Lipid nanoparticles comprising ginsenoside or derivative thereof, and use thereof

Abstract

The present invention relates to lipid nanoparticles comprising ginsenoside or a derivative thereof, and use thereof, and, specifically, to: lipid nanoparticles containing vegetable ginsenoside or a derivative thereof included in ginseng or red ginseng, instead of animal cholesterol for the delivery of therapeutic or vaccine nucleic acids; gene-inorganic nanoparticles in which the corresponding lipid nanoparticles are encapsulated, and a preparation method therefor; and a nucleic acid delivery composition comprising same.

Description

Lipid nanoparticles containing ginsenoside or derivatives thereof and uses thereof

[0001] The present invention relates to lipid nanoparticles containing ginsenoside or a derivative thereof and their uses, and more particularly, to lipid nanoparticles containing plant ginsenoside or a derivative thereof contained in ginseng or red ginseng in place of animal cholesterol for delivery of nucleic acid (mRNA, DNA, small RNA, etc.) for therapeutic or vaccine purposes, and to nucleic acid-inorganic nanoparticles encapsulating the lipid nanoparticles and a method for producing the same, and a nucleic acid delivery composition comprising the same.

[0002]

[0003] Gene therapy has been developed as a treatment to treat or prevent diseases by adding, modifying, or deleting new information to existing genes and delivering the genes to the patient's cells in the form of plasmid DNA (pDNA) or messenger RNA (mRNA) (Dunbar, C. E et al., Science 2018 1:12).

[0004] The goal of gene therapy is to correct genetic defects in people with inherited or rare diseases and cure them completely. Recent technological innovations and R&D investments have led to a global gene therapy market growing at an average annual rate of 10%. Gene therapy is emerging as a blue chip in the new pharmaceutical market, and among them, mRNA is emerging as a promising therapeutic tool in vaccine development and protein replacement therapy. The principle of gene therapy is to introduce genes into cells in pDNA or mRNA form using viruses, liposomes, or antisense technology, thereby enabling them to function as therapeutic agents (Dunbar, C. E et al., Science 2018 1:12).

[0005] Gene therapy, while relatively new compared to other therapeutics, offers the advantage of being easily developed for diseases caused by specific genes, leading to rapid expansion of research results and new drug approvals. Furthermore, mRNA therapeutics, for example, can undergo various modifications within the cytoplasm, allowing for control of half-life or increasing or decreasing the amount of translated protein, potentially expanding the therapeutic target range. However, to ensure that these therapeutics are not destroyed by enzymes like RNase and reach target cells to produce the desired protein, it is crucial to develop gene delivery vehicles with high encapsulation rates, stability, and biocompatibility.

[0006] Over the past decade, messenger RNA (mRNA) therapeutics have emerged as a promising strategy for a variety of applications, from protein replacement therapy to vaccination.

[0007] mRNA therapeutics offer advantages over DNA or viral therapeutics in terms of safety, efficacy, and productivity. First, because mRNA is produced in the cytoplasm, the risk of mutations resulting from infection or genomic DNA insertion is reduced. Second, because mRNA undergoes various modifications within the cytoplasm, its half-life can be adjusted or the amount of translated protein can be increased, thereby enhancing intracellular stability. Third, mRNA is readily adaptable to in vitro experiments, allowing for rapid development and GMP production, and facilitates mass production (Wang, Y., Su et al. Molecular Therapy 2013 358-367).

[0008] mRNA is RNA that transfers genetic information from DNA to ribosomes, leading to protein expression through mRNA translation. Recombinant mRNA, used for the development of therapeutics or vaccines, is produced from linear DNA using promoters (including but not limited to T7 and SP6) and RNA polymerase. This is followed by in vitro transcription, where 5' capping and poly A adenylation occur. This mRNA, similar to mature mRNA in the cytoplasm, consists of a 5' capping, 5' untranslated region (UTR), 3' UTR, poly A, and the target gene to be expressed. The untranslated region (5' or 3' untranslated region) influences mRNA stability and translational activation, increasing half-life and expression levels, depending on its sequence. Poly A also prevents mRNA degradation in the cytoplasm, thereby increasing stability and expression levels. Therefore, in order for mRNA therapeutics to efficiently and stably express proteins in the body, it is important to find the optimal non-translated region sequence and poly A length (Pardi, N et al., Nature reviews 2018 261-279).

[0009] While mRNA is used as a versatile clinical intervention, a delivery platform is required to reach the cytoplasm of target cells and achieve the functional outcomes necessary for clinical efficacy. LNP-based mRNA therapies for gene insertion / replacement, gene expression control, and gene editing applications are being studied for a variety of diseases, including congenital diseases. Research is underway to address a variety of conditions, including congenital diseases, cancer immunotherapy, and corneal diseases.

[0010] In many of these applications, intravenous (IV) or intraperitoneal (IP) injections are preferred to achieve systemic therapeutic effects or organ-specific delivery. However, there are drug delivery barriers encountered when attempting to deliver mRNA-containing LNPs (mRNA-LNPs) via IV or IP administration. In particular, mRNA-LNPs administered intravenously exhibit significant accumulation and delivery of mRNA to the liver.

[0011] Although liver delivery and expression of therapeutic mRNA is desirable for certain applications (e.g., expression of replacement plasma proteins, gene editing for liver disease, etc.), sufficient delivery to other organs (e.g., spleen, lungs, gastrointestinal tract, uterus, etc.) is required for the treatment of many diseases.

[0012] Currently, the most widely used nucleic acid delivery vehicle is lipid nanoparticle, which is composed of ionic lipids, phospholipids, cholesterol, and polyethylene glycol (PEG) lipids. In particular, cholesterol plays a role in maintaining the lipid bilayer structure, thereby enhancing the stability of the lipid nanoparticle structure. Although cholesterol plays this important role, it has some challenges to overcome as a delivery vehicle component. First, cholesterol is easily oxidized, which can pose a safety issue for lipid-based drugs. For example, cholesterol oxidation byproducts such as 25-hydroxycholesterol, 7-keto-cholesterol, 7α- and 7β-hydroxycholesterol, cholesterin-3β,5α,6β-triol, and 5- and 7-hydroperoxides tend to be toxic to some biological systems. Furthermore, there are reports that 27-hydroxycholesterol, a primary metabolite of cholesterol, functions as an endogenous selective estrogen receptor modulator (SERM) and increases the growth of estrogen receptor (ER)-positive tumors. Furthermore, most commercially available cholesterol is derived from animal sources, such as egg and wool grease, which may be unsuitable for human pharmaceuticals due to potential viral contamination.

[0013] Meanwhile, inorganic nanoparticles, including metal nanoparticles and magnetic nanoparticles, have recently been developed and applied as nucleic acid delivery vehicles. However, these nanoparticles face stability issues and difficulties in cell penetration due to the high negative charge associated with the binding of biomolecules to inorganic nanoparticles. Therefore, the introduction of inclusion bodies capable of mitigating these issues is necessary. Lipid nanoparticles can be used as such inclusion bodies.

[0014] Against this technical background, the inventors of the present application have discovered that although many pharmaceuticals have been developed to date using lipid nanoparticles containing animal cholesterol as nucleic acid carriers for coronavirus vaccines or cancer vaccines, they have identified lipid nanoparticles containing plant-based raw materials in place of animal cholesterol and have completed the present invention through a combination of various carriers.

[0015]

[0016] Summary of the invention

[0017] The purpose of the present invention is to provide lipid nanoparticles containing plant-based raw materials.

[0018] The purpose of the present invention is to provide a composition for nucleic acid delivery comprising the lipid nanoparticles.

[0019] The purpose of the present invention is to provide a method for producing the above lipid nanoparticles.

[0020] The purpose of the present invention is to provide a complex of nucleic acid-inorganic nanoparticle / lipid nanoparticle for improving cell permeability and expression of surface-treated inorganic nanoparticles.

[0021] To achieve the above purpose, the present invention provides a lipid nanoparticle comprising an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

[0022] In addition, the present invention provides a lipid nanoparticle complex in which a nucleic acid-inorganic nanoparticle structure is encapsulated, wherein the lipid nanoparticle is a complex comprising an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

[0023] In addition, the present invention provides a composition for nucleic acid delivery comprising the lipid nanoparticle.

[0024] In addition, the present invention provides a composition for nucleic acid delivery comprising a complex encapsulating lipid nanoparticles containing an ionizable lipid; a phospholipid; a water-soluble polymer; and ginsenoside or a derivative thereof as an active ingredient to increase the cell penetration and expression rate of inorganic nanoparticles to which nucleic acids are bound.

[0025] Furthermore, the present invention provides a method for producing lipid nanoparticles, comprising a step of dissolving ionizable lipids, phospholipids, water-soluble polymers, and ginsenosides or derivatives thereof in a solvent.

[0026]

[0027] FIG. 1 is a diagram showing the physicochemical properties of lipid nanoparticles manufactured according to the present invention, including (A) an electron micrograph of a lipid nanoparticle (Gin_Rg2-LNP) / mRNA complex containing ginsenoside Rg2, (B) an electron micrograph of a lipid nanoparticle (Gin_PPD-LNP) / mRNA complex containing protopanaxadiol, a phytosterol, (C) a change in the size of Gin_Rg2_LNP depending on the presence or absence of mRNA, and (D) a change in the size of Gin_PPD-LNP depending on the presence or absence of mRNA ((a) when there is no mRNA, (b) when there is mRNA).

[0028] FIG. 2 is a diagram showing the results of electrophoresis for confirming the encapsulation rate according to the ratio of lipid nanoparticles (Gin_Rg2-LNP, Gin_PPD-LNP) and mRNA manufactured according to the present invention, (A) the encapsulation rate of Gin_Rg2-LNP according to the mass ratio of LNP and mRNA, (B) the encapsulation rate of Gin_PPD-LNP according to the mass ratio of LNP and mRNA, and (C) the encapsulation rate of Gin_PPD-LNP according to the volume ratio of the solvent composition of LNP and mRNA.

