Targeted delivery of mRNA therapeutics to lung parenchyma using one-component delivery system for nucleic acids
Patent Information
- Application Number
- PCT/US2025/024306
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-12
- Filing Date
- 2025-04-11
- Publication Date
- 2025-11-20
AI Technical Summary
Current delivery systems for mRNA therapeutics, such as four-component lipid nanoparticle systems, struggle to effectively target and deliver therapeutic agents to the lung parenchyma, particularly in conditions like acute lung injury, leading to poor specificity and uneven distribution.
A one-component delivery system using ionizable amphiphilic Janus dendrimers (IAJDs) encapsulates therapeutic agents, including mRNA molecules, to specifically target and deliver them to the lung parenchyma, enhancing delivery efficiency and specificity.
The IAJD system achieves targeted and efficient delivery of mRNA to the lung parenchyma, improving therapeutic efficacy by ensuring uniform distribution and reducing inflammatory responses.
Smart Images

Figure US2025024306_20112025_PF_FP_ABST
Abstract
Description
TARGETED DELIVERY OF MRNA THERAPEUTICS TO LUNG PARENCHYMA USING ONE-COMPONENT DELIVERY SYSTEM FOR NUCLEIC ACIDSCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No. 63 / 633,445, filed April 12, 2024, which is hereby incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY
[0002] This application contains a Sequence Listing, which is submitted electronically via EFS-Web as an XML Document formatted sequence listing with a file name “046483- 6284-OOWO Sequence Listing. xml,” having a creation date of April 11, 2025, and having a size of 46,487 bytes. The sequence listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in its entirety.BACKGROUND OF THE INVENTION
[0003] Acute lung injury (ALI) is a prevalent condition in the United States, with 200,000 new diagnoses each year, resulting in high morbidity and mortality (Johnson et al., 2010, J. Aerosol Med. Pulm. Drug Deliv. 23, 243-252; Dushianthan et al., 2011, Postgrad. Med. J. 87, 612-622; Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365; Wilkinson et al., 2020, Toxicol. Appl. Pharmacol. 407, 115236). Injury progression is a result of epithelial barrier dysfunction, alveolar damage, pulmonary edema, and surfactant dysfunction brought on by changes in innate immune, epithelial, and endothelial cell dysfunction (Johnson et al., 2010, J. Aerosol Med. Pulm. Drug Deliv. 23, 243-252; Matthay et al., 2005, Am. J. Respir. Cell Mol. Biol. 33, 319-327; Tam et al., 2011, Thera. Adv. Respir. Dis. 5, 255-273; Butt et al., 2016, Arch. Pathol. Lab. Med. 140, 345-350; Cross et al., 2011, Crit. Care Clin. 27, 355-377). There are 23 generations of division in the lung, where Generations 0-16 are the conductive airways and 16-23 are the respiratory airways. Within the pulmonary circuit, blood flow is matched to gas exchange in the respiratory portion of the lung. Many of the effects of ALI, a result of the liquid leak, are observed in the lung parenchyma beyond the 16th generation. However, drug delivery to this area is challenging often leading topoor specificity and an uneven distribution (Schwaiblmair et al., 2012, Open Respir. Med. J. 6, 63; He et al., 2022, J. Nanobiotechnol. 20, 101; Labiris et al., 2003, Br. J. Clin. Pharmacol. 56, 588-599; Newman et al., 2017, Ther. Deliv. 8, 647-661; O’Callaghan et al., 1994, Mediators of Inflamm. 3, S31-S33). Therefore, there is a therapeutic gap in the treatment of ALI requiring the development of methods to deliver pharmacological agents to the lower lung. This is a particular challenge when administering a complex biologic, such as anti-inflammatory cytokine mRNA, to the site of injury.
[0004] Since the beginning of the severe acute respiratory syndrome coronavirus-2 (SARS-CoV2) pandemic in 2019, there have been a series of major breakthroughs in the development of nucleoside-modified mRNA vaccines by both major research institutions and the pharmaceutical industry (Hou et al., 2021, Nat. Rev. Mater. 6, 1078-1094; Pilkington et al., 2021, Acta Biomater. 131, 16-40; Rele et al., 2021, Hum. Vaccines Immunother. 17, 1122— 1127; Parhiz et al., 2024, Lancet 403, 1192-1204). Currently, the leading delivery system for mRNA vaccines are four-component lipid nanoparticle (LNP) synthetic delivery systems, which consist of ionizable lipids, phospholipids, cholesterol, and polyethylene glycol (PEG)- conjugated lipids, which can be assembled by microfluidic or T-tube technology (Sabnis et al., 2018, Mol. Ther. 26, 1509-1519; US 11357856). Despite their wide adoption of COVID-19 vaccinations, the targeted delivery of mRNA to the lung with four-component LNPs has not proven successful (Hibbitts et al., 2020, Nanomaterials 10, 1248; Kaczmarek et al., 2018, Nano Lett. 18, 6449-6454; Kaczmarek et al., 2016, Angew. Chem. 128, 14012-14016; Kaczmarek et al., 32021, . Biomaterials 275, 120966; Patel et al., 2019, Adv. Mater. 31, 1805116; Pardi et al., 2015, J. Control. Release 217, 345-351; Sahu et al., 2019, Mol. Ther. 27, 803-823).
[0005] Thus, there is a need in the art for compositions and methods for the delivery of mRNA. The present invention satisfies this unmet need.SUMMARY OF THE INVENTION
[0006] In some embodiments, the invention relates to a composition for delivering an agent to the lung parenchyma of a subject in need thereof, wherein the method comprises administering at least one nanoparticle comprising an ionizable amphiphilic Janus dendrimer (IAJD), wherein the IAJD encapsulates a therapeutic agent, or a composition comprising the same to the subject.
[0007] In some embodiments, the IAJD comprises a formula of:
[0008] In some embodiments, the therapeutic agent comprises an anti-inflammatory agent.
[0009] In some embodiments, the therapeutic agent comprises TGF-P, Alpha-1 - antitrypsin (A1AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP-B) or surfactant protein C (SP-C) or a fragment or variant thereof. In some embodiments, the therapeutic agent comprises a nucleic acid molecule comprising SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 11. The composition of claim 14, wherein the therapeutic agent comprises an mRNA molecule transcribed from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10 or SEQ ID NO: 12.
[0010] In some embodiments, the invention relates to a method of delivering an agent to the lung parenchyma of a subject in need thereof, wherein the method comprises administering at least one nanoparticle comprising an ionizable amphiphilic Janus dendrimer (IAJD), wherein the IAJD encapsulates a therapeutic agent, or a composition comprising the same to the subject.
[0011] In some embodiments, the IAJD comprises a formula of:
[0012] In some embodiments, the method treats or inflammation, a viral infection, bacterial infection, fungal infection, parasitic infection, cancer, disease or disorder associated with cancer, autoimmune disease or disorder, or any combination thereof.
[0013] In some embodiments, the method treats or prevents asthma, chronic obstructive pulmonary disease (COPD), emphysema, acute respiratory distress syndrome (ARDS), lung cancer, sarcoidosis, asbestosis, chronic cough, pneumothorax, pulmonary embolism, pleural effusion, rheumatoid lung disease, pulmonary fibrosis, bronchiectasis, tuberculosis, bronchitis, or pneumonia. In one embodiment, the lung cancer is non-small cell lung cancer.
[0014] In some embodiments, the method treats or prevents acute lung injury (ALI), emphysema, cystic fibrosis or idiopathic fibrosis.
[0015] In some embodiments, the therapeutic agent comprises at least one selected from the group consisting of cDNA, cRNA, CirRNA, mRNA, miRNA, siRNA, sgRNA, modified RNA, tRNA, antagomir, antisense molecule, targeted nucleic acid, and any combination thereof.
[0016] In some embodiments, the therapeutic agent is an mRNA molecule. In some embodiments, the therapeutic agent is an mRNA molecule encoding TGF-P, Alpha-1- antitrypsin (A1AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP-B) or surfactant protein C (SP-C) or a fragment or variant thereof. In some embodiments, the therapeutic agent is an mRNA molecule comprising SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO:11. In some embodiments, the therapeutic agent is an mRNA molecule transcribed from SEQ ID NO:2, SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO:8, SEQ ID NO: 10 or SEQ ID NO: 12
[0017] In some embodiments, the therapeutic agent is a nucleoside-modified RNA. In some embodiments, the nucleoside-modified RNA comprises pseudouridine. In some embodiments, the nucleoside-modified RNA comprises pseudouridine plus 5 -methyl -cytosine.In some embodiments, the nucleoside-modified RNA comprises 5-methyl-uridine. In some embodiments, the nucleoside-modified RNA comprises 1-methyl-pseudouridine.BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The following detailed description of embodiments of the invention will be better understood when read in conjunction with the appended drawings. It should be understood that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0019] Figure 1, comprising Figures 1A-1F, depicts data demonstrating the characterization of mRNA-IAJD34 formulation. IAJD34 formulated as empty-IAID34, Luc mRNA-IAJD34, and TGF-[3 -IAJD34 were evaluated using (Figure 1 A) size (nm), poly dispersity index (PDI), zeta potential, encapsulation efficiency (% EE) (Data presented as mean + SE) and (Figure IB) Cryo-TEM. Synthetized IAJD34 was evaluated for purity using (Figure 1C) carbon 13 nuclear magnetic imaging (13C NMR), (Figure ID) hydrogen nuclear magnetic imaging (1H NMR), (Figure IE) high-performance liquid chromatography (HPLC), (Figure IF) and electrospray ionization time-of-flight (ESI-TOF) mass spectrometry. ND = Not Detected.
[0020] Figure 2, comprising Figures 2A-2F, depicts data demonstrating the specificity of IAJD34 for targeted mRNA delivery to the lung. IAJD34 formulated with luciferase mRNA (Luc mRNA-IAID34) was i.v. injected into BALB / c mice and analyzed for efficient pulmonary mRNA using IVIS. Figure 2A depicts data demonstrating the chemical structure of one- component IAJD3440. Figure 2B depicts data demonstrating the specificity of Luc mRNA- IAJD34 delivery to the lung. Representative IVIS images of whole-body and organs of mice at 4 h postinjection of 10 pg Luc mRNA-IAID34 show luminescent biodistribution of luciferase expression predominantly in the lungs. IVIS images were analyzed, and the photon radiance (s ' sr1m2) of each image was quantified. The quantitative bioluminescence imaging (BLI) data are shown as total flux (p / s). Figure 2C depicts data demonstrating a time course of luciferase expression in vivo. Representative IVIS images of whole-body mice following 10 pg Luc mRNA-IAJD34, imaged at 4, 24, 48, or 72 h post-injection. Figure 2D depicts data demonstrating whole-body radiant flux (p / s) at various time points following the injection of 10 pg Luc mRNA-IAJD34. Data presented as mean ± SE, with n = 12 for 4 h, n = 15 for 24 h, n =18 for 48 h, and n = 6 for 72 h. Figure 2E depicts data demonstrating the dose-dependent pulmonary delivery of Luc mRNA-IAJD34. Representative IVIS images of whole-body and organs of mice injected with Luc mRNAIAJD34 at doses of 10, 20, or 30 pg, imaged at 24 h post-injection. Particle size (nm) and poly dispersity index (PDI) for Luc mRNA-IAJD34 at each dose were measured prior to injection and are shown above the corresponding mouse IVIS image. Figure 2F depicts data demonstrating the delivery of Luc mRNA-IAJD34 to the lung parenchyma. At 24 h post-injection with 30 pg Luc mRNA-IAJD34, lung tissue was harvested and immunohistochemistry (IHC) for luciferase or IgG was performed and compared to naive animals. Experiment was repeated 2 independent times.
[0021] Figure 3 depicts a table of the specificity of IAJD34 for targeted mRNA delivery to the lung over time. IAJD34 formulated with luciferase mRNA (Luc mRNA-IAJD34) was i.v. injected into BALB / c mice and analyzed for efficient pulmonary delivery of mRNA using IVIS. IVIS images were analyzed and the photon radiance (s 'sr 'm2) of each image was quantified. The quantitative bioluminescence imaging (BLI) data are shown as total flux photon / sec (p / s) at various time points following the injection of 10 pg Luc mRNA-IAJD34. Exact n is indicated in the table. Data presented as mean + SE
[0022] Figure 4, comprising Figure 4A and Figure 4B, depicts data demonstrating the evaluation of stability of Luc and TGF-P mRNA-IAJD34 formulation. Figure 4A depicts data demonstrating Luc mRNA-IAJD34 at dose 10 pg per mouse was injected into BALB / c mice 1 hour after formulating (fresh), or 5 days after storing formulations at 4C. IVIS images of whole-body of mice at 4, 24, and 48 hrs post-injection of 10 pg Luc mRNA-IAJD34 were analyzed. IVIS images were analyzed and the photon radiance (s 'sr 'm2) of each image was quantified. The quantitative BLI data are shown as total flux photon / sec (p / s). Figure 4B depicts data demonstrating TGF-P mRNA-IAJD34 formulation at dose 10 pg was evaluated for size (nm) and PDI at 1,2, 3, 4, and 5 weeks after storing formulations at 4°C. Data presented as mean + SE. Exact n is indicated in the table, depicts a table demonstrating an inflammatory response to TGF-P mRNA delivery with IAJD34 only at high doses. TGF mRNA formulated with IAID34 (IAJD34 [TGF-P] 10-30 pg / mouse) were delivered to Balb / C mice and compared to naive animals. 24 hr post treatment, total protein in the bronchoalveolar lavage (BAL), differential BAL cell count, and BAL phospholipid levels were quantified as markers of lung injury: MP Macrophage, NP: neutrophil, LP: Lymphocyte. Data are presented as mean ± SD,n=3-10 / group. Samples were compared using Shapiro-Wilk test for normality followed by an ordinary one-way ANOVA with Tukey’s Multiple comparison where * = significantly different from control, P<0.05.
[0023] Figure 5 depicts a table of the specificity of IAJD34 for targeted mRNA delivery to the lung at multiple doses. IAJD34 formulated with luciferase mRNA (Luc mRNA-IAJD34) was i.v. injected into BALB / c mice and analyzed for efficient pulmonary delivery of mRNA using IVIS in whole body and organs 24 hrs post injection. IVIS images were analyzed and the photon radiance (s 'sr 'm2) of each image was quantified. The quantitative BLI data are shown as total flux photon / sec (p / s). Exact n is indicated in the table. Data presented as mean + SE. Whole-body data were evaluated for normality using a Shapiro-Wilk’s test and compared across doses using a one-way ANOVA followed by Tukey's multiple comparisons test. * indicates a significant difference from the 10 pg whole-body, p<0.05 (Whole body: 10 pg vs 20 pg p=0.0014; 10 pg vs 30 pg p<0.0001).
[0024] Figure 6 depicts data demonstrating the specificity of IAJD34 for targeted mRNA delivery to the lung at multiple doses. IAJD34 formulated with luciferase mRNA (Luc mRNA-IAJD34) was i.v. injected into BALB / c mice and analyzed for efficient pulmonary delivery of mRNA using IVIS. Data are individual presentation of whole-body measurements 24 hrs post injection from Figure 3. IVIS images were analyzed and the photon radiance (s-1sr_1m"2) of each image was quantified. The quantitative BLI data are shown as total flux photon / sec (p / s). Exact n are indicated in Figure 5. Data presented as mean + SE. Data were evaluated for normality using a Shapiro-Wilk’s test and compared using a one-way ANOVA followed by Tukey's multiple comparisons test. A significant difference from the 10 pg wholebody is indicated at p.
[0025] Figure 7, comprising Figure 7A and Figure 7B, depicts data demonstrating the confirmation of TGF-0 mRNA expression and protein production. Figure 7A depicts data demonstrating that TGF-P mRNA was produced from plasmids, purified using cellulose, and imaged using gel electrophoresis to confirm mRNA presence and quality. Figure 7B depicts data demonstrating that human embryonic kidney (HEK) 293 cells were seeded into a 24 well plate at 150,000 cells / well and transfected with 500 ng mRNA / well or no mRNA for negative control (NC) according to Methods and Materials. Cells were collected in RIPA (Sigma Aldrich) buffer and equal protein (10 pg / well) was loaded for western blot analysis withprimary antibody to TGF-P (1 :5,000) or GAPDH (1 :1,000) and secondary antibody anti-Rabbit IgG.
[0026] Figure 8, comprising Figures 8A through Figure 8E, depicts data demonstrating the evaluation of dose-dependent toxicity of TGFp mRNA delivery with IAJD34. Various doses of TGFp mRNA-IAJD34 (10, 20, and 30 pg per mouse) were delivered to BALB / c mice and compared to naive animals. At 24 h post-injection, BAL fluid and cells, whole lung tissue, and serum were collected. Figure 8A depicts data demonstrating that BAL cells were fixed and stained using a Hema 3 Stat kit. Total BAL protein, differential BAL cell count, and BAL phospholipid levels were quantified as markers of lung injury: MP, Macrophage, NP, neutrophil, LP, Lymphocyte. Figure 8B depicts representative cell differentials. Figure 8C depicts data demonstrating that formaldehyde-fixed lung tissue was processed, stained with H&E, and scored by a board-certified pathologist. Representative H&E images are shown. Figure 8D depicts data demonstrating that IL-6 was measured in BAL fluid via ELISA according to manufacturer’s guidelines (n / group = 10 / Naive, 5 / 10 pg, 7 / 20 pg, 3 / 30ug). Figure 8E depicts data demonstrating that ALT and AST were measured in serum via ELSIA according to the manufacturer’s guidelines (n / group = 5 / Naive, 5 / 20 pg, 5 / 30 pg). Data are presented as mean ± SE, n = 3-10 / group from 2 independent experiments. For Figures 8 A, 8D, and 8E, samples were compared using the Shapiro-Wilk test for normality followed by an ordinary one-way ANOVA with Tukey’s Multiple comparisons where *indicates a significant difference from the naive control, p < 0.05. ((A) BAL protein: Naive vs 30 pg p = 0.0001; NP: Naive vs 30 pg p = 0.0134; (E) ALT: Naive vs 30 pg p = 0.0164). Scale bar = 50 pm.
[0027] Figure 9 depicts data demonstrating the evaluation of dose-dependent toxicity of TGF-P mRNA delivery with IAJD34. BALB / c mice were injected with various doses of TGF-P mRNAIAJD34 (10, 20, and 30 pg per mouse). At 24 hrs post-injection, liver, spleen, and kidney tissue were collected (n / group = 10 mice / Naive, 5 / 10 pg, 8 / 20 pg, 4 / 30 pg), stained with H&E and scored by a board-certified pathologist. Representative images of naive mice and mice that received 30 pg TGF-P mRNA- IAJD34 are shown. Scale bar = 50 pm.
[0028] Figure 10, comprising Figure 10A and Figure 10B, depicts the gating strategy for alveolar and Interstitial macrophage characterization. Cells were analyzed using a Gallios 10-color flow cytometer (Beckman Coulter, Brea, CA). Using Kaluza software (Beckman Coulter, Brea, CA) cells were gated upon size and complexity. Cells were confirmed to beCD45+ and viable. Figure 10A depicts data demonstrating that cells that were positively stained for both Siglec F and F4 / 80 were determined to be alveolar macrophages (AMs). Resident macrophages (CD1 lc+ / CDl lb-), can be differentiated from recruited (CD11c- / CD1 lb+) or migratory macrophages (CD1 lc+ / CDl lb+). Figure 10B depicts data demonstrating that cells from digested lung tissue were immunomagnetically separated based upon CD45 expression. CD45+ cells were isolated, immunostained, and analyzed. Cells that expressed F4 / 80 and CD1 lb in the absence of Siglec F were categorized as interstitial macrophages (IMs).
[0029] Figure 11, comprising Figure 11 A and Figure 1 IB, depicts data demonstrating the absence of inflammatory activation in response to increasing doses of TGF-P mRNA- IAJD34 in alveolar macrophages and interstitial macrophages. Various doses of TGFP mRNA- IAJD34 (10, 20, and 30 pg per mouse) were delivered to BALB / c mice and compared to naive animals at 24 h post-injection. Figure 11 A depicts data demonstrating that cells from the BAL were isolated, immunostained, and analyzed by flow cytometry. Cells that were positively stained for both Siglec F and F4 / 80 were determined to be alveolar macrophages (AMs) and were evaluated for Ly6c and CD11c expression. Figure 1 IB depicts data demonstrating that cells from digested lung tissue were immunomagnetically separated based upon CD45 expression. CD45+ cells were isolated, immunostained, and analyzed. Cells that expressed F4 / 80 and CD1 lb in the absence of Siglec F were categorized as interstitial macrophages (IMs) and were analyzed for Ly6c and CD206 expression. Data are presented as mean ± SE for n = 4-10 per group. Samples were compared using the Shapiro-Wilk test for normality followed by an ordinary one-way ANOVA with Sidak’s multiple comparisons test where * indicates a significant difference from the naive control, p < 0.05. B Ly6c- / CD11c- IMs: Naive vs 10 pg p = 0.0135, Naive vs 30 pg p = 0.0427; Ly6c + / CD11c- IMs: Naive vs 20 pg p < 0.0001, Naive vs 30 pg p = 0.0003; Ly6c- / CD1 lc+ IMs: Naive vs 10 pg p = 0.0069, Naive vs 20 pg p < 0.0001, Naive vs 30 pg p < 0.0001; Ly6c + / CD1 lc+ IMs: Naive vs 10 pg p = 0.0026.
[0030] Figure 12 depicts data demonstrating the evaluation of alveolar macrophages containing Ly6c and CD206. BALB / c mice were injected with various doses of TGF-[3 mRNA- IAFD34 (10, 20, and 30 pg per mouse). At 24 hrs post-injection bronchoalveolar lavage fluid (BAL) cells were isolated, immunostained, and analyzed by flowcytometry. Cells that were positively stained for both Siglec F and F4 / 80 were determined to be AMs and were evaluatedfor Ly6c and CD206 populations. Data are presented as mean ± SE for n / group = 10 mice / Naive, 5 / 10 pg, 8 / 20 pg, 4 / 30 pg. Alveolar Macrophages (AMs).
[0031] Figure 13, comprising Figure 13 A and Figure 13B depicts data demonstrating the evaluation of interstitial macrophages containing Ly6c and CD206. BALB / c mice were injected with various doses of TGF-P mRNA-IAJD34 (10, 20, and 30 pg per mouse). Figure 13A depicts data demonstrating that, at 24 hrs post-injection, cells from digested lung tissue were immunomagnetically separated based upon CD45 expression. CD45+ cells were isolated, immunostained, and analyzed. Cells that expressed F4 / 80 and CD1 lb in the absence of Siglec F were categorized as IMs and were analyzed for Ly6c and CD206 expression. Figure 13B depicts the percent Ly6c- / CD206- and Ly6c+ / CD206- IMs. Data are presented as mean ± SE for n / group = 10 mice / Naive, 5 / 10 pg, 8 / 20 pg, 4 / 30 pg. Data were evaluated for normality using a Shapiro Wilk’s test and compared using a one-way ANOVA followed by Tukey's multiple comparisons test. * indicates a significant difference from the naive control, p<0.05.
