Anti-CLDN18.2 / CD3 bispecific antibody and use thereof

Abstract

Provided is an anti-CLDN18.2 / CD3 bispecific antibody or an antigen-binding fragment thereof. The anti-CLDN18.2 / CD3 bispecific antibody has high specific binding to CLDN18.2 and low affinity with a CD3 terminal, facilitating the reduction of in vivo toxicity. Meanwhile, the anti-CLDN18.2 / CD3 bispecific antibody has excellent tumor cell killing activity, activation activity, and in vivo anti-tumor activity. Provided is use of the anti-CLDN18.2 / CD3 bispecific antibody or the antigen-binding fragment thereof in the preparation of a drug for treating CLDN18.2-mediated diseases or disorders.

Description

Anti-CLDN18.2 / CD3 bispecific antibody and its uses Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a bispecific antibody or its antigen-binding fragment that binds specifically to both CLDN18.2 and CD3, its preparation method, and its uses. Background Technology

[0002] Claudin18 (CLDN18) has two splice variants, Claudin18.1 and Claudin18.2, described in mice and humans (Niimi, Mol. Cell. Biol. 21: 7380-90, 2001). They differ by eight amino acids in the N-terminal portion containing the first transmembrane (TM) region and loop 1, while their C-terminal protein primary sequences are identical. The expression distribution of CLDN18.1 and CLDN18.2 differs; CLDN18.1 is selectively expressed in normal lung cells, while CLDN18.2 expression is highly restricted in normal cells but frequently ectopically activated and overexpressed in various tumors (such as gastric, lung, and pancreatic cancer).

[0003] CLDN18.2 is a gastric-specific membrane protein containing four transmembrane domains and two small extracellular loops (loop 1 is surrounded by hydrophobic regions 1 and 2, and loop 2 is surrounded by hydrophobic regions 3 and 4). It is a highly selective gastric lineage antigen, expressed only on short-lived differentiated gastric epithelial cells and undetectable in any other tissues of normal individuals. This antigen is ectopically expressed at significant levels in various human cancers, including gastric, esophageal, and pancreatic cancer (Sahin.U et al., Clin Cancer RES, 2008.14(23): 7624-34). CLDN18.2 protein is frequently detected in lymph node metastases and distant metastases of gastric cancer and is considered a potential therapeutic target for gastric cancer and other cancer types. The discovery of this target also provides a new option for the treatment of gastric cancer. The differential expression of CLDN18.2 between cancer cells and normal cells, its membrane localization, its absence in most toxic-associated normal tissues, and its limited expression in the stomach to a non-essential cell population that can be supplemented by target-negative stem cells—differentiated gastric cells—make CLDN18.2 an attractive target for cancer immunotherapy. Furthermore, the use of antibody-based therapies targeting CLDN18.2 in cancer treatment enables high levels of specific therapy.

[0004] From the perspective of cell adhesion mechanisms, blocking claudin seems to disrupt cell adhesion and accelerate tumor metastasis, and some studies have indeed shown that blocking certain claudins can accelerate tumor metastasis. However, because CLDN18.2 is expressed only in tumor cells, it is relatively safe to use antibodies to induce cell killing and prepare antibodies targeting CLDN18.2 without binding to CLDN18.1. This allows for specific blocking of the CLDN18.2 pathway in tumors and has broad applications.

[0005] CD3 (a T-cell surface glycoprotein, CD3, a signal transduction co-receptor for T-cell receptors, comprising five peptide chains: γ, δ, ε, ζ, and η) is a differentiation antigen expressed on the surface of all T lymphocytes, primarily mediating the transduction of T-cell activation signals. It plays a crucial role in the body's immune system's anti-infective response. The transmembrane region of the CD3 molecule forms a stable TCR-CD3 complex with the T-cell antigen receptor (TCR) via a salt bridge, jointly participating in T-cell antigen recognition. The activation signal generated by TCR antigen recognition is transduced into the T cell by CD3, thereby participating in the regulation of immune system activation. The quantity of CD3-positive lymphocytes is an important indicator for assessing the status of collective cellular immunity.

[0006] Bispecific antibodies (BsAbs), also known as bifunctional antibodies, can simultaneously and specifically bind to two different antigens or two different antigenic epitopes. Due to their specificity and bifunctionality, they show promising applications and potential in tumor immunotherapy and autoimmune diseases. Bispecific antibodies exist in various forms, and different forms of bispecific antibodies exhibit varying effects against different tumor-associated antigens. Because of this unique function, they hold broad application prospects in tumor immunotherapy.

[0007] Since Catumaxomab was approved in the European Union in 2009 as the first bispecific trifunctional antibody (anti-EpCAM × anti-CD3) for the intraperitoneal treatment of malignant ascites in patients with EpCAM-positive epithelial tumors, bispecific antibodies (BsAbs) have begun to attract more attention in the field of antibody-based cancer therapy (Sebastian et al., 2009; Linke et al., 2010). CD3-based BsAbs are designed to bind to target cells and redirect T cells via CD3, leading to T cell activation and killing of target cells (Yoon et al., 2020). To minimize off-target toxicity and maximize therapeutic efficacy, BsAb design focuses on selecting appropriate affinity for CD3 or the target antigen, preferably accompanied by complete inhibition of Fc-mediated effector function (Yoon et al., 2020; Labrijn et al., 2019).

[0008] Anti-CLDN18.2 / CD3 bispecific antibodies in clinical development include Amgen's AMG910. AMG910 can induce TDCC (T cell-dependent cytotoxicity) to mediate tumor killing. However, existing antibodies may suffer from problems such as short half-life, poor efficacy, and cytokine release syndrome (CRS). Therefore, there is an urgent need to develop safer and more effective bispecific antibodies. Summary of the Invention

[0009] To address the aforementioned problems, this invention utilizes molecular recombination technology to design a method capable of simultaneously binding CLDN18.2. + Cells (target cells) and CD3 + A bispecific antibody against CLDN18.2 / CD3 for T cells (effective cells). This antibody exhibits low affinity for CD3, high specificity binding to CLDN18.2, and the ability to block CD3. + Effector T cells guide CLDN18.2 + It targets cells or tissues and possesses effective tumor cell killing activity, activating activity, and significant in vivo antitumor activity.

