutical composition described herein are administered by an intravenous, intramuscular, intradermal, subcutaneous, intraperitoneal, or intranasal route.EXAMPLESMaterials and methodsCell culture

[0358] Human primary lung fibroblast IMR90 cells were obtained from ATCC and were cultured in DMEM (Gibco™), 10% FBS(Gibco™), 1% penicillin / streptomycin (Invitrogen™), along with lx Glutamax (Invitrogen™) and Non-Essential amino acids (Invitrogen™). HEK293 A cells were used for AAV production and maintained in the medium containing DMEM, 10% FBS; 1% penicillin / streptomycin. All cells were cultured at 37° C with 7% CO2 in a humid incubator. Cells were split in regular intervals when they reaching around 70% confluency and the medium was changed every 2 days.Adeno-associated virus (AA V) production

[0359] AAVs were prepared using HEK293-AAV cells (Cell Biolabs, Inc.) as described with minor modifications (Grieger, J. C., Choi, V. W. & Samulski, R. J. NatProtoc 1, 1412-1428, 2006). PEI (MW 40000) was used to transfect cells followed by CsCl gradient purification. Virus titer was determined via qPCR using primers: ITR-F:5’ GGAACCCCTAGTGATGGAGTT 3’ and ITR-R: 5’ CGGCCTCAGTGAGCGA 3’.Plasmid vectors

[0360] All plasmids used in this study are shown in FIGs. 5-7.Real-time quantitative real Polymerase Chain Reaction (PCR)

[0361] mRNA levels were quantified as previously described (Sahu, S. K. et al. Nat Commun 8, 1523, 2017). In brief, total RNA was prepared using Trizol (Invitrogen™) and was reverse transcribed with a First Strand cDNA Synthesis Kit (Fermentas). The transcripts were quantified via PCR using SYBR green PCR MasterMix (AB I) on a ViiA7 PCR machine (Life Technologies™). Human or mouse GAPDH and TBP primers were used for normalization. The sequence details of primers used in this study are listed below. Mouse real-Time PCT primers are listed in Table 1.Table 1

[0362] Human Real-Time PCR primers are listed in Table 2.Table 2Sl 'Q ID NO : 33 : CDKN2A FP : acattcatgtgggcatttcttgSEQ ID NO: 34 CDKN2A aatgcttgtcatgaagtcgacagRPMice

[0363] All animal experiments were carried out following the protocols and ethical guidelines, as approved by the Altos Labs, Inc. The Institutional Animal Care and Use Committee (IACUC) and conform to regulatory standards. LMNAG609G mice were generated by Carlos Lopez-Otin at the University of Oviedo, Spain and kindly donated by Brian Kennedy at the Buck Institute. Eight-week-old male C57BL / 6J mice were obtained from the Jackson Laboratory. Animals were housed in a specific pathogen free environment and kept under standard conditions with a twelve-hour day / night cycle and access to food and water ad libitum.

[0364] AAV particles (IxlO11genetic copies (GC) / mouse as specified) of AAV DJ serotype, carrying GFP or CDKN2A promoter-OSK (Oct4, Sox2 and Klf4), CDKN2A promoter-OS (Oct4 and Sox2), or EFla promoter OS were injected via tail vein in 300 pL PBS into each mouse. Mice were routinely observed for body weight loss and other defects. Mice were sacrificed by CO2 inhalation or cervical dislocation and blood harvested by cardiac puncture. Immediately tissues were either fixed or flash frozen for hematoxylin and eosin (H&E) and RNA.RNA-seq and data analysis

[0365] Total RNA was extracted with Invitrogen™ PureLink™ RNA Mini Kit. Extracted RNA was quantified at OD260 nm with a NanoDrop® ND- 1000 spectrophotometer (Nanodrop Technology) and quality of the RNA was assessed with the RNA 6000 LabChip kit using a Bioanalyzer 2100 (Agilent Technologies, Inc.). Poly-A RNA isolation and Library Preparation was done using NEBNext® Poly(A) mRNA Magnetic Isolation Module and NEBNext® Ultra™ II RNA Library Prep Kit for Illumina® as per manufacturer’s instruction. Sequencing was performed with Illumina, HiSeq 4000 SR75 for Pair-End, 150-cycle. The reads were aligned to the mouse genome (mm8) and human (hg38) using TopHat (version 2.0.9) (Trapnell, C., Pachter, L. & Salzberg, S. L. Bioinformatics 25, 1105-1111, 2009) with the default options. After library size normalization using DESeq (Anders, S. & Huber, W. Genome Biol 11, R106, 2010), expression was quantified and expressed in reads / kilobase of transcript per millionmapped reads (RPKM) using cufflink (version 2.1.1) (Trapnell, C. et al. Nat Biotechnol 28, 511-515, 2010). Differential expression analysis was performed using the DESeq package with an FDR cutoff of 0.1.EXAMPLE 1 — Suppression of Senescence- Associated Secretory Phenotype (SASP) activity and Partial Reprogramming

