Methods and compositions for stimulating immune response

Immunostimulatory RNA sequences from Influenza A virus nucleoprotein enhance immune responses by minimizing dsRNA contamination and using modifications, addressing the inadequacies of current adjuvants to induce strong cellular immune responses in cancer vaccines.

WO2025223684A1PCT designated stage Publication Date: 2025-10-30BIONTECH SE
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2024/071234
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-23
Filing Date
2024-07-26
Publication Date
2025-10-30

AI Technical Summary

Technical Problem

Current adjuvants for cancer vaccines do not induce a strong cellular immune response, and ModRNA platforms lack sufficient immunostimulatory capacity to upregulate the required danger signals for inducing effector T cells.

Method used

Compositions comprising immunostimulatory RNA sequences derived from Influenza A virus nucleoprotein-encoding RNA molecules, which act as adjuvants or immunostimulatory agents, are used to enhance host immune responses, specifically designed to minimize double-stranded RNA contamination and include modifications like pseudouridine to reduce innate immune activation.

Benefits of technology

These compositions effectively stimulate a robust immune response, including T and B cell activation, by inducing type I interferon secretion and enhancing antigen-specific T cell responses, thereby improving the efficacy and safety of cancer vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000012_0001
    Figure IMGF000012_0001
  • Figure IMGF000019_0001
    Figure IMGF000019_0001
  • Figure IMGF000024_0001
    Figure IMGF000024_0001
Patent Text Reader

Abstract

The present invention relates to methods and compositions for stimulating an immune response. In particular, the present invention relates to compositions comprising an immunostimulatory RNA comprising sequences derived from an Influenza A virus nudeoprotein-encoding RNA molecule that act as adjuvants and / or immunostimulatory agents to enhance host immune responses, in particular as adjuvants for cancer vaccines.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS AND COMPOSITIONS FOR STIMULATING IMMUNE RESPONSE

[0002] Technical Field

[0003] The present invention relates to methods and compositions for stimulating an immune response. In particular, the present invention relates to compositions comprising an immunostimulatory RNA comprising sequences derived from an Influenza A virus nucleoprotein-encoding RNA molecule that act as adjuvants and / or immunostimulatory agents to enhance host immune responses, in particular as adjuvants for cancer vaccines.

[0004] Background

[0005] The immune system plays an important role in defense against microorganisms, for example viruses, fungi and bacteria, as well as in recognizing and repelling malignant cells (tumor cells). The evolution of the immune system resulted in a highly effective network based on two types of defense: the innate and the adaptive immunity. In contrast to the evolutionary ancient innate immune system that relies on invariant receptors recognizing common molecular patterns associated with pathogens, the adaptive immunity is based on highly specific antigen receptors on B cells (B lymphocytes) and T cells (T lymphocytes) and clonal selection. While B cells raise humoral immune responses by secretion of antibodies, T cells mediate cellular immune responses leading to destruction of recognized cells.

[0006] Antigen-specific immunotherapy aims to enhance or induce specific immune responses in patients to control infectious or malignant diseases. The identification of a growing number of pathogen- and tumor-associated antigens led to a broad collection of suitable targets for immunotherapy. Vaccination and immunization is the introduction of a non-virulent antigen into a subject, in which the antigen elicits the subject's immune system to mount an immunological response. Often, vaccine antigens are killed or attenuated forms of the microbes which cause the disease. Different antigen formats can be used for vaccination including whole diseased cells, proteins, peptides or immunizing vectors such as RNA, DNA or viral vectors that can be applied either directly in vivo or in vitro by pulsing of DCs following transfer into the patient.

[0007] Messenger RNA (mRNA) is a promising therapeutic tool in vaccination. The advantages of RNA over subunits, inactivated and attenuated vaccines or even DNA-based vaccines are numerous [Sahin U. et al. Nature reviews. Drug discovery 2014; doi:10.1038 / nrd4278; Pardi N et al. Nature reviews. Drug discovery 2018; doi: 10.1038 / nrd.2017.243]. For example, but not limited to, RNA is not infectious and cannot integrate into the genome. Thus, there is no risk of infection or insertional mutagenesis. In addition, RNA is transiently active and degraded by a cellular process. Unlike protein-based vaccines, mRNA can be produced quickly and inexpensively without need of complicated upstream and downstream production processes.

[0008] Activation of the innate immune system by an RNA vaccine represents a very important aspect of vaccine adjuvant development [Kanzler H et al. Nature medicine 2007; doi: 10.1038 / nml589; Hornung V et al. Journal of immunology (Baltimore, Md. : 1950) 2002; doi:10.4049 / jimmunol.168.9.4531]. The specific activation of so-called pattern recognition receptors (PRRs) represents the first step of innate induction by an RNA vaccine. PRRs are proteins which can recognize molecules typically found in pathogens [Amarante-Mendes GP et al. Frontiers in immunology 2018; doi:10.3389 / fimmu.2018.02379]. These molecules are called pathogen-associated molecular patterns or short PAMPs. Currently identified PRR families include the Toll-like receptors (TLRs), the C-type lectin receptors (CLRs), the nucleotide-binding oligomerization domain-like receptors (NLRs), the retinoic acid-inducible gene-I-like receptors (RLRs) and the AIM2-like receptor (ALR) [Liu T et al. Signal transduction and targeted therapy 2017; doi:10.1038 / sigtrans.2017.23]. Nucleic acid including RNA can be recognized by a wide range of such receptors [Nance KD, Meier JL. ACS central science 2021; doi:10.1021 / acscentsci.lc00197; Linares-Fernandez S et al. Trends in molecular medicine 2020; doi: 10.1016 / j.molmed.2019.10.002]. TLR3 recognizes double-stranded RNA (dsRNA), whereas endocytosed and phagocytosed single-stranded RNA (ssRNA) is sensed by TLR7 and TLR8 [Linares-Fernandez S et al. Trends in molecular medicine 2020; doi:10.1016 / j.molmed.2019.10.002; Alexopoulou L et al. Nature 2001; doi: 10.1038 / 35099560]. While TLR7 is highly expressed and functional in human and mouse plasmacytoid dendritic cells (pDCs) and B cells, TLR8 is mostly expressed in monocytes, myeloid dendritic cells (mDCs), and monocyte derived dendritic cells [Jarrossay D et al. Eur. J. Immunol. 2001; doi: 10.1002 / 1521- 4141(200111)31:ll<3388:aid-immu3388>3.0.co;2-q]. The specific recognition of RNA molecule by TLR7 and 8 results in type I interferon responses (e.g., IFN-a) and a Thl-biasing cytokine profile [Nguyen DN et al. Proceedings of the National Academy of Sciences of the United States of America 2012; doi:10.1073 / pnas.H21423109] that ensure an immune surveillance [Schon MP et al. Oncogene 2008; doi:10.1038 / sj.onc.l210913] and induces specific adaptive immune responses by upregulating the required danger signals for strong induction of T and B cell responses [Steinman RM, Banchereau J. Nature 2007; doi:10.1038 / nature06175]. Cytosolic RNA sensing involves multiple sensors like retinoic-acid inducible gene I (RIG- I), melanoma differentiation-associated protein 5 (MDA-5), protein kinase R (PKR) and 2 '-5 '-oligoadenylate synthase (OAS). RIG-I sensor detects 5'-triphosphate (5'-3p)-ending RNA and short double stranded (ds)RNA, while MDA5 recognize long dsRNA [Linares-Fernandez S et al. Trends in molecular medicine 2020; doi:10.1016 / j.molmed.2019.10.002; Schlee M. Immunobiology 2013; doi:10.1016 / j.imbio.2013.06.007]. They are expressed in immune as well as in non-immune cells and regulate the signalling pathways that promote type I interferon (IFN I) expression. These receptors signal via the interferon regulatory factor 3 / 7 (IRF3 / IRF7) and pro- inflammatory cytokines dependent on NF-kB pathway [Schlee M. Immunobiology 2013; doi:10.1016 / j.imbio.2013.06.007; Brisse M, Ly H. Frontiers in immunology 2019; doi: 10.3389 / fimmu.2019.01586]. PKR and OAS are activated by dsRNA, e.g., in case of viral infection [Linares-Fernandez S et al. Trends in molecular medicine 2020; doi:10.1016 / j.molmed.2019.10.002; lordanov MS et al. Molecular and cellular biology 2000; doi:10.1128 / mcb.20.2.617-627.2000]. The downstream protein involved in the signaling pathway after specific stimulation of those receptors is the adaptor mitochondrial antiviral-signaling protein (MAVS) located in the outer mitochondrial membrane that can lead to activation of Interferon regulatory factor 3 or 7 (IRF3 / IRF7) and nuclear factor 'kappa-light-chain-enhancer' of activated B-cells (NF-KB) transcription factors. This results in IFN production and consequently in induction of interferon-stimulated genes (ISGs) and activation of NF-kB target genes [Linares- Fernandez S et al. Trends in molecular medicine 2020; doi:10.1016 / j.molmed.2019.10.002; lurescia S et al. Frontiers in immunology 2018; doi:10.3389 / fimmu.2018.00711]. These sensors are involved in central cellular processes as protein translation, proliferation and regulation of apoptosis [Garcia MA et al. Biochimie 2007; doi:10.1016 / j. biochi.2007.03.001] and play a central role in regulating cellular functions, especially with the focus on inflammation and cancer [Zheng X, Bevilacqua PC. RNA (New York, N.Y.) 2004; doi: 10.1261 / rna.7150804; Gai- Ben-Ari S et al. Frontiers in molecular neuroscience 2018; doi:10.3389 / fnmol.2018.00480].

[0009] 1 / 7 vitro transcription (IVT) enables transcription of a DNA template to RNA in a cell-free system. It has been reported that IVT RNA contains multiple contaminants, including short RNAs produced by abortive initiation events and double stranded (ds)RNAs generated by self-complementary 3' extension, RNA-primed transcription from RNA templates and RNA-dependent RNA polymerase activity [Kariko K et al. Nucleic acids research 2011; doi:10.1093 / nar / gkr695]. Especially dsRNA contamination represents an important factor in the activation of a wide range of PRRs and other receptors [Sahin U et al. Nature reviews. Drug discovery 2014; doi:10.1038 / nrd4278]. The uncontrolled stimulation of those receptors can negatively affect the translation efficiency of the IVT RNA and accordingly limit its anti-cancer efficacy. Different studies have shown that the inherent innate immunogenicity of RNA can be reduced by defined chemical modifications such as pseudouridine. In addition, the efficiency of translation is also improved by those modifications. An example of this is ModRNA, which uses 1- methylpseudouridine (<+>, a naturally occurring nucleoside) as a base modification [Sahin U et al. Nature reviews. Drug discovery 2014; doi:10.1038 / nrd4278; Kariko K et al. Immunity 2005; doi:10.1016 / j.immuni.2005.06.008; Karikd K et al. Molecular therapy : the journal of the American Society of Gene Therapy 2008; doi:10.1038 / mt.2008.200]. Moreover, a chromatographic based method can be used to deplete or even eliminate the IVT contaminations [Sahin U et al. Nature reviews. Drug discovery 2014; doi:10.1038 / nrd4278]. Kariko et al. have shown that contaminants, including double-stranded RNA, in nucleoside-modified in wfiro-transcribed mRNA (qj RNA) are responsible for innate immune activation and their removal by high performance liquid chromatography (HPLC) results in mRNA that does not induce IFNs and inflammatory cytokines and is translated at 10- to 1000-fold greater levels in primary cells [Kariko K et al. Nucleic acids research 2011; doi:10.1093 / nar / gkr695] than uridine-containing IVT mRNA (uRNA). Subsequently, Baiersdbrfer et al. presented a simple, fast, scalable, and cost-effective alternative involving only standard laboratory techniques and equipment to deplete the dsRNA contaminations. In this method, the purification of IVT mRNA is based on the selective binding of dsRNA to cellulose in an ethanol-containing buffer. It was demonstrated that over 90% of the dsRNA contaminants can be removed with a >65% recovery rate, regardless of the length, coding sequence and nucleoside composition of the IVT mRNA [Baiersdbrfer M et al. Molecular therapy. Nucleic acids 2019; doi:10.1016 / j.omtn.2019.02.018]. Murine in vivo experiments demonstrated an improved RNA translation and reduced IFN-a induction in comparison to non-cellulose purified mRNA. However, for cancer vaccines, the strong immune-stimulatory effect and intrinsic adjuvant activity of non-purified IVT mRNA can be beneficial and can trigger potent antigen-specific T and B cell responses to the applied antigen [Weissman D et al. Journal of immunology (Baltimore, Md. : 1950) 2000; doi:10.4049 / jimmunol.165.8.4710]. The induced immune response depends on a range of factors including the application of non-modified or modified (I1) RNA, further purification steps for depleting the IVT contaminations, the applied carrier material and the characteristics of the type and size of formed nanoparticles and the used adjuvant.

[0010] Currently approved adjuvants do not induce a strong cellular immune response, which is mandatory for cancer vaccination. The ModRNA platform lacks the sufficient immunostimulatory capacities to upregulate the required danger signals for inducing effector T cells.

[0011] Therefore, there is a need for effective adjuvant systems for improving the efficacy and safety of existing and future vaccines, in particular vaccines involving ModRNA.