[0010] In a first aspect, the present invention provides an anti-CLDN18.2 / CD3 bispecific antibody or an antigen-binding fragment thereof, wherein the bispecific antibody or the antigen-binding fragment thereof comprises a first antigen-binding domain for binding CLDN18.2 and a second antigen-binding domain for binding CD3. The first antigen-binding domain binding CLDN18.2 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes heavy chain complementarity-determining regions HCDR1, HCDR2, and HCDR3, and the light chain variable region includes light chain complementarity-determining regions LCDR1, LCDR2, and LCDR3. The amino acid sequences of HCDR1, HCDR2, and HCDR3 are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; and the amino acid sequences of LCDR1, LCDR2, and LCDR3 are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively. The second antigen-binding domain binding CD3 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes heavy chain complementarity-determining regions HCDR1, HCDR2, and HCDR3, and the light chain variable region includes light chain complementarity-determining regions LCDR1, LCDR2, and LCDR3. The amino acid sequences of HCDR1, HCDR2, and HCDR3 are shown in SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:6, respectively. As shown in NO:15; and the amino acid sequences of LCDR1, LCDR2 and LCDR3 are shown in SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18, respectively.

[0011] In some embodiments, the bispecific antibody or its antigen-binding fragment described in this invention may be selected from: Fab fragment, Fab' fragment, F(ab)2 fragment, Fv fragment, ScFv, linear antibody, single-domain antibody or full-length antibody.

[0012] In some embodiments, the heavy chain variable region of the first antigen-binding domain of the anti-CLDN18.2 / CD3 bispecific antibody of the present invention is in the form of the VH structure of the heavy chain variable region of the anti-CLDN18.2 antibody, and the light chain variable region is in the form of the VL structure of the light chain variable region of the anti-CLDN18.2 antibody; the variable region of the second antigen-binding domain is in the form of the VL-linking peptide-VH structure of the light chain variable region of the anti-CD3 antibody.

[0013] In some embodiments, the heavy chain variable region of the first antigen-binding domain of the anti-CLDN18.2 / CD3 bispecific antibody of the present invention is in the form of the VH structure of the heavy chain variable region of the anti-CLDN18.2 antibody, and the light chain variable region is in the form of the VL structure of the light chain variable region of the anti-CLDN18.2 antibody; the heavy chain variable region of the second antigen-binding domain is in the form of the VH structure of the heavy chain variable region of the anti-CD3 antibody, and the light chain variable region is in the form of the VL structure of the light chain variable region of the anti-CD3 antibody.

[0014] In a second aspect, the present invention provides a bispecific antibody against CLDN18.2 / CD3 or an antigen-binding fragment thereof, wherein the heavy and light chain variable regions of the bispecific antibody or the antigen-binding fragment thereof are selected from the following group:

[0015] (1) The first antigen-binding domain of CLDN18.2 has a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO:7 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:8; the variable region of the second antigen-binding domain of CD3 has an amino acid sequence as shown in SEQ ID NO:19.

[0016] (2) The first antigen-binding domain that binds to CLDN18.2 has a heavy chain variable region as shown in SEQ ID NO:7 and a light chain variable region as shown in SEQ ID NO:8; the second antigen-binding domain that binds to CD3 has a heavy chain variable region as shown in SEQ ID NO:24 and a light chain variable region as shown in SEQ ID NO:25.

[0017] In some embodiments, the anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment further includes a heavy chain constant region and a light chain constant region.

[0018] In some embodiments, the first antigen-binding domain of CLDN18.2 of the present invention further has a heavy chain constant region in the form of CH1-CH2-CH3 structure and a light chain constant region in the form of anti-CLDN18.2 antibody LC structure; the second antigen-binding domain of CD3 further has a constant region in the form of CH2-CH3 structure.

[0019] In some embodiments, the first antigen-binding domain of CLDN18.2 of the present invention further has a heavy chain constant region in the form of CH1-CH2-CH3 structure and a light chain constant region in the form of LC structure of anti-CLDN18.2 antibody; the second antigen-binding domain of CD3 further has a heavy chain constant region in the form of LC-CH2-CH3 structure and a light chain constant region in the form of CH1 structure.

[0020] In some embodiments, amino acid sites have been substituted or replaced to facilitate the construction or subsequent processing of anti-CLDN18.2 / CD3 bispecific antibodies.

[0021] In some embodiments, the Fc of the second antigen-binding domain that binds CD3 and the Fc of the first antigen-binding domain that binds CLDN18.2 are connected by disulfide bonds in the hinge region and a club-and-mortar structure in the CH3 domain.

[0022] In a third aspect, the present invention provides an anti-CLDN18.2 / CD3 bispecific antibody or an antigen-binding fragment thereof, wherein the heavy and light chain constant regions of the bispecific antibody or the antigen-binding fragment thereof are selected from the following group:

[0023] (1) The first antigen-binding domain of CLDN18.2 includes a heavy chain constant region containing an amino acid sequence as shown in SEQ ID NO:9 and a light chain constant region containing an amino acid sequence as shown in SEQ ID NO:10; the second antigen-binding domain of CD3 includes a heavy chain constant region containing an amino acid sequence as shown in SEQ ID NO:20.

[0024] (2) The first antigen-binding domain that binds CLDN18.2 includes a heavy chain constant region containing an amino acid sequence as shown in SEQ ID NO:22 and a light chain constant region containing an amino acid sequence as shown in SEQ ID NO:10; the second antigen-binding domain that binds CD3 includes a heavy chain constant region containing an amino acid sequence as shown in SEQ ID NO:32 and a light chain constant region containing an amino acid sequence as shown in SEQ ID NO:27.

[0025] In some embodiments, the anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment has complete heavy and light chain structures.

[0026] In some embodiments, the first antigen-binding domain of CLDN18.2 of the present invention has a heavy chain with a structure of VH-CH1-CH2-CH3 from the N-terminus to the C-terminus and a light chain with a structure of VL-LC; the second antigen-binding domain of CD3 has a heavy chain with a structure of VL-linker peptide-VH-CH2-CH3 from the N-terminus to the C-terminus.

[0027] In some embodiments, the first antigen-binding domain of CLDN18.2 of the present invention has a heavy chain with a structure of anti-CLDN18.2 antibody VH-CH1-CH2-CH3 from the N-terminus to the C-terminus and a light chain with a structure of anti-CLDN18.2 antibody VL-LC; the second antigen-binding domain of CD3 has a heavy chain with a structure of anti-CD3 antibody VH-LC-CH2-CH3 from the N-terminus to the C-terminus and a light chain with a structure of anti-CD3 antibody VL-CH1.

[0028] In some embodiments, amino acid sites may be substituted or replaced to facilitate the construction or subsequent processing of anti-CLDN18.2 / CD3 bispecific antibodies.