[0029] FIG. 3 is a diagram showing the results of a stability test for RNA degrading enzyme (RNase) in a lipid nanoparticle (A) Gin_Rg2_LNP / mRNA (B) Gin_PPD_LNP / mRNA complex manufactured according to the invention.

[0030] Figure 4 shows the results of cytotoxicity of ginsenoside Rg2, a component of the developed lipid nanoparticle, and protopanaxadiol (PPD), a phytosterol, as shown in (A) the results of a cell counting kit assay (Cell Counting Kit-8, CCK-8), and (B) an optical microscope photograph of cells after treatment.

[0031] Figure 5 shows the results of cytotoxicity of the developed lipid nanoparticles (Gin_Rg2-LNP, Gin_PPD-LNP), including (A) the results of a cell counting kit assay (Cell Counting Kit-8, CCK-8), and (B) an optical microscope photograph of cells after lipid nanoparticle treatment.

[0032] Figure 6 is an optical microscope photograph showing the expression of GFP when 1 μg of GFP mRNA was delivered using Gin_Rg2-LNP and Gin_PPD-LNP in the lung cancer cell line A549.

[0033] Figure 7 is an optical microscope photograph showing the expression of GFP when 1 μg of GFP mRNA was delivered using Gin_Rg2-LNP and Gin_PPD-LNP in HeLa, a cervical cancer cell line.

[0034] Figure 8 is a diagram showing the results of comparing the expression rates according to the mixing ratio of GFPmRNA and Gin_Rg2-LNP in HeLa cells.

[0035] Figure 9 is a diagram showing the results of comparing the expression rates according to the mixing ratio of GFPmRNA and Gin_DDP-LNP in HeLa cells.

[0036] Figure 10 is a diagram showing the results of optical microscopy confirming the optimization of mRNA delivery and expression according to the amount of PEG lipid contained in Gin_Rg2-LNP and Gin_PPD-LNP in HeLa cells.

[0037] Figure 11 is a diagram showing the results of comparing the mRNA expression rates of the lipid nanoparticles of the present invention (Gin_Rg2-LNP, Gin_PPD-LNP) and the commercialized lipid nanoparticle synthesis kit when 1 μg of GFP mRNA was delivered.

[0038] Figure 12 is a diagram showing the results of encapsulating luciferase mRNA in lipid nanoparticles (Gin_Rg2-LNP, Gin_PPD-LNP) of the present invention, delivering them to A549 cells, and confirming the luminescence value according to luciferase expression.

[0039] Figure 13 shows the results of analyzing the change in surface charge of the complex encapsulated with Gin_PPD-LNP after attaching GFPmRNA to the surface of gold nanoparticles (AuNP) and observing it with a transmission electron microscope. (A) Zeta potential change of GFPmRNA-AuNP@Gin_PPD-LNP according to the synthesis stage ((a) AuNP, (b) GFPmRNA-AuNP, (c) GFPmRNA-AuNP@Gin_PPD-LNP) and (B) transmission electron microscope photographs of GFPmRNA-AuNP@Gin_PPD-LNP.

[0040] Figure 14 is an optical microscope photograph showing the results of comparing expression according to the presence or absence of lipid nanoparticle encapsulation in lung cancer cell line A549, observing GFP expressed when (A) GFP mRNA-AuNP was treated and (B) GFPmRNA-AuNP@Gin_PPD-LNP was treated.

[0041] Figure 15 is a drawing of a fluorescence microscope image of GFP and mCherry expressed after encapsulating GFP mRNA and mCherry mRNA into PPD-LNPs alone or simultaneously and then delivering them to HEK293T.

[0042] Figure 16 is a diagram showing the results of analyzing the fluorescence intensity of GFP and mCherry expressed in HEK293T after encapsulating GFP mRNA and mCherry mRNA in PPD-LNPs alone or simultaneously and then delivering them to HEK293T using a flow cytometer.

[0043] Figure 17 is a diagram showing the results of verifying the in vivo mRNA delivery and expression of Gin_Rg2-LNP and Gin_PPD-LNP, in which luciferase mRNA was administered intramuscularly to hairless mice and the expressed luciferase was observed.

[0044] Figure 18 is a graph showing the luminescence efficiency of Luciferase expressed in vivo expressed as total flux.

[0045] Figure 19 is a drawing of a fluorescent microscope image observing GFP expression to verify that Folate-PPD-LNP has targeting properties to the folate receptor in HeLa cells.

[0046] Figure 20 is a photomicrograph showing GFP expression observed to verify the targeting properties of HA-PPD-LNPs to CD44 in A549 cells.

[0047]

[0048] Detailed description and specific implementation examples of the invention

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein is well known and commonly used in the art.

[0050] The inventors of the present application recognized the need for an effective delivery system while studying the functions of cancer cell growth inhibition and apoptosis using tumor suppressor genes, and in particular, because there is uncertainty about toxicity, etc. in the case of animal cholesterol, they judged that it was necessary to overcome this.

[0051] Accordingly, phytosterols, including ginsenosides, which are substitutes for animal cholesterol, and their derivatives, protopanaxadiol (PPD) and protopanaxatriol (PPT), are phytocompounds, which are plant-based raw materials mainly contained in ginseng, etc., and have properties such as high biocompatibility and physiological activity, and are known to exhibit anticancer, anti-inflammatory, and antioxidant properties, and to be effective against diabetes and hypertension.

[0052] In the case of ginsenoside and its derivative, phytosterol, it was confirmed that not only can they play a role in strengthening the structure of lipid nanoparticles, but there is also the possibility that they can have a synergistic effect with therapeutic nucleic acids or vaccine nucleic acids. To date, many pharmaceuticals have been developed using lipid nanoparticles containing animal cholesterol as nucleic acid carriers for coronavirus vaccines or cancer vaccines, but instead of cholesterol, we have developed lipid nanoparticles for nucleic acid delivery using plant-based ginsenoside and its derivatives.

[0053] We synthesized lipid nanoparticles using plant-based raw materials such as ginsenosides or their derivatives, phytosterols, as a substitute for cholesterol, and then loaded them with nucleic acids to confirm their expression in various cells. Lipid nanoparticles containing ginsenosides and their derivatives were non-cytotoxic and showed superior expression rates compared to intracellular genetic transfection reagents such as lipofectamine. Furthermore, when compared to commercially available lipid nanoparticle synthesis kits containing cholesterol for in vivo nucleic acid delivery, they also showed superior protein expression rates.

[0054] In addition, the present invention was completed by confirming that a complex in which inorganic nanoparticles combined with nucleic acids are encapsulated in lipid nanoparticles containing ginsenoside derivatives improves penetration into cells and expression compared to a case in which there are no lipid nanoparticles.

[0055] In one aspect, the present invention relates to lipid nanoparticles comprising an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

[0056] “Lipid nanoparticle” means a lipid-based particle in the submicron range, and may include any vesicle structure formed by one or more lipid components.

[0057] "Lipids" refers to a group of oils, fats, and fat-like substances that are soluble in relatively non-polar solvents, but largely insoluble in aqueous solvents. Lipids are the main organic compounds that make up cells; lipids and fats can be used interchangeably, and fats are a type of lipid that can include 'triglycerides'.

[0058] The above ionizable lipid is mixed with a 'lipidoid' and means an amine-containing lipid that can be easily protonated, and may be, for example, a lipid whose charge state changes depending on the surrounding pH.

[0059] The ionizable lipid may be protonated (positively charged) at a pH below the pKa of the cationic lipid, and may be substantially neutral at a pH above the pKa. In one example, the lipid nanoparticle may comprise a protonated ionizable lipid and / or an ionizable lipid that exhibits neutrality.

[0060] The ionizable lipid may be mixed with an ionic lipid. The ionizable lipid is an ionizable compound with properties similar to lipids, and can play a role in efficiently encapsulating an active ingredient (e.g., an anionic drug and / or nucleic acid) contained in a lipid nanoparticle through electrostatic interaction with the active ingredient.

[0061] 상기 이온화 가능한 지질은 미국특허공개 제2018 / 0311176호, 제2019 / 0032051호 등을 통해 구체적으로 예시되어 있으며, 예를 들어 N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9, 12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1, 1′-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane, β-L-arginyl-2, 3-L-diaminopropionic acid-N-palmityl-N-oleylamide trihydrochloride, N′,N′-dioctadecyl-N-4, 8-diaza-10-aminodecanoylglycine amide

[0071] , 1,2-dilinoleyloxy-3-dimethylaminopropane, DLin-KC2-DMA, amino lipid 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA, 1), 1,2-distearloxy- / V,N-dimethylaminopropane (DSDMA), dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA), DLin-D-DMA, C12-200, 98N12-5, (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimemylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N-dimethylpentacosa-16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-dien-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,N-dimethylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-1-nonylicosa-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-10-amine, (15Z)-N,N-dimethyleptacos-15-en-10-amine, (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)-N,N-dimethylnonacos-20-en-10-amine, (22Z)-N,N-dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]eptadecan-8-amine, 1-[(1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine,N,N-dimeth-yl-1-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine,N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(1R,2S)-2-undecylcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(1 S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadecan-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propa-n-2-amine, S-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octy-loxy)propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-Roctyloxy)methyl]ethyl}pyrro-lidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azet-idine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-ylo-xy]propan-2-amine, (2S)-1-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]pr-opan-2-amine, N,N-dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-am-ine; (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-1-yloxy]-3-(o-ctyloxy)propan-2-amine, (2 S)-1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propa-n-2-amine, (2S)-1-(hexyloxy)-3-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-di-methylpropan-2-amine, 1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)pr-opan-2-amine, (2S)-1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpro-pan-2-amine, (2S)-1-[(13Z)-docos-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amin-e, 1-[(13Z)-docos-13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-metoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-di-en-1-yloxy]propan-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]-methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-am-ine and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-trien-10-amine, 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”), dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxy ethyl ammonium bromide (DMRIE), DMRIE-HP, Lipofectamine (DOSPA), 3b-(N-(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (“DC-Choi”), N-(1,2-dimyhstyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (“DMRIE”), 1,2-Dioleoyl-3-dimethylammonium-propane (“DODAP”), DMDMA, cationic lipid-based transfection reagents TransIT-TKO,LIPOFECTIN, Lipofectamine, OLIGOFECTAMINE or DHARMAFECT, DSDMA, DODMA, DLinDMA, DLenDMA, gamma-DLenDMA, DLin-K-DMA, DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K), DLin-K-C3-DM A, DLin-K-C4-DMA, DLen-C2K-DMA, y-DLen-C2K-DMA, DLin-M-C2-DMA (MC2), DLin-M-C3-DMA (MC3) or (DLin-MP-DMA)(1-B11), or a mixture thereof, but is not limited thereto.