[0012] Summary

[0013] The present invention is based, at least in part, on the identification of compositions comprising immunostimulatory RNA comprising sequences derived from an Influenza A virus nucleoprotein-encoding RNA molecule that act as adjuvants or immunostimulatory agents to enhance host immune responses. These compositions comprising immunostimulatory RNA can be used as immunostimulants in vivo.

[0014] In one aspect, the present disclosure provides a composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 1 or a variant thereof, which composition comprises 1000 pg or less dsRNA / pg RNA.

[0015] In some embodiments, the immunostimulatory RNA comprises a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 2 or a variant thereof, and the nucleotide sequence of SEQ ID NO: 3 or a variant thereof.

[0016] In a further aspect, the present disclosure provides a composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof. In some embodiments, the composition comprises 1000 pg or less dsRNA / pg RNA.

[0017] In some embodiments of any of the compositions described herein, the immunostimulatory RNA is a toll-like receptor (TLR) agonist.

[0018] In some embodiments the TLR is TLR7.

[0019] In some embodiments of any of the compositions described herein, the immunostimulatory RNA Is capable of inducing secretion of type I interferon, e.g., interferon alpha.

[0020] In some embodiments of any of the compositions described herein, the composition comprises 750 pg or less, 500 pg or less, 400 pg or less, 300 pg or less, 200 pg or less, 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0021] In some embodiments of any of the compositions described herein, the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linearized plasmid encoding the immunostimulatory RNA.

[0022] In some embodiments of any of the compositions described herein, the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linear oligo-hybridized oligonucleotide DNA encoding the immunostimulatory RNA or PCR amplified DNA encoding the immunostimulatory RNA.

[0023] In some embodiments, the in vitro transcription uses T7-RNA-polymerase.

[0024] In some embodiments, the process further comprises magnetic beads purification of in vitro transcribed immunostimulatory RNA.

[0025] In some embodiments, the process further comprises the removal of dsRNA from in vitro transcribed immunostimulatory RNA.

[0026] In some embodiments, the dsRNA is removed from in vitro transcribed immunostimulatory RNA using cellulose based purification.

[0027] In some embodiments, the composition comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 2 or a variant thereof and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0028] In some embodiments, the composition comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 2 and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0029] In some embodiments, the composition comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0030] In some embodiments, the composition comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0031] In some embodiments of any of the compositions described herein, the composition is a pharmaceutical composition.

[0032] In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier.

[0033] In some embodiments of any of the compositions described herein, the composition comprises an antigen or a nucleic acid encoding an antigen.

[0034] In a further aspect, the present disclosure provides a kit comprising the composition described herein and an antigen or a nucleic acid encoding an antigen.

[0035] In some embodiments, the composition comprising an immunostimulatory RNA and the antigen or nucleic acid encoding an antigen are present in the same or different receptacles. In some embodiments of the composition or kit described herein, the antigen is useful for vaccination against cancer or infection.

[0036] In some embodiments, the infection is a viral, bacterial, fungal, or parasite infection.

[0037] In some embodiments of the composition or kit described herein, the antigen is selected from the group consisting of cancer, virus, bacterial, fungal, or parasite antigens.

[0038] In some embodiments of the composition or kit described herein, the nucleic acid encoding an antigen is RNA encoding an antigen.

[0039] In some embodiments, the RNA encoding an antigen is single-stranded RNA.

[0040] In some embodiments, the RNA encoding an antigen is mRNA.

[0041] In some embodiments, the RNA encoding an antigen comprises a 5' cap, a 5' UTR, a 3' UTR, and a poly(A) sequence.

[0042] In some embodiments, the poly-A sequence is an interrupted sequence of A nucleotides.

[0043] In some embodiments, the RNA encoding an antigen comprises a modified nucleoside in place of uridine.

[0044] In some embodiments, the RNA encoding an antigen comprises a modified nucleoside in place of each uridine.

[0045] In some embodiments, the modified nucleoside is pseudouridine (tp) and / or Nl-methyl-pseudouridine (mlip).

[0046] In some embodiments, the modified nucleoside is Nl-methyl-pseudouridine (mlqj).

[0047] In some embodiments, the immunostimulatory RNA and / or the RNA encoding an antigen are formulated in particles.

[0048] In some embodiments, the immunostimulatory RNA and the RNA encoding an antigen are co-formulated in particles.

[0049] In some embodiments, the particles are lipid particles.

[0050] In some embodiments, the particles are lipoplex particles (LPX).

[0051] In some embodiments, the LPX particles are obtainable by combining the immunostimulatory RNA and the RNA encoding an antigen with liposomes.

[0052] In some embodiments, the LPX particles comprises DOTMA and DOPE.

[0053] In some embodiments, the particles have an average size of about 50 to 400 nm.

[0054] In some embodiments, the particles are negatively charged.

[0055] In some embodiments, the particles have a zeta potential of about -10 to -80 mV.

[0056] In a further aspect, the present disclosure provides a method for stimulating an immune response in a subject comprising providing a composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 1 or a variant thereof, which composition comprises 1000 pg or less dsRNA / pg RNA, and providing an antigen to the subject.

[0057] In some embodiments, the immunostimulatory RNA comprises a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 2 or a variant thereof, and the nucleotide sequence of SEQ ID NO: 3 or a variant thereof.

[0058] In a further aspect, the present disclosure provides a method for stimulating an immune response in a subject comprising providing a composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof, and providing an antigen to the subject.

[0059] In some embodiments, the composition comprises 1000 pg or less dsRNA / pg RNA.

[0060] In some embodiments of any of the methods described herein, the immunostimulatory RNA is a toll-like receptor (TLR) agonist.

[0061] In some embodiments, the TLR is TLR7.

[0062] In some embodiments of any of the methods described herein, the immunostimulatory RNA is capable of inducing secretion of type I interferon, e.g., interferon alpha. In some embodiments of any of the methods described herein, the composition comprising an immunostimulatory RNA comprises 750 pg or less, 500 pg or less, 400 pg or less, 300 pg or less, 200 pg or less, 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0063] In some embodiments of any of the methods described herein, the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linearized plasmid encoding the immunostimulatory RNA.

[0064] In some embodiments of any of the methods described herein, the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linear oligo-hybridized oligonucleotide DNA encoding the immunostimulatory RNA or PCR amplified DNA encoding the immunostimulatory RNA.

[0065] In some embodiments, the in vitro transcription uses T7-RNA-polymerase.

[0066] In some embodiments, the process further comprises magnetic beads purification of in vitro transcribed immunostimulatory RNA.

[0067] In some embodiments, the process further comprises the removal of dsRNA from in vitro transcribed immunostimulatory RNA.

[0068] In some embodiments, the dsRNA is removed from in vitro transcribed immunostimulatory RNA using cellulose based purification.

[0069] In some embodiments, the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 2 or a variant thereof and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0070] In some embodiments, the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 2 and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0071] In some embodiments, the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0072] In some embodiments, the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

[0073] In some embodiments of any of the methods described herein, the composition comprising an immunostimulatory RNA is provided to the subject by administering the composition comprising an immunostimulatory RNA.

[0074] In some embodiments of any of the methods described herein, the immunostimulatory RNA is administered in a pharmaceutical composition.

[0075] In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable carrier.

[0076] In some embodiments of any of the methods described herein, the antigen is provided to the subject by administering the antigen or a nucleic acid encoding the antigen.

[0077] In some embodiments of any of the methods described herein, the antigen is useful for vaccination against cancer or infection.

[0078] In some embodiments, the infection is a viral, bacterial, fungal, or parasite infection. In some embodiments of any of the methods described herein, the antigen is selected from the group consisting of cancer, virus, bacterial, fungal, or parasite antigens.

[0079] In some embodiments, the nucleic acid encoding the antigen is RNA encoding the antigen.

[0080] In some embodiments, the RNA encoding the antigen is single-stranded RNA.

[0081] In some embodiments, the RNA encoding the antigen is mRNA.

[0082] In some embodiments, the RNA encoding the antigen comprises a 5' cap, a 5' UTR, a 3' UTR, and a poly(A) sequence.

[0083] In some embodiments, the poly-A sequence is an interrupted sequence of A nucleotides.

[0084] In some embodiments, the RNA encoding the antigen comprises a modified nucleoside in place of uridine.

[0085] In some embodiments, the RNA encoding the antigen comprises a modified nucleoside in place of each uridine.

[0086] In some embodiments, the modified nucleoside is pseudouridine (ip) and / or Nl-methyl-pseudouridine (mlip).

[0087] In some embodiments, the modified nucleoside is Nl-methyl-pseudouridine (mlip).

[0088] In some embodiments, the immunostimulatory RNA and / or the RNA encoding the antigen are formulated in particles.

[0089] In some embodiments, the immunostimulatory RNA and the RNA encoding the antigen are co-formulated in particles.

[0090] In some embodiments, the particles are lipid particles.

[0091] In some embodiments, the particles are lipoplex particles (LPX).

[0092] In some embodiments, the LPX particles are obtainable by combining the immunostimulatory RNA and the RNA encoding the antigen with liposomes.

[0093] In some embodiments, the LPX particles comprises DOTMA and DOPE.

[0094] In some embodiments, the particles have an average size of about 50 to 400 nm.

[0095] In some embodiments, the particles are negatively charged.

[0096] In some embodiments, the particles have a zeta potential of about -10 to -80 mV.

[0097] In some embodiments of any of the methods described herein, the immunostimulatory RNA and the antigen are capable of inducing an antigen specific immune response in the subject.

[0098] In some embodiments, the immune response comprises a T cell response, a B cell response, or both.

[0099] In some embodiments, the immune response comprises a T cell response.

[0100] In some embodiments of any of the methods described herein, the subject is a mammal.

[0101] In some embodiments of any of the methods described herein, the subject is a human.

[0102] In further aspects, the invention provides the agents and compositions described herein for use in the methods of treatment described herein, in particular for stimulating an immune response.

[0103] In further aspects, the invention provides a composition comprising immunostimulatory RNA described herein for pharmaceutical use. In further aspects, the invention provides a composition comprising immunostimulatory RNA described herein for stimulating an immune response, in particular for stimulating an immune response to an antigen, e.g., an antigen provided to a subject. In further aspects, the invention provides a composition comprising immunostimulatory RNA described herein for use as adjuvant.

[0104] In further aspects, the invention provides a method for stimulating an immune response, in particular for stimulating an immune response to an antigen, e.g., an antigen provided to a subject, in a subject comprising administering a composition comprising immunostimulatory RNA described herein to the subject. In further aspects, the invention provides a method for providing an adjuvant to a subject comprising administering a composition comprising immunostimulatory RNA described herein to the subject.

[0105] Other features and advantages of the instant invention will be apparent from the following detailed description and claims. Brief description of the Figures

[0106] Figure 1: Sequence optimization of the already identified immunostimulatory single-stranded (is)RNA NP71-Seq4 enables the identification of a new sequence candidate with modified secondary structure and cytokine induction profile. Figure 1 depicts the generated isRNA gene sequences after IVT reaction. Generations 1 and 2 consist of (5' -> 3') transcription start site of the T7 promotor, a linker region, Spel restriction site, viral sequence (NP658-700) and Xhol restriction site. In generation 3 the linker region and the Spel and Xhol restrictions were removed.

[0107] Figure 2: Manufacturing process of immunostimulatory RNA by in vitro transcription and quality control after purification. In particular, Figure 2A shows the workflow of the manufacturing process of small non-coding immunostimulatory RNAs (isRNA). Process 1 depicts the workflow if a plasmid DNA is used as template, while process 2 depicts the workflow if single-stranded DNA oligonucleotides are used.

[0108] Figure 3: Optimizing the manufacturing process of IVT isRNA test candidates reduced dsRNA contamination and thus TLR3 stimulation without affecting TLR7 specificity. NP71-Seq4 G1 - G3 HEK293 cells stably co-expressing human TLR3, TLR7, TLR8 or TLR9 under the control of a NF-KB-inducible luciferase reporter gene were incubated with F12-formulated isRNA NP71-Seq4 and luciferase signals were compared to untreated (medium only) cells.

[0109] Figure 4: F12-formulated isRNA generation 1 - 3 induce differential cytokine profiles in human PBMCs. To analyze the cytokine profile induced by isRNA NP71-Seq4 G1 - G3 MSD multiplex immunoassay was performed. Isolated human PBMCs were stimulated with F12-formulated isRNA NP71-Seq4 G1 - G3 alone or co- formulated with modified (Nl-methylpseudouridine-5'-triphosphate; mlY) antigen RNA.

[0110] Figure 5: isRNA NP71-Seq4 G2 and G3 do not inhibit mRNA translation in vivo.

[0111] To investigate the effect of isRNA NP71-Seq4 on translation efficiency in vivo, C57BL / 6 Albino mice were injected i.v. once with F12-formulated isRNA NP71-Seq4 G1 - G3 co-formulated with modified (mlY) luciferase RNA (Figure 5A + B). Translation efficiency was quantified 6, 24, 48, 72 and 96 hours post-injection using non-invasive bioluminescence imaging (BLI) (Figure 5C). To confirm that adjuvantation does not affect the biodistribution of the F12 lipoplex, 2 animals per group were sacrificed 24-hours post immunization and organs (spleen, lung, liver) harvested for ex vivo analysis (Figure 5D).