[0032] Figure 14, comprising Figure 14A and Figure 14B, depicts data demonstrating Dose-dependent expression of TGF-P mRNA-IAJD34 in lung tissue. Various doses of TGF-P mRNA-IAJD34 (10, 20, and 30 pg per mouse) were delivered to BALB / c mice, and lung tissue was collected 24 h post-injection and analyzed for TGF-P protein expression. Figure 14A depicts western blots for TGF-P were performed on homogenized whole lung tissue at indicated time points. Representative images are shown. Figure 14B depicts a table demonstrating that western blots results were quantified using densitometry. TGF-P protein expression was normalized to P-actin for each band, and the density was expressed relative to the naive control. Data are presented as mean ± SE for n = 4-9 per group. Statistical comparisons were made using a two-tailed Mann-Whitney U test where * indicates a significant difference from the control, p < 0.05. (Unprocessed TGFP: Naive vs 20 pg p = 0.0012, Naive vs 30 pg p = 0.0046; Cleaved TGF-P: Naive vs 10 pg p = 0.0557, Naive vs 20 pg p = 0.0029, Naive vs 30 pg p = 0.0026; Total TGF-P: Naive vs 20 pg p = 0.0003, Naive vs 30 pg p = 0.0444).
[0033] Figure 15 depicts data demonstrating that TGF-P mRNA-IAJD34-induced alterations in BAL cytokine production. BALB / c mice were injected with various doses of TGF-P mRNA-IAJD34 (10, 20, and 30 pg per mouse). At 24 hrs post-injection, cell-free BAL fluid was evaluated for cytokines using a Milliplex Max Mouse Cytokine / Chemokine MagneticBead Panel - Premixed 32 Plex - Immunology Multiplex Assay and are presented as pg / mL. Data shown as mean ± SE for n / group = 10 mice / Naive, 5 / 10 pg, 8 / 20 pg, 4 / 30 pg. Data were compared using a one-way ANOVA followed by Tukey's multiple comparisons test, p < 0.05 when compared to the naive control (*), 30 pg ( ) (IP-10: Naive vs 30 pg p=0.0410; MCP-1 : Naive vs 30 pg p=0.0054, 20 pg vs 30 pg p=0.0087). ND = Not Detected. Figure 16, comprising Figures 16A-16B, depicts data demonstrating that TGF-P expression is transiently induced after mRNA delivery to lung via IAJD34. Empty IAJD34 (IAJD34 [Empty]) and 10 pg TGF-P mRNA formulated with IAJD34 (IAJD34 [TGF-P]) were delivered to Balb / c mice (n=5) and sacrificed 4, 24, and 48 hr post-delivery. A: Western blots for TGF-P were performed on homogenized whole lung tissue. B: Western blots were quantified by densitometry and expression was normalized to P-actin for each band. Density is expressed relative to Naive. Data are presented as Mean ± SE, n = 3-5 / group. Samples were compared using a Mann-Whitney U test where * = significantly different from matched empty control, p<0.05.
[0034] Figure 16, comprising Figure 16A through Figure 16F, depicts data demonstrating TGF-P mRNA-IAJD34-induced alterations in BAL cytokine production and cellular metabolic function. Various doses of TGF-P mRNA-IAJD34 (10, 20, and 30 pg per mouse) were delivered to BALB / c mice, and BAL fluid was collected 24 h post-injection. A D Cell- free BAL was evaluated for cytokines using a Milliplex Max Mouse Cytokine / Chemokine Magnetic Bead Panel - Premixed 32 Plex - Immunology Multiplex Assay. The concentration of (Figure 16A) G-SCF, (Figure 16B) IL-la, (Figure 16C) IL-9, and (Figure 16D) TNFa are presented as pg / mL. Figure 16E and Figure 16F depicts data demonstrating that cells from digested lung tissue were immunomagnetically separated based upon CD45 expression. CD45 + cells were isolated and analyzed metabolically using an Agilent Seahorse according to manufacturer’s guidelines; (Figure 16E) ECAR was measured following injections of glucose, oligomycin (Oligo), and 2-DG, and glycolysis was determined following injection of glucose; (Figure 16F) OCR was measured with injections of oligo, FCCP, and rotenone / antimycin (R / A) and normalized to non-mitochondrial energy production. Maximal respiration was determined following FCCP injection. Data are shown as mean ± SE, for all experiments n / group = 10 / Naive, 5 / 10 pg, 8 / 20 pg, 4 / 30ug. Data were evaluated for normality using a Shapiro- Wilk’s test and compared using a one-way ANOVA followed by Tukey’s multiplecomparisons test. * indicates a significant difference from the control, p < 0.05. ((Figure 16A): Naive vs 30 pg p = 0.0034; (Figure 16B): Naive vs 20 pg p = 0.0322, Naive vs 30 pg p = 0.0003; (Figure 16C): Naive vs 20 pg p = 0.0129, Naive vs 30 pg p = 0.0233; (Figure 16E) Glycolysis: Naive vs 20 pg p = 0.0001, Naive vs 30 pg p < 0.0001).
[0035] Figure 17, comprising Figure 17A and Figure 17B, depicts data demonstrating the effects of TGF-P mRNA-IAJD34 delivery on BAL content over time. BALB / c mice were injected with 10 pg of TGF-P mRNA-IAJD34 or empty IAJD34, BAL fluid and large aggregate surfactant fractions were collected at 4, 24, and 48 hrs post-injection. Figure 17A depicts data demonstrating that cell-free BAL fluid was evaluated for total protein content using a BCA assay. Figure 17B depicts data demonstrating that total phospholipids were determined from the large aggregate surfactant fraction and normalized to naive phospholipid content. Data are presented as mean ± SE, n / group = 5 / Naive, 3 / 4hr empty-IAJD34, 3 / 4hr TGFP mRNA-IAJD34, 4 / 24hr empty-IAJD34, 4 / 24hr TGF0 mRNA-IAJD34, 3 / 48hr empty- 1AJD34, 5 / 48hr TGF mRNAIAJD34.
[0036] Figure 18 depicts data demonstrating the cell specific expression of TGF-P mRNA-IAJD34 in the lung over time. Empty IAJD34 or 10 pg TGF-P mRNA-IAJD34 were delivered to BALB / c mice, and lung tissues were evaluated for TGF-P protein expression at 4, 24, and 48 h postinjection. Lung tissues was stained for TGF-P or IgG control via immunohistochemistry. Representative IHC images are shown. The slides are at lOOx magnification, and the scale bars presented 100 pm. Increases in TGF-P protein expression were observed in the TGF-P mRNA-IAJD34 group through immunohistochemical staining from 4 to 48 h. The experiment was repeated 2 independent times. Scale bar = 100 pm.
[0037] Figure 19, comprising Figure 19A and Figure 19B, depicts data demonstrating that TGF-P protein expression is transiently induced after mRNA delivery to lung via IAJD34. Empty IAJD34 or 10 ug TGF-P mRNA-IAJD34 were delivered to BALB / c mice, and lung tissue homogenates were evaluated for TGF-P protein expression at 4, 24, and 48 h postinjection. Figure 19A depicts western blots for TGF-P were performed on homogenized whole lung tissue. Representative images are shown. Figure 19B depicts data demonstrating that western blots bands were quantified by densitometry and TGF-P protein expression was normalized to P-actin for each band, and the density was expressed relative to the naive control. Data are presented as mean ± SE, n = 3-5 per group. Statistical comparisons were made using atwo-tailed Mann-Whitney U test, where * indicates a significant difference from the matched empty control, p < 0.05. (Unprocessed TGF-P: Control vs 4 hr p = 0.0357; Cleaved TGF-P: Control vs 4 hr p = 0.0357, Control vs 24 hr p = 0.0159; Total TGF-P: Control vs 4 hr p = 0.0357).
[0038] Figure 20 depicts data demonstrating the absence of time-dependent Inflammatory activation in response to TGF-P mRNA-IAJD34 in alveolar macrophages. BALB / c mice were injected with 10 pg of TGF-P mRNA-IAJD34 or empty IAJD34. At 4, 24, and 48 hrs postinjection BAL cells were isolated, immunostained, and analyzed by flow cytometry. Cells that were positively stained for both Siglec F and F4 / 80 were determined to be AMs. Mature macrophages (CD1 lc+ / CDl lb-), can be differentiated from recruited or migratory macrophages (CD1 lb+). No differences were observed in the percentage of CD1 lb+ alveolar macrophage population between groups. Data are presented as mean ± SE, n / group = 5 / Naive, 3 / 4hr empty-IAJD34, 3 / 4hr TGFp mRNA-IAJD34, 4 / 24hr emptyIAJD34, 4 / 24hr TGFP mRNA-lAJD34, 3 / 48hr empty-IAJD34, 5 / 48hr TGFp mRNAIAJD34. Representative images are shown.
[0039] Figure 21 depicts data demonstrating the Absence of time-dependent Inflammatory activation in response to TGF-P mRNA-IAJD34 in interstitial macrophages. BALB / c mice were injected with 10 pg of TGF-P mRNA-IAJD34 or empty IAJD34. At 4, 24, and 48 hrs postinjection, cells from digested lung tissue were immunomagnetically separated based upon CD45 expression. CD45+ cells were isolated, immunostained, and analyzed by flow cytometry. Cells that expressed F4 / 80 and CD1 lb in the absence of Siglec F were categorized as interstitial macrophages and were analyzed for Ly6c and CD206 expression. Data are presented as mean ± SE, n / group = 5 / Naive, 3 / 4hr empty-IAJD34, 3 / 4hr TGFp mRNA-IAJD34, 4 / 24hr empty-IAJD34, 4 / 24hr TGFp mRNA-IAJD34, 3 / 48hr empty-IAJD34, 5 / 48hr TGFp mRNA-IAJD34. Data were evaluated for normality using a Shaprio-Wilks normality test and then compared using a One-way ANOVA with Tukey’s multiple comparison, p < 0.05 when compared to the naive control (*), TGF-P IAJD344 hrs (#), TGF-P IAJD34 24 hrs (f), TGF-P IAJD34 48 hrs ($) (CD1 lb: Naive vs EmptyIAJD34 4hr p=0.0013, Naive vs Empty-IAJD34 24hr p=0.0014, Naive vs TGF-P mRNAIAJD34 4hr p =0.0153).
[0040] Figure 22 depicts data demonstrating the effects of TGF-P mRNA-IAJD34 on bleomycin-induced changes in body weight. BALB / c mice were exposed to PBS or bleomycin(ITB) and subsequently received either an empty IAJD34 or 10 pg TGF-P mRNA-IAJD34. Baseline body weights were measured, and then daily body weights were recorded. Percent change in body weight was determined based on baseline weights. Data are presented as mean ± SE n / group = 7 / PBS+Empty-IAJD34, 6 / PBS+TGF-p mRNA+IAJD34, 10 / ITB+Empty- IAJD34, 8 / ITB+TGF-P mRNA+IAJD34.
[0041] Figure 23 depicts data demonstrating the effects of TGF-P mRNA-IAJD34 on bleomycin-induced histological alterations. BALB / c mice were exposed to PBS or bleomycin (ITB) and subsequently received either an empty IAJD34 or 10 pg TGF-P mRNA-IAJD34. Lung tissue was collected 3 days post-exposure and injection. Fixed lung tissue was processed and stained with H&E. Representative H&E images are shown. The slides are shown at 400x magnification, with scale bars indicating 50 pm. An inset image shows the data of evaluating alveolar thickness, where 10 fields per slide were randomly selected and analyzed using ImageJ. Data are presented as Median ± SE, n = 6-10 per group. Statistical comparisons were made using a two-tailed Wilcoxon ranked sum test, where * indicates a significant difference from the PBS / empty-IAJD34 group, p < 0.05. (Alveolar Thickness: PBS / Empty-IAJD34 vs ITB / Empty-AJD34 p = 0.0273, PBS / Empty-IAJD34 vs PBS / TGF-P mRNA-IAJD34 p = 0.0625, ITB / EmptyIAJD34 vs ITB / TGF-P mRNA-IAJD34 p = 0.2188). Scale bar = 50 pm.
[0042] Figure 24, comprising Figure 24A through Figure 24F, depicts data demonstrating the effects of TGF-P mRNA-IAJD34 bleomycin-induced injury. BALB / c mice were exposed to PBS or bleomycin (ITB) and subsequently received either an empty IAJD34 or 10 pg TGF-P mRNA-IAJD34. Cell-free BAL fluid, BAL cells, and large aggregate surfactant fractions were collected 3 days post-exposure and injection. Figure 24A depicts data demonstrating that cell-free BAL fluid was evaluated for total protein content using a BCA assay (n / group = 7 / PBS + Empty-IAJD34, 6 / PBS + TGF-P mRNA+IAJD34, 10 / ITB+EmptyIAJD34, 8 / ITB + TGF-P mRNA+IAJD34). Data were evaluated for normality using a Shaprio-Wilks normality test. PBS and ITB were compared using a 2-way ANOVA. Figure 24B depicts data demonstrating that total phospholipids were determined from the large aggregate surfactant fraction (n / group = 4 / PBS + Empty-IAJD34, 3 / PBS + TGF-P mRNA + IAJD34, 5 / ITB + EmptyIAJD34, 5 / ITB + TGF-P mRNA + IAJD34). Data were compared using a 2-way ANOVA. Figure 24C depicts data demonstrating that total BAL cells were counted using a colter counter (n / group = 8 / PBS + EmptyIAJD34, 6 / PBS + TGF-P mRNA +IAJD34, 10 / ITB + Empty-IAID34, 10 / ITB + TGF-P mRNA+IAJD34). Data were compared using a 2-way ANOVA with Sidak’s multiple comparisons test. Figure 24D and Figure 24E depict data demonstrating that BAL cells were immunostained for flow cytometric analysis. Cells that were positively stained for both Siglec F and F4 / 80 were determined to be alveolar macrophages (AMs). Resident macrophages (CD1 lc+ / CD1 lb- ), can be differentiated from recruited (CD11c- / CD 1 lb+ ) or migratory macrophages (CD1 lc+ / CD1 lb+ ) (n / group = 7 / PBS + Empty-IAJD34, 6 / PBS + TGF-P mRNA + IAJD34, 10 / ITB +Empty-IAJD34, 8 / ITB + TGF-P mRNA+IAJD34). Resident AMs exposed to PBS and ITB were compared using a 2- way ANOVA. Recruited AMs were compared using a two-tailed Wilcoxon Signed Rank test. Figure 24F depicts data demonstrating that cells from digested lung tissue were immunomagnetically separated based upon CD45 expression. CD45+ cells were isolated, immunostained, and analyzed. Cells that expressed F4 / 80 and CD1 lb in the absence of Siglec F were categorized as interstitial macrophages (IMs) and were analyzed for Ly6c expression (n / group = 7 / PBS + Empty-IAJD34, 6 / PBS + TGF-P mRNA + IAJD34, 10 / ITB + Empty- IAJD34, 8 / ITB + TGF-P mRNA + IAID34). Ly6c+ IMs exposed to PBS and ITB were compared using a 2-way ANOVA. All data were evaluated for normality using a Shaprio-Wilks normality test and are presented as Mean ± SE, n = 3-10 / group. * indicates a significant difference from the control, p < 0.05. ((Figure 24A): PBS vs ITB p = 0.0486; (Figure 24C): PBS / Empty-IAJD34 vs ITB / Empty-IAJD34 p = 0.0087; (Figure 24D): PBS vs ITB p = 0.0360; (E): PBS / Empty-IAID34 vs ITB / Empty-IAID34 p = 0.0156; (Figure 24F): PBS vs ITB p = 0.0089).
[0043] Figure 25, comprising Figure 25A through Figure 25E, depicts data demonstrating the effects of TGF-P mRNA-IAID34 bleomycin-induced cytokine production. BALB / c mice were exposed to PBS or bleomycin (ITB) and subsequently received either an empty IAJD34 or 10 pg TGF-P mRNA-IAJD34. Cell-free BAL fluid was collected 3 days postexposure and injection. A-E Cell-free BAL fluid was evaluated for cytokines using a Milliplex Max Mouse Cytokine / Chemokine Magnetic Bead Panel - Premixed 32 Plex - Immunology Multiplex Assay. The concentrations of (Figure 25A) G-SCF, (Figure 25B) IL-6, (Figure 25C) CXCL10, (Figure 25D) IL-la, and (Figure 25E) IL -2 are presented as pg / mL. Date shown a mean ± SE, n / group = 7 / PBS + Empty-IAJD34, 6 / PBS + TGF-P mRNA + IAJD34, 10 / ITB + Empty-IAJD34, 8 / ITB + TGF-P mRNA+IAJD34. Data were evaluated for normality using aShapiro Wilk’s test. If data were normally distributed, they were compared using a 2-way ANOVA followed by Sidak’s multiple comparisons test. Data points that were identified as 0 were set to the limit of detection according to manufacture values for statistical analysis. If data were not normally distributed, they were evaluated using a Kruskal Wallis test with Dunn’s multiple comparison test. * indicates a significant difference, p < 0.05. ((Figure 25A): PBS / Empty-IAJD34 vs ITB / Empty-IAJD34 p = 0.0231, ITB / Empty-IAJD34 vs ITB / TGF-P mRNA- IAJD34 p = 0.0300; (Figure 25B): PBS / Empty-IAJD34 vs ITB / Empty-IAJD34 p = 0.0057, ITB / Empty-IAJD34 vs ITB / TGF-P mRNA-IAJD34 p = 0.0285; (Figure 25C): PBS / Empty- IAJD34 vs ITB / Empty-IAJD34 p = 0.0168; (Figure 25D): PBS / Empty-IAJD34 vs ITB / Empty- IAJD34 p = 0.0296; (Figure 25E) PBS vs ITB p = 0.0107).
[0044] Figure 26 depicts data demonstrating the effect of TGF-P mRNA-IAJD34 on bleomycin induced alterations in BAL cytokine production. BALB / c mice were exposed to PBS or bleomycin (ITB) and subsequently received either an empty IAJD34 or 10 pg TGF-P mRNA-IAJD34. 3 days post exposure and injection, BAL fluid was collected. Cell-free BAL fluid was evaluated for cytokines using a Milliplex Max Mouse Cytokine / Chemokine Magnetic Bead Panel (Premixed 32 Plex) Immunology Multiplex Assay and are presented as pg / mL. Data are presented as mean ± SE n / group = 7 / PBS+Empty-IAJD34, 6 / PBS+TGF-P mRNA+IAJD34, 10 / ITB+Empty-IAJD34, 8 / ITB+TGF-P mRNA+IAJD34.
[0045] Figure 27 depicts data demonstrating that Alpha- 1 -Antitrypsin mRNA treatment is useful for the treatment of genetically induced chronic obstructive pulmonary disease in a genetic knockout model. 10 pg of luciferase mRNA was co-assemble with IAFD34 or IAJD34 formulated with 1.5% PEG, followed by dialysis in PBS, and then administered intravenously into C57BL / 6 mice. Representative IVIS images of whole-body mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of C57B1 / 6 mice.
[0046] Figure 28 depicts data demonstrating that 10 pg of luciferase mRNA was coassemble with IAJD33 or IAID33 formulated with 1.5% PEG, followed by dialysis in PBS, and then administered intravenously into C57BL / 6 mice. Representative IVIS images of wholebody mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of C57B1 / 6 mice.
[0047] Figure 29 depicts data demonstrating that 10 pg of luciferase mRNA was coassemble with IAJD33 (Luc mRNA-IAID33) and injected by intravenous administration intoBALB / c mice. Representative IVIS images of whole-body mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of BALB / c mice
[0048] Figure 29 depicts data demonstrating that 5 pg of luciferase mRNA was coassemble with IAJD34 and then administered intranasally into BALB / c mice. Representative IVIS images of whole-body mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of BALB / c mice.DETAILED DESCRIPTION
[0049] The present invention is based, in part, on the unexpected results that nanoparticles comprising at least one ionizable amphiphilic Janus dendrimer having the structure of Formula (I) or Formula (II) effectively and efficiently delivered a therapeutic agent to the lung parenchyma. Thus, in one aspect, the present invention relates to methods of use of an ionizable amphiphilic Janus dendrimer having the structure of Formula (I) or Formula (II) for delivery of therapeutic mRNA to the lung parenchyma. In some embodiments, the nanoparticle further comprises at least one therapeutic mRNA that is encapsulated by an ionizable amphiphilic Janus dendrimer of the present invention. In another aspect, the present invention relates to a composition comprising at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle thereof.
[0050] In one aspect, the present invention relates to methods of delivering an agent to a target of interest using at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle or a composition thereof. In another aspect, the present invention relates to methods of preventing or treating a disease or disorder in a subject using at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle or a composition thereof. In another aspect, the present invention relates to methods of treating or preventing a lung disease or disorder in a subject using at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle or a composition thereof. In another aspect, the present invention relates to methods of reducing lung inflammation in a subject using at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle or a composition thereof.Definitions
[0051] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0052] As used herein, each of the following terms has the meaning associated with it in this section.
[0053] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0054] “About” as used herein when referring to a measurable value, for example numerical values and / or ranges, such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods. For example, “about 40 [units]” may mean within ± 25% of 40 (e.g., from 30 to 50), within ± 20%, ± 15%, ± 10%, ± 9%, ± 8%, ± 7%, ± 6%, ± 5%, ± 4%, ± 3%, ± 2%, ± 1%, less than ± 1%, or any other value or range of values therein or therebelow. Furthermore, the phrases “less than about [a value]” or “greater than about [a value]” should be understood in view of the definition of the term “about” provided herein.
[0055] The term “compound,” as used herein, unless otherwise indicated, refers to any specific chemical compound disclosed herein. In one embodiment, the term also refers to stereoisomers and / or optical isomers (including racemic mixtures) or enantiomerically enriched mixtures of disclosed compounds.
[0056] As used herein, the term “analog,” “analogue,” or “derivative” is meant to refer to a chemical compound or molecule made from a parent compound or molecule by one or more chemical reactions. As such, an analog can be a structure having a structure similar to that of the small molecule therapeutic agents described herein or can be based on a scaffold of a small molecule therapeutic agents described herein, but differing from it in respect to certain components or structural makeup, which may have a similar or opposite action metabolically. An analog or derivative can also be a small molecule that differs in structure from the reference molecule, but retains the essential properties of the reference molecule. An analog or derivative may change its interaction with certain other molecules relative to the reference molecule. Ananalog or derivative molecule may also include a salt, an adduct, tautomer, isomer, prodrug, or other variant of the reference molecule.
