Vaccine composition for transdermal administration and method for administering said vaccine composition
The transdermal administration of a vaccine composition with mRNA and adjuvants like mineral salts and cytokine inducers enhances antibody and cellular immunity, addressing adverse reactions in intramuscular mRNA vaccines.
Patent Information
- Application Number
- PCT/JP2025/014574
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-15
- Filing Date
- 2025-04-14
- Publication Date
- 2025-10-23
AI Technical Summary
Existing mRNA vaccines for COVID-19, particularly those administered intramuscularly, often cause adverse reactions and lack effective adjuvants for transdermal administration to enhance antigen-specific antibody production and cellular immunity.
A vaccine composition comprising mRNA encoding a peptide antigen and adjuvants, such as mineral salts and inflammatory cytokine inducers, is administered transdermally using a jet spray device to enhance specific antibody production and cellular immunity.
The transdermal administration of the vaccine composition with adjuvants significantly increases specific antibody production and antigen-specific cellular immunity compared to intramuscular injection, reducing adverse reactions.
Smart Images

Figure JP2025014574_23102025_PF_FP_ABST
Abstract
Description
Vaccine composition for transdermal administration and method of administering said vaccine composition
[0001] The present invention relates to a vaccine composition for transdermal administration and a method for administering said vaccine composition.
[0002] Compared to conventional vaccines, mRNA vaccines are easier to develop and manufacture, and have begun to be used worldwide for the purposes of preventing infection, onset, and / or aggravation of COVID-19 (SARS-CoV-2). COVID-19 mRNA vaccines involve intramuscular injection of pseudouridine-containing mRNA encapsulated in lipid nanoparticles (Patent Documents 1 and 2). However, adverse reactions occur relatively frequently.
[0003] Patent Document 3 discloses that mRNA can be widely penetrated into the skin (particularly the dermis) by jetting it onto the skin using a transdermal administration device, and that the mRNA can be expressed to provide a vaccine effect to the administered individual.
[0004] US8,058,069BUS9,469,664BWO2023 / 145755A
[0005] Adjuvants and combinations of different adjuvants suitable for inducing antigen-specific antibody production and cellular immunity in vaccine compositions containing nucleic acids for transdermal administration have not been fully established. The present invention provides adjuvants and combinations of multiple adjuvants suitable for the above purposes, as well as vaccine compositions containing nucleic acids for transdermal administration and methods for administering the vaccine compositions. According to the present invention, the nucleic acid particularly comprises RNA, preferably mRNA, and more preferably naked mRNA. According to the present invention, the composition further comprises one or more, preferably two or more, adjuvants.
[0006] The present inventors have found that transdermal administration by jet spray of a transdermal administration device of a vaccine composition comprising a nucleic acid and an adjuvant, wherein the nucleic acid comprises mRNA encoding a peptide antigen, has an enhanced ability to produce specific antibodies against the peptide antigen and / or an enhanced ability to induce antigen-specific cellular immunity, compared to a control vaccine composition not containing an adjuvant.The present inventors have found that the adjuvant is preferably (i) an adjuvant containing a mineral salt (preferably an adjuvant containing an aluminum salt, the same applies hereinafter), and (ii) an inflammatory cytokine inducer, and that (iii) a combination of an adjuvant containing a mineral salt and an inflammatory cytokine inducer is more preferable.
[0007] The present invention provides the following: (1A) A vaccine composition comprising a nucleic acid and an adjuvant, wherein the nucleic acid comprises mRNA (preferably naked or free mRNA) encoding a peptide antigen, and the adjuvant preferably comprises (i) an adjuvant containing a mineral salt (preferably an adjuvant containing an aluminum salt, the same applies below), (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral salt and an inflammatory cytokine inducer, and the vaccine composition is administered by an administration method (preferably transdermal administration), which administration method (preferably transdermal administration) comprises administering (preferably spraying) the vaccine composition to the surface of a target tissue. (1A') A method of administering a vaccine composition to a subject in need thereof, the vaccine composition comprising a nucleic acid and an adjuvant, the adjuvant comprising (i) an adjuvant comprising a mineral salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral salt and an inflammatory cytokine inducer, the nucleic acid comprising mRNA encoding a peptide antigen, the method comprising administering (preferably by spraying) the vaccine composition to the surface of a target tissue of the subject, whereby the vaccine composition is administered (preferably by spraying) toward the target tissue, penetrates the surface of the target tissue and is delivered into the target tissue, causing cells in the target tissue to produce the peptide antigen from the mRNA, and inducing enhanced specific antibody production and / or enhanced antigen-specific cellular immunity against the peptide antigen in the body of the subject, compared to administration of a control vaccine composition not containing an adjuvant. (2A) The vaccine composition according to (1A) or (1A') above, wherein the adjuvant comprises a combination of an adjuvant comprising a mineral salt and an inflammatory cytokine inducer. (3A) A vaccine composition according to any one of (1A) to (2A) above, wherein the adjuvant comprises a CpG oligoDNA that induces IFN-α or an mRNA encoding an inflammatory cytokine {hereinafter, such a comprehensive expression shall include (1A') described between (1A) and (2A)}.(4A) The vaccine composition according to any one of (1A) to (3A) above, wherein the adjuvant comprises a CpG oligoDNA that induces an inflammatory cytokine. (5A) The vaccine composition according to any one of (1A) to (3A) above, wherein the adjuvant comprises an mRNA encoding an inflammatory cytokine (e.g., an mRNA encoding IFN-α). (6A) The vaccine composition according to any one of (1A) to (5A) above, wherein the mRNA encoding the peptide antigen comprises naked mRNA. (7A) The vaccine composition according to any one of (1A) to (6A) above, wherein the mRNA encoding the inflammatory cytokine is naked mRNA. (8A) The vaccine composition according to any one of (1A) to (7A) above, wherein the antigen is influenza hemagglutinin or coronavirus spike protein. (9A) The vaccine composition according to any of (1A) to (8A) above, wherein the vaccine composition is administered (preferably by spraying) to penetrate the surface of the target tissue and be delivered into the target tissue (preferably the cytoplasm of cells in the target tissue), and the peptide antigen is produced from mRNA in cells in the target tissue. (10A) A method of administering a vaccine composition to a subject in need thereof, wherein the vaccine composition comprises a nucleic acid and an adjuvant, the adjuvant comprising (i) an adjuvant comprising a mineral salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral salt and an inflammatory cytokine inducer, and the nucleic acid comprises mRNA encoding the peptide antigen, the method comprising administering (preferably by spraying) the vaccine composition to the surface of the target tissue of the subject, whereby the vaccine composition is administered (e.g., by spraying) toward the target tissue, penetrates the surface of the target tissue and is delivered into the target tissue, and the peptide antigen is produced from mRNA in cells in the target tissue.(10A') A method of administering a vaccine composition to a subject in need thereof, wherein the vaccine composition comprises a nucleic acid and an adjuvant, the adjuvant comprising (i) an adjuvant comprising a mineral salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral salt and an inflammatory cytokine inducer, and the nucleic acid comprises mRNA encoding a peptide antigen, the method comprising administering (preferably by spraying) the vaccine composition to the surface of a target tissue of the subject, whereby the vaccine composition is administered (preferably by spraying) toward the target tissue, penetrates the surface of the target tissue, and is delivered into the target tissue, causing cells in the target tissue to produce the peptide antigen from the mRNA, and inducing enhanced specific antibody production and / or enhanced antigen-specific cellular immunity against the peptide antigen in the body of the subject, compared to administration of a control vaccine composition not containing an adjuvant. (11A) A method for inducing antigen-specific immunity in a subject in need thereof, comprising administering (preferably by spraying) to the skin surface of the subject a vaccine composition comprising an adjuvant and mRNA encoding the peptide antigen, wherein the adjuvant comprises (i) an adjuvant comprising a mineral salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral salt and an inflammatory cytokine inducer. (11A') A method for inducing antigen-specific immunity in a subject in need thereof, comprising administering (preferably spraying) a vaccine composition comprising an adjuvant and mRNA encoding the peptide antigen to the skin surface of the subject, wherein the adjuvant comprises (i) an adjuvant comprising a mineral salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral salt and an inflammatory cytokine inducer, whereby the vaccine composition is administered (preferably sprayed) toward the target tissue, penetrates the surface of the target tissue, and is delivered into the target tissue, whereby the peptide antigen is produced from the mRNA in cells in the target tissue, thereby inducing enhanced specific antibody production and / or enhanced antigen-specific cellular immunity against the peptide antigen in the body of the subject, compared to administration of a control vaccine composition not containing an adjuvant.(12A) The method according to (10A), (10A'), (11A), or (11A') above, wherein the adjuvant comprises a combination of an adjuvant containing a mineral acid salt and an inflammatory cytokine-inducing agent. (13A) The method according to any of (10A) to (12A) above {hereinafter, such comprehensive expressions include (10A') described between (10A) and (11A), and (11A') described between (11A) and (12A)}, wherein the inflammatory cytokine-inducing agent comprises a CpG oligoDNA that induces an inflammatory cytokine or an mRNA that encodes an inflammatory cytokine. (14A) The method according to any of (10A) to (12A) above, wherein the inflammatory cytokine-inducing agent comprises a CpG oligoDNA that induces an inflammatory cytokine. (15A) The method according to any of (10A) to (12A) above, wherein the inflammatory cytokine-inducing agent comprises an mRNA that encodes an inflammatory cytokine. (16A) A method according to any one of (10A) to (15A) above, wherein the mRNA consists of naked mRNA. (17A) An administration device containing a vaccine formulation, comprising: (α) an administration device comprising a gas generating unit containing at least a gas generating agent, the gas generating unit having a drive unit for driving a plunger by pressure caused by gas generated from the gas generating agent in the gas generating unit; and (β) a vaccine formulation comprising a vaccine composition and a container storing the vaccine composition, the container having a pressurizing port for pressurizing and an ejection port for ejection, wherein the vaccine composition comprises mRNA encoding a peptide antigen and an adjuvant, and the adjuvant preferably comprises (i) an adjuvant containing a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral acid salt and an inflammatory cytokine inducer, and the plunger is inserted into the pressurizing port of the vaccine formulation in an airtight and liquidtight manner, and the drive unit drives the plunger by gas generation in the gas generating unit, thereby pushing the plunger into the container, thereby ejecting the vaccine composition from the ejection port. (18A) An administration device according to (17A) above, wherein the container is a cartridge-type container that is detachable from the device.(19A) A cartridge-type container for the administration device described in (18A) above, containing mRNA encoding the peptide antigen and an adjuvant, the adjuvant comprising (i) an adjuvant containing a mineral salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral salt and an inflammatory cytokine inducer.
[0008] (21A) Any of the above-mentioned inventions, wherein the inflammatory cytokine comprises interferon-α (IFN-α). (22A) Any of the above-mentioned inventions, wherein the inflammatory cytokine inducer comprises a Toll-like receptor 9 (TLR9) ligand that induces inflammatory cytokines such as IFN-α. (23A) Any of the above-mentioned inventions, wherein the inflammatory cytokine inducer comprises a Toll-like receptor 9 (TLR9) ligand that induces IFN-α.
[0009] (31A) Any of the above-mentioned inventions, wherein the mRNA encoding the peptide antigen and the adjuvant are not encapsulated in a drug delivery carrier. (32A) Any of the above-mentioned inventions, wherein the mRNA encoding the peptide antigen and the adjuvant are in a free form. (33A) Any of the above-mentioned inventions, wherein the mRNA encoding the peptide antigen and the adjuvant are dissolved in a vaccine composition.