[0112] Figure 6: F12-formulated isRNA generation 1 - 3 induce differential cytokine levels in vivo.

[0113] In the previously described in vivo experiment in Figure 5 blood was collected 6-hours post-immunization. Serum cytokines were analyzed by MSD multiplex technology.

[0114] Figure 7: F12 co-formulated isRNA up-regulates CD40, CD69, CD86 and MHC-II on antigen presenting cells in vivo.

[0115] In the previously described in vivo experiment in Figure 5 two mice were sacrificed 24-hours post-immunization and organs collected (spleen, lung, liver) for ex vivo analysis. Splenocytes were isolated and, additionally, analyzed by flow cytometry. Several immune populations (including plasmacytoid and classic dendritic cells) were analyzed on the expression of activation markers (CD40, CD69, CD86, MHC-II).

[0116] Figure 8: F12 co-formulated isRNAs induce an antigen-specific CD8+ T-cell response in vivo.

[0117] BALB / cJ mice were i.v. immunized twice (day 0 and 7) with co-formulated isRNA NP71-Seq4 G1 - G3 (Figure 8A + B). 7 days after the last immunization mice were sacrificed and splenocytes isolated to analyze the induction of antigen-specific CD8+ T-cells (Figure 8D). In addition, blood samples were taken 6-hours post-immunization for serum cytokine analysis (Figure 8C). Untreated mice served as an additional negative control. F12 co-formulated Poly(I:C) and CpG ODN2395 served as references for adjuvant capacity to induce T-cells.

[0118] Figure 9: F12 co-formulated isRNA induce an peptide-specific CD8+ T-cell response in vivo. In the previously described in vivo experiment in Figure 8 mice were sacrificed 7 days after the last immunization. Isolated splenocytes were stimulated ex vivo with an MHC-I restricted peptide and T-cell specific responses analyzed by an Enzyme-linked ImmunoSpot (ELISpot) assay.

[0119] Detailed Description

[0120] Although the present disclosure is further described in more detail below, it is to be understood that this disclosure is not limited to the particular methodologies, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0121] In the following, the elements of the present disclosure will be described in more detail. These elements are listed with specific embodiments, however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present disclosure to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and / or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.

[0122] The practice of the present disclosure will employ, unless otherwise indicated, conventional chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques which are explained in the literature in the field.

[0123] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated feature, element, member, integer or step or group of features, elements, members, integers or steps but not the exclusion of any other feature, element, member, integer or step or group of features, elements, members, integers or steps. The term "consisting essentially of limits the scope of a claim or disclosure to the specified features, elements, members, integers, or steps and those that do not materially affect the basic and novel characteristic(s) of the claim or disclosure. The term "consisting of" limits the scope of a claim or disclosure to the specified features, elements, members, integers, or steps. The term "comprising" encompasses the term "consisting essentially of which, in turn, encompasses the term "consisting of. Thus, at each occurrence in the present application, the term "comprising" may be replaced with the term "consisting essentially of or "consisting of. Likewise, at each occurrence in the present application, the term "consisting essentially of may be replaced with the term "consisting of.

[0124] The terms "a", "an" and "the" and similar references used in the context of describing the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by the context.

[0125] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by the context.

[0126] The use of any and all examples, or exemplary language (e.g., "such as"), provided herein is intended merely to better illustrate the present disclosure and does not pose a limitation on the scope of the present disclosure otherwise claimed. No language in the specification should be construed as indicating any non-daimed element essential to the practice of the present disclosure. The term "optional" or "optionally" as used herein means that the subsequently described event, circumstance or condition may or may not occur, and that the description includes instances where said event, circumstance, or condition occurs and instances in which it does not occur.

[0127] Where used herein, "and / or" is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, "X and / or Y" is to be taken as specific disclosure of each of (i) X, (ii) Y, and (iii) X and Y, just as if each is set out individually herein.

[0128] In the context of the present disclosure, the term "about" denotes an interval of accuracy that the person of ordinary skill will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from the indicated numerical value by ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05%, and for example ±0.01%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±10%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±5%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±4%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±3%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±2%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±1%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.9%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.8%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.7%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.6%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.5%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.4%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.3%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.2%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.1%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.05%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.01%. As will be appreciated by the person of ordinary skill, the specific such deviation for a numerical value for a given technical effect will depend on the nature of the technical effect. For example, a natural or biological technical effect may generally have a larger such deviation than one for a man-made or engineering technical effect.

[0129] Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if It were individually recited herein.

[0130] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0131] In the following, definitions and embodiments will be provided which apply to all aspects of the present disclosure. Terms which are defined in the following have the meanings as defined, unless otherwise indicated. Any undefined terms have their art recognized meanings.

[0132] Terms such as "reduce" or "inhibit" as used herein means the ability to cause an overall decrease, for example, of about 5% or greater, about 10% or greater, about 15% or greater, about 20% or greater, about 25% or greater, about 30% or greater, about 40% or greater, about 50% or greater, or about 75% or greater, in the level. The term "inhibit" or similar phrases includes a complete or essentially complete inhibition, i.e. a reduction to zero or essentially to zero. Terms such as "enhance" as used herein means the ability to cause an overall increase, or enhancement, for example, by at least about 5% or greater, about 10% or greater, about 15% or greater, about 20% or greater, about 25% or greater, about 30% or greater, about 40% or greater, about 50% or greater, about 75% or greater, or about 100% or greater in the level.

[0133] If the disclosure refers to a charge such as a positive charge, negative charge or neutral charge or a cationic compound, negative compound or neutral compound this generally means that the charge mentioned is present at a selected pH, such as a physiological pH. "Physiological pH" as used herein refers to a pH of about 7.4. In some embodiments, physiological pH is from 7.3 to 7.5. In some embodiments, physiological pH is from 7.35 to 7.45. In some embodiments, physiological pH is 7.3, 7.35, 7.4, 7.45, or 7.5.

[0134] As used in the present disclosure, "% w / v" refers to weight by volume percent, which is a unit of concentration measuring the amount of solute in grams (g) expressed as a percent of the total volume of solution in milliliters (mL).

[0135] As used in the present disclosure, "% by weight" refers to weight percent, which is a unit of concentration measuring the amount of a substance in grams (g) expressed as a percent of the total weight of the total composition in grams (g).

[0136] As used in the present disclosure, "mol %" is defined as the ratio of the number of moles of one component to the total number of moles of all components, multiplied by 100.

[0137] As used in the present disclosure, "mol % of the total lipid" is defined as the ratio of the number of moles of one lipid component to the total number of moles of all lipids, multiplied by 100. In this context, in some embodiments, the term "total lipid" includes lipids and lipid-like material.

[0138] The term "ionic strength" refers to the mathematical relationship between the number of different kinds of ionic species in a particular solution and their respective charges. Thus, ionic strength I is represented mathematically by the formula: in which c is the molar concentration of a particular ionic species and z the absolute value of its charge. The sum 2 is taken over all the different kinds of ions (i) in solution.

[0139] According to the disclosure, the term "ionic strength" in some embodiments relates to the presence of monovalent ions. Regarding the presence of divalent ions, in particular divalent cations, their concentration or effective concentration (presence of free ions) due to the presence of chelating agents is, in some embodiments, sufficiently low so as to prevent degradation of nucleic acid. In some embodiments, the concentration or effective concentration of divalent ions is below the catalytic level for hydrolysis of the phosphodiester bonds between nucleotides such as RNA nucleotides. In some embodiments, the concentration of free divalent ions is 20 pM or less. In some embodiments, there are no or essentially no free divalent ions.

[0140] "Osmolality" refers to the concentration of a particular solute expressed as the number of osmoles of solute per kilogram of solvent.

[0141] The term "lyophilizing" or "lyophilization" refers to the freeze-drying of a substance by freezing it and then reducing the surrounding pressure (e.g., below 15 Pa, such as below 10 Pa, below 5 Pa, or 1 Pa or less) to allow the frozen medium in the substance to sublimate directly from the solid phase to the gas phase. Thus, the terms "lyophilizing" and "freeze-drying" are used herein interchangeably.

[0142] The term "spray-drying" refers to spray-drying a substance by mixing (heated) gas with a fluid that is atomized (sprayed) within a vessel (spray dryer), where the solvent from the formed droplets evaporates, leading to a dry powder. The term "reconstitute" relates to adding a solvent such as water to a dried product to return it to a liquid state such as its original liquid state.

[0143] The term "recombinant" in the context of the present disclosure means "made through genetic engineering". In some embodiments, a "recombinant object" in the context of the present disclosure is not occurring naturally.

[0144] The term "naturally occurring" as used herein refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring. The term "found in nature" means "present in nature" and includes known objects as well as objects that have not yet been discovered and / or isolated from nature, but that may be discovered and / or isolated in the future from a natural source.

[0145] As used herein, the terms "room temperature" and "ambient temperature" are used interchangeably herein and refer to temperatures from at least about 15°C, e.g., from about 15°C to about 35°C, from about 15°C to about 30°C, from about 15°C to about 25°C, or from about 17°C to about 22°C. Such temperatures will include 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C and 22°C.

[0146] The term "EDTA" refers to ethylenediaminetetraacetic acid disodium salt. All concentrations are given with respect to the EDTA disodium salt.

[0147] The term "cryoprotectant" relates to a substance that is added to a formulation in order to protect the active ingredients during the freezing stages.

[0148] The term "lyoprotectant" relates to a substance that is added to a formulation in order to protect the active ingredients during the drying stages.

[0149] According to the present disclosure, the term "peptide" refers to substances which comprise about two or more, about 3 or more, about 4 or more, about 6 or more, about 8 or more, about 10 or more, about 13 or more, about 16 or more, about 20 or more, and up to about 50, about 100 or about 150, consecutive amino acids linked to one another via peptide bonds. The term "polypeptide" refers to large peptides, in particular peptides having at least about 151 amino acids. However, "peptides" and "polypeptides" are both protein molecules, and, therefore, the terms "peptide", "protein" and "polypeptide" are generally used interchangeably herein. In particular, the term "polypeptide" when used herein generally covers peptides and polypeptides of any length.

[0150] The term "biological activity" means the response of a biological system to a molecule. Such biological systems may be, for example, a cell or an organism. In some embodiments, such response is therapeutically or pharmaceutically useful.

[0151] The term "portion" refers to a fraction. With respect to a particular structure such as an amino acid sequence or protein the term "portion" thereof may designate a continuous or a discontinuous fraction of said structure.

[0152] The terms "part" and "fragment" are used interchangeably herein and refer to a continuous element. For example, a part of a structure such as an amino acid sequence or protein refers to a continuous element of said structure. When used in context of a composition, the term "part" means a portion of the composition. For example, a part of a composition may be any portion from 0.1% to 99.9% (such as 0.1%, 0.5%, 1%, 5%, 10%, 50%, 90%, or 99%) of said composition.

[0153] "Fragment", with reference to an amino acid sequence (peptide or polypeptide), relates to a part of an amino acid sequence, i.e. a sequence which represents the amino acid sequence shortened at the N-terminus and / or C- terminus. A fragment shortened at the C-terminus (N-terminal fragment) is obtainable, e.g., by translation of a truncated open reading frame that lacks the 3'-end of the open reading frame. A fragment shortened at the N- terminus (C-terminal fragment) is obtainable, e.g., by translation of a truncated open reading frame that lacks the 5'-end of the open reading frame, as long as the truncated open reading frame comprises a start codon that serves to initiate translation. A fragment of an amino acid sequence comprises, e.g., at least 50 %, at least 60 %, at least 70 %, at least 80%, at least 90% of the amino acid residues from an amino acid sequence. A fragment of an amino acid sequence comprises, e.g., at least 6, in particular at least 8, at least 10, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids from an amino acid sequence. A fragment of an amino acid sequence comprises, e.g., a sequence of up to 8, in particular up to 10, up to 12, up to 15, up to 20, up to 30 or up to 55, consecutive amino acids of the amino acid sequence.

[0154] "Variant," as used herein and with reference to an amino acid sequence (peptide or polypeptide), is meant an amino acid sequence that differs from a parent amino acid sequence by virtue of at least one amino acid (e.g., a different amino acid, or a modification of the same amino acid). The parent amino acid sequence may be a naturally occurring or wild type (WT) amino acid sequence, or may be a modified version of a wild type amino acid sequence. In some embodiments, the variant amino acid sequence has at least one amino acid difference as compared to the parent amino acid sequence, e.g., from 1 to about 20 amino acid differences, such as from 1 to about 10 or from 1 to about 5 amino acid differences compared to the parent.

[0155] By "wild type" or "WT" or "native" herein is meant an amino acid sequence that is found in nature, including allelic variations. A wild type amino acid sequence, peptide or polypeptide has an amino acid sequence that has not been intentionally modified.

[0156] For the purposes of the present disclosure, "variants" of an amino acid sequence (peptide or polypeptide) may comprise amino acid insertion variants, amino acid addition variants, amino acid deletion variants and / or amino acid substitution variants. The term "variant" includes all mutants, splice variants, post-translationally modified variants, conformations, isoforms, allelic variants, species variants, and species homologs, in particular those which are naturally occurring. The term "variant" includes, in particular, fragments of an amino acid sequence.