[0366] Cellular senescence plays a major role during physiological aging and HGPS by both cell-intrinsic and extrinsic programs mediated by SASP (Coppe, J.-P., Desprez, P - Y., Krtolica, A. & Campisi, J. Annual Review of Pathology: Mechanisms of Disease 5, 99-118, 2010; Kuilman, T. & Peeper, D. S. Nat Rev Cancer 9, 81-94, 2009; Di Mitri, D. et al. Nature 515, 134-137, 2014; Eggert, T. et al. Cancer Cell 30, 533-547, 2016). While senescent cells are thought to be harmful to the organism, they also have beneficial roles in various physiological processes such as wound healing and blockage of fibrosis. For example, continuous or acute elimination of pl6hlghsenescent cells disrupts blood-tissue barriers with subsequent liver and perivascular tissue fibrosis and health deterioration (Grosse, L. et al. Cell Metab 32, 87-99 e86, 2020). Furthermore, since general tissue and organ cell composition in an aged organism is dominated by a large pool of senescent cells, depletion of a high number of them might not always be the preferable strategy to prevent further health deterioration. In fact, recent advances have shown a critical role of senescence cells during normal physiology and targeting senescence cells for clearance has shown harmful consequences (Baker, D. J. et al. Nature 479, 232-236 (2011); Reyes, N. S. et al. Science 378, 192-201 (2022)). Therefore, compositions and methods targeting appropriate cell types and / or appropriate cell states, e.g., senescent, aged, somatic, and / or stem cells are needed to target senescent cells in a manner most beneficial to organismal longevity.

[0367] To target senescent cells, we pursued partial reprogramming mediated rejuvenation, the transcription factors Oct4, Sox2 and Klf4 (OSK) or Oct4 and Sox2 (OS) were used. The transcription factors were delivered using an adenovirus-associated virus (AAV) vector containing a recombinant AAV genome carrying the genes encoding OSK or OS under the control of a mouse Cdkn2a or human elongation factor-la (EFla) promoter within AAV2 inverted terminal repeats (FIGs. 1 A, 5, 6, and 7). Because EFla sustains stable constitutive gene expression for long periods of time (Gopalkrishnan, R. et al. Nucleic Acids Res Cell 27, 4775-4782, 1999), it was used as a control. Notably,Cdkn2a is an established marker of senescence. Further, CDKN2A is expressed in various tissues in a premature aging mouse model that has a point mutation in the Lmna gene (LAKI) and manifests symptoms reminiscent of accelerated aging seen in Hutchinson- Gilford Progeria Syndrome (HGPS) patients (FIG. 3C of PCT / US2023 / 075374) (See, e.g., Krishnamurthy, J. et al. J Clin Invest 114, 1299-1307, 2004; He, S. & Sharpless, N. E. Cell 169, 1000-1011, 2017; Muss, H. B. et al. Transl Cancer Res 9, 5732-5742, 2020). According to a published single cell transcriptome atlas in humans (Tabula Sapiens), higher CDKN2A expression is found in older individuals and the high CDKN2A expressing cells are mostly immune system related cells (FIG. 2A of PCT / US2023 / 075374). The senescent cell specific induction of target genes transduced via AAV particles harboring the respective transgenes under the control of a CDKN2A promoter was confirmed in in vitro cellular systems (FIG. 2C of PCT / US2023 / 075374).EXAMPLE 2 — Effect of Senescent Cell Specific Interventions on Organismal Lifespan

[0368] To test whether targeted expression of OCT4 and SOX2 (OS) alone in senescent cells could improve age-related phenotypes and extend organismal lifespan, the premature aging LAKI- / - mouse model was used (FIG. 1 A). LAKI- / - is a mouse model characterized by premature aging due to a point mutation in the Lmna gene, mirroring the accelerated aging observed in Hutchinson-Gilford Progeria Syndrome (HGPS) patients. In this example, a single dose of AAV-DJ carrying either EF-la-OS, or mCdkn2a-OS was administered to 8-week-old LAKI- / - mice (n=15 mice per construct) and assessed their health and lifespan. Results are shown at FIG. IB. The mice that received m- Cdkn2a-OS exhibited a comparable improvement in health and lifespan to those treated with m-Cdkn2a-OSK and better than the EFla-OS treated mice.