[0010] (1) A vaccine composition comprising a nucleic acid, the nucleic acid comprising RNA (preferably naked or free RNA), the RNA comprising mRNA encoding a peptide antigen, and the vaccine composition further comprising an adjuvant, wherein the vaccine composition is administered by an administration method (preferably transdermal administration), the administration method (preferably transdermal administration) comprising administering (preferably spraying) the vaccine composition to the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering it into the target tissue (preferably the cytoplasm of cells in the target tissue). 2 (3) The vaccine composition described above, wherein the injection is carried out so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2(4) The vaccine composition described above, wherein the injection is performed so as to introduce mRNA into an area of 8 mm or more or larger (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). (5) The vaccine composition described above, wherein the pressurization is caused by the generation of gas from a gas generating agent. (6) The vaccine composition described above, wherein the nucleic acid comprises naked mRNA (preferably free mRNA) (wherein the mRNA may contain pseudouridine). (7) The vaccine composition described above, wherein the vaccine composition further comprises another adjuvant. (8) The vaccine composition described above, wherein the other adjuvant comprises a RIG-I ligand (e.g., double-stranded RNA) or a STING activator (e.g., cGAMP). (9) The vaccine composition described above, wherein at least a portion or all of the nucleic acid is contained in a lipid nanoparticle (e.g., vesicle) or a polyion complex (e.g., micelle or polymersome). (10) (i) The vaccine composition described above for use in delivering a nucleic acid to the epidermis or dermis of a subject, (ii) for use in expressing a nucleic acid in the epidermis or dermis of a subject, (iii) for use in inducing the formation of lymphoid follicles in the subcutaneous tissue of a subject, and / or (iv) for use in inducing specific immunity (which may be systemic) against a translation product of the nucleic acid in a subject. (11) (iv-1) The vaccine composition described above for use in inducing an antibody against the translation product of the nucleic acid in a subject. (12) (iv-2) The vaccine composition described above for use in inducing T cell immunity (which may be systemic) against the translation product of the nucleic acid in a subject. (13) A method for administering a nucleic acid to a subject in need thereof, wherein the nucleic acid comprises RNA, the method comprising administering (preferably spraying) a vaccine composition comprising the nucleic acid to the surface of a target tissue of the subject, whereby the vaccine composition is administered (preferably sprayed) toward the target tissue and the nucleic acid in the vaccine composition penetrates the surface of the target tissue and is delivered into the target tissue.(14) A method for inducing antigen-specific immunity in a subject in need thereof, wherein the nucleic acid comprises mRNA encoding the antigen, the method comprising administering (preferably spraying) a vaccine composition comprising the nucleic acid to the surface of a target tissue of the subject, whereby the vaccine composition is administered (preferably sprayed) toward the target tissue and the nucleic acid in the vaccine composition penetrates the surface of the target tissue and is delivered into the target tissue.
[0011] (15) The method according to the above, wherein the spraying of the vaccine composition is carried out by applying pressure to the vaccine composition. (16) The method according to the above, wherein the spraying of the vaccine composition is carried out by applying pressure to the vaccine composition. (17) The method according to the above, wherein the RNA consists of naked mRNA.
[0012] (21) A vaccine composition comprising a nucleic acid, wherein the nucleic acid comprises naked RNA (preferably free RNA), wherein the RNA comprises mRNA encoding a peptide antigen, and further comprising an adjuvant, wherein the vaccine composition is administered by transdermal administration, wherein the transdermal administration comprises administering (preferably by spraying) the vaccine composition to the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering it into the target tissue (preferably the cytoplasm of cells in the target tissue). (22) A vaccine composition comprising a nucleic acid, wherein the nucleic acid comprises naked RNA (preferably free RNA), wherein the RNA comprises mRNA encoding a peptide antigen, and further comprising an adjuvant, wherein the vaccine composition is administered by transdermal administration, wherein the transdermal administration comprises administering (preferably by spraying) the vaccine composition to the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering it into the cytoplasm of cells in the target tissue. (23) A vaccine composition comprising a nucleic acid, wherein the nucleic acid comprises naked RNA (preferably free RNA), wherein the RNA comprises mRNA encoding a peptide antigen, and further comprising an adjuvant, wherein the vaccine composition is administered by transdermal administration, wherein the transdermal administration comprises administering (preferably by spraying) the vaccine composition to the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering it into the cytoplasm of cells in the target tissue. 2 (24) The vaccine composition according to (21) above, wherein the injection is carried out so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2(25) The vaccine composition according to (21) above, wherein the injection is carried out so as to introduce mRNA into an area of 70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). 2 (26) The vaccine composition according to (22) above, wherein the injection is carried out so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2(27) The vaccine composition according to any one of (21) to (26), wherein the RNA is mRNA. (28) An administration device containing a vaccine formulation, comprising: (α) an administration device (preferably the administration device described above) equipped with a gas generating unit containing at least a gas generating agent, the gas generating unit having a gas outlet; and (β) a vaccine formulation comprising a vaccine composition and a container storing the vaccine composition, the container having a pressurizing port for pressurizing and an ejection port for ejection, wherein the vaccine composition comprises mRNA encoding a peptide antigen and an adjuvant, and the adjuvant preferably comprises (i) an adjuvant containing a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral acid salt and an inflammatory cytokine inducer, and the pressurizing port of the vaccine formulation is connected to the gas ejection port of the administration device, and the vaccine composition can be ejected from the ejection port by the pressure of the gas generated in the gas generating unit.(28-2) An administration device containing a vaccine formulation, comprising: (α) an administration device comprising a gas generating unit containing at least a gas generating agent, the gas generating unit having a drive unit for driving a plunger by pressure caused by gas generated from the gas generating agent in the gas generating unit; and (β) a vaccine formulation comprising a vaccine composition and a container storing the vaccine composition, the container having a pressurizing port for pressurizing and an ejection port for ejection, wherein the vaccine composition comprises mRNA encoding a peptide antigen and an adjuvant, and the adjuvant preferably comprises (i) an adjuvant containing a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral acid salt and an inflammatory cytokine inducer, and a plunger is inserted into the pressurizing port of the vaccine formulation in an airtight and liquidtight manner, and the drive unit drives the plunger by gas generation in the gas generating unit, thereby pushing the plunger into the container, thereby ejecting the vaccine composition from the ejection port. (29) The administration device according to (28) above, wherein the administration device comprises a body having a handle portion and a gas generating unit (actuator) having a container connectable to the body and containing at least a gas generating agent, the gas generating unit (actuator) having a drive unit for pushing the plunger, the vaccine formulation comprises a vaccine composition and a container storing the vaccine composition, the container has a pressurization port for pressurization and a spray port for spraying, the plunger is inserted into the pressurization port, and when the plunger is pushed into the container (i.e., pressurized), the vaccine composition is sprayed from the spray port. 2 (30) The administration device according to (28) above, wherein the administration is performed so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2 (31) The administration device according to (28) above, wherein the administration is performed so as to introduce mRNA into an area of 70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). 2(32) The administration device according to (28-2) above, wherein the administration is performed so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2 The administration device described in (28-2) above is performed so as to introduce mRNA into the above area (for example, so as to form a swelling of 8 mm or more in diameter in the skin immediately after administration).
[0013] (41) A vaccine preparation comprising: a vaccine composition; and a first container storing the vaccine composition; wherein the vaccine composition comprises mRNA encoding a peptide antigen and an adjuvant, and the adjuvant preferably comprises (i) an adjuvant containing a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral acid salt and an inflammatory cytokine inducer; the container has a pressurization port for pressurization and an ejection port for ejection, a plunger inserted into the pressurization port and capable of being pushed into the first container; and when the plunger is pushed from the pressurization port into the first container (i.e., pressurized), the vaccine composition is ejected from the ejection port, thereby allowing at least the mRNA to penetrate the tissue surface and penetrate into the tissue. (42) The vaccine formulation according to (41) above, further comprising a gas generating unit (actuator), the gas generating unit comprising a second container containing at least a gas generating agent, the gas generating unit (actuator) having a drive unit for pushing the plunger, and the plunger can be pushed into the first container via the drive unit by gas generated from the gas generating agent, and when the plunger is pushed into the first container from the pressure port (i.e., pressurized), the vaccine is ejected from the ejection port, thereby allowing at least the mRNA to penetrate the tissue surface and penetrate into the tissue, wherein the vaccine composition comprises mRNA encoding a peptide antigen and an adjuvant, and the adjuvant preferably comprises (i) an adjuvant containing a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral acid salt and an inflammatory cytokine inducer.(43) The vaccine preparation according to (42) above, further comprising a body portion of the administration device, wherein the body portion has a handle portion, a switch, a voltage generating unit electrically connected to the switch, and a plug electrically connected to the voltage generating unit, and also has a holder portion to which a gas generating unit (actuator) can be fixed, the gas generating unit is fixed to the holder portion, and the plug of the body is electrically connected to an ignition plug of the gas generating unit (actuator), whereby when the switch is turned on, a voltage is generated from the voltage generating unit, igniting the ignition plug and generating gas from the gas generating agent in the second container of the gas generating unit. (44) The vaccine preparation has a spray of 70 mm. 2 (45) The vaccine preparation according to (41) above, wherein the injection is carried out so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2 (46) The vaccine preparation according to (41) above, wherein the injection is carried out so as to introduce mRNA into an area of 70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). 2 (47) The vaccine preparation according to (42) above, wherein the injection is carried out so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2 (48) The vaccine preparation according to (42) above, wherein the injection is carried out so as to introduce mRNA into an area of 70 mm or more (for example, so as to form a swelling of 8 mm or more in diameter on the skin immediately after administration). 2 (49) The vaccine preparation according to (43) above, wherein the injection is carried out so as to introduce mRNA into an area of 200 mm or more (for example, so as to form a swelling of 5 mm or more in diameter on the skin immediately after administration). 2 The vaccine preparation according to (43) above, wherein the administration is carried out so as to introduce mRNA into the above area (for example, so as to form a swelling of 8 mm or more in diameter in the skin immediately after administration).
[0014] (61) The vaccine formulation described above, which does not contain a lipid component. (62) The vaccine formulation described above, which does not contain a polyethylene glycol component. (63) The vaccine formulation described above, wherein the RNA is naked RNA. (64) The vaccine formulation described above, wherein the RNA is RNA containing pseudouridine (e.g., m1Ψ). (65) The vaccine formulation described above in (64), wherein all uridines in the RNA are replaced with pseudouridines (e.g., m1Ψ). (66) The vaccine formulation described above in (64), wherein the RNA is naked mRNA, and all uridines in the RNA are replaced with pseudouridines (e.g., m1Ψ). (67) The vaccine formulation described above in (66), which does not contain a lipid component and / or a polyethylene glycol component.