[0157] Amino acid insertion variants comprise insertions of single or two or more amino acids in a particular amino acid sequence. In the case of amino acid sequence variants having an insertion, one or more amino acid residues are inserted into a particular site in an amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible. Amino acid addition variants comprise amino- and / or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as by removal of 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions may be in any position of the protein. Amino acid deletion variants that comprise the deletion at the N-terminal and / or C-terminal end of the protein are also called N-terminal and / or C-terminal truncation variants. Amino acid substitution variants are characterized by at least one residue in the sequence being removed and another residue being inserted in its place. Preference is given to the modifications being in positions in the amino acid sequence which are not conserved between homologous peptides or polypeptides and / or to replacing amino acids with other ones having similar properties. In some embodiments, amino acid changes in peptide and polypeptide variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. A conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains. Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.

[0158] In some embodiments the degree of similarity, such as identity between a given amino acid sequence and an amino acid sequence which is a variant of said given amino acid sequence, will be at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the degree of similarity or identity is given for an amino acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is given, e.g., for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, in some embodiments continuous amino acids. In some embodiments, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. The alignment for determining sequence similarity, such as sequence identity, can be done with art known tools, such as using the best sequence alignment, for example, using Align, using standard settings, preferably EMBOSS: : needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0159] According to the invention, nucleic acid variants include single or multiple nucleotide deletions, additions, mutations and / or insertions in comparison with the reference nucleic acid. Deletions include removal of one or more nucleotides from the reference nucleic acid. Addition variants comprise 5’- and / or 3 -terminal fusions of one or more nucleotides, such as 1, 2, 3, 5, 10, 20, 30, 50, or more nucleotides. Mutations can include but are not limited to substitutions, wherein at least one nucleotide in the sequence is removed and another nucleotide is inserted in its place (such as transversions and transitions), abasic sites, crosslinked sites, and chemically altered or modified bases. Insertions include the addition of at least one nucleotide into the reference nucleic acid.

[0160] Preferably the degree of identity between a given nucleic acid sequence and a nucleic acid sequence which is a variant of said given nucleic acid sequence will be at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of identity is given preferably for a nucleic acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference nucleic acid sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given preferably for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 nucleotides, preferably continuous nucleotides. In preferred embodiments, the degree of identity is given for the entire length of the reference nucleic acid sequence.

[0161] Variants of specific nucleic acid sequences or nucleic acid sequences having a particular degree of identity to specific nucleic acid sequences preferably have at least one functional property of said specific sequences and preferably are functionally equivalent to said specific sequences, e.g. nucleic acid sequences exhibiting properties identical or similar to those of the specific nucleic acid sequences.

[0162] One important property includes the ability to act as adjuvant or immunostimulatory agent, in particular when administered in conjunction with an antigen or nucleic acid encoding an antigen.

[0163] "Sequence similarity" indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences.

[0164] The terms "% identical" and "% identity" or similar terms are intended to refer, in particular, to the percentage of nucleotides or amino acids which are identical in an optimal alignment between the sequences to be compared. Said percentage is purely statistical, and the differences between the two sequences may be but are not necessarily randomly distributed over the entire length of the sequences to be compared. Comparisons of two sequences are usually carried out by comparing the sequences, after optimal alignment, with respect to a segment or "window of comparison", in order to identify local regions of corresponding sequences. The optimal alignment for a comparison may be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981, Ads App. Math. 2, 482, with the aid of the local homology algorithm by Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, with the aid of the similarity search algorithm by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or with the aid of computer programs using said algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.). In some embodiments, percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the United States National Center for Biotechnology Information (NCBI) website (e.g., at blast.ncbi.nlm.nih.gov / Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq). In some embodiments, the algorithm parameters used for BLASTN algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 28; (iii) Max matches in a query range set to 0; (iv) Match / Mismatch Scores set to 1, -2; (v) Gap Costs set to Linear; and (vi) the filter for low complexity regions being used. In some embodiments, the algorithm parameters used for BLASTP algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 3; (iii) Max matches in a query range set to 0; (iv) Matrix set to BLOSUM62; (v) Gap Costs set to Existence: 11 Extension: 1; and (vi) conditional compositional score matrix adjustment.

[0165] Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence) and multiplying this result by 100.

[0166] Homologous amino acid sequences exhibit according to the disclosure at least 40%, in particular at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and, e.g., at least 95%, at least 98 or at least 99% identity of the amino acid residues.

[0167] The amino acid sequence and nucleic acid sequence variants described herein may readily be prepared by the skilled person, for example, by recombinant DNA manipulation. The manipulation of DNA sequences for preparing peptides or polypeptides having substitutions, additions, insertions or deletions, is described in detail in Molecular Cloning: A Laboratory Manual, 4thEdition, M.R. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012, for example. Furthermore, the peptides, polypeptides and amino acid variants described herein may be readily prepared with the aid of known peptide synthesis techniques such as, for example, by solid phase synthesis and similar methods.

[0168] In some embodiments, a fragment or variant of an amino acid sequence (peptide or polypeptide) or nucleic acid sequence is a "functional fragment" or "functional variant". The term "functional fragment" or "functional variant" of an amino acid sequence or nucleic acid sequence relates to any fragment or variant exhibiting one or more functional properties identical or similar to those of the amino acid sequence or nucleic acid sequence from which it is derived, Ze., it is functionally equivalent. With respect to antigens or antigenic sequences, one particular function is one or more immunogenic activities displayed by the amino acid sequence from which the fragment or variant is derived. The term "functional fragment" or "functional variant", as used herein, in particular refers to a variant molecule or sequence that comprises an amino acid sequence or nucleic acid sequence that is altered by one or more amino acids or nucleotides compared to the amino acid sequence or nucleic acid sequence of the parent molecule or sequence and that is still capable of fulfilling one or more of the functions of the parent molecule or sequence, e.g., inducing an immune response. In some embodiments, the modifications in the amino acid sequence or nucleic acid sequence of the parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence. In different embodiments, the function of the functional fragment or functional variant may be reduced but still significantly present, e.g., function of the functional fragment or functional variant may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the parent molecule or sequence. However, in other embodiments, function of the functional fragment or functional variant may be enhanced compared to the parent molecule or sequence. An amino acid sequence (peptide or polypeptide) or nucleic acid sequence "derived from" a designated amino acid sequence (peptide or polypeptide) or nucleic acid sequence refers to the origin of the first sequence. In some embodiments, the amino acid sequence or nucleic acid sequence which is derived from a particular amino acid sequence or nucleic acid sequence has an amino acid sequence or nucleic acid sequence that is identical, essentially identical or homologous to that particular sequence or a fragment thereof. Amino acid sequences or nucleic acid sequences derived from a particular amino acid sequence or nucleic acid sequence may be variants of that particular sequence or a fragment thereof. For example, it will be understood by one of ordinary skill in the art that the immunostimulatory RNAs or antigens suitable for use herein may be altered such that they vary in sequence from the sequences from which they were derived, while retaining the desirable activity of the parental sequences.

[0169] In some embodiments, "isolated" means removed (e.g., purified) from the natural state or from an artificial composition, such as a composition from a production process. For example, a nucleic acid, peptide or polypeptide naturally present in a living animal is not "isolated", but the same nucleic acid, peptide or polypeptide partially or completely separated from the coexisting materials of its natural state is "isolated". An isolated nucleic acid, peptide or polypeptide can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.

[0170] The term "transfection" relates to the introduction of nucleic acids, in particular RNA, into a cell. For purposes of the present disclosure, the term "transfection" also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such cell, wherein the cell may be present in a subject, e.g., a patient, or the cell may be in vitro, e.g., outside of a patient. Thus, according to the present disclosure, a cell for transfection of a nucleic acid described herein can be present in vitro or in vivo, e.g. the cell can form part of an organ, a tissue and / or the body of a patient. According to the disclosure, transfection can be transient or stable. For some applications of transfection, it is sufficient if the transfected genetic material is only transiently expressed. RNA can be transfected into cells to transiently express its coded protein. Since the nucleic acid introduced in the transfection process is usually not integrated into the nuclear genome, the foreign nucleic acid will be diluted through mitosis or degraded. Cells allowing episomal amplification of nucleic acids greatly reduce the rate of dilution. If it is desired that the transfected nucleic acid actually remains in the genome of the cell and its daughter cells, a stable transfection must occur. Such stable transfection can be achieved by using virus-based systems or transposon-based systems for transfection, for example. Generally, nucleic acid encoding antigen is transiently transfected into cells. RNA can be transfected into cells to transiently express its coded protein.

[0171] As used herein, the terms "linked”, "fused", or "fusion" are used interchangeably. These terms refer to the joining together of two or more elements or components or domains.

[0172] As used herein "endogenous" refers to any material from or produced inside an organism, cell, tissue or system.

[0173] As used herein, the term "exogenous" refers to any material introduced from or produced outside an organism, cell, tissue or system.

[0174] According to various embodiments of the present disclosure, a nucleic acid such as RNA encoding a peptide or polypeptide is taken up by or introduced, i.e. transfected or transduced, into a cell which cell may be present in vitro or in a subject, resulting in expression of said peptide or polypeptide. The cell may, e.g., express the encoded peptide or polypeptide intracellularly {e.g. in the cytoplasm and / or in the nucleus), may secrete the encoded peptide or polypeptide, and / or may express it on the surface. In some embodiments, the cell secretes the encoded peptide or polypeptide.

[0175] According to the present disclosure, terms such as "nucleic acid expressing" and "nucleic acid encoding" or similar terms are used interchangeably herein and with respect to a particular peptide or polypeptide mean that the nucleic acid, if present in the appropriate environment, e.g. within a cell, can be expressed to produce said peptide or polypeptide.

[0176] In particular, the term "encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an RNA (in particular, mRNA), to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0177] An "open reading frame" or "ORF" is a continuous stretch of codons beginning with a start codon and ending with a stop codon.

[0178] The term "expression" as used herein includes the transcription and / or translation of a particular nucleotide sequence.

[0179] In the context of the present disclosure, the term "transcription" relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA (especially mRNA). Subsequently, the RNA may be translated into peptide or polypeptide.

[0180] With respect to RNA, the term "expression" or "translation" relates to the process in the ribosomes of a cell by which a strand of mRNA directs the assembly of a sequence of amino acids to make a peptide or polypeptide.

[0181] A medical preparation, in particular kit, described herein may comprise instructional material or instructions. As used herein, "instructional material" or "instructions" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the present disclosure. The instructional material of the kit of the present disclosure may, for example, be affixed to a container which contains the compositions / formulations of the present disclosure or be shipped together with a container which contains the compositions / formulations. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compositions be used cooperatively by the recipient.

[0182] In the present specification, a structural formula of a compound may represent a certain isomer of said compound. It is to be understood, however, that the present disclosure includes all isomers such as geometrical isomers, optical isomers based on an asymmetrical carbon, stereoisomers, tautomers and the like which occur structurally and isomer mixtures and is not limited to the description of the formula. Furthermore, in the present specification, a structural formula of a compound may represent a specific salt and / or solvate of said compound. It is to be understood, however, that the present disclosure includes all salts (e.g., pharmaceutically acceptable salts) and solvates (e.g., hydrates) and is not limited to the description of the specific salt and / or solvate.

[0183] "Isomers" are compounds having the same molecular formula but differ in structure ("structural isomers") or in the geometrical (spatial) positioning of the functional groups and / or atoms ("stereoisomers"). "Enantiomers" are a pair of stereoisomers which are non-superimposable mirror-images of each other. A "racemic mixture" or "racemate" contains a pair of enantiomers in equal amounts and is denoted by the prefix (±). "Diastereomers" are stereoisomers which are non-superimposable and which are not mirror-images of each other. "Tautomers" are structural isomers of the same chemical substance that spontaneously and reversibly interconvert into each other, even when pure, due to the migration of individual atoms or groups of atoms; i.e., the tautomers are in a dynamic chemical equilibrium with each other. An example of tautomers are the isomers of the keto-enol-tautomerism. "Conformers" are stereoisomers that can be interconverted just by rotations about formally single bonds, and include - in particular - those leading to different 3-dimentional forms of (hetero)cyclic rings, such as chair, half- chair, boat, and twist-boat forms of cyclohexane.

[0184] The term "solvate" as used herein refers to an addition complex of a dissolved material in a solvent (such as an organic solvent (e.g., an aliphatic alcohol (such as methanol, ethanol, n-propanol, isopropanol), acetone, acetonitrile, ether, and the like), water or a mixture of two or more of these liquids), wherein the addition complex exists in the form of a crystal or mixed crystal. The amount of solvent contained in the addition complex may be stoichiometric or non-stoichiometric. A "hydrate" is a solvate wherein the solvent is water.

[0185] In isotopically labeled compounds one or more atoms are replaced by a corresponding atom having the same number of protons but differing in the number of neutrons. For example, a hydrogen atom may be replaced by a deuterium or tritium atom. Exemplary isotopes which can be used in the present disclosure include deuterium, tritium,UC,13C,MC,15N,18F,32P,32S,35S,36CI, and125I.