[0062] In a specific embodiment according to the present invention, the ionizable lipid may be heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate.

[0063] "Phospholipids" are complex lipids containing phosphate esters within their molecules. Phospholipids are a major component of biological membranes, such as cell membranes, endoplasmic reticulum (ER), mitochondria, and the myelin sheath surrounding nerve fibers. Phospholipids have a hydrophilic head and two hydrophobic tails. When exposed to water, phospholipids organize themselves into two-layer sheets (bilayers), with all tails pointing toward the center of the sheet.

[0064] The above phospholipid is specifically exemplified in U.S. Patent Publication Nos. 2018 / 0311176 and 2019 / 0032051, and may be, for example, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl phosphatidylethanolamine, N-succinyl phosphatidylethanolamine, N-glutaryl phosphatidylethanolamine, or lysylphosphatidylglycerol.

[0065] In a specific embodiment according to the present invention, the phospholipid may be 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine.

[0066] In some cases, a non-cationic lipid may be additionally included. The non-cationic lipid may include an amphipathic lipid, a neutral lipid, or an anionic lipid.상기 비양이온성 지질은 예를 들어, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, phosphatidylglycerols, cardiolipins, diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl phosphatidylethanolamines, N-succinyl phosphatidylethanolamines, N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG)일 수 있으나, 이에 제한되는 것은 아니다.

[0067] The above water-soluble polymer is included to ensure stability in vivo and may include, for example, a polyethylene glycol derivative. The polyethylene glycol derivative may be mixed with PEG lipids.

[0068] 상기 폴리에틸렌글리콜 유도체는 미국특허공개 제2018 / 0311176호, 제2019 / 0032051호 등을 통해 구체적으로 예시되어 있으며, 예를 들어, PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. As a non-limiting example, PLGA may be conjugated to a lipid-terminating PEG forming PLGA-DSPE-PEG, PEG lipid is selected from PEG-c-DOMG and 1,2-Dimyristoyl-sn-glycerol, methoxypolyethylene Glycol (PEG-DMG), 1,2-Distearoyl-sn-glycerol, methoxypolyethylene Glycol (PEG-DSG), PEG-c-DOMG, 1,2-Distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG) 1,2-Dipalmitoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DPG), PEG-lipid conjugates such as, e.g., PEG coupled to dialkyloxypropyls (e.g., PEG-DAA conjugates), PEG coupled to diacylglycerols (e.g., PEG-DAG conjugates), PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, and PEG conjugated to ceramides, cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates, polyamide oligomers (e.g., ATTA-lipid conjugates), and mixtures thereof. In some embodiments, the PEG may be, but is not limited to, a PEG-dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), a PEG-distearyloxypropyl (C18), PEG-c-DOMG, PEG-DMG, or mixtures thereof.

[0069] In a specific embodiment according to the present invention, the polyethylene glycol derivative may be 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol.

[0070] The above ginsenoside is a plant ginsenoside, and may be, for example, Rg2 or Rh2, or an isomer thereof. The Rg2 may be a protopanaxadiol series ginsenoside, and the Rh2 may be a PPD (protopanaxadiol) series ginsenoside. The isomer may be an optical isomer, and may include, for example, optical isomers of the S form and the R form.

[0071] The above ginsenoside derivative may be a phytosterol from which sugar has been removed from the Rg2 or Rh2 structure.

[0072] The above phytosterol may be selected from the group consisting of, but is not limited to, protopanaxadiol (PPD), protopanaxatriol (PPT) and mixtures thereof.

[0073] Each of the ionizable lipid, phospholipid, water-soluble polymer, and ginsenoside or its derivative contained in the above lipid nanoparticle may be contained in a molar ratio of, for example, 30-70:7-13:1-1.5:20-85.

[0074] Each of the ionizable lipid, phospholipid, water-soluble polymer, and ginsenoside or a derivative thereof included in the lipid nanoparticle may be, for example, ionizable lipid: phospholipid: PEG lipid: ginsenoside, and the ionizable lipid: phospholipid: PEG lipid: ginsenoside may be included in a molar ratio of, for example, 50:10:1.5:78 to 50:10:1.5:39 to 50:10:0.75:39, but is not limited thereto.

[0075] In a specific embodiment according to the present invention, the ginsenoside or its derivative, phytosterol, is included in an amount of 1.48 mg or 0.74 mg, and may include ionized lipid: phospholipid: PEG lipid: phytosterol. The molar ratio of the ionized lipid: phospholipid: PEG lipid: phytosterol may be, for example, 50:10:1.5:45.81 or 50:10:1.5:22.9 or 50:10:0.75:22.9, but is not limited thereto.

[0076] Nucleic acids can be delivered via the lipid nanoparticles. The nucleic acids, for example, can include polymeric forms of nucleotides of any length, deoxyribonucleotides or ribonucleotides, or analogs thereof. The polynucleotides can have any three-dimensional structure and perform any known or unknown function. The polynucleotides can include one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure can occur before or after polymer assembly.

[0077] Preferably, a nucleic acid is a polymer comprising or consisting of nucleotide monomers covalently linked to each other by phosphodiester bonds in a sugar / phosphate backbone. “Nucleic acid” includes modified nucleic acids, such as base-modified, sugar-modified, or backbone-modified DNA or RNA molecules.

[0078] The above DNA is an abbreviation for deoxyribonucleic acid. It is a polymer made of nucleic acid molecules, i.e., nucleotides. These nucleotides are usually monomers of deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate, and are composed of a sugar (deoxyribose), a base, and a phosphate, and are polymerized by a unique backbone structure. The backbone structure is typically formed by the sugar moiety of the first nucleotide, i.e., deoxyribose, and the phosphate moiety of the second nucleotide, and the phosphodiester bond between adjacent monomers. The specific order of the monomers, i.e., the order of the bases linked to the sugar / phosphate backbone, is called the DNA sequence. DNA can be single-stranded or double-stranded. In double-stranded form, nucleotides of the first strand typically hybridize with nucleotides of the second strand, for example, by A / T base pairing and G / C base pairing.

[0079] RNA includes, for example, mRNA. RNA is usually an abbreviation for ribonucleic acid. It is a polymer made of nucleic acid molecules, i.e., nucleotides. Nucleotides are usually monomers of adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate, linked together by a so-called backbone. The backbone is formed first by a sugar, such as ribose, and second by phosphodiester bonds between adjacent monomers, the phosphate moieties. The specific sequence of monomers is called an RNA sequence. RNA can usually be obtained by transcription of a DNA sequence, for example, within a cell. In eukaryotic cells, transcription typically occurs in the nucleus or mitochondria. In the body, DNA transcription is usually processed into mRNA, messenger RNA. For example, RNA processing in eukaryotic cells involves various posttranscriptional modifications, such as splicing, 5'-capping, polyadenylation, export from the nucleus or mitochondria, and the like. Messenger RNA (MRNA) typically provides a nucleotide sequence that can be translated into the amino acid sequence of a specific peptide or protein. Typically, mRNA contains a 5'-cap, a 5'UTR, an open reading frame, a 3'UTR, and a poly(A) sequence. Aside from messenger RNA, several non-coding RNAs exist that can be involved in the regulation of transcription and / or translation.

[0080] It can be a sequence of several nucleotide triplets that can typically be translated into a peptide or protein. The open reading frame preferably comprises a start codon, i.e., a combination of three subsequent nucleotides at its 5'-end, which typically encode the amino acid methionine (ATG or AUG), and a subsequent region that is usually a multiple of three nucleotides in length. The ORF is preferably terminated by a stop codon (e.g., TAA, TAG, TGA). This is the only stop codon in the open reading frame. Therefore, in the context of the present invention, an open reading frame is a nucleotide sequence consisting of a number of nucleotides that can be divided into three, preferably beginning with a start codon (e.g., ATG or AUG) and preferably ending with a stop codon (e.g., TAA, TGA, or TAG, or UAA, UAG, UGA, respectively). The open reading frame can be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame may also be called a 'polypeptide or protein coding region'.

[0081] In some cases, the nucleic acid may be, but is not limited to, a modified nucleic acid, such as LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro, 8-aza7-deaza-dA), ppG (8-aza-7-deaza-dG), iso-dC (2'-deoxypseudoisocytidine), fdU (5-fluoro-2'-deoxyuridine), or ENA (2'-O,4'-C-ethylene bridged nucleic acid) or a combination thereof.

[0082] "LNA" includes a family of nucleic acid analogues in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4'-C atom. LNA nucleosides include the common nucleobases (T, C, G, A, U, and mC) and can form base pairs according to the standard Watson-Crick base pairing rules.

[0083] "PNA" encompasses non-naturally occurring and artificially synthesized nucleic acids comprising a variety of naturally occurring or non-naturally occurring nucleobases joined to a backbone of repeating N-(2-aminoethyl)-glycine units linked by amide bonds. Purine and pyrimidine bases are attached to the uncharged backbone through methylene carbonyl linkages.