[0369] The plasmid map for the m-CDKN2a-OS is illustrated at FIG. 5. A promoter region derived from the mouse CDKN2a gene (SEQ ID NO: 2) is operably linked to a nucleic acid encoding human OCT4 (SEQ ID NO: 3) and human SOX2 (SEQ ID NO: 4) separated by a P2A cleavable linker.

[0370] The plasmid map for the m-ElFa-OS is illustrated at FIG. 6. A ElFa promoter is a composite promoter comprising a CMV enhancer (SEQ ID NO: 39), a core promoter derived from eukaryotic translation elongation factor la (SEQ ID NO: 40), and an intron sequence (SEQ ID NO: 41). The ElFa promoter is operably linked to a nucleic acidencoding human OCT4 (SEQ ID NO: 3) and human SOX2 (SEQ ID NO: 4) separated by a P2A cleavable linker.

[0371] Also described is a h-CDKN2a-OS construct, the plasmid map for which is illustrated at FIG. 7. A promoter region derived from the human CDKN2a gene (SEQ ID NO: 1) is operably linked to a nucleic acid encoding human OCT4 (SEQ ID NO: 3) and human SOX2 (SEQ ID NO: 4) separated by a P2A cleavable linker.EXAMPLE 3 — Analysis of RNA-sequencing Data

[0372] IMR90 cell culture were cultured, expanded for various time periods to represent different stages of replicative senescence, and cryopreserved for subsequent experimentation. After all cell stages were prepared, they were thawed simultaneously. Two days post-thaw, the cells were split into 6-well plates at a density of 50-60%. The following day, each well containing cells from various stages was infected with AAV. Medium was refreshed every other day, and on day 12 post-AAV treatment, cells were harvested for RNA isolation and sequencing. The final time points corresponded to day 20, 50, 85, and 125 of IMR90 cell culture, counted from the initiation of expansion. RNAseq data was generated for: (a) expression levels of human CDKN2A, POUF51, SOX2, and KLF4 genes by normalized tag count (TPM) (results shown at FIG. 2); (b) Based on RNAseq data expression of cell cycle-related genes (results shown at FIGs. 3 A- 3E) by row normalized heat map; and (c) expression of inflammation-related genes (results shown at FIGs. 4A-4F) by row normalized heat map. Results are shown at FIGs. 2, 3A-3E, and 4A-4F.

[0373] FIG. 2 demonstrates the induction of genes controlled by the CDKN2A promoter during replicative senescence, alongside the transgenes Oct4, Sox2, and another pluripotent driver gene, Klf4, under these conditions.

[0374] FIGs. 3 A-3E illustrate the expression levels of various cell-cycle-associated genes after 20, 50, 85, and 125 days of expansion (and in each case, 12 days post-AAV treatment). Read from Day 20 to Day 125 cell-cycle-associated gene expression changed where more genes had higher expression at Day 20 and Day 50 and lower expression at Day 85 and Day 125. The cell cycle is a critical feature of youthful cells, gradually diminishing as they age, except in cases where they become tumorigenic. For senescent cells, permanent cell cycle arrest serves as a vital characteristic and a safety mechanism to prevent oncogenic transformation. Genes associated with the cell cycle regulation arefundamental drivers across various cell types. Alterations in these genes in aged, nondividing primary cells raise concerns about potential tumorigenicity. However, in our experiment, we observed no changes in the expression of cell cycle-related genes following 12 days post-expression of CDKN2A-0S / -0SK via AAV in primary IMR90 cells at various stages of replicative senescence.

[0375] FIGs. 4A-4F illustrate the expression levels of various inflammation-associated genes after 20, 50, 85, and 125 days of expansion (and in each case, 12 days post-AAV treatment). Read from Day 20 to Day 125 inflammation-associated gene expression changed where more genes had lower expression at Day 20 and Day 50 and higher expression at Day 85 and Day 125. Cellular senescence serves as a critical tumorsuppressive mechanism and plays a pivotal role in the biological process of aging. Alongside the characteristic permanent growth arrest exhibited by senescent cells, prolonged DNA damage signaling can trigger the expression and secretion of numerous cytokines, chemokines, growth factors, and proteases. This collective secretion, termed the senescence-associated secretory phenotype (SASP), exerts detrimental effects on the surrounding tissue microenvironment. Importantly, SASP can impair the functional competence of stem cells, thereby compromising their ability to facilitate tissue renewal. These signatures of SASP constitute an inflammatory component within the organism, contributing significantly to the progression of aging and age-associated pathologies. While not exhaustive, the majority of the indicated genes represent inflammatory cytokines pivotal in driving pathology in senescent cells. As illustrated in FIGs. 4A-4F, we observed a gradual increase in the expression of inflammation-associated genes during replicative senescence in primary IMR90 cells under control conditions. Following the expression of CDKN2A-OS / -OSK via AAV in IMR90 cells at various stages of replicative senescence, we noted a significant reduction in the expression of a major fraction of these genes, particularly within the senescent cell population, by the 12th day post-expression.EXAMPLE 4 — Effect of Senescent Cell Specific Interventions on Dermal Thickness and Hair RegrowthTissue sectioning method to retain in vivo structure

[0376] While there is some evidence that human skin histology shows certain structural changes with aging, such as thinning of the epidermis and dermis, there has been no agreement in mice.