[0057] As used herein, the term “prodrug” refers to an agent that is converted into the parent drug in vivo. For example, the term “prodrug” refers to a derivative of a known direct acting drug, which derivative has enhanced delivery characteristics and therapeutic value as compared to the drug, and is transformed into the active drug by an enzymatic or chemical process. In some embodiments, “prodrug” refers to an inactive or relatively less active form of an active agent that becomes active by undergoing a chemical conversion through one or more metabolic processes. In one embodiment, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically, or therapeutically active form of the compound. In another embodiment, a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically, or therapeutically active form of the compound. For example, the present compounds can be administered to a subject as a prodrug that includes an initiator bound to an active agent, and, by virtue of being degraded by a metabolic process, the active agent is released in its active form.
[0058] The term “tautomers” are constitutional isomers of organic compounds that readily interconvert by a chemical process (tautomerization).
[0059] The term “isomers” or “stereoisomers” refers to compounds, which have identical chemical constitution, but differ with regard to the arrangement of the atoms or groups in space.
[0060] The term “nanoparticle” refers to a particle having at least one dimension on the order of nanometers (e.g., 1-1,000 nm), which includes one or more amphiphilic Janus dendrimer of Formula (I) or Formula (II). In some embodiments, nanoparticles are included in a formulation comprising a nucleoside-modified RNA as described herein. In some embodiments, such nanoparticles an ionizable hydrophilic group and a lipophilic (hydrophobic) group. In one embodiment, the nanoparticles further comprise one or more excipient selected from neutral lipids, charged lipids, steroids and polymer conjugated lipids. In one embodiment, the nanoparticles do not comprise additional excipients. In one embodiment, the nanoparticles do not comprise any of additional lipids, additional cationic polymers, steroids, neutral lipids, charged lipids, or polymer conjugated lipids, besides the at least one compound of Formula (I) or Formula (II). In some embodiments, the nucleoside-modified RNA is encapsulated in thelipid portion of the nanoparticle or an aqueous space enveloped by some or all of the lipid portion of the nanoparticle, thereby protecting it from enzymatic degradation or other undesirable effects induced by the mechanisms of the host organism or cells, e.g., an adverse immune response.
[0061] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA, circularRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the noncoding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0062] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, and the like.
[0063] “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) RNA, and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
[0064] “Homologous” as used herein, refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared X 100. For example, if 6 of 10 of the positions in two sequences are matched or homologous then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
[0065] “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0066] In the context of the invention, the following abbreviations for the commonly occurring nucleosides (nucleobase bound to ribose or deoxyribose sugar via N-glycosidic linkage) are used. “A” refers to adenosine, “C” refers to cytidine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0067] By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and / or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and / or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject.
[0068] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns. In addition, the nucleotide sequence may contain modified nucleosides that are capable of being translation by translational machinery in a cell. For example, anmRNA where all of the uridines have been replaced with pseudouridine, 1 -methyl psuedouridine, or another modified nucleoside.
[0069] The term “operably linked” refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA or RNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.
[0070] The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.
[0071] In certain instances, the polynucleotide or nucleic acid of the invention is a “nucleoside-modified nucleic acid,” which refers to a nucleic acid comprising at least one modified nucleoside. A “modified nucleoside” refers to a nucleoside with a modification. For example, over one hundred different nucleoside modifications have been identified in RNA (Rozenski, et al., 1999, The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197).
[0072] In certain embodiments, “pseudouridine” refers, in another embodiment, to m l acp3 (l-methyl-3-(3-amino-3-carboxypropyl) pseudouridine. In another embodiment, the term refers to m l (1-methylpseudouridine). In another embodiment, the term refers to i (2'-O-methylpseudouridine). In another embodiment, the term refers to m5D (5- methyldihydrouridine). In another embodiment, the term refers to m3T (3- methylpseudouridine). In another embodiment, the term refers to a pseudouridine moiety that isnot further modified. In another embodiment, the term refers to a monophosphate, diphosphate, or triphosphate of any of the above pseudouridines. In another embodiment, the term refers to any other pseudouridine known in the art. Each possibility represents a separate embodiment of the invention.
[0073] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
[0074] As used herein, the terms “amino acid”, “amino acidic monomer”, or “amino acid residue” refer to any of the twenty naturally occurring amino acids including synthetic amino acids with unnatural side chains and including both D and L optical isomers.
[0075] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
[0076] The term “promoter” as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence. For example, the promoter that is recognized by bacteriophage RNA polymerase and is used to generate the mRNA by in vitro transcription.
[0077] The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.
[0078] The phrase “under transcriptional control” or “operatively linked” as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.
[0079] The term “therapeutic” as used herein means a treatment and / or prophylaxis. A therapeutic effect is obtained by suppression, diminution, remission, or eradication of at least one sign or symptom of a disease or disorder state.
[0080] As used herein, the terms “therapeutic compound”, “therapeutic agent”, “drug”, “active pharmaceutical”, and “active pharmaceutical ingredient” are used interchangeably to refer to chemical entities that display certain pharmacological effects in a body and are administered for such purpose. Non-limiting examples of therapeutic agents include, but are not limited to, hydrophilic therapeutic agents, hydrophobic therapeutic agents, antibiotics, antibodies, small molecules, anti-cancer agents, chemotherapeutic agents, immunomodulatory agents, RNA molecules, siRNA molecules, DNA molecules, gene editing agents, genesilencing agents, CRISPR-associated agents (e.g., guide RNA molecules, endonucleases, and variants thereof), analgesics, vaccines, anticonvulsants; anti-diabetic agents, antifungal agents, antineoplastic agents, anti-parkinsonian agents, anti-rheumatic agents, appetite suppressants, biological response modifiers, cardiovascular agents, central nervous system stimulants, contraceptive agents, dietary supplements, vitamins, minerals, lipids, saccharides, metals, amino acids (and precursors), nucleic acids and precursors, contrast agents, diagnostic agents, dopamine receptor agonists, erectile dysfunction agents, fertility agents, gastrointestinal agents, hormones, immunomodulators, antihypercalcemia agents, mast cell stabilizers, muscle relaxants, nutritional agents, ophthalmic agents, osteoporosis agents, psychotherapeutic agents, parasympathomimetic agents, parasympatholytic agents, respiratory agents, sedative hypnotic agents, skin and mucous membrane agents, smoking cessation agents, steroids, sympatholytic agents, urinary tract agents, uterine relaxants, vaginal agents, vasodilator, anti -hypertensive,hyperthyroids, anti-hyperthyroids, anti-asthmatics and vertigo agents. In certain embodiments, the one or more therapeutic agents are water-soluble, poorly water-soluble drug or a drug with a low, medium or high melting point. The therapeutic agents may be provided with or without a stabilizing salt or salts.
[0081] Some examples of active ingredients suitable for use in the pharmaceutical formulations and methods of the present invention include: hydrophilic, lipophilic, amphiphilic or hydrophobic, and that can be solubilized, dispersed, or partially solubilized and dispersed, on or about the nanocluster. The active agent-nanocluster combination may be coated further to encapsulate the agent-nanocluster combination and may be directed to a target by functionalizing the nanocluster with, e.g., aptamers and / or antibodies. Alternatively, an active ingredient may also be provided separately from the solid pharmaceutical composition, such as for co-administration. Such active ingredients can be any compound or mixture of compounds having therapeutic or other value when administered to an animal, particularly to a mammal, such as drugs, nutrients, cosmeceuticals, nutraceuticals, diagnostic agents, nutritional agents, and the like. The active agents described herein may be found in their native state, however, they will generally be provided in the form of a salt. The active agents described herein include their isomers, analogs and derivatives.
[0082] An “effective amount” as used herein, means an amount which provides a therapeutic or prophylactic benefit.
[0083] The term “therapeutically effective amount” refers to the amount of the subject compound that will elicit the biological or medical response of a tissue, system, or subject that is being sought by the researcher, veterinarian, medical doctor or other clinician. The term “therapeutically effective amount” includes that amount of a compound that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the signs or symptoms of the disorder or disease being treated. The therapeutically effective amount will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated.
[0084] The terms “patient,” “subject,” “individual,” and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject or individual is a human.
[0085] A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.
[0086] In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.
[0087] To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0088] As used herein, “treating a disease or disorder” means reducing the frequency with which a symptom of the disease or disorder is experienced by a patient. Disease and disorder are used interchangeably herein.
[0089] A disease or disorder is “alleviated” if the severity of at least one sign or symptom of the disease or disorder, the frequency with which such at least one sign or symptom is experienced by a patient, or both, is reduced.
[0090] By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and / or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and / or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, such as, a human.
[0091] “Parenteral” administration of a composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrastemal injection, or infusion techniques.
[0092] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4,from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.Description
[0093] The present invention is based, in part, on the unexpected results that nanoparticles comprising at least one ionizable amphiphilic Janus dendrimer having the structure of Formula (I) or Formula (II) effectively and efficiently delivered an agent to a target of interest. Thus, in one aspect, the present invention relates to an ionizable amphiphilic Janus dendrimer having the structure of Formula (I) or Formula (II). In another aspect, the present invention relates to a nanoparticle comprising at least one ionizable amphiphilic Janus dendrimer of the present invention. In some embodiments, the nanoparticle further comprises at least one agent. In some embodiment, the nanoparticle further comprises at least one agent that is encapsulated by the ionizable amphiphilic Janus dendrimer of the present invention. In another aspect, the present invention relates to a composition comprising at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle thereof. In some embodiments, the composition is a vaccine.
[0094] In one aspect, the present invention relates to compositions for delivering an agent to a target of interest using at least one ionizable amphiphilic Janus dendrimer (IAJD) of the present invention or a nanoparticle or a composition thereof, and method of use of the IAJD for targeted delivery of therapeutic agents to the lung. In another aspect, the present invention relates to methods of preventing or treating a lung disease or disorder in a subject using at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle or a composition thereof. In another aspect, the present invention relates to methods of reducing lung inflammation in a subject using at least one ionizable amphiphilic Janus dendrimer of the present invention or a nanoparticle or a composition thereof.Nanoparticles
[0095] In some embodiments, the amphiphilic Janus dendrimer is an amphiphilic Janus dendrimer 34 (IAJD34) having a structure of:Formula (I).
[0096] In some embodiments, the amphiphilic Janus dendrimer is an amphiphilic Janus dendrimer 33 (IAJD33) having a structure of:Formula (II).
[0097] In one aspect, the invention relates to nanoparticles comprising at least one amphiphilic Janus dendrimer of the present invention.
[0098] In various embodiments, the nanoparticle is a one-component nanoparticle.
[0099] In some embodiments, the nanoparticle is a racemic ionizable amphiphilic Janus dendrimer.
[0100] In some embodiments, the nanoparticle is a dendrimersome nanoparticle (DNP).
[0101] In some embodiments, the nanoparticle comprises at least two amphiphilic Janus dendrimers. Thus, in some embodiments, the nanoparticle comprises a first ionizableamphiphilic Janus dendrimer and a second ionizable amphiphilic Janus dendrimer. In some embodiments, the first ionizable amphiphilic Janus dendrimer has a different structure than the second ionizable amphiphilic Janus dendrimer.
[0102] In some embodiments, the nanoparticles further comprise at least one amphiphilic Janus dendrimer disclosed in Wang, et al., J. Am. Chem. Soc. 2020, 142, 9525-9536; Xiao et al., J. Am. Chem. Soc. 2016, 138, 12655-12663; Torre et al., Proc. Natl. Acad. Sci. U.S.A. 2019, 116, 15378-15385; Percec et al., J. Am. Chem. Soc. 2021, 143, 17724-17743; Wilson et al., J. Polym. Sci. Part A: Polymer Chemistry, 2010, 2498-2508; Xiao et al., Proc. Natl. Acad. Sci. U. S. A. 2017, E7045-E7053; U.S. Patent Application Publication No. 2012277460; U.S. Patent No. 8,614,347; or International Patent Application Publication No. WO2022 / 251191, each of which is hereby incorporated by reference in their entireties.
[0103] In various embodiments, the nanoparticle has a mean diameter of from about 10 nm to about 100,000 nm, about 30 nm to about 1000 nm, about 30 nm to about 500 nm, from about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about 110 nm, from about 70 nm to about 100 nm, from about 80 nm to about 100 nm, from about 90 nm to about 100 nm, from about 70 to about 90 nm, from about 80 nm to about 90 nm, from about 70 nm to about 80 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, 160 nm, 170 nm, 200 nm, 250 nm, 300 nm, 310 nm, 375 nm, 400 nm, 500 nm, 800 nm, 1000 nm, 1250 nm, 1400 nm, or 1500 nm. For example, in some embodiments, the the nanoparticle has a mean diameter of from about 10 nm to about 1,000 nm.
[0104] In various embodiments, the nanoparticle is substantially non-toxic.
[0105] In various embodiments, the nanoparticle is biodegradable.
[0106] In one aspect of the invention, the nanoparticle comprises at least one cargo. In various aspects, the invention is not limited to any particular cargo or otherwise agent for which the nanoparticle is able to carry or transport. Rather, the invention includes any agent that can be carried by the nanoparticle. For example, agents that can be carried by the nanoparticle of the invention include, but are not limited to, diagnostic agents, detectable agents, and therapeutic agents. Thus, in various embodiments, the nanoparticle comprises at least one agent. In other embodiments, the nanoparticle encapsulates at least one agent.
[0107] In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 1 : 1 to about 10,000 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 2 : 1 to about 1,000 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 3 : 1 to about 10 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 4 : 1 to about 10 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 5 : 1 to about 10 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 6 : 1 to about 10 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 7 : 1 to about 10 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 8 : 1 to about 10 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 9 : 1 to about 10 : 1. In some embodiments, the nanoparticle comprises, or encapsulates, at least one agent. In some embodiments, the weight ratio of the amphiphilic Janus dendrimer : the at least one agent is between about 9.5 : 1 to about 10 : 1.
[0108] In various embodiments, the nanoparticle is suitable for delivering at least one cargo to a cell of interest.
[0109] For example, in some embodiments, the cargo is at least one agent comprising a diagnostic agent, detectable agent, therapeutic agent, nucleic acid molecule, gene editing agent, vaccine, composition for protein replacement therapy, or any combination thereof. In some embodiments, the at least one agent is selected from an mRNA, siRNA, microRNA, CRISPR- Cas9, sgRNA, small molecule, protein, antibody, peptide, protein, or any combination thereof.In some embodiments, the at least one agent comprises a nucleic acid molecule. In some embodiments, the nucleic acid molecule encodes at least one selected from an antigen, antibody, gene editing molecule, chimeric antigen receptor (CAR), or any combination thereof. In some embodiments, the nucleic acid molecule is a DNA molecule or an RNA molecule. In some embodiments, the nucleic acid molecule is selected from cDNA, cRNA, CirRNA, mRNA, miRNA, siRNA, sgRNA, modified RNA, tRNA, antagomir, antisense molecule, targeted nucleic acid, or any combination thereof. In some embodiments, the modified RNA is a nucleoside-modified RNA. In some embodiments, the nucleoside-modified RNA comprises pseudouridine. In some embodiments, the nucleoside-modified RNA comprises pseudouridine plus 5-methyl-cytosine. In some embodiments, the nucleoside-modified RNA comprises 5- methyl-uridine. In some embodiments, the nucleoside-modified RNA comprises 1-methyl- pseudouridine.
[0110] Thus, in one embodiment, the nanoparticles may be used for the delivery of nucleoside-modified RNA to a subject in need thereof. In certain embodiments, delivery of a nucleoside-modified RNA to a subject comprises mixing the nucleoside-modified RNA with at least one nanoparticle comprising an LAID of Formula (I) or Formula (II) prior to the step of contacting. In another embodiment, a method of invention further comprises administering nucleoside-modified RNA together with at least one nanoparticle comprising an IAJD of Formula (I) or Formula (II).
[0111] In some embodiments, the composition provides for targeted delivery of the encapsulated agent to the lungs. In one embodiment, the composition provides for delivery of mRNA molecules encoding anti-inflammatory drugs to the lungs. Exemplary agents that can be delivered include, but are not limited to, TGF-0, Alpha- 1 -antitrypsin (A1AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP- B) or surfactant protein C (SP-C) or a fragment or variant thereof. In one embodiment, the composition provides for delivery of mRNA molecules encoding TGF-P to the lungs. In certain embodiments, the nucleoside-modified RNA, when present in the nanoparticles, is resistant in aqueous solution to degradation with a nuclease.Nucleic Acid Therapeutic Agents
[0112] In some embodiments, the therapeutic agent is an isolated nucleic acid. In certain embodiments, the isolated nucleic acid molecule is one of a DNA molecule or an RNA molecule. In certain embodiments, the isolated nucleic acid molecule is a cDNA, mRNA, siRNA, shRNA or miRNA molecule. In one embodiment, the isolated nucleic acid molecule encodes a therapeutic peptide such a thrombomodulin, endothelial protein C receptor (EPCR), anti -thrombotic proteins including plasminogen activators and their mutants, antioxidant proteins including catalase, superoxide dismutase (SOD) and iron-sequestering proteins. In some embodiments, the therapeutic agent is an siRNA, miRNA, shRNA, or an antisense molecule, which inhibits a targeted nucleic acid including those encoding proteins that are involved in aggravation of the pathological processes.
[0113] In one embodiment, the nucleic acid comprises a promoter / regulatory sequence such that the nucleic acid is capable of directing expression of the nucleic acid. Thus, the invention encompasses expression vectors and methods for the introduction of exogenous nucleic acid into cells with concomitant expression of the exogenous nucleic acid in the cells such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York) and as described elsewhere herein.
[0114] In one embodiment, siRNA is used to decrease the level of a targeted protein. RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U.S. Patent No. 6,506,559; Fire et al., 1998, Nature 391(19):306-311 ; Timmons et al., 1998, Nature 395:854; Montgomery et al., 1998, TIG 14 (7):255-258; David R. Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Gregory J. Hannon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, NY (2003). Soutschek et al. (2004, Nature 432:173-178) describe a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G / C content, C / T content at the termini, Tm and the nucleotide content of the 3’ overhang. See, for instance, Schwartz et al., 2003, Cell, 115: 199- 208 and Khvorova et al., 2003, Cell 115:209-216. Therefore, the invention also includes methods of decreasing levels of PTPN22 using RNAi technology.
[0115] In one aspect, the invention includes a vector comprising an siRNA or an antisense polynucleotide. In some embodiments, the siRNA or antisense polynucleotide is capable of inhibiting the expression of a target polypeptide. The incorporation of a desired polynucleotide into a vector and the choice of vectors are well-known in the art as described in, for example, Sambrook et al. (2012), and in Ausubel et al. (1997), and elsewhere herein.
[0116] In certain embodiments, the expression vectors described herein encode a short hairpin RNA (shRNA) therapeutic agents. shRNA molecules are well known in the art and are directed against the mRNA of a target, thereby decreasing the expression of the target. In certain embodiments, the encoded shRNA is expressed by a cell, and is then processed into siRNA. For example, in certain instances, the cell possesses native enzymes (e.g., dicer) that cleave the shRNA to form siRNA.
[0117] In order to assess the expression of the siRNA, shRNA, or antisense polynucleotide, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification of expressing cells from the population of cells sought to be transfected or infected using a the delivery vehicle of the invention. In other embodiments, the selectable marker may be carried on a separate piece of DNA and also be contained within the delivery vehicle. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibioticresistance genes, such as neomycin resistance and the like.
[0118] Therefore, in one aspect, the delivery vehicle may contain a vector, comprising the nucleotide sequence or the construct to be delivered. The choice of the vector will depend on the host cell in which it is to be subsequently introduced. In a particular embodiment, the vector of the invention is an expression vector. Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. In specific embodiments, the expression vector isselected from the group consisting of a viral vector, a bacterial vector and a mammalian cell vector. Prokaryote- and / or eukaryote-vector based systems can be employed for use with the invention to produce polynucleotides, or their cognate polypeptides. Many such systems are commercially and widely available.
[0119] By way of illustration, the vector in which the nucleic acid sequence is introduced can be a plasmid, which is or is not integrated in the genome of a host cell when it is introduced in the cell. Illustrative, non-limiting examples of vectors in which the nucleotide sequence of the invention or the gene construct of the invention can be inserted include a tet-on inducible vector for expression in eukaryote cells.
[0120] The vector may be obtained by conventional methods known by persons skilled in the art (Sambrook et al., 2012). In a particular embodiment, the vector is a vector useful for transforming animal cells.
[0121] In one embodiment, the recombinant expression vectors may also contain nucleic acid molecules, which encode a peptide or peptidomimetic.
[0122] A promoter may be one naturally associated with a gene or polynucleotide sequence, as may be obtained by isolating the 5’ non-coding sequences located upstream of the coding segment and / or exon. Such a promoter can be referred to as “endogenous.” Similarly, an enhancer may be one naturally associated with a polynucleotide sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding polynucleotide segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a polynucleotide sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a polynucleotide sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not “naturally occurring,” i.e., containing different elements of different transcriptional regulatory regions, and / or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and / or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (U.S. Patent 4,683,202, U.S. Patent 5,928,906). Furthermore, it is contemplated the control sequences that directtranscription and / or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.
[0123] Naturally, it will be important to employ a promoter and / or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know how to use promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. (2012). The promoters employed may be constitutive, tissue-specific, inducible, and / or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and / or peptides. The promoter may be heterologous or endogenous.
[0124] The recombinant expression vectors may also contain a selectable marker gene, which facilitates the selection of host cells. Suitable selectable marker genes are genes encoding proteins such as G418 and hygromycin, which confer resistance to certain drugs, P- galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin such as IgG. The selectable markers may be introduced on a separate vector from the nucleic acid of interest.
[0125] Following the generation of the siRNA polynucleotide, a skilled artisan will understand that the siRNA polynucleotide will have certain characteristics that can be modified to improve the siRNA as a therapeutic compound. Therefore, the siRNA polynucleotide may be further designed to resist degradation by modifying it to include phosphorothioate, or other linkages, methylphosphonate, sulfone, sulfate, ketyl, phosphorodithioate, phosphoramidate, phosphate esters, and the like (see, e.g., Agrawal et al., 1987, Tetrahedron Lett. 28:3539-3542; Stec et al., 1985 Tetrahedron Lett. 26:2191-2194; Moody et al., 1989 Nucleic Acids Res. 12:4769-4782; Eckstein, 1989 Trends Biol. Sci. 14:97-100; Stein, In: Oligodeoxynucleotides. Antisense Inhibitors of Gene Expression, Cohen, ed., Macmillan Press, London, pp. 97-117 (1989)).
[0126] Any polynucleotide may be further modified to increase its stability in vivo. Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and / or 3' ends; the use of phosphorothioate or 2' O-methyl rather than phosphodiester linkages in the backbone; and / or the inclusion of nontraditional bases such as inosine,queuosine, and wybutosine and the like, as well as acetyl- methyl-, thio- and other modified forms of adenine, cytidine, guanine, thymine, and uridine.