[0029] In some embodiments, the Fc of the second antigen-binding domain that binds CD3 and the Fc of the first antigen-binding domain that binds CLDN18.2 are connected by disulfide bonds in the hinge region and a club-and-mortar structure in the CH3 domain.

[0030] In a fourth aspect, the present invention provides an anti-CLDN18.2 / CD3 bispecific antibody or an antigen-binding fragment thereof, wherein the heavy and light chains of the anti-CLDN18.2 / CD3 bispecific antibody or the antigen-binding fragment thereof are selected from the following group:

[0031] (1) The first antigen-binding domain that binds to CLDN18.2 has a heavy chain with an amino acid sequence as shown in SEQ ID NO:11 and a light chain with an amino acid sequence as shown in SEQ ID NO:12; the second antigen-binding domain that binds to CD3 has a full-length single-chain antibody structure with an amino acid sequence as shown in SEQ ID NO:21;

[0032] (2) The first antigen-binding domain that binds to CLDN18.2 comprises a heavy chain with an amino acid sequence as shown in SEQ ID NO:23 and a light chain with an amino acid sequence as shown in SEQ ID NO:12; the second antigen-binding domain that binds to CD3 comprises a heavy chain with an amino acid sequence as shown in SEQ ID NO:30 and a light chain with an amino acid sequence as shown in SEQ ID NO:31.

[0033] In a fifth aspect, the present invention provides an isolated polynucleotide encoding the bispecific antibody or its antigen-binding fragment described herein.

[0034] In some embodiments, the anti-CLDN18.2 / CD3 bispecific antibody has nucleotide sequences encoding the heavy and light chain amino acid sequences of the first antigen-binding domain, as shown in SEQ ID NO:35 and SEQ ID NO:36, and nucleotide sequences encoding the second antigen-binding domain, as shown in SEQ ID NO:37.

[0035] In some embodiments, the anti-CLDN18.2 / CD3 bispecific antibody has nucleotide sequences encoding the heavy and light chain amino acid sequences of the first antigen-binding domain, as shown in SEQ ID NO:38 and SEQ ID NO:36, and nucleotide sequences encoding the heavy and light chain amino acid sequences of the second antigen-binding domain, as shown in SEQ ID NO:39 and SEQ ID NO:40.

[0036] In a sixth aspect, the present invention provides an expression vector comprising the polynucleotide.

[0037] In a seventh aspect, the present invention provides a host cell comprising the expression vector. The host cell may be a prokaryotic cell or a eukaryotic cell; in a preferred embodiment, the host cell is an Expi293F cell.

[0038] In an eighth aspect, the present invention provides a method for constructing the anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment thereof as described herein.

[0039] (1) The first antigen-binding domain was constructed based on the anti-CLDN18.2 antibody. Its variable region includes the anti-CLDN18.2 antibody heavy chain variable region and the anti-CLDN18.2 antibody light chain variable region. The heavy chain constant region, which is the structural basis, was substituted with amino acids at four sites: N297A, Y349C, T366S, L368A and Y407V.

[0040] (2) A second antigen-binding domain was constructed based on the anti-CD3 antibody. Its variable region was linked to the anti-CD3 antibody VL and VH via a flexible linker peptide, forming an scFv structure with the sequence VL-GGS(G3S)4G-VH from the N-terminus to the C-terminus. To maintain antibody stability, the G100C amino acid was replaced in the variable region of the CD3 antibody light chain, and the G44C amino acid was replaced in the variable region of the heavy chain; to prevent mismatch, the C220S amino acid was replaced. The constant region of the second antigen-binding domain was based on the anti-CD3 antibody CH2-CH3 constant region, with N297A, S354C, T366W, H435R, and Y436F amino acid replacements. The scFv structure was constructed by linking the mutated constant region CH2-CH3 via amino acid AA; and / or

[0041] (3) The first antigen-binding domain was constructed based on the anti-CLDN18.2 antibody. Its variable region includes the anti-CLDN18.2 antibody heavy chain variable region and the anti-CLDN18.2 antibody light chain variable region. The heavy chain constant region, which serves as the structural basis, was substituted with amino acids at four sites: L234A, L235A, P331S, Y349C, T366S, L368A and Y407V.

[0042] (4) A second antigen-binding domain was constructed based on the anti-CD3 antibody. The second antigen-binding domain was constructed in the form of a CrossMab, with a heavy chain domain in the form of VH-LC-CH2-CH3 and a light chain domain in the form of VL-CH1 formed sequentially from the N-terminus to the C-terminus. Among them, the light chain of the anti-CD3 antibody, which serves as the structural basis, underwent amino acid substitutions at R108A and T109S, and the heavy chain underwent amino acid substitutions at L234A, L235A, P331S, S354C, T366W, H435R, and Y436F. The VL domain was connected to the CH1 domain through the amino acid SS.

[0043] (5) The heavy chain containing the CLDN18.2 binding domain is designed as a "hole" structure, and the heavy chain containing the CD3 binding domain is designed as a "knob" structure. The first antigen binding domain and the second antigen binding domain are connected by disulfide bonds in the hinge region and the knob structure of the CH3 domain.

[0044] A ninth aspect of the invention provides the use of the bispecific antibody or its antigen-binding fragment in the preparation of a medicament for treating CLDN18.2-mediated diseases or conditions. These diseases or conditions include, but are not limited to, gastric cancer, esophageal cancer, pancreatic cancer, lung cancer, non-small cell lung cancer (NSCLC), ovarian cancer, colon cancer, liver cancer, head and neck cancer, and gallbladder cancer and their metastases.

[0045] The technical solution of the present invention has achieved beneficial technical effects: the anti-CLDN18.2 / CD3 bispecific antibody obtained in this application has good in vitro and in vivo stability, high specificity in binding to CLDN18.2 and low affinity to the CD3 end to reduce in vivo toxicity, and at the same time has excellent tumor cell killing activity, activation activity and in vivo anti-tumor activity. Attached Figure Description

[0046] Figure 1. Schematic diagram of the structure of the anti-CLDN18.2 / CD3 bispecific antibody Bimab1.

[0047] Figure 2. Schematic diagram of the structure of the anti-CLDN18.2 / CD3 bispecific antibody Bimab2.

[0048] Figure 3. Results of sandwich ELISA assay using bispecific antibodies Bimab1 and Bimab2.