[0377] This may be due to the fact that mouse skin is highly elastic and therefore loses much of its in vivo structure at the time of harvest, making meaningful comparisons difficult. To minimize the effects of artifacts associated with tissue collection, a splint was attached to the skin prior to tissue collection.

[0378] A transparent plastic plate was shaped into a hollowed-out rectangle, which was attached to the skin using glue. Tissues were harvested along with the splints and fixed using formalin or Bouin solution in accordance with the usual methods. By proceeding with tissue processing with the splint attached until just before paraffin embedding, it was possible to obtain tissue sections that accurately maintained the in vivo morphology.Dermal thickness of mice of different ages

[0379] Skin was harvested from the backs of mice of different ages (4 months (n=3), 14 months (n=4), and 24 months (n=5) C57BL / 6J (Jax 000664) mice) using the splinting method, processed, and stained with H&E staining. Histological images were obtained with a slide scanner (Zeiss Axioscan 7) (FIGs. 8A-8C).

[0380] Each section was divided into 1-mm wide portions, and the average dermal thickness was calculated for each portion. The median value of the portions was taken as the dermal thickness of that section. Dermal thickness was measured on at least 10 tissue sections for each mouse (FIGs. 9A-9B).Analyses of AAVDJ-CDKN2A-OS virus on dermal thickness

[0381] To see the effect of pl6-OS expression on dermal thickness of aged mice, 1011GC / 20pl AAVDJ- CDKN2A-OS and AAVDJ- CDKN2A-GFP virus were intradermally injected to abdominal skin of 24-month-old C57BL / 6J male mice (10 mm caudal to the xiphoid process), respectively. After 1 month, the skin was harvested using a splint with the injected site as the mid-point, processed, and analyzed for the dermal thickness as described above (FIGs. 9A-9B). With aging, the dermal thickness decreased. The 24 month old mice had significantly decreased dermal thickness compared to the 14 month and 4 month old mice.Analyses of AAVDJ- CDKN2A-OS virus on hair regrowth after hair depilation

[0382] It is known that anagen entry after hair removal was delayed in aged mice in comparison with young mice (Keyes, BE. et al. Proc Natl Acad Sci 17, E4950-9, 2013).To see the effect of CDKN2A-0S expression on hair regrowth after hair depilation in aged mice, 1011GC / 20pl AAVDJ- CDKN2A-OS and AAVDJ- CDKN2A-GFP virus were intradermally injected to abdominal skin of 24-month-old C57BL / 6J female mice (10 mm caudal to the xiphoid process), respectively. Twenty-eight days later, regional hair was removed using hair removal wax tape (Hair remover wax, Sally Hansen). Hair regrowth was observed for another 8 days or period. The results are shown at FIGs. 10A- 10C. Prior injection of AAVDJ- CDKN2AOS enhances hair regrowth after hair depilation in aged mice abdominal skin (FIG. 10C).

[0383] In 2 skin phenotypes known to change with age: dermal thickness and hair regrowth after depilation, intradermal injection of AAVDJ- CDKN2A-OS virus brought rejuvenation phenotypes in comparison with AAVDJ- CDKN2A-GFP controls. Rejuvenation effect of AAVDJ- CDKN2A-OS virus was indicated (FIGs. 11 A-l IB).

[0384] Altogether, the results of the above Examples indicated activation of repair and rejuvenation pathways in CDKN2A expressing cells following cellular partial reprogramming. The results described herein indicate that partial cellular reprogramming of senescent cells can have a broad organismal rejuvenation effect without the risks of tumor induction or organ failure due to loss of cell number and identity and augment dermal thickness and hair regrowth.

[0385] The sequences described herein are shown in Table 3.Table 3

[0386] It is to be appreciated that the Detailed Description section, and not the Summary and Abstract sections, is intended to be used to interpret the claims. The Summary and Abstract sections may set forth one or more but not all exemplary embodiments of the present invention as contemplated by the inventor(s), and thus, are not intended to limit the present invention and the appended claims in any way.

