Lipid nanoparticles for aerosol delivery of base editors

Lipid nanoparticles with β-sitosterol and optimized lipid ratios enhance aerosol delivery to lungs, addressing shear stress and liver tropism issues, thereby improving gene editing efficacy.

WO2025212607A1PCT designated stage Publication Date: 2025-10-09BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/022486
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-01
Filing Date
2025-04-01
Publication Date
2025-10-09

AI Technical Summary

Technical Problem

Current lipid nanoparticle (LNP) formulations for delivering gene editors to the lungs are limited by their inability to withstand aerosolization shear stress and liver tropism, leading to ineffective lung targeting and distribution.

Method used

Lipid nanoparticles comprising β-sitosterol, reduced ionizable lipids, and specific molar ratios of ionizable, phospholipid, sterol, and polymer conjugated lipids, designed for inhalation delivery to overcome shear stress and improve lung targeting.

Benefits of technology

Enhances the stability and effectiveness of lipid nanoparticles for aerosolized delivery of therapeutic agents to lung cells, improving gene editing efficiency and reducing off-target distribution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025022486_09102025_PF_FP_ABST
    Figure US2025022486_09102025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure relates to pharmaceutical compositions for editing genes that can be administered through inhalation, such as via nebulization. In particular, these compositions contain β-sitosterol instead of other sterols or steroids. These compositions may show improved gene editing performance with fewer editing errors and / or improved aerosolization compared to lipid nanoparticles with cholesterol.
Need to check novelty before this filing date? Find Prior Art

Description

DESCRIPTION LIPID NANOPARTICLES FOR AEROSOL DELIVERY OF BASE EDITORS

[0001] This application claims the benefit of priority to United States Provisional Application No. 63 / 572,604, filed on April 1, 2024, the entire contents of which are incorporated herein by reference. REFERENCE TO A SEQUENCE LISTING

[0001] This application contains a Sequence Listing XML, which has been submitted electronically and is hereby incorporated by reference in its entirety. Said Sequence Listing XML, created on March 31, 2025, is named UTFBP1370WO.xml and is 35,365 bytes in size. BACKGROUND OF THE INVENTION Field of the Invention

[0002] The present disclosure relates generally to the fields of biochemistry, molecular biology, pharmaceutical formulation, and biologics. The present application relates to lipid nanoparticles and compositions for delivery via inhalation of those lipid nanoparticles. Description of Related Art

[0003] Gene editing has the potential to correct mutations within the cystic fibrosis transmembrane conductance regulator (CFTR) protein that cause cystic fibrosis (CF) (Geurts et al., 2020; Jiang et al., 2020; Krishnamurthy et al., 2021; Wei et al., 2023; Mention et al., 2023; Piotrowski-Daspit et al., 2022, Krishnamurthy et al., 2019; Zhou et al., 2019). While gene editing can correct all mutations, it is of particular importance for the mutations that result in premature stop codons which are not yet treatable by small molecule modulators (Hodges and Conlon, 2019). Gene editing systems such as CRISPR-Cas9, base editing, and prime editing show promise for this application. Specifically, base (Komor et al., 2016; Gaudelli et al., 2017) and prime editors (Anzalone et al., 2019; Chen et al., 2021; Doman et al., 2023) build upon the CRISPR-Cas9 systems to offer editing with high efficiency and minimal off-targets.

[0004] While these systems show strong promise for Class I mutations, they have not yet achieved clinical approval. To reach this therapeutic goal, a major hurdle to overcome is-1- 4933-2629-4831, v.1the delivery of editors to the lungs. While lipid nanoparticles (LNPs) have arisen as stable carriers of mRNA-based gene editors, they are limited to intramuscular delivery to prime the immune system (Baden et al., 2021; Polack et al., 2020) or intravenous delivery to target the liver (Akinc et al., 2019). To successfully target the lungs, the composition of the LNPs must be modified depending on the pathway of injection: inhalation or intravenous. In particular, inhaled LNPs must possess specific requirements to overcome the shear stress of aerosolization (Zhang et al., 2020; Kim et al., 2022; Lewis et al., 2023; Chow et al., 2020) while intravenously injected LNPs must overcome liver tropism (Wei et al., 2023). The limitations of LNPs formulated with a permanently cationic excipient to reach the lungs – a majority of the distribution lies within the endothelial cells which do not contribute to CFTR expression – is also known. As an alternative, aerosolization of LNPs offers local delivery of mRNA to the lungs, but the carrier is susceptible to the shear stress imparted by the nebulizer (Zhang et al., 2020; Kim et al., 2022; Lewis et al., 2023; Chow et al., 2020).

[0005] Therefore, there remains a need to develop LNP formulations that are capable of effectively delivering a therapeutic payload to lung cells while also being able to be aerosolized without loss of effectiveness.-2- 4933-2629-4831, v.1SUMMARY OF THE INVENTION

[0006] The present disclosure relates to lipid nanoparticles that are capable of being administered via inhalation that contain β-sitosterol. In particular, the lipid nanoparticles comprise β-sitosterol, while being free of any cholesterol. Additionally, the present disclosure also relates to compositions containing β-sitosterol in a lipid nanoparticle comprising reduced amounts of ionizable lipids. In particular, the lipid nanoparticles comprise less than 49% of moles of the total lipids.

[0007] In some aspects, the present disclosure provides compositions comprising: (A) a lipid nanoparticle comprising: (I) an ionizable lipid; (II) a phospholipid; (III) a sterol comprising an aliphatic carbon tail of at least 9 carbon atoms; and (IV) a polymer conjugated lipid; and (B) a therapeutic agent.

[0008] In some aspects, the present disclosure provides compositions comprising: (A) a lipid nanoparticle comprising: (I) an ionizable lipid; wherein the lipid nanoparticle comprises less than 49% by moles of the ionizable lipid relative to the total moles of the total lipids; (II) a phospholipid; (III) a sterol comprising an aliphatic carbon tail of at least 9 carbon atoms; and (IV) a polymer conjugated lipid; and (B) a therapeutic agent.

[0009] In some embodiments, the sterol comprises an aliphatic carbon tail of 9 to 15 carbon atoms. In some embodiments, the sterol is further defined as:-3- 4933-2629-4831, v.1(I-Sterol) wherein: R1is alkyl(C9-15), alkenyl(C9-C15), or a substituted version of either group; or a pharmaceutically acceptable salt thereof.

[0010] In some embodiments, R1 is alkyl(C9-15) or substituted alkyl(C9-15). In some embodiments, R1 is alkyl(C9-15) such as 5-ethyl-6-methyl-hep-2-yl. In some embodiments, the sterol is β-sitosterol.

[0011] In some embodiments, the polymer conjugated lipid is a PEG conjugated lipid. In some embodiments, the PEG conjugated lipid is DMG-PEG, DMPE-PEG, or DSPE-PEG. In some embodiments, the lipid nanoparticles comprise a molar ratio of the polymer conjugated lipid to the total lipid nanoparticle of about 1:50 to about 1:1,000. In some embodiments, the molar ratio is about 1:75 to about 1:500. In some embodiments, the molar ratio is about 1:90 to about 1:250. In some embodiments, the molar ratio is about 1:100.

[0012] In some embodiments, the ionizable lipid is a cationic ionizable lipid. In some embodiments, the ionizable lipid is a compound of the formula: wherein:m, n, and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; X2and X3are each independently −O− or −N−; R1 is hydroxy, amino, halo, or mercapto; or alkoxy(C≤8), alkylamino(C≤8), dialkylamino(C≤12), , or a substituted version of any of these groups; and R2and R3are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

[0013] In some embodiments, the ionizable lipid is further defined as:-4- 4933-2629-4831, v.1(I) wherein: m is 1, 2, 3, 4, or 5; n and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; X2and X3are each independently−O− or −N−; R1 is hydroxy, amino, halo, or mercapto; or alkoxy(C≤8), alkylamino(C≤8), dialkylamino(C≤12), , or a substituted version of any of these groups; and R2and R3are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

[0014] In some embodiments, the ionizable lipid is further defined as: wherein:m is 1, 2, 3, 4, or 5; n and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and X2 and X3 are each independently −O− or −N−; and R2 and R3 are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

[0015] In some embodiments, the ionizable lipid is further defined as: wherein:-5- 4933-2629-4831, v.1m is 1, 2, 3, 4, or 5; n and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and R2and R3are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

[0016] In some embodiments, m is 1, 2, 3, or 4. In some embodiments, m is 2 or 3. In some embodiments, m is 2. In other embodiments, m is 3. In some embodiments, n is 3, 4, 5, 6, 7, 8, or 9. In some embodiments, n is 4, 5, 6, 7, or 8. In some embodiments, n is 5 or 7. In some embodiments, n is 5. In other embodiments, n is 7. In some embodiments, o is 3, 4, 5, 6, 7, 8, or 9. In some embodiments, o is 4, 5, 6, 7, or 8. In some embodiments, o is 5 or 7. In some embodiments, o is 5. In other embodiments, o is 7. In some embodiments, n is 5 and o is 7. In other embodiments, n and o are each 5. In other embodiments, n is 7 and o is 5. In other embodiments, n and o are each 7.

[0017] In some embodiments, R2 is alkyl(C≤24) or substituted alkyl(C≤24). In some embodiments, R2is alkyl(C≤24). In some embodiments, R2is alkyl(C6-20). In some embodiments, R2 is n-alkyl(C6-20). In some embodiments, R2 is n-alkyl(C6-12) such as n-hexane, n-heptane, n-octane, n-nonane, n-decane, n-undecane, or n-dodecane. In some embodiments, the carbon atom of R2 that is bonded to X2 is a secondary carbon. In some embodiments, R2 is heptadecan-9-yl.

[0018] In some embodiments, R3 is alkyl(C≤24) or substituted alkyl(C≤24). In some embodiments, R3is alkyl(C≤24). In some embodiments, R3is alkyl(C6-20). In some embodiments, R3 is n-alkyl(C6-20). In some embodiments, R3 is n-alkyl(C6-12) such as n-hexane, n-heptane, n-octane, n-nonane, n-decane, n-undecane, or n-dodecane. In some embodiments, the carbon atom of R3 that is bonded to X3 is a secondary carbon. In some embodiments, R3 is heptadecan-9-yl.

[0019] In some embodiments, R2is n-alkyl(C6-20)and wherein the carbon of R3that is bonded to X3 is a secondary carbon. In some embodiments, R2 and R3 are n-alkyl(C6-20). In some embodiments, the carbon of R2that is bonded to X2is a secondary carbon and wherein the carbon of R3 that is bonded to X3 is a secondary carbon. In some embodiments, the cationic ionizable lipid is further defined as:-6- 4933-2629-4831, v.1r p y p .-7- 4933-2629-4831, v.1

[0020] In some embodiments, the composition comprises an ionizable lipid molar ratio of the ionizable lipid to the total lipid nanoparticles is from about 1:10 to about 8:10. In some embodiments, the ionizable lipid molar ratio is about 1:5 to about 3:5. In some embodiments, the ionizable lipid molar ratio is about 2:5 to about 1:2. In some embodiments, the ionizable lipid molar ratio is about 45:100.

[0021] In some embodiments, the composition comprises a phospholipid molar ratio of the phospholipid to the total lipid nanoparticles is from about 1:20 to about 2:5. In some embodiments, the phospholipid molar ratio is about 1:10 to about 3:10. In some embodiments, the phospholipid molar ratio is about 15:100 to about 1:4. In some embodiments, the phospholipid molar ratio is about 1:5. In some embodiments, the composition comprises a sterol molar ratio of the sterol to the total lipid nanoparticles is from about 1:5 to about 3:5. In some embodiments, the sterol molar ratio is about 1:4 to about 1:2. In some embodiments, the sterol molar ratio is about 3:10 to about 2:5. In some embodiments, the sterol molar ratio is about 34:100.