[0127] In one embodiment of the invention, an antisense nucleic acid sequence, which is expressed by a plasmid vector is used as a therapeutic agent to inhibit the expression of a target protein. The antisense expressing vector is used to transfect a mammalian cell or the mammal itself, thereby causing reduced endogenous expression of the target protein.
[0128] Antisense molecules and their use for inhibiting gene expression are well known in the art (see, e.g., Cohen, 1989, In: Oligodeoxyribonucleotides, Antisense Inhibitors of Gene Expression, CRC Press). Antisense nucleic acids are DNA or RNA molecules that are complementary, as that term is defined elsewhere herein, to at least a portion of a specific mRNA molecule (Weintraub, 1990, Scientific American 262:40). In the cell, antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule thereby inhibiting the translation of genes.
[0129] The use of antisense methods to inhibit the translation of genes is known in the art, and is described, for example, in Marcus-Sakura (1988, Anal. Biochem. 172:289). Such antisense molecules may be provided to the cell via genetic expression using DNA encoding the antisense molecule as taught by Inoue, 1993, U.S. Patent No. 5,190,931.
[0130] Alternatively, antisense molecules of the invention may be made synthetically and then provided to the cell. Antisense oligomers of between about 10 to about 30, or 15 nucleotides, are useful in some embodiments since they are easily synthesized and introduced into a target cell. Synthetic antisense molecules contemplated by the invention include oligonucleotide derivatives known in the art which have improved biological activity compared to unmodified oligonucleotides (see U.S. Patent No. 5,023,243).
[0131] In one embodiment of the invention, a ribozyme is used as a therapeutic agent to inhibit expression of a target protein. Ribozymes useful for inhibiting the expression of a target molecule may be designed by incorporating target sequences into the basic ribozyme structure, which are complementary, for example, to the mRNA sequence encoding the target molecule. Ribozymes targeting the target molecule, may be synthesized using commercially available reagents (Applied Biosystems, Inc., Foster City, CA) or they may be genetically expressed from DNA encoding them.
[0132] In one embodiment, the therapeutic agent may comprise one or more components of a CRISPR-Cas system, where a guide RNA (gRNA) targeted to a gene encoding a target molecule, and a CRISPR-associated (Cas) peptide form a complex to induce mutations within the targeted gene. In one embodiment, the therapeutic agent comprises a gRNA or a nucleic acid molecule encoding a gRNA. In one embodiment, the therapeutic agent comprises a Cas peptide or a nucleic acid molecule encoding a Cas peptide.
[0133] In one embodiment, the agent comprises a miRNA or a mimic of a miRNA. In one embodiment, the agent comprises a nucleic acid molecule that encodes a miRNA or mimic of a miRNA.
[0134] MiRNAs are small non-coding RNA molecules that are capable of causing post- transcriptional silencing of specific genes in cells by the inhibition of translation or through degradation of the targeted mRNA. A miRNA can be completely complementary or can have a region of noncomplementarity with a target nucleic acid, consequently resulting in a "bulge" at the region of non-complementarity. A miRNA can inhibit gene expression by repressing translation, such as when the miRNA is not completely complementary to the target nucleic acid, or by causing target RNA degradation, which is believed to occur only when the miRNA binds its target with perfect complementarity. The disclosure also can include double-stranded precursors of miRNA. A miRNA or pri-miRNA can be 18- 100 nucleotides in length, or from 18-80 nucleotides in length. Mature miRNAs can have a length of 19-30 nucleotides, or 21-25 nucleotides, particularly 21, 22, 23, 24, or 25 nucleotides. MiRNA precursors typically have a length of about 70-100 nucleotides and have a hairpin conformation. miRNAs are generated in vivo from pre- miRNAs by the enzymes Dicer and Drosha, which specifically process long pre- miRNA into functional miRNA. The hairpin or mature microRNAs, or pri-microRNA agents featured in the disclosure can be synthesized in vivo by a cell-based system or in vitro by chemical synthesis.
[0135] In various embodiments, the agent comprises an oligonucleotide that comprises the nucleotide sequence of a disease-associated miRNA. In certain embodiments, the oligonucleotide comprises the nucleotide sequence of a disease-associated miRNA in a pre - microRNA, mature or hairpin form. In other embodiments, a combination of oligonucleotides comprising a sequence of one or more disease-associated miRNAs, any pre -miRNA, any fragment, or any combination thereof is envisioned.
[0136] MiRNAs can be synthesized to include a modification that imparts a desired characteristic. For example, the modification can improve stability, hybridization thermodynamics with a target nucleic acid, targeting to a particular tissue or cell -type, or cell permeability, e.g., by an endocytosis-dependent or -independent mechanism.
[0137] Modifications can also increase sequence specificity, and consequently decrease off-site targeting. Methods of synthesis and chemical modifications are described in greater detail below. If desired, miRNA molecules may be modified to stabilize the miRNAs against degradation, to enhance half-life, or to otherwise improve efficacy. Desirable modifications are described, for example, in U.S. Patent Publication Nos. 20070213292, 20060287260, 20060035254. 20060008822. and 2005028824, each of which is hereby incorporated by reference in its entirety. For increased nuclease resistance and / or binding affinity to the target, the single- stranded oligonucleotide agents featured in the disclosure can include 2'-O-methyl, 2'-fluorine, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-amino, and / or phosphorothioate linkages. Inclusion of locked nucleic acids (LNA), ethylene nucleic acids (ENA), e.g., 2'-4'-ethylene- bridged nucleic acids, and certain nucleotide modifications can also increase binding affinity to the target. The inclusion of pyranose sugars in the oligonucleotide backbone can also decrease endonucleolytic cleavage. An oligonucleotide can be further modified by including a 3' cationic group, or by inverting the nucleoside at the 3 '-terminus with a 3 -3' linkage. In another alternative, the 3 '-terminus can be blocked with an aminoalkyl group. Other 3' conjugates can inhibit 3'-5' exonucleolytic cleavage. While not being bound by theory, a 3' may inhibit exonucleolytic cleavage by sterically blocking the exonuclease from binding to the 3' end of the oligonucleotide. Even small alkyl chains, aryl groups, or heterocyclic conjugates or modified sugars (D-ribose, deoxyribose, glucose etc.) can block 3'-5'-exonucleases.
[0138] In one embodiment, the miRNA includes a 2'-modified oligonucleotide containing oligodeoxynucleotide gaps with some or all intemucleotide linkages modified to phosphorothioates for nuclease resistance. The presence of methylphosphonate modifications increases the affinity of the oligonucleotide for its target RNA and thus reduces the IC5Q. This modification also increases the nuclease resistance of the modified oligonucleotide. It is understood that the methods and reagents of the present disclosure may be used in conjunction with any technologies that may be developed to enhance the stability or efficacy of an inhibitory nucleic acid molecule.
[0139] miRNA molecules include nucleotide oligomers containing modified backbones or non-natural internucleoside linkages. Oligomers having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this disclosure, modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone are also considered to be nucleotide oligomers. Nucleotide oligomers that have modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriest- ers, and boranophosphates. Various salts, mixed salts and free acid forms are also included.
[0140] A miRNA described herein, which may be in the mature or hairpin form, may be provided as a naked oligonucleotide. In some cases, it may be desirable to utilize a formulation that aids in the delivery of a miRNA or other nucleotide oligomer to cells (see, e.g., U.S. Pat. Nos. 5,656,61 1, 5,753,613, 5,785,992, 6,120,798, 6,221,959, 6,346,613, and 6,353,055, each of which is hereby incorporated by reference).
[0141] In some examples, the miRNA composition is at least partially crystalline, uniformly crystalline, and / or anhydrous (e.g., less than 80, 50, 30, 20, or 10% water). In another example, the miRNA composition is in an aqueous phase, e.g., in a solution that includes water. The aqueous phase or the crystalline compositions can be incorporated into a delivery vehicle, e.g., a liposome (particularly for the aqueous phase), or a particle (e.g., a microparticle as can be appropriate for a crystalline composition). Generally, the miRNA composition is formulated in a manner that is compatible with the intended method of administration. A miRNA composition can be formulated in combination with another agent, e.g., another therapeutic agent or an agent that stabilizes an oligonucleotide agent, e.g., a protein that complexes with the oligonucleotide agent. Still other agents include chelators, e.g., EDTA (e.g., to remove divalent cations such as Mg), salts, and RNAse inhibitors (e.g., a broad specificity RNAse inhibitor). In one embodiment, the miRNA composition includes another miRNA, e g., a second miRNA composition (e.g., a microRNA that is distinct from the first). Still other preparations can include at least three, five, ten, twenty, fifty, or a hundred or more different oligonucleotide species.
[0142] In certain embodiments, the composition comprises an oligonucleotide composition that mimics the activity of a miRNA. In certain embodiments, the composition comprises oligonucleotides having nucleobase identity to the nucleobase sequence of a miRNA, and are thus designed to mimic the activity of the miRNA. In certain embodiments, the oligonucleotide composition that mimics miRNA activity comprises a double-stranded RNA molecule which mimics the mature miRNA hairpins or processed miRNA duplexes.
[0143] In one embodiment, the oligonucleotide shares identity with endogenous miRNA or miRNA precursor nucleobase sequences. An oligonucleotide selected for inclusion in a composition of the invention may be one of a number of lengths. Such an oligonucleotide can be from 7 to 100 linked nucleosides in length. For example, an oligonucleotide sharing nucleobase identity with a miRNA may be from 7 to 30 linked nucleosides in length. An oligonucleotide sharing identity with a miRNA precursor may be up to 100 linked nucleosides in length. In certain embodiments, an oligonucleotide comprises 7 to 30 linked nucleosides. In certain embodiments, an oligonucleotide comprises 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 28, 29, or 30 linked nucleotides. In certain embodiments, an oligonucleotide comprises 19 to 23 linked nucleosides. In certain embodiments, an oligonucleotide is from 40 up to 50, 60, 70, 80, 90, or 100 linked nucleosides in length.
[0144] In certain embodiments, an oligonucleotide has a sequence that has a certain identity to a miRNA or a precursor thereof. Nucleobase sequences of mature miRNAs and their corresponding stem-loop sequences described herein are the sequences found in miRBase, an online searchable database of miRNA sequences and annotation. Entries in the miRBase Sequence database represent a predicted hairpin portion of a miRNA transcript (the stem-loop), with information on the location and sequence of the mature miRNA sequence. The miRNA stem-loop sequences in the database are not strictly precursor miRNAs (pre-miRNAs), and may in some instances include the pre-miRNA and some flanking sequence from the presumed primary transcript. The miRNA nucleobase sequences described herein encompass any version of the miRNA, including the sequences described in Release 10.0 of the miRBase sequence database and sequences described in any earlier Release of the miRBase sequence database. A sequence database release may result in the re-naming of certain miRNAs. A sequence database release may result in a variation of a mature miRNA sequence. The compositions of theinvention encompass oligomeric compound comprising oligonucleotides having a certain identity to any nucleobase sequence version of a miRNAs described herein.
[0145] In certain embodiments, an oligonucleotide has a nucleobase sequence at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to the miRNA over a region of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases. Accordingly, in certain embodiments the nucleobase sequence of an oligonucleotide may have one or more non-identical nucleobases with respect to the miRNA.
[0146] In certain embodiments, the composition comprises a nucleic acid molecule encoding a miRNA, precursor, mimic, or fragment thereof. For example, the composition may comprise a viral vector, plasmid, cosmid, or other expression vector suitable for expressing the miRNA, precursor, mimic, or fragment thereof in a desired mammalian cell or tissue.
[0147] In one embodiment, the invention includes a nanoparticle comprising or encapsulating one or more nucleic acid molecule. In one embodiment, the nucleic acid molecule is a nucleoside-modified mRNA molecule. In one embodiment, the nucleoside- modified mRNA molecule encodes a therapeutic agent. In one embodiment, the nucleoside- modified mRNA molecule encodes a plurality of therapeutic agents. In certain embodiments, the nucleoside-modified mRNA molecule encodes an anti-inflammatory agent.
[0148] The nucleotide sequences encoding a therapeutic agent, as described herein, can alternatively comprise sequence variations with respect to an original nucleotide sequence, for example, substitutions, insertions and / or deletions of one or more nucleotides, with the condition that the resulting polynucleotide encodes a polypeptide according to the invention.
[0149] Further, the scope of the invention includes nucleotide sequences that encode amino acid sequences that are substantially homologous to the amino acid sequences recited herein and preserve the immunogenic function of the original amino acid sequence.
[0150] As used herein, an amino acid sequence is “substantially homologous” to any of the amino acid sequences described herein when its amino acid sequence has a degree of identity with respect to the amino acid sequence of at least 60%, at least 70%, at least 85%, at least 95%, or greater than 95%. In some embodiments, the identity between two amino acid sequences is determined by using the BLASTN algorithm (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S„ et al., J. Mol. Biol. 215: 403-410 (1990)).
[0151] In one embodiment, the invention relates to a construct, comprising a nucleotide sequence encoding a therapeutic agent. In one embodiment, the construct comprises a plurality of nucleotide sequences encoding a plurality of therapeutic agents. For example, in certain embodiments, the construct encodes 1 or more, 2 or more, 5 or more, 10 or more, 15 or more, or 20 or more therapeutic agents. Exemplary therapeutic agents that can be delivered include, but are not limited to, TGF-P, Alpha- 1 -antitrypsin (A1AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP-B) or surfactant protein C (SP-C) or a fragment or variant thereof.
[0152] In one embodiment, the therapeutic agent comprises a nucleotide sequence encoding TGFp, or a fragment or variant thereof. In some embodiments, the nucleotide sequence encoding TGFP comprises:ATGCCCCCCTCCGGCCTGCGCCTGCTGCCCCTGCTGCTGCCCCTGCCC TGGCTGCTGGTGCTGACCCCCGGCCGCCCCGCCGCCGGCCTGTCCACCTGCAAGAC CATCGACATGGAGCTGGTGAAGCGCAAGCGCATCGAGGCCATCCGCGGCCAGATC CTGTCCAAGCTGCGCCTGGCCTCCCCCCCCTCCCAGGGCGAGGTGCCCCCCGGCCC CCTGCCCGAGGCCGTGCTGGCCCTGTACAACTCCACCCGCGACCGCGTGGCCGGCG AGTCCGCCGACCCCGAGCCCGAGCCCGAGGCCGACTACTACGCCAAGGAGGTGAC CCGCGTGCTGATGGTGGACCGCAACAACGCCATCTACGAGAAGACCAAGGACATC TCCCACTCCATCTACATGTTCTTCAACACCTCCGACATCCGCGAGGCCGTGCCCGA GCCCCCCCTGCTGTCCCGCGCCGAGCTGCGCCTGCAGCGCCTGAAGTCCTCCGTGG AGCAGCACGTGGAGCTGTACCAGAAGTACTCCAACAACTCCTGGCGCTACCTGGG CAACCGCCTGCTGACCCCCACCGACACCCCCGAGTGGCTGTCCTTCGACGTGACCG GCGTGGTGCGCCAGTGGCTGAACCAGGGCGACGGCATCCAGGGCTTCCGCTTCTCC GCCCACTGCTCCTGCGACTCCAAGGACAACAAGCTGCACGTGGAGATCAACGGCA TCTCCCCCAAGCGCCGCGGCGACCTGGGCACCATCCACGACATGAACCGCCCCTTC CTGCTGCTGATGGCCACCCCCCTGGAGCGCGCCCAGCACCTGCACTCCTCCCGCCA CCGCCGCGCCCTGGACACCAACTACTGCTTCTCCTCCACCGAGAAGAACTGCTGCG TGCGCCAGCTGTACATCGACTTCCGCAAGGACCTGGGCTGGAAGTGGATCCACGA GCCCAAGGGCTACCACGCCAACTTCTGCCTGGGCCCCTGCCCCTACATCTGGTCCC TGGACACCCAGTACTCCAAGGTGCTGGCCCTGTACAACCAGCACAACCCCGGCGC CTCCGCCTCCCCCTGCTGCGTGCCCCAGGCCCTGGAGCCCCTGCCCATCGTGTACTACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCCAACATGATCGTGCGCTCCTG CAAGTGCTCC (SEQ ID NO: 1), or an RNA molecule comprising an RNA sequence corresponding to SEQ ID NO: 1.
[0153] In one embodiment, the therapeutic agent comprises a nucleotide sequence encoding A1AT isoform 1 (AATl-isol), or a fragment or variant thereof. In some embodiments, the nucleotide sequence encoding A1AT comprises:ATGACCCCCTCCATCTCCTGGGGCCTGCTGCTGCTGGCCGGCCTGTGC TGCCTGGTGCCCTCCTTCCTGGCCGAGGACGTGCAGGAGACCGACACCTCCCAGAA GGACCAGTCCCCCGCCTCCCACGAGATCGCCACCAACCTGGGCGACTTCGCCATCT CCCTGTACCGCGAGCTGGTGCACCAGTCCAACACCTCCAACATCTTCTTCTCCCCC GTGTCCATCGCCACCGCCTTCGCCATGCTGTCCCTGGGCTCCAAGGGCGACACCCA CACCCAGATCCTGGAGGGCCTGCAGTTCAACCTGACCCAGACCTCCGAGGCCGAC ATCCACAAGTCCTTCCAGCACCTGCTGCAGACCCTGAACCGCCCCGACTCCGAGCT GCAGCTGTCCACCGGCAACGGCCTGTTCGTGAACAACGACCTGAAGCTGGTGGAG AAGTTCCTGGAGGAGGCCAAGAACCACTACCAGGCCGAGGTGTTCTCCGTGAACTT CGCCGAGTCCGAGGAGGCCAAGAAGGTGATCAACGACTTCGTGGAGAAGGGCACC CAGGGCAAGATCGCCGAGGCCGTGAAGAAGCTGGACCAGGACACCGTGTTCGCCC TGGCCAACTACATCCTGTTCAAGGGCAAGTGGAAGAAGCCCTTCGACCCCGAGAA CACCGAGGAGGCCGAGTTCCACGTGGACGAGTCCACCACCGTGAAGGTGCCCATG ATGACCCTGTCCGGCATGCTGCACGTGCACCACTGCTCCACCCTGTCCTCCTGGGT GCTGCTGATGGACTACGCCGGCAACGCCACCGCCGTGTTCCTGCTGCCCGACGACG GCAAGATGCAGCACCTGGAGCAGACCCTGTCCAAGGAGCTGATCTCCAAGTTCCTG CTGAACCGCCGCCGCCGCCTGGCCCAGATCCACTTCCCCCGCCTGTCCATCTCCGG CGAGTACAACCTGAAGACCCTGATGTCCCCCCTGGGCATCACCCGCATCTTCAACA ACGGCGCCGACCTGTCCGGCATCACCGAGGAGAACGCCCCCCTGAAGCTGTCCCA GGCCGTGCACAAGGCCGTGCTGACCATCGACGAGACCGGCACCGAGGCCGCCGCC GTGACCGTGCTGCAGATGGTGCCCATGTCCATGCCCCCCATCCTGCGCTTCGACCA CCCCTTCCTGTTCATCATCTTCGAGGAGCACACCCAGTCCCCCATCTTCCTGGGCAA GGTGGTGGACCCCACCCACAAGTAA (SEQ ID NO:3) or an RNA molecule comprising an RNA sequence corresponding to SEQ ID NO:3.
[0154] In one embodiment, the therapeutic agent comprises a nucleotide sequence encoding A1AT isoform 2 (AATl-iso2), or a fragment or variant thereof. In some embodiments, the nucleotide sequence encoding A1AT comprises:ATGTACTGCGCCATCCGCGTGCGCCTGTCCCGCCTGTTCACCGTGAAGGGCCAGAAGGCCCGCTGGAAGATGACCCCCTCCATCTCCTGGGGCCTGCTGCTGC TGGCCGGCCTGTGCTGCCTGGTGCCCTCCTTCCTGGCCGAGGACGTGCAGGAGACC GACACCTCCCAGAAGGACCAGTCCCCCGCCTCCCACGAGATCGCCACCAACCTGG GCGACTTCGCCATCTCCCTGTACCGCGAGCTGGTGCACCAGTCCAACACCTCCAAC ATCTTCTTCTCCCCCGTGTCCATCGCCACCGCCTTCGCCATGCTGTCCCTGGGCTCC AAGGGCGACACCCACACCCAGATCCTGGAGGGCCTGCAGTTCAACCTGACCCAGA CCTCCGAGGCCGACATCCACAAGTCCTTCCAGCACCTGCTGCAGACCCTGAACCGC CCCGACTCCGAGCTGCAGCTGTCCACCGGCAACGGCCTGTTCGTGAACAACGACCT GAAGCTGGTGGAGAAGTTCCTGGAGGAGGCCAAGAACCACTACCAGGCCGAGGTG TTCTCCGTGAACTTCGCCGAGTCCGAGGAGGCCAAGAAGGTGATCAACGACTTCGT GGAGAAGGGCACCCAGGGCAAGATCGCCGAGGCCGTGAAGAAGCTGGACCAGGA CACCGTGTTCGCCCTGGCCAACTACATCCTGTTCAAGGGCAAGTGGAAGAAGCCCT TCGACCCCGAGAACACCGAGGAGGCCGAGTTCCACGTGGACGAGTCCACCACCGT GAAGGTGCCCATGATGACCCTGTCCGGCATGCTGCACGTGCACCACTGCTCCACCC TGTCCTCCTGGGTGCTGCTGATGGACTACGCCGGCAACGCCACCGCCGTGTTCCTG CTGCCCGACGACGGCAAGATGCAGCACCTGGAGCAGACCCTGTCCAAGGAGCTGA TCTCCAAGTTCCTGCTGAACCGCCGCCGCCGCCTGGCCCAGATCCACTTCCCCCGC CTGTCCATCTCCGGCGAGTACAACCTGAAGACCCTGATGTCCCCCCTGGGCATCAC CCGCATCTTCAACAACGGCGCCGACCTGTCCGGCATCACCGAGGAGAACGCCCCC CTGAAGCTGTCCCAGGCCGTGCACAAGGCCGTGCTGACCATCGACGAGACCGGCA CCGAGGCCGCCGCCGTGACCGTGCTGCAGATGGTGCCCATGTCCATGCCCCCCATC CTGCGCTTCGACCACCCCTTCCTGTTCATCATCTTCGAGGAGCACACCCAGTCCCCCATCTTCCTGGGCAAGGTGGTGGACCCCACCCACAAGTAA (SEQ ID NO: 5), or an RNA molecule comprising an RNA sequence corresponding to SEQ ID NO:5.