[0387] The present invention has been described above with the aid of functional building blocks illustrating the implementation of specified functions and relationships thereof. The boundaries of these functional building blocks have been arbitrarily defined herein for the convenience of the description. Alternate boundaries can be defined so long as the specified functions and relationships thereof are appropriately performed.

[0388] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and / or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.

[0389] The breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. Database entries and electronic publications disclosed in the present disclosure are incorporated by reference in their entireties. The version of the database entry or electronic publication incorporated by reference in the present application is the most recent version of the database entry or electronic publication that was publicly available at the time the present application was filed.

Claims

WHAT IS CLAIMED IS:

1. A polynucleotide comprising a kozak sequence and at least one CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein, wherein the polynucleotide does not comprise a polynucleotide encoding a KLF4 protein or a MYC protein.

2. The polynucleotide of claim 1, wherein the CDKN2A promoter is a human or murine CDKN2A promoter.

3. The polynucleotide of claim 1 or 2, wherein the human CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

4. The polynucleotide of claim 1 or 2, wherein the murine CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

5. A polynucleotide comprising at least one Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein.

6. The polynucleotide of claim 5, wherein the Efl a promoter is operably linked to a nucleic acid sequence encoding an Oct4 protein and a Sox2 protein.

7. The polynucleotide of claim 5 or 6, wherein the Efl a promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 40.

8. The polynucleotide of any one of claims 5-7, wherein the polynucleotide further comprises a CMV enhancer.

9. The polynucleotide of claim 8, wherein the CMV enhancer has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39.

10. The polynucleotide of any one of claims 5-9, wherein the polynucleotide further comprises an Efl a intron A.

11. The polynucleotide of claim 10, wherein the Efl a intron A has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41.

12. The polynucleotide of any one of claims 1-11, wherein the nucleic acid sequence encoding Oct4 comprises SEQ ID NO: 3 and the nucleic acid sequence encoding Sox2 comprises SEQ ID NO: 4.

13. The polynucleotide of any one of claims 1-12, further comprising at least one Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) sequence and at least one polyadenylation signal sequence.

14. The polynucleotide of claim 13, wherein the at least one polyadenylation signal sequence is an SV40 polyadenylation signal sequence, a human growth hormone polyadenylation signal sequence, or a bovine growth hormone polyadenylation signal sequence.

15. The polynucleotide of any one of claims 1-14, wherein the polynucleotide further comprises at least one internal ribosome entry site (IRES).

16. The polynucleotide of any one of claims 1-15, wherein the polynucleotide further comprises at least one cleavage site.

17. The polynucleotide of claim 16, wherein the at least one cleavage site is a self-processing cleavage site or a furin cleavage site.

18. The polynucleotide of claim 18 or 19, wherein the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.

19. The polynucleotide of claim 17, wherein the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO: 6.

20. The polynucleotide of any one of claims 1-19, wherein the polynucleotide further comprises a second promoter.

21. The polynucleotide of claim 20, wherein the second promoter is a CDKN2A promoter.

22. The polynucleotide of claim 20 or 21, wherein the first and the second promoter initiate transcription in the same direction.

23. The polynucleotide of claim 20 or 21, wherein the first and the second promoter initiate transcription in different directions.

24. The polynucleotide of any one of claims 1-4 and 12-23, wherein the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

25. The polynucleotide of claim 24, wherein the polynucleotide further comprises a WPRE sequence.

26. The polynucleotide of claims 24 or 25, wherein the polynucleotide further comprises a polyadenylation signal sequence.

27. The polynucleotide of any one of claims 24-26, wherein the cleavage site is a P2A, E2A, F2A, or T2A peptide.

28. The polynucleotide of claim 27, wherein the cleavage site is a P2A peptide.

29. The polynucleotide of claim 27 or 28, wherein the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polynucleotide signal sequence.

30. The polynucleotide of claim 29, wherein the polynucleotide comprises a CDKN2A promoter, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleicacid sequence encoding a Sox2 protein, a WPRE sequence, and a polynucleotide signal sequence in the 5' to 3' orientation.

31. The polynucleotide of any one of claims 5-23, wherein the polynucleotide comprises an Efl a promoter, a nucleic acid sequence encoding an Oct4 protein, a cleavage site, and a nucleic acid sequence encoding a Sox2 protein.

32. The polynucleotide of claim 31, wherein the polynucleotide further comprises a WPRE sequence.

33. The polynucleotide of claims 31 or 32, wherein the polynucleotide further comprises a polyadenylation signal sequence.