[0015] Figure 1A shows the expression level of luciferase on the body surface of mice, measured by luminescence intensity, after transdermal administration of a vaccine composition containing a mixture of mRNA encoding firefly luciferase (Fluc) and various adjuvants via jet spray onto the skin using an administration device of the present invention. Figure 1B shows the change in luminescence intensity over time. Figure 2 shows the results of evaluating the ability of various adjuvants to induce antigen-specific antibody production. Figure 3 shows the results of evaluating the ability of various adjuvants to induce antigen-specific cellular immunity. Figure 4 shows the results of evaluating the ability of a combination of two adjuvants to induce antigen-specific antibody production (left) and antigen-specific cellular immunity (right). Figure 5 shows the results of evaluating the ability of a combination of mRNA encoding influenza virus hemagglutinin and two adjuvants to induce antigen-specific antibody production (left) and antigen-specific cellular immunity (right). Figure 6 shows the results of evaluating the ability of adjuvants containing only mRNA encoding interferon-α (IFN-α), as an alternative to CpG oligo-DNA, to induce antigen-specific antibody production (left) and antigen-specific cellular immunity (right). Figure 7 shows the results of evaluating the ability of adjuvants containing only mRNA encoding other cytokines, as an alternative to CpG oligo-DNA, to induce antigen-specific antibody production (left) and antigen-specific cellular immunity (right). Figure 8 shows the relationship between the ability of various adjuvants and adjuvant combinations to induce antigen-specific antibody production (horizontal axis) and the ability to induce antigen-specific cellular immunity (vertical axis). Region I shows adjuvants and adjuvant combinations that exhibit higher abilities to induce antigen-specific antibody production and antigen-specific cellular immunity than those without adjuvant. Regions II and III show adjuvants and adjuvant combinations that exhibit higher abilities to induce antigen-specific cellular immunity and antigen-specific antibody production than those without adjuvant, respectively. Region IV indicates that no adjuvant effect is observed in this system. Figure 9 is a schematic diagram of a vaccine preparation of the present invention. Figure 10 is a schematic diagram of a vaccine preparation of the present invention connected to an administration device. Figure 11 is a schematic diagram of an administration device equipped with a gas generator. Figure 12 is a schematic diagram of the gas generator. Figure 13 is the body of an administration device equipped with a holder for the gas generator.Figure 14 is a schematic diagram of the administration device body before connection to the gas generator. Figure 15A shows the experimental scheme for investigating the production of antigen-specific antibodies and the induction of antigen-specific cellular immunity. Figure 15B shows the production of antigen-specific antibodies in each treatment group: untreated group (n=6), no adjuvant group (n=6), adjuvant group (n=6), and MC3-LNP-treated group (n=6). Figure 16 shows the induction of antigen-specific cellular immunity by ELISPOT assay. Figure 17 shows the amount of leukocyte infiltration into the skin. Figure 18A shows the expression level of inflammatory cytokines in inguinal lymph nodes. Figure 18B shows the expression level of inflammatory cytokines in axillary lymph nodes. Figure 18C shows the expression level of inflammatory cytokines in the spleen. Figure 18D shows the expression level of inflammatory cytokines in the liver. Figure 19 shows the inflammatory cytokine levels in serum. Specific Description of the Invention
[0016] <Definition of Terms> In this specification, defined terms have the meanings as defined. Undefined terms have the meanings commonly used in the technical field. The singular form does not exclude plural. "Comprise" means that elements other than those specified may be included, and "consist of" means that elements other than those specified are substantially free (for example, only including unavoidable contamination of the elements in the production, or containing only an amount that does not substantially affect the function, or containing only the elements at levels below the detection limit), or are completely free of elements other than those specified.
[0017] As used herein, a "subject" may be an animal or plant. An animal or plant includes animals and plants. An animal may be, for example, a vertebrate, for example, a mammal or a bird. A mammal may be, for example, a primate, such as a human, a rodent, such as a mouse or a rat, or a domestic mammal, such as a cow, a horse, a sheep, a donkey, a sheep, a goat, a llama, or a camel. An example of a bird may be, for example, a chicken.
[0018] As used herein, "target tissue" refers to tissues such as skin (preferably the epidermis and dermis), mucous membranes, and various organs. Therefore, the surface of a target tissue includes the surface of skin, the surface of tissues such as mucous membranes, and the surface of various organs. In the present invention, a composition is administered by penetrating (or passing through) the surface of a target tissue, and administration by penetrating (or passing through) the skin surface is referred to as transdermal administration. As used herein, "skin" refers to the layer covering the outer surface of the body. Skin is composed of the epidermis and dermis. The epidermis is a tissue derived from the ectoderm and is primarily composed of keratinocytes. The epidermis has a basal layer on a basement membrane containing basal cells that divide actively in contact with the dermis. Epidermal cells derived from basal cells migrate outward from the basal side, transforming into spinous cells, granular cells, and keratinocytes. The dermis is a mesodermally derived tissue present in the lower layer of the epidermis. The dermis contains collagen-producing fibroblasts and immune cells such as mast cells, which are involved in immune function and inflammation. The dermis contains sweat glands such as eccrine and apocrine glands.
[0019] As used herein, the term "nucleic acid" includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), as well as modified nucleic acids thereof. Examples of nucleic acids include, but are not limited to, nucleic acids containing only DNA, nucleic acids containing only RNA, nucleic acids containing only DNA and RNA, nucleic acids containing DNA and modified nucleic acids, nucleic acids containing RNA and modified nucleic acids, and nucleic acids containing DNA, RNA, and modified nucleic acids.
[0020] As used herein, "messenger RNA" (mRNA) refers to RNA that has a protein-coding region and is capable of producing the protein as a translation product in a cell. mRNA typically has a 5' cap structure, a 5' untranslated region (UTR), a coding region, a 3' UTR, and a polyadenine sequence. The 5' cap structure may be, for example, a cap containing N7-methylguanosine (m7G) (e.g., m7GpppG cap, 3'-O-methyl-m7GpppG cap). The 5' UTR and 3' UTR, for example, facilitate translation of a protein from an mRNA.
[0021] As used herein, a "modified nucleic acid" refers to a derivative of DNA or RNA, and may be DNA or RNA modified for the purposes of enhancing hybridization ability, stability against degradation, thermal stability, or the like. Modified nucleic acids are not particularly limited, but examples include fluorescent dye-modified nucleic acids, biotinylated nucleic acids, and nucleic acids into which a cholesteryl group has been introduced. To enhance the stability of RNA, bases may be modified with 2'-O-methyl, 2'-fluoro, or 2'-methoxyethyl (MOE), and the phosphodiester bond in the nucleic acid backbone may be replaced with a phosphorothioate bond. Modified nucleic acids include crosslinked nucleic acids. Examples of such artificial nucleic acids include locked nucleic acids, which are crosslinked DNA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are crosslinked via a methylene. bridged nucleic acids (BNA) such as LNA, ENA in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via ethylene, BNACOC in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via -CHOCH-, BNANC in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via -NR-CH- (where R is a methyl or hydrogen atom), cMOE in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via -CH(OCH)-, and BNANC in which the oxygen atom at the 2' position and the carbon atom at the 4' position are bridged via -CH(CH)-. Examples of modified nucleic acids include bridged cEt, AmNA in which the 2' and 4' carbon atoms are bridged via an amide, scpBNA in which the 2' oxygen atom and the 4' carbon atom are bridged via a methylene, forming a cyclopropane at the 6' position, peptide nucleic acids (PNAs) in which the backbone is a polymer in which N-(2-aminoethyl)glycine is amide-linked instead of deoxyribose or ribose, and morpholino oligos in which the bases are linked by morpholine rings (e.g., U.S. Pat. No. 9,469,664B, the entirety of which is incorporated herein by reference). Modified nucleic acids may have acidic properties, but are not necessarily acidic. Examples of modified mRNA include mRNAs containing modified nucleosides. Examples of modified nucleosides include the modified nucleosides described in U.S. Pat. No. 8,278,036B, the entirety of which is incorporated herein by reference.Modified nucleosides include, for example, pseudouridine, which is known as a modified nucleoside for in vivo expression of mRNA. Modified nucleosides can replace unmodified nucleosides. Pseudouridines include, for example, 1-methyl-3-(amino-5-carboxypropyl)pseudouridine (m-methyl-3-(amino-5-carboxypropyl)pseudouridine). 1 acp 3 Examples of such pseudouridines include 1-methylpseudouridine (m1Ψ), 2'-O-methylpseudouridine (Ψm), 5-methyldihydriuridine (m5D), and 3-methylpseudouridine (m3Ψ), which can replace uridine. The modified mRNA preferably contains pseudouridine, and may further preferably contain 5-methylcytidine.
[0022] As used herein, "vesicles" refer to particles capable of storing substances inside. As used herein, nanovesicles refer to vesicles having a hydrodynamic diameter of less than 1 μm. Vesicles may be, for example, micelles, which are composed of a single membrane and capable of storing substances inside, or hollow vesicles, which are composed of a double membrane and capable of storing substances inside.
[0023] As used herein, "lipidic nanoparticles" (LNPs) refer to nanoparticles that are nanovesicles composed of lipid molecules (e.g., micelles and liposomes) or complexes (lipoplexes) of lipid molecules and components such as nucleic acids. Lipid nanoparticles include the nucleic acid-lipid particles described in U.S. Pat. No. 8,058,069B, the entire contents of which are incorporated herein by reference. Amphiphilic lipids can form lipidic nanoparticles in aqueous solutions. Those skilled in the art can appropriately select lipids to form lipidic nanoparticles from the lipids.
[0024] As used herein, RNA refers to naked RNA or vesicle-encapsulated RNA. Here, "naked RNA" refers to RNA that exists in a form that is not encapsulated in a vesicle. Among naked RNA, RNA that is not bound to other components is particularly referred to as free RNA.
[0025] As used herein, "isolation" refers to the removal of at least one or more contaminants contained in a system. For example, isolation refers to the removal of a target substance from a cell. As used herein, "purification" refers to the improvement of the purity of a target substance. In compositions to be applied to the human body (e.g., pharmaceutical compositions for humans and vaccines for humans), the components are usually each isolated or purified.
[0026] <Composition of the Present Invention> The composition of the present invention is a vaccine composition. The vaccine composition has a composition suitable for exerting a vaccine effect in a living body. The vaccine composition can be used to exert a vaccine effect in a subject to administration. The composition of the present invention comprises a nucleic acid. In one aspect of the present invention, the nucleic acid comprises RNA (particularly isolated RNA). In one aspect of the present invention, the nucleic acid comprises only RNA. In a preferred aspect of the present invention, the RNA is single-stranded RNA. In one aspect of the present invention, the RNA may be in a form encapsulated in a vesicle (e.g., lipid nanoparticle, micelle, or liposome). In one aspect of the present invention, the RNA may be in the form of a complex with a lipid molecule (lipoplex). In one aspect of the present invention, the RNA may be in a complex with a cationic polymer (polyion complex, e.g., polyion complex micelle or polymersome). In a preferred aspect of the present invention, the RNA is naked RNA. In a preferred aspect of the present invention, the nucleic acid may be naked single-stranded RNA (particularly free RNA).
[0027] In a preferred embodiment, the RNA may be messenger RNA (mRNA). In a preferred embodiment, each base of the mRNA consists of an unmodified base. In a preferred embodiment, the mRNA may contain modified nucleic acids. Particularly preferred mRNAs may contain pseudouridine instead of uridine, and in more preferred mRNAs, some or all uridines (particularly all uridines) are changed to pseudouridine. In a particularly preferred embodiment, the pseudouridine is m1Ψ. The mRNA contained in the composition of the present disclosure is suitable for protein expression in cells.