[0084] "ZNA" comprises an oligonucleotide conjugated with one or more cationic spermine moieties that reduce electrostatic repulsion with a target nucleic acid strand and increase the affinity of the oligonucleotide for its target.

[0085] “LDNA” includes oligonucleotides containing non-naturally occurring triazole linkages.

[0086] "TNA" refers to non-naturally occurring nucleic acids that follow the Watson-Crick base-pairing rules and are linked to an alternative sugar phosphate backbone. TNAs have repeating units that are one atom shorter than naturally occurring nucleic acids, but they can base-pair with DNA, RNA, and themselves.

[0087] The nucleic acid may be single-stranded or double-stranded. In addition to DNA, RNA, mRNA, small RNA (si-RNA), duplex formation is also possible with modified nucleic acids such as LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro, 8-aza7-deaza-dA), ppG (8-aza-7-deaza-dG), iso-dC (2'-deoxypseudoisocytidine), fdU (5-fluoro-2'-deoxyuridine), or ENA (2'-O,4'-C-ethylene bridged nucleic acid) or combinations thereof.

[0088]

[0089] From another aspect, the present invention relates to a method for producing lipid nanoparticles, comprising a step of dissolving ionizable lipids, phospholipids, water-soluble polymers, and ginsenosides or derivatives thereof in a solvent.

[0090] The solvent may be, but is not limited to, alcohol. Specifically, the solvent may be ethanol.

[0091] The synthesis method of the above lipid nanoparticles may include, but is not limited to, a synthesis method using rapid mixing using a T-type or Y-type microfluidic system, an extrusion method using a mini-extruder, a synthesis method using ultrasound, and stirring.

[0092] The volume ratio (v / v) of the solvent of the lipid nanoparticles, ethanol, and the aqueous solution containing nucleic acid may be 1:3, 2:3, or 1:1, and this may be used in an optimized ratio depending on the ginsenoside and phytosterol.

[0093] 상기 이온화 가능한 지질은 미국특허공개 제2018 / 0311176호, 제2019 / 0032051호 등을 통해 구체적으로 예시되어 있으며, 예를 들어 N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(I-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-DiLinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyoxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-Dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-Dioleylamino)-1,2-propanedio (DOAP), 1,2-Dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-Dilinolenyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or analogs thereof, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9, 12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (MC3), 1, 1′-(2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol (Tech G1), 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane, β-L-arginyl-2, 3-L-diaminopropionic acid-N-palmityl-N-oleylamide trihydrochloride, N′,N′-dioctadecyl-N-4, 8-diaza-10-aminodecanoylglycine amide

[0071] , 1,2-dilinoleyloxy-3-dimethylaminopropane, DLin-KC2-DMA, amino lipid 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA, 1), 1,2-distearloxy- / V,N-dimethylaminopropane (DSDMA), dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA), DLin-D-DMA, C12-200, 98N12-5, (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,N-dimemylhexacosa-17,20-dien-9-amine, (1Z,19Z)-N5N-dimethylpentacosa-16,19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16-dien-5-amine, (12Z,15Z)-N,N-dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-9-amine, (18Z,21Z)-N,N-dimethylheptacosa-18,21-dien-8-amine, (17Z,20Z)-N,N-dimethylhexacosa-17,20-dien-7-amine, (16Z,19Z)-N,N-dimethylpentacosa-16,19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-dien-10-amine, (21Z,24Z)-N,N-dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,N-dimethylheptacos-18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N-dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(11Z,14Z)-1-nonylicosa-11,14-dien-1-yl]pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-10-amine, (15Z)-N,N-dimethyleptacos-15-en-10-amine, (14Z)-N,N-dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine, (24Z)-N,N-dimethyltritriacont-24-en-10-amine, (20Z)-N,N-dimethylnonacos-20-en-10-amine, (22Z)-N,N-dimethylhentriacont-22-en-10-amine, (16Z)-N,N-dimethylpentacos-16-en-8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine, (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]eptadecan-8-amine, 1-[(1S,2R)-2-hexylcyclopropyl]-N,N-dimethylnonadecan-10-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]nonadecan-10-amine, N,N-dimethyl-21-[(1S,2R)-2-octylcyclopropyl]henicosan-10-amine,N,N-dimeth-yl-1-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]methyl}cyclopropyl]nonadecan-10-amine,N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(1R,2S)-2-undecylcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3-{7-[(1 S,2R)-2-octylcyclopropyl]heptyl}dodecan-1-amine, 1-[(1R,2S)-2-heptylcyclopropyl]-N,N-dimethyloctadecan-9-amine, 1-[(1S,2R)-2-decylcyclopropyl]-N,N-dimethylpentadecan-6-amine, N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]pentadecan-8-amine, R-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octyloxy)propa-n-2-amine, S-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-(octy-loxy)propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-Roctyloxy)methyl]ethyl}pyrro-lidine, (2S)-N,N-dimethyl-1-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-3-[(5Z)-oct-5-en-1-yloxy]propan-2-amine, 1-{2-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-1-[(octyloxy)methyl]ethyl}azet-idine, (2S)-1-(hexyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-ylo-xy]propan-2-amine, (2S)-1-(heptyloxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]pr-opan-2-amine, N,N-dimethyl-1-(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, N,N-dimethyl-1-[(9Z)-octadec-9-en-1-yloxy]-3-(octyloxy)propan-2-am-ine; (2S)-N,N-dimethyl-1-[(6Z,9Z,12Z)-octadeca-6,9,12-trien-1-yloxy]-3-(o-ctyloxy)propan-2-amine, (2 S)-1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(pentyloxy)propa-n-2-amine, (2S)-1-(hexyloxy)-3-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-di-methylpropan-2-amine, 1-[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-N,N-dimethyl-3-(octyloxy)pr-opan-2-amine, (2S)-1-[(13Z,16Z)-docosa-13,16-dien-1-yloxy]-3-(hexyloxy)-N,N-dimethylpro-pan-2-amine, (2S)-1-[(13Z)-docos-13-en-1-yloxy]-3-(hexyloxy)-N,N-dimethylpropan-2-amin-e, 1-[(13Z)-docos-13-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, 1-[(9Z)-hexadec-9-en-1-yloxy]-N,N-dimethyl-3-(octyloxy)propan-2-amine, (2R)-N,N-dimethyl-H(1-metoyloctyl)oxy]-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy]-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-di-en-1-yloxy]propan-2-amine, N,N-dimethyl-1-(octyloxy)-3-({8-[(1S,2S)-2-{[(1R,2R)-2-pentylcyclopropyl]-methyl}cyclopropyl]octyl}oxy)propan-2-amine, N,N-dimethyl-1-{[8-(2-oclylcyclopropyl)octyl]oxy}-3-(octyloxy)propan-2-am-ine and (11E,20Z,23Z)-N,N-dimethylnonacosa-11,20,2-trien-10-amine, 5-carboxyspermylglycine dioctaoleoylamide (“DOGS”), dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (“DPPES”), 1,2-dimyristyloxypropyl-3-dimethyl-hydroxy ethyl ammonium bromide (DMRIE), DMRIE-HP, Lipofectamine (DOSPA), 3b-(N-(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (“DC-Choi”), N-(1,2-dimyhstyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (“DMRIE”), 1,2-Dioleoyl-3-dimethylammonium-propane (“DODAP”), DMDMA, cationic lipid-based transfection reagents TransIT-TKO,LIPOFECTIN, Lipofectamine, OLIGOFECTAMINE or DHARMAFECT, DSDMA, DODMA, DLinDMA, DLenDMA, gamma-DLenDMA, DLin-K-DMA, DLin-K-C2-DMA (also known as DLin-C2K-DMA, XTC2, and C2K), DLin-K-C3-DM A, DLin-K-C4-DMA, DLen-C2K-DMA, y-DLen-C2K-DMA, DLin-M-C2-DMA (MC2), DLin-M-C3-DMA (MC3) or (DLin-MP-DMA)(1-B11), or a mixture thereof, but is not limited thereto.

[0094] In a specific embodiment according to the present invention, the ionizable lipid may be heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate.

[0095] The above phospholipid is specifically exemplified in U.S. Patent Publication Nos. 2018 / 0311176 and 2019 / 0032051, and may be, for example, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoyl phosphatidylethanolamine, N-succinyl phosphatidylethanolamine, N-glutaryl phosphatidylethanolamine, or lysylphosphatidylglycerol.

[0096] In a specific embodiment according to the present invention, the phospholipid may be 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine.

[0097] In some cases, a non-cationic lipid may be additionally included. The non-cationic lipid may include an amphipathic lipid, a neutral lipid, or an anionic lipid.상기 비양이온성 지질은 예를 들어, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), cholesterol, phosphatidylglycerols, cardiolipins, diacylphosphatidylserines, diacylphosphatidic acids, N-dodecanoyl phosphatidylethanolamines, N-succinyl phosphatidylethanolamines, N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG)일 수 있으나, 이에 제한되는 것은 아니다.

[0098] The above water-soluble polymer is included to ensure stability in vivo and may include, for example, a polyethylene glycol derivative. The polyethylene glycol derivative may be mixed with PEG lipids.