[0186] The term "average diameter" refers to the mean hydrodynamic diameter of particles as measured by dynamic light scattering (DLS) with data analysis using the so-called cumulant algorithm, which provides as results the so-called with the dimension of a length, and the polydispersity index (PDI), which is dimensionless (Koppel, D., J. Chem. Phys. 57, 1972, pp 4814-4820, ISO 13321). Here "average diameter", "diameter" or "size" for particles is used synonymously with this value of the

[0187] In some embodiments, the "polydispersity index" is calculated based on dynamic light scattering measurements by the so-called cumulant analysis as mentioned in the definition of the "average diameter". Under certain prerequisites, it can be taken as a measure of the size distribution of an ensemble of nanoparticles.

[0188] Nucleic Acids

[0189] The term "nucleic acid" comprises deoxyribonucleic acid (DNA), ribonucleic acid (RNA), combinations thereof, and modified forms thereof. The term comprises genomic DNA, cDNA, RNA, mRNA, recombinantly produced and chemically synthesized molecules. In some embodiments, a nucleic acid is DNA. In some embodiments, a nucleic acid is RNA. In some embodiments, a nucleic acid is a mixture of DNA and RNA. A nucleic acid may be present as a single-stranded or double-stranded and linear or covalently circularly closed molecule. A nucleic acid can be isolated. The term "isolated nucleic acid" means, according to the present disclosure, that the nucleic acid (i) was amplified in vitro, for example via polymerase chain reaction (PCR) for DNA or in vitro transcription (using, e.g., an RNA polymerase) for RNA, (ii) was produced recombinantly by cloning, (iii) was purified, for example, by cleavage and separation by gel electrophoresis, or (iv) was synthesized, for example, by chemical synthesis.

[0190] The term "nucleoside" (abbreviated herein as "N") relates to compounds which can be thought of as nucleotides without a phosphate group. While a nucleoside is a nucleobase linked to a sugar (e.g., ribose or deoxyribose), a nucleotide is composed of a nucleoside and one or more phosphate groups. Examples of nucleosides include cytidine, uridine, pseudouridine, adenosine, and guanosine.

[0191] The five standard nucleosides which usually make up naturally occurring nucleic acids are uridine, adenosine, thymidine, cytidine and guanosine. The five nucleosides are commonly abbreviated to their one letter codes U, A, T, C and G, respectively. However, thymidine is more commonly written as "dT" ("d" represents "deoxy") as it contains a 2'-deoxyribofuranose moiety rather than the ribofuranose ring found in uridine. This is because thymidine is found in deoxyribonucleic acid (DNA) and not ribonucleic acid (RNA). Conversely, uridine is found in RNA and not DNA. The remaining three nucleosides may be found in both RNA and DNA. In RNA, they would be represented as A, C and G, whereas in DNA they would be represented as dA, dC and dG.

[0192] A modified purine (A or G) or pyrimidine (C, T, or U) base moiety is, in some embodiments, modified by one or more alkyl groups, e.g., one or more CM alkyl groups, e.g., one or more methyl groups. Particular examples of modified purine or pyrimidine base moieties include N7-alkyl-guanine, N6-alkyl-adenine, 5-alkyl-cytosine, 5-alkyl- uracil, and N(l)-alkyl-uracil, such as N7-C1-4 alkyl-guanine, N6-C1-4 alkyl-adenine, 5-C1-4 alkyl-cytosine, 5-C1-4 alkyl- uracil, and N(1)-C1-4 alkyl-uracil, preferably N7-methyl-guanine, N6-methyl-adenine, 5-methyl-cytosine, 5-methyl- uracil, and N(l)-methyl-uracil.

[0193] DNA

[0194] Herein, the term "DNA" relates to a nucleic acid molecule which is entirely or at least substantially composed of deoxyribonucleotide residues. In preferred embodiments, the DNA contains all or a majority of deoxyribonucleotide residues. As used herein, "deoxyribonucleotide" refers to a nucleotide which lacks a hydroxyl group at the 2'- position of a p-D-ribofuranosyl group. DNA encompasses without limitation, double stranded DNA, single stranded DNA, isolated DNA such as partially purified DNA, essentially pure DNA, synthetic DNA, recombinantly produced DNA, as well as modified DNA that differs from naturally occurring DNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal DNA nucleotides or to the end(s) of DNA. It is also contemplated herein that nucleotides in DNA may be non-standard nucleotides, such as chemically synthesized nucleotides or ribonucleotides. For the present disclosure, these altered DNAs are considered analogs of naturally-occurring DNA. A molecule contains "a majority of deoxyribonucleotide residues" if the content of deoxyribonucleotide residues in the molecule is more than 50% (such as at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%), based on the total number of nucleotide residues in the molecule. The total number of nucleotide residues In a molecule is the sum of all nucleotide residues (irrespective of whether the nucleotide residues are standard {i.e., naturally occurring) nucleotide residues or analogs thereof).

[0195] DNA may be recombinant DNA and may be obtained by cloning of a nucleic acid, in particular cDNA. The cDNA may be obtained by reverse transcription of RNA.

[0196] RNA

[0197] The term "RNA" relates to a nucleic acid molecule which includes ribonucleotide residues. In preferred embodiments, the RNA contains all or a majority of ribonucleotide residues. As used herein, "ribonucleotide" refers to a nucleotide with a hydroxyl group at the 2'-position of a p-D-ribofuranosyl group. RNA encompasses without limitation, double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal RNA nucleotides or to the end(s) of RNA. It is also contemplated herein that nucleotides in RNA may be non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides. For the present disclosure, these altered / modified nucleotides can be referred to as analogs of naturally occurring nucleotides, and the corresponding RNAs containing such altered / modified nucleotides {i.e., altered / modified RNAs) can be referred to as analogs of naturally occurring RNAs. A molecule contains "a majority of ribonucleotide residues" if the content of ribonucleotide residues in the molecule is more than 50% (such as at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%), based on the total number of nucleotide residues in the molecule. The total number of nucleotide residues in a molecule is the sum of all nucleotide residues (irrespective of whether the nucleotide residues are standard {i.e., naturally occurring) nucleotide residues or analogs thereof).

[0198] "RNA" includes mRNA, tRNA, ribosomal RNA (rRNA), small nuclear RNA (snRNA), self-amplifying RNA (saRNA), trans-amplifying RNA (taRNA), single-stranded RNA (ssRNA), double-stranded RNA (dsRNA), inhibitory RNA (such as antisense ssRNA, small interfering RNA (siRNA), or microRNA (miRNA)), activating RNA (such as small activating RNA) and immunostimulatory RNA (isRNA). In some embodiments, "RNA" refers to mRNA. In some embodiments, "RNA" refers to isRNA.

[0199] In some embodiments, RNA described herein such as immunostimulatory RNA and antigen-encoding RNA is in vitro transcribed RNA (IVT-RNA) and may be obtained by in vitro transcription of an appropriate DNA template. The term "in vitro transcription" or "IVT" as used herein means that the transcription (i.e., the generation of RNA) is conducted in a cell-free manner. I.e., IVT does not use living / cultured cells but rather the transcription machinery extracted from cells (e.g., cell lysates or the isolated components thereof, including an RNA polymerase (preferably T7, T3 or SP6 polymerase)). The promoter for controlling transcription can be any promoter for any RNA polymerase. Particular examples of RNA polymerases are the T7, T3, and SP6 RNA polymerases. Preferably, the in vitro transcription is controlled by a T7 or SP6 promoter. A DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA. Alternatively, a DNA template for in vitro transcription may be obtained by generating double-stranded DNA from single-stranded, complementary oligos. The in vitro transcription methodology is known to the skilled person; cf., e.g., Molecular Cloning: A Laboratory Manual, 4thEdition, M.R. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012. Furthermore, a variety of in vitro transcription kits is commercially available, e.g., from Thermo Fisher Scientific (such as TranscriptAid™ T7 kit, MEGAscript® T7 kit, MAXIscript®), New England BioLabs Inc. (such as HiScribe™ T7 kit, HiScribe™ T7 ARCA mRNA kit), Promega (such as RiboMAX™, HeLaScribe®, Riboprobe® systems), Jena Bioscience (such as SP6 or T7 transcription kits), and Epicentre (such as AmpliScribe™).

[0200] For providing modified mRNA, correspondingly modified nucleotides, such as modified naturally occurring nucleotides, non-naturally occurring nucleotides and / or modified non-naturally occurring nucleotides, can be incorporated during synthesis (preferably in vitro transcription), or modifications can be effected in and / or added to the mRNA after transcription.

[0201] In general, RNA, e.g., immunostimulatory RNA and / or antigen-encoding RNA, is single-stranded but may contain self-complementary sequences that allow parts of the RNA to fold and pair with itself to form double helices.

[0202] According to the present disclosure, "dsRNA" means RNA with two partially or completely complementary strands. According to the present disclosure, the term '"RNA" includes "mRNA". According to the present disclosure, the term "mRNA" means "messenger-RNA" and includes a "transcript" which may be generated by using a DNA template. Generally, mRNA encodes a peptide or polypeptide.

[0203] In some embodiments, mRNA has a length of at least 45 nucleotides (such as at least 60, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 3,500, at least 4,000, at least 4,500, at least 5,000, at least 6,000, at least 7,000, at least 8,000, at least 9,000 nucleotides), preferably up to 15,000, such as up to 14,000, up to 13,000, up to 12,000 nucleotides, up to 11,000 nucleotides or up to 10,000 nucleotides.

[0204] As established in the art, mRNA generally contains a 5' untranslated region (5'-UTR), a peptide / polypeptide coding region and a 3' untranslated region (3'-UTR). In some embodiments, the mRNA is produced by in vitro transcription or chemical synthesis. In some embodiments, the mRNA is produced by in vitro transcription using a DNA template. In some embodiments of the present disclosure, the RNA is "replicon RNA" or simply a "replicon", in particular "self-replicating RNA" or "self-amplifying RNA". In certain embodiments, the replicon or self-replicating RNA is derived from or comprises elements derived from an ssRNA virus, in particular a positive-stranded ssRNA virus such as an alphavirus. Alphaviruses are typical representatives of positive-stranded RNA viruses. Alphaviruses replicate in the cytoplasm of infected cells (for review of the alphaviral life cycle see Jose eta!., Future Microbiol., 2009, vol. 4, pp. 837-856). The total genome length of many alphaviruses typically ranges between 11,000 and 12,000 nucleotides, and the genomic RNA typically has a 5'-cap, and a 3' poly(A) tail. The genome of alphaviruses encodes non-structural proteins (involved in transcription, modification and replication of viral RNA and in protein modification) and structural proteins (forming the virus particle). There are typically two open reading frames (ORFs) in the genome. The four non-structural proteins (nsPl-nsP4) are typically encoded together by a first ORF beginning near the 5' terminus of the genome, while alphavirus structural proteins are encoded together by a second ORF which is found downstream of the first ORF and extends near the 3' terminus of the genome. Typically, the first ORF is larger than the second ORF, the ratio being roughly 2: 1. In cells infected by an alphavirus, only the nucleic acid sequence encoding non-structural proteins is translated from the genomic RNA, while the genetic information encoding structural proteins is translatable from a subgenomic transcript, which is an RNA molecule that resembles eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., vol. 87 pp. 111-124). Following infection, i.e. at early stages of the viral life cycle, the (+) stranded genomic RNA directly acts like a messenger RNA for the translation of the open reading frame encoding the non-structural poly-protein (nsP1234).

[0205] Alphavirus-derived vectors have been proposed for delivery of foreign genetic information into target cells or target organisms. In simple approaches, the open reading frame encoding alphaviral structural proteins is replaced by an open reading frame encoding a protein of interest. Alphavirus-based trans-replication (trans-amplification) systems rely on alphavirus nucleotide sequence elements on two separate nucleic acid molecules: one nucleic acid molecule encodes a viral replicase, and the other nucleic acid molecule is capable of being replicated by said replicase in trans (hence the designation trans-replication system). Trans-replication requires the presence of both these nucleic acid molecules in a given host cell. The nucleic acid molecule capable of being replicated by the replicase in trans must comprise certain alphaviral sequence elements to allow recognition and RNA synthesis by the alphaviral replicase.