[0022] In some embodiments, the therapeutic agent comprises two or more therapeutic agents. In some embodiments, the therapeutic agent comprises a base editor. In some embodiments, the therapeutic agent comprises one or more biologic agents. In some embodiments, the biologic agent is one or more nucleic acids. In some embodiments, one or more of the nucleic acids is an mRNA. In some embodiments, the mRNA encodes for a protein such as a Cas protein. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, one or more of the nucleic acids is a sgRNA. In some embodiments, one or more of the nucleic acids is DNA. In some embodiments, the composition comprises at least two of mRNA, sgRNA, and DNA. In some embodiments, the composition comprises mRNA, sgRNA, and DNA. In some embodiments, the composition comprises mRNA and sgRNA. In some embodiments, the composition comprises mRNA and DNA. In some embodiments, the therapeutic agent is further modified. In some embodiments, the composition has been formulated for administration via inhalation. In some embodiments, the administration via inhalation is intranasally, topically, intratracheal, or as an aerosol.

[0023] In still another aspect, the present disclosure provides methods of treating a disease or disorder in a patient comprising administering to the patient a composition described herein, wherein the therapeutic agent is therapeutically effective for the disease or disorder. In some embodiments, the disease or disorder is a genetic disorder. In some-8- 4933-2629-4831, v.1embodiments, the disease or disorder is a genetic disease of the lungs. In some embodiments, the disease or disorder is cystic fibrosis. In some embodiments, the patient is a mammal such as a human. In some embodiments, the composition is administered via inhalation. In some embodiments, the composition is administered as a nebulized solution.

[0024] In still yet another aspect, the present disclosure provides methods of delivering a therapeutic agent to the lungs of a patient comprising administering a composition described herein via inhalation.

[0025] In another aspect, the present disclosure provides methods of editing the genes in a patient comprising administering to the patient a composition described herein, wherein the therapeutic agent is a therapeutic agent capable of editing a gene.

[0026] Other objects, features, and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.-9- 4933-2629-4831, v.1BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0028] FIGS. 1A-1C evaluate the editing efficiency of B-1 encapsulating Cas9:sgPTEN mRNA in mice lungs (SEQ ID NOs: 8-10). (a) Schematic of CRISPR-Cas9- mediating a double strand break of PTEN. (b) Cas9:sgPTEN B-1 LNP is delivered 3x over a period of 5 days with a dose of 0.75 mg / kg. Lungs are harvested 8 days after the final dose. (c) % Gene editing of Cas9:sgPTEN B-1 evaluated in whole lung lysate (n=2, mean ± standard deviation).

[0029] FIGS. 2A-2C evaluate editing efficiency of B-1-1 LNPs for editing efficiency in W1282X FRT cells. (a) Schematic of base editing of W1282X (SEQ ID NOs: 11 and 12). (b) Schematic of prime editing of W1282X. The intended edit is lowercase in both the spacer and RTT. PBS, primer binding site; RTT, reverse transcription template (SEQ ID NOs: 13- 19). (c) % Gene editing of A6and A7evaluated in W1282X FRT cells after delivering 1.5 µg of LNPs before and after aerosolization (n=3, mean ± standard deviation).-10- 4933-2629-4831, v.1DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0030] In some aspects, the present disclosure relates to the use of alternative sterols in the formulation of lipid nanoparticles that can be delivered via inhalation to the lungs of a patient. These lipid nanoparticle formulations may be used to carry a therapeutic agent to the lungs of the patient. In particular, these lipid nanoparticle formulations may be used to treat a genetic disease or disorder such as cystic fibrosis. These compositions may have one or more advantageous properties such as improved stability, improved pharmacokinetic properties, or improved activity in vivo. These and more details are described below. I. Nanoparticle and nanoparticle compositions

[0031] In certain embodiments the presently disclosed lipid nanoparticle compositions and methods relating to the treatment of a genetic disease or disorder. In certain embodiments, the genetic disease or disorder is cystic fibrosis. In certain embodiments the presently disclosed compositions can be administered in combination with one or more additional compounds or agents (“additional active agents”) for the treatment, management, and / or prevention of generic disease or disorder such as cystic fibrosis. Such therapies can be administered to a patient at therapeutically effective doses to treat or ameliorate the genetic disease or disorder, or symptoms or disorders associated with the genetic disease or disorder. A therapeutically effective dose refers to that amount of the compound sufficient to result in any delay in onset, amelioration, or retardation of disease symptoms. The presently disclosed compositions in some embodiments comprise peptides described above and elsewhere in combination with a lipid nanoparticle, details of which are provided below.

[0032] As used herein, the term “nanoparticle” refers to any material having dimensions in the 1-1,000 nm range. In some embodiments, nanoparticles have dimensions in the 50-500 nm range. Nanoparticles used in the present embodiments include such nanoscale materials as a lipid-based nanoparticle, a superparamagnetic nanoparticle, a nanoshell, a semiconductor nanocrystal, a quantum dot, a polymer-based nanoparticle, a silicon-based nanoparticle, a silica-based nanoparticle, a metal-based nanoparticle, a fullerene and a nanotube (Ferrari, 2005). The conjugation of polypeptide or nucleic acids to nanoparticles provides structures with potential application for targeted delivery, controlled release, enhanced cellular uptake and intracellular trafficking, and molecular imaging of-11- 4933-2629-4831, v.1therapeutic peptides in vitro and in vivo (West, 2004; Stayton et al., 2000; Ballou et al., 2004; Frangioni, 2003; Dubertret et al., 2002; Michalet et al., 2005; Dwarakanath et al., 2004.) (1) Lipid nanoparticles (LNPs)

[0033] Lipid-based nanoparticles include liposomes, lipid preparations and lipid- based vesicles. Lipid-based nanoparticles may be positively charged, negatively charged or neutral. In preferred embodiments of the present disclosure, the lipid-based nanoparticles of the present disclosure comprise a cationic ionizable lipid.

[0034] A “liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes may be characterized as having vesicular structures with a bilayer membrane, generally comprising a phospholipid, and an inner medium that generally comprises an aqueous composition. Liposomes provided herein include unilamellar liposomes, multilamellar liposomes and multivesicular liposomes. Liposomes provided herein may be positively charged, negatively charged or neutrally charged. In certain embodiments, the liposomes are neutral in charge.

[0035] A multilamellar liposome has multiple lipid layers separated by aqueous medium. They form spontaneously when lipids comprising phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Lipophilic molecules or molecules with lipophilic regions may also dissolve in or associate with the lipid bilayer.

[0036] In specific aspects, a polypeptide or nucleic acids may be, for example, encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the polypeptide / nucleic acid, entrapped in a liposome, complexed with a liposome, or the like.

[0037] The size of a liposome varies depending on the method of synthesis. Liposomes in the present embodiments can be a variety of sizes. In certain embodiments, the liposomes are small, e.g., less than about 200 nm, about 190 nm, about 180 nm, about 170 nm, about 160 nm, about 150 nm, about 140 nm, about 130 nm, about 120 nm, about 110 nm,-12- 4933-2629-4831, v.1about 100 nm, about 90 nm, about 80 nm, about 70 nm, about 60 nm, or about 50 nm in external diameter. For example, in general, prior to the incorporation of nucleic acid, a liposome for use according to the present embodiments comprises a size of about 50 to 250 nm. Such liposome formulations may also be defined by particle charge (zeta potential) and / or optical density (OD). For instance, a liposome formulation will typically comprise an OD400 of less than 0.45 prior to nucleic acid incorporation. Likewise, the overall charge of such particles in solution can be defined by a zeta potential of about 50-80 mV. In other embodiments, the liposomes or lipid nanoparticles may have a larger diameter, such as about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm, about 550 nm, about 600 nm, about 650 nm, about 700 nm, about 750 nm, about 800 nm, about 850 nm, about 900 nm, about 950 nm, about 1000 nm, or any range derivable therein.

[0038] The liposomes provided by the present disclosure are shown, for example, above in the summary of the invention section and in the claims below. They may be made using the methods outlined in the Examples section. These methods can be further modified and optimized using the principles and techniques of organic chemistry as applied by a person skilled in the art. Such principles and techniques are taught, for example, in March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure (2007), which is incorporated by reference herein.

[0039] Furthermore, in preparing such liposomes, any protocol described herein, or as would be known to one of ordinary skill in the art may be used. Additional non-limiting examples of preparing liposomes are described in WO02 / 100435A1, WO03 / 015757A1, WO04029213A2, U.S. Application 2004 / 0208921, U.S. Patents 4,728,578, 4,728,575, 4,737,323, 4,533,254, 4,162,282, 4,310,505, and 4,921,706; 5,030,453, 5,962,016, 6,680,068, International Applications PCT / US85 / 01161 and PCT / US89 / 05040; U.K. Patent Application GB 2193095 A; Mayer et al., 1986; Hope et al., 1985; Mayhew et al. 1987; Mayhew et al., 1984; Cheng et al., 1987; and Liposome Technology, 1984, each incorporated herein by reference). A process of making liposomes is also described in WO04 / 002453A1.

[0040] In certain embodiments, the lipid-based nanoparticle is a positive liposome. “Positive liposomes” or “cationic liposomes”, as used herein, are defined as liposomes having one or more lipid components that yield an essentially positive net charge (substantially positive). By “essentially positive”, it is meant that overall, lipid components within a given population (e.g., a population of liposomes) include positive charges that are not canceled by-13- 4933-2629-4831, v.1an opposite charge of another component (i.e., fewer than 10% of components are canceled by an opposite charge of another component, more preferably fewer than 5%, and most preferably fewer than 1%). In certain embodiments, positive liposomes may include mostly lipids and / or phospholipids that are themselves positive under physiological conditions (i.e., at about pH 7). As used herein, the lipid components that yield an essentially positive net charge of the positive liposomes, that is, the lipids that are themselves positive under physiological conditions, may also be known as cationic ionizable lipids. In some embodiments, the cationic ionizable lipids may be neutral at physiological pH and positively charged in acidic pH or environments. The localized microenvironment surrounding cationic ionizable lipids may affect the protonation state of the cationic ionizable lipids and result in positively charged cationic ionizable lipids under conditions which would not otherwise be thought to result in positively charged cationic ionizable lipids. In some embodiments, the cationic ionizable lipid is an amino lipid. In some embodiments, the cationic ionizable lipids comprise a tertiary amine. In some embodiments, the alkyl groups attached to the tertiary amine may be independently substituted with functional groups, such as esters or hydroxy groups. In some embodiments, the cationic ionizable lipid is SM-102, MC3, or ALC-0315.

[0041] The cationic ionizable lipid component of lipid nanoparticle compositions of the present disclosure may be present in a variety of molar ratios with respect to the composition. In some embodiments of the present invention, the cationic ionizable lipid is present in a molar ratio with respect to the lipid nanoparticle composition of from about 0.2 to about 1.0. In some embodiments, the molar ratio of cationic ionizable lipid to lipid nanoparticle composition is from about 0.3 to about 0.7 or from about 0.4 to about 0.6. The molar ratio of cationic lipid to lipid nanoparticle composition may be about 0.2, about 0.25 about 0.3, about 0.35, about 0.4, about 0.45, about 0.5, about 0.55, about 0.6, about 0.65, about 0.7, about 0.75, about 0.8, about 0.85, about 0.9, about 0.95, or about 1.0, or any range derivable therein. In some embodiments, the molar ratio of cationic lipid to lipid nanoparticle composition is about 0.45.

[0042] The cationic ionizable lipids and other lipids of the present disclosure may contain one or more asymmetrically-substituted carbon or nitrogen atoms, and may be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of a chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. Cationic ionizable-14- 4933-2629-4831, v.1lipids may occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single diastereomer is obtained. The chiral centers of the cationic ionizable lipids of the present disclosure can have the S or the R configuration. Furthermore, it is contemplated that one or more of the cationic ionizable lipids may be present as constitutional isomers. In some embodiments, the compounds have the same formula but different connectivity.

[0043] Chemical formulas used to represent cationic ionizable lipids of the present disclosure will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.

[0044] The cationic ionizable lipids of the present disclosure may also have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, more metabolically stable than, more lipophilic than, more hydrophilic than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.

[0045] In addition, atoms making up the cationic ionizable lipids of the present disclosure are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.