[0155] In one embodiment, the therapeutic agent comprises a nucleotide sequence encoding IL-1 soluble Receptor isoform 1 (ILlra-isol), or a fragment or variant thereof. In some embodiments, the nucleotide sequence encoding ILlra-isol comprises:ATGACCGCCGCCCAGGCCGAGGCCGCCTGCCGCCCCTCCGGCAAGCGCCCCTGCAAGATGCAGGCCTTCCGCATCTGGGACACCAACCAGAAGACCTTCTACCTGCGCAACAACCAGCTGATCGCCGGCTACCTGCAGGGCCCCAACATCAAGCTGGAGGAGAAGATCGACATGGTGCCCATCGACCTGCACTCCGTGTTCCTGGGCATCCACGGCGGCAAGCTGTGCCTGTCCTGCGCCAAGTCCGGCGACGACATCAAGCTGCAGCTGGAGGAGGTGAACATCACCGACCTGTCCAAGAACAAGGAGGAGGACAAGCGCTTCACCTTCATCCGCTCCGAGAAGGGCCCCACCACCTCCTTCGAGTCCGCCGCCTGCCCCGGCTGGTTCCTGTGCACCACCCTGGAGGCCGACCGCCCCGTGTCCCTGACCAACAC CCCCGAGGAGCCCCTGATCGTGACCAAGTTCTACTTCCAGGAGGACCAGTAA (SEQ ID N0:7), or an RNA molecule comprising an RNA sequence corresponding to SEQ ID NO:7.
[0156] In one embodiment, the therapeutic agent comprises a nucleotide sequence encoding IL-1 soluble Receptor isoform 2 (ILlra-iso2), or a fragment or variant thereof. In some embodiments, the nucleotide sequence encoding ILlra-iso2 comprises:ATGGAGATCTGCTGGGGCCCCTACTCCCACCTGATCTCCCTGCTGCTGATCCTGCTGTTCCACTCCGAGGCCGCCTGCCGCCCCTCCGGCAAGCGCCCCTGCAAGATGCAGGCCTTCCGCATCTGGGACACCAACCAGAAGACCTTCTACCTGCGCAACAACCAGCTGATCGCCGGCTACCTGCAGGGCCCCAACATCAAGCTGGAGGAGAAGATCGACATGGTGCCCATCGACCTGCACTCCGTGTTCCTGGGCATCCACGGCGGCAAGCTGTGCCTGTCCTGCGCCAAGTCCGGCGACGACATCAAGCTGCAGCTGGAGGAGGTGAACATCACCGACCTGTCCAAGAACAAGGAGGAGGACAAGCGCTTCACCTTCATCCGCTCCGAGAAGGGCCCCACCACCTCCTTCGAGTCCGCCGCCTGCCCCGGCTGGTTCCTGTGCACCACCCTGGAGGCCGACCGCCCCGTGTCCCTGACCAACACCCCCGAGG AGCCCCTGATCGTGACCAAGTTCTACTTCCAGGAGGACCAGTAA (SEQ ID NO:9), or an RNA molecule comprising an RNA sequence corresponding to SEQ ID NO:9.
[0157] In one embodiment, the therapeutic agent comprises a nucleotide sequence encoding IL-1 soluble Receptor isoform 3 (ILlra-iso3), or a fragment or variant thereof. In some embodiments, the nucleotide sequence encoding ILlra-iso3 comprises:ATGGCCTCCGAGGCCGCCTGCCGCCCCTCCGGCAAGCGCCCCTGCAAGATGCAGGCCTTCCGCATCTGGGACACCAACCAGAAGACCTTCTACCTGCGCAACAACCAGCTGATCGCCGGCTACCTGCAGGGCCCCAACATCAAGCTGGAGGAGAAGATCGACATGGTGCCCATCGACCTGCACTCCGTGTTCCTGGGCATCCACGGCGGCAAGCTGTGCCTGTCCTGCGCCAAGTCCGGCGACGACATCAAGCTGCAGCTGGAGGAGGT GAACATCACCGACCTGTCCAAGAACAAGGAGGAGGACAAGCGCTTCACCTTCATC CGCTCCGAGAAGGGCCCCACCACCTCCTTCGAGTCCGCCGCCTGCCCCGGCTGGTT CCTGTGCACCACCCTGGAGGCCGACCGCCCCGTGTCCCTGACCAACACCCCCGAGG AGCCCCTGATCGTGACCAAGTTCTACTTCCAGGAGGACCAGTAA (SEQ ID NO: 11), or an RNA molecule comprising an RNA sequence corresponding to SEQ ID NO: 11.
[0158] In one embodiment, the composition comprises a plurality of constructs, each construct encoding at least one therapeutic agent. In certain embodiments, the composition comprises 1 or more, 2 or more, 5 or more, 10 or more, 15 or more, or 20 or more constructs. In one embodiment, the composition comprises a first construct, comprising a nucleotide sequence encoding a first therapeutic agent; and a second construct, comprising a nucleotide sequence encoding a second agent. In some embodiments, the second agent is a second therapeutic agent.
[0159] In another particular embodiment, the construct is operatively bound to a translational control element. The construct can incorporate an operatively bound regulatory sequence for the expression of the nucleotide sequence of the invention, thus forming an expression cassette.Vectors
[0160] The nucleic acid sequences encapsulated in the nanoparticle of the invention can be obtained using recombinant methods known in the art, such as, for example by screening libraries from cells expressing the gene, by deriving the gene from a vector known to include the same, or by isolating directly from cells and tissues containing the same, using standard techniques. Alternatively, the nucleic acid molecule of interest can be produced synthetically.
[0161] The nucleic acid can be cloned into a number of types of vectors. For example, the nucleic acid can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors and vectors optimized for in vitro transcription.Nucleoside-Modified RNA
[0162] In one embodiment, the nucleic acid molecule comprises a nucleoside-modified RNA. Nucleoside-modified mRNA have particular advantages over non-modified mRNA, including for example, increased stability, low or absent innate immunogenicity, and enhanced translation. Nucleoside-modified mRNA useful in the invention is further described in U.S. Patent No. 8,278,036, which is incorporated by reference herein in its entirety.
[0163] In certain embodiments, nucleoside-modified mRNA does not activate any pathophysiologic pathways, translates very efficiently and almost immediately following delivery, and serve as templates for continuous protein production in vivo lasting for several days (Kariko et al., 2008, Mol Ther 16: 1833-1840; Kariko et al., 2012, Mol Ther 20:948-953). The amount of mRNA required to exert a physiological effect is small and that makes it applicable for human therapy.
[0164] In certain instances, expressing a protein by delivering the encoding mRNA has many benefits over methods that use protein, plasmid DNA or viral vectors. During mRNA transfection, the coding sequence of the desired protein is the only substance delivered to cells, thus avoiding all the side effects associated with plasmid backbones, viral genes, and viral proteins. More importantly, unlike DNA- and viral-based vectors, the mRNA does not carry the risk of being incorporated into the genome and protein production starts immediately after mRNA delivery. For example, high levels of circulating proteins have been measured within 15 to 30 minutes of in vivo injection of the encoding mRNA. In certain embodiments, using mRNA rather than the protein also has many advantages. Half-lives of proteins in the circulation are often short, thus protein treatment would need frequent dosing, while mRNA provides a template for continuous protein production for several days. Purification of proteins is problematic and they can contain aggregates and other impurities that cause adverse effects (Kromminga and Schellekens, 2005, Ann NY Acad Sci 1050:257-265).
[0165] In certain embodiments, the nucleoside-modified RNA comprises the naturally occurring modified-nucleoside pseudouridine. In certain embodiments, inclusion of pseudouridine makes the mRNA more stable, non-immunogenic, and highly translatable (Kariko et al., 2008, Mol Ther 16: 1833-1840; Anderson et al., 2010, Nucleic Acids Res 38:5884-5892; Anderson et al., 2011, Nucleic Acids Research 39:9329-9338; Kariko et al., 2011, Nucleic Acids Research 39:el42; Kariko et al., 2012, Mol Ther 20:948-953; Kariko et al., 2005, Immunity 23:165-175).
[0166] It has been demonstrated that the presence of modified nucleosides, including pseudouridines in RNA suppress their innate immunogenicity (Kariko et al., 2005, Immunity 23: 165-175). Further, protein-encoding, in vitro-transcribed RNA containing pseudouridine can be translated more efficiently than RNA containing no or other modified nucleosides (Kariko et al., 2008, Mol Ther 16: 1833-1840). Subsequently, it is shown that the presence of pseudouridine improves the stability of RNA (Anderson et al., 2011, Nucleic Acids Research 39:9329-9338) and abates both activation of PKR and inhibition of translation (Anderson et al., 2010, Nucleic Acids Res 38:5884-5892). A preparative HPLC purification procedure has been established that was critical to obtain pseudouridine-containing RNA that has superior translational potential and no innate immunogenicity (Kariko et al., 2011, Nucleic Acids Research 39:el42). Administering HPLC-purified, pseudouridine-containing RNA coding for erythropoietin into mice and macaques resulted in a significant increase of serum EPO levels (Kariko et al., 2012, Mol Ther 20:948-953), thus confirming that pseudouridine-containing mRNA is suitable for in vivo protein therapy.
[0167] The invention encompasses RNA, oligoribonucleotide, and polyribonucleotide molecules comprising pseudouridine or a modified nucleoside. In certain embodiments, the composition comprises an isolated nucleic acid encoding a therapeutic agent, wherein the nucleic acid comprises a pseudouridine or a modified nucleoside.
[0168] In one embodiment, the nucleoside-modified RNA of the invention is IVT RNA. For example, in certain embodiments, the nucleoside-modified RNA is synthesized by T7 phage RNA polymerase. In another embodiment, the nucleoside-modified mRNA is synthesized by SP6 phage RNA polymerase. In another embodiment, the nucleoside-modified RNA is synthesized by T3 phage RNA polymerase.
[0169] In one embodiment, the modified nucleoside is m1acp3vP (l-methyl-3-(3-amino- 3 -carboxypropyl) pseudouridine. In another embodiment, the modified nucleoside is mllP (1- methylpseudouridine). In another embodiment, the modified nucleoside is Tm (2'-O- methylpseudouridine. In another embodiment, the modified nucleoside is nr D (5- methyldihydrouridine). In another embodiment, the modified nucleoside is m3(3- methylpseudouridine). In another embodiment, the modified nucleoside is a pseudouridine moiety that is not further modified. In another embodiment, the modified nucleoside is a monophosphate, diphosphate, or triphosphate of any of the above pseudouridines. In anotherembodiment, the modified nucleoside is any other pseudouridine-like nucleoside known in the art.
[0170] In another embodiment, the nucleoside that is modified in the nucleoside- modified RNA the invention is uridine (U). In another embodiment, the modified nucleoside is cytidine (C). In another embodiment, the modified nucleoside is adenosine (A). In another embodiment the modified nucleoside is guanosine (G).
[0171] In another embodiment, the modified nucleoside of the invention is m5C (5- methylcytidine). In another embodiment, the modified nucleoside is irf U (5-methyluridine). In another embodiment, the modified nucleoside is m6A (N6-methyladenosine). In another embodiment, the modified nucleoside is s2U (2 -thiouridine). In another embodiment, the modified nucleoside is T (pseudouridine). In another embodiment, the modified nucleoside is Um (2'-O-methyluridine).
[0172] In other embodiments, the modified nucleoside is nfA (1 -methyladenosine); m2A (2-methyladenosine); Am (2'-O-methyladenosine); ms2m6A (2-methylthio-N6- methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2-methylthio- N6isopentenyladenosine); io6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2- methylthio-N6-(cis-hydroxyisopentenyl) adenosine); g6A (N6-glycinylcarbamoyladenosine); t6A (N6-threonylcarbamoyladenosine); ms2t6A (2-methylthio-N6-threonyl carbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); hn6A(N6- hydroxynorvalylcarbamoyladenosine); ms2hn6A (2-methylthio-N6-hydroxynorvalyl carbamoyladenosine); Ar(p) (2'-O-ribosyladenosine (phosphate)); I (inosine); m1! (1- methylinosine); nflm (l,2'-O-dimethylinosine); m3C (3 -methylcytidine); Cm (2'-O- methylcytidine); s2C (2-thiocytidine); ac4C (N4-acetylcytidine); f^C (5-formylcytidine); m5Cm (5,2'-O-dimethylcytidine); ac4Cm (N4-acetyl-2'-O-methylcytidine); k2C (lysidine); m'G (1- methylguanosine); m2G (N2-methylguanosine); m7G (7-methylguanosine); Gm (2'-O- methylguanosine); m22G (N2,N2-dimethylguanosine); m2Gm (N2,2'-O-dimethylguanosine); m22Gm (N2,N2,2'-O-trimethylguanosine); Gr(p) (2'-O-ribosylguanosine (phosphate)); yW (wybutosine); O2yW (peroxywybutosine); OHyW (hydroxywybutosine); OHyW* (undermodified hydroxywybutosine); imG (wyosine); mimG (methylwyosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQo (7- cyano-7-deazaguanosine); preQi (7-aminomethyl-7-deazaguanosine); G (archaeosine); D(dihydrouridine); m’Um (5,2'-O-dimethyluridine); s4U (4-thiouridine); m5s2U (5-methyl-2- thiouridine); s2Um (2-thio-2'-O-methyluridine); acp3U (3-(3-amino-3-carboxypropyl)uridine); ho5U (5-hydroxyuridine); mo5U (5-methoxyuridine); cmo5U (uridine 5-oxyacetic acid); mcmo5U (uridine 5-oxyacetic acid methyl ester); chm5U (5-(carboxyhydroxymethyl)uridine)); mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U (5- methoxycarbonylmethyluridine); mcm5Um (5-methoxycarbonylmethyl-2'-O-methyluridine); mcm3s2U (5-methoxycarbonylmethyl-2 -thiouridine); nm5s2U (5-aminomethyl-2-thiouridine); mnm5U (5-methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2-thiouridine); mnm’se2!! (5-methylaminomethyl-2-selenouridine); ncm5U (5-carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl-2'-O-methyluridine); cmnm5U (5- carboxymethylaminomethyluridine); cmnm5Um (5-carboxymethylaminomethyl-2'-O- methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6- dimethyladenosine); Im (2'-O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4,2'-O- dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3 -methyluridine); cm’U (5- carboxymethyluridine); m6Am (N6,2'-O-dimethyladenosine); m62Am (N6,N6,O-2'- trimethyladenosine); m2,7G (N2,7-dimethylguanosine); m2’2,7G (N2,N2,7-trimethylguanosine); m3Um (3,2'-O-dimethyluridine); nrD (5-methyldihydrouridine); fiCm (5-formyl-2'-O- methylcytidine); m'Gm (l,2'-O-dimethylguanosine); m'Am (l,2'-O-dimethyladenosine); rm5U (5-taurinomethyluridine); rm5s2U (5-taurinomethyl-2-thiouridine)); imG-14 (4- demethylwyosine); imG2 (isowyosine); or ac6A (N6-acetyladenosine).
[0173] In another embodiment, a nucleoside-modified RNA of the invention comprises a combination of 2 or more of the above modifications. In another embodiment, the nucleoside- modified RNA comprises a combination of 3 or more of the above modifications. In another embodiment, the nucleoside-modified RNA comprises a combination of more than 3 of the above modifications.
[0174] In another embodiment, between 0.1% and 100% of the residues in the nucleoside-modified of the invention are modified (e.g. either by the presence of pseudouridine or a modified nucleoside base). In another embodiment, 0.1% of the residues are modified. In another embodiment, the fraction of modified residues is 0.2%. In another embodiment, the fraction is 0.3%. In another embodiment, the fraction is 0.4%. In another embodiment, the fraction is 0.5%. In another embodiment, the fraction is 0.6%. In another embodiment, thefraction is 0.8%. In another embodiment, the fraction is 1%. In another embodiment, the fraction is 1.5%. In another embodiment, the fraction is 2%. In another embodiment, the fraction is 2.5%. In another embodiment, the fraction is 3%. In another embodiment, the fraction is 4%. In another embodiment, the fraction is 5%. In another embodiment, the fraction is 6%. In another embodiment, the fraction is 8%. In another embodiment, the fraction is 10%. In another embodiment, the fraction is 12%. In another embodiment, the fraction is 14%. In another embodiment, the fraction is 16%. In another embodiment, the fraction is 18%. In another embodiment, the fraction is 20%. In another embodiment, the fraction is 25%. In another embodiment, the fraction is 30%. In another embodiment, the fraction is 35%. In another embodiment, the fraction is 40%. In another embodiment, the fraction is 45%. In another embodiment, the fraction is 50%. In another embodiment, the fraction is 60%. In another embodiment, the fraction is 70%. In another embodiment, the fraction is 80%. In another embodiment, the fraction is 90%. In another embodiment, the fraction is 100%.
[0175] In another embodiment, the fraction is less than 5%. In another embodiment, the fraction is less than 3%. In another embodiment, the fraction is less than 1%. In another embodiment, the fraction is less than 2%. In another embodiment, the fraction is less than 4%. In another embodiment, the fraction is less than 6%. In another embodiment, the fraction is less than 8%. In another embodiment, the fraction is less than 10%. In another embodiment, the fraction is less than 12%. In another embodiment, the fraction is less than 15%. In another embodiment, the fraction is less than 20%. In another embodiment, the fraction is less than 30%. In another embodiment, the fraction is less than 40%. In another embodiment, the fraction is less than 50%. In another embodiment, the fraction is less than 60%. In another embodiment, the fraction is less than 70%.
[0176] In another embodiment, 0.1% of the residues of a given nucleoside (i.e., uridine, cytidine, guanosine, or adenosine) are modified. In another embodiment, the fraction of the given nucleotide that is modified is 0.2%. In another embodiment, the fraction is 0.3%. In another embodiment, the fraction is 0.4%. In another embodiment, the fraction is 0.5%. In another embodiment, the fraction is 0.6%. In another embodiment, the fraction is 0.8%. In another embodiment, the fraction is 1%. In another embodiment, the fraction is 1.5%. In another embodiment, the fraction is 2%. In another embodiment, the fraction is 2.5%. In another embodiment, the fraction is 3%. In another embodiment, the fraction is 4%. In anotherembodiment, the fraction is 5%. In another embodiment, the fraction is 6%. In another embodiment, the fraction is 8%. In another embodiment, the fraction is 10%. In another embodiment, the fraction is 12%. In another embodiment, the fraction is 14%. In another embodiment, the fraction is 16%. In another embodiment, the fraction is 18%. In another embodiment, the fraction is 20%. In another embodiment, the fraction is 25%. In another embodiment, the fraction is 30%. In another embodiment, the fraction is 35%. In another embodiment, the fraction is 40%. In another embodiment, the fraction is 45%. In another embodiment, the fraction is 50%. In another embodiment, the fraction is 60%. In another embodiment, the fraction is 70%. In another embodiment, the fraction is 80%. In another embodiment, the fraction is 90%. In another embodiment, the fraction is 100%.
[0177] In another embodiment, the fraction of the given nucleotide that is modified is less than 8%. In another embodiment, the fraction is less than 10%. In another embodiment, the fraction is less than 5%. In another embodiment, the fraction is less than 3%. In another embodiment, the fraction is less than 1%. In another embodiment, the fraction is less than 2%. In another embodiment, the fraction is less than 4%. In another embodiment, the fraction is less than 6%. In another embodiment, the fraction is less than 12%. In another embodiment, the fraction is less than 15%. In another embodiment, the fraction is less than 20%. In another embodiment, the fraction is less than 30%. In another embodiment, the fraction is less than 40%. In another embodiment, the fraction is less than 50%. In another embodiment, the fraction is less than 60%. In another embodiment, the fraction is less than 70%.
[0178] In another embodiment, a nucleoside-modified RNA of the invention is translated in the cell more efficiently than an unmodified RNA molecule with the same sequence. In another embodiment, the nucleoside-modified RNA exhibits enhanced ability to be translated by a target cell. In another embodiment, translation is enhanced by a factor of 2- fold relative to its unmodified counterpart. In another embodiment, translation is enhanced by a 3-fold factor. In another embodiment, translation is enhanced by a 5-fold factor. In another embodiment, translation is enhanced by a 7-fold factor. In another embodiment, translation is enhanced by a 10-fold factor. In another embodiment, translation is enhanced by a 15-fold factor. In another embodiment, translation is enhanced by a 20-fold factor. In another embodiment, translation is enhanced by a 50-fold factor. In another embodiment, translation is enhanced by a 100-fold factor. In another embodiment, translation is enhanced by a 200-foldfactor. In another embodiment, translation is enhanced by a 500-fold factor. In another embodiment, translation is enhanced by a 1000-fold factor. In another embodiment, translation is enhanced by a 2000-fold factor. In another embodiment, the factor is 10-1000-fold. In another embodiment, the factor is 10-100-fold. In another embodiment, the factor is 10-200- fold. In another embodiment, the factor is 10-300-fold. In another embodiment, the factor is 10- 500-fold. In another embodiment, the factor is 20-1000-fold. In another embodiment, the factor is 30-1000-fold. In another embodiment, the factor is 50-1000-fold. In another embodiment, the factor is 100-1000-fold. In another embodiment, the factor is 200-1000-fold. In another embodiment, translation is enhanced by any other significant amount or range of amounts.Polypeptide Therapeutic Agents
[0179] In other related aspects, the therapeutic agent includes an isolated peptide that modulates a target. For example, in one embodiment, the peptide of the invention inhibits or activates a target directly by binding to the target thereby modulating the normal functional activity of the target. In one embodiment, the peptide of the invention modulates the target by competing with endogenous proteins. In one embodiment, the peptide of the invention modulates the activity of the target by acting as a transdominant negative mutant.
[0180] The variants of the polypeptide therapeutic agents may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (such as a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the polypeptide is an alternative splice variant of the polypeptide of the invention, (iv) fragments of the polypeptides and / or (v) one in which the polypeptide is fused with another polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag). The fragments include polypeptides generated via proteolytic cleavage (including multisite proteolysis) of an original sequence. Variants may be post-translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein.
[0181] The nanoparticles may further comprise any lipid capable of forming a particle to which the one or more nucleic acid molecules are attached, or in which the one or more nucleic acid molecules are encapsulated. The term “lipid” refers to a group of organic compounds that are derivatives of fatty acids (e.g., esters) and are generally characterized by being insoluble in water but soluble in many organic solvents. Lipids are usually divided in at least three classes: (1) “simple lipids” which include fats and oils as well as waxes; (2) “compound lipids” which include phospholipids and glycolipids; and (3) “derived lipids” such as steroids. In one embodiment, the nanoparticles do not further comprise any lipid capable of forming a particle to which the one or more nucleic acid molecules are attached, or in which the one or more nucleic acid molecules are encapsulated. In one embodiment, the nanoparticles do not further comprise any or all of a simple lipid, a compound lipid, or a derived lipid.