[0099] 상기 폴리에틸렌글리콜 유도체는 미국특허공개 제2018 / 0311176호, 제2019 / 0032051호 등을 통해 구체적으로 예시되어 있으며, 예를 들어, PEG-diacylglycerol (DAG), a PEG-dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or a mixture thereof. As a non-limiting example, PLGA may be conjugated to a lipid-terminating PEG forming PLGA-DSPE-PEG, PEG lipid is selected from PEG-c-DOMG and 1,2-Dimyristoyl-sn-glycerol, methoxypolyethylene Glycol (PEG-DMG), 1,2-Distearoyl-sn-glycerol, methoxypolyethylene Glycol (PEG-DSG), PEG-c-DOMG, 1,2-Distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DSG) 1,2-Dipalmitoyl-sn-glycerol, methoxypolyethylene glycol (PEG-DPG), PEG-lipid conjugates such as, e.g., PEG coupled to dialkyloxypropyls (e.g., PEG-DAA conjugates), PEG coupled to diacylglycerols (e.g., PEG-DAG conjugates), PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, and PEG conjugated to ceramides, cationic PEG lipids, polyoxazoline (POZ)-lipid conjugates, polyamide oligomers (e.g., ATTA-lipid conjugates), and mixtures thereof. In some embodiments, the PEG may be, but is not limited to, a PEG-dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16), a PEG-distearyloxypropyl (C18), PEG-c-DOMG, PEG-DMG, or mixtures thereof.

[0100] In a specific embodiment according to the present invention, the polyethylene glycol derivative may be 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol.

[0101] The above ginsenoside is a plant ginsenoside, and may be, for example, Rg2 or Rh2, or an isomer thereof. The Rg2 may be a protopanaxadiol series ginsenoside, and the Rh2 may be a PPD (protopanaxadiol) series ginsenoside. The isomer may be an optical isomer, and may include, for example, optical isomers of the S form and the R form.

[0102] The above ginsenoside derivative may be a phytosterol from which sugar has been removed from the Rg2 or Rh2 structure.

[0103] The above phytosterol may be selected from the group consisting of, but is not limited to, protopanaxadiol (PPD), protopanaxatriol (PPT) and mixtures thereof.

[0104] Each of the ionizable lipid, phospholipid, water-soluble polymer, and ginsenoside or a derivative thereof included in the lipid nanoparticle may be, for example, ionizable lipid: phospholipid: PEG lipid: ginsenoside, and the ionizable lipid: phospholipid: PEG lipid: ginsenoside may be included in a molar ratio of, for example, 50:10:1.5:78 to 50:10:1.5:39 to 50:10:0.75:39, but is not limited thereto.

[0105] In a specific embodiment according to the present invention, the ginsenoside or its derivative, phytosterol, is included in an amount of 1.48 mg or 0.74 mg, and may include ionized lipid: phospholipid: PEG lipid: phytosterol. The molar ratio of the ionized lipid: phospholipid: PEG lipid: phytosterol may be, for example, 50:10:1.5:45.81 or 50:10:1.5:22.9 or 50:10:0.75:22.9, but is not limited thereto.

[0106] The above gene may be bound to an inorganic nanoparticle. In this case, the lipid nanoparticle may be encapsulated in a nucleic acid-conjugated inorganic nanoparticle. Based on this, a nucleic acid-inorganic nanoparticle / lipid nanoparticle complex can be produced.

[0107] The present invention relates to a lipid nanoparticle complex in which a nucleic acid-inorganic nanoparticle structure is encapsulated, wherein the lipid nanoparticle is a complex comprising an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

[0108] The above inorganic nanoparticles may include, but are not limited to, metal nanoparticles including gold, silver, platinum, etc.; metal oxide nanoparticles including iron oxide, zinc oxide, titanium oxide, silicon oxide, etc.; and quantum dot nanoparticles including chalcogenides.

[0109] The method for binding between nucleic acids and inorganic nanoparticles may include a method for directly binding nucleic acids to the surface of inorganic nanoparticles and a method for indirectly binding them. Examples of the direct binding method include, but are not limited to, a method for binding by electrostatic attraction due to the difference in surface charge, a method for inducing binding between nucleic acids having a thiol group at the terminal and metal nanoparticles, a method for utilizing coupling reagents such as 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for chemically binding the carboxyl group on the surface of inorganic nanoparticles to the amine group at the terminal of the gene, and a click chemistry-based binding method using alkyne and azide.

[0110] Methods for indirectly binding nucleic acids and inorganic nanoparticles include a method of modifying the surface of an inorganic nanoparticle with a sequence such as an antisense leader sequence, and then inducing binding with a nucleic acid containing a leader sequence that can bind complementarily thereto; a method of inducing binding using a biomolecule such as streptavidin-biotin; and a method of utilizing a low-molecular-weight compound or a high-molecular-weight compound, but are not limited thereto.

[0111] In the case of manufacturing a nucleic acid-inorganic nanoparticle / lipid nanoparticle complex for the above nucleic acid delivery, the mass ratio (w / w) of the amount of nucleic acid and the lipid nanoparticle component may include, for example, 1:2 to 1:20, specifically 1:2, 1:5, 1:10, 1:20, but the ratios for effective nucleic acid delivery and expression are preferably 1:2 and 1:5.

[0112] In another aspect, the present invention relates to a composition for nucleic acid delivery comprising the lipid nanoparticles.

[0113] In another aspect, the present invention relates to a composition for gene delivery comprising a nucleic acid-inorganic nanoparticle encapsulated in the lipid nanoparticle.

[0114] The above nucleic acid may include a therapeutic or vaccine nucleic acid.

[0115] The nucleic acid may refer to, for example, DNA or RNA. The terms "polynucleotide," "nucleotide," "nucleotide sequence," and "oligonucleotide" are used interchangeably. The polynucleotide may comprise a polymeric form of nucleotides of any length, deoxyribonucleotides or ribonucleotides, or analogs thereof. The polynucleotide may have any three-dimensional structure and may perform any function, known or unknown. The polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. Modifications to the nucleotide structure may occur before or after assembly of the polymer.

[0116] Preferably, a nucleic acid is a polymer comprising or consisting of nucleotide monomers covalently linked to each other by phosphodiester bonds in a sugar / phosphate backbone. “Nucleic acid” includes modified nucleic acids, such as base-modified, sugar-modified, or backbone-modified DNA or RNA molecules.

[0117] The above DNA is an abbreviation for deoxyribonucleic acid. It is a polymer made of nucleic acid molecules, i.e., nucleotides. These nucleotides are usually monomers of deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate, and are composed of a sugar (deoxyribose), a base, and a phosphate, and are polymerized by a unique backbone structure. The backbone structure is typically formed by the sugar moiety of the first nucleotide, i.e., deoxyribose, and the phosphate moiety of the second nucleotide, and the phosphodiester bond between adjacent monomers. The specific order of the monomers, i.e., the order of the bases linked to the sugar / phosphate backbone, is called the DNA sequence. DNA can be single-stranded or double-stranded. In double-stranded form, nucleotides of the first strand typically hybridize with nucleotides of the second strand, for example, by A / T base pairing and G / C base pairing.

[0118] RNA includes, for example, mRNA. RNA is usually an abbreviation for ribonucleic acid. It is a polymer made of nucleic acid molecules, i.e., nucleotides. Nucleotides are usually monomers of adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate, linked together by a so-called backbone. The backbone is formed first by a sugar, such as ribose, and second by phosphodiester bonds between adjacent monomers, the phosphate moieties. The specific sequence of monomers is called an RNA sequence. RNA can usually be obtained by transcription of a DNA sequence, for example, within a cell. In eukaryotic cells, transcription typically occurs in the nucleus or mitochondria. In the body, DNA transcription is usually processed into mRNA, messenger RNA. For example, RNA processing in eukaryotic cells involves various posttranscriptional modifications, such as splicing, 5'-capping, polyadenylation, export from the nucleus or mitochondria, and the like. Messenger RNA (MRNA) typically provides a nucleotide sequence that can be translated into the amino acid sequence of a specific peptide or protein. Typically, mRNA contains a 5'-cap, a 5'UTR, an open reading frame, a 3'UTR, and a poly(A) sequence. Aside from messenger RNA, several non-coding RNAs exist that can be involved in the regulation of transcription and / or translation.

[0119] It can be a sequence of several nucleotide triplets that can typically be translated into a peptide or protein. The open reading frame preferably comprises a start codon, i.e., a combination of three subsequent nucleotides at its 5'-end, which typically encode the amino acid methionine (ATG or AUG), and a subsequent region that is usually a multiple of three nucleotides in length. The ORF is preferably terminated by a stop codon (e.g., TAA, TAG, TGA). This is the only stop codon in the open reading frame. Therefore, in the context of the present invention, an open reading frame is a nucleotide sequence consisting of a number of nucleotides that can be divided into three, preferably beginning with a start codon (e.g., ATG or AUG) and preferably ending with a stop codon (e.g., TAA, TGA, or TAG, or UAA, UAG, UGA, respectively). The open reading frame can be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame may also be called a 'polypeptide or protein coding region'.

[0120] In some cases, the modified nucleic acid may be, but is not limited to, LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro, 8-aza7-deaza-dA), ppG (8-aza-7-deaza-dG), iso-dC (2'-deoxypseudoisocytidine), fdU (5-fluoro-2'-deoxyuridine), or ENA (2'-O,4'-C-ethylene bridged nucleic acid) or combinations thereof.

[0121] "LNA" includes a family of nucleic acid analogues in which the ribose ring is "locked" by a methylene bridge connecting the 2'-O atom and the 4'-C atom. LNA nucleosides include the common nucleobases (T, C, G, A, U, and mC) and can form base pairs according to the standard Watson-Crick base pairing rules.

[0122] "PNA" encompasses non-naturally occurring and artificially synthesized nucleic acids comprising a variety of naturally occurring or non-naturally occurring nucleobases joined to a backbone of repeating N-(2-aminoethyl)-glycine units linked by amide bonds. Purine and pyrimidine bases are attached to the uncharged backbone through methylene carbonyl linkages.

[0123] "ZNA" comprises an oligonucleotide conjugated with one or more cationic spermine moieties that reduce electrostatic repulsion with a target nucleic acid strand and increase the affinity of the oligonucleotide for its target.

[0124] “LDNA” includes oligonucleotides containing non-naturally occurring triazole linkages.