[0046] It should be recognized that the particular anion or cation forming a part of any salt form of a cationic ionizable lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference.-15- 4933-2629-4831, v.1(a) Lipids

[0047] In some aspects of the present disclosure, one or more additional types of lipids are mixed with the ionizable lipids of the instant disclosure to create a nanoparticle composition. The ionizable lipid may be a cationic ionizable lipid or an anionic ionizable lipid. In other embodiments, the ionizable lipid is a zwitterionic lipid. In particular, the present application may contain one or more cationic ionizable lipid. In some embodiments, the cationic ionizable lipids are mixed with 1, 2, 3, 4, or 5 different types of lipids. It is contemplated that the cationic ionizable lipids can be mixed with multiple different lipids of a single type.

[0048] In some embodiments, the present composition comprises a molar ratio of the ionizable lipid to the lipid nanoparticle composition of from about 0.1 to about 0.6. The molar ratio may be from about 0.15 to about 0.5 such as a molar ratio of about such as a molar ratio of ionizable lipid to lipid nanoparticle composition of about 0.45. In some embodiments, the molar ratio of ionizable lipid to lipid nanoparticle composition is about 0.05, about 0.10, about 0.15, about 0.20, about 0.25, about 0.30, about 0.35, about 0.4, about 0.45, about 0.50, about 0.55, about 0.60, about 0.65, about 0.70, about 0.75, about 0.80, or any range derivable therein.

[0049] In some embodiments, at least one of the additional lipids may be a steroid or a steroid derivative. In some embodiments, the additional lipid may be a PEG lipid. In some embodiments, the additional lipid may be a phospholipid. In some embodiments, the nanoparticle composition comprises a steroid or a steroid derivative, a PEG lipid, and a phospholipid, or any combination thereof. Additional details of the types of lipids that may be used to form the nanoparticle composition are provided in the sections that follow. i. Steroids and Steroid Derivatives

[0050] In the lipid nanoparticle compounds of the present disclosure of the present disclosure, the cationic ionizable lipids (or compounds) are mixed with one or more sterols or sterol derivatives and other components described below to form the nanoparticle composition. In some embodiments, the steroid or steroid derivative comprises any steroid or steroid derivative. As used herein, in some embodiments, the term “sterol” is a class of compounds with a four ring 17 carbon cyclic structure which can further comprises one or more substitutions including alkyl groups, alkoxy groups, hydroxy groups, oxo groups, acyl-16- 4933-2629-4831, v.1groups, or a double bond between two or more carbon atoms. In one aspect, the ring structure of a steroid comprises three fused cyclohexyl rings and a fused cyclopentyl ring as shown in the formula below: .

[0051] In some comprises the ring structure abovewith one or more non-alkyl substitutions. In some embodiments, the sterol or sterol derivative is a sterol wherein the formula is further defined as: .

[0052] In somecomprises a molar ratio of the sterol or sterol derivative to the lipid nanoparticle composition of from about 0.1 to about 0.6. The molar ratio may be from about 0.15 to about 0.5 such as a molar ratio of about such as a molar ratio of steroid or steroid derivative to lipid nanoparticle composition of about 0.34. In some embodiments, the molar ratio of steroid or steroid derivative to lipid nanoparticle composition is about 0.05, about 0.10, about 0.15, about 0.20, about 0.25, about 0.30, about 0.35, about 0.4, about 0.45, about 0.50, about 0.55, about 0.60, about 0.65, about 0.70, about 0.75, about 0.80, about 0.85, to about 0.90, or any range derivable therein. ii. Polymer Conjugated lipid

[0053] In the lipid nanoparticle compounds of the present disclosure of the present disclosure, the cationic ionizable lipids (or compounds) are mixed with one or more polymer conjugated lipids such as PEGylated lipids (or PEG lipid) and other components described above and below to form the nanoparticle composition. In some embodiments, the present disclosure comprises using any lipid to which a PEG group has been attached. In some embodiments, the PEG lipid is a diglyceride which also comprises a PEG chain attached to the glycerol group. In other embodiments, the PEG lipid is a compound which contains one or more C6-C24 long chain alkyl or alkenyl group or a C6-C24 fatty acid group attached to a linker group with a PEG chain. In some embodiments, the PEG-lipid has an advantage such as that it prevents aggregation or reduces uptake of the composition by immune cells. Some-17- 4933-2629-4831, v.1non-limiting examples of a PEG lipid includes a PEG modified phosphatidylethanolamine and phosphatidic acid, a PEG ceramide conjugated, PEG modified dialkylamines and PEG modified 1,2-diacyloxypropan-3-amines, PEG modified diacylglycerols and dialkylglycerols. In some embodiments, the PEG lipid is PEG modified diastearoylphosphatidylethanolamine. In some embodiments, the PEG lipid comprises a PEG modified phospholipid, such as any of the lipids mentioned in the section that follows. In some embodiments, the PEG lipid is a PEG modified dimyristoyl phosphatidylethanolamine or a PEG modified myristoyl diglyceride.

[0054] In some embodiments, the PEG modification is measured by the molecular weight of PEG component of the lipid. In some embodiments, the PEG modification has a molecular weight from about 100 to about 5,000. In some embodiments, the molecular weight is from about 200 to about 500 or from about 1,200 to about 3,000. Some non- limiting examples of lipids that may be used in the present disclosure are taught by U.S. Patent 5,820,873, WO 2010 / 141069, or U.S. Patent 8,450,298, which is incorporated herein by reference.

[0055] In some embodiments, the present composition comprises a molar ratio of the PEG lipid to the lipid nanoparticle composition of from about 0.001 to about 0.04 or from about 0.005 to about 0.03. The molar ratio may be from about 0.005 to about 0.015. In some embodiments, the molar ratio of PEG lipid to the lipid nanoparticle composition may be about 0.01. In some embodiments, the ratio is about 0.001, about 0.005, about 0.006, about 0.007, about 0.008, about 0.009, about 0.01, about 0.011, about 0.012, about 0.013, about 0.014, about 0.015, about 0.02, about 0.025, about 0.03, about 0.035, to about 0.04 or any range derivable therein. iii. Phospholipids

[0056] In the lipid nanoparticle compounds of the present disclosure of the present disclosure, the cationic ionizable lipids (or compounds) are mixed with one or more phospholipids and other components described above and below to form the nanoparticle composition. The phospholipids may also be referred to herein as “helper lipids.” In some embodiments, compositions disclosed herein comprise a helper lipid which comprises a phosphate group. In some embodiments, more than one kind of phospholipid may be used to form the composition. In some embodiments, the phospholipid is a structure which contains one or two long chain C6-C24 alkyl or alkenyl groups, a glycerol or a sphingosine, one or-18- 4933-2629-4831, v.1two phosphate groups, and, optionally, a small organic molecule. In some embodiments, the small organic molecule is an amino acid, a sugar, or an amino substituted alkoxy group, such as choline or ethanolamine. In some embodiments, the phospholipid is a phosphatidylcholine. In some embodiments, the phospholipid is distearoylphosphatidylcholine, dioleoylphosphatidylycholine or dipalmitoylphosphatidylcholine. In some embodiments, the helper lipid may be neutral under physiological conditions (i.e., at about pH 7). In some embodiments, the helper lipid has an advantage such as that it improves the structure or enhances endosomal escape.

[0057] Phospholipids include, for example, phosphatidylcholines, phosphatidylglycerols, and phosphatidylethanolamines; because phosphatidylethanolamines and phosphatidyl cholines are non-charged under physiological conditions (i.e., at about pH 7), these compounds may be particularly useful for generating positive liposomes. In certain embodiments, the phospholipid DPPC is used to produce positive liposomes.

[0058] Phospholipids that may be components of compositions disclosed herein include glycerophospholipids and certain sphingolipids. Phospholipids include, but are not limited to, dioleoylphosphatidylycholine ("DOPC"), egg phosphatidylcholine ("EPC"), dilauryloylphosphatidylcholine ("DLPC"), dimyristoylphosphatidylcholine ("DMPC"), dipalmitoylphosphatidylcholine ("DPPC"), distearoylphosphatidylcholine ("DSPC"), 1- myristoyl-2-palmitoyl phosphatidylcholine ("MPPC"), 1-palmitoyl-2-myristoyl phosphatidylcholine ("PMPC"), 1-palmitoyl-2-stearoyl phosphatidylcholine ("PSPC"), 1- stearoyl-2-palmitoyl phosphatidylcholine ("SPPC"), dilauryloylphosphatidylglycerol ("DLPG"), dimyristoylphosphatidylglycerol ("DMPG"), dipalmitoylphosphatidylglycerol ("DPPG"), distearoylphosphatidylglycerol ("DSPG"), distearoyl sphingomyelin ("DSSP"), distearoylphophatidylethanolamine ("DSPE"), dioleoylphosphatidylglycerol ("DOPG"), dimyristoyl phosphatidic acid ("DMPA"), dipalmitoyl phosphatidic acid ("DPPA"), dimyristoyl phosphatidylethanolamine ("DMPE"), dipalmitoyl phosphatidylethanolamine ("DPPE"), dimyristoyl phosphatidylserine ("DMPS"), dipalmitoyl phosphatidylserine ("DPPS"), brain phosphatidylserine ("BPS"), brain sphingomyelin ("BSP"), dipalmitoyl sphingomyelin ("DPSP"), dimyristyl phosphatidylcholine ("DMPC"), 1,2-distearoyl-sn- glycero-3-phosphocholine ("DAPC"), 1,2-diarachidoyl-sn-glycero-3-phosphocholine ("DBPC"), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine ("DEPC"), dioleoylphosphatidylethanolamine ("DOPE"), palmitoyloeoyl phosphatidylcholine ("POPC"),-19- 4933-2629-4831, v.1palmitoyloeoyl phosphatidylethanolamine ("POPE"), lysophosphatidylcholine, lysophosphatidylethanolamine, and dilinoleoylphosphatidylcholine.

[0059] In some embodiments, the present composition comprises a molar ratio of the phospholipid to the lipid nanoparticle composition from about 0.01 to about 0.5 or about 0.02 to about 0.4. The molar ratio may be from about 0.05 to about 0.3 such as a molar ratio of about 0.2. In some embodiments, the molar ratio of phospholipid to lipid nanoparticle composition is from about 0.01, about 0.03, about 0.05, about 0.07, about 0.09, about 0.1, about 0.12, about 0.14, about 0.16, about 0.18, about 0.2, about 0.22, about 0.24, about 0.26, about 0.28, about 0.3, about 0.35, about 0.4, about 0.45, to about 0.5, or any range derivable therein.

[0060] Phospholipids may be from natural or synthetic sources. However, phospholipids from natural sources, such as egg or soybean phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiolipin and plant or bacterial phosphatidylethanolamine are not used, in certain embodiments, as the primary phosphatide (i.e., constituting 50% or more of the total phosphatide composition) because this may result in instability and leakiness of the resulting liposomes. (b) Biologically active polynucleotides

[0061] Methods and composition of the embodiments concern biologically active polynucleotides. In some cases, these can comprise single stranded or double stranded RNA or DNA. It should be clear that the present disclosure is not limited to the specific nucleic acids disclosed herein. The present disclosure is not limited in scope to any particular source, sequence, or type of nucleic acid, however, as one of ordinary skill in the art could readily identify related homologs in various other sources of the nucleic acid including nucleic acids from non-human species (e.g., mouse, rat, rabbit, dog, monkey, gibbon, chimp, ape, baboon, cow, pig, horse, sheep, cat and other species). It is contemplated that the nucleic acid used in the present disclosure can comprises a sequence based upon a naturally-occurring sequence.