[0182] In one embodiment, the nanoparticle comprises a cationic lipid. As used herein, the term “cationic lipid” refers to a lipid that is cationic or becomes cationic (protonated) as the pH is lowered below the pK of the ionizable group of the lipid, but is progressively more neutral at higher pH values. At pH values below the pK, the lipid is then able to associate with negatively charged nucleic acids. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that assumes a positive charge on pH decrease. In one embodiment, the nanoparticle does not comprise a cationic lipid.
[0183] In certain embodiments, the cationic lipid which is optionally present or not present in the nanoparticles comprises any of a number of lipid species which carry a net positive charge at a selective pH, such as physiological pH. Such lipids include, but are not limited to, N,N-dioleyl-N,N-dimethylammonium chloride (DODAC); N-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA); N,N-distearyl-N,N- dimethylammonium bromide (DDAB); N-(2, 3 -di oleoyloxy )propyl)-N,N,N- trimethylammonium chloride (DOTAP); 3-(N — (N',N'-dimethylaminoethane)- carbamoyl)cholesterol (DC-Chol), N-(l-(2,3-dioleoyloxy)propyl)-N-2- (sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoracetate (DOSPA), dioctadecylamidoglycyl carboxyspermine (DOGS), l,2-dioleoyl-3-dimethylammonium propane (DODAP), N,N-dimethyl-2,3-dioleoyloxy)propylamine (DODMA), and N-(l,2- dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (DMRIE). Additionally, a number of commercial preparations of cationic lipids are available which can beused in the invention. These include, for example, LIPOFECTIN® (commercially available cationic liposomes comprising DOTMA and l,2-dioleoyl-sn-3 -phosphoethanolamine (DOPE), from GIBCO / BRL, Grand Island, N.Y.); LIPOFECT AMINE® (commercially available cationic liposomes comprising N-(l-(2,3-dioleyloxy)propyl)-N-(2- (sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoroacetate (DOSPA) and (DOPE), from GIBCO / BRL); and TRANSFECTAM® (commercially available cationic lipids comprising dioctadecylamidoglycyl carboxyspermine (DOGS) in ethanol from Promega Corp., Madison, Wis.). The following lipids are cationic and have a positive charge at below physiological pH: DODAP, DODMA, DMDMA, l,2-dilinoleyloxy-N,N- dimethylaminopropane (DLinDMA), 1 ,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA).
[0184] In one embodiment, the cationic lipid is an amino lipid. Such amino lipids include those described in WO 2012 / 016184, incorporated herein by reference in its entirety. Representative amino lipids include, but are not limited to, l,2-dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoley oxy-3 -morpholinopropane (DLin- MA), l,2-dilinoleoyl-3 -dimethylaminopropane (DLinDAP), l,2-dilinoleylthio-3- dimethylaminopropane (DLin-S-DMA), l-linoleoyl-2-linoleyloxy-3 -dimethylaminopropane (DLin-2-DMAP), l,2-dilinoleyloxy-3 -trimethylaminopropane chloride salt (DLin-TMA.Cl), l,2-dilinoleoyl-3 -trimethylaminopropane chloride salt (DLin-TAP.Cl), l,2-dilinoleyloxy-3-(N- methylpiperazino)propane (DLin-MPZ), 3-(N,N-dilinoleylamino)-l,2-propanediol (DLinAP), 3 -(N,N-di oleylamino)- 1,2-propanediol (DOAP), l,2-dilinoleyloxo-3-(2-N,N- dimethylamino)ethoxypropane (DLin-EG-DMA), and 2,2-dilinoleyl-4-dimethylaminomethyl- [1,3] -di oxolane (DLin-K-DMA).
[0185] In various embodiments, the nanoparticles further comprise a steroid or steroid analogue. A “steroid” is a compound comprising the following carbon skeleton:
[0186] In certain embodiments, the steroid or steroid analogue is cholesterol. In one embodiment, the nanoparticles do not comprise a steroid or steroid analogue. In one embodiment, the nanoparticles do not comprise cholesterol.
[0187] In one embodiment, the nanoparticles further comprise a stabilizer. In one embodiment, the stabilizer comprises oligooxyetylenes. In one embodiment, the stabilizer comprises a water soluble macromolecule. In one embodiment the stabilizer comprises a water soluble oligomer. In one embodiment, the stabilizer comprises a carbohydrate.
[0188] In certain embodiments, the nanoparticle comprises one or more targeting moieties which are capable of targeting the nanoparticle to a cell or cell population. For example, in one embodiment, the targeting moiety is a ligand which directs the nanoparticle to a receptor found on a cell surface.
[0189] In certain embodiments, the nanoparticle comprises one or more internalization domains. For example, in one embodiment, the nanoparticle comprises one or more domains which bind to a cell to induce the internalization of the nanoparticle. For example, in one embodiment, the one or more internalization domains bind to a receptor found on a cell surface to induce receptor-mediated uptake of the nanoparticle. In certain embodiments, the nanoparticle is capable of binding a biomolecule in vivo, where the nanoparticle-bound biomolecule can then be recognized by a cell-surface receptor to induce internalization. For example, in one embodiment, the nanoparticle binds systemic ApoE, which leads to the uptake of the nanoparticle and associated cargo.Compositions
[0190] In one aspect, the present invention relates to compositions comprising at least one amphiphilic Janus dendrimer of the present invention and / or nanoparticle thereof. In some embodiments, the composition further comprises at least one agent described herein.
[0191] The invention also relates to compositions comprising at least one compound of Formula (I) or Formula (II) and methods of use thereof for delivering an encapsulated agent to the lung parenchyma. Exemplary agents that can be encapsulated in the compositions of the invention include, but are not limited to, diagnostic agents, detectable agents, and therapeutic agents.
[0192] In one embodiment, the composition comprises nanoparticles comprising a compound of Formula (I) or Formula (II) and at least one agent encapsulated by the nanoparticle. In some embodiments, the encapsulated agent comprises an agent for reducing inflammation in a subject.
[0193] In one embodiment, the composition may be prepared by injection of a mixture comprising a compound described herein into a suitable solution, such as a solution comprising the agent to be encapsulated. In one embodiment, the composition of the invention comprises in vitro transcribed (IVT) RNA molecule. For example, in certain embodiments, the composition of the invention comprises IVT RNA molecule which encodes an agent. In certain embodiments, the IVT RNA molecule of the present composition is a nucleoside-modified mRNA molecule. In certain embodiments, the nucleoside-modified mRNA molecule encodes an anti-inflammatory agent. In one embodiment, the nucleoside-modified mRNA molecule encodes TGF-P, Alpha- 1 -antitrypsin (A1AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP-B) or surfactant protein C (SP- C), or a fragment or variant thereof. In one embodiment, the nucleoside-modified mRNA molecule encodes TGF-0, Alpha- 1 -antitrypsin (A1AT) or soluble IL-1R.
[0194] In one embodiment, the nucleic acid molecule encoding TGF-P comprises SEQ ID NO: 1, SEQ ID NO:2. In one embodiment, the nucleic acid molecule encoding TGF-P comprises an mRNA molecule comprising a sequence corresponding to the sequence of SEQ ID NO: 1. In one embodiment, the nucleic acid molecule encoding Al AT comprises an mRNA transcribed from SEQ ID NO:2. In one embodiment, the nucleic acid molecule encoding A1AT comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6. In one embodiment, the nucleic acid molecule encoding A1AT comprises an mRNA molecule comprising a sequence corresponding to the sequence of SEQ ID NO:3 (AlAT-isol) or SEQ ID NO:5 (AlAT-iso2). In one embodiment, the nucleic acid molecule encoding A1AT comprises an mRNA transcribed from 3_2560_pUC-ccTEV-co.m.AATl-isol(AAC28869.1)-A101 (SEQ ID NO:4) or 6_2560_pUC-ccTEV-co.m.AATl-iso2(NP_001239498.1)-A101 (SEQ ID NO:6). In one embodiment, the nucleic acid molecule encoding soluble IL-1R comprises SEQ ID NO:7, SEQ ID NO 8, SEQ ID NOV, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12. In one embodiment, the nucleic acid molecule encoding soluble IL-1R comprises an mRNA molecule comprising a sequence corresponding to the sequence of SEQ ID NO:7 (ILlra-isol), SEQ IDN0:9 (ILlra-iso2) or SEQ ID NO: 11 (ILlra-iso3). In one embodiment, the nucleic acid molecule encoding soluble IL-1R comprises an mRNA transcribed from 3_2560_pUC-ccTEV- co.m.ILlra-isol-AlOl (SEQ ID N0:8), 6_2560_pUC-ccTEV-co.m.ILlra-iso2p-A101 (SEQ ID NO: 10) or 9_2560_pUC-ccTEV-co.m.ILlra-iso3-A101 (SEQ ID NO: 12). However, the invention is not limited to any particular agent or combination of agents.
[0195] In certain embodiments, the nucleoside-modified mRNA molecule encodes SEQ ID NO: 13 (alpha-1 protease inhibitor 1), SEQ ID NO: 14 (alpha- 1 -antitrypsin 1-1 isoform 2), SEQ ID NO: 15 (Interleukin- 1 receptor antagonist protein isoform 2 precursor), SEQ ID NO: 16 (Interleukin- 1 receptor antagonist protein isoform 3), or SEQ ID NO: 17 (Interleukin- 1 receptor antagonist protein isoform 1), or a fragment or variant thereof.
[0196] In one embodiment, the composition comprises at least one nucleoside-modified RNA molecule encoding a combination of at least two agents. In one embodiment, the composition comprises a combination of two or more nucleoside-modified RNA molecules encoding a combination of two or more agents.
[0197] In one embodiment, the method comprises the systemic administration of the composition into the subject, including for example intradermal administration. In certain embodiments, the method comprises administering a plurality of doses to the subject. In another embodiment, the method comprises administering a single dose of the composition, where the single dose is effective in inducing a therapeutic response.Combinations
[0198] In one embodiment, the composition of the invention comprises a combination of agents described herein. In certain embodiments, a composition comprising a combination of agents described herein has an additive effect, wherein the overall effect of the combination is approximately equal to the sum of the effects of each individual agent. In other embodiments, a composition comprising a combination of agents described herein has a synergistic effect, wherein the overall effect of the combination is greater than the sum of the effects of each individual agent.
[0199] A composition comprising a combination of agents comprises individual agents in any suitable ratio. For example, in one embodiment, the composition comprises a 1 : 1 ratio oftwo individual agents. However, the combination is not limited to any particular ratio. Rather any ratio that is shown to be effective is encompassed.Pharmaceutical Compositions
[0200] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single- or multi-dose unit.
[0201] Although the description of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as non-human primates, cattle, pigs, horses, sheep, cats, and dogs.
[0202] Pharmaceutical compositions that are useful in the methods of the invention may be prepared, packaged, or sold in formulations suitable for ophthalmic, oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, buccal, intravenous, intracerebroventricular, intradermal, intramuscular, or another route of administration. Other contemplated formulations include projected nanoparticles, liposomal preparations, resealed erythrocytes containing the active ingredient, and immunogenic-based formulations.
[0203] A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to thedosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
[0204] The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) active ingredient.
[0205] In addition to the active ingredient, a pharmaceutical composition of the invention may further comprise one or more additional pharmaceutically active agents.
[0206] Controlled- or sustained-release formulations of a pharmaceutical composition of the invention may be made using conventional technology.
[0207] As used herein, “parenteral administration” of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, intraocular, intravitreal, subcutaneous, intraperitoneal, intramuscular, intradermal, intrastemal injection, intratumoral, intravenous, intracerebroventricular and kidney dialytic infusion techniques.
[0208] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulationfor parenteral administration, the active ingredient is provided in dry (i.e. powder or granular) form for reconstitution with a suitable vehicle (e.g. sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
[0209] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer systems. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
[0210] A pharmaceutical composition of the invention may be prepared, packaged, or sold in a formulation suitable for pulmonary administration via the buccal cavity. Such a formulation may comprise dry particles which comprise the active ingredient and which have a diameter in the range from about 0.5 to about 7 nanometers, or from about 1 to about 6 nanometers. Such compositions are conveniently in the form of dry powders for administration using a device comprising a dry powder reservoir to which a stream of propellant may be directed to disperse the powder or using a self-propelling solvent / powder-dispensing container such as a device comprising the active ingredient dissolved or suspended in a low-boiling propellant in a sealed container. In some embodiments, such powders comprise particles wherein at least 98% of the particles by weight have a diameter greater than 0.5 nanometers and at least 95% of the particles by number have a diameter less than 7 nanometers. In some embodiments, at least 95% of the particles by weight have a diameter greater than 1 nanometer and at least 90% of the particles by number have a diameter less than 6 nanometers. Dry powder compositions may include a solid fine powder diluent such as sugar and are conveniently provided in a unit dose form.
[0211] Low boiling propellants generally include liquid propellants having a boiling point of below 65°F at atmospheric pressure. Generally the propellant may constitute 50 to 99.9% (w / w) of the composition, and the active ingredient may constitute 0.1 to 20% (w / w) of the composition. The propellant may further comprise additional ingredients such as a liquid non-ionic or solid anionic surfactant or a solid diluent (sometimes having a particle size of the same order as particles comprising the active ingredient).
[0212] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multi-dose containers containing a preservative. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additional ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In one embodiment of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g., sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.
[0213] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally-acceptable diluent or solvent, such as water or 1,3-butane diol, for example. Other acceptable diluents and solvents include, but are not limited to, Ringer’s solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations that are useful include those that comprise the active ingredient in microcrystalline form, in a liposomal preparation, or as a component of a biodegradable polymer system. Compositions for sustained release or implantation maycomprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.
[0214] As used herein, “additional ingredients” include, but are not limited to, one or more of the following: excipients; surface active agents; dispersing agents; inert diluents; granulating and disintegrating agents; binding agents; lubricating agents; sweetening agents; flavoring agents; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents, demulcents; buffers; salts; thickening agents; fillers; emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing agents; and pharmaceutically acceptable polymeric or hydrophobic materials. Other “additional ingredients” which may be included in the pharmaceutical compositions of the invention are known in the art and described, for example in Remington's Pharmaceutical Sciences (1985, Genaro, ed., Mack Publishing Co., Easton, PA), which is incorporated herein by reference.Treatment Methods
[0215] The invention provides methods of delivering an agent to a lung cell, or tissue of a subject. In some embodiments, the agent is a therapeutic agent for the treatment or prevention of a disease or disorder. In some embodiments, the agent is an anti-inflammatory agent for the treatment or prevention of inflammation in the lung. In some embodiments, the antiinflammatory agent is TGF-0, Alpha- 1 -antitrypsin (A1AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP-B) or surfactant protein C (SP-C) or a fragment or variant thereof. In some embodiments, the anti-inflammatory agent is TGF-p. In some embodiments, the anti-inflammatory agent is an mRNA molecule comprising SEQ ID NO: 1. In some embodiments, the anti-inflammatory agent is an mRNA molecule comprising SEQ ID NO:2.
[0216] In some embodiments, the invention provides methods for treating or preventing a disease or disorder comprising administering an effective amount of a composition comprising at least one therapeutic agent.
[0217] In one embodiment, the composition is administered to a subject having inflammation of the lung. In one embodiment, the composition is administered to a subject at risk for inflammation of the lung. For example, the composition may be co-administered to asubject who is being treated with a therapeutic agent known to be associated with an increased risk of inflammation of the lung. In some embodiments, co-administration of the composition and at least one additional therapeutic agent prevents or reduces drug-induced inflammation. In one embodiment, the composition is administered to a subject who has increased likelihood, though genetic factors, environmental factors, or the like, of developing lung inflammation.
[0218] In some embodiments, the method prevents or treats asthma, chronic obstructive pulmonary disease (COPD), emphysema, acute respiratory distress syndrome (ARDS), lung cancer, sarcoidosis, asbestosis, chronic cough, pneumothorax, pulmonary embolism, pleural effusion, rheumatoid lung disease, pulmonary fibrosis, bronchiectasis, tuberculosis, bronchitis, pneumonia, acute lung injury (ALI), emphysema, cystic fibrosis or idiopathic fibrosis. In one embodiment, the lung cancer is non-small cell lung cancer.
[0219] In some embodiments, the method reduces at least one symptom of asthma, chronic obstructive pulmonary disease (COPD), emphysema, acute respiratory distress syndrome (ARDS), lung cancer, sarcoidosis, asbestosis, chronic cough, pneumothorax, pulmonary embolism, pleural effusion, rheumatoid lung disease, pulmonary fibrosis, bronchiectasis, tuberculosis, bronchitis, pneumonia, acute lung injury (ALI), emphysema, cystic fibrosis or idiopathic fibrosis. In one embodiment, the lung cancer is non-small cell lung cancer.
[0220] In one embodiment, the method comprises administering a composition comprising at least one nucleoside-modified nucleic acid molecule encoding at least one therapeutic agent. In one embodiment, the method comprises administering a composition comprising a first nucleoside-modified nucleic acid molecule encoding at least one therapeutic agent and a second therapeutic agent. In one embodiment, the method comprises administering a first composition comprising at least one nucleoside-modified nucleic acid molecules encoding at least one therapeutic agent and administering a second composition comprising at least one nucleoside-modified nucleic acid molecule encoding at least one additional therapeutic agent.
[0221] In certain embodiments, the method comprises administering to subject a plurality of nucleoside-modified nucleic acid molecules encoding a plurality of therapeutic agents.
[0222] In certain embodiments, the method of the invention allows for sustained expression of the therapeutic agent for at least several days following administration. However, the method, in certain embodiments, also provides for transient expression, as in certain embodiments, the nucleic acid is not integrated into the subject genome.
[0223] In certain embodiments, the method comprises administering nucleoside- modified RNA which provides stable expression of the therapeutic agent.
[0224] Administration of the compositions of the invention in a method of treatment can be achieved in a number of different ways, using methods known in the art. In one embodiment, the method of the invention comprises systemic administration of the subject, including for example enteral or parenteral administration. In certain embodiments, the method comprises intradermal delivery of the composition. In another embodiment, the method comprises intravenous delivery of the composition. In some embodiments, the method comprises intramuscular delivery of the composition. In one embodiment, the method comprises subcutaneous delivery of the composition. In one embodiment, the method comprises inhalation of the composition. In one embodiment, the method comprises intranasal delivery of the composition.
[0225] It will be appreciated that the composition of the invention may be administered to a subject either alone, or in conjunction with another agent.
[0226] The therapeutic and prophylactic methods of the invention thus encompass the use of pharmaceutical compositions comprising a nanoparticle encapsulating an RNA molecule encoding a therapeutic agent alone or in combination with at least one additional therapeutic agent. The pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of from ng / kg / day and 100 mg / kg / day. In one embodiment, the invention envisions administration of a dose which results in a concentration of the compound of the invention from lOnM and 10 pM in a mammal.
[0227] Typically, dosages which may be administered in a method of the invention to a mammal, such as a human, range in amount from 0.01 pg to about 50 mg per kilogram of body weight of the mammal, while the precise dosage administered will vary depending upon any number of factors, including but not limited to, the type of mammal and type of disease state being treated, the age of the mammal and the route of administration. In some embodiments, the dosage of the compound will vary from about 0.1 pg to about 10 mg per kilogram of bodyweight of the mammal. In some embodiments, the dosage will vary from about 1 pg to about 1 mg per kilogram of body weight of the mammal.
[0228] The composition may be administered to a mammal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. The frequency of the dose will be readily apparent to the skilled artisan and will depend upon any number of factors, such as, but not limited to, the type and severity of the disease being treated, the type and age of the mammal, etc.
[0229] In certain embodiments, administration of an composition or vaccine of the invention may be performed by single administration or boosted by multiple administrations.
[0230] In one embodiment, the invention includes a method comprising administering one or more compositions encoding at least one therapeutic agent described herein. In certain embodiments, the method has an additive effect, wherein the overall effect of the administering the combination is approximately equal to the sum of the effects of administering each therapeutic agent. In other embodiments, the method has a synergistic effect, wherein the overall effect of administering the combination is greater than the sum of the effects of administering each therapeutic agent.EXPERIMENTAL EXAMPLES
[0231] The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0232] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the invention and practice the claimed methods. The following working examples therefore are not to be construed as limiting in any way the remainder of the disclosure.Example 1 : Targeted delivery of TGF-B mRNA to murine lung parenchyma using one-component ionizable amphiphilic Janus Dendrimers
[0233] IAJD34 is a single component lipid particle that can perform targeted delivery of mRNA to the lung (Zhang et al., 2021, Journal of the American Chemical Society 143, 17975- 17982). The current studies have shown that IAJD34 can successfully deliver luciferase mRNA to the lung, specifically targeting lung parenchyma. This is of particular therapeutic advantage as targeting the smaller airways, specifically the more vascular regions at airway zones 16 and below, is necessary to treat most lung injury and disease (Johnson et al., 2010, J. Aerosol Med. Pulm. Drug Deliv. 23, 243-252; Matthay et al., 2005, Am. J. Respir. Cell Mol. Biol. 33, 319— 327; Butt et al., 2016, Arch. Pathol. Lab. Med. 140, 345-350). While necessary, targeting these areas of the lung is challenging and has proven difficult in clinical settings (Johnson et al., 2010, J. Aerosol Med. Pulm. Drug Deliv. 23, 243-252). It is not clear why IAJD34 particles localize to the lung. However, without being bound by theory it is hypothesized that IAJD34 is able to target these areas due to its lipophilic and charged nature. When injected intravenously these characteristics lead to pulmonary accumulation as it is the first pass organ for i.v. administration. TGF-P mRNA-IAJD34 was able to deliver dose-dependent levels of TGF-B mRNA to the lung with limited inflammation and toxicity observed. Once delivered, TGF-P protein was produced, processed, and mediated downstream cytokine signaling. Delivery of TGF-P was transiently expressed over the course of 48 h, which is important as long-term delivery of TGF-P can lead to significant fibrosis.
[0234] TGF-P mRNA-IAJD34 was used to treat ITB effects on the lung 3 days postinjury showed only mild improvements in lung histology and barrier function. Although the use of the day 3 timepoint in BALB / c mice meant that these factors were only mildly affected by ITB, our intention was to demonstrate that delivery of TGF-P mRNA-IAJD34 to the lung would reduce inflammatory signaling. Indeed, there was a significant TGF-P mRNA-IAJD34 effect that correlated with TGF-P expression. These results indicate that TGF-P was successfully delivered to the lower lung and a significant signaling effect was observed. Furthermore, this effect appears to be transitory in nature as would be required in a therapeutic setting.