[0028] mRNA encodes proteins. Proteins encoded by mRNA include components or parts thereof specific to heterologous organisms, such as pathogens, and components or parts thereof specific to cancer cells. Pathogens include pathogenic viruses, pathogenic microorganisms, and pathogenic parasites. Pathogenic viruses include viruses selected from the group consisting of human immunodeficiency virus (HIV), hepatitis A, hepatitis B, hepatitis C, herpesvirus, adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, coxsackievirus, coronavirus (e.g., severe acute respiratory syndrome-associated coronavirus (SARS-CoV), Middle East respiratory syndrome-associated coronavirus (MERS), SARS-CoV-2), respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, human T-cell leukemia (HTL) virus, dengue virus, papillomavirus, molluscum contagiosum virus, poliovirus, rabies virus, John Cunningham (JC) virus, and arboviral encephalitis virus. Pathogenic microorganisms include pathogenic bacteria, including bacteria selected from the group consisting of chlamydia, rickettsiales, mycobacteria, staphylococci, streptococci, pneumococci, meningococci and gonococci, Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, diphtheria, Salmonella, bacillus, cholera, tetanus, botulism, anthrax, plague, leptospirosis, and Lyme disease bacteria. Pathogenic microorganisms include pathogenic fungi, such as Candida (e.g., albicans, krusei, glabrata, tropicalis), Cryptococcus neoformans, Aspergillus (e.g., fumigatus, niger), Mucorales (e.g., Mucor, Abscisicida, Rhizopus), Sporothrix schenckii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis, and Histoplasma capsulatum.Pathogenic parasites include those selected from the group consisting of Entamoeba histolytica, Balanchine coli, Naegleria fowleri, Acanthamoeba spp., Giardia lamblia, Cryptosporidium spp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondii, and Oncus brasiliensis. Thus, in one embodiment of the present invention, the mRNA can encode a component (preferably a surface antigen) of these pathogens or a portion thereof. In particular, among the surface antigens of pathogens, antigens used by pathogens to infect cells, such as the S protein of a betacoronavirus, can be preferably encoded by the mRNA of the present invention. Examples of cancer include bladder cancer, breast cancer, uterine cancer, endometrial cancer, ovarian cancer, colorectal cancer, colon cancer, head and neck cancer, lung cancer, gastric cancer, germ cell cancer, bone cancer, squamous cell carcinoma, skin cancer, central nervous system neoplasms, lymphoma, leukemia, sarcoma, virus-related cancer, small cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, Hodgkin's or non-Hodgkin's lymphoma, pancreatic cancer, glioblastoma, glioma, cervical cancer, ovarian cancer, liver cancer, myeloma, salivary gland cancer, kidney cancer, basal cell carcinoma, melanoma, prostate cancer, vulvar cancer, thyroid cancer, testicular cancer, esophageal cancer, and head and neck cancer. In some embodiments of the present invention, the mRNA may be an antigen specific to these cancers (cancer-specific antigen, preferably a cancer-specific surface antigen) or a portion thereof. The cancer-specific antigen may be, for example, a neoantigen or a portion thereof characteristic of a neoantigen. Cancer-specific antigens also include, for example, cancer-testis antigens (e.g., proteins of the MAGE family, NY-ESO-1), differentiation antigens (e.g., tyrosine kinase in melanoma, Melan-A / MART-1, PSA in prostate cancer), overexpressed cancer antigens (e.g., Her-2 / Neu, survivin, telomerase, and WT-1), cancer-induced mutants of β-catenin, cancer-induced mutants of CDK4, MUC-1, particularly MUC-1 with altered glycosylation patterns, and E6 or E7 of human papillomavirus.With regard to these, a person skilled in the art can select an appropriate antigen depending on the type of infectious disease and cancer with which the subject is suffering and the type of antigen expressed in the cancer, and prepare mRNA suitable for the present invention.
[0029] In some preferred embodiments, the compositions of the present invention are substantially free of or free of lipid nanoparticles and their components. In some embodiments, the compositions of the present invention are substantially free of or free of polyethylene glycol components. In some embodiments, the nucleic acid in the compositions of the present invention comprises RNA (preferably mRNA), and the RNA consists of naked RNA (preferably mRNA). In some embodiments, the nucleic acid in the compositions of the present invention comprises RNA, and the RNA comprises RNA (preferably mRNA) encapsulated in lipid nanoparticles.
[0030] The composition of the present invention may further comprise an adjuvant. In a preferred embodiment, the adjuvant comprises (i) an adjuvant containing a mineral acid salt (preferably an aluminum salt), (ii) an inflammatory cytokine inducer, or (iii) a combination of a mineral acid salt (preferably an aluminum salt) and an inflammatory cytokine inducer. More preferably, the adjuvant comprises (iii) a combination of a mineral acid salt (preferably an aluminum salt) and an inflammatory cytokine inducer. The adjuvant may further comprise another adjuvant. In a preferred embodiment, the adjuvant containing a mineral acid salt (preferably an aluminum salt) has the effect of inducing antigen-specific cellular immunity, the inflammatory cytokine inducer exhibits the effect of inducing antigen-specific antibody production, and the combination of the mineral acid salt (preferably an aluminum salt) and an inflammatory cytokine inducer exhibits both the effect of inducing antigen-specific cellular immunity and the effect of inducing antigen-specific antibody production.
[0031] In a preferred embodiment, the mineral acid salt can enhance the ability to induce antigen-specific cellular immunity by 1.2-fold or more, 1.3-fold or more, 1.4-fold or more, 1.5-fold or more, 1.6-fold or more, 1.7-fold or more, 1.8-fold or more, 1.9-fold or more, or 2-fold or more compared to the absence of the combination. In a preferred embodiment, the mineral acid salt can enhance antigen-specific antibody production by 5-fold or less, 4-fold or less, 3-fold or less, 2.9-fold or less, 2.8-fold or less, 2.7-fold or less, 2.6-fold or less, 2.5-fold or less, 2.4-fold or less, 2.3-fold or less, 2.2-fold or less, 2.1-fold or less, or 2-fold or less compared to the absence of the combination. In a preferred embodiment, the mineral acid salt can enhance antigen-specific antibody production by 1.5-fold to 5-fold, or 1.5-fold to 3-fold compared to the combination. The absence of the combination means that neither mineral acid salt nor IFN-α inducer is contained, and other adjuvants are contained in the same amounts between the comparison subjects.
[0032] In a preferred embodiment, the inflammatory cytokine-inducing agent can enhance antigen-specific antibody production by 1.2-fold or more, 1.3-fold or more, 1.4-fold or more, 1.5-fold or more, 1.6-fold or more, 1.7-fold or more, 1.8-fold or more, 1.9-fold or more, or 2-fold or more compared to the absence of the combination. In a preferred embodiment, the inflammatory cytokine-inducing agent can enhance antigen-specific antibody production by 5-fold or less, 4-fold or less, 3-fold or less, 2.9-fold or less, 2.8-fold or less, 2.7-fold or less, 2.6-fold or less, 2.5-fold or less, 2.4-fold or less, 2.3-fold or less, 2.2-fold or less, 2.1-fold or less, or 2-fold or less compared to the absence of the combination. In a preferred embodiment, the inflammatory cytokine-inducing agent can enhance antigen-specific antibody production 2-fold to 5-fold compared to the absence of the combination.
[0033] In a preferred embodiment, the combination of a mineral acid salt and an inflammatory cytokine-inducing agent can enhance the ability to induce antigen-specific cellular immunity by 1.2-fold or more, 1.3-fold or more, 1.4-fold or more, 1.5-fold or more, 1.6-fold or more, 1.7-fold or more, 1.8-fold or more, 1.9-fold or more, or 2-fold or more compared to the absence of the combination, and can enhance antigen-specific antibody production by 1.2-fold or more, 1.3-fold or more, 1.4-fold or more, 1.5-fold or more, 1.6-fold or more, 1.7-fold or more, 1.8-fold or more, 1.9-fold or more, or 2-fold or more compared to the absence of the combination. In a preferred embodiment, the combination of a mineral acid salt and a pro-inflammatory cytokine-inducing agent enhances antigen-specific antibody production by 5-fold or less, 4-fold or less, 3-fold or less, 2.9-fold or less, 2.8-fold or less, 2.7-fold or less, 2.6-fold or less, 2.5-fold or less, 2.4-fold or less, 2.3-fold or less, 2.2-fold or less, 2.1-fold or less, or 2-fold or less, compared to the absence of the combination, and can enhance antigen-specific antibody production by 5-fold or less, 4-fold or less, 3-fold or less, 2.9-fold or less, 2.8-fold or less, 2.7-fold or less, 2.6-fold or less, 2.5-fold or less, 2.4-fold or less, 2.3-fold or less, 2.2-fold or less, 2.1-fold or less, or 2-fold or less, compared to the absence of the combination. In a preferred embodiment, the combination of a mineral acid salt and a pro-inflammatory cytokine-inducing agent can enhance antigen-specific antibody production 1.5 to 5 times (e.g., 1.5 to 3 times) compared to the absence of the combination, and can enhance antigen-specific antibody production 2 to 5 times compared to the absence of the combination.
[0034] The mineral acid salt (preferably an aluminum salt) is an inorganic acid salt. Mineral oil and the like have long been used as adjuvants, but in recent years, the most commonly used adjuvants are those containing aluminum salts. Examples of aluminum salts include aluminum hydroxide, aluminum phosphate, aluminum chloride, and aluminum sulfate. In the United States, aluminum hydroxide, aluminum phosphate, and aluminum potassium sulfate are widely used as adjuvants suitable for human vaccine adjuvants.
[0035] In a preferred embodiment, the inflammatory cytokine inducer induces the production of inflammatory cytokines in cells. The inflammatory cytokine inducer may be, for example, a TLR9 ligand. The TLR9 ligand can bind to TLR9 and induce the production of inflammatory cytokines. The inflammatory cytokine may be, for example, interferon-α (IFN-α), interferon-γ (IFN-γ), and tumor necrosis factor (TNF-α), and may include any one or more of these. In a preferred embodiment, the inflammatory cytokine includes at least IFN-α. In this embodiment, the inflammatory cytokine inducer induces the production of inflammatory cytokines including at least IFN-α in cells. Examples of the inflammatory cytokine inducer include CpG oligoDNA, preferably CpG oligoDNA type A and type C, that induce TLR9 ligands and inflammatory cytokines. Unmethylated CpG dinucleotides derived from bacteria have immune-stimulating properties. Various synthetic oligonucleotides mimicking such bacterial DNA are known and commercially available. CpG oligo DNA type A potently induces interferon-α (IFN-α), interferon-γ (IFN-γ), and tumor necrosis factor-α (TNF-α) through Toll-like receptor 9 (TLR9), which recognizes single-stranded DNA. CpG oligo DNA type A is characterized by containing a palindromic sequence with a CG dinucleotide, and the optimal CpG motif in humans is believed to be GTCGTT (SEQ ID NO: 1). Therefore, in one preferred embodiment, a TLR9 ligand containing single-stranded DNA containing GTCGTT (SEQ ID NO: 1) is used as the TLR9 ligand. For example, TLR9 ligands that can be used include GGGGAATCGTCGTCGTTTG (SEQ ID NO: 3) and TCGTCGTTTTGTCGTTTTGT (SEQ ID NO: 4), as well as TLR9 ligands that include SEQ ID NO: 1 and have 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, or 90% or more sequence identity with the sequence set forth in SEQ ID NO: 3 or 4. Furthermore, examples of CpG oligo DNA type A include ODN1585 and ODN2216 from AdipoGen™.CpG oligoDNA type B stimulates interleukin-8 (IL-8) production and induces B cell proliferation and IgM and IL-6 production. CpG oligoDNA type B is characterized by containing a TCGTCG motif (SEQ ID NO: 2) at the 5' end. Examples of CpG oligoDNA type B include ODN2006 or ODN1668 / ODN1826 from AdipoGen™. CpG oligoDNA type C contains both Type A and Type B motifs and exhibits the respective effects. Examples of CpG oligoDNA type C include ODN2395 or ODNM362. An example of a CpG oligoDNA that induces IFN-α may be a CpG oligoDNA that contains an unmethylated CG dinucleotide, GTCGTT (SEQ ID NO: 1), and has agonistic activity against TLR9.