[0049] Figure 4. FACS results of bispecific antibodies Bimab1 and Bimab2 versus CHO-hu-CLDN18.2-luc

[0050] Figure 5. FACS results of bispecific antibodies Bimab1 and Bimab2 versus Jurkat-luc

[0051] Figure 6. Activation activity assay results of bispecific antibodies Bimab1 and Bimab2

[0052] Figure 7. Results of the cytotoxic activity assay for the bispecific antibodies Bimab1 and Bimab2.

[0053] Figure 8. Changes in mouse body weight after treatment with bispecific antibodies Bimab1 and Bimab2.

[0054] Figure 9. In vivo efficacy results of bispecific antibodies Bimab1 and Bimab2 Detailed Implementation

[0055] The present invention will be further explained and described below with reference to the embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and are not intended to limit the scope of protection of the present invention.

[0056] In the following embodiments, all materials used in the experiments can be purchased or prepared with reference to existing publicly available techniques; materials whose source and specifications are not specified are commercially available; and various processes and methods not described in detail are conventional methods known in the art.

[0057] Amgen CLDN18.2 / CD3 (also known as AMG910) is derived from the amino acid sequence described in SEQ ID NO:132 of US20200055932A1. The humanized antibody 254H4E11-VH6+VL1t is derived from the amino acid sequences described in SEQ ID NO:36 and SEQ ID NO:39 in Table 7 of CN115477701A.

[0058] Example 1: Construction and expression of anti-CLDN18.2 / CD3 bispecific antibody

[0059] Table 1. Heavy and light chain amino acid sequences of CLDN18.2 monoclonal antibody and CD3 monoclonal antibody.

[0060] The variable regions of the heavy and light chains of the anti-CLDN18.2 antibody, which form the structural basis, are derived from the variable regions of the heavy and light chains of the humanized antibody 254H4E11-VH6+VL1t in CN115477701A; the variable regions of the heavy and light chains of the anti-CD3 antibody, which forms the structural basis, are derived from the variable regions of the heavy and light chains of the humanized antibody AB614 in CN115558023A; the antibodies are prepared according to the methods disclosed in the patents; the constant regions of the heavy and light chains, which form the structural basis, are added by the present application. Based on the antibody structures shown in Table 1, the present invention's anti-CLDN18.2 / CD3 bispecific antibody is constructed, as shown in Figures 1 and 2, respectively; the bispecific antibody shown in Figure 1 is named Bimab1; the bispecific antibody shown in Figure 2 is named Bimab2. The first antigen-binding domain of both bispecific antibodies Bimab1 and Bimab2 binds to CLDN18.2 and is named A1, and the second antigen-binding domain of both binds to CD3 and is named A2. The first and second antigen-binding domains of Bimab1 are named Bimab1-A1 and Bimab1-A2, respectively; the first and second antigen-binding domains of Bimab2 are named Bimab2-A1 and Bimab2-A2, respectively; the three HCDRs of the first antigen-binding domain of Bimab1 are named Bimab1-A1-HCDR1, Bimab1-A1-HCDR2, and Bimab1-A1-HCDR3, respectively, and so on.

[0061] Construction of the bispecific antibody Bimab1:

[0062] (1) Construction of the Bimab1-A1 domain: The Bimab1-A1 domain was constructed based on the anti-CLDN18.2 antibody (the amino acid sequence of the heavy chain variable region as shown in SEQ ID No:7, the light chain variable region as shown in SEQ ID No:8, the heavy chain constant region as shown in SEQ ID No:33, and the light chain constant region as shown in SEQ ID No:10). To reduce the ADCC activity of the antibody, the N297A amino acid was substituted in the FC region of the CLDN18.2 antibody. The heavy chain containing the CLDN18.2 binding domain was designed as a "hole" structure, including amino acid substitutions at four sites: Y349C, T366S, L368A, and Y407V. The variable region of the heavy and light chains, the constant region of the heavy and light chains, and the heavy and light chains of Bimab1-A1 are denoted as Bimab1-A1-VH, Bimab1-A1-VL, Bimab1-A1-HC, Bimab1-A1-LC, Bimab1-A1-H, and Bimab1-A1-L, respectively.

[0063] (2) Construction of the Bimab1-A2 domain: The Bimab1-A2 domain was constructed based on the variable regions of the anti-CD3 antibody (the heavy chain variable region shown in SEQ ID No:24, the light chain variable region shown in SEQ ID No:25, the heavy chain constant region shown in SEQ ID No:33, and the light chain constant region shown in SEQ ID No:10). The variable regions of the Bimab1-A2 domain are connected to the light chain variable region and the heavy chain variable region of the anti-CD3 antibody, which serve as the structural basis, through a flexible linker peptide to form an scFv structure with the structure VL-GGS(G3S)4G-VH from the N-terminus to the C-terminus. To maintain antibody stability, the G100C amino acid was replaced in the CD3 antibody light chain variable region, which serves as the structural basis, and the G44C amino acid was replaced in the heavy chain variable region. The constant region of the Bimab1-A2 domain is based on the heavy chain constant region shown in SEQ ID No:33. To prevent mismatches, the C220S amino acid is replaced. To reduce the ADCC activity of the antibody, the N297A amino acid is replaced in the Fc region. The heavy chain of the CD3 binding domain is designed as a "knob" structure, including amino acid substitutions at the S354C and T366W sites. In addition, to facilitate the purification of the bispecific antibody, the heavy chain of the "knob" structure is also substituted with H435R and Y436F. The variable region scFv structure is linked to the mutated CH2-CH3 constant region via amino acid AA. The variable region of the Bimab1-A2 domain is denoted as Bimab1-A2-ScFv, the constant region of the Bimab1-A2 domain is denoted as Bimab1-A2-CH2-CH3, and the full length is denoted as Bimab1-A2-ScFv-CH2-CH3.

[0064] (3) The heavy chain containing the CLDN18.2 binding domain is designed as a "hole" structure, and the heavy chain containing the CD3 binding domain is designed as a "knob" structure. The first antigen binding domain and the second antigen binding domain are connected by disulfide bonds in the hinge region and the knob structure of the CH3 domain.