[0206] In some embodiments of the present disclosure, the RNA (in particular, antigen-encoding RNA such as antigen- encoding mRNA) described herein (e.g., contained in the compositions / formulations of the present disclosure and / or used in the methods of the present disclosure) contains one or more modifications, e.g., in order to increase its stability and / or increase translation efficiency and / or decrease immunogenicity and / or decrease cytotoxicity. For example, in order to increase expression of the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA), it may be modified within the coding region, i.e., the sequence encoding the expressed peptide or polypeptide, preferably without altering the sequence of the expressed peptide or polypeptide. Such modifications are described, for example, in WO 2007 / 036366 and PCT / EP2019 / 056502, and include the following: a 5'-cap structure; an extension or truncation of the naturally occurring poly(A) tail; an alteration of the 5'- and / or 3'- untranslated regions (UTR) such as introduction of a UTR which is not related to the coding region of said RNA; the replacement of one or more naturally occurring nucleotides with synthetic nucleotides; and codon optimization (e.g., to alter, preferably increase, the GC content of the RNA). A combination of the above described modifications, i.e., incorporation of a 5'-cap structure, incorporation of a poly-A sequence, unmasking of a poly-A sequence, alteration of the 5'- and / or 3'-UTR (such as incorporation of one or more 3’-UTRs), replacing one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5-methylcytidine for cytidine and / or pseudouridine (4J) or N(l)-methylpseudouridine (mlU1) or 5-methyluridine (m5U) for uridine), and codon optimization, has a synergistic influence on the stability of RNA (preferably mRNA) and increase in translation efficiency. Thus, in some embodiments, the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described in the present disclosure contains a combination of at least two, at least three, at least four or all five of the above-mentioned modifications, i.e., (i) incorporation of a 5'-cap structure, (ii) incorporation of a poly-A sequence, unmasking of a poly-A sequence; (iii) alteration of the 5'- and / or 3'-UTR (such as incorporation of one or more 3'-UTRs); (iv) replacing one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5- methylcytidine for cytidine and / or pseudouridine (4J) or N(l)-methylpseudouridine (mlV) or 5-methyluridine (m5U) for uridine), and (v) codon optimization.

[0207] 5'-Cao

[0208] In some embodiments, the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein comprises a 5'-cap structure. In some embodiments, the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) does not have uncapped 5'-tri phosphates. In some embodiments, the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) may comprise a conventional 5'-cap and / or a 5'-cap analog. The term "conventional 5'-cap" refers to a cap structure found on the 5'-end of an RNA molecule and generally comprises a guanosine 5'-triphosphate (Gppp) which is connected via its triphosphate moiety to the 5'- end of the next nucleotide of the RNA (i.e., the guanosine is connected via a 5' to 5' triphosphate linkage to the rest of the RNA). The guanosine may be methylated at position N7(resulting in the cap structure m7Gppp). The term "5'-cap analog" includes a 5'-cap which is based on a conventional 5'-cap but which has been modified at either the 2'- or 3'-position of the m7guanosine structure in order to avoid an integration of the 5'-cap analog in the reverse orientation (such 5'-cap analogs are also called anti-reverse cap analogs (ARCAs)). Particularly preferred 5'- cap analogs are those having one or more substitutions at the bridging and non-bridging oxygen in the phosphate bridge, such as phosphoroth ioate modified 5'-cap analogs at the p-phosphate (such as m27'2’°G(5')ppSp(5')G (referred to as beta-S-ARCA or p-S-ARCA)), as described in PCT / EP2019 / 056502. Providing an RNA with a 5'-cap structure as described herein may be achieved by in vitro transcription of a DNA template in presence of a corresponding 5'-cap compound, wherein said 5'-cap structure is co-transcriptionally incorporated into the generated RNA (in particular, mRNA) strand, or the RNA may be generated, for example, by in vitro transcription, and the 5'-cap structure may be attached to the RNA post-transcriptionally using capping enzymes, for example, capping enzymes of vaccinia virus.

[0209] In some embodiments, the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) comprises a 5'-cap structure selected from the group consisting of m27’2'°G(5')ppSp(5’)G (in particular its DI diastereomer), m27-3 OG(5')ppp(5')G, and m27-3'0Gppp(mi2'0)ApG. In some embodiments, RNA comprises m27'2'°G(5')ppSp(5')G (in particular its DI diastereomer) as 5'-cap structure. In some embodiments, RNA comprises m27'3'0Gppp(mi2'0)ApG as 5'-cap structure.

[0210] In some embodiments, the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) comprises a capO, capl, or cap2, preferably capl or cap2. According to the present disclosure, the term "capO" comprises the structure "m7GpppN", wherein N is any nucleoside bearing an OH moiety at position 2'. According to the present disclosure, the term "capl" means the structure "m7GpppNm", wherein Nm is any nucleoside bearing an OCH3 moiety at position 2'. According to the present disclosure, the term "cap2" means the structure "m7GpppNmNm", wherein each Nm is independently any nucleoside bearing an OCH3moiety at position 2'.

[0211] The 5'-cap analog beta-S-ARCA (P-S-ARCA) has the following structure:

[0212]

[0213] The "DI diastereomer of beta-S-ARCA" or "beta-S-ARCA(Dl)" is the diastereomer of beta-S-ARCA which elutes first on an HPLC column compared to the D2 diastereomer of beta-S-ARCA (beta-S-ARCA(D2)) and thus exhibits a shorter retention time. The HPLC preferably is an analytical HPLC. In some embodiments, a Supelcosil LC-18-T RP column, preferably of the format: 5 pm, 4.6 x 250 mm is used for separation, whereby a flow rate of 1.3 ml / min can be applied. In some embodiments, a gradient of methanol in ammonium acetate, for example, a 0-25% linear gradient of methanol in 0.05 M ammonium acetate, pH = 5.9, within 15 min is used. UV-detection (VWD) can be performed at 260 nm and fluorescence detection (FLD) can be performed with excitation at 280 nm and detection at 337 nm.

[0214] The 5'-cap analog m27'3''0Gppp(mi2'’°)ApG (also referred to as m27'3'0G(5')ppp(5,)m2'‘°ApG) which is a building block of a capl has the following structure:

[0215] An exemplary capO mRNA comprising p-S-ARCA and mRNA has the following structure:

[0216] An exemplary capO mRNA comprising m27'3'0G(5')ppp(5')G and mRNA has the following structure:

[0217] An exemplary capl mRNA comprising m27'3'0Gppp(mi2’0)ApG and mRNA has the following structure:

[0218] Po / v-A tai!

[0219] As used herein, the term "poly-A tail" or "poly-A sequence" refers to an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3'-end of an RNA (in particular, mRNA) molecule. Poly-A tails or poly-A sequences are known to those of skill in the art and may follow the 3'-UTR in the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein. An uninterrupted poly-A tail is characterized by consecutive adenylate residues. In nature, an uninterrupted poly-A tail is typical. RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) disclosed herein can have a poly-A tail attached to the free 3'-end of the RNA by a template-independent RNA polymerase after transcription or a poly-A tail encoded by DNA and transcribed by a template-dependent RNA polymerase.

[0220] It has been demonstrated that a poly-A tail of about 120 A nucleotides has a beneficial influence on the levels of RNA in transfected eukaryotic cells, as well as on the levels of protein that is translated from an open reading frame that is present upstream (S') of the poly-A tail (Holtkamp eta / ., 2006, Blood, vol. 108, pp. 4009-4017).

[0221] The poly-A tall may be of any length. In some embodiments, a poly-A tail comprises, essentially consists of, or consists of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and, in particular, about 120 A nucleotides. In this context, "essentially consists of means that most nucleotides in the poly-A tail, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly-A tail are A nucleotides, but permits that remaining nucleotides are nucleotides other than A nucleotides, such as U nucleotides (uridylate), G nucleotides (guanylate), or C nucleotides (cytidylate). In this context, "consists of means that all nucleotides in the poly-A tail, i.e., 100% by number of nucleotides in the poly-A tail, are A nucleotides. The term "A nucleotide" or "A" refers to adenylate.

[0222] In some embodiments, a poly-A tail is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand. The DNA sequence encoding a poly-A tail (coding strand) is referred to as poly(A) cassette.

[0223] In some embodiments, the poly(A) cassette present in the coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length. Such a cassette is disclosed in WO 2016 / 005324 Al, hereby incorporated by reference. Any poly(A) cassette disclosed in WO 2016 / 005324 Al may be used in the present disclosure. A poly(A) cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides shows, on DNA level, constant propagation of plasmid DNA in £ coii and is still associated, on RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency is encompassed. Consequently, in some embodiments, the poly-A tail contained in an RNA (in particular, antigen- encoding RNA such as antigen-encoding mRNA) described herein essentially consists of A nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, II). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.

[0224] In some embodiments, the poly(A) tail comprises 30 adenine nucleotides followed by 70 adenine nucleotides, wherein the 30 adenine nucleotides and 70 adenine nucleotides are separated by a linker sequence, e.g., a linker sequence of 10 nucleotides.

[0225] In some embodiments, no nucleotides other than A nucleotides flank a poly-A tail at its 3'-end, i.e., the poly-A tail is not masked or followed at its 3'-end by a nucleotide other than A.

[0226] In some embodiments, a poly-A tail comprises at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, a poly-A tail essentially consists of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, a poly-A tail consists of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, a poly-A tail comprises about 150 nucleotides. In some embodiments, a poly-A tail comprises about 120 nucleotides.

[0227] Untranslated regions (UTR)

[0228] In some embodiments, RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein comprises a 5'-UTR and / or a 3'-UTR.

[0229] The term "untranslated region" or "UTR" relates to a region in a DNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA molecule, such as an mRNA molecule. An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5'-UTR) and / or 3' (downstream) of an open reading frame (3'-UTR). A 5'-UTR, if present, is located at the 5'-end, upstream of the start codon of a protein-encoding region. A 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap. A 3'-UTR, if present, is located at the 3'-end, downstream of the termination codon of a protein- encoding region, but the term "3'-UTR" does generally not include the poly-A sequence. Thus, the 3'-UTR is upstream of the poly-A sequence (if present), e.g., directly adjacent to the poly-A sequence. Incorporation of a 3'- UTR into the 3'-non translated region of an RNA can result in an enhancement in translation efficiency. The 5'-UTRs and / or 3'-UTRs may be autologous or heterologous to the RNA (e.g., mRNA) into which they are introduced. In some embodiments, a 5'-UTR is or comprises a modified human alpha-globin 5'-UTR. In some embodiments, the 3'-UTR is derived from a globin gene or mRNA, such as a gene or mRNA of alpha2-globin, alphal-globin, or beta- globin, e.g., beta-globin, e.g., human beta-globin. In some embodiments, a 3 -UTR comprises a first sequence from the amino terminal enhancer of split (AES) messenger RNA and a second sequence from the mitochondrial encoded 12S ribosomal RNA.

[0230] Chemical modification

[0231] The RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein may have modified ribonucleotides in order to increase its stability and / or decrease immunogenicity and / or decrease cytotoxicity. In some preferred embodiments, the RNA (in particular, antigen-encoding RNA such as antigen- encoding mRNA) described herein has modified ribonucleotides. For example, in some embodiments, uridine is replaced (partially or completely, preferably completely) by a modified nucleoside. In some embodiments, the modified nucleoside is a modified uridine.

[0232] In some embodiments, the modified uridine replacing uridine is selected from the group consisting of pseudouridine (ip), Nl-methyl-pseudouridine (mlip), 5-methyl-uridine (m5U), and combinations thereof.

[0233] In some embodiments, the modified nucleoside replacing (partially or completely, preferably completely) uridine in the RNA may be any one or more of 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), 5-aza-uridine, 6-aza- uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine {e.g., 5-iodo-uridineor 5-bromo-uridine), uridine 5- oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1- carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchmSU), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5- methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5- carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl- 2-thio-uridlne (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (rm5U), 1- taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(Tm5s2U), l-taurinomethyl-4-thio-pseudouridine), 5- methyl-2-thio-uridine (m5s2U), l-methyl-4-thio-pseudouridine (mls4ip), 4-thio-l-methyl-pseudouridine, 3-methyl- pseudouridine (m3ip), 2-thio-l-methyl-pseudouridine, 1-methyl-l-deaza-pseudouridine, 2-thio-l-methyl-l-deaza- pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2- thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy- pseudouridine, 4-methoxy-2-thio-pseudouridine, Nl-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3 ip), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O- dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio-2'-O-methyl-uridine (s2Um), 5- methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5- carboxymethylaminomethyl-2'-0-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), 5-

[0234] (isopentenylaminomethyl)-2'-O-methyl-uridine (lnm5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F- uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, 5-[3-(l-E-propenylamino)uridine, or any other modified uridine known in the art.

[0235] An RNA which is modified by pseudouridine (replacing partially or completely, preferably completely, uridine) is referred to herein as "^-modified", whereas the term "mlUJ-modified" means that the RNA contains N(l)- methylpseudouridine (replacing partially or completely, preferably completely, uridine). Furthermore, the term "m5U-modified" means that the RNA contains 5-methyluridine (replacing partially or completely, preferably completely, uridine). Such 4>- or mlUJ- or m5U-modified RNAs usually exhibit decreased immunogenicity compared to their unmodified forms. In some embodiments, the RNA (in particular, antigen-encoding RNA such as antigen- encoding mRNA) contains N(l)-methylpseudouridine replacing completely uridine.

[0236] Codon optimization and GC enrichment

[0237] The codons of the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein may further be optimized, e.g., to increase the GC content of the RNA and / or to replace codons which are rare in the cell (or subject) in which the peptide or polypeptide of interest is to be expressed by codons which are synonymous frequent codons in said cell (or subject). In some embodiments, the amino acid sequence encoded by the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein is encoded by a coding sequence which is codon-optimized and / or the G / C content of which is increased compared to wild type coding sequence. This also includes embodiments, wherein one or more sequence regions of the coding sequence are codon-optimized and / or increased in the G / C content compared to the corresponding sequence regions of the wild type coding sequence. In some embodiments, the codon-optimization and / or the increase in the G / C content preferably does not change the sequence of the encoded amino acid sequence.