34. The polynucleotide of any one of claims 31-33, wherein the cleavage site is a P2A, E2A, F2A, or T2A peptide.

35. The polynucleotide of claim 34, wherein the cleavage site is a P2A peptide.

36. The polynucleotide of any one of claims 31-35, wherein the polynucleotide further comprises a CMV enhancer.

37. The polynucleotide of any one of claims 31-36, wherein the polynucleotide further comprises an Efl a intron A.

38. The polynucleotide of claim 37, wherein the polynucleotide comprises an CMV enhancer, Efl a promoter, Efl a intron A, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polyadenylation signal sequence.

39. The polynucleotide of claim 37 or 38, wherein the polynucleotide comprises an CMV enhancer, Efl a promoter, Efl a intron A, a nucleic acid sequence encoding an Oct4 protein, a P2A peptide, a nucleic acid sequence encoding a Sox2 protein, a WPRE sequence, and a polyadenylation signal sequence in the 5' to 3' orientation.

40. The polynucleotide of any one of claims 1-39, wherein the polynucleotide further comprises a reporter gene.

41. A vector comprising the polynucleotide of any one of claims 1-40.

42. The vector of claim 41, wherein the vector is a viral vector, a non-viral vector, or a polymer.

43. The vector of claim 41, wherein the viral vector is an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

44. The vector of claim 43, wherein the AAV vector is a AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVRH8, AAVrh9, AAV9, AAVrhlO, AAV10, AAVRH10, AAV11, AAV12, or AAV-DJ vector.

45. The vector of claim 43 or 44, wherein the AAV vector is an AAV-DJ vector.

46. The vector of claim 42, wherein the non-viral vector is a plasmid.

47. The vector of claim 42, wherein the polymer is a cationic polymer comprising a polyethyleneimine (PEI) backbone linked to a lipid or a polyethylene glycol (PEG).

48. A cell comprising the polynucleotide of any one of claims 1-40 or the vector of any one of claims 41-47.

49. The cell of claim 48, wherein the cell is a bacterial cell, an insect cell, or an animal cell.

50. The cell of claim 49, wherein the animal cell is a mammalian cell.

51. A composition comprising the polynucleotide of any one of claims 1-40, or the vector of claims 41-47, and a carrier.

52. A recombinant adeno-associated vector (rAAV) virus comprising the polynucleotide of any one of claims 1-40 and an AAV capsid protein.

53. The rAAV of claim 52, comprising an AAV-DJ capsid.

54. A pharmaceutical composition comprising the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, or the rAAV of claim 52 or 53, and a pharmaceutically acceptable carrier.

55. A kit comprising the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, or the rAAV of claim 52 or 53.

56. A method for making a rAAV comprising:(i) providing a cell with (a) adeno-associated virus (AAV) rep genes, (b) AAV cap genes, (c) the nucleic acid comprising the polynucleotide of any one of claims 1-40 or the vector of any one of claims 41-47, and (d) at least one AAV serotype 2 inverted terminal repeat,(ii) providing helper functions for generating a productive AAV infection;(iii) allowing assembly of the AAV; and(iv) collecting the rAAV.

57. The method of claim 56, wherein the AAV rep genes and AAV cap genes are provided by a plasmid.

58. The method of claim 56, wherein the AAV rep genes and AAV cap genes are provided by an adenovirus vector.

59. The method of claim 56, wherein the AAV rep genes and AAV cap genes are stably integrated into the genome of the cell.

60. The method of any one of claims 56-59, wherein the helper functions are provided by a plasmid.

61. The method of any one of claims 56-59, wherein the helper functions are provided by an adenovirus vector.

62. A rAAV produced by the method of any one of claims 56-61.

63. A rAAV comprising a polynucleotide comprising:(a) a 5' inverted terminal repeat;(b) a Kozak sequence;(c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein; and(d) a 3' inverted terminal repeat; wherein the polynucleotide comprises a cleavage site between the nucleic acid encoding the Oct4 protein and the nucleic acid sequence encoding the Sox2 protein.

64. The rAAV of claim 63, wherein the cleavage site is a self-processing cleavage site or a furin cleavage site.

65. The rAAV of claim 64, wherein the self-processing cleavage site is a P2A, E2A, F2A, or T2A peptide.

66. The rAAV of claim 64, wherein the furin cleavage site comprises the consensus sequence RXK(R)R of SEQ ID NO: 6.

67. The rAAV of any one of claims 63-66, wherein the CDKN2A promoter is a human or murine CDKN2A promoter.

68. The rAAV of claim 67, wherein the human CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

69. The rAAV of claim 67, wherein the murine CDKN2A promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

70. The rAAV of any one of claims 63-69, wherein the polynucleotide further comprises a WPRE sequence.

71. The rAAV of any one of claims 63-70, wherein the polynucleotide further comprises a polyadenylation signal sequence.

72. The rAAV of claim 71, wherein the polynucleotide comprises(a) a 5' inverted terminal repeat;(b) a Kozak sequence;(c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein;(d) a WPRE sequence;(e) a polyadenylation signal sequence; and(f) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding the Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide.