[0062] The amount of nucleic acid encapsulated by or located within the lipid nanoparticle may vary based on the intended use. The amount of nucleic acid may be calculated as a ratio with respect to the lipid nanoparticle composition (w / w) or to any of the individual components of the lipid nanoparticle composition (w / w). For example, the ratio of cationic ionizable lipid to nucleic acid may be about from about 50:1 (w / w), about 20:1-20- 4933-2629-4831, v.1(w / w), about 15:1 (w / w), about 14:1 (w / w), about 13:1 (w / w), about 12:1 (w / w), about 11:1 (w / w), about 10:1 (w / w), about 9:1 (w / w), about 8:1 (w / w), about 7:1 (w / w), about 6:1 (w / w), to about 5:1 (w / w), or any range derivable therein. In some embodiments, the ratio of cationic ionizable lipid to nucleic acid is about 11.33 (w / w). The length of the nucleic acid encapsulated by or located within the lipid nanoparticle may also vary based on the intended use. The length of the nucleic acid may be about 20 bp, about 50 bp, about 75 bp, about 100 bp, about 150 bp, about 200 bp, about 250 bp, about 300 bp, about 350 bp, about 400 bp, about 450 bp, about 500 bp, about 550 bp, about 600 bp, about 650 bp, about 700 bp, about 750 bp, about 800 bp, about 850 bp, about 900 bp, about 950 bp, about 1000 bp, or any range derivable therein. Longer nucleic acids are also contemplated, such as nucleic acids that are about 1500 bp, about 2000 bp, about 2500 bp, about 3000 bp, about 3500 bp, about 4000 bp, about 4500 bp, about 5000 bp, about 5500 bp, about 6000 bp, about 6500 bp, about 7000 bp, about 7500 bp, about 8000 bp, about 8500 bp, about 9000 bp, about 9500 bp, about 10,000 bp, or any range derivable therein.

[0063] In some aspects, the nucleic acid is a sequence which silences, is complimentary to, or replaces another sequence present in vivo. Sequences of 17 bases in length should occur only once in the human genome and, therefore, suffice to specify a unique target sequence. Although shorter oligomers are easier to make and increase in vivo accessibility, numerous other factors are involved in determining the specificity of hybridization. Both binding affinity and sequence specificity of an oligonucleotide to its complementary target increases with increasing length. It is contemplated that exemplary oligonucleotides of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more base pairs will be used, although others are contemplated. Longer polynucleotides encoding 250, 500, 1000, 1212, 1500, 2000, 2500, 3000 or longer are contemplated as well.

[0064] The nucleic acid used herein may be derived from genomic DNA, i.e., cloned directly from the genome of a particular organism. In preferred embodiments, however, the nucleic acid would comprise complementary DNA (cDNA). Also contemplated is a cDNA plus a natural intron or an intron derived from another gene; such engineered molecules are sometime referred to as "mini-genes." At a minimum, these and other nucleic acids of the present disclosure may be used as molecular weight standards in, for example, gel electrophoresis.-21- 4933-2629-4831, v.1

[0065] The term "cDNA" is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.

[0066] In some embodiments, the nucleic acid comprises one or more antisense segments which inhibits expression of a gene or gene product. Antisense methodology takes advantage of the fact that nucleic acids tend to pair with "complementary" sequences. By complementary, it is meant that polynucleotides are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.

[0067] Targeting double-stranded (ds) DNA with polynucleotides leads to triple-helix formation; targeting RNA will lead to double-helix formation. Antisense polynucleotides, when introduced into a target cell, specifically bind to their target polynucleotide and interfere with transcription, RNA processing, transport, translation and / or stability. Antisense RNA constructs, or DNA encoding such antisense RNA's, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject.

[0068] Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. It is contemplated that the most effective antisense constructs will include regions complementary to intron / exon splice junctions. Thus, it is proposed that a preferred embodiment includes an antisense construct with complementarity to regions within 50-200 bases of an intron-exon splice junction. It has been observed that some exon sequences can be included in the construct without seriously affecting the target selectivity thereof. The amount of exonic material included will vary depending on the particular exon and intron sequences used. One-22- 4933-2629-4831, v.1can readily test whether too much exon DNA is included simply by testing the constructs in vitro to determine whether normal cellular function is affected or whether the expression of related genes having complementary sequences is affected.

[0069] As stated above, "complementary" or "antisense" means polynucleotide sequences that are substantially complementary over their entire length and have very few base mismatches. For example, sequences of fifteen bases in length may be termed complementary when they have complementary nucleotides at thirteen or fourteen positions. Naturally, sequences which are completely complementary will be sequences which are entirely complementary throughout their entire length and have no base mismatches. Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., ribozyme; see below) could be designed. These molecules, though having less than 50% homology, would bind to target sequences under appropriate conditions.

[0070] It may be advantageous to combine portions of genomic DNA with cDNA or synthetic sequences to form a siRNA or to generate specific constructs. For example, where an intron is desired in the ultimate construct, a genomic clone will need to be used. The cDNA, siRNA, or a synthesized polynucleotide may provide more convenient restriction sites for the remaining portion of the construct and, therefore, would be used for the rest of the sequence. Other embodiments include dsRNA or ssRNA, which may be used to target genomic sequences or coding / non-coding transcripts.

[0071] In other embodiments, the nanoparticles may comprise a nucleic acid which comprises one or more expression vectors are used in a gene therapy. Expression requires that appropriate signals be provided in the vectors, and which include various regulatory elements, such as enhancers / promoters from both viral and mammalian sources that drive expression of the genes of interest in host cells. Elements designed to optimize messenger RNA stability and translatability in host cells also are defined. The conditions for the use of a number of dominant drug selection markers for establishing permanent, stable cell clones expressing the products are also provided, as is an element that links expression of the drug selection markers to expression of the polypeptide.

[0072] Throughout this application, the term "expression construct" is meant to include any type of genetic construct containing a nucleic acid coding for a gene product in-23- 4933-2629-4831, v.1which part or all of the nucleic acid encoding sequence is capable of being transcribed. The transcript may be translated into a protein, but it need not be. In certain embodiments, expression includes both transcription of a gene and translation of mRNA into a gene product. In other embodiments, expression only includes transcription of the nucleic acid encoding a gene of interest.

[0073] The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Sambrook et al. (1989) and Ausubel et al. (1994), both incorporated herein by reference.

[0074] The term "expression vector" refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra. mRNA

[0075] In some aspects, the present compounds and compositions may be used in the delivery of an mRNA to a cell. Messenger RNA or mRNA are short RNA strands which transfer the genetic code from the DNA to the ribosomes so the mRNA may be translated into a therapeutic protein or peptide, or an antigen. The mRNAs described herein may be unprocessed or have undergone processing to add a poly(A) tail, be edited in vivo, or have a 5′ cap added. The mRNA molecules may comprise a 5’ UTR or a 3’UTR. The mRNA molecules may comprise one or more modified nucleotides such as pseudouridines. The-24- 4933-2629-4831, v.1present compositions are contemplated in the delivery of a variety of different mRNA including those which have not undergone processing or have been further processed. Additionally, these nucleic acids may be used therapeutically, used to produce an antibody in vivo, or in a vaccine formulation. mRNA molecules can provide a more direct method of expressing a polypeptide of interest in a target cell. However, such molecules are typically highly liable and rapidly degraded. In some aspects, LNP processing according to the embodiments can be used to substantially stabilize mRNA. In preferred aspects, mRNA is provided encapsulated in or in complex with LNPs.

[0076] As mentioned above, in some aspects a nucleic acid molecule of the embodiments encodes a therapeutic polypeptide. For example, the therapeutic protein may be a protein, such as an enzyme that is non-functional or disrupted in a particular disease state (e.g., CFTR in cystic fibrosis).

[0077] In further aspects, a polynucleotide of the embodiments encodes an antigen, such as an antigen from a pathogen or a cancer cell-associated antigen. For example, the cancer associated antigen can be CD19, CD20, ROR1, CD22, carcinoembryonic antigen, alphafetoprotein, CA-125, 5T4, MUC-1, epithelial tumor antigen, prostate-specific antigen, melanoma-associated antigen, mutated p53, mutated ras, HER2 / Neu, folate binding protein, GD2, CD123, CD33, CD138, CD23, CD30 , CD56, c-Met, mesothelin, GD3, HERV-K, IL- 11Ralpha, kappa chain, lambda chain, CSPG4, ERBB2, EGFRvIII or VEGFR2. In some specific aspects the antigen is GP240, 5T4, HER1, CD-33, CD-38, VEGFR-1, VEGFR-2, CEA, FGFR3, IGFBP2, IGF-1R, BAFF-R, TACI, APRIL, Fn14, ERBB2 or ERBB3

[0078] Antigens useful in the present disclosure may include those derived from viruses including, but not limited to, those from the family Arenaviridae (e.g., Lymphocytic choriomeningitis virus), Arterivirus (e.g., Equine arteritis virus), Astroviridae (Human astrovirus 1), Birnaviridae (e.g., Infectious pancreatic necrosis virus, Infectious bursal disease virus), Bunyaviridae (e.g., California encephalitis virus Group), Caliciviridae (e.g., Caliciviruses), Coronaviridae (e.g., Human coronaviruses 299E and OC43), Deltavirus (e.g., Hepatitis delta virus), Filoviridae (e.g., Marburg virus, Ebola virus), Flaviviridae (e.g., Yellow fever virus group, Hepatitis C virus), Hepadnaviridae (e.g., Hepatitis B virus), Herpesviridae (e.g., Epstein-Bar virus, Simplexvirus, Varicellovirus, Cytomegalovirus, Roseolovirus, Lymphocryptovirus, Rhadinovirus), Orthomyxoviridae (e.g., Influenzavirus A, B, and C), Papovaviridae (e.g., Papillomavirus), Paramyxoviridae (e.g., Paramyxovirus such-25- 4933-2629-4831, v.1as human parainfluenza virus 1, Morbillivirus such as Measles virus, Rubulavirus such as Mumps virus, Pneumovirus such as Human respiratory syncytial virus), Picornaviridae (e.g., Rhinovirus such as Human rhinovirus 1A, Hepatovirus such Human hepatitis A virus, Human poliovirus, Cardiovirus such as Encephalomyocarditis virus, Aphthovirus such as Foot-and- mouth disease virus O, Coxsackie virus), Poxyiridae (e.g., Orthopoxvirus such as Variola virus or monkey poxvirus), Reoviridae (e.g., Rotavirus such as Groups A-F rotaviruses), Retroviridae (Primate lentivirus group such as human immunodeficiency virus 1 and 2), Rhabdoviridae (e.g., rabies virus), Togaviridae (e.g., Rubivirus such as Rubella virus), Human T-cell leukemia virus, Murine leukemia virus, Vesicular stomatitis virus, Wart virus, Blue tongue virus, Sendai virus, Feline leukemia virus, Simian virus 40, Mouse mammary tumor virus, Dengue virus, HIV-1 and HIV-2, West Nile, H1N1, SARS, 1918 Influenza, Tick-borne encephalitis virus complex (Absettarov, Hanzalova, Hypr), Russian Spring- Summer encephalitis virus, Congo-Crimean Hemorrhagic Fever virus, Junin Virus, Kumlinge Virus, Marburg Virus, Machupo Virus, Kyasanur Forest Disease Virus, Lassa Virus, Omsk Hemorrhagic Fever Virus, FIV, SIV, Herpes simplex 1 and 2, Herpes Zoster, Human parvovirus (B19), Respiratory syncytial virus, Pox viruses (all types and serotypes), Coltivirus, Reoviruses—all types, and / or Rubivirus (rubella).

[0079] Antigens useful in the present disclosure may include those derived from bacteria including, but not limited to, Streptococcus agalactiae, Legionella pneumophilia, Streptococcus pyogenes, Escherichia coli, Neisseria gonorrhosae, Neisseria meningitidis, Pneumococcus, Hemophilis influenzae B, Treponema pallidum, Lyme disease spirochetes, Pseudomonas aeruginosa, Mycobacterium leprae, Brucella abortus, Mycobacterium tuberculosis, Plasmodium falciparum, Plasmodium vivax, Toxoplasma gondii, Trypanosoma rangeli, Trypanosoma cruzi, Trypanosoma rhodesiensei, Trypanosoma brucei, Schistosoma mansoni, Schistosoma japanicum, Babesia bovis, Elmeria tenella, Onchocerca volvulus, Leishmania tropica, Trichinella spiralis, Theileria parva, Taenia hydatigena, Taenia ovis, Taenia saginata, Echinococcus granulosus, Mesocestoides corti, Mycoplasma arthritidis, M. hyorhinis, M. orale, M. arginini, Acholeplasma laidlawii, M. salivarium, M. pneumoniae, Candida albicans, Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Aspergillus fumigatus, Penicillium marneffei, Bacillus anthracis, Bartonella, Bordetella pertussis, Brucella—all serotypes, Chlamydia trachomatis, Chlamydia pneumoniae, Clostridium botulinum—anything from clostridium serotypes, Haemophilus influenzae, Helicobacter pylori, Klebsiella—all serotypes, Legionella—all serotypes, Listeria,-26- 4933-2629-4831, v.1Mycobacterium—all serotypes, Mycoplasma—human and animal serotypes, Rickettsia—all serotypes, Shigella—all serotypes, Staphylococcus aureus, Streptococcus—S. pneumoniae, S. pyogenes, Vibrio cholera, Yersinia enterocolitica, and / or Yersinia pestis.