[0065] Construction of the bispecific antibody Bimab2:

[0066] (1) Construction of the Bimab2-A1 domain: The Bimab2-A1 domain was constructed based on the anti-CLDN18.2 antibody (the amino acid sequence of the heavy chain variable region as shown in SEQ ID No:7, the light chain variable region as shown in SEQ ID No:8, the heavy chain constant region as shown in SEQ ID No:34, and the light chain constant region as shown in SEQ ID No:10). To reduce the ADCC activity of the antibody, the L234A, L235A, and P331S amino acids were substituted in the heavy chain constant region of the anti-CLDN18.2 antibody, which served as the structural basis. The heavy chain containing the CLDN18.2 binding domain was designed as a "hole" structure, and the heavy chain constant region also included amino acid substitutions at four sites: Y349C, T366S, L368A, and Y407V. The variable region of the heavy and light chains, the constant region of the heavy and light chains, and the heavy and light chains of Bimab2-A1 are denoted as Bimab2-A1-VH, Bimab1-A1-VL, Bimab2-A1-HC, Bimab2-A1-LC, Bimab2-A1-H, and Bimab2-A1-L, respectively.

[0067] (2) Construction of the Bimab2-A2 domain: The Bimab2-A2 domain was constructed based on the anti-CD3 antibody (the heavy chain variable region shown in SEQ ID No:24, the light chain variable region shown in SEQ ID No:25, the heavy chain constant region shown in SEQ ID No:34, and the light chain constant region shown in SEQ ID No:10). To maintain antibody stability and prevent mismatches, Bimab2-A2 was constructed in CrossMab form. From the N-terminus to the C-terminus, a heavy chain domain is formed in the form of a heavy chain variable region-light chain constant region LC-heavy chain constant region CH2-CH3. To facilitate the construction and connection of the Bimab2-A2 heavy chain variable region and the light chain constant region LC, the light chain constant region shown in SEQ ID No:10 is substituted with amino acids R108A and T109S, respectively. The structure after the mutation of the light chain constant region is denoted as Bimab2-A2-LC', and the heavy chain of the Bimab2-A2 domain is denoted as Bimab2-A2-VH-LC'-CH2-CH3. From the N-terminus to the C-terminus, a light chain domain in the form of a CD3 light chain variable region-heavy chain constant region CH1 is formed, denoted as Bimab2-A2-VL-CH1, where Bimab2-A2-VL is connected to the CH1 domain through the amino acid SS. To reduce the ADCC activity of the antibody, the constant region of the anti-CD3 antibody heavy chain, which forms the structural basis, was substituted with amino acids at L234A, L235A, and P331S. The heavy chain of Bimab2 containing the CD3-binding domain was designed as a "knob" structure, including amino acid substitutions at S354C and T366W. To facilitate the purification of the bispecific antibody, the heavy chain of the "knob" structure was substituted with amino acids at H435R and Y436F. The heavy and light chains of Bimab2-A2 are denoted as Bimab2-A2-H: Bimab2-A2-VH-LC'-CH2-CH3 and Bimab2-A2-L: Bimab2-A2-VL-CH1, respectively; the constant regions of the heavy and light chains of Bimab2-A2 are denoted as Bimab2-A2-LC'-CH2-CH3 and Bimab2-A2-CH1, respectively.

[0068] (3) The heavy chain containing the CLDN18.2 binding domain is designed as a "hole" structure, and the heavy chain containing the CD3 binding domain is designed as a "knob" structure. The first antigen-binding domain and the second antigen-binding domain are connected by disulfide bonds in the hinge region and the knob-hole structure of the CH3 domain. The specific sequences of the bispecific antibodies of this invention are shown in Table 2. The CDRs analysis system is the Kabat system.

[0069] Table 2. Structures of bispecific antibodies and sequences of related antibodies.

[0070] The plasmid construction process for the bispecific antibody is as follows: The heavy chain (SEQ ID NO:11) and light chain (SEQ ID NO:12) of the first antigen-binding domain of Bimab1 (binding to CLDN18.2) and the full-length structure of the second antigen-binding domain of Bimab1 (binding to CD3) (SEQ ID NO:21) were optimized, and the Kozak sequence GCCGCCACC and the signal peptide sequence ATGGACTGGACCTGGAGGATCCTGTTCCTGGTGGCCGCCGCCACCGGCGTGCACAGC were added. These were then cloned into the pcDNA3.1 vector to prepare a transfection-grade plasmid. The heavy chain sequence (SEQ ID NO:23) and light chain sequence (SEQ ID NO:12) of the first antigen-binding domain of Bimab2 (binding to CLDN18.2) and the heavy chain sequence (SEQ ID NO:30) and light chain sequence (SEQ ID NO:12) of the second antigen-binding domain of Bimab2 (binding to CD3) were also optimized. After optimizing the amino acid codon of NO:31, the kozak sequence GCCGCCACC and the signal peptide sequence ATGGACTGGACCTGGAGGATCCTGTTCCTGGTGGCCGCCGCCACCGGCGTGCACAGC were added, and the resulting plasmid was cloned into the pcDNA3.1 vector to prepare a transfection-grade plasmid. Using the Expi293F cell transfection kit, according to the instructions, the heavy chain plasmid and light chain plasmid at the CLDN18.2 end were co-transfected with the CD3 end plasmid of Bimab1 and the CD3 heavy chain plasmid and light chain plasmid of Bimab2 into Expi293 cells (Invitrogen A14527), and cultured in a shaker at 37 degrees Celsius and 8% CO2. Seven days later, the cell fermentation broth was obtained, clarified, and used to capture antibodies using a Maxtar ARPA Protein A column (Bailinco). The column was equilibrated with 3CV mobile phase A (0.02 mol / L PB + 0.15 mol / L NaCl, pH 7.4 ± 0.1) at a set flow rate of 300 cm / h. After equilibration, the clarified culture medium was loaded with adsorption at a retention time of 5 min. After adsorption, the column was washed with 3CV mobile phase A (0.02 mol / L PB + 0.15 mol / L NaCl, pH 7.4 ± 0.1) at the same flow rate as the adsorption. The column was then washed with 5CV mobile phase B (20 mM Tris + 0.5 M ArgHCl, pH 5.5) at a set flow rate of 300 cm / h. Finally, the column was washed with 3CV mobile phase C (50 mM HAC, pH 5.5) at a set flow rate of 300 cm / h.The column was eluted with mobile phase D (50 mM HAC pH 3.0) at a set flow rate of 300 cm / h. Eluent collection began when the UV detection value was ≥0.1 Au and stopped when the UV detection value was ≤0.1 Au. The pH was then adjusted to 6.0 with 2 M TriS.