73. The rAAV of claim 71 or 72, wherein the polynucleotide comprises(a) a 5' inverted terminal repeat;(b) a Kozak sequence;(c) a CDKN2A promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein;(d) a WPRE sequence;(e) a polyadenylation signal sequence; and(f) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding the Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide; and wherein the polynucleotide comprises (a)-(f) in the 5' to 3' orientation.

74. A rAAV comprising a polynucleotide comprising:(a) a 5' inverted terminal repeat;(b) a CMV enhancer;(c) an Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein;(d) an Efl a intron A; and(e) a 3' inverted terminal repeat wherein the polynucleotide comprises a cleavage site between the nucleic acid encoding the Oct4 protein and the nucleic acid sequence encoding the Sox2 protein.

75. The rAAV of claim 74, wherein the Efl a promoter has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 40.

76. The rAAV of any one of claims 74-75, wherein the CMV enhancer has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 39.

77. The rAAV of any one of claims 74-76, wherein the Efl a intron A has a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 41.

78. The rAAV of any one of claims 74-77, wherein the polynucleotide further comprises a WPRE sequence.

79. The rAAV of any one of claims 74-78, wherein the polynucleotide further comprises a polyadenylation signal sequence.

80. The rAAV of claim 79, wherein the polynucleotide comprises:(a) a 5' inverted terminal repeat;(b) a CMV enhancer;(c) an Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein;(d) an Efl a intron A;(e) a WPRE sequence;(f) a polyadenylation signal sequence; and(g) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding the Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide.

81. The rAAV of claim 79 or 80, wherein the polynucleotide comprises:(a) a 5' inverted terminal repeat;(b) a CMV enhancer;(c) an Efl a promoter operably linked to a nucleic acid sequence encoding an Oct4 protein and a nucleic acid sequence encoding a Sox2 protein;(d) an Efl a intron A;(e) a WPRE sequence;(f) a polyadenylation signal sequence; and(g) a 3' inverted terminal repeat; wherein the cleavage site between the nucleic acid encoding the Oct4 protein and the nucleic acid sequence encoding the Sox2 protein is a P2A peptide and wherein the polynucleotide comprises (a)-(g) in the 5' to 3' orientation.

82. The rAAV of any one of claims 63-81, wherein the 5' and 3' inverted terminal repeats are AAV serotype 2 inverted terminal repeats.

83. The rAAV of any one of claims 63-82, wherein the rAAV comprises an AAV-DJ capsid.

84. A method of reprogramming a senescent cell to a non-senescent stage phenotype, the method comprising contacting a senescent cell with the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, or the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54 in an amount effective to partially reprogram the senescent cell to a non-senescent stage phenotype.

85. A method for reprogramming senescent cells in a subject to a non-senescent stage phenotype, the method comprising:(i) administering to the subject in need thereof a therapeutically effective amount of the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54, and(ii) partially reprogramming senescent cells of the subject to a non-senescent stage phenotype.

86. The method of claim 85, wherein the administering is by systemic administration.

87. A method for partially or fully reverting immune senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54 in an amount effective to partially or fully revert immune senescence in the subject.

88. The method of claim 87, wherein the immune senescence is characterized by a decrease in a homing ability of a hematopoietic stem cell (HSC) and the amount effective to partially or fully revert immune senescence in the subject is an amount that is effective to increase the homing ability of the HSC to a level of HSC homing ability found in a HSC of a non-senescent subject.

89. The method of claim 87, wherein the immune senescence is characterized by a decrease in per-cell repopulating self-renewal activity of a HSC and the amount effective to partially or fully revert immune senescence in the subject is an amount effective to increase the per-cell repopulating self-renewal activity of the HSC to a level of HSC per- cell repopulating self-renewal activity found in a HSC of a non-senescent subject.

90. The method of claim 87, wherein the immune senescence is characterized by a bias towards myeloid differentiation of a HSC and the amount effective to partially or fully revert immune senescence in the subject is an amount effective to reduce the bias towards myeloid differentiation of the HSC to a level of bias towards myeloid differentiation found in a HSC of a non-senescent subject.