[0080] Antigens useful in the present disclosure may include those derived from parasites including, but not limited to, Ancylostomahuman hookworms, Leishmania—all strains, Microsporidium, Necator human hookworms, Onchocerca filarial worms, Plasmodium—all human strains and simian species, Toxoplasma—all strains, Trypanosoma—all serotypes, and / or Wuchereria bancrofti filarial worms. siRNA

[0081] As mentioned above, the present disclosure contemplates the use of one or more inhibitory nucleic acid for reducing expression and / or activation of a gene or gene product. Examples of an inhibitory nucleic acid include but are not limited to molecules targeted to an nucleic acid sequence, such as an siRNA (small interfering RNA), short hairpin RNA (shRNA), double-stranded RNA, an antisense oligonucleotide, a ribozyme and molecules targeted to a gene or gene product such as an aptamer.

[0082] An inhibitory nucleic acid may inhibit the transcription of a gene or prevent the translation of the gene transcript in a cell. An inhibitory nucleic acid may be from 16 to 1000 nucleotides long, and in certain embodiments from 18 to 100 nucleotides long.

[0083] Inhibitory nucleic acids are well known in the art. For example, siRNA, shRNA and double-stranded RNA have been described in U.S. Patents 6,506,559 and 6,573,099, as well as in U.S. Patent Publications 2003 / 0051263, 2003 / 0055020, 2004 / 0265839, 2002 / 0168707, 2003 / 0159161, and 2004 / 0064842, all of which are herein incorporated by reference in their entirety.

[0084] Since the discovery of RNAi by Fire and colleagues in 1998, the biochemical mechanisms have been rapidly characterized. Double stranded RNA (dsRNA) is cleaved by Dicer, which is an RNAase III family ribonuclease. This process yields siRNAs of ~21 nucleotides in length. These siRNAs are incorporated into a multiprotein RNA-induced silencing complex (RISC) that is guided to target mRNA. RISC cleaves the target mRNA in the middle of the complementary region. In mammalian cells, the related microRNAs (miRNAs) are found that are short RNA fragments (~22 nucleotides). miRNAs are generated-27- 4933-2629-4831, v.1after Dicer-mediated cleavage of longer (~70 nucleotide) precursors with imperfect hairpin RNA structures. The miRNA is incorporated into a miRNA-protein complex (miRNP), which leads to translational repression of target mRNA.

[0085] In designing a nucleic acid capable of generating an RNAi effect, there are several factors that need to be considered such as the nature of the siRNA, the durability of the silencing effect, and the choice of delivery system. To produce an RNAi effect, the siRNA that is introduced into the organism will typically contain exonic sequences. Furthermore, the RNAi process is homology dependent, so the sequences must be carefully selected so as to maximize gene specificity, while minimizing the possibility of cross- interference between homologous, but not gene-specific sequences. Particularly the siRNA exhibits greater than 80, 85, 90, 95, 98% or even 100% identity between the sequence of the siRNA and a portion of a EphA nucleotide sequence. Sequences less than about 80% identical to the target gene are substantially less effective. Thus, the greater identity between the siRNA and the gene to be inhibited, the less likely expression of unrelated genes will be affected.

[0086] In addition, the size of the siRNA is an important consideration. In some embodiments, the present disclosure relates to siRNA molecules that include at least about 19-25 nucleotides, and are able to modulate gene expression. In the context of the present disclosure, the siRNA is particularly less than 500, 200, 100, 50, 25, or 20 nucleotides in length. In some embodiments, the siRNA is from about 25 nucleotides to about 35 nucleotides or from about 19 nucleotides to about 25 nucleotides in length.

[0087] To improve the effectiveness of siRNA-mediated gene silencing, guidelines for selection of target sites on mRNA have been developed for optimal design of siRNA (Soutschek et al., 2004; Wadhwa et al., 2004). These strategies may allow for rational approaches for selecting siRNA sequences to achieve maximal gene knockdown. To facilitate the entry of siRNA into cells and tissues, a variety of vectors including plasmids and viral vectors such as adenovirus, lentivirus, and retrovirus have been used (Wadhwa et al., 2004).

[0088] Within an inhibitory nucleic acid, the components of a nucleic acid need not be of the same type or homogenous throughout (e.g., an inhibitory nucleic acid may comprise a nucleotide and a nucleic acid or nucleotide analog). Typically, an inhibitory nucleic acid-28- 4933-2629-4831, v.1form a double-stranded structure; the double-stranded structure may result from two separate nucleic acids that are partially or completely complementary. In certain embodiments of the present disclosure, the inhibitory nucleic acid may comprise only a single nucleic acid (polynucleotide) or nucleic acid analog and form a double-stranded structure by complementing with itself (e.g., forming a hairpin loop). The double-stranded structure of the inhibitory nucleic acid may comprise 16-500 or more contiguous nucleobases, including all ranges derivable thereof. The inhibitory nucleic acid may comprise 17 to 35 contiguous nucleobases, more particularly 18 to 30 contiguous nucleobases, more particularly 19 to 25 nucleobases, more particularly 20 to 23 contiguous nucleobases, or 20 to 22 contiguous nucleobases, or 21 contiguous nucleobases that hybridize with a complementary nucleic acid (which may be another part of the same nucleic acid or a separate complementary nucleic acid) to form a double-stranded structure.

[0089] siRNA can be obtained from commercial sources, natural sources, or can be synthesized using any of a number of techniques well-known to those of ordinary skill in the art. For example, commercial sources of predesigned siRNA include Invitrogen’s StealthTM Select technology (Carlsbad, CA), Ambion®(Austin, TX), and Qiagen® (Valencia, CA). An inhibitory nucleic acid that can be applied in the compositions and methods of the present disclosure may be any nucleic acid sequence that has been found by any source to be a validated downregulator of the gene or gene product.

[0090] In some embodiments, the disclosure features an isolated siRNA molecule of at least 19 nucleotides, having at least one strand that is substantially complementary to at least ten but no more than thirty consecutive nucleotides of a nucleic acid that encodes a gene, and that reduces the expression of a gene or gene product. In one embodiments of the present disclosure, the siRNA molecule has at least one strand that is substantially complementary to at least ten but no more than thirty consecutive nucleotides of the mRNA that encodes a gene or a gene product.

[0091] In one embodiments, the siRNA molecule is at least 75, 80, 85, or 90% homologous, particularly at least 95%, 99%, or 100% similar or identical, or any percentages in between the foregoing (e.g., the disclosure contemplates 75% and greater, 80% and greater, 85% and greater, and so on, and said ranges are intended to include all whole numbers in between), to at least 10 contiguous nucleotides of any of the nucleic acid sequences encoding a target therapeutic protein.-29- 4933-2629-4831, v.1

[0092] The siRNA may also comprise an alteration of one or more nucleotides. Such alterations can include the addition of non-nucleotide material, such as to the end(s) of the 19 to 25 nucleotide RNA or internally (at one or more nucleotides of the RNA). In certain aspects, the RNA molecule contains a 3'-hydroxyl group. Nucleotides in the RNA molecules of the present disclosure can also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. The double-stranded oligonucleotide may contain a modified backbone, for example, phosphorothioate, phosphorodithioate, or other modified backbones known in the art, or may contain non-natural internucleoside linkages. Additional modifications of siRNAs (e.g., 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, “universal base” nucleotides, 5-C-methyl nucleotides, one or more phosphorothioate internucleotide linkages, and inverted deoxyabasic residue incorporation) can be found in U.S. Publication 2004 / 0019001 and U.S. Patent 6,673,611 (each of which is incorporated by reference in its entirety). Collectively, all such altered nucleic acids or RNAs described above are referred to as modified siRNAs.

[0093] In one embodiment, siRNA is capable of decreasing the expression of a particular genetic product by at least 10%, at least 20%, at least 30%, or at least 40%, at least 50%, at least 60%, or at least 70%, at least 75%, at least 80%, at least 90%, at least 95% or more or any ranges in between the foregoing. II. Pharmaceutical Formulations and Routes of Administration

[0094] In another aspect, for administration to a patient in need of such treatment, pharmaceutical formulations (also referred to as a pharmaceutical preparations, pharmaceutical compositions, pharmaceutical products, medicinal products, medicines, medications, or medicaments) comprise a therapeutically effective amount of a compound disclosed herein formulated with one or more excipients and / or drug carriers appropriate to the indicated route of administration. In some embodiments, the compounds disclosed herein are formulated in a manner amenable for the treatment of human and / or veterinary patients. In some embodiments, formulation comprises admixing or combining one or more of the compounds disclosed herein with one or more of the following excipients: lactose, sucrose, starch powder, cellulose esters of alkanoic acids, cellulose alkyl esters, talc, stearic acid, magnesium stearate, magnesium oxide, sodium and calcium salts of phosphoric and sulfuric acids, gelatin, acacia, sodium alginate, polyvinylpyrrolidone, and / or polyvinyl alcohol. In some embodiments, e.g., for oral administration, the pharmaceutical formulation may be-30- 4933-2629-4831, v.1tableted or encapsulated. In some embodiments, the compounds may be dissolved or slurried in water, polyethylene glycol, propylene glycol, ethanol, corn oil, cottonseed oil, peanut oil, sesame oil, benzyl alcohol, sodium chloride, and / or various buffers. In some embodiments, the pharmaceutical formulations may be subjected to pharmaceutical operations, such as sterilization, and / or may contain drug carriers and / or excipients such as preservatives, stabilizers, wetting agents, emulsifiers, encapsulating agents such as lipids, dendrimers, polymers, proteins such as albumin, nucleic acids, and buffers.

[0095] Pharmaceutical formulations may be administered by a variety of methods, e.g., orally or by injection (e.g. subcutaneous, intravenous, and intraperitoneal). Depending on the route of administration, the compounds disclosed herein may be coated in a material to protect the compound from the action of acids and other natural conditions which may inactivate the compound. To administer the active compound by other than parenteral administration, it may be necessary to coat the compound with, or co-administer the compound with, a material to prevent its inactivation. In some embodiments, the active compound may be administered to a patient in an appropriate carrier, for example, liposomes, or a diluent. Pharmaceutically acceptable diluents include saline and aqueous buffer solutions. Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes.

[0096] The compounds disclosed herein may also be administered parenterally, intraperitoneally, intraspinally, or intracerebrally. Dispersions can be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.

[0097] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (such as, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens,-31- 4933-2629-4831, v.1chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.

[0098] The compounds disclosed herein can be administered orally, for example, with an inert diluent or an assimilable edible carrier. The compounds and other ingredients may also be enclosed in a hard or soft-shell gelatin capsule, compressed into tablets, or incorporated directly into the patient’s diet. For oral therapeutic administration, the compounds disclosed herein may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. The percentage of the therapeutic compound in the compositions and preparations may, of course, be varied. The amount of the therapeutic compound in such pharmaceutical formulations is such that a suitable dosage will be obtained.