[0125] "TNA" refers to non-naturally occurring nucleic acids that follow the Watson-Crick base-pairing rules and are linked to an alternative sugar phosphate backbone. TNAs have repeating units that are one atom shorter than naturally occurring nucleic acids, but they can base-pair with DNA, RNA, and themselves.

[0126] The nucleic acid may be single-stranded or double-stranded. In addition to DNA, RNA, mRNA, small RNA (si-RNA), duplex formation is also possible with modified nucleic acids such as LNA, PNA, TNA, ZNA, ppA (triazole nucleic acid, 5'-methyl-deoxycytidine, 2'-fluoro, 8-aza7-deaza-dA), ppG (8-aza-7-deaza-dG), iso-dC (2'-deoxypseudoisocytidine), fdU (5-fluoro-2'-deoxyuridine), or ENA (2'-O,4'-C-ethylene bridged nucleic acid) or combinations thereof.

[0127] The nucleic acid may be a target related to a human disease, such as, but not limited to, p53 (Tumor suppressor Protein 53), Rb (RB transcriptional corepressor 1), DAPK1 (Death Associated Protein Kinase 1), WIF1 (Wnt Inhibitory Factor 1), KRAS (KRAS proto-oncogene), etc.

[0128] In the case of manufacturing the lipid nanoparticle-gene complex for the nucleic acid delivery, the mass ratio (w / w) of the amount of nucleic acid and the lipid nanoparticle component may include, for example, 1:5 to 1:20, specifically 1:5, 1:10, 1:20, but the ratios for effective nucleic acid delivery and expression are preferably 1:10 and 1:20.

[0129] Specifically, it may include mRNA. In one embodiment, it may include one or more types of mRNA. In one embodiment, it may include multiple types of mRNA. In one embodiment, it may include two or more types of mRNA. When multiple types of mRNA are included, each mRNA may be included in a molar ratio of, for example, 0.5-2:1, for example, 1:1.

[0130] The composition may further comprise one or more pharmaceutically acceptable carriers. The pharmaceutically acceptable carriers must be compatible with the active ingredient of the present invention, and may include saline solution, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components mixed together. If necessary, other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate the composition into an injectable formulation such as an aqueous solution, suspension, or emulsion. In particular, it is preferable to provide the composition in a lyophilized form. A method commonly known in the art to which the present invention pertains can be used for the preparation of a lyophilized formulation, and a stabilizer for lyophilization may be added. Furthermore, it can be preferably formulated according to each disease or ingredient using an appropriate method in the field or a method disclosed in Remington's pharmaceutical Science (Mack Publishing company, Easton PA).

[0131] The content and administration method of the active ingredients, etc. included in the composition of the present invention can be determined by a person skilled in the art based on the symptoms and severity of the disease of a typical patient. Furthermore, the composition can be formulated in various forms, such as powders, tablets, capsules, liquids, injections, ointments, and syrups, and can also be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.

[0132] The composition of the present invention can be administered orally or parenterally. The route of administration of the composition according to the present invention is not limited to these, but for example, it can be administered intrabronchially, orally, intravenously, intramuscularly, intraarterially, intramedullaryly, intrathecally, intracardiacly, transdermally, subcutaneously, intraperitoneally, enterally, sublingually, or topically. The dosage of the composition according to the present invention varies depending on the patient's weight, age, sex, health condition, diet, administration time, method, excretion rate, or disease severity, and can be easily determined by a person skilled in the art. In addition, the composition of the present invention can be formulated into a suitable dosage form using known techniques for clinical administration.

[0133]

[0134] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0135]

[0136] Manufacturing Example 1: Manufacturing of lipid nanoparticles containing ginsenoside Rg2 (Gin_Rg2-LNP)

[0137] Ginsenoside Rg2 was dissolved in a mixture of ionizable lipid Heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate, phospholipid 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine, and PEG derivative 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 at the following molar ratio of 50:10:1.5:78 to 50:10:1.5:39 to 50:10:0.75:39 (ionizable lipid: phospholipid: PEG lipid: ginsenoside) in ethanol to synthesize lipid nanoparticle structures.

[0138] Afterwards, the mass ratios (w:w) of nucleic acids and total lipid components were mixed at 1:5, 1:10, and 1:20 to form complexes for each condition. At this time, in the case of solvent, ethanol containing lipids and aqueous solution containing nucleic acids were prepared at a ratio of 1:3 (v / v), and the above mixture was reacted at room temperature for 15 minutes. Afterwards, the dispersion of the mRNA-lipid nanocomplex was improved by sonication for about 1 minute, and it was used for characterization and intracellular expression test.

[0139]

[0140] Manufacturing Example 2: Manufacturing of lipid nanoparticles containing phytosterol (protopanaxadiol (PPD)), a derivative of ginsenoside (Gin_PPD-LNP)

[0141] Lipid nanoparticle structures were synthesized by dissolving Protopanaxadiol in a mixture of an ionizable lipid, Heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate, a phospholipid, 1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine, and a PEG derivative, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000, in ethanol at two concentrations of molar ratios of 50:10:1.5:45.81 or 50:10:1.5:22.9 or 50:10:0.75:22.9 (ionizable lipid: phospholipid: PEG lipid: phytosterol).

[0142] Afterwards, the mass ratios (w:w) of nucleic acids and total lipid components were mixed at 1:5, 1:10, and 1:20 to form complexes for each condition. At this time, in the case of solvent, ethanol containing lipids and aqueous solution containing nucleic acids were prepared at ratios of 1:3, 2:3, and 1:1 (v / v), and the above mixtures were reacted at room temperature for 15 minutes. Afterwards, the dispersion of the mRNA-lipid nanocomplex was improved by sonication for about 1 minute, and it was used for characterization and intracellular expression test.

[0143] Manufacturing Example 3: Manufacturing of nucleic acid-gold nanoparticles (Au nanoparticles (Au NPs)) encapsulated with lipid nanoparticles containing phytosterol PPD

[0144] 20 μg of gold nanoparticles, 10 μl of citrate buffer, and 15 pmol of a thiol-modified antisense leader sequence were mixed and reacted at room temperature for more than 5 minutes to produce gold nanoparticles surface-treated with an antisense leader. At this time, the sequence of the antisense leader was modified with a thiol group for binding to the gold nanosurface, and the sequence was 5'- GTTGGTTGGTTTGTTACCTGGGAAGGTATAAACCTTTAATAAAAAAAAAA- SH-3'. However, the functional group for binding to the nanoparticle is not limited to a thiol group, and the antisense leader sequence is not limited to the above sequence. The ratio of the amount of gold nanoparticles and the antisense leader sequence for surface modification may vary depending on the purpose of the experiment. Afterwards, the unbound antisense leader sequence in the supernatant was removed by centrifugation and purified.

[0145] Next, the obtained precipitate (antisense leader-gold nanoparticle complex) is dispersed in 40 μl of HEPES buffer, and then 18.75 pmol of mRNA including a leader sequence is added to the solution. At this time, the leader sequence includes a complementary sequence to the antisense leader sequence bound to the surface of the gold nanoparticle, such as 5'-ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACAAACTAAA-3', but is not limited thereto, and is included in the mRNA structure prepared in Example 4-1 below. The mixture is heated in a heat block at 90 °C for 30 seconds to undergo an annealing process for the mRNA, and then at about 70 °C for 30 minutes to induce binding between the antisense leader sequence on the surface of the gold nanoparticle and the leader sequence of the mRNA. At this time, the processing ratio of the mRNA may vary depending on the purpose of the experiment, etc. Afterwards, mRNA-gold nanoparticles (mRNA-AuNPs) for LNP encapsulation were synthesized by removing unbound mRNA present in the supernatant through centrifugation purification.

[0146] The Gin_PPD-LNP synthesized from Manufacturing Example 2 and the mRNA-AuNP synthesized by the above method were mixed at a ratio of 1:5 (mass ratio = mRNA:LNP), 12.7 μl of sodium acetate was added, and the mixture was thoroughly mixed by vortexing for 1 minute, followed by reaction at room temperature for 15 minutes. Afterwards, ultrasonic treatment was performed for 1 minute to improve the encapsulation and dispersion. At this time, the amount of sodium acetate added or the reaction time can be adjusted depending on the experimental purpose.

[0147]

[0148] Example 1: Structural observation of lipid nanoparticles and analysis of nucleic acid encapsulation rate

[0149] The structure and shape of the lipid nanoparticles (Gin_Rg2-LNP, Gin_PPD-LNP) synthesized from the above manufacturing examples were observed using a transmission electron microscope, and the results are shown in Fig. 1. (A) and (B). As can be seen in the images, the synthesized lipid nanoparticles were spherical in shape, with a size of approximately 50 nm to 250 nm, and exhibited high dispersion. In particular, Gin_Rg2-LNP was observed to have a layered structure.

[0150] Next, Fig. 1. (C) and (D) show the results of measuring the change in particle size through dynamic light scattering (DLS), and it was confirmed that the sizes of the two types of lipid nanoparticles, Gin_Rg2-LNP and Gin_PPD-LNP, increased after mRNA encapsulation. Meanwhile, the reason why the sizes measured were larger than those observed with an electron microscope is thought to be because the size, which took into account the hydrodynamic diameter, was analyzed through DLS.

[0151] In addition, electrophoresis was performed to confirm the degree of mRNA encapsulation in lipid nanoparticles, and the results are shown in Fig. 2. First, as shown in Fig. 2 (A), in the case of Gin_Rg2_LNP, a residual band of mRNA was confirmed when the mass ratio of nucleic acid to lipid nanoparticle was 1:5, but no residual band was confirmed at 1:10 and 1:20, so it was determined that 1:10 and 1:20 were 100% encapsulated. In this case, the solvent ratio of LNP to gene was fixed at 1:3. On the other hand, as shown in Fig. 2 (B), in the case of Gin_PPD_LNP, even when the mass ratio of gene to lipid nanoparticle was different, all residual bands were detected, so the volume ratios of LNP to gene solvent were prepared at ratios of 1:3, 2:3, and 1:1 (3:3), and electrophoresis was analyzed. At this time, the mass ratio of nucleic acid and lipid nanoparticle was fixed at 1:20. As a result, as shown in (C) of Fig. 2, it was confirmed that the highest encapsulation rate with the least residual band was achieved at a ratio of 1:1.