[0071] Antibody purification was performed using MaxtarMMA (Bailinco) packing material. The column was equilibrated with 7CV mobile phase E (20mM His + 30mM NaCl, pH 6.0) at a set flow rate of 300 cm / h. After equilibration, the sample was loaded onto the column at a set flow rate of 200 cm / h. The eluent was collected when the absorbance value was ≥0.02 Au. After loading, the column was washed with mobile phase E (20mM His + 30mM NaCl, pH 6.0) at a set flow rate of 200 cm / h. Eluent collection was stopped when the UV detection value was ≤0.2 Au.

[0072] Antibody purification was performed using MaxtarSPHR (Bailinco) packing material. The column was equilibrated with 5CV mobile phase E (20 mM His + 30 mM NaCl, pH 6.0) at a set flow rate of 200 cm / h. After equilibration, the sample was loaded onto the column at a set flow rate of 200 cm / h. Following loading, the column was washed with 3CV mobile phase E (20 mM His + 30 mM NaCl, pH 6.0) at a set flow rate of 200 cm / h. After washing, the column was eluted with mobile phase F (20 mM His + 95 mM NaCl, pH 6.0) at a set flow rate of 200 cm / h. Eluent collection began when the UV detection value was ≥0.3 Au and stopped when the UV detection value was ≤0.3 Au. The resulting sample was then subjected to ultrafiltration to 10 mM NaCitrate at pH 6.0, and the product quality was assessed for subsequent experiments. The two bispecific antibody molecules, Bimab1 and Bimab2, were purified for use in the next embodiment. The nucleotide sequences encoding the bispecific antibodies of the present invention can be obtained by conventional techniques in the relevant field.

[0073] Example 2: Detection of protein-level binding activity of anti-CLDN18.2 / CD3 bispecific antibody

[0074] This experiment used a sandwich ELISA method to detect the binding activity of anti-CLDN18.2 / CD3 bispecific antibodies Bimab1 and Bimab2 with Claudin18.2 protein ((N-Twin strep-Flag) and Biotinylated Human CD3E & CD3DH eterodimer Protein, Fc, His Tag & Fc, Flag Tag, ultrasensitivity (primary amine labeling) (MALS verified), respectively. The coating antigen (Recombinant Human) was collected... CLDN18.2) was diluted to 0.5 μg / ml with coating buffer, and 100 μl / well was coated into a 96-well plate. The plate was incubated overnight at 2–8°C. The liquid in the wells was discarded, and the plate was blistered. Blocking buffer was added at 320 μl / well, and the plate was blocked at 25°C for 2 h. The plate was washed three times with PBST solution and blistered. Samples were then serially diluted with diluent, ranging from 200 μg / ml to 0.19 ng / ml, with 11 4-fold serial dilutions, including a zero concentration point. Samples were added to the microplate in duplicate. 100 μl / well of the diluted sample was added to the microplate and incubated at 25°C for 2 h. The solution was discarded, and the plate was washed four times and blistered. Streptavidin HRP was diluted 1000-fold as reagent A. The mixture was then used to dilute Biotinylated Human CD3E & CD3D Heterodimer. Protein was added to 1 μg / ml as reagent B. 100 μl of reagent B was added to each well of the plate and incubated at 25°C for 1 h. The solution in the wells was discarded, and the plates were washed 6 times with 300 μl of washing buffer per well. 100 μl of TMB substrate was added to each well, and the plates were incubated at room temperature in the dark for 2–4 min. 100 μl of stop solution was added to terminate the reaction. The absorbance was read at 450 nm. The results are shown in Table 3 and Figure 3. Both bispecific antibodies Bimab1 and Bimab2 specifically bound to Claudin 18.2 and CD3.

[0075] Table 3. ELISA results of bispecific antibodies Bimab1 and Bimab2

[0076] Example 3: Detection of Bispecific Antibody Cellular Binding Activity

[0077] The binding activity of the anti-CLDN18.2 / CD3 bispecific antibodies Bimab1 and Bimab2 at the CLDN18.2 end to CHO-hu-CLDN18.2-luc and at the CD3 end to Jurkat-luc cells was detected by FACS assay. The specific experimental steps are as follows: (1) Collect target cells (CHO-hu-CLDN18.2-luc or Jurkat-luc), centrifuge, discard the supernatant, add 5 mL PBS to resuspend the cells, count them by trypan blue counting method, and adjust the cell density to 2×10⁻⁶. 6 / mL; seed 50μl of target cell suspension per well into a 96-well plate with a U-shaped bottom;

[0078] (2) Bimab1 and Bimab2, anti-CLDN18.2 / CD3 bispecific antibodies (initial concentration of CHO-hu-CLDN18.2-luc was 25 μg / mL; initial concentration of Jurkat-luc was 25 μg / mL), were diluted 3-fold to 11 concentration points. 50 μl of the sample to be tested was added to each well of a 96-well plate and mixed well. The 96-well plate was placed at 2-8 degrees Celsius and allowed to stand for 1 h.

[0079] (3) Centrifuge and discard the supernatant. Add 200 μl of PBS to each well, centrifuge again and discard the supernatant. Add 100 μl of PBS containing fluorescent secondary antibody to each well. Place the 96-well plate at 2-8 degrees Celsius and let it stand for 1 hour.

[0080] (4) Centrifuge and discard the supernatant. Add 200 μl of PBS to each well and centrifuge twice. Centrifuge again and discard the supernatant.

[0081] (5) Add 50 μl PBS to each well, perform flow cytometry analysis, and analyze the data. The results are shown in Table 4 and Figures 4 and 5. Both Bimab1 and Bimab2 can specifically bind to CLDN18.2 and CD3 expressed on the cell surface.

[0082] Table 4. FACS results of bispecific antibodies Bimab1 and Bimab2

[0083] Example 4: Affinity assay of anti-CLDN18.2 / CD3 bispecific antibody

[0084] This experiment used the surface plasmon resonance (SPR) method to determine the affinity kinetics of the interaction between the anti-CLDN18.2 / CD3 bispecific antibodies Bimab1, Bimab2, and AMG910 and the CLDN18.2 and CD3 proteins using a Biacore T200 instrument. The specific operating procedures are as follows:

[0085] (1) CLDN18.2 and CD3 were diluted with HBS-EP+ buffer solution as ligands.

[0086] (2) Bimab1 and Bimab2 were serially diluted with HBS-EP+ buffer solution as analytes and a zero concentration point was set.

[0087] (3) Set up the program as shown in Table 5 and run it.