[0099] The therapeutic compound may also be administered topically to the skin, eye, ear, or mucosal membranes. Administration of the therapeutic compound topically may include formulations of the compounds as a topical solution, lotion, cream, ointment, gel, foam, transdermal patch, or tincture. When the therapeutic compound is formulated for topical administration, the compound may be combined with one or more agents that increase the permeability of the compound through the tissue to which it is administered. In other embodiments, it is contemplated that the topical administration is administered to the eye. Such administration may be applied to the surface of the cornea, conjunctiva, or sclera. Without wishing to be bound by any theory, it is believed that administration to the surface of the eye allows the therapeutic compound to reach the posterior portion of the eye. Ophthalmic topical administration can be formulated as a solution, suspension, ointment, gel, or emulsion. Finally, topical administration may also include administration to the mucosa membranes such as the inside of the mouth. Such administration can be directly to a particular location within the mucosal membrane such as a tooth, a sore, or an ulcer. Alternatively, if local delivery to the lungs is desired the therapeutic compound may be administered by inhalation in a dry-powder or aerosol formulation.

[0100] In some embodiments, it may be advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.-32- 4933-2629-4831, v.1Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. In some embodiments, the specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such a therapeutic compound for the treatment of a selected condition in a patient. In some embodiments, active compounds are administered at a therapeutically effective dosage sufficient to treat a condition associated with a condition in a patient. For example, the efficacy of a compound can be evaluated in an animal model system that may be predictive of efficacy in treating the disease in a human or another animal.

[0101] In some embodiments, the effective dose range for the therapeutic compound can be extrapolated from effective doses determined in animal studies for a variety of different animals. In some embodiments, the human equivalent dose (HED) in mg / kg can be calculated in accordance with the following formula (see, e.g., Reagan-Shaw et al., FASEB J., 22(3):659-661, 2008, which is incorporated herein by reference): HED (mg / kg) = Animal dose (mg / kg) × (Animal Km / Human Km)

[0102] Use of the Km factors in conversion results in HED values based on body surface area (BSA) rather than only on body mass. Km values for humans and various animals are well known. For example, the Km for an average 60 kg human (with a BSA of 1.6 m2) is 37, whereas a 20 kg child (BSA 0.8 m2) would have a Km of 25. Km for some relevant animal models are also well known, including: mice Km of 3 (given a weight of 0.02 kg and BSA of 0.007); hamster Km of 5 (given a weight of 0.08 kg and BSA of 0.02); rat Km of 6 (given a weight of 0.15 kg and BSA of 0.025) and monkey Km of 12 (given a weight of 3 kg and BSA of 0.24).

[0103] Precise amounts of the therapeutic composition depend on the judgment of the practitioner and are specific to each individual. Nonetheless, a calculated HED dose provides a general guide. Other factors affecting the dose include the physical and clinical state of the patient, the route of administration, the intended goal of treatment and the potency, stability and toxicity of the particular therapeutic formulation.-33- 4933-2629-4831, v.1

[0104] The actual dosage amount of a compound of the present disclosure or composition comprising a compound of the present disclosure administered to a patient may be determined by physical and physiological factors such as type of animal treated, age, sex, body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. These factors may be determined by a skilled artisan. The practitioner responsible for administration will typically determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual patient. The dosage may be adjusted by the individual physician in the event of any complication.

[0105] In some embodiments, the therapeutically effective amount typically will vary from about 0.001 mg / kg to about 1000 mg / kg, from about 0.01 mg / kg to about 750 mg / kg, from about 100 mg / kg to about 500 mg / kg, from about 1 mg / kg to about 250 mg / kg, from about 10 mg / kg to about 150 mg / kg in one or more dose administrations daily, for one or several days (depending of course of the mode of administration and the factors discussed above). Other suitable dose ranges include 1 mg to 10,000 mg per day, 100 mg to 10,000 mg per day, 500 mg to 10,000 mg per day, and 500 mg to 1,000 mg per day. In some embodiments, the amount is less than 10,000 mg per day with a range of 750 mg to 9,000 mg per day.

[0106] In some embodiments, the amount of the active compound in the pharmaceutical formulation is from about 2 to about 75 weight percent. In some of these embodiments, the amount if from about 25 to about 60 weight percent.

[0107] Single or multiple doses of the agents are contemplated. Desired time intervals for delivery of multiple doses can be determined by one of ordinary skill in the art employing no more than routine experimentation. As an example, patients may be administered two doses daily at approximately 12-hour intervals. In some embodiments, the agent is administered once a day.

[0108] The agent(s) may be administered on a routine schedule. As used herein a routine schedule refers to a predetermined designated period of time. The routine schedule may encompass periods of time which are identical, or which differ in length, as long as the schedule is predetermined. For instance, the routine schedule may involve administration twice a day, every day, every two days, every three days, every four days,-34- 4933-2629-4831, v.1every five days, every six days, a weekly basis, a monthly basis or any set number of days or weeks there-between. Alternatively, the predetermined routine schedule may involve administration on a twice daily basis for the first week, followed by a daily basis for several months, etc. In other embodiments, the invention provides that the agent(s) may be taken orally and that the timing of which is or is not dependent upon food intake. Thus, for example, the agent can be taken every morning and / or every evening, regardless of when the patient has eaten or will eat. III. Definitions

[0109] In this disclosure, the use of the singular includes the plural, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” As used herein “another” may mean at least a second or more. As used herein, “or” means “and / or”, unless specifically stated otherwise.

[0110] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”), or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. For example, any method that “comprises,” “has” or “includes” one or more steps is not limited to possessing only those one or more steps and also covers other unlisted steps.

[0111] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated herein by reference in their entirety for any purpose. In the event that one or more of the incorporated literature and similar materials defines a term in a manner that contradicts the definition of that term in this application, this application controls.

[0112] All the compounds of the present invention may in some embodiments be used for the prevention and treatment of one or more diseases or disorders discussed herein or otherwise. In some embodiments, one or more of the compounds characterized or-35- 4933-2629-4831, v.1exemplified herein as an intermediate, a metabolite, and / or prodrug, may nevertheless also be useful for the prevention and treatment of one or more diseases or disorders. As such unless explicitly stated to the contrary, all the compounds of the present invention are deemed “active compounds” and “therapeutic compounds” that are contemplated for use as active pharmaceutical ingredients (APIs). Actual suitability for human or veterinary use is typically determined using a combination of clinical trial protocols and regulatory procedures, such as those administered by the Food and Drug Administration (FDA). In the United States, the FDA is responsible for protecting the public health by assuring the safety, effectiveness, quality, and security of human and veterinary drugs, vaccines and other biological products, and medical devices.

[0113] In some embodiments, the compounds of the present invention have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, more metabolically stable than, more lipophilic than, more hydrophilic than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.

[0114] In some embodiments, compounds of the present invention function as prodrugs or can be derivatized to function as prodrugs. Since prodrugs are known to enhance numerous desirable qualities of pharmaceuticals (e.g., solubility, bioavailability, manufacturing, etc.), the compounds employed in some methods of the invention may, if desired, be delivered in prodrug form. Thus, the invention contemplates prodrugs of compounds of the present invention as well as methods of delivering prodrugs. Prodrugs of the compounds employed in the invention may be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Accordingly, prodrugs include, for example, compounds described herein in which a hydroxy, amino, or carboxy group is bonded to any group that, when the prodrug is administered to a patient, cleaves to form a hydroxy, amino, or carboxylic acid, respectively. For example, a compound comprising a hydroxy group may be administered as an ester that is converted by hydrolysis in vivo to the hydroxy compound. Non-limiting examples of suitable esters that may be converted in vivo into hydroxy compounds include acetates, citrates, lactates, phosphates, tartrates, malonates,-36- 4933-2629-4831, v.1oxalates, salicylates, propionates, succinates, fumarates, maleates, methylene-bis hydroxynaphthoate, gentisates, isethionates, di-p-toluoyltartrates, methane¬sulfonates, ethanesulfonates, benzenesulfonates, p toluenesulfonates, cyclohexyl-sulfamates, quinates, and esters of amino acids. Similarly, a compound comprising an amine group may be administered as an amide that is converted by hydrolysis in vivo to the amine compound.

[0115] In some embodiments, compounds of the present invention exist in salt or non-salt form. With regard to the salt form(s), in some embodiments the particular anion or cation forming a part of any salt form of a compound provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference.

[0116] It will be appreciated that many organic compounds can form complexes with solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as “solvates.” Where the solvent is water, the complex is known as a “hydrate.” It will also be appreciated that many organic compounds can exist in more than one solid form, including crystalline and amorphous forms. All solid forms of the compounds provided herein, including any solvates thereof are within the scope of the present invention.

[0117] As used herein, the terms “drug”, “pharmaceutical”, “therapeutic agent”, and “therapeutically active agent” are used interchangeably to represent a compound which invokes a therapeutic or pharmacological effect in a human or animal and is used to treat a disease, disorder, or other condition. In some embodiments, these compounds have undergone and received regulatory approval for administration to a living creature.

[0118] An “active ingredient” (AI) or active pharmaceutical ingredient (API) (also referred to as an active compound, active substance, active agent, pharmaceutical agent, agent, biologically active molecule, or a therapeutic compound) is the ingredient in a pharmaceutical drug that is biologically active.

[0119] The term “effective,” as that term is used in the specification and / or claims, means adequate to accomplish a desired, expected, or intended result. “Effective amount,” “Therapeutically effective amount” or “pharmaceutically effective amount” when used in the-37- 4933-2629-4831, v.1context of treating a patient or subject with a compound means that amount of the compound which, when administered to the patient or subject, is sufficient to effect such treatment or prevention of the disease as those terms are defined below.

[0120] An “excipient” is a pharmaceutically acceptable substance formulated along with the active ingredient(s) of a medication, pharmaceutical composition, formulation, or drug delivery system. Excipients may be used, for example, to stabilize the composition, to bulk up the composition (thus often referred to as “bulking agents,” “fillers,” or “diluents” when used for this purpose), or to confer a therapeutic enhancement on the active ingredient in the final dosage form, such as facilitating drug absorption, reducing viscosity, or enhancing solubility. Excipients include pharmaceutically acceptable versions of antiadherents, binders, coatings, colors, disintegrants, flavors, glidants, lubricants, preservatives, sorbents, sweeteners, and vehicles. The main excipient that serves as a medium for conveying the active ingredient is usually called the vehicle. Excipients may also be used in the manufacturing process, for example, to aid in the handling of the active substance, such as by facilitating powder flowability or non-stick properties, in addition to aiding in vitro stability such as prevention of denaturation or aggregation over the expected shelf life. The suitability of an excipient will typically vary depending on the route of administration, the dosage form, the active ingredient, as well as other factors.

[0121] The term “hydrate” when used as a modifier to a compound means that the compound has less than one (e.g., hemihydrate), one (e.g., monohydrate), or more than one (e.g., dihydrate) water molecules associated with each compound molecule, such as in solid forms of the compound.

[0122] As used herein, the term “IC50” refers to an inhibitory dose which is 50% of the maximum response obtained. This quantitative measure indicates how much of a particular drug or other substance (inhibitor) is needed to inhibit a given biological, biochemical or chemical process (or component of a process, i.e. an enzyme, cell, cell receptor or microorganism) by half.

[0123] As used herein, the term “patient” or “subject” refers to a living mammalian organism, such as a human, monkey, cow, sheep, goat, dog, cat, mouse, rat, guinea pig, or transgenic species thereof. In certain embodiments, the patient or subject is a primate. Non- limiting examples of human patients are adults, juveniles, infants and fetuses.-38- 4933-2629-4831, v.1

[0124] As generally used herein “pharmaceutically acceptable” refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and / or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.