[0036] The inflammatory cytokine-inducing agent also includes, for example, a nucleic acid (particularly, mRNA) encoding a type I interferon, preferably interferon-α (IFN-α). The inflammatory cytokine-inducing agent also includes, for example, a nucleic acid (particularly, mRNA) encoding a type II interferon, preferably interferon-γ (IFN-γ). The inflammatory cytokine-inducing agent also includes, for example, a nucleic acid (particularly, mRNA) encoding TNF-α. The mRNA encoding the inflammatory cytokine may be naked RNA, similar to the mRNA encoding the antigen. In a preferred embodiment of the present invention, the mRNA encoding the inflammatory cytokine may be naked single-stranded RNA (particularly, free RNA). In a preferred embodiment of the present invention, the mRNA encoding the inflammatory cytokine may contain pseudouridine instead of uridine, and more preferably, some or all uridines (particularly all uridines) are changed to pseudouridine. In a particularly preferred embodiment, the pseudouridine is m1Ψ. The IFN-α may be any one or more subtypes selected from the group consisting of IFN-α1, IFN-α2, IFN-α3, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α8, IFN-α9, IFN-α10, IFN-α11, IFN-α12, IFN-α13, and IFN-α14. Nucleic acids encoding IFN-α capable of inducing antibody production are preferably used in the present invention as IFN-α inducers. In one aspect, the inflammatory cytokine is not interleukin-6 (IL-6) or IL-12.
[0037] The adjuvant may further contain other adjuvants, provided that they do not significantly inhibit the action of the mineral acid salt and the inflammatory cytokine inducer. Examples of other adjuvants include, but are not limited to, poly I:C polynucleotide, double-stranded RNA, lipopolysaccharide (LPS), CD40 ligand, a Toll-like receptor (TLR) ligand such as a ligand for TLR 1, TLR 2, TLR 3, TLR 4, TLR 5, TLR 6, TLR 7, TLR 8, TLR 10, or TLR 13, a ligand for NOD-like receptors, a retinoic acid-inducible gene I (RIG-I) ligand, an immunostimulatory nucleic acid, an immunostimulatory The ligand may be selected from the group consisting of an isRNA, a STING activator, for example, cGAMP (e.g., natural cGAMP or, for example, cyclic GMP-AMP, particularly one produced intracellularly by cyclic GMP-AMP (cGAS), e.g., 2',3'-cGAMP), or Freund's complete / incomplete adjuvant (see WO 2017 / 083963, which is incorporated herein by reference in its entirety). The ligand typically acts as an agonist, since it acts on the detection mechanism of foreign invaders.
[0038] The compositions of the present invention may further comprise a pharmaceutically acceptable carrier, additive, or excipient. For example, the compositions of the present invention may be an aqueous formulation and may further comprise a pharmaceutically acceptable salt (e.g., sodium salt), a pH buffer, and / or a metal chelator. The compositions of the present invention are RNAase-free and sterilized (e.g., sterilized by electron beam irradiation, etc.). The compositions of the present invention are preferably endotoxin-free.
[0039] The compositions of the present invention may be, for example, an aqueous solution, a cream, an ointment, an emulsion (e.g., an O / W emulsion), a powder, granules, or a gel, provided that the compositions of the present invention are in a form suitable for delivery by pressurization.
[0040] The vaccine composition of the present disclosure comprises a nucleic acid and an adjuvant, where the nucleic acid comprises mRNA encoding a peptide antigen. The composition exhibits enhanced specific antibody production and / or enhanced antigen-specific cellular immunity induction against the peptide antigen compared to a control composition not containing an adjuvant. The vaccine composition of the present disclosure more preferably exhibits enhanced specific antibody production and enhanced antigen-specific cellular immunity induction against the antigen. This allows the vaccine composition of the present disclosure to be preferably used as a vaccine against a pathogen bearing the antigen or a cell bearing the antigen (e.g., tumor, cancer). The vaccine composition of the present disclosure preferably comprises a nucleic acid containing mRNA encoding the peptide antigen and an adjuvant, but the nucleic acid is present in a naked, free form in the composition, eliminating the need for a carrier such as lipid nanoparticles that may cause side effects (e.g., pain and swelling at the injection site, as well as fever and chills (iScience 24, 103479, December 17, 2021)). The vaccine composition of the present disclosure preferably comprises a nucleic acid comprising an mRNA encoding a peptide antigen, an adjuvant, and a pharmaceutically acceptable carrier, additive, or excipient, wherein the nucleic acid is present in a naked, free form in the composition. In some embodiments, the vaccine composition of the present disclosure does not contain lipids. The adjuvant may also be present in a free form in the composition. In some embodiments, the mRNA may be complexed with a support, such as a cationic polymer, or the mRNA may be in a free form without being complexed with a support.
[0041] In a preferred embodiment, the vaccine composition of the present disclosure does not contain components of a drug delivery carrier (e.g., in the case of lipid nanoparticles, lipids such as ionizable lipids, neutral lipids, and PEG-lipids, and cholesterol), thereby reducing the risk of side effects (induction of inflammation) that may be caused by the use of lipid nanoparticles.
[0042] <Administration Method of the Composition of the Present Invention> The composition of the present invention is administered by the administration method of the present invention. Specifically, the administration method of the present invention comprises administering (preferably spraying) the composition (e.g., an aqueous solution) onto the surface of a target tissue. The spraying is performed with sufficient or appropriate intensity to penetrate the surface of the target tissue and deliver it into the target tissue. Thus, the administration method of the present invention comprises spraying the composition onto the surface of the target tissue with sufficient intensity to penetrate the surface of the target tissue and deliver it into the target tissue. Sufficient intensity may be, for example, an intensity that reaches a depth of about 5 mm, about 4 mm, about 3 mm, about 3 mm, about 2 mm, about 1 mm, about 0.5 mm, about 0.3 mm, about 0.2 mm, or about 0.2 mm to about 3 mm, about 0.5 mm to about 3 mm, or about 1 mm to about 3 mm from the surface of the target tissue. In addition to spraying, administration can also be performed using, for example, electroporation, cavitation, iontophoresis, microneedle, liposome, viral vector, microparticle, nanoparticle, or dendrimer methods. These methods can be carried out in accordance with conventional methods.
[0043] In a preferred embodiment, the composition can be sprayed by pressurizing it. Pressurization can be achieved by pressurizing the composition with a gas. In a preferred embodiment, the composition is stored in a container, which is equipped with a pressurization port for pressurizing the inside of the container and a nozzle for spraying, and the composition can be sprayed from the nozzle. The inside of the container can be pressurized by generating gas or expanding the gas and spraying the gas into the container containing the composition, and the composition can be sprayed from the nozzle provided in the container by this pressure. The gas used for pressurization can be generated, for example, from a gas generating agent. The gas generating agent can generate gas by combustion. Gas generation from the gas generating agent can be caused directly or through the combustion of an ignition charge. The generated gas reaches the pressurization port and pressurizes the inside of the container. In contrast, the nozzle has a relatively low pressure, and the composition is sprayed from the pressurized container through the nozzle. In a preferred embodiment, the pressurization utilizes explosive force generated by gas generation. The explosive force can be controlled. In a preferred embodiment, as described below, injection may be performed with the vaccine formulation 10 described below.
[0044] The ignition charge may be, but is not limited to, any one of the following explosives: zirconium and potassium perchlorate; titanium hydride and potassium perchlorate; titanium and potassium perchlorate; aluminum and potassium perchlorate; aluminum and bismuth oxide; aluminum and molybdenum oxide; aluminum and copper oxide; and aluminum and iron oxide; or a combination of these. For example, a zirconium-potassium perchlorate (ZPP) mixture may be used as the ignition charge. For example, a gas generant may be a powder containing nitrocellulose, diphenylamine, and potassium sulfate. The gas generant may also be any of the various gas generants used in airbag gas generators and seatbelt pretensioner gas generators. The gas generant may preferably be a smokeless powder containing 95 to 99% by weight (e.g., 98%) of nitrocellulose, 0.5 to 1.5% by weight (e.g., 0.8% by weight), and potassium sulfate (0.7 to 2% by weight (e.g., 1.2% by weight)). It is preferable that the ignition charge does not generate gas at a level that would cause substantial fluctuations in pressure during combustion. The gas generant can generate a pressure of 5 to 50 MPa, preferably 20 to 40 MPa, and more preferably 25 to 34 MPa, upon gas generation. Those skilled in the art will be able to appropriately select and use the gas generant and ignition charge. Furthermore, the pressure may reach its maximum, for example, within 10 to 30 milliseconds after gas generation.
[0045] The injection may be performed multiple times using the same or different pressures. In this case, it may be effective to increase the skin permeability by the first pressure and then penetrate the drug solution into the skin by the second pressure, for example.
[0046] In the present invention, the composition can be widely permeated onto the skin by transdermal administration using jet spray. 2) or greater, an area of skin receives the composition (particularly mRNA, preferably mRNA encoding an immunogen). Thus, transdermal administration by jet propellant can cause a circular bulge of 2 mm or greater in diameter to form on the skin surface. In one embodiment, skin having an area equivalent to a circular area of 2 mm or greater, 3 mm or greater, 4 mm or greater, 5 mm or greater, 6 mm or greater, 7 mm or greater, 8 mm or greater, 9 mm or greater, or 10 mm or greater in diameter receives the composition (particularly mRNA, preferably mRNA encoding an immunogen). In one embodiment, 2 More than 10 mm 2 More than 20 mm 2 Above, 30mm 2 Above 40mm 2 Above 50 mm 2 Above, 60mm 2 Above 70 mm 2 Above 80mm 2 Above 90mm 2 Over 100mm 2 Above, 110mm 2 Above 120mm 2 Above 130mm 2 Above 140mm 2 Above, 150mm 2 Above, 160mm 2 Over 170mm 2 Above, 180mm 2 Over 190mm 2 or more, or 200 mm 2 These areas of skin receive the composition (particularly mRNA, preferably mRNA encoding an immunogen). In these embodiments, a bulge may form in the area of skin. In some embodiments, the mRNA encodes a protein whose expression in skin-resident immune cells is beneficial. In some embodiments, the mRNA encodes an immunogen. In some embodiments, the mRNA encodes a viral antigen. In some embodiments, the mRNA encodes a cancer antigen.
[0047] <Medical Uses of the Composition of the Present Invention> The composition of the present invention can be used for vaccine applications. For example, the composition of the present invention can be used to introduce a nucleic acid containing RNA into a target tissue, express an antigen from the RNA in the target tissue, and induce specific immunity against the antigen. The target tissue is preferably the skin or mucosa.
[0048] The compositions of the present invention can be used, for example, to deliver nucleic acids to the skin tissue (e.g., epidermis or dermis) of a subject. The compositions of the present invention can be used, preferably, to deliver nucleic acids to the dermis of the skin tissue of a subject. The compositions of the present invention can express nucleic acids in the dermis of a subject, produce antigens, and induce immunity against the antigens. In the present disclosure, adjuvants are also considered to penetrate the skin. The mode of penetration of the adjuvant into the skin can affect the effect of the adjuvant by transdermal administration.
[0049] The compositions of the present invention can induce lymph nodes (lymph follicles) to form in the subcutaneous tissue of a subject. The lymph follicles can contain immune cells, such as dendritic cells. The compositions of the present invention can deliver nucleic acids to and / or express nucleic acids in lymph nodes (lymph follicles) in the subcutaneous tissue.
[0050] The compositions of the present invention can also be used, for example, to induce specific immunity in a subject against the translation product of the nucleic acid contained in the composition (i.e., a protein encoded by the nucleic acid, more specifically, a peptide antigen). The specific immunity is preferably systemic. The compositions of the present invention can also preferably be used to induce antibodies in a subject against the translation product of the nucleic acid (more specifically, a peptide antigen). The antibodies may be, for example, IgG. The compositions of the present invention can further preferably be used to induce T cell immunity in a subject against the translation product of the nucleic acid (more specifically, a peptide antigen). The T cell immunity may be the induction of CD4 single-positive T cells and / or CD8 single-positive T cells.