[0152]

[0153] Example 2: Stability analysis against RNA-degrading enzyme (RNase)

[0154] Figure 3 shows the results of testing the stability of mRNA encapsulated in lipid nanoparticles. For this purpose, the experiment was conducted under the following conditions. 1 μg of GFP mRNA and 1 μg of LNP+GFP mRNA ((A) Gin_Rg2-LNP / GFPmRNA, (B) Gin_PPD-LNP / GFPmRNA) were treated with 0.025 μg, 0.005 μg, and 0.01 μg of RNase at various concentrations to confirm the stability of the mRNA-lipid nanocomplex. The RNase-treated samples were reacted at 37°C for 1 hour, and then treated with Proteinase K for 10 minutes to inhibit RNase activity and terminate the reaction. The sample after the reaction was electrophoresed on an agarose gel (1.5%, 0.5 X TBE). As a result, the GFP mRNA that was not encapsulated due to the absence of lipid nanoparticles was decomposed and the corresponding band disappeared, whereas the GFP mRNA-lipid nano complex was not decomposed and the corresponding band (red box in Fig. 3) was observed on electrophoresis, proving that the stability of mRNA was secured by lipid nanoparticles from external factors.

[0155]

[0156] Example 3: Toxicity analysis of lipid nanoparticles

[0157] To confirm the biocompatibility as a gene delivery vehicle, a toxicity test was performed, and the results are shown in Figures 4 and 5. To obtain the results, the following experiment was performed. First, A549 cells, a lung cancer cell line, and HeLa cells, a cervical cancer cell line, were seeded in a 24-well plate at a density of 0.05 x 10 6After spreading the cells per well, they were cultured for 24 hours in a 37°C incubator under 5% CO2 conditions. In order to confirm the toxicity of Rg2 and PPD, which are components of the delivery system, Rg2 and PPD used in Manufacturing Examples 1 and 2 were dispersed in distilled water and treated to each cell line, and then cultured for 24 hours in a 37°C incubator under 5% CO2 conditions. Afterwards, the absorbance (450 nm) of living cells was measured using a cell count kit assay (Cell Counting Kit-8, CCK-8). As shown in Fig. 4, compared to the untreated control group, the cell number was analyzed to be slightly reduced by up to about 10%, confirming that the delivery system had no cytotoxicity.

[0158] Next, the toxicity evaluation of lipid nanoparticles (Gin_Rg2-LNP, Gin_PPD-LNP) was conducted under the above cell conditions, and the results are shown in Fig. 5. According to the results, compared to the control group, the cell number was reduced by up to about 10%, confirming that there was no cytotoxicity as a nucleic acid delivery vehicle.

[0159]

[0160] Example 4: Verification of protein expression following mRNA delivery

[0161] 4-1. Production of GFP and luciferase mRNA

[0162] The GFP mRNA construct for GFP expression was prepared based on the mRNA construct production method previously developed by the present inventor (International Patent Application Publication No. WO / 2023 / 063769).

[0163] To produce GFP mRNA, 10 pmole of the forward primer (5'-TCCACTAGTAACGGCCGCCA-3') corresponding to the front sequence of the T7 promoter, 10 pmole of the poly-dT-linked reverse primer (5'-TT ... The amplified PCR products were purified using Qiaquick® Gel Extraction Kit (QIAGEN, Germany) after electrophoresis on a 1.5% agarose gel and used as templates for IVT. IVT was performed using Takara IVT pro TMT7 mRNA Synthesis Kit (Takara, Japan) was used according to the manufacturer's instructions. Using 1 ug of the above-mentioned PCR product as a template, 2 μl of 10 X Transcription buffer, 2 μl of 10 X ATP, 2 μl of 10 X CTP, 2 μl of 10 X GTP, 2 μl of 10 X UTP, and 2 μl of 10 X Enzyme Mix were added to make a total of 20 μl, and the mixture was incubated at 37°C for 2 hours to allow mRNA synthesis. After the reaction, 4 μl of DNase I was added, and the reaction was incubated at 37°C for 15 minutes to remove the DNA template. After the IVT reaction, the reaction solution was purified by the LiCl Precipitation method, and finally eluted into 100 μl of RNase-free distilled water. To increase mRNA stability, 2 μl of 10X capping buffer, 1 μl of GTP (10 mM), 1 μl of SAM (4 mM), 1 μl of Vaccinia Capping Enzyme (10 U / μl), and 1 μl of mRNA Cap 2'-O-Methyltransferase (50 U / μl) were added to 10 μg of the RNA synthesized above, and mixed to make a total of 20 μl. The mixture was incubated at 37°C for 2 hours to add an anti-reverse cap analog (ARCA) to the 5' end and methylate it to synthesize more stable mRNA. The purified mRNA was quantified using nanodorp.

[0164] Luciferase mRNA was produced using the same method as in Example 4-1, quantified, and then used for expression testing.

[0165]

[0166] 4-2. Confirmation of mRNA delivery and expression

[0167] The GFP mRNA manufactured in 4-1 was encapsulated in the lipid nanoparticles synthesized in Manufacturing Examples 1 and 2 to verify cell delivery and protein expression, and the results are shown in Figs. 6 to 12. First, the results of GFP expression by delivering mRNA to A549 cells are shown in Fig. 6. For this purpose, A549 cells were seeded in a 24-well plate at 0.05 x 10 6 After dispensing cells per well, they were cultured for 24 hours in a 37°C incubator under 5% CO2 conditions. Next, complexes were prepared at a ratio of 1:10 of GFPmRNA: Gin_Rg2-LNP or Gin_PPD-LNP, treated with cells, and cultured for 24 hours in a 37°C incubator under 5% CO2 conditions, and fluorescence was confirmed. At this time, both delivery vehicles were able to observe green fluorescence in cells with high efficiency.

[0168] In addition, an experiment was performed to confirm GFP expression after mRNA delivery in HeLa cells, a cervical cancer cell line, and the results are shown in Figs. 7 to 9. First, the results shown in Fig. 7 are optical micrographs observing fluorescent proteins expressed under conditions of a GFPmRNA:Gin_Rg2-LNP or Gin_PPD-LNP ratio of 1:20, and high green fluorescence expression was confirmed in both delivery systems. In particular, as shown in Figs. 8 and 9, in the case of HeLa cells, unlike the conditions of A549, expression was not confirmed at 1:5 for both delivery systems, and very weak expression was observed at a mixing ratio of 1:10, whereas high expression efficiency was observed at 1:20. When compared with the electrophoresis results of Figure 2 (A), no residual band was detected in the electrophoresis results for both 1:10 and 1:20, indicating a high mRNA loading rate. However, it was confirmed that there was a difference in expression within the cell, indicating that an optimization process for the mixing ratio for delivery and expression was necessary.

[0169] To optimize mRNA delivery and expression, an additional comparative expression experiment was performed according to the PEG lipid content of Gin_Rg2-LNP or Gin_PPD-LNP, and the results are shown in Fig. 10. Compared to the condition using 0.38 mg of PEG lipid, which is the commonly used dose, when LNPs were synthesized using half the amount, 0.19 mg, and GFP mRNA was encapsulated and delivered, a stronger green fluorescence image was observed in HeLa cells. This means that more GFP was expressed at half the PEG lipid content compared to the conventional one, and therefore, the PEG lipid content for delivery and expression was optimized based on these results.

[0170] Figure 11 shows the results of comparing the delivery and expression efficiency between the lipid nanoparticle manufacturing kit for nucleic acid delivery currently on the market and the lipid nanoparticles manufactured in this development. In this case, GFP expression for 1 μg of GFP mRNA delivered into cells through each carrier in A549 cells was compared. As a result of observation with a fluorescence microscope, higher GFP expression was confirmed in both carriers compared to the commercialized kit. Therefore, it was confirmed that the gene delivery vehicle developed from this patent can also be used for the purpose of delivering nucleic acids for therapeutic or vaccine purposes.

[0171] Figure 12 shows the results of confirming expression through delivery of mRNA other than GFP mRNA. 1 μgluciferase mRNA manufactured in 4-1 was encapsulated in lipid nanoparticles synthesized in Manufacturing Examples 1 and 2 at a mixing ratio of 1:10, and after treatment to A549 cells, luciferase expression was confirmed 24 hours later. As a result, a higher luminescence value was confirmed compared to naked mRNA, and it was determined that Gin_Rg2-LNP or Gin_PPD-LNP can be utilized as a delivery vehicle for delivery and expression of other types of mRNA other than GFP mRNA.

[0172]

[0173] Example 5: Verification of protein expression following delivery of mRNA-gold nanoparticles (mRNA-AuNPs) encapsulated with phytosterol-based lipid nanoparticles (Gin_PPD-LNPs).

[0174] 5-1. Characterization of mRNA-AuNP encapsulated with Gin_PPD-LNP (mRNA-AuNP@PPD-LNP)

[0175] The change in surface charge according to the synthesis stage of mRNA-AuNP@PPD-LNP obtained from Manufacturing Example 3 was confirmed through zeta potential, and the result is shown in Fig. 13 (A). First, in the case of gold nanoparticles, as shown in (a), it has a negative charge of -26 mV, and in the case of mRNA-AuNP conjugated to GFP mRNA, the charge was analyzed to be slightly more negative at approximately -32 mV. In contrast, when mRNA-AuNP was encapsulated with PPD-LNP, the charge of the particles shifted to a positive charge, confirmed to be approximately +37 mV. Therefore, a positively charged complex capable of penetrating into cells was constructed. Next, an electron microscope analysis was performed to observe whether gold nanoparticles were present inside the lipid nanoparticles, and the result is shown in Fig. 13 (B). In this case, the black dots represent gold nanoparticles (red arrows), which were not observed in Figure 1B, so the difference could be identified, and the thin film surrounding the black particles was subsequently analyzed to represent lipid nanoparticles (yellow arrows).