[0125] “Pharmaceutically acceptable salts” means salts of compounds disclosed herein which are pharmaceutically acceptable, as defined above, and which possess the desired pharmacological activity. Such salts include acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or with organic acids such as 1,2 ethanedisulfonic acid, 2 hydroxyethanesulfonic acid, 2 naphthalenesulfonic acid, 3 phenylpropionic acid, 4,4′ methylenebis(3 hydroxy 2 ene-1 carboxylic acid), 4 methylbicyclo[2.2.2]oct 2 ene-1 carboxylic acid, acetic acid, aliphatic mono- and dicarboxylic acids, aliphatic sulfuric acids, aromatic sulfuric acids, benzenesulfonic acid, benzoic acid, camphorsulfonic acid, carbonic acid, cinnamic acid, citric acid, cyclopentanepropionic acid, ethanesulfonic acid, fumaric acid, glucoheptonic acid, gluconic acid, glutamic acid, glycolic acid, heptanoic acid, hexanoic acid, hydroxynaphthoic acid, lactic acid, laurylsulfuric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, muconic acid, o (4 hydroxybenzoyl)benzoic acid, oxalic acid, p chlorobenzenesulfonic acid, phenyl-substituted alkanoic acids, propionic acid, p toluenesulfonic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, tartaric acid, tertiarybutylacetic acid, trimethylacetic acid, and the like. Pharmaceutically acceptable salts also include base addition salts which may be formed when acidic protons present are capable of reacting with inorganic or organic bases. Acceptable inorganic bases include sodium hydroxide, sodium carbonate, potassium hydroxide, aluminum hydroxide and calcium hydroxide. Acceptable organic bases include ethanolamine, diethanolamine, triethanolamine, tromethamine, N methylglucamine and the like. It should be recognized that the particular anion or cation forming a part of any salt of this invention is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (P. H. Stahl & C. G. Wermuth eds., Verlag Helvetica Chimica Acta, 2002).-39- 4933-2629-4831, v.1

[0126] A “pharmaceutically acceptable carrier,” “drug carrier,” or simply “carrier” is a pharmaceutically acceptable substance formulated along with the active ingredient medication that is involved in carrying, delivering and / or transporting a chemical agent. Drug carriers may be used to improve the delivery and the effectiveness of drugs, including for example, controlled-release technology to modulate drug bioavailability, decrease drug metabolism, and / or reduce drug toxicity. Some drug carriers may increase the effectiveness of drug delivery to the specific target sites. Examples of carriers include: liposomes, microspheres (e.g., made of poly(lactic-co-glycolic) acid), albumin microspheres, synthetic polymers, nanofibers, protein-DNA complexes, protein conjugates, erythrocytes, virosomes, and dendrimers.

[0127] A “pharmaceutical drug” (also referred to as a pharmaceutical, pharmaceutical preparation, pharmaceutical composition, pharmaceutical formulation, pharmaceutical product, medicinal product, medicine, medication, medicament, or simply a drug, agent, or preparation) is a composition used to diagnose, cure, treat, or prevent disease, which comprises an active pharmaceutical ingredient (API) (defined above) and optionally contains one or more inactive ingredients, which are also referred to as excipients (defined above).

[0128] The term “identity” refers to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. “Percent identity” means the percent of identical residues between the amino acids or nucleotides in the compared molecules and is calculated based on the size of the smallest of the molecules being compared. For these calculations, gaps in alignments (if any) are preferably addressed by a particular mathematical model or computer program (i.e., an “algorithm”). Methods that can be used to calculate the identity of the aligned nucleic acids or polypeptides include those described in Computational Molecular Biology, (Lesk, A. M., ed.), 1988, New York: Oxford University Press; Biocomputing Informatics and Genome Projects, (Smith, D. W., ed.), 1993, New York: Academic Press; Computer Analysis of Sequence Data, Part I, (Griffin, A. M., and Griffin, H. G., eds.), 1994, New Jersey: Humana Press; von Heinje, G., 1987, Sequence Analysis in Molecular Biology, New York: Academic Press; Sequence Analysis Primer, (Gribskov, M. and Devereux, J., eds.), 1991, New York: M. Stockton Press; and Carillo et al., 1988, SIAM J. Applied Math.48:1073.-40- 4933-2629-4831, v.1

[0129] In calculating percent identity, the sequences being compared are typically aligned in a way that gives the largest match between the sequences. One example of a computer program that can be used to determine percent identity is the GCG program package, which includes GAP (Devereux et al., 1984, Nucl. Acid Res.12:387; Genetics Computer Group, University of Wisconsin, Madison, Wis.). The computer algorithm GAP is used to align the two polypeptides or polynucleotides for which the percent sequence identity is to be determined. The sequences are aligned for optimal matching of their respective amino acid or nucleotide (the “matched span”, as determined by the algorithm). A gap opening penalty (which is calculated as 3× the average diagonal, wherein the “average diagonal” is the average of the diagonal of the comparison matrix being used; the “diagonal” is the score or number assigned to each perfect amino acid match by the particular comparison matrix) and a gap extension penalty (which is usually 1 / 10 times the gap opening penalty), as well as a comparison matrix such as PAM 250 or BLOSUM 62 are used in conjunction with the algorithm. In certain embodiments, a standard comparison matrix (see, Dayhoff et al., 1978, Atlas of Protein Sequence and Structure 5:345-352 for the PAM 250 comparison matrix; Henikoff et al., 1992, Proc. Natl. Acad. Sci. U.S.A.89:10915-10919 for the BLOSUM 62 comparison matrix) is also used by the algorithm.

[0130] Examples of parameters that can be employed in determining percent identity for polypeptides or nucleotide sequences using the GAP program can be found in Needleman et al., 1970, J. Mol. Biol.48:443-453.

[0131] Certain alignment schemes for aligning two amino acid sequences may result in matching of only a short region of the two sequences, and this small aligned region may have very high sequence identity even though there is no significant relationship between the two full-length sequences. Accordingly, the selected alignment method (GAP program) can be adjusted if so desired to result in an alignment that spans at 50 or fewer of contiguous amino acids of the target peptide or polypeptide.

[0132] As used in this specification, the term “significant” (and any form of significant such as “significantly”) is not meant to imply statistical differences between two values but only to imply importance or the scope of difference of the parameter.

[0133] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to-41- 4933-2629-4831, v.1determine the value, or the variation that exists among the study subjects or experimental studies. Unless another definition is applicable, the term “about” refers to ±10% of the indicated value.

[0134] As used herein, the term “substantially free of” or “substantially free” in terms of a specified component, is used herein to mean that none of the specified component has been purposefully formulated into a composition and / or is present only as a contaminant or in trace amounts. The total amount of all containments, by-products, and other material is present in that composition in an amount less than 2%. The term “more substantially free of” or “more substantially free” is used to represent that the composition contains less than 1% of the specific component. The term “essentially free of” or “essentially free” contains less than 0.5% of the specific component.

[0135] As used herein, “Treatment” or “treating” includes (1) inhibiting a disease in a subject or patient experiencing or displaying the pathology or symptomatology of the disease (e.g., arresting further development of the pathology and / or symptomatology), (2) ameliorating a disease in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease (e.g., reversing the pathology and / or symptomatology), and / or (3) effecting any measurable decrease in a disease or symptom thereof in a subject or patient that is experiencing or displaying the pathology or symptomatology of the disease.

[0136] As used herein, and unless otherwise indicated, the terms “prevent,” “preventing,” and “prevention” includes: (1) inhibiting the onset of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease, and / or (2) slowing the onset of the pathology or symptomatology of a disease in a subject or patient which may be at risk and / or predisposed to the disease but does not yet experience or display any or all of the pathology or symptomatology of the disease.

[0137] The term “unit dose” refers to a formulation of the compound or composition such that the formulation is prepared in a manner sufficient to provide a single therapeutically effective dose of the active ingredient to a patient in a single administration. Such unit dose formulations that may be used include but are not limited to a single tablet, capsule, or other oral formulations, a single vial with a syringeable liquid or other injectable formulations, or a dose that is formulated for administration in a single inhalation.-42- 4933-2629-4831, v.1

[0138] As used herein, the term “nanoparticle” has its customary and ordinary definition and refers to discrete particles which behave as a whole unit rather than as individual molecules within the particle. A nanoparticle may have a size from about 1 to about 10,000 nm with ultrafine nanoparticles having a size from 1 nm to 100 nm, fine particles having a size from 100 nm to 2,500 nm, and coarse particles having a size from 2,500 nm to 10,000 nm. In some embodiments, the nanoaggregates described herein may comprise a composition of multiple nanoparticles and have a size from about 10 nm to about 100 µm.

[0139] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements and parameters.-43- 4933-2629-4831, v.1IV. Examples

[0140] To facilitate a better understanding of the present disclosure, the following examples of specific embodiments are given. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure. In no way should the following examples be read to limit or define the entire scope of the disclosure. Example 1: Preparation of LNP for Delivery of Base Editing Compositions i. Results

[0141] Experiments were conducted to test the editing capacity of B-1 LNPs in mice lungs. Therefore, B-1 LNPs (SM-102:DPPC:Cholesterol:DMPE-PEG 45:20:34:1) were formulated to encapsulate Cas9 mRNA and an end-modified sgRNA targeted to sgPTEN (Cheng et al., 2020) (FIG. 1A). The Cas9 machinery will be targeted to the PTEN locus in the genome and cause double-stranded breaks in the DNA 3 base pairs away from the PAM sequence. The DNA will subsequently be repaired by the non-homologous end joining pathway and therefore contain indels. The presence of indels indicates successful editing.

[0142] B-1 LNPs were delivered to mice intratracheally 3× total over a period of five days (FIG. 1B). Eight days after the last dose, lungs were harvested and whole lung lysate was evaluated for editing of PTEN through NGS. Both lungs showed the presence of indels compared to PBS (FIG.1C) (0.3% and 0.4%, respectively).

[0143] To repurpose B-1 to treat CF, the LNPs were formulated with an ABE8.20 base editor and a sgRNA (Krishnamurthy et al., 2021) targeted to the CF-causing W1282X mutation (FIG. 2A). The W1282X mutation which results from a one base pair substitution (G^A). This causes a premature stop codon ‘TGA’ during translation instead of a tryptophan codon ‘TGG’ that occurs in wild-type CFTR. The adenine base editor ABE8.20 has the potential to address this edit by reverting adenines back to guanines within a ~4-8 base pair window away from the PAM sequence. While this works the most efficiently at the adenine-44- 4933-2629-4831, v.1closest to the PAM (A6with reference to the sgRNA), ABE8.20 also has the potential to edit the adenine directly downstream (A7).

[0144] The formulation was delivered to FRT cells harboring the humanized cDNA CFTR gene containing the W1282X mutation. After achieving minimal editing, LNPs were screened for LNPs with a higher efficiency. An analog of cholesterol, β-sitosterol, demonstrates enhanced endosomal escape and could therefore improve upon the editing efficiency in FRT cells (Patel et al., 2020). To test this hypothesis, cholesterol in the B-1 LNP was substituted with β-sitosterol (SM-102:DPPC:β-sitosterol:DMPE-PEG 45:20:34:1) to deliver the base editor and sgRNA (B-1-1 BE).

[0145] Additionally, further experimentation sought to decrease the amount of bystander editing in the initial B-1-1 formulation by encapsulating a prime editor (PE4) and pegRNA (FIG. 2B). The pegRNA has the capacity to encode for editing of A6^ G while avoiding bystander mutation of A7. The pegRNA was designed usingsoftware (Hsu et al., 2021) to select the optimal conditions, and the sequence was further modified to include a 3′ motif for increased stability (Nelson et al., 2022). B-1-1 was formulated to encapsulate the PEmax prime editor and lead candidate pegRNA (B-1-1 PE).

[0146] B-1-1 BE and B-1-1 PE were delivered before and after aerosolization while delivering B-1 BE and B-1 EGFP (encapsulated EGFP mRNA) as negative controls to W1282X FRT cells (FIG. 2C). After 60 hours, the cells were harvested to assess the editing capacity. Before aerosolization, B-1-1 BE showed an average of 58.67% editing of the intended adenine (A6) with 36.33% editing of the bystander adenine (A7) (FIG. 2E). After aerosolization, B-1-1 showed an average of 22% editing of the intended adenine with 0% bystander editing. While B-1-1 BE is able to achieve editing after aerosolization, there is a significant loss of efficiency. Additionally, the lack of bystander editing after aerosolization in contrast with its significant presence before aerosolization indicate that dosage or base editor fidelity may play a role. B-1-1 PE, on the other hand, showed no editing. Therefore, further screening of pegRNAs is required to achieve prime editing. ii. Discussion

[0147] B-1 mediates editing after delivery of Cas9 components to mouse lungs. Although the editing efficiency in the lung is low for B-1, candidates with low efficiency in whole lung lysates have shown promising results in primary lung cells with Cas9.-45- 4933-2629-4831, v.1Additionally, previous work with B-1 shows its transfection of the clinically relevant epithelial cells (Lewis et al., 2023). As there are many other cell types in the lung (endothelial, stromal, immune, epithelial), the editing data in whole lung lysates coupled with the cell type data highlights the promise of B-1 for editing in the lungs.