[0088] Table 5. Affinity Measurement Procedure Settings

[0089] The Biacore T200 Control Software acquired and saved the SPR signal, which was then processed using the Biacore T200 Evaluation software. The signal value of the detection channel (Fc2 or Fc4) was subtracted from the corresponding reference channel (Fc1 or Fc3) signal value to obtain the corrected signal curve. Affinity evaluation employed a double-subtraction method: a zero-concentration cycle (Sample0) with identical parameters was added before sample cycling; the sample cycle was then subtracted from the zero-concentration cycle (Sample-Sample0) to obtain the second-corrected signal curve. The affinity kinetics curve was fitted using the 1:1 Langmuir binding model, and the affinity curve was fitted using the Steady State Affinity model, with the KD value calculated. The affinities of the anti-CLDN18.2 / CD3 bispecific antibodies Bimab1 and Bimab2 are shown in Table 6.

[0090] Table 6. Affinity results of bispecific antibodies

[0091] Example 5: Assay of Cell Activation Activity of Anti-CLDN18.2 / CD3 Bispecific Antibody

[0092] This invention provides a bispecific antibody molecule targeting the immune effector cell antigen CD3 and the tumor antigen Claudin18.2. NFAT-Luc / Jurkat is a CD3-positive reporter gene cell line, and BXPC3-CLDN18.2 cells are CLDN18.2-overexpressing tumor cells. This study mainly verifies that the recombinant humanized anti-Claudin18.2 / CD3 bispecific antibody can stimulate Jurkat-Luc reporter gene cells in the presence of CLDN18.2-overexpressing tumor cells. Specific experimental procedures are as follows:

[0093] (1) Collect target cells BXPC3-Claudin18.2 and centrifuge. Discard the supernatant, resuspend the BXPC3-Claudin18.2 cells in 10% inactivated FBS + 1640 medium, count the cells, and adjust the cell density to 1×10⁻⁶.5 / ml, ready for use.

[0094] (2) Collect effector cells NFAT-Luc / Jurkat cells and centrifuge. Discard the supernatant, resuspend the NFAT-Luc / Jurkat cells in 10% inactivated FBS + 1640 medium, count the cells, and adjust the cell density to 4 × 10⁻⁶. 5 / ml, ready for use.

[0095] (3) Mix the two types of cells in equal volumes and add 100 μl to each well of a 96-well plate.

[0096] (4) The final concentration of the sample was 39.67 nm. After a 4-fold dilution, 50 μl of the sample was added to each well of the experimental plate and incubated at 37℃ (±2℃) and 5% (±1%) CO2 for 4-6 hours.

[0097] (5) Add 50 μl of Luciferase Assay System to each well, incubate at room temperature in the dark for 3 min, and then perform RLU detection on the instrument.

[0098] The cell activation activity results of the bispecific antibodies Bimab1 and Bimab2 are shown in Table 7 and Figure 6. This indicates that both Bimab1 and Bimab2 can effectively activate downstream signaling pathways in T cells, and their activation activity is superior to that of AMG910.

[0099] Table 7. EC50 values ​​of cell activation effects of bispecific antibodies Bimab1 and Bimab2

[0100] Example 6: Detection of T-cell killing activity of anti-CLDN18.2 / CD3 bispecific antibody

[0101] Human primary T cells are CD3 + The cell line BXPC3-CLDN18.2-LUC is a Claudin18.2 positive cell line. This study mainly aims to verify the killing effect of recombinant humanized anti-CLDN18.2 / CD3 bispecific antibody-mediated T cell activity against BXPC3-CLDN18.2-LUC cells. Specific procedures are as follows:

[0102] (1) Collect BXPC3-CLDN18.2-LUC cells and centrifuge. Discard the supernatant, resuspend the BXPC3-CLDN18.2-LUC cells in 10% inactivated FBS + 1640 medium, count the cells, and adjust the cell density to 1×10⁻⁶. 5 / mL, ready for use.

[0103] (2) Collect CIK cells (CIK cells, i.e., cytokine-induced killer cells, also known as NK cell-like T lymphocytes) and centrifuge them, discard the supernatant, resuspend the CIK cells in 10% inactivated FBS + 1640 medium and count them, adjusting the cell density to 1×10⁻⁶ cells / year. 6 / mL, ready for use.

[0104] (3) Mix the two types of cells in equal volumes and add 100 μl to each well of a 96-well plate.

[0105] (4) The final concentration of the sample was 12.7 nm. After a 5-fold dilution, 50 μl of the sample was added to each well of the experimental plate and incubated at 37℃ (±2℃) and 5% (±1%) CO2 for 24 h.

[0106] (5) Add 50 μl of Luciferase Assay System to each well, incubate at room temperature in the dark for 3 min, and then detect the fluorescence value RLU.

[0107] (6) Kill percentage (%) = (1 - RLU of test well / RLU of control well) * 100

[0108] The results of the killing activity of T cells mediated by the bispecific antibodies Bimab1 and Bimab2 against BXPC3-CLDN18.2-LUC cells are shown in Table 9 and Figure 7. The killing activity of T cells mediated by Bimab1 and Bimab2 against BXPC3-CLDN18.2-LUC cells is superior to that of the control antibody AMG910.

[0109] Table 9. EC50 values ​​of the cytotoxic effects of bispecific antibodies Bimab1 and Bimab2.

[0110] Example 7: In vivo efficacy study of anti-CLDN18.2 / CD3 bispecific antibody

[0111] Study on the effects of bispecific antibodies Bimab1 and Bimab2 on a subcutaneous xenograft model of female NOG mice co-inoculated with NUGC4-CLDN18.2 / CIK.

[0112] Human gastric cancer NUGC4-CLDN18.2 cells (purchased from Kangyuan Bochuang Biotechnology (Beijing) Co., Ltd.) and CIK cells were mixed at a 1:1 ratio and then mixed with Matrigel at a 1:1 volume ratio. 0.1 mL / mouse was subcutaneously injected into the right flank of immunodeficient female NOG mice, with each mouse receiving 5 × 10⁻⁶ NUGC4-CLDN18.2 cells. 6 When the average tumor volume in mice reached 110 mm. 3Mice with excessively large or small tumors were culled. Based on tumor volume and body weight, the selected mice were randomly divided into three groups of five mice each. The experiment included a PBS control group, a 0.3 mg / kg AMG910 positive control group, a 0.3 mg / kg Bimab1 treatment group, a 0.3 mg / kg Bimab2 treatment group, and a 10 mg / kg CLDN18.2 humanized monoclonal antibody 254H4E11-VH6+VL1t treatment group. Administration began on the day of group assignment. All groups were administered via intraperitoneal injection.