[0051] Therefore, the composition of the present invention can be used as a vaccine, preferably a vaccine against infectious diseases or cancer. In this aspect, according to the present invention, the composition of the present invention can be a vaccine, preferably a vaccine against infectious diseases or cancer can be provided.
[0052] <Method for administering the vaccine composition of the present disclosure according to the present invention> The present invention provides a method for administering a vaccine composition. As the vaccine composition, the vaccine composition as explained in the section on the composition of the present invention can be used, so please refer to the description in the section on the composition of the present invention and explanation will be omitted here.
[0053] According to the present invention, there is provided a method for administering a vaccine composition to a subject in need thereof, the method comprising spraying the composition onto the surface of a target tissue of the subject, thereby spraying the composition toward the target tissue, penetrating the surface of the target tissue, and delivering the composition into the target tissue. The target tissue may be an organ, or a tissue such as skin or mucosal tissue. Details of the spraying method are as described in the method for administering the composition of the present invention, so reference is made to this description and further description will be omitted here.
[0054] The method of administering a nucleic acid of the present invention comprises spraying the composition onto the surface of a target tissue, thereby delivering the nucleic acid through the surface of the target tissue into the target tissue, and simultaneously distributing the adjuvant through the surface of the target tissue into the target tissue.
[0055] In the method for administering the vaccine composition of the present invention, the injection can be carried out using an administration device suitable for this. The administration device can include an enclosure that encloses the composition, a pressurizing unit that pressurizes the composition enclosed in the enclosure, and a flow path that defines a flow path so that the composition pressurized by the pressurizing unit is injected toward the surface of the target tissue. The pressurizing unit can pressurize the composition in the pressurizing unit to penetrate the surface, and the pressure increase in the pressurizing unit serves as the driving force for the injection. The pressure increase in the pressurizing unit is caused by gas release from a gas generating agent.
[0056] <Method for Inducing Immunity According to the Present Invention> The present invention provides a method for inducing antigen-specific immunity in a subject, the method comprising spraying the composition (containing mRNA encoding the antigen) onto the skin surface of the subject, thereby spraying the composition toward the target tissue, penetrating the surface of the target tissue, and delivering the composition into the target tissue. Details of the composition and the administration method are as described above. In one aspect, the antigen-specific immunity can be antigen-specific humoral immunity (antibody production). In one aspect, the antigen-specific immunity can be cellular immunity (T cell immunity, particularly T cell immunity mediated by CD8 single-positive T cells and T cell immunity mediated by CD4 single-positive T cells). In one aspect, the antigen-specific immunity can be both antigen-specific humoral immunity (antibody production) and cellular immunity (T cell immunity, particularly T cell immunity mediated by CD8 single-positive T cells and T cell immunity mediated by CD4 single-positive T cells). In one aspect, the method for inducing antigen-specific immunity involves the induction of lymph nodes (lymph follicles) in the skin. The lymph nodes (lymph follicles) can contain dendritic cells.
[0057] <Other Inventions> The present invention provides use of the nucleic acid in the production of a composition of the present invention. The present invention also provides use of the adjuvant in the production of a composition of the present invention. The present invention still further provides use of the nucleic acid and the adjuvant in the production of a composition of the present invention.
[0058] The present invention provides a vaccine preparation containing a vaccine composition. The vaccine preparation comprises a vaccine composition and a container containing the composition. In one embodiment of the present invention, a vaccine preparation (RNA preparation) 10 may be provided, comprising a vaccine composition 13 and a container 14 containing the composition 13, the container 14 comprising a pressure port 11 for pressurization and an ejection port 12 for ejection. In a preferred embodiment, the container 14 has a cylindrical shape, and a plunger 11a may be inserted into the pressure port 11 in an airtight and liquid-tight manner. That is, pressurization may be achieved by pushing the plunger 11a into the container 14. In this manner, gas pressure generated by a gas generating agent can be transmitted to the container via the plunger, and the composition can be ejected from the ejection port while preventing contact of the gas generated by the gas generating agent with the composition. For this purpose, the plunger 11a may be provided with a plunger rubber 11b at its tip. The provision of the plunger rubber 11b advantageously facilitates pushing the plunger into the container 14 in an airtight and liquid-tight manner. In a preferred embodiment, the container 14 has a cylindrical shape, and the plunger 11a or plunger rubber 11b can move within the cylinder in an airtight and liquid-tight manner, thereby effectively spraying the composition stored in the container 14 from the nozzle 12. The plunger rubber can be made of rubber (e.g., silicone rubber) so that it can move in an airtight and liquid-tight manner. In a preferred embodiment, the nozzle 12 is aseptically sealed. In a preferred embodiment, the nozzle 12 may be a hole with a diameter sufficient for ejection. The diameter of the hole can be appropriately adjusted to ensure the ejection pressure of the composition inside. The nozzle 12 may also be an opening. The vaccine formulation may be aseptically contained in a bag. This vaccine formulation can be used to administer to a subject via the subject's tissue surface (e.g., the skin surface). The RNA may be naked RNA, for example, free RNA. In a preferred embodiment, the RNA may be mRNA. The internal volume of the container 14 can be determined appropriately. In this specification, the container 14 may be referred to as a first container.
[0059] The vaccine preparation can be administered to a subject by applying pressure through a pressure port to eject the vaccine composition from the container through a nozzle. The pressurization method and vaccine composition are as described above. Therefore, for the pressurization method and vaccine composition, please refer to the above, and a repeated explanation will be omitted here.
[0060] The vaccine preparation is connected to an administration device (see, e.g., FIG. 11 ), and the vaccine composition can be sprayed from a nozzle by applying pressure from the administration device (see, e.g., FIG. 10 ). The administration device 50 includes a body 31 with a handle 32 and a gas generator (actuator) 20 with a container 21 that contains at least a gas generating agent 23 and is connectable to the body 31. The gas generator (actuator) 20 has a drive unit 25 for pushing the plunger. The drive unit 25 is connected to the plunger 11a, and can push the plunger 11a into the container 14 via the drive unit 25 as gas is generated from the gas generating agent 23. The administration device 50 and the vaccine preparation 10 are configured as separate entities (see, e.g., FIGS. 9 and 11 ). For example, they may be sold separately and connected before use, or they may be sold in a connected state (see, e.g., FIG. 10 ). Forming the vaccine preparation 10 into a cartridge-type container in this manner is preferable because it allows the vaccine preparation to be replaced for each administration as needed. In addition, in the administration device, the body 30 with a handle and the gas generator 20 may be configured as separate entities (see Figures 12 and 13). For example, they may be sold separately and connected before use, or they may be sold connected together (see, for example, Figure 11). This is preferable because the body can be reused by using a cartridge-type gas generator for each administration and replacing it as needed. Furthermore, the vaccine preparation may be integrated with the gas generator (see Figure 14). Therefore, in this embodiment, a vaccine preparation equipped with a gas generator is provided, and in this vaccine preparation, the drive unit 25 of the gas generator is configured to push the plunger 11a into the container 14 as gas is generated from the gas generant 23. The gas generator may further include an ignition charge; for example, the gas generant 23 may further include an ignition charge. In this specification, the container 21 may sometimes be referred to as a second container.
[0061] The gas generating unit (actuator) 20 may include an ignition plug 24 for generating gas from the gas generating agent 23. In this manner, gas can be generated by igniting the gas generating agent 23, etc. The body 30 may also include a plug 33 that can be electrically connected to the ignition plug 24. A voltage generating unit 35 is connected to the plug. This connection may be made via a conductive wire 37 or the like. The voltage generating unit 35 is also connected to a switch 34. This connection may be made via a conductive wire 36 or the like. By turning on the switch 34, the voltage generating unit 35 can generate a voltage and transmit the voltage to the plug 33. The ignition plug 24, electrically connected to the plug 33, generates gas from the gas generating agent 23 in response to the voltage from the plug 33, and when the gas is generated, the drive unit 25 is driven to push the plunger 11a into the container 14. The voltage generating unit may be driven by electricity supplied from an external source or an internal power source.
[0062] In one aspect of the present invention, there is provided the above-mentioned vaccine formulation, which comprises a gas generating unit containing at least a gas generating agent, and the gas generating unit is used in connection with an administration device having a gas outlet.
[0063] The vaccine formulation of the present invention can be administered using (α) an administration device including a gas generator containing at least a gas generating agent, the gas generator having a gas outlet. The vaccine formulation of the present invention can be connected to the gas outlet of the administration device via a pressurization port.
[0064] Furthermore, in one aspect of the present invention, there is provided an administration device containing a vaccine formulation, comprising: (α) an administration device (preferably the administration device described above) comprising a gas generating unit containing at least a gas generating agent, the gas generating unit having a drive unit that is driven in response to gas generation within the gas generating unit; and (β) a vaccine formulation comprising a vaccine composition and a container that stores the composition, the container having a pressurizing port for pressurizing and an ejection port for ejection, wherein the pressurizing port for the vaccine formulation is connected to the drive unit of the administration device, and the container can be pressurized by the drive unit that is driven in response to gas generation in the gas generating unit, thereby ejecting the composition from the ejection port. More specifically, as shown in Figure 9, a vaccine preparation 100 comprises a vaccine composition 13 and a container 14 storing the composition 13, the container 14 having a pressurizing port 11 for pressurizing and an ejection port 12 for ejection, a plunger 11a inserted into the pressurizing port 11 in an airtight and liquidtight manner, and pressurization is achieved by pushing the plunger 11a into the container 14, whereby the pressure associated with gas generation in the gas generating section is transmitted to the container via the plunger, and the composition can be ejected from the ejection port, and the administration device further has a body portion 30. A vaccine preparation can be provided in which the body portion has a handle portion 32, a switch 34, a voltage generating unit 35 electrically connected to the switch 34, and a plug 33 electrically connected to the voltage generating unit 35, and also has a holder portion 38 to which a gas generating unit (actuator) 20 can be fixed, the gas generating unit 20 is fixed to the holder portion 38, and the plug 33 of the body and the ignition plug 24 of the gas generating unit (actuator) are electrically connected, so that when the switch 34 is turned on, a voltage is generated from the voltage generating unit 35, igniting the ignition plug 24 and generating gas from the gas generating agent 23 in the second container 21 of the gas generating unit.
[0065] The gas release port of the administration device may be directly or indirectly connected to the pressurization port, for example, via a gas delivery pipe between the gas release port and the pressurization port.
[0066] All references cited herein are incorporated by reference in their entirety.
[0067] Example 1 Materials: CleanCap™ FLuc mRNA, 5'-cap analog (ARCA), m1Ψ-5'-Triphosphate, m1Ψ-modified COVID-19 spike protein mRNA, and m1Ψ-modified hemagglutinin mRNA were purchased from Trilink biotechnologies (San Diego, CA, USA). The intradermal administration device, Actranza® (actuator: 1A1MD-5, container unit: 1C20-5), was purchased from Daicel. Goat anti-mouse IgG horseradish peroxidase (HRP)-conjugated antibody was purchased from abcam. Anti-IFNγ ELISpot was purchased from MABTECH. MEGAscript TM was purchased from Thermo Fisher Scientific. For mRNA preparation of IFNα11 (see NM_008333.2), IL-6 (see NM_031168.1), and IL-12 (see NM_008366.3), template DNA was purchased from Genscript and used in MEGAscript. TM In vitro transcription was performed using ARCA, m1Ψ-5′-Triphosphate.