[0176]

[0177] 5-2. Confirmation of delivery and expression via mRNA-AuNP@PPD-LNP

[0178] The results of GFP expression after treating A549 cells with a complex in which GFPmRNA-AuNPs bound through the antisense leader sequence and the leader sequence were encapsulated in PPD-LNP are shown in Fig. 14. First, in the case of GFPmRNA-AuNPs without PPD-LNP encapsulation, GFP expression was not observed, as shown in Fig. 14 (A). This was analyzed to be the result of not penetrating into the cells due to the repulsion between the cells and the particles due to the high negative charge mentioned above. However, in contrast, green fluorescence was observed after treating GFPmRNA-AuNP@PPD-LNP, which was confirmed to be the result of GFPmRNA being delivered into the cells and GFP being expressed. This is analyzed to be because penetration into the cells was possible as the surface charge changed to a positive charge after encapsulation. Accordingly, it was determined that even a negatively charged nucleic acid-inorganic nanoparticle structure can be utilized as a carrier for nucleic acid delivery and expression when encapsulated with phytosterol-based PPD-LNP, a ginsenoside derivative.

[0179]

[0180] Example 6: Verification of multiple mRNA delivery and expression

[0181]

[0182] After encapsulating two or more types of mRNA in LNP, delivery and protein expression were verified, and the results are shown in Figs. 15 and 16. In this case, referring to Manufacturing Example 2, a solution containing GFP mRNA and mCherry mRNA in a 1:1 molar ratio was mixed with a PPD-LNP solution to synthesize an mRNA-PPD-LNP complex. To confirm mRNA delivery and expression, HEK293T cells were cultured in a 24-well plate, and then treated with GFP mRNA / mCherry mRNA-PPD-LNP. GFP expression and mCherry expression were observed using a fluorescence microscope, and fluorescence expression was quantified and measured using a flow cytometer.

[0183] According to Figure 15, when GFP mRNA and mCherry mRNA were separately encapsulated in PPD-LNP and delivered to HEK293T, and observed under a fluorescence microscope, green fluorescence due to GFP and red fluorescence due to mCherry were observed in the cells respectively (Figures 15 (b) and (c)), but when GFP mRNA and mCherry mRNA were mixed, encapsulated together in PPD-LNP, and treated simultaneously, green and red fluorescence were observed simultaneously in the cells, verifying that heterogeneous mRNAs were delivered and expressed simultaneously (Figure 15 (d)).

[0184] Next, the delivery and expression of GFPmRNA and mCherrymRNA were analyzed using a flow cytometer. (Fig. 16) In this case, GFP expression was analyzed using the FITC fluorescence channel, and mCherry expression was analyzed using the PE fluorescence channel. As shown in (b) and (c) of Fig. 16, when GFPmRNA was treated alone, it was confirmed that the fluorescence intensity increased in the FITC part of the x-axis, and when mCherrymRNA was treated alone, it was analyzed that the fluorescence intensity increased in the PE part of the y-axis. However, when GFPmRNA and mCherrymRNA were treated simultaneously, as shown in Fig. 16 (d), both FITC and PE fluorescence intensities increased, verifying that the two types of mRNA were simultaneously delivered into the cell and expressed.

[0185]

[0186] Example 7: Validation of mRNA delivery and expression in vivo

[0187]

[0188] The in vivo mRNA delivery and expression of Gin_Rg2-LNP and Gin_PPD-LNP obtained from Manufacturing Examples 1 and 2 were verified, and the results are shown in Figures 17 and 18. In this case, 10 μg of luciferase mRNA was encapsulated into Gin_Rg2-LNP and Gin_PPD-LNP, respectively, and then administered intramuscularly to hairless mice. Then, the in vivo expression was verified using IVIS Lumina III imaging equipment, a live imaging equipment. (IACUC: KMEDI-24031903-00)

[0189] According to Figure 17, compared to the control group (A) that was not administered luciferase mRNA, in case (B), luciferase protein was expressed 6 hours after administration, and luminescence was observed in the thigh muscles of the hairless mice. Even 54 hours after administration, luciferase protein was observed to be expressed in vivo.

[0190] The luminescence efficiency of the luciferase protein, expressed as flux, is shown in Fig. 18. The luminescence efficiency also showed the same trend as the image in Fig. 17, and was detected even after 54 hours after administration. In addition, as in Fig. 17, the Rg2-LNP condition was confirmed to have higher luminescence efficiency and sustained protein expression than the PPD-LNP condition.

[0191]

[0192] Example 8: LNP surface modification for targeted delivery of mRNA and verification of targeting function.

[0193]

[0194] In order to impart targeting functions such as cell selectivity to the manufactured LNP, the LNP surface was modified with a low-molecular-weight compound or a high-molecular-weight compound to synthesize an LNP carrier with cell selectivity, and its function was verified.

[0195] First, to target the folate receptor (FR), LNPs surface-modified with folate were synthesized. In this case, referring to Manufacturing Example 2, the PEG lipid (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000) used in the synthesis of PPD-LNPs was replaced with a PEG lipid containing a folate functional group (folate-PEG-lipid), thereby producing folate-PPD-LNPs. Afterwards, GFP mRNA was encapsulated and treated on FR-positive HeLa cells, and GFP expression was confirmed. The results are shown in Fig. 19. Observation of the treated HeLa cells under a fluorescence microscope confirmed that higher GFP expression was observed in Folate-PPD-LNPs compared to general PPD-LNPs. (Fig. 19 (B) and (C))

[0196] In addition, HA-PPD-LNPs surface-modified with hyaluronic acid (HA) polymers targeting CD44 were synthesized using the following method. First, referring to Manufacturing Example 2, PEG lipid (1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000) used in the synthesis of PPD-LNPs was replaced with amine-PEG lipids substituted with amine functional groups (amine-PEG-lipd) to prepare amine-PPD-LNPs. Then, GFP mRNA was encapsulated in amine-PPD-LNPs to form a complex, and N-Ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride was added and mixed in a shaker for 1 minute. Then, N-hydroxysuccinimide was added and mixed in a shaker for 30 minutes to activate the amine functional groups. HA was then added and shaken overnight to prepare HA-PPD-LNPs. The complex was then treated with CD44-overexpressing A549 cells, and GFP expression was observed using a fluorescence microscope. The results are shown in Figure 20. In this case, higher GFP expression was observed under conditions where GFP mRNA was encapsulated and delivered in HA-PPD-LNPs compared to PPD-LNPs and amine-PPD-LNPs, verifying their cell targeting properties. (Figures 20 (B), (C), and (D))

[0197]

[0198] According to the present invention, in the case of lipid nanoparticles containing ginsenoside and its derivatives, safety was ensured by not causing cytotoxicity, and the ability to protect encapsulated mRNA from RNA-degrading enzymes was excellent, and the expression rate was superior compared to intracellular genetic transfection reagents such as lipofectamine, and the protein expression rate was also confirmed to be superior when compared to a commercialized lipid nanoparticle synthesis kit containing cholesterol for use in in vivo gene delivery, and thus it can be usefully used as a nucleic acid delivery vehicle. Furthermore, a complex in which a lipid nanoparticle composed of a ginsenoside derivative is encapsulated in an mRNA-inorganic nanoparticle having a high negative charge characteristic penetrates into cells and expresses proteins, and therefore can be usefully used as an organic / inorganic complex for nucleic acid delivery.

[0199]

[0200] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Ionizable lipids; phospholipids; water-soluble polymers; and Lipid nanoparticles comprising ginsenoside or a derivative thereof.

2. A lipid nanoparticle in the first paragraph, wherein the ionizable lipid is heptadecan-9-yl 8-[2-hydroxyethyl-(6-oxo-6-(undecoxy)hexyl)amino]octanoate.

3. A lipid nanoparticle in the first paragraph, wherein the phospholipid is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine.

4. A lipid nanoparticle according to claim 1, characterized in that the water-soluble polymer is a polyethylene glycol derivative.

5. A lipid nanoparticle according to claim 4, wherein the polyethylene glycol derivative is 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol.

6. A lipid nanoparticle according to claim 1, characterized in that the ginsenoside is Rg2 or Rh2.

7. A lipid nanoparticle according to claim 1, characterized in that the ginsenoside derivative is a phytosterol.

8. A lipid nanoparticle according to claim 7, characterized in that the phytosterol is selected from the group consisting of protopanaxadiol (PPD), protopanaxatriol (PPT), and mixtures thereof.

9. A lipid nanoparticle according to claim 1, characterized in that the nucleic acid is bound to an inorganic nanoparticle.

10. A lipid nanoparticle according to claim 9, characterized in that the inorganic nanoparticle is a metal nanoparticle, a metal oxide nanoparticle, or a quantum dot nanoparticle.

11. A composition for nucleic acid delivery comprising a lipid nanoparticle according to any one of claims 1 to 10.

12. A composition according to claim 11, characterized in that the mass ratio of the lipid nanoparticles and the gene is 1:5 to 1:

20.

13. A composition according to claim 11, characterized in that the gene comprises one or more types of mRNA.

14. A method for producing lipid nanoparticles, comprising a step of dissolving ionizable lipids, phospholipids, water-soluble polymers, and ginsenosides or derivatives thereof in a solvent.

15. A manufacturing method according to claim 14, characterized in that the solvent is ethanol.

16. A lipid nanoparticle complex in which a nucleic acid-inorganic nanoparticle structure is encapsulated, wherein the lipid nanoparticle is a complex comprising an ionizable lipid; a phospholipid; a water-soluble polymer; and a ginsenoside or a derivative thereof.

Images