[0235] To establish TGF-P mRNA-IAJD34 as a therapeutic in this ALI model, the effect of TGF-P at 7 days or longer post-injury should be characterized, which may require multiple dosing regimens. This study establishes the potential use of IAJD34 to treat ALI andother pulmonary ailments that currently require targeted clinical interventions and demonstrates the potential of mRNA delivery for therapeutic use in the lung.The materials and methods are now described mRNA production and confirmation
[0236] Codon optimized sequences of TGF-P or Luc were synthesized and cloned into an mRNA plasmid (Pardi et al., 2015, J. Control. Release 217, 345-351; Martinez et al., 2021, Science 373, 991-998). Briefly, nucleoside-modified mRNAs were transcribed to contain 101 nucleotide-long poly(A) tails. mRNAs were modified with ml'P-5'-triphosphate (Trilink, # N- 1081) instead of UTP and capped co-transcriptionally using the trinucleotide capl analog, CleanCap (Trilink, # N-7413). mRNA was purified by cellulose (Sigma-Aldri ch, # 11363-250 G) purification 25 All mRNA were analyzed for quality control through agarose gel electrophoresis, dsRNA, endotoxin, and IFN-a assays and in vitro transfection. mRNA was stored at -20 °C until ready for use.TGF-P mRNA transfection in human embryonic kidney 293 cell line
[0237] Human Embryonic Kidney (HEK) 293 cells were seeded into a 24-well cell culture plate at a density of 150,000 cells / well in Dulbecco’s Modified Enriched Medium (DMEM) containing fetal bovine serum (10%), L-Glutamine, and penicillin / streptomycin. Cells were allowed to grow for 24 hrs and then TGF-P mRNA (500 n per / well) was transfected into cells in triplicate using lipofectamine MessengerMax (Life Technologies, Carlsbad, CA) and OptiMEM serum-free medium (ThermoFisher Scientific, # 31985-062, Rockford, IL) according to manufacturer guidelines. Cells were allowed to grow for an additional 24 h, and then samples collected in RIPA buffer (Sigma Aldrich, # R0278-500ml) containing cOmpleteMini protease cocktail inhibitors (Roche Diagnostics, # 11836153001). Samples were centrifuged (300 x g, 5 min, 4 °C) to remove cellular debris, and super- natant was then collected. Protein concentrations were determined using a Pierce™ BCA Protein Assay (Peirce, # 23227).Immunoblots
[0238] Whole cell lysates samples (10 pg per well) were analyzed for TGF-P by denaturing SDS-PAGE 4-12% Bis-Tris followed by western blot analysis. Samples were transferred to PVDF membrane using an iBlot 2 dry apparatus (ThermoFisher Scientific, Rockford, IL), The membranes were blocked in non-fat dried milk (10% with 5% TTBS), and TGF-P was detected using primary anti TGF-P antibody (1 :5000, Abeam ab215715; Waltham, MA) overnight at 4 °C, followed by a secondary goat anti -rabbit IgG HRP at 1 : 10,000 for 1 h at room temperature. Membranes were stripped and re-probed with anti-GAPDH (Cell Signaling Technology,# 21185, Danvers, MA) for 1 h at room temperature at a 1 : 1000 dilution, and a secondary goat anti-rabbit IgG HRP (Bio-Rad,# 170-6515 Bio-Rad, Hercules, CA) at a 1 : 10,000 for 1 h at room temperature. Membranes were washed in ECL Prime Western Blotting Detection Reagent (Amersham Biosciences, Amersham, UK,# RPN2232) prior to visualization using an Amersham Cytiva imager (Amersham Biosciences, Amersham, UK).
[0239] To analyze TGF-P protein expression in lung tissue, immunoblots were performed on collected lung tissue. Tissue from the accessory lobe was mechanically homogenized on dry ice and digested in lysis buffer with protease inhibitors (100 pL / 0.33 g tissue). The tissues were sonicated, centrifuged (2 min, 1000 x g), and supernatants were assessed for protein concentration using a Pierce™ BCA Protein Assay. Equal amounts of protein from lung tissue samples (45 pg per well) were analyzed for TGF-P protein expression as described above. Antibodies for TGF-P were used at 1 : 5000, and goat anti-rabbit HRP at 1 : 5000. Membranes were washed in ECL Prime Western Blotting Detection Reagent prior to visualization on x-ray film. Uncropped gel images are available in the Source Data file.Co-assembly of IAID34 and mRNA
[0240] IAJD34 was synthesized as previously described (Zhang et al., 2021, J. Am. Chem. Soc. 143, 12315-12327) and the purity and structural identity of final products and intermediates were determined using various techniques, including thin-layer chromatography (TLC), high-pressure liquid chromatography (HPLC),1H and13C NMR, and Electrospray Ionization Time-of-Flight (ESI TOF) mass spectrometry (Zhang et al., 2021, J. Am. Chem. Soc. 143, 12315-12327). Co-assembly of IAID34 and mRNA was per formed (Zhang et al., 2021, J. Am. Chem. Soc. 143, 12315-12327; Zhang et al., 2022, J. Am. Chem. Soc. 144, 4746- 4753). Nucleoside-modified mRNA encoding Luc mRNA or TGF-P mRNA was dissolved at aconcentration of 4 mg / ml in UltraPure DNase / RNase- free PCR-certified water (Teknova, # W3440). IAJD34 was dissolved in ethanol at a concentration of 80 mg / ml. For the co-assembly oflAFD34 with mRNA, the mRNA was mixed with 10 mM acetate buffer (pH 4.0), and this solution was rapidly mixed with IAFD34 in ethanol at an IAJD34 / mRNA weight-to-weight ratio of 40 and vortexed for 5 s. The prepared formulation was analyzed for size (nm), poly dispersity index (POI), and zeta potential using dynamic light scattering (DLS) prior to injection of empty-1 AJD34, Luc mRNA-IAJD34, and TGF-P mRNA- IAJD34. Prepared formulations were also evaluated for mRNA encapsulation efficiency, defined as the amount of mRNA encapsulated versus free, was determined using a Quant-iT™ RiboGreen™ RNA Assay Kit (Invitrogen) according to manufacturer instructions. Briefly, to measure nonencapsulated mRNA (free mRNA), mRNA-IAJD formulations were diluted with Tris-EDTA buffer (TE) and treated with the RiboGreen™ reagent. To measure total mRNA, mRNA-IAJD formulations were disrupted by treatment with 2% Triton X-100 in TE buffer and treated with RiboGreen™ reagent. Both conditions were per- formed in triplicate to ensure proper release of encapsulated mRNA. Fluorescence changes were measured using a Qubit 4 Fluorometer (Invitrogen) at 480 nm excitation and 520 nm emission. mRNA encapsulation efficiency was calculated as: (total mRNA - free mRNA) / total mRNA x 100% (EE, %) (Figure 1 A).
[0241] Cryogenic Transmission Electron Microscopy (Cryo-TEM) imaging was done to characterize the morphologies of mRNA-IAJD34 nanoparticles (Figure IB). Samples were prepared by deposition of 5 pL sample solution onto a 300-mesh copper TEM grid, and samples were immediately flash-frozen in liquid ethane using a Vitrobot Mark IV system (Thermo Fisher) and maintained at liquid nitrogen temperature. Images were recorded at -170 °C with an acceleration voltage of 200 kV using a Talos F200C G2 microscope.
[0242] Purity of IAJD34 was also confirmed using carbon 13 nuclear magnetic imaging (13C NMR), hydrogen nuclear magnetic imaging ('H NMR) , High-performance liquid chromatography (HPLC), and Electrospray Ionization Time-of-Flight (ESLTOF) Figure 1C- 1F). 'H NMR and13C NMR spectra were recorded on a Bruker Avance Neo (400 MHz) spectrometer at 298 K. Deuterated chloroform (CDCI3) was used as the solvent. NMR chemical shifts were calculated with the residual protic solvent of CDCI3 (’H, 6 7.26 ppm;13C, 6 77.16 ppm) as an internal reference. The purity of the products was determined by HPLC. HPLC was performed using a Thermo Fisher Vanquish Core at 298 K on a Chiralpak AD column.Methanol was used as an elute at a flow rate of 1.0 ml / min; A= 210 nm; tR = 3.122 min . ESI- TOF mass spectrometry was performed on a Thermo Fisher Scientific Exactive™. IAJD 34 was dis- solved in dichloromethane (3 mg / ml). The report contains the ionization method (ESI in positive mode), chemical formula, [ion]charge, mass to charge ratio (m / z): calculated value, found value.Animal Studies
[0243] Male and female wild-type BALB / c (8-10 weeks) mice were used for all experiments. Mice were housed under standard conditions with food and water provided ad libitum.Bioluminescence characterization for Luc mRNA delivery to mouse lungs
[0244] Female or male 6-8-week-old BALB / c mice were administered 10 pg of Luc mRNA-IAJD34 in alOO pL volume via retro-orbital intravenous injection. Four hours post-injection, mice were injected intraperitoneally (i.p.) with D-luciferin (Regis Technologies) at a dose of 150 mg / kg of body weight. The mice were anesthetized in a ventilated anesthesia chamber with 3% isoflurane (Piramal Healthcare Limited) in oxygen and imaged 10 min post D-luciferin inj ection using an in vivo imaging system (IVIS, PerkinElmer, Waltham, MA). For organs imaging, mice were sacrificed, organs were collected immediately, and bioluminescence imaging was performed . Bioluminescence was quantified as proton flux (photons / seconds) in each region of interest using Living Image software v3.2 (PerkinElmer)( Zhang et al., 2022, J. Am. Chem. Soc. 144, 4746-4753).TGF-P mRNA-IAJD34 formulation toxicity studies
[0245] TGF-P mRNA was co-assembled with IAJD34 as described above. The formulation was then concentrated using a Vivaspin ultrafiltration spin column MWCO 10,000 (Cytiva # 28-9322-47) according to manufacture guidelines. Mice were randomly assigned to control or treated. Mice were anesthetized with isoflurane and received a single retro- orbital intravenous injection of 10 pg, 20 pg, or 30 pg of TGF-P mRNA co-assembled with IAJD34 or empty IAJD34. The following criteria to assess the toxicity of formulated TGF-P mRNA-IAJDs was utilized: mice behavior, serum and BAL fluid cytokine analysis,liver enzyme activities, and main organs' histological score. Mice were sacrificed 24 h post-injections, and their serum samples and organs were collected. Organs were fixed in 4% paraformaldehyde and further stained with H&E as described below. The liver, spleen, kidney, and lungs were inspected for signs of inflammation and deviations from normal histology.Enzyme-linked immunosorbent assay (ELISA)
[0246] ELISAs for aspartate aminotransferase (AST; Abeam ab263882) and alanine aminotransferase (ALT; Abeam ab282882) were performed in serum in a 1 :80 dilution according to manufacture guidelines, lnterleukin-6 (IL-6; Abeam ab222503) was used to measure serum and first wash BAL fluid levels in accordance with manufacturer guidelines.Multiplex cytokine analysis
[0247] Cytokine in the first 1ml of BAL fluid was performed by the University of Pennsylvania Human Immunology Core (RRID: SCR_022380) usinga Milliplex Max Mouse Cytokine / Chemokine Magnetic Bead Panel - Premixed 32 Plex - Immunology Multiplex Assay (MCYTMAG-70K- PX32; MilliporeSigma, Burlington, MA). Samples were run in duplicate, and cytokine and chemokine concentrations were determined from a matched standard curve.Bleomycin mRNA-IAJD34 studies
[0248] Mice were randomly assigned to treatment groups. Mice were anesthetized with isoflurane and received a single retro-orbital intravenous injection of 10 pg of TGF-0 mRNA formulated with IAJD34 or empty IAJD34. while still under anesthesia, mice immediately received a single intratracheal instillation of either 50 pLPBS or 50 pL of bleomycin (3U / kg of body weight) (Santa Cruz Biotechnology, Inc., Dallas, TX; # sc- 200134B) diluted in PBS (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365). Following injections and treatment, mice were observed to ensure full recovery from anesthesia, and that dose was successfully administered. Animals were weighed daily and provided supportive care when necessary. Mice were sacrificed 3 days post intratrachealadministration of bleomycin via a single intraperitoneal injection of ketamine (135 mg / kg of body weight) and xylazine (30 mg / kg of body weight) (Fort Dodge Ani mal Health, Fort Dodge, IA).Bronchoalveolar lavage
[0249] Lungs were lavaged with 1ml of ice-cold PBS, followed by five 1 ml washes of ice-cold PBS through a 20-g auge canula inserted into the trachea. Collected BAL fluid was centrifuged at 300 * g for 8 mins. The cell-free supernatant from the first wash was collected for protein and cytokine analysis, and the cell-free supernatant from the five subsequent washes (5 ml) was collected for phospholipid analysis. Cell pellets from both washes were combined and resuspended in 1 ml of staining buffer (5%FBS in PBS, 0. 2% sodium azide) and assessed for viability using Trypan Blue Solution (0.4%, ThermoFisher Scientific, Rockford, IL). The total cell count was determined using a Z1 Counter particle counter (Beckman Colter). Approximately 10,000 cells were centrifuged on a Thermo Shandon Cytospin-3 at 750 rpm for 3 min onto a microscope slide, followed by Giemsa staining using a Herna 3™ Stat Pack (Fisherbrand, ThermoFi sher Sci entific, Rockford, IL). Total and differential cell counts were obtained . Cells were identified as macrophages, eosinophils, neutrophils, and lymphocytes by standard morphology.Phospholipids
[0250] Collected cell-free BAL fluid (5 ml) was centrifuged (20,000 xg, 4 °C, 1 hour) and separated into large and small aggregate surfactant fractions (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365; Botelho et al., 2018, Front. Pharmacol. 9, 213). Phospholipids were extracted from the large aggregate fraction and resuspended in 30 pL 0.9% sodium chloride. Total phospholipids were measured by light absorbance at 830 nm using a standard curve ranging from 0 to 3.1 pg phosphate (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365; Atochina-Vasserman et al., 2009, J. Immunol. 182, 2277-2287; Bartlett et al., 1959, J. Biol. Chem. 234, 466-468).Lung tissue digest
[0251] Lung tissue from the right lobes was incubated at 37 °C for 30 min with intermittent shaking in 5 ml of collagenase buffer (2 mg / ml colagenase type IV (Sigma Aldrich, St. Louis, MO) in RPMI 1640 (ThermoFisher Scientific, Rock ford , IL) with 5% FBS (ThermoFisher Scientific, Rockford, IL)). The digested tissue was filtered through a 70 pm strainer, washed with RPMI with 5% FBS, and centrifuged (6 min, 400 xg). The cell pellet was lysed with Red Blood Cell Lysis Buffer (Sigma Aldrich, St. Louis, MO) for 5 min. The purified cell pellet was resuspended at a concentration of! x 108cells / ml PBS with 2% FBS and 1 mM EDTA. CD45 + leukocytes were isolated using the EasySep™ Mouse CD45 Positive Selection Kit (Stemcell Technologies, Cam- bridge, MA) and prepared for flow cytometry.Flow cytometry
[0252] Cells from the BAL fluid or lung tissue digest were resuspended in 100 pL of staining buffer (PBS with 5% FBS, with 0.2% w / v sodium azide). Cells were incubated with TruStainFcXanti-mouse CD16 / 32(Fe Block, l:100) for 10 min at 4 °C to prevent nonspecific antibody binding. Cells were then incubated with antibodies against CD1 lb, CD206, CDl lc, CD45, F4 / 80, Ly6c, MIIC 11, and Siglec F at a 1 : 100 dilution in staining buffer. After centrifugation and washing, cells were stained with eFluor 780-conjugated fix- able viability dye for 30 min at 4 °C, washed with staining buffer, and fixed in paraformaldehyde (3%). Fluorescence was analyzed using a Gallios lO-col or flow cytometer (Beckman Colter, Brea, CA). Cells were analyzed after sorting based upon forward and side scatter, doublet di scrimination, and viability using Kaluza software v 2.2.1 (Beckman Colter, Brea, CA). Discrete alveolar and interstitial macrophage phenotypes were determined (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365).Seahorse real-time cellular metabolic analysis
[0253] Positively selected CD45 lung digest cells were plated at 200,000 cells per well in a poly -D-lysine coated Seahorse XF96 Cell Culture Micro- plate (Agilent, Santa Clara, C A) and incubated at 37 °C, 5% CO2 for 1 h to allow for cell adhesion. The cells were fed with EC AR medium (DMEM media, pH 7.4 (Agilent # 103575-100) with 2mM L- glutamine) or OCR medium ( DMEM media, pH 7.4 with 25 mM glucose, ImM pyruvate, and 2 mM L-glutamine). The extracellular acidification rate (EC AR) and oxygenconsumption rate (OCR) were measured using a Seahorse XF96 Analyzer (Agilent Technologies, Santa Clara, CA). For ECAR analysis, CD45 + cells were sequentially treated with 25 mM glucose, 4 pM oligomycin, and 50 mM 2-deoxy-d-glucose (2-DG). For OCR measurement, the cells were sequentially treated with 4 pM oligomy- cin, 1 pM carbonyl cyanide ptrifluoromethoxyphenylhydrazone (FCCP), 0.5 pM rotenone, and 0.5 pM antimycin A. Data were normalized to pg of protein per well and analyzed using Agilent Wave software.Histology and immunohistochemistry (IHC)
[0254] After BAL fluid collection, the left lung lobe was inflation fixed in 3% paraformaldehyde and embedded in paraffin. Liver, spleen, and kidney tissue were also fixed in 3% paraformaldehyde and embedded in paraffin. Four-micrometer sections were cut, slide-mounted, and left unstained for IHC or stained with hematoxylin and eosin (H&E) to observe histological changes. For the TGF-0 dose-response toxicity study, tissues were blindly scored by a board-certified pathologist to determine overt toxicological pathology. For bleomycin studies, scans were blindly scored and quantified via ImageJ (NIH) . For ImageJ quantification, samples were analyzed as previously described (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365; Golden et al., 2021, Data Brief 37, 107270). Briefly, randomly selected histological areas (n = 10, 400X) from each sample were captured and used to determine tissue consolidation (% white space), alveolar wall thickness, and cell infiltration (number of nuclei).
[0255] Mounted unstained tissue sections were deparaffmized in xylenes followed by decreasing concentrations of ethanol (100- 50%) and water. Antigen retrieval was performed in heated citrate buffer (10 mM sodium citrate, pH 6.0) for 30 min followed by quenching of endogenous peroxidase (3% H2O2 in methanol). Tissue sections were incubated in blocking buffer (10% normal goat serum in PBS) for 1 h at ambient temperature to prevent non-specific binding. Tissues were incubated at 4 °C for 18 h with anti -firefly luciferase (Abeam ab238448; Waltham, MA 1: 100) or TGF-0 (Abeam ab215715; Waltham, MA 1 : 100) antibody in a blocking buffer along with IgG controls (Pro-Sci 3703; Fort Collins, CO, matched concentrations). Sections were washed in decreasing concentrations of Tween -PB S ( l%-0.5 %) and incubated with biotin-conj ugated secondaryantibody (Vector Laboratories Vectastain Rabbit Kit; Newark, CA) for 1 h at ambient temperature. Antibody binding was vi sualized beneath a microscope using a DAB Peroxidase Substrate Kit (Vector Laboratories, Newark, CA). Slides were scanned at40X magnification using a VS 120 Virtual Slide Microscope (Olympus, Waltham, MA) and viewed with Oly VIA software (Olympus, Waltham , MA) at 400X magnification.Statistical analysis
[0256] Statistical analyses were completed using GraphPad Prism version 9 or 10.Results are reported as means± SE unless otherwise indicated. Data were tested for normal distribution using a Shapiro -Wilks test. If normally distributed, statistical significance for multiple group comparisons was determined using a one-way ANOVA with Tukey's post-hoc test or Sidak's multiple comparison test. If not normally distributed, statistical significance for multiple comparisons was determined using a Kruskal-Walli's test with a Dunn's multiple comparison test if needed. For parametric single comparisons, statistical significance was determined using an unpaired t-test with Welch's correction compared to control groups as indicated in figure legends If single comparisons were nonparametric, statistical significance was determined using a Mann-Whitney U test. All P-values < 0.05 were considered statistically significant. For data presented as Median± SE, statistical comparisons were made using a Wilcoxon ranked sum test. Statistical tests were conducted using a 5% significance level. n = 3- 18 animals / group and is further indicated in figure legends. Studies are represented as at least 2 independent studies.The experimental results are now describedCharacterization of lung-specific IAJD34 for targeted mRNA delivery to the lung
[0257] Many lAJDs identified are capable of targeting the lung (Zhang et al., 2021, Journal of the American Chemical Society 143, 17975-17982). With a relatively large chemical structure and a pKa of 7.04 lending to a strongly lung specific targeting, IAJD34 was selected for further characterization (Figure 2A - 2B). To evaluate lung-specific delivery, the Luc mRNA-IAJD34 formulation was injected into mice at an initial dose of 10 pg per mouse. Fourhours post-injection, whole-body, and organ luminescence were quantified via IVIS. Luciferin intensity in the lungs was strong and several magnitudes higher compared to other organs (Figure 2B). To evaluate the kinetics of luciferin protein production over time, mice were injected with the Luc mRNA-IAJD34 formulation at a dose of 10 pg per mouse. Live mice were imaged at various time points (4, 24, 48, and 72 h) post-injection, and the luciferase intensity was quantified as a whole-body flux (p / s) (Figure 2C). Luciferin intensity peaked at 4 h postinjection (3.12 x 107± 9.15 x 106), by 24 h, the flux intensity decreased but remained elevated by 37%. At 48 and 72-h post-injection, there was a more significant drop to 3% and 1.9%, respectively (Figure 2D and Figure 3).
[0258] The stability of the Luc mRNA-IAJD34 formulation was studied over time at +4 °C. The formulation was stored at +4 °C for 5 days and then injected into mice. Whole-body luciferase intensity did not change significantly compared to the freshly prepared formulation (Figure 4A). Thus, the one-component IAJD34 formulated with Luc mRNA maintains stability and activity at 4 °C and can be stored for at least 5 days prior to use. The stability of particle size and POI of 1AJ034 formulated with TGF- mRNA was also evaluated and was found to be stable for at least 5 weeks at +4 °C (Figure 4B). To evaluate the impact of dose on luciferase expression, Luc mRNA-IAJD34 was injected at 10, 20, and 30 pg doses per mouse and imaged at 24 h post-injection. There was a dose-dependent increase in lung-specific luciferase expression, reaching 9.3 x 108at 30 pg per mouse (Figure 2E, Figure 5 and Figure 6). Immunohistochemical staining of lung tissue with the 30 pg dose revealed that expression of luciferase protein was well distributed throughout the alveolar epithelium, with minimal staining in the upper airway compared to the control (Figure 2F). The mRNA delivery to the alveolar level (i.e., below the 16th generati on of the airway tree) had previously been unsuccessful, the expression of luciferase in these lower respiratory zones suggests our approach may serve as a promising therapeutic.