[0068] IVIS observation: 20 μL of a solution containing 10 μg of FLuc mRNA was administered to C57BL / 6J mice and Balb / C mice using a syringe (manual) or an Actranza (registered trademark) device. For IVIS, 200 μL of a 5 mg / mL luciferin solution was intraperitoneally administered, and IVIS was measured 10 minutes later.
[0069] Balb / C mice were purchased from Charles River and used for vaccine experiments at 7-9 weeks of age. mRNA was diluted in 10 mM HEPES buffer (pH 7.4) and 20 μL was administered into the flank. To assess efficacy, blood was collected from the inferior vena cava, centrifuged at 2000 × g for 10 minutes at 4°C, and used for antibody detection. Spleens were also collected and used for ELISpot.
[0070] ELISpot After harvesting, the spleen was immersed in 5 mL of RPMI-1640 medium (containing 10% FBS, 1 mM sodium pyruvate, 10 mM HEPES, 50 μM mercaptoethanol, and 1% penicillin-streptomycin), and a splenocyte suspension was prepared using a metal mesh. The suspension was passed through a 40 μm nylon mesh (Cell strainer, Falcon). These cells were collected at a density of 2.5 × 10 5 The cells were seeded onto an anti-IFNγ ELISpot 96-well plate at a concentration of 1000 cells / well. After overnight incubation, the plate was stained according to the protocol, and the number of spots was counted using an ELISpot plate reader (AID GmbH, Germany).
[0071] Antibody quantification Plasma antibody titers were quantified by enzyme-linked immunosorbent (ELISA). To prepare ELISA plates, S protein or hemagglutinin was diluted to a concentration of 2 μg / mL in 50 mM carbonate buffer (pH 9.6). 50 μL of this solution was added to Clear Flat-Bottom Immuno Nonsterile 96-well Plates (Thermo) at a concentration of 2 μg / mL and incubated overnight at 4°C. The plates were washed three times with PBS containing 0.5% v / v Tween 20 (PBS-T), and then 100 μL of PBS-T containing 1% BSA and 2.5 mM EDTA was added and incubated at room temperature for 1 hour. The solution was then removed and the plate was used for ELISA. Plasma samples were diluted with 1% BSA and 2.5 mM EDTA in PBS-T, then added to the plate at 50 μL / well and incubated overnight at 4°C. After washing three times with PBS-T, 50 μL of horseradish peroxidase (HRP)-labeled goat anti-mouse IgG-HRP (1:8000) was added and incubated at room temperature for 2 hours. Finally, 100 μL / well of HRP substrate was added and incubated at room temperature for 30 minutes. The reaction was stopped by adding 2 M sulfuric acid, and the absorbance at 492 nm was observed using a plate reader (Tecan, Switzerland). The antibody titer was determined using an absorbance of 0.1 as the threshold.
[0072] Results Devices that administer drugs transdermally by jet spraying are known (see, for example, JP 2012-061269, JP 2012-065920, JP 2012-065922, JP 2014-147841, JP 2014-176759, JP 2016-221411, PHARMACEUTICS, DRUG DELIVERY AND PHARMACEUTICAL TECHNOLOGY | VOLUME 108, ISSUE 7, P2415-2420, JULY 01, 2019, AAPS PharmSciTech volume 21, Article number: 19 (2020), https: / / doi.org / 10.1101 / 2021.01.13.426436. These documents are incorporated herein by reference in their entirety.) An administration device based on these technologies is sold by Daicel Corporation under the name Actranza (registered trademark) Lab. Hereinafter, "transdermal administration" refers to transdermal administration using this administration device. Actranza (registered trademark) Lab is not a device that simply administers a substance to the skin with a single gas jet; rather, it uses an ignition charge and a gas generator to generate two jet jets with one ignition, and each of the two pressurizations causes the plunger to inject the drug solution. The two pressurized jets allow the drug solution to penetrate a wide area of the skin. When naked mRNA encoding the luciferase was administered transdermally to mice (Balb / c, n=3) (referred to as the "transdermal administration group") using Actranza (registered trademark) Lab, Ivis observation revealed that the total luminescence intensity exceeded approximately 10 million, demonstrating an expression efficiency that was 100 times higher than that of the intradermal administration group (see WO2023 / 145755A).
[0073] Actranza (registered trademark) allows the drug solution to penetrate a wide area of the skin by two pressurized sprays (see, for example, JP 2012-061269 A). Two sprays are expected to be effective in increasing the amount of drug solution that penetrates and spreading the drug solution over a wide area. The first spray creates a vertical pathway for the drug solution from the surface layer of the skin to the deeper layers, and the second spray spreads the drug solution horizontally over a wide area from the pathway, which is thought to enable widespread delivery of nucleic acids to the surrounding skin, expression of peptide antigens, and induction of a vaccine effect.
[0074] We investigated whether the effect could be enhanced by mixing an adjuvant. Specifically, the adjuvant used was Alum (Adju-Phos TM adjuvant (invivogen, vac-phos-250). Final conc: 0.1% w / w), NF59-like (AddaVax TM (Invivogen, vac-adx-10) (mixed with mRNA solution at a volume ratio of 1:1)), AS03-like (AddaS03 TM (Invivogen, vac-as03-10) (mixed with mRNA solution at a volume ratio of 1:1)), LPS derivative (MPLAs VacciGrade TM (invivogen, vac-mpls) Final conc. 0.5 mg / mL), CpG ODN type A (ODN 1585 VacciGrade TM (Invivogen, tlrl-1585) Final conc. 1mg / mL), and CpG ODN type B (ODN 1826 VacciGrade TM (Invivogen, vac-1826) Final concentration 1 mg / mL) was used.
[0075] Balb / C mice (n=3) were administered transdermally with mRNA encoding Fluc (10 μg / mouse) mixed with each of the above adjuvants using Actranza® Lab. First, we confirmed that mixing with the adjuvants did not significantly affect the luminescence intensity of the expressed Fluc (see Figures 1A and 1B).
[0076] Next, we examined the effect of the above adjuvants on a coronavirus vaccine containing mRNA encoding the SARS-CoV-2 S protein. Specifically, SARS-CoV-2 Spike mRNA (N1-methylpseudouridine modified) was purchased from Trilink. Balb / C mice (n=4) were administered a mixture of mRNA (10 μg / dose) and one of the above adjuvants intradermally using Actranza® Lab. A second administration was administered three weeks later, and antigen-specific antibody production and induction of cellular immunity were evaluated two weeks later.
[0077] The results of antigen-specific antibody production are shown in Figure 2. As shown in Figure 2, Alum actually reduced the production of antigen-specific antibodies, which was a surprising result. As shown in Figure 2, CpG ODN type A promoted the production of antigen-specific antibodies. The results of the induction of antigen-specific cellular immunity are shown in Figure 3. As shown in Figure 3, Alum demonstrated the ability to induce antigen-specific cellular immunity. On the other hand, the other adjuvants either had no significant effect or actually reduced the immune induction effect. This result was surprising, as CpG ODN type A was expected to be effective in inducing cellular immunity, and CpG ODN type B was expected to be effective in inducing antibody production.
[0078] Similarly, the effect of the above adjuvants on a coronavirus vaccine containing mRNA encoding the S protein of SARS-CoV-2 was further confirmed. Both Alum and CpG ODN type A were used as adjuvants, at the same concentrations as those described above. The results are shown in Figure 4. As shown in Figure 4, the combination of Alum and CpG ODN type A stimulated the production of antibodies specific to the spike protein and induced spike protein-specific cellular immunity.
[0079] The adjuvant effect of the combination of Alum and CpG ODN type A was also applied to other vaccines. Specifically, mRNA encoding the hemagglutinin of H1N1 influenza virus was mixed with the adjuvant combination of Alum and CpG ODN type A and the mRNA (10 μg) was administered intradermally to mice (Balb / C, n = 8) using Actranza® Lab. The hemagglutinin-encoding mRNA had the sequence of influenza virus (A / California / 07 / 2009 H1N1) and contained N1 methylpseudouridine modification. The mRNA was synthesized by Genscript, Inc. Adju-Phos™ adjuvant (Invivogen, vac-phos-250) was used as the alum at a final concentration of 0.1 w / w%. CpG ODN type A was used as ODN 1585 VacciGrade (Invivogen, tlrl-1585) at a final concentration of 0.5 mg / mL. Booster immunizations were administered at the same dose two and four weeks after the primary immunization. Two weeks later, antibody production and induction of cellular immunity were assessed. ELISA was performed on plates coated with Influenza A H1N1 (A / California / 07 / 2009) Hemagglutinin / HA Protein (His Tag) (Sinobiological, 11085-V08H). ELISpot assays were performed using Influenza A, Hemagglutinin, California (H1N1), and PepMix (jpt peptide technologies).
[0080] The results are shown in Figure 5. Administration of the mRNA with an adjuvant consisting of Alum and CpG ODN type A significantly induced hemagglutinin-specific antibody production and cellular immunity. The titer of antibody production in the adjuvant-treated group was several dozen times higher than in the adjuvant-free group. Thus, the combination of an adjuvant containing mineral acid salts with an adjuvant that activates TLR9 and induces inflammatory cytokines enhanced antigen-specific antibody production and cellular immunity induction in transdermal administration of mRNA via jet spray.
[0081] Instead of CpG ODN type A, mRNA encoding various cytokines (each N1-methylpseudouridine modified) was used as an adjuvant. SARS-CoV-2 Spike mRNA (N1-methylpseudouridine modified) was administered to mice (Balb / C, n = 4 unless otherwise noted) at a dose of 10 μg per administration. The results are shown in Figures 6 and 7. As shown in Figure 6, the group administered IFN-α mRNA (N1-methylpseudouridine modified) as an adjuvant induced the production of specific antibodies against the spike protein.
[0082] Appropriate adjuvants may be specific for mRNA administration using a jet-propelled transdermal delivery device. Figure 8 plots the effects of various adjuvants relative to the effect without adjuvant on a graph with the ability to stimulate antigen-specific antibody production (horizontal axis) and the ability to induce cellular immunity (vertical axis). Of the four regions separated by two dashed lines in Figure 8, adjuvants plotted in the upper right region (Region I) possess both the ability to stimulate antigen-specific antibody production and the ability to induce cellular immunity. CpG ODN type A alone does not exhibit an enhancing effect on the ability to induce antigen-specific cellular immunity (see Figure 8), but when used in combination with Alum, it enhanced the ability of Alum to induce cellular immunity, an unexpected effect of the combination (see Figure 8). Furthermore, the mRNA encoding IFN-α used in this example preferably induces antigen-specific antibody production. Thus, IFN-α used in this example is a pro-inflammatory cytokine and preferably induces antigen-specific antibody production.
[0083] As shown in Figure 15A, female BALB / c mice (6-8 weeks old) were immunized on days 0 and 21 with 20 μL of different formulations containing 10 μg OVA mRNA (Genscript) or 10 μg OVA mRNA and adjuvant using a Pyrodrive liquid jet injector (Daicel Corporation, Tokyo, Japan). The adjuvants used were aluminum phosphate (5 μL Adju-Phos™ adjuvant (Invivogen, vac-phos-250)) and CpG DNA (ODN 1585 (Invivogen, vac-1585-1)). Alternatively, MC3-LNP (containing 10 μg OVA mRNA) was injected intradermally with a syringe needle.