[0113] Animals were monitored daily for 20 days after drug administration. Throughout the experiment, the long and wide diameters of the tumor were measured 3-4 times per week using calipers, and the tumor volume (mm²) was also measured. 3 = 0.5 × (tumor long diameter × tumor short diameter) 2 )calculate.

[0114] TGI TV Calculation formula:

[0115] V nt : Tumor volume of mouse number n on day t;

[0116] V n0 : Tumor volume of mouse number n on day 0;

[0117] RTV n : The relative tumor volume of mouse number n on day t;

[0118] mean RTV article Mean RTV: The average RTV of the treatment group. vehicle : Average RTV of the Vehicle group.

[0119] All data are expressed as mean+SEM. Student's t-test was used to compare whether there was a significant difference in tumor volume between the treatment group and the control group. p<0.001 was considered statistically significant.

[0120] The body weight of mice after drug administration is shown in Figure 8. All animals maintained good activity and appetite during the drug administration and observation periods. No significant weight loss was observed in any of the NOG mouse groups, indicating that NOG mice tolerated the anti-CLDN18.2 / CD3 bispecific antibody at this dose well. The tumor volume of mice after drug administration is shown in Figure 9. On day 20 after treatment, the average tumor volume in the solvent group was 873.8 ± 344.6 mm. 3 Tumor volume inhibition rate (TGI) of AMG910 in the positive control group TV The TGI of the Bimab1 and Bimab2 groups was 104.4%.TV The rates were 114.4% and 111.8%, respectively; the TGI in the CLDN18.2 humanized monoclonal antibody 254H4E11-VH6+VL1t group was... TV The efficacy was 73.2%. This indicates that both bispecific antibodies Bimab1 and Bimab2 significantly inhibited the growth of subcutaneous xenografts of human gastric cancer NUGC4-CLDN18.2 cells, with a tumor-suppressing effect far stronger than that of monoclonal antibody 254H4E11-VH6+VL1t and superior to the positive control group AMG910.

Claims

1. A bispecific antibody against CLDN18.2 / CD3 or its antigen-binding fragment, characterized in that, The bispecific antibody or its antigen-binding fragment comprises a first antigen-binding domain for binding CLDN18.2 and a second antigen-binding domain for binding CD3. The first antigen-binding domain for binding CLDN18.2 comprises a heavy chain variable region and a light chain variable region. The heavy chain variable region comprises heavy chain complementarity-determining regions HCDR1, HCDR2, and HCDR3, and the light chain variable region comprises light chain complementarity-determining regions LCDR1, LCDR2, and LCDR3. The amino acid sequences of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 are as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively. As shown in NO:6; the second antigen-binding domain that binds to CD3 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes heavy chain complementarity-determining regions HCDR1, HCDR2, and HCDR3, and the light chain variable region includes light chain complementarity-determining regions LCDR1, LCDR2, and LCDR3. The amino acid sequences of HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 are shown in SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, and SEQ ID NO:18, respectively.

2. The anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment according to claim 1, characterized in that, The amino acid sequences of the heavy chain variable region and light chain variable region of the anti-CLDN18.2 / CD3 bispecific antibody are selected from the following groups: (1) The first antigen-binding domain of CLDN18.2 comprises a heavy chain variable region of the amino acid sequence shown in SEQ ID NO:7 and a light chain variable region of the amino acid sequence shown in SEQ ID NO:8; the second antigen-binding domain of CD3 comprises ScFv of the amino acid sequence shown in SEQ ID NO:

19. (2) The first antigen-binding domain that binds CLDN18.2 includes a heavy chain variable region of the amino acid sequence shown in SEQ ID NO:7 and a light chain variable region of the amino acid sequence shown in SEQ ID NO:8; the second antigen-binding domain that binds CD3 includes a heavy chain variable region of the amino acid sequence shown in SEQ ID NO:24 and a light chain variable region of the amino acid sequence shown in SEQ ID NO:

25.

3. The anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment according to claim 2, characterized in that, The bispecific antibody or its antigen-binding fragment further comprises heavy and light chain constant regions selected from the following group: (1) The first antigen-binding domain that binds CLDN18.2 comprises a heavy chain constant region containing the amino acid sequence shown in SEQ ID NO:9 and a light chain constant region containing the amino acid sequence shown in SEQ ID NO:10; the second antigen-binding domain that binds CD3 comprises a constant region containing the amino acid sequence shown in SEQ ID NO:

20. (2) The first antigen-binding domain that binds CLDN18.2 comprises a heavy chain constant region containing the amino acid sequence shown in SEQ ID NO:22 and a light chain constant region containing the amino acid sequence shown in SEQ ID NO:10; the second antigen-binding domain that binds CD3 comprises a heavy chain constant region containing the amino acid sequence shown in SEQ ID NO:32 and a light chain constant region containing the amino acid sequence shown in SEQ ID NO:

27.

4. The anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment according to claim 3, characterized in that, The heavy and light chains of the anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment are selected from the following groups: (1) The first antigen-binding domain of CLDN18.2 comprises a heavy chain of amino acid sequence as shown in SEQ ID NO:11 and a light chain of amino acid sequence as shown in SEQ ID NO:12; and a second antigen-binding domain of CD3 comprising amino acid sequence as shown in SEQ ID NO:

21. (2) The first antigen-binding domain that binds CLDN18.2 comprises a heavy chain of amino acid sequence as shown in SEQ ID NO:23 and a light chain of amino acid sequence as shown in SEQ ID NO:12; the second antigen-binding domain that binds CD3 comprises a heavy chain of amino acid sequence as shown in SEQ ID NO:30 and a light chain of amino acid sequence as shown in SEQ ID NO:

31.

5. A polynucleotide, characterized in that, The polynucleotide encodes the anti-CLDN18.2 / CD3 bispecific antibody or its antigen-binding fragment as described in any one of claims 1-4.

6. An expression carrier, characterized in that, The expression vector comprises the polynucleotide of claim 5.

7. A host cell, characterized in that, The host cell comprises the expression vector of claim 6.

8. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises any one of the anti-CLDN18.2 / CD3 bispecific antibodies or antigen-binding fragments thereof as claimed in any one of claims 1-4 and a pharmaceutically acceptable carrier.

9. Use of the anti-CLDN18.2 / CD3 bispecific antibody or antigen-binding fragment thereof as described in any one of claims 1-4 and / or the pharmaceutical composition of claim 8 in the preparation of a medicament for treating CLDN18.2-mediated diseases or conditions.

Images