91. The method of claim 87, wherein the immune senescence is characterized by an increase in apoptosis of a HSC upon stress stimuli and the amount effective to partially or fully revert immune senescence in the subject is an amount effective to reduce apoptosis of the HSC upon stress stimuli to a level of apoptosis upon stress stimuli found in a HSC of a non-senescent subject.

92. The method of claim 87, wherein the administering is by systemic administration.

93. A method for reducing the number of senescent cells in a subject, the method comprising: administering to the subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54 in an amount effective to reduce the number of senescent cells in the subject.

94. The method of claim 93, wherein the administering is by systemic administration.

95. A method for extending organismal lifespan of a subject, the method comprising: administering to the subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54 in an amount effective to extend organismal lifespan of the subject.

96. The method of claim 95, wherein the administering is by systemic administration.

97. A method for reducing progressive body weight loss in a senescent subject, the method comprising: administering to the senescent subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62- 83, or the pharmaceutical composition of claim 54 in an amount effective to reduce progressive body weight loss in the senescent subject.

98. The method of claim 97, wherein the administering is by systemic administration.

99. A method for increasing physical fitness in a senescent subject, the method comprising: administering to the senescent subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or thepharmaceutical composition of claim 54 in an amount effective to increase physical fitness in the senescent subject.

100. The method of claim 99, wherein the administering is by systemic administration.

101. A method for reducing an inflammatory response in a subject, the method comprising: administering to the subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54, in an amount effective to reduce an inflammatory response in the subject.

102. The method of claim 101, wherein the administering is by systemic administration.

103. A method for reducing replicative senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54 in an amount effective to reduce replicative senescence in the subject.

104. The method of claim 103, wherein the administering is by systemic administration.

105. A method for reducing DNA damage induced senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54 in an amount effective to reduce DNA damage induced senescence in the subject.

106. The method of claim 105, wherein the administering is by systemic administration.

107. A method of reducing oncogene induced senescence in a subject, the method comprising: administering to the subject in need thereof the polynucleotide of any one of claims 1-40,the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54, in an amount effective to reduce oncogene induced senescence in the subject.

108. The method of claim 107, wherein the administering is by systemic administration.

109. A method for inhibiting Senescence- Associated Secretory Phenotype (SASP) activity in a cell, comprising contacting the cell with the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54, in an amount effective to inhibit SASP activity in the cell.

110. A method for increasing age-related survival of a subject, the method comprising:(i) administering to a subject in need thereof a therapeutically effective amount of the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 63-83, or the pharmaceutical composition of claim 54, and(ii) reprogramming senescent cells in the subject, whereby the age-related survival of the subject is increased.

111. The method of claim 110, wherein the administering is by systemic administration.

112. A method for treating cellular senescence-related aging in a subject in need thereof, comprising administering to subject a therapeutically effective amount of the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54.

113. The method of claim 112, wherein the administering is by systemic administration.

114. A method of treating Hutchinson-Gilford Progeria Syndrome in a subject in need thereof comprising administering to subject a therapeutically effective amount of the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cellof any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54.

115. The method of claim 114, wherein the administering is by systemic administration.

116. The method of claim 114 or 115, wherein the subject is a human.

117. A method of increasing dermal thickness in a subject in need thereof comprising administering to subject a therapeutically effective amount of the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54.

118. The method of claim 117, wherein the administering is by intradermal injection.

119. A method of inducing hair growth in a subject in need thereof comprising administering to subject a therapeutically effective amount of the polynucleotide of any one of claims 1- 40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54.

120. The method of claim 119, wherein the administering is by intradermal injection.

121. The method of any one of claims 114-116, wherein the administration induces reduced mesangial area in the kidney, increased structural arrangement of hepatocytes in the liver, rescued lymphoid depletion in germinal centers of the spleen, reduced level of inflammatory markers, increased number of hematopoietic stem cells, restoration of bone marrow tissue and / or an increased activation of DNA repair pathways in the subject.

122. The method of claim 121, wherein the reduced level of inflammatory markers comprises reduced neutrophil invasion in the liver and a reduced inflammatory signature in the spleen.

123. Use of the polynucleotide of any one of claims 1-40, the vector of any one of claims 41- 47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54, for treating cellular senescence-related aging.

124. Use of the polynucleotide of any one of claims 1-40, the vector of any one of claims 41- 47, the cell of any one of claims 48-50, the composition of claim 51, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54 in the manufacture of a medicament for treating cellular senescence-related aging.

125. An article of manufacture comprising the polynucleotide of any one of claims 1-40, the vector of any one of claims 41-47, the cell of any one of claims 48-50, the composition of claim 41, the rAAV of any one of claims 52-53 or 62-83, or the pharmaceutical composition of claim 54.

Images