[0259] Notably, the evaluation of 1AJD34 toxicity and efficacy was limited using this formulation because luciferase is encoded by a large mRNA and has no biological function within the cell. Thus, delivery of clinically relevant mRNA was essential to fully characterize the therapeutic nature of IAJD34.Evaluation the pulmonary delivery of therapeutic mRNA'll
[0260] Following confirmation of IAJD34 lung specificity, a therapeutic mRNA was designed for lung-targeted delivery. TGF-P, a prominent anti-inflammatory cytokine associated with the resolution of ALI, was selected as the mRNA of interest (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365; Saito et al., 2018, Int. J. Mol. Sci. 19, 2460). The production and quality of TGF-P mRNA were validated (Figure 7 A). Protein expression of TGF-P was confirmed in Human epithelial kidney (HEK293) cells following transfection with TGF-P mRNA (Figure 7B).
[0261] To evaluate inflammatory effects in the lung, IAJD34 formulated with TGF-P mRNA (TGF-P mRNA-IAJD34) was injected at 10, 20, and 30 pg per mouse and bronchoalveolar lavage fluid (BAL) markers were measured 24 h post-injection. Increasing doses (10 pg and 20 pg) had no effect on BAL phospholipids or total cell count in the BAL fluid (Figure 8A). However, a significant increase in BAL fluid protein and neutrophils was observed at the 30 pg dose, indicating epithelial barrier dysfunction (Figure 8A, 8B). Although BAL fluid protein was increased, there was no significant increase in BAL IL-6 levels (Figure 8D), suggesting this may have been a downstream effect of abundant TGF-P delivery rather than a side effect of IAJD34 formulation.
[0262] Histological sections of organs were stained with H&E and evaluated by a board-certified pathologist. No pathological alterations were observed in the liver, spleen, or ki dney at any of the tested doses (Figure 9). In the lung histology, a dose-dependent increase in fibrin deposition and lymphocyte infiltration was observed, as was expected at higher doses of TGF-P (Figure 8C). Liver function was also evaluated by measuring serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT), known markers of liver function (Gowda et al., 2009, Pan Afr. Med. J. 3, 17). Increased ALT was observed at the 30 pg dose, with no significant change in AST (Figure 8E). Thus, systemic pathological and toxicological markers are limited in the 10 pg and 20 pg doses of TGF-P mRNA- IAJD34. Even at the highest dose, 30 pg, increases in systemic toxicity markers were minimal. Established four-component LNPs are typically dosed between 1 and 10 pg for vaccinations for SARS-COV2 in mice, indicating that l Opg would likely be sufficient (Naderi Soh et al., 2021, Vaccines 9, 1007). In addition, most studies using lAJOs report that 10 pg or less of mRNA to be effective for organ-specific detection (Zhang et al., 2021, J. Am. Chem. Soc. 143, 17975-17982).
[0263] To determine alveolar macrophage (AM) activation, BAL cells were evaluated by flow cytometry as previously described (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365). AMs were defined as viable CD45+F4 / 80+SiglecF+cells (Figure 10A). Inflammatory activation was characterized by the expression of Ly6c and cone. No dosedependent difference was observed in the AM phenotype, with a majority of cells being resident AMs (Ly6c7CDllc+) under all conditions. This was consistent with the lack of observed acute inflammatory activation (Figure 1 1 A). There were also no differences in Ly6C / C0206 AM populations at any dose of TGF-P mRNA-IAJD34 compared to the control (Figure 12). Interstitial macrophages (IMs) were identified in CD45+lung digest cells. IMs were defined as viable being CD45 \ CDllbt. and SiglecF' cells as previously described (Figure 10B) (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365). Ly6c+ IMs were increased in all doses of TGF-P mRNA-IAJD34 with no increases in either CD1 lc+or C0206 + expression at any dose (Figure 1 IB and Figure 13).
[0264] Ultimately, no acute inflammatory activation was observed in IMs as a result of TGF-P mRNA IAJD34 treatment when compared to control. It is unclear why treatment with TGF-P mRNA IAJD34 increased Ly6c in IMs, but a previous study evaluating renal interstitial macrophages in Tgfbr2fl / flmice showed a decrease in Ly6c+macrophages indicating that there may be a relationship between Ly6c and TGF-P signaling (Chung et al., 2018, JCI Insight 3). Further analysis will be necessary to fully understand TGF-P mRNA- IAJD34's effects on Ly6c+IMs. TGF-P protein exists in an unprocessed form with a latency-associated peptide that is cleaved to form an active protein, which can then initiate signal transduction (Lyons et al., 1988, J. Cell Biol. 106, 1659-1665; Bottinger et al., 1996, Proc. Natl. Acad. Sci. USA 93, 5877-5882). To confirm that TGF-P mRNA- IAJD34 was reaching the lung and being processed, TGF-P protein expression was confirmed in lung tissue digest using western blotting. Cleaved TGF-P was significantly increased at all doses compared to the control, whereas unprocessed and total TGF-P were only significantly increased in the 20 pg and 30 pg groups (Figure 14).
[0265] Next, the presence of other cytokines and chemokines in the BAL fluid that can be upregulated or downregulated by TGF-P signaling was evaluated (Figure 15). Granulocytecolony stimulating factor (G-CSF), identified as an anti-inflammatory pro-neutrophilic growth factor, was elevated at the 30 pg dose of TGF-P mRNA-IAJD34 compared to the control(Figure 16A) (Visani et ak, 1995, Leukemia lymphoma 18, 423-428) By contrast, pro- inflammatory cytokines interleukin-1 alpha (IL-la), interleukin 9 (IL 9), and tumor necrosis factor (TNFa) were decreased in a dose-dependent manner (Figure 16B- 16D) (Noelle et al., 2010, Nat. Rev. Immunol. 10, 683-687; Mukhopadhyay et al., 2006, Respir. Res. 7, 1-9). Thus, at 24 h post-treatment, TGF-P protein expression alters the downstream signaling of pro- and anti-inflammatory cytokines. These observations are likely directly associated with increased TGF-P signaling and not an off-target effect of IAJD34.
[0266] Finally, metabolic upregulation, which is predicted to occur with increased protein synthesis and cell signaling stimulated by TGF-P mRNA was studied. CD45+lungdigest cells were evaluated by employing the glycolysis stress test and the mito stress test. For the glycolysis stress test, the extracellular acidification rate (ECAR) was recorded. Glycolysis was determined by the ECAR measurement prior to glucose injection subtracted from the maximum ECAR before oligomycin injection. Injection with TGF-P mRNA-IAJE)34 caused a dose-dependent increase in glycolysis, with a significant increase observed in the 20 pg and 30 pg groups compared to the control (Figure 16E). This increase was associated with increased cytokine production, likely a direct impact of TGF-P signaling cascades (Ogger et al., 2021, Mucosal Immunol. 14, 282-295; Drzewicka et al., 2024, Front. Immunol. 15, 1328781). For the mito stress test, oxygen consumption rate (OCR) was used to determine oxidative phosphorylation. OCR data were first normalized to the post rotenone / antimycin (R / A) injections to control for non-mitochondrial oxygen consumption. Maximal respiration was determined from OCR data as the maximum OCR following the injection of FCCP (Carbonyl cyanide-p-trifluoromethoxyphenylhydrazone), a potent mitochondrial uncoupler. A TGF-P mRNA-IAJD34 induced dose-dependent increase was observed in maximal respiration, though this was not significant (Figure 16F). Although increased metabolic demand is likely a part of increased translational processes, it has also been hypothesized to be a direct effect of increased TGF-P expression and macrophage activation (Drzewicka et al., 2024, Front. Immunol. 15, 1328781). Thus, treatment with TGF-P mRNA-IAJD34 successfully alters macrophage cell phenotype and cytokine expression as expected with the production of TGF-P protein.Evaluating pulmonary delivery of TGF-P mRNA-IAJD34 over time
[0267] Due to the lack of toxicity, limited alterations in cell phenotype, and efficient expression of TGF-P protein and downstream signals, the 10 pg dose of TGF-P mRNA-IAJD34 was selected for further development.
[0268] The 10 pg dose of empty-IAJD34 or TGF-P mRNA-IAJD34 was further evaluated at 4, 24, and 48 h post-injection. Treatment with TGF-P mRNA IAJD34 did not increase BAL protein or phospholipids at any time point (Figure 17).
[0269] Immunohistochemistry (IHC) staining of lung tissue confirmed that TGF-P protein expression was transiently expressed in lung tissue, peaking at 4 h post-injection, and persisting up to 48 h (Figure 18). Unprocessed and cleaved TGF-P were also measured in whole lung tissue, showing significant increases in all forms of TGF-P at 4 h post-injection, an increase in cleaved TGF-P at 24 h, and no significant increases in any TGF-P isoforms at 48 h post-injection compared to the control (Figure 19). Consistent with TGF-P dose-response findings, there were no changes in AM or IM inflammatory activation at any time point compared to control, though slight increases in Ly6c+IMs were observed (Figure 20 and Figure 21). Thus, a 10 pg dose of TGF-P mRNA IAJD34 can deliver robust and transient TGF-P to the lung without significant signs of inflammation or toxicity. Transient expression is therapeutically beneficial as prolonged TGF-P expression can lead to fibrin deposition and fibrosis (Meng et al., 2016, Nat. Rev. Nephrol. 12, 325). However, in the future, it may be necessary to deliver repeat doses of TGF-P mRNA-IAJD34 until resolution is achieved.TGF-P mRNA-IAJD34 can limit pulmonary injury following exposure to bleomycin
[0270] The ultimate goal of lung-targeted delivery of therapeutic mRNA is to generate treatment strategies for pulmonary injury and disease. Intratracheal bleomycin (ITB) is a laboratory model of ALI, characterized by acute pulmonary inflammation occurring over the first 7 days, transitioning to fibrotic development around 14 days, and resolving at 21-28 days post initial exposure (Stevenson et al., 2022, 1. Pharmacol. Exp. Ther. 382, 356-365; Wilkinson et al., 2020, Toxicol. Appl. Pharmacol. 407, 115236; Izbicki et al., 2002, Int. J. Exp. Pathol. 83, 111-119). It should be noted that not all models of ITB result in the same level of fibrosis (Pottier et al., 2007, Am. J. Respir. Crit. Care Med. 176, 1098-1107; Schrier et al., 1983, Am. Rev. Respir. Dis. 127, 63-66). To have interventive therapeutic potential, treatment with TGF-P is predicted to be most effective during the development of pro-inflammatory cellular activation and pathology.
[0271] For initial studies, animals were treated with a 10 pg dose of TGF-P mRNA- IAJD34 or empty-lAJD34 concurrently to instillation of bleomycin or PBS control. To align with initial pulmonary inflammation development and the expression of TGF-P mRNA- IAJD34, animals were euthanized 3 days post ITB or PBS exposure. ITB causes weight loss in mice over the course of the first 7 days51« Substantial weight loss was observed in groups exposed to ITB, where treatment with TGF-P mRNA-IAJD34 had no impact on ITB-induced decreases in percent body weight (Figure 22). ITB is also associated with increases in alveolar thickness, immune cell infiltration, and tissue consolidation that variably develop over the first 7 days post-exposure (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365;Wilkinson et al., 2020, Toxicol. Appl. Pharmacol. 407, 115236; Golden et al., 2021, Data Brief 37, 107270; Izbicki et al., 2002, Int. J. Exp. Pathol. 83, 111-119). An increase in alveolar thickness was observed in ITB + empty-lAJD34 animals when compared to PBS control, with no change in percent white space and nuclei count (Figure 23). Treatment with TGF-P mRNA- IAJD34 alone did not significantly increase epithelial thickness compared to PBS control. However, in the presence of TGF-P mRNA-IAID34, there was no significant increase in epithelial thickness in response to ITB (Figure 23). The limited (TB-induced histological alterations are likely a consequence of evaluating injury at such an early time point and a limitation of using BALB / c mice as a model. Notably, BALB / c mice are slightly more resistant to ITB expo- sure as compared to C57BL6 / J mice (Pottier et al., 2007, Am. J. Respir. Crit. Care Med. 176, 1098-1107; Schrier et al., 1983, Am. Rev. Respir. Dis. 127, 63-66; Gur et al., 2000, Exp. Lung Res. 26, 521-534). BALB / c mice were chosen for this study as IAJD targeting and development has primarily been characterized in this strain of mice (Zhang et al., 2021, J. Am. Chem. Soc. 143, 12315-12327; Zhang et al., 2022, J. Am. Chem. Soc. 144, 4746-4753; Zhang et al., 2021, J. Am. Chem. Soc. 143, 17975-17982). The 3-day timepoint was chosen as the peak of inflammatory signaling post ITB injury. Successful delivery of TGF-P is predicted to have its greatest effect on inflammatory cellular phenotype at this time point.
[0272] Beyond histopathological alterations, ITB-induced ALI is also associated with increases in pulmonary epithelial injury, marked by increased BAL fluid protein and disrupted epithelial lipid barriers (Allawz et al., 2019, Curr. Opin. Toxicol. 13, 68-73). Exposure to ITBcaused a significant increase in BAL fluid protein content as compared to control. TGF-P mRNA-IAJD34 treatment reduced the protein level within the BAL but not significantly (Figure 24A). Neither ITB nor TGF-P mRNA-IATD34 had an effect on BAL fluid phospholipid levels, hypothesized to be a limitation of the 3-day time-point (Figure 24B). As shown previously, ITB induces a loss of BAL cells, a consequence of early pulmonary inflammation and cell death. However, in the presence of TGF-P mRNA-IAJD34, this (TB-induced loss was not observed (Figure 24C) (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365).
[0273] To characterize the loss of BAL cells, AMs (viable CD45+ Siglec F+ F4 / 80+ BAL cells) were characterized further as being resident (CD1 lc+ CD1 lb- ), recruited (CD1 lc- CD1 lb+ ), or migratory macrophages (CD1 lc+ CD1 lb+ ). In line with previous 7- day studies, exposure to bleomycin reduced resident AMs and increased recruited AMs compared to PBS control (Figure 24D, 24E) (Stevenson et al., 2022, J. Pharmacol. Exp. Ther. 382, 356-365; Wilkinson et al., 2020, Toxicol. Appl. Pharmacol. 407, 115236). Although treatment with TGF-P mRNA- IAJD34 did not prevent ITS-induced decreases in resident AMs, treatment did mitigate ITS-induced increases in recruited AMs (Figure 24D, 24E). In contrast to TGF-P mRNA-IAJD34 dose-response studies, Ly6c+ IMs (viable CD45+ / CD1 lb+ SiglecF- lung-digest cells) were decreased in ITB exposed animals irrespective of TGF-P mRNA-IAJD34 treatment (Figure 24F). (TB-induced changes in AM and IM populations were variable between animals due to the early inflammatory time point and the less sensitive BALB / c model. Treatment with TGF-P mRNA-IAJD34 helped mitigate some AM alterations but had no effect on IMs at this time point. Innate TGF-P expression is expressed more highly in human AMs when compared to other lung cell types (Yu et al., 2017, Immunity 47, 903- 912). There is some evidence that TGF-P plays a less significant role in IM cell maturation and activity, but this remains largely speculative (Yu et al., 2017, Immunity 47, 903-912). Further model development may be beneficial to understanding the role that TGF-P plays in modulating ITB-induced AM and IM cell characteristics.
[0274] Next, the downstream effects of TGF-P mRNA IAJD34 on cytokine signaling following exposure to ITB was evaluated beyond pathological and inflammatory indicators (Figure 25 and Figure 26). As anticipated, exposure to ITB elevated levels of G- CSF, IL- 6, and CXCL-10 compared to control. These neutrophilic or pro-inflammatory cytokines are elevated following ITB exposure (Figure 25A- 25C) (Tager et al., 2004, J. Respir. Cell Mol.Biol. 31, 395-404; Takamizawa et al., 1999, J. Immunol. 162, 6200-6208). Treatment with TGF-P mRNA-IAJD34 prevented ITB-induced increases in all three of these pro-inflammatory cytokines, consistent with the anti-inflammatory signaling of TGF-P (Figure 25A- 25C). Exposure to ITB caused a reduction in IL-lex and IL-2 compared to PBS control, irrespective of treatment with TGF-P mRNA-IAJD34 (Figure 25D, 25E). Both IL-1 a and IL-2 are also pro- inflammatory cytokines, and it is unclear why ITB exposure decreased these cytokines, though it may be a result of AM resident cell loss. Thus, treatment with TGF-P mRNA-IAJD34 can prevent components of ITB-induced pulmonary inflammatory signaling.Example 2: Alpha- 1 -Antitrypsin mRNA treatment is useful for the treatment of genetically induced chronic obstructive pulmonary disease in a genetic knockout model.
[0275] 10 pg of luciferase mRNA was co-assemble with IAJD34 or IAJD34 formulated with 1.5% PEG, followed by dialysis in PBS, and then administered intravenously into C57BL / 6 mice. Figure 27 shows representative IVIS images of whole-body mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of C57B1 / 6 mice.
[0276] 10 pg of luciferase mRNA was co-assemble with IAJD33 or IAJD33 formulated with 1.5% PEG, followed by dialysis in PBS, and then administered intravenously into C57BL / 6 mice. Figure 28 shows representative IVIS images of whole-body mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of C57B1 / 6 mice.
[0277] 10 pg of luciferase mRNA was co-assemble with IAJD33 (Luc mRNA-IAJD33) and injected by intravenous administration into BALB / c mice. Figure 29 shows representative IVIS images of whole-body mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of BALB / c mice
[0278] 5 pg of luciferase mRNA was co-assemble with IAJD34 and then administered intranasally into BALB / c mice. Figure 30 shows representative IVIS images of whole-body mice and organs were taken 4 hours post-injection and show a strong luciferase signal in the lung of BALB / c mice.
[0279] These data demonstrate that delivery of Alpha- 1 -Antitrypsin mRNA to the lungs is useful for the treatment of chronic obstructive pulmonary disease.
[0280] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
Claims
CLAIMSWhat is claimed is:
1. A method of delivering an agent to the lung parenchyma of a subject in need thereof, wherein the method comprises administering at least one nanoparticle comprising an ionizable amphiphilic Janus dendrimer (IAJD), wherein the IAJD encapsulates a therapeutic agent, or a composition comprising the same to the subject.
2. The method of claim 1, wherein the IAJD comprises a formula of:
3. The method of claim 1, wherein the method treats or prevents at least one condition selected from the group consisting of: inflammation, a viral infection, bacterial infection, fungal infection, parasitic infection, cancer, disease or disorder associated with cancer, autoimmune disease or disorder, and any combination thereof.
4. The method of claim 1, wherein the method treats or prevents at least one condition selected from the group consisting of: asthma, chronic obstructive pulmonary disease (COPD), emphysema, acute respiratory distress syndrome (ARDS), lung cancer, sarcoidosis, asbestosis, chronic cough, pneumothorax, pulmonary embolism, pleural effusion, rheumatoid lung disease, pulmonary fibrosis, bronchiectasis, tuberculosis, bronchitis, or pneumonia.
5. The method of claim 1, wherein the method treats or prevents at least one condition selected from the group consisting of: non-small cell lung cancer, acute lung injury (ALI), emphysema, cystic fibrosis and idiopathic fibrosis.
6. The method of claim 1, wherein the therapeutic agent comprises at least one selected from the group consisting of cDNA, cRNA, CirRNA, mRNA, miRNA, siRNA, sgRNA, modified RNA, tRNA, antagomir, antisense molecule, targeted nucleic acid, and any combination thereof.
7. The method of claim 1, wherein the therapeutic agent is an mRNA molecule.
8. The method of claim 1, wherein the therapeutic agent is an mRNA molecule encoding TGF-0, Alpha- 1 -antitrypsin (A1AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP-B) or surfactant protein C (SP-C) or a fragment or variant thereof.
9. The method of claim 1, wherein the therapeutic agent is an mRNA molecule comprising SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9 or SEQ ID NO: 11.
10. The method of claim 1, wherein the therapeutic agent is an mRNA molecule transcribed from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 10 or SEQ ID NO: 12.
11. The method of claim 1, wherein the therapeutic agent is an mRNA molecule encoding SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 or SEQ ID NO: 17.
12. The method of claim 1, wherein the therapeutic agent is a nucleoside-modified RNA13. The method of claim 12, wherein the nucleoside-modified RNA comprises pseudouridine.
14. The method of claim 12, wherein the nucleoside-modified RNA comprises pseudouridine plus 5-methyl-cytosine.
15. The method of claim 12, wherein the nucleoside-modified RNA comprises 5- methyl-uridine.
16. The method of claim 12, wherein the nucleoside-modified RNA comprises 1- methyl-pseudouridine.
17. A composition for delivering a therapeutic agent to the lung parenchyma of a subject in need thereof, wherein the composition comprises a nanoparticle comprising an ionizable amphiphilic Janus dendrimer (IAJD), wherein the IAJD encapsulates a therapeutic nucleic acid agent.
18. The composition of claim 17, wherein the IAJD comprises a formula of:
19. The composition of claim 17, wherein the therapeutic nucleic acid agent comprises at least one selected from the group consisting of cDNA, cRNA, CirRNA, mRNA, miRNA, siRNA, sgRNA, modified RNA, tRNA, antagomir, antisense molecule, targeted nucleic acid, and any combination thereof.
20. The composition of claim 17, wherein the therapeutic nucleic acid agent is an mRNA molecule.
21. The composition of claim 17, wherein the therapeutic nucleic acid agent is a nucleoside-modified mRNA molecule.
22. The composition of claim 21, wherein the nucleoside-modified mRNA molecule comprises pseudouridine.
23. The composition of claim 21, wherein the nucleoside-modified mRNA molecule comprises pseudouridine plus 5-methyl-cytosine.
24. The composition of claim 21, wherein the nucleoside-modified mRNA molecule comprises 5-methyl-uridine.
25. The composition of claim 21, wherein the nucleoside-modified mRNA molecule compri ses 1 -methyl-pseudouri dine .
26. The composition of claim 17, wherein the therapeutic nucleic acid agent encodes an anti-inflammatory agent.
27. The composition of claim 17, wherein the anti-inflammatory agent comprises TGF-P, Alpha- 1 -antitrypsin (Al AT), soluble IL-1R, CFTR, IL-4, IL-13, Surfactant Protein D fragment (SP-D fragment), surfactant protein B (SP-B) or surfactant protein C (SP-C) or a fragment or variant thereof.
28. The composition of claim 17, wherein the therapeutic nucleic acid agent comprises a nucleic acid molecule comprising SEQ ID NO: 1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11.
29. The composition of claim 17, wherein the therapeutic agent comprises a mRNA molecule transcribed from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ IDNO: 10 or SEQIDNO:12.
Citation Information
Patent Citations
Lipoprotein-Based Nanoplatforms
US20080253960A1
Lung targeting dual drug delivery system
US20170042818A1
Mucus penetrating gene carriers
US20170246320A1
Synergistic combinations to reduce particle dose for targeted treatment of cancer and its metastases
US9125835B2