[0148] Although the formulation can edit mouse lung cells, B-1 fails to produce editing while delivering adenine base editing components to FRT cells. To build upon this formulation, the substitution of β-sitosterol for cholesterol allows for significant editing of W1282X FRTs before and after aerosolization. Without wishing to be bound by any theory, it is believed that the substitution of cholesterol in B-1 with β-sitosterol in B-1-1 increased the endosomal escape (Patel et al., 2020). Therefore, B-1-1 may increase the copy number of base editors and sgRNAs available in the cell cytoplasm. Uptake studies analyzing the colocalization of fluorescently tagged mRNA and markers of the endosomal pathway would provide a better understanding of the differences between B-1 and B-1-1. iii. Materials and Methods a. In vitro transcription and sgRNAs

[0149] The pCMV-T7-ABE8.20m-nSpCas9-NG-P2A-EGFP (KAC1164) plasmid was a gift from Benjamin Kleinstiver (Addgene plasmid #185919). The ABE8.20 plasmid was digested with AgeI for 30 mins at 37°C to linearize the construct. After digestion, IVT was performed as previously described (Lewis et al., 2023). Briefly, the construct was transcribed with the T7 enzyme, enzymatically capped with Cap1, and polyadenylated. Products were validated through gel electrophoresis on a denaturing RNA gel.

[0150] The pCMV-PEmax-P2A-hMLH1dn was a gift from David Liu (Addgene plasmid #174828). PE-max-P2A-hMLH1dn construct was amplified with a Q5 polymerase with the forward primer (5′ GCGGCCGCTAATACGACTCACTATAGG 3′) (Seq. ID 1) and a reverse primer (5′ GAGGCTGATCAGCGGGTTTAAAC 3′) (Seq. ID 2) for 35 cycles with an extension time of 3 mins and an annealing temperature of 69°C. The amplicon then underwent IVT as described for the base editor.

[0151] The sgRNA for PTEN (AGAUCGUUAGCAGAAACAAA) (Seq. ID 3) and the sgRNA for W1282X (CAGUGAAGGAAAGCCUUUGG) (Seq. ID 4) were purchased from Synthego with 2′-O-Methyl at 3 first and last bases and 3′ phosphorothioate bonds between first 3 and last 2 bases. The epegRNA for W1282X-46- 4933-2629-4831, v.1(CAAUAACUUUGCAACAGUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAA GGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCAGGCUUUCC UCCACUGUUGCAAAGUUCGCGGUUCUAUCUAGUUACGCGUUAAACCAACUAGA A) (Seq. ID 5) was purchased from IDT with the same modifications. b. Lipids

[0152] SM-102 (N-1102) was purchased from Echelon Biosciences, DPPC (850355P) was purchased from Avanti Polar Lipids, cholesterol (C8667) was purchased from Sigma Aldrich, β-sitosterol (HY-N0171A) was purchased from MedChemExpress, and DMPE-PEG (SUNBRIGHT PM-020CN) was purchased from NOF America. c. Lipid nanoparticle formulation

[0153] LNPs were formulated as previously described (Lewis et al., 2023). Briefly, the mRNA was diluted into 50 mM sodium citrate (pH = 3.0) and the lipids were diluted into 100% EtOH. The mRNA and lipid phases were mixed at a 3:1 ratio using a NanoAssemblr for LNP formulation. For the in vivo experiment, the formulating concentration was 50 ng / uL of total mRNA (including both the Cas9 and sgRNA). The weight ratio of Cas9 to sgRNA was 4:1. For the FRT experiments, the formulating concentration was 40 ng / µL of total mRNA (including both base or prime editors and respective sgRNA or pegRNA). The weight ratio of base and prime editors to sgRNA and pegRNA were 1:1. All LNPs were formulated with an N / P ratio of 5.67. After formulation, LNPs were dialyzed overnight in 1× PBS at 4°C. Following dialysis, all formulations were concentrated back to the original formulation volume using 10 kDa MWCO Amicon filters (Millipore Sigma, UFC8010) by centrifugation at 4°C at 5000xg. d. Aerosolization

[0154] LNPs were aerosolized with an Aerogen Solo nebulizer. After aerosolization, mist was collected in a 1.5 mL Eppendorf tube for subsequent studies. e. Cell Culture

[0155] W1282X FRTs are FRT cells harboring the humanized cDNA version of CFTR that was inserted using Flp-In™ technology (Cell Model Resources). W1282X FRTs were cultured with Ham’s F-12, Coon's Modification (Sigma, F6636) with 5% FBS and 100 μg / ml Hygromycin B (ThermoFisher, 10687010). Cells were cultured in T75 flasks and were-47- 4933-2629-4831, v.1passaged using incubation with Trypsin-EDTA (0.25%) (ThermoFisher, 25200056) for 10 mins at 37°C. f. Cell harvesting for gene editing analysis

[0156] W1282X FRT cells were seeded at 75,000 cells per well into 24-well plates. LNPs, both non-aerosolized and aerosolized, were dosed at 1.5 µg per well and were added directly to the cell media. Plates were swirled to mix. After 60 hours, the genomic DNA was extracted using the PureLink Genomic DNA Mini Kit per the manufacturer’s instructions. Before DNA extraction, the cells were washed with PBS and subsequently incubated for 10 mins at 37°C with trypsin. The cells were then transferred to a 1.5 mL Eppendorf tube and washed twice with PBS. Purified genomic extracts were amplified with a Q5 polymerase with the forward primer (5′ GAGAATTCACACGTGAAG 3′) (Seq. ID 6) and the reverse primer (5′ CACAAGGACAAAGTCAAG 3′) (Seq. ID 7) for 35 cycles. Following PCR, amplicons were purified using the QIAquick PCR Purification Kit per manufacturer’s instructions. Sequencing was performed with the forward primer at Eurofins. *-*-*-*-*

[0157] All of the compositionsdisclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.-48- 4933-2629-4831, v.1REFERENCES

[0139] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. Akinc et al., Nature Nanotechnol., 14:1084-1087, 2019. Anazalone et al., Nature, 576:149-157, 2019. Baden et al., New England J. of Medicine, 384:403-416, 2021. Cell Model Resources, www.cff.org / research / cell-model-resources, accessed on March 8, 2024. Chen et al., Cell, 184:5635-5652, 2021. Cheng et al., Nat. Nanotechnol., 15:313-320, 2020. Chow et al., Trends Pharmacol. Sci., 41:715-729, 2020. Doman et al., Nat. Protoc., 17:2431-2468, 2022. Doman et al., Cell, 186:3983-4002, 2023. Gaudelli et al., Nature, 551:464-471, 2017. Geurts et al., Cell Stem Cell, 26:503-510, 2020. Hodges and Conlon, Genes & Diseases, 6:97-108, 2019. Hsu et al., Nat. Commun., 12:1034, 2021. Jiang et al., Nat. Commun., 11:1979, 2020. Kim et al., ACS Nano, 16:14792-14806, 2022. Komor et al., Nature, 533:420-424, 2016. Krishnamurthy et al., Nat. Commun., 10:4906, 2019. Krishnamurthy et al., Nucleic Acid Res., 49:10558-10572, 2021. Lewis et al., Bioengineering & Translational Medicine, 8:e10580, 2023. Mention et al., Hum. Mol. Genet., 32:3237-3248, 2023. Nelson et al., Nat. Biotechnol., 40:402-410, 2022. Patel et al., Nat. Commun., 11:983, 2020. Polack et al., New England J. of Medicine, 383:2603-2615, 2020. Piotrowski-Daspit et al., Science Advance, 8:eabo0522, 2022. Wei et al., Nat. Commun., 14:7322, 2023. Zhang et al., Pharmaceutics, 12:1042, 2020. Zhou et al., Hum. Gene Ther., 30:1101-1116, 2019.-49- 4933-2629-4831, v.1

Claims

WHAT IS CLAIMED IS:

1. A composition comprising: (A) a lipid nanoparticle comprising: (I) an ionizable lipid; wherein the lipid nanoparticle comprises less than 49% by moles of the ionizable lipid relative to the total moles of the total lipids; (II) a phospholipid; (III) a sterol comprising an aliphatic carbon tail of at least 9 carbon atoms; and (IV) a polymer conjugated lipid; and (B) a therapeutic agent.

2. The composition of claim 1, wherein the sterol is further defined as: wherein:R1 is alkyl(C9-15), alkenyl(C9-C15), or a substituted version of either group; or a pharmaceutically acceptable salt thereof.

3. The composition of either claim 1 or claim 2, wherein the sterol is β-sitosterol.

4. The composition according to any one of claims 1-3, wherein the ionizable lipid is a cationic ionizable lipid.

5. The composition according to any one of claims 1-4, wherein the ionizable lipid is a compound of the formula: wherein:m, n, and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; X2and X3are each independently −O− or −N−; R1 is hydroxy, amino, halo, or mercapto; or-50- 4933-2629-4831, v.1alkoxy(C≤8), alkylamino(C≤8), dialkylamino(C≤12), , or a substituted version of any of these groups; and R2 and R3 are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

6. The composition of claim 5, wherein the ionizable lipid is further defined as: wherein:m is 1, 2, 3, 4, or 5; n and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; X2 and X3 are each independently−O− or −N−; R1is hydroxy, amino, halo, or mercapto; or alkoxy(C≤8), alkylamino(C≤8), dialkylamino(C≤12), , or a substituted version of any of these groups; and R2and R3are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

7. The composition of claim 6, wherein the ionizable lipid is further defined as: wherein:m is 1, 2, 3, 4, or 5; n and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and X2 and X3 are each independently −O− or −N−; and R2 and R3 are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

8. The composition of claim 7, wherein the ionizable lipid is further defined as:-51- 4933-2629-4831, v.1II) wherein: m is 1, 2, 3, 4, or 5; n and o are each independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and R2 and R3 are each independently alkyl(C≤24), alkenyl(C≤24), or alkynyl(C≤24); or a pharmaceutically available salt thereof.

9. The composition according to claim 5, wherein the cationic ionizable lipid is further defined as:-52- 4933-2629-4831, v.1, or 10. The composition according to any one of claims 1-9, wherein the composition comprises an ionizable lipid molar ratio of the ionizable lipid to the total lipid nanoparticles is from about 1:10 to about 8:

10.

11. The composition according to any one of claims 1-10, wherein the composition comprises a phospholipid molar ratio of the phospholipid to the total lipid nanoparticles is from about 1:20 to about 2:5 or the composition comprises a sterol molar ratio of the sterol to the total lipid nanoparticles is from about 1:5 to about 3:

5.

12. The composition according to any one of claims 1-11, wherein the therapeutic agent comprises two or more therapeutic agents.

13. The composition according to any one of claims 1-12, wherein the therapeutic agent comprises a base editor.

14. The composition according to any one of claims 1-13, wherein the therapeutic agent comprises one or more biologic agents.

15. The composition of claim 14, wherein the biologic agent is one or more nucleic acids.

16. The composition of claim 15, wherein one or more of the nucleic acids is an mRNA.

17. The composition of claim 15, wherein one or more of the nucleic acids is a sgRNA.

18. The composition according to any one of claims 1-17, wherein the composition has been formulated for administration via inhalation.-53- 4933-2629-4831, v.

119. A method of treating a disease or disorder in a patient comprising administering to the patient a composition according to any one of claims 1-18, wherein the therapeutic agent is therapeutically effective for the disease or disorder.

20. A method of delivering a therapeutic agent to the lungs of a patient comprising administering a composition according to any one of claims 1-18 via inhalation.-54- 4933-2629-4831, v.1

Citation Information

Patent Citations

  • Lipid nanoparticle compound for efficiently delivering nucleic acid to immune cells

    CN119732927A

  • Lipid nanoparticle compositions for delivering circular polynucleotides

    WO2023056033A1