[0238] The term "codon-optimized" refers to the alteration of codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without preferably altering the amino acid sequence encoded by the nucleic acid molecule. Within the context of the present disclosure, coding regions may be codon-optimized for optimal expression in a subject to be treated using the RNA (in particular, antigen-encoding RNA such as antigen- encoding mRNA) described herein. Codon-optimization is based on the finding that the translation efficiency is also determined by a different frequency in the occurrence of tRNAs in cells. Thus, the sequence of RNA may be modified such that codons for which frequently occurring tRNAs are available are inserted in place of "rare codons". In some embodiments, the guanosine / cytosine (G / C) content of the coding region of the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein is increased compared to the G / C content of the corresponding coding sequence of the wild type RNA, wherein the amino acid sequence encoded by the RNA is preferably not modified compared to the amino acid sequence encoded by the wild type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of that RNA. Sequences having an increased G (guanosine) / C (cytosine) content are more stable than sequences having an increased A (adenosine) / U (uracil) content. In respect to the fact that several codons code for one and the same amino acid (so-called degeneration of the genetic code), the most favorable codons for the stability can be determined (so-called alternative codon usage). Depending on the amino acid to be encoded by the RNA, there are various possibilities for modification of the RNA sequence, compared to its wild type sequence. In particular, codons which contain A and / or U nucleotides can be modified by substituting these codons by other codons, which code for the same amino acids but contain no A and / or U or contain a lower content of A and / or U nucleotides.

[0239] In various embodiments, the G / C content of the coding region of the RNA (in particular, antigen-encoding RNA such as antigen-encoding mRNA) described herein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, or even more compared to the G / C content of the coding region of the wild type RNA.

[0240] Reducing immunogenicity of RNA Immunogenicity of RNA described herein may be reduced such that the RNA does not induce a response by the immune system upon administration, e.g., to a mammal, or induces a weaker response than would have been induced by the same RNA that differs only in that it has not been subjected to the modifications and treatments that reduce immunogenicity, i.e., than would have been induced by standard RNA (stdRNA). In certain embodiments, RNA immunogenicity is reduced by incorporating modified nucleosides suppressing RNA-mediated activation of innate immune receptors into the RNA and / or limiting the amount of double-stranded RNA (dsRNA), e.g., by limiting the formation of double-stranded RNA (dsRNA), e.g., during in vitro transcription, and / or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription. In certain embodiments, RNA immunogenicity is reduced by incorporating modified nucleosides suppressing RNA-mediated activation of innate immune receptors into the RNA and / or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription.

[0241] In general, modified nucleosides suppressing RNA-mediated activation of innate immune receptors are incorporated into antigen-encoding RNA such as antigen-encoding mRNA and / or the amount of double-stranded RNA (dsRNA) is limited in antigen-encoding RNA such as antigen-encoding mRNA, e.g., by limiting the formation of double- stranded RNA (dsRNA), e.g., during in vitro transcription, and / or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription. In some embodiments, modified nucleosides suppressing RNA-mediated activation of innate immune receptors are incorporated into antigen-encoding RNA such as antigen-encoding mRNA and the amount of double-stranded RNA (dsRNA) is limited in antigen-encoding RNA such as antigen-encoding mRNA, e.g., by limiting the formation of double-stranded RNA (dsRNA), e.g., during in vitro transcription, and / or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription.

[0242] In some embodiments, the amount of double-stranded RNA (dsRNA) is limited in immunostimulatory RNA, e.g., by limiting the formation of double-stranded RNA (dsRNA), e.g., during in vitro transcription, and / or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription. In general, modified nucleosides suppressing RNA-mediated activation of innate immune receptors are not incorporated into in immunostimulatory RNA. Thus, in general, the uridines in immunostimulatory RNA are not replaced with a nucleoside comprising a modified nucleobase, i.e., in general, immunostimulatory RNA contains unmodified uridines.

[0243] For reducing immunogenicity of RNA by the incorporation of modified nucleosides, any modified nucleoside may be used as long as it lowers or suppresses immunogenicity of the RNA. Particularly preferred are modified nucleosides that suppress RNA-mediated activation of innate immune receptors. In some embodiments, the modified nucleosides comprise a replacement of one or more uridines with a nucleoside comprising a modified nucleobase. In some embodiments, the modified nucleobase is a modified uracil. In some embodiments, the nucleoside comprising a modified nucleobase is selected from the group consisting of 3-methyl-uridine (m3U), 5-methoxy- uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo- uridine or 5-bromo-uridine), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5- carboxymethyl-uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5- carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5- methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl- uridine (mnm5U), 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2- seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine (Tm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(Tm5s2U), 1- taurinomethyl-4-thio-pseudouridine), 5-methyl-2-thio-uridine (m5s2U), l-methyl-4-thio-pseudouridine (m^ip), 4- thio-l-methyl-pseudouridine, 3-methyl-pseudouridine (m3ip), 2-thio-l-methyl-pseudouridine, 1-methyl-l-deaza- pseudouridine, 2-thio-l-methyl-l-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy- uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, Nl-methyl- pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3qj), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio- uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio-2'-O- methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl- uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)-2'-0-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F- uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and 5-[3-(l-E-propenylamino)uridine. In certain embodiments, the nucleoside comprising a modified nucleobase is pseudouridine (ip), Nl-methyl-pseudouridine (mlip) or 5-methyl-uridine (m5U), in particular Nl-methyl-pseudouridine.

[0244] In some embodiments, the replacement of one or more uridines with a nucleoside comprising a modified nucleobase comprises a replacement of at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the uridines.

[0245] During synthesis of mRNA by in vitro transcription (IVT) using T7 RNA polymerase significant amounts of aberrant products, including double-stranded RNA (dsRNA) are produced due to unconventional activity of the enzyme. dsRNA induces inflammatory cytokines and activates effector enzymes leading to protein synthesis inhibition.

[0246] Formation of dsRNA can be limited during synthesis of mRNA by in vitro transcription (IVT). For example, the amount of uridine triphosphate (UTP) may be limited during synthesis, and, optionally, UTP may be added once or several times during synthesis of mRNA. Additionally, or alternatively, DNA template may be used during synthesis which reduces formation of dsRNA. As demonstrated herein, changing the DNA template from linearized plasmid DNA to oligoDNA reduces dsRNA contamination significantly.

[0247] Also, dsRNA can be removed from RNA such as IVT RNA, for example, by ion-pair reversed phase HPLC using a non-porous or porous C-18 polystyrene-divinylbenzene (PS-DVB) matrix. Alternatively, an enzymatic based method using E coii RNaselll that specifically hydrolyzes dsRNA but not ssRNA, thereby eliminating dsRNA contaminants from IVT RNA preparations can be used. Furthermore, dsRNA can be separated from ssRNA by using a cellulose material. In some embodiments, an RNA preparation is contacted with a cellulose material and the ssRNA is separated from the cellulose material under conditions which allow binding of dsRNA to the cellulose material and do not allow binding of ssRNA to the cellulose material. Suitable methods for providing ssRNA are disclosed, for example, in WO 2017 / 182524.

[0248] As the term is used herein, "remove" or "removal" refers to the characteristic of a population of first substances, such as RNA with reduced immunogenicity, being separated from the proximity of a population of second substances, such as dsRNA, wherein the population of first substances is not necessarily devoid of the second substance, and the population of second substances is not necessarily devoid of the first substance. However, a population of first substances characterized by the removal of a population of second substances has a measurably lower content of second substances as compared to the non-separated mixture of first and second substances.

[0249] In some embodiments, the amount of double-stranded RNA (dsRNA) is limited, e.g., dsRNA (especially dsmRNA) is removed from RNA, such that less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.3%, less than 0.1%, less than 0.05%, less than 0.03%, less than 0.01%, less than 0.005%, less than 0.004%, less than 0.003%, less than 0.002%, less than 0.001%, or less than 0.0005% of the RNA in the RNA composition is dsRNA. In some embodiments, the RNA is free or essentially free of dsRNA. In some embodiments, the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) composition comprises a purified preparation of single-stranded nucleoside modified RNA. In some embodiments, the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) composition comprises single-stranded nucleoside modified RNA and is substantially free of double stranded RNA (dsRNA). In some embodiments, the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) composition comprises at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, at least 99.991%, at least 99.992%, , at least 99.993%,, at least 99.994%, at least 99.995%, at least 99.996%, at least 99.997%, or at least 99.998% single stranded nucleoside modified RNA, relative to all other nucleic acid molecules (DNA, dsRNA, etc.).

[0250] In some embodiments, the RNA (especially immunostimulatory RNA) composition is substantially free of double stranded RNA (dsRNA). In some embodiments, in the RNA (especially immunostimulatory RNA) composition, less than 0.1%, less than 0.05%, less than 0.03%, less than 0.01%, less than 0.005%, less than 0.004%, less than 0.003%, less than 0.002%, less than 0.001%, or less than 0.0005% is dsRNA relative to the total amount of RNA in the composition.

[0251] Various methods can be used to determine the amount of dsRNA. For example, a sample may be contacted with dsRNA-specific antibody and the amount of antibody binding to RNA may be taken as a measure for the amount of dsRNA in the sample. A sample containing a known amount of dsRNA may be used as a reference.

[0252] For example, RNA may be spotted onto a membrane, e.g., nylon blotting membrane. The membrane may be blocked, e.g., in TBS-T buffer (20 mM TRIS pH 7.4, 137 mM NaCI, 0.1% (v / v) TWEEN-20) containing 5% (w / v) skim milk powder. For detection of dsRNA, the membrane may be incubated with dsRNA-specific antibody, e.g., dsRNA-specific mouse mAb (English & Scientific Consulting, Szirak, Hungary). After washing, e.g., with TBS-T, the membrane may be incubated with a secondary antibody, e.g., HRP-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, Cat #715-035-150), and the signal provided by the secondary antibody may be detected.

[0253] In some embodiments, the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) is translated in a cell more efficiently than standard RNA with the same sequence. In some embodiments, translation is enhanced by a factor of 2-fold relative to its unmodified counterpart. In some embodiments, translation is enhanced by a 3- fold factor. In some embodiments, translation is enhanced by a 4-fold factor. In some embodiments, translation is enhanced by a 5-fold factor. In some embodiments, translation is enhanced by a 6-fold factor. In some embodiments, translation is enhanced by a 7-fold factor. In some embodiments, translation is enhanced by an 8- fold factor. In some embodiments, translation is enhanced by a 9-fold factor. In some embodiments, translation is enhanced by a 10-fold factor. In some embodiments, translation is enhanced by a 15-fold factor. In some embodiments, translation is enhanced by a 20-fold factor. In some embodiments, translation is enhanced by a 50- fold factor. In some embodiments, translation is enhanced by a 100-fold factor. In some embodiments, translation is enhanced by a 200-fold factor. In some embodiments, translation is enhanced by a 500-fold factor. In some embodiments, translation is enhanced by a 1000-fold factor. In some embodiments, translation is enhanced by a 2000-fold factor. In some embodiments, the factor is 10-1000-fold. In some embodiments, the factor is 10-100- fold. In some embodiments, the factor is 10-200-fold. In some embodiments, the factor is 10-300-fold. In some embodiments, the factor is 10-500-fold. In some embodiments, the factor is 20-1000-fold. In some embodiments, the factor is 30-1000-fold. In some embodiments, the factor is 50-1000-fold. In some embodiments, the factor is 100-1000-fold. In some embodiments, the factor is 200-1000-fold. In some embodiments, translation is enhanced by any other significant amount or range of amounts.

[0254] In some embodiments, the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) exhibits significantly less innate immunogenicity than standard RNA with the same sequence. In some embodiments, the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) exhibits an innate immune response that is 2-fold less than its unmodified counterpart. In some embodiments, innate immunogenicity is reduced by a 3-fold factor. In some embodiments, innate immunogenicity is reduced by a 4-fold factor. In some embodiments, innate immunogenicity is reduced by a 5-fold factor. In some embodiments, innate immunogenicity is reduced by a 6-fold factor. In some embodiments, innate immunogenicity is reduced by a 7-fold factor. In some embodiments, innate immunogenicity is reduced by an 8-fold factor. In some embodiments, innate immunogenicity is reduced by a 9- fold factor. In some embodiments, innate immunogenicity is reduced by a 10-fold factor. In some embodiments, innate immunogenicity is reduced by a 15-fold factor. In some embodiments, innate immunogenicity is reduced by a 20-fold factor. In some embodiments, innate immunogenicity is reduced by a 50-fold factor. In some embodiments, innate immunogenicity is reduced by a 100-fold factor. In some embodiments, innate immunogenicity is reduced by a 200-fold factor. In some embodiments, innate immunogenicity is reduced by a 500-fold factor. In some embodiments, innate immunogenicity is reduced by a 1000-fold factor. In some embodiments, innate immunogenicity is reduced by a 2000-fold factor.

[0255] The term "exhibits significantly less innate immunogenicity" refers to a detectable decrease in innate immunogenicity. In some embodiments, the term refers to a decrease such that an effective amount of RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) can be administered without triggering a detectable innate immune response. In some embodiments, the term refers to a decrease such that the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) can be repeatedly administered without eliciting an innate immune response sufficient to detectably reduce production of the protein encoded by the RNA. In some embodiments, the decrease is such that the RNA (especially antigen-encoding RNA such as antigen-encoding mRNA) can be repeatedly administered without eliciting an innate immune response sufficient to eliminate detectable production of the protein encoded by the RNA.

[0256] "Immunogenicity" is the ability of a foreign substance, such as RNA, to provoke an immune response in the body of a human or other animal. The innate immune system is the component of the immune system that is relatively unspecific and immediate. It is one of two main components of the vertebrate immune system, along with the adaptive immune system.

[0257] Antigen and antigen-coding nucleic acids and use thereof for immunization

[0258] The immunotherapeutic approaches described herein may include immunization (vaccination), e.g., with peptide or protein antigen (native or modified), nucleic acid encoding peptide or protein antigen, recombinant cells encoding peptide or protein antigen, recombinant viruses encoding peptide or protein antigen and antigen presenting cells pulsed with peptide or protein antigen (native or modified) or transfected with nucleic acids encoding peptide or protein antigen. In some embodiments, the immunotherapeutic approaches described herein include immunization with RNA encoding peptide or protein antigen.

[0259] In some embodiments, the immunotherapeutic approaches described herein include immunization (vaccination), with antigen-encoding RNA such as antigen-encoding mRNA. In some embodiments, such RNA comprises a nucleic acid sequence encoding a peptide or polypeptide comprising an amino acid sequence corresponding to a naturally occurring antigen or variant thereof, e.g., a fragment of the naturally occurring antigen. In some embodiments, RNA (in particular, mRNA) encoding an antigen described in the present disclosure is capable of expressing the encoded peptide or polypeptide, in particular if transferred into a cell or subject. Thus, in some embodiments, the RNA (in particular, mRNA) encoding an antigen described in the present disclosure contains a coding sequence or region (open reading frame (ORF)) encoding a peptide or polypeptide comprising an antigenic sequence against which an immune response can be elicited.

[0260] According to the present disclosure, the term "nucleic acid encoding an antigen" includes RNA encoding an antigen and refers to a nucleic acid encoding a peptide or polypeptide comprising an antigenic sequence against which an immune response can be elicited. In some embodiments, eliciting the immune response is beneficial in the prevention and / or treatment of a disease in an individual. In some embodiments, the immune response is directed against a disease-associated antigen, in particular a tumor-associated antigen, or pathogen-associated antigen (such as bacterial, parasitic, or viral antigen). In some embodiments, the antigen provided to a subject according to the disclosure, e.g., encoded by a nucleic acid, i.e., vaccine antigen, comprises an amino acid sequence corresponding to the amino acid sequence of a disease-associated antigen against which an elicited immune response is to be directed, or a variant thereof, or a fragment of the amino acid sequence or variant. Such fragment may comprise one or more epitopes of the disease-associated antigen.

[0261] In some embodiments, antigen-encoding RNA described herein comprises a nucleic acid sequence encoding a peptide or polypeptide comprising an epitope for inducing an Immune response against an antigen, e.g., a disease- associated antigen, in a subject. The "peptide or polypeptide comprising an epitope for inducing an immune response against an antigen in a subject" is also designated herein as "vaccine antigen", or simply "antigen".

[0262] In some embodiments, the RNA encoding the vaccine antigen is expressed in cells of the subject to provide the vaccine antigen. In some embodiments, the vaccine antigen is expressed in antigen-presenting cells (APCs). In some embodiments, expression of the vaccine antigen is at the cell surface. In some embodiments, the vaccine antigen is presented in the context of MHC. In some embodiments, the RNA encoding the vaccine antigen is transiently expressed in cells of the subject. In some embodiments, the RNA encoding the vaccine antigen is administered systemically, e.g., intravenously. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in spleen occurs. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in antigen presenting cells, preferably professional antigen presenting cells occurs. In some embodiments, the antigen presenting cells are selected from the group consisting of dendritic cells, macrophages and B cells. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, no or essentially no expression of the RNA encoding the vaccine antigen in lung and / or liver occurs. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in spleen is at least 5-fold the amount of expression in lung. In some embodiments, the RNA encoding the vaccine antigen is administered intramuscularly.

[0263] The vaccine antigen comprises an epitope for inducing an immune response against an antigen in a subject. Accordingly, the vaccine antigen comprises an antigenic sequence for inducing an immune response against an antigen in a subject. Such antigenic sequence may correspond to a target antigen or disease-associated antigen, e.g., a protein of an infectious agent (e.g., viral or bacterial antigen) or tumor antigen, or may correspond to an immunogenic variant thereof, or an immunogenic fragment of the target antigen or disease-associated antigen or the immunogenic variant thereof. Thus, the antigenic sequence may comprise at least an epitope of a target antigen or disease-associated antigen or an immunogenic variant thereof.

[0264] The antigenic sequences, e.g., epitopes, suitable for use according to the disclosure typically may be derived from a target antigen, i.e., the antigen against which an immune response is to be elicited. For example, the antigenic sequences contained within the vaccine antigen may be a target antigen or a fragment or variant of a target antigen.

[0265] The antigenic sequence or a procession product thereof, e.g., a fragment thereof, may bind to the antigen receptor such as TCR or CAR carried by immune effector cells. In some embodiments, the antigenic sequence is selected from the group consisting of the antigen expressed by a target cell to which the immune effector cells are targeted or a fragment thereof, or a variant of the antigenic sequence or the fragment.

[0266] A vaccine antigen which may be provided to a subject according to the present disclosure by administering RNA encoding the vaccine antigen, preferably results in the induction of an immune response, e.g., in the stimulation, priming and / or expansion of immune effector cells, in the subject being provided the vaccine antigen. Said immune response, e.g., stimulated, primed and / or expanded immune effector cells, is preferably directed against a target antigen, in particular a target antigen expressed by diseased cells, tissues and / or organs, i.e., a disease-associated antigen. Thus, a vaccine antigen may comprise the disease-associated antigen, or a fragment or variant thereof. In some embodiments, such fragment or variant is immunologically equivalent to the disease-associated antigen.

[0267] In the context of the present disclosure, the term "fragment of an antigen" or "variant of an antigen" means an agent which results in the induction of an immune response, e.g., in the stimulation, priming and / or expansion of immune effector cells, which immune response, e.g., stimulated, primed and / or expanded immune effector cells, targets the antigen, i.e., a disease-associated antigen, in particular when presented by diseased cells, tissues and / or organs. Thus, the vaccine antigen may correspond to or may comprise the disease-associated antigen, may correspond to or may comprise a fragment of the disease-associated antigen or may correspond to or may comprise an antigen which is homologous to the disease-associated antigen or a fragment thereof. If the vaccine antigen comprises a fragment of the disease-associated antigen or an amino acid sequence which is homologous to a fragment of the disease-associated antigen said fragment or amino acid sequence may comprise an epitope of the disease-associated antigen to which the antigen receptor of the immune effector cells is targeted or a sequence which is homologous to an epitope of the disease-associated antigen. Thus, according to the disclosure, a vaccine antigen may comprise an immunogenic fragment of a disease-associated antigen or an amino acid sequence being homologous to an immunogenic fragment of a disease-associated antigen.

[0268] An "immunogenic fragment of an antigen" according to the disclosure preferably relates to a fragment of an antigen which is capable of inducing an immune response against, e.g., stimulating, priming and / or expanding immune effector cells carrying an antigen receptor binding to, the antigen or cells expressing the antigen. It is preferred that the vaccine antigen (similar to the disease-associated antigen) provides the relevant epitope for binding by the antigen receptor present on the immune effector cells. In some embodiments, the vaccine antigen or a fragment thereof (similar to the disease-associated antigen) is expressed on the surface of a cell such as an antigen-presenting cell (optionally in the context of MHC) so as to provide the relevant epitope for binding by immune effector cells. The vaccine antigen may be a recombinant antigen.

[0269] In some embodiments of all aspects, the RIMA encoding the vaccine antigen is expressed in cells of a subject to provide the antigen or a procession product thereof for binding by the antigen receptor expressed by immune effector cells, said binding resulting in stimulation, priming and / or expansion of the immune effector cells.

[0270] An "antigen" according to the present disclosure covers any substance that will elicit an immune response and / or any substance against which an immune response or an immune mechanism such as a cellular response and / or humoral response is directed. This also includes situations wherein the antigen is processed into antigen peptides and an immune response or an immune mechanism is directed against one or more antigen peptides, in particular if presented in the context of MHC molecules. In particular, an "antigen" relates to any substance, such as a peptide or polypeptide, that reacts specifically with antibodies or T-lymphocytes (T-cells). The term "antigen" may comprise a molecule that comprises at least one epitope, such as a T cell epitope. In some embodiments, an antigen is a molecule which, optionally after processing, induces an immune reaction, which may be specific for the antigen (including cells expressing the antigen). In some embodiments, an antigen comprises the amino acid sequence of a disease-associated antigen, such as a tumor antigen, a viral antigen, or a bacterial antigen, or the amino acid sequence of an epitope derived from such antigen.

[0271] In some embodiments, an antigen is presented or present on the surface of cells of the immune system such as antigen presenting cells like dendritic cells or macrophages. An antigen or a procession product thereof such as a T cell epitope is in some embodiments bound by an antigen receptor. Accordingly, an antigen or a procession product thereof may react specifically with immune effector cells such as T-lymphocytes (T cells). In some embodiments, an antigen comprises an autoantigen, an immunogenic fragment thereof, or a variant of an autoantigen or an immunogenic fragment thereof.

[0272] The term "autoantigen" or "self-antigen" refers to an antigen which originates from within the body of a subject (Ze., the autoantigen can also be called "autologous antigen") and which produces an abnormally vigorous immune response against this normal part of the body. Such vigorous immune reactions against autoantigens may be the cause of "autoimmune diseases".

[0273] According to the present disclosure, any suitable antigen may be used, which is a candidate for an immune response, wherein the immune response may comprise a humoral or cellular immune response, or both. In the context of some embodiments of the present disclosure, the antigen is presented by a cell, such as by an antigen presenting cell, in the context of MHC molecules, which results in an immune response against the antigen. An antigen may be a product which corresponds to or is derived from a naturally occurring antigen. Such naturally occurring antigens may include or may be derived from allergens, viruses, bacteria, fungi, parasites and other infectious agents and pathogens or an antigen may also be a tumor antigen. According to the present disclosure, an antigen may correspond to a naturally occurring product, for example, a viral protein, or a part thereof.

[0274] The term "disease-associated antigen" is used in its broadest sense to refer to any antigen associated with a disease. A disease-associated antigen is a molecule which contains epitopes that will stimulate a host's immune system to make a cellular antigen-specific immune response and / or a humoral antibody response against the disease. Disease-associated antigens include pathogen-associated antigens, Ze., antigens which are associated with infection by microbes, typically microbial antigens (such as bacterial or viral antigens), or antigens associated with cancer, typically tumors, such as tumor antigens.

[0275] In some embodiments, the antigen is a tumor antigen, Ze., a part of a tumor cell, in particular those which primarily occur intracellularly or as surface antigens of tumor cells. In another embodiment, the antigen is a pathogen-associated antigen, Ze., an antigen derived from a pathogen, e.g., from a virus, bacterium, unicellular organism, or parasite, for example a viral antigen such as viral ribonucleoprotein or coat protein. In some embodiments, the antigen should be presented by MHC molecules which results in modulation, in particular activation of cells of the immune system, such as CD4+ and CD8+ lymphocytes, in particular via the modulation of the activity of a T-cell receptor.

[0276] The term "tumor antigen" or "tumor-associated antigen" refers to a constituent of cancer cells which may be derived from the cytoplasm, the cell surface or the cell nucleus. In particular, it refers to those antigens which are produced intracellularly or as surface antigens on tumor cells. For example, tumor antigens include the carcinoembryonal antigen, al-fetoprotein, isoferritin, and fetal sulphoglycoprotein, a2-H-ferroprotein and y- fetoprotein, as well as various virus tumor antigens. According to some embodiments of the present disclosure, a tumor antigen comprises any antigen which is characteristic for tumors or cancers as well as for tumor or cancer cells with respect to type and / or expression level.

[0277] In some embodiments, a tumor antigen is under normal conditions specifically expressed in a limited number of tissues and / or organs or in specific developmental stages, for example, the tumor antigen may be under normal conditions specifically expressed in stomach tissue, preferably in the gastric mucosa, in reproductive organs, e.g., in testis, in trophoblastic tissue, e.g., in placenta, or in germ line cells, and is expressed or aberrantly expressed in one or more tumor or cancer tissues. Tumor antigens include, for example, differentiation antigens, preferably cell type specific differentiation antigens, i.e., proteins that are under normal conditions specifically expressed in a certain cell type at a certain differentiation stage, cancer / testis antigens, i.e., proteins that are under normal conditions specifically expressed in testis and sometimes in placenta, and germ line specific antigens. A tumor antigen may be a self-protein in a subject. The term "viral antigen" refers to any viral component having antigenic properties, i.e., being able to provoke an immune response in an individual. The viral antigen may be a viral ribonucleoprotein or