[0084] On day 35, mice were euthanized, and blood was collected from the inferior vena cava. Plasma antigen-specific antibody production was confirmed. Specifically, antigen-specific antibodies in plasma were assessed by ELISA. Flat-bottom 96-well MaxiSorp plates (Thermo Fisher Scientific, 439454) were precoated overnight at 4°C with 50 μL of OVA protein (Sigma-Aldrich, St. Louis, MO, USA) per well at a concentration of 20 μg / mL protein in 50 mM carbonate buffer (pH 9.6). The plates were washed three times with 0.05% w / v Tween 20 in PBS (PBS-T) and blocked with 100 μL of 1% BSA in PBS-T at room temperature for 1 hour. After removing the dilution solution, 50 μL of diluted plasma, serially diluted 30-3, was added to each well and incubated at room temperature for 2 hours. After washing, HRP-conjugated goat anti-mouse IgG (R&D systems, HAF007, 1:8,000) (Minneapolis, MN), IgG1 (ab97240, 1:10,000) (Abcam, Cambridge, UK), or IgG2a (ab97245, 1:10,000) (Abcam, Cambridge, UK) antibodies were added and incubated at room temperature for 1 hour. Finally, 100 μL of TMB substrate (Thermo Fisher Scientific, 34028, Waltham, MA, USA) was added, and the reaction was stopped with 2N sulfuric acid. The plate was read at 450 nm using a plate reader (Tecan, Switzerland).
[0085] The results are shown in Figure 15B. As shown in Figure 15B, significantly higher antibody induction was observed in the MC3-LNP-treated group and the adjuvant-treated group, and higher antibody induction was also observed in the non-adjuvant-treated group compared to the untreated group. It is particularly noteworthy that the adjuvant-treated group showed comparable effects to the MC3-LNP-treated group in terms of IgG2a production. Figure 15B shows the mean ± standard error (N = 6).
[0086] Mice were also euthanized on day 35, and blood was collected from the inferior vena cava. Spleens were harvested and processed for ELISpot assays and intracellular cytokine staining by flow cytometry. Specifically, spleens were removed from immunized mice on day 35, mechanically disrupted to obtain single-cell suspensions, and filtered through a 40 μM cell strainer. The spleen cell suspension was layered on the surface of Lympholyte™-M (Cedarlane Labs, Burlington, ON, Canada) and centrifuged at 800 × g for 30 minutes at room temperature to separate lymphocytes. IFN-γ precoated plates (ELISpot PLUS kits, Mabtech, Nacka Strand, Sweden) were washed with PBS and blocked with medium containing 10% FBS for 30 minutes. Lymphocytes (5 × 10 cells) isolated from the spleens were then collected. 5 Cells (1000 cells) were plated in each well and stimulated with 0.25 μg / mL PepTivator Ovalbumin epitope mix (Miltenyi Biotec, Nordrhein-Westfalen, Germany) for 24 hours. Spots were visualized by incubation with IFN-γ detection antibody and streptavidin-HRP antibody, followed by TMB substrate, according to the manufacturer's protocol. Spots were quantified using an ELISpot plate reader (AID GmbH, Strassberg, Germany).
[0087] The results are shown in Figure 16. As shown in Figure 16, significantly high levels of antigen-specific cellular immunity were induced in the MC3-LNP-treated group and the adjuvant-treated group, and a high level of antigen-specific cellular immunity was also induced in the non-adjuvant-treated group compared to the untreated group. Figure 16 shows the mean ± standard error (N = 6). Statistical analysis was performed using analysis of variance followed by Tukey's test.
[0088] The ability to induce acute inflammation was evaluated. Specifically, 6- to 8-week-old female BALB / c mice (n = 6 per group) were injected with 20 μL of different formulations containing 10 μg spike mRNA (Genscript) or 10 μg spike mRNA, 10 μg ODN 1585 (Invivogen, vac-1585-1), and 5 μL of Adju-Phos™ adjuvant (Invivogen, vac-phos-250) using a Pyrodrive liquid jet injector (Daicel Corporation, Tokyo, Japan). MC3-LNP (containing 10 μg spike mRNA) was injected intradermally with a syringe needle. Six hours after injection, the skin, draining lymph nodes, spleen, liver, and blood were collected.
[0089] As shown in Figure 17, leukocyte infiltration into the skin was significantly higher in the MC3-LNP-treated group and the adjuvant-treated group. Figure 17 shows the mean ± standard error (N = 6). Statistical analysis was performed using analysis of variance followed by Tukey's test.
[0090] Inflammation was assessed in each tissue. Specifically, axillary and inguinal lymph nodes, liver, and spleen were extracted and homogenized using a Multi-Beads Shocker at 3,000 rpm for 60 seconds. Total RNA was extracted from the homogenate using the RNeasy Mini Kit (Qiagen, Hilden, Germany). Genomic DNA was removed by enzymatic digestion, followed by reverse transcription to obtain complementary DNA (cDNA) using a ReverTraAce with a gDNA Remover Kit (Toyobo, Osaka, Japan). Inflammatory cytokines in these organs were measured by quantitative PCR (qPCR) using the following primers: IL-6 (Mm00446190_m1): 4331182, IFN-β (Mm00439552_s1): 4331182, and β-Actin: 4352933E. Data were collected using the β-actin gene as an endogenous control housekeeping gene. -ΔCt was analyzed by the method.
[0091] As shown in Figures 18A-D, induction of inflammatory cytokines in the groin, axilla, spleen, and liver was significantly higher in the MC3-LNP-treated group, while expression of inflammatory cytokines in the above tissues was lower in the adjuvant-treated group. Figures 18A-D show mean values ± standard error (N = 6 for each). Statistical analysis was performed using analysis of variance followed by Tukey's test.
[0092] Serum cytokines were assessed. Specifically, whole blood was incubated at 4°C for 30 minutes and then centrifuged at 2,000 × g for 10 minutes at 4°C to separate the serum. 50 μL of serum was used to measure IL-6 and IFN-β levels by ELISA. ELISA was performed using uncoated ELISA kits (R&D systems, DY406 and DY8234) according to the manufacturer's protocol. Optical density was measured at 450 nm using a plate reader (Tecan, Switzerland).
[0093] As shown in Figure 19, the induction of inflammatory cytokines in serum was significantly higher in the MC3-LNP-treated group, while the expression of inflammatory cytokines in serum was lower in the adjuvant-treated group. Figure 19 shows the mean ± standard error (N = 6). Statistical analysis was performed using analysis of variance followed by Tukey's test.
[0094] Explanation of symbols in the drawings: 10: vaccine preparation, 11: pressure port, 11a: plunger, 11b: plunger rubber, 12: injection port, 13: vaccine composition, 14: vaccine preparation container, 20: gas generator, 21: gas generator container, 23: gas generator, 24: ignition plug, 30: administration device before connecting gas generator, 31: body, 32: handle, 33: plug, 34: switch, 35: voltage generator, 36: conductive wire, 37: conductive wire, 38: holder for fixing gas generator, 50: administration device connected to gas generator, 100: vaccine preparation connected to administration device equipped with gas generator
[0095] Sequence description SEQ ID NO: 1: GTCGTT SEQ ID NO: 2: TCGTCG SEQ ID NO: 3 (ODN2216): GGGGAATCGTCGTCGTTTG SEQ ID NO: 4 (ODN2395): TCGTCGTTTTGTCGTTTTGT
Claims
1. A vaccine composition comprising a nucleic acid and an adjuvant, wherein the nucleic acid comprises mRNA encoding a peptide antigen; the adjuvant comprises (i) an adjuvant comprising a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral acid salt and an inflammatory cytokine inducer; and the composition is administered by an administration method comprising spraying the composition against the surface of a target tissue, thereby penetrating the surface of the target tissue and delivering the composition into the target tissue.
2. The composition of claim 1, wherein the adjuvant comprises a combination of an adjuvant containing an aluminum salt and an inflammatory cytokine inducer.
3. The composition according to claim 1 or 2, wherein the adjuvant comprises a CpG oligoDNA that induces an inflammatory cytokine or an mRNA that encodes an inflammatory cytokine.
4. The composition according to any one of claims 1 to 3, wherein the adjuvant comprises a CpG oligo-DNA that induces inflammatory cytokines.
5. The composition of any one of claims 1 to 3, wherein the adjuvant comprises mRNA encoding an inflammatory cytokine.
6. The composition of any one of claims 1 to 5, wherein the mRNA encoding the peptide antigen comprises naked mRNA.
7. The composition of claim 3 or 5, wherein the mRNA encoding the proinflammatory cytokine comprises naked mRNA.
8. The composition of any one of claims 1 to 7, wherein the antigen is influenza hemagglutinin or coronavirus spike protein.
9. The composition according to any one of claims 1 to 8, wherein the vaccine composition is sprayed to penetrate the surface of the target tissue and be delivered into the target tissue, and the peptide antigen is produced from mRNA within cells in the target tissue.
10. A method of administering a vaccine composition to a subject in need thereof, wherein the vaccine composition comprises a nucleic acid and an adjuvant, the adjuvant comprising (i) an adjuvant comprising a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral acid salt and an inflammatory cytokine inducer, and the nucleic acid comprises mRNA encoding a peptide antigen, the method comprising spraying the composition against the surface of a target tissue of the subject, whereby the composition is sprayed toward the target tissue, penetrates the surface of the target tissue, and is delivered into the target tissue, causing cells in the target tissue to produce the peptide antigen from the mRNA.
11. A method for inducing antigen-specific immunity in a subject in need thereof, comprising spraying a composition comprising an adjuvant and mRNA encoding the peptide antigen onto the skin surface of the subject, wherein the adjuvant comprises (i) an adjuvant comprising a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral acid salt and an inflammatory cytokine inducer, thereby causing the composition to be sprayed toward the target tissue, penetrate the surface of the target tissue, and be delivered into the target tissue, causing the peptide antigen to be produced from the mRNA in cells in the target tissue.
12. The method of claim 10 or 11, wherein the adjuvant comprises a combination of an adjuvant comprising an aluminum salt and an inflammatory cytokine inducer.
13. The method according to any one of claims 10 to 12, wherein the inflammatory cytokine inducer comprises CpG oligoDNA that induces an inflammatory cytokine or mRNA that encodes an inflammatory cytokine.
14. The method according to any one of claims 10 to 13, wherein the inflammatory cytokine inducer comprises a CpG oligoDNA that induces an inflammatory cytokine.
15. The method of any one of claims 10 to 13, wherein the inflammatory cytokine inducer comprises mRNA encoding an inflammatory cytokine.
16. The method of any one of claims 10 to 15, wherein the mRNA consists of naked mRNA.
17. An administration device containing a vaccine formulation, comprising: (α) an administration device having a gas generating unit containing at least a gas generating agent, the gas generating unit having a drive unit for driving a plunger by pressure caused by gas generated from the gas generating agent in the gas generating unit; and (β) a vaccine formulation comprising a vaccine composition and a container storing the composition, the container having a pressurizing port for pressurizing and an ejection port for ejection, wherein the vaccine composition comprises mRNA encoding a peptide antigen and an adjuvant, and the adjuvant comprises (i) an adjuvant containing a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant containing a mineral acid salt and an inflammatory cytokine inducer, a plunger inserted into the pressurizing port in an airtight and liquid-tight manner, and gas generated in the gas generating unit causes the drive unit to drive the plunger, thereby forcing the plunger into the container, thereby ejecting the composition from the ejection port.
18. A dispensing device according to claim 17, wherein the container is a cartridge-type container that is detachable from the device.
19. A cartridge-type container for use with the administration device of claim 18, comprising mRNA encoding a peptide antigen and an adjuvant, the adjuvant comprising (i) an adjuvant comprising a mineral acid salt, (ii) an inflammatory cytokine inducer, or (iii) a combination of an adjuvant comprising a mineral acid salt and an inflammatory cytokine inducer.
Citation Information
Patent Citations
RNA vaccine
JP2010540500A
RNA-containing composition for transdermal administration, and method for administering said composition
WO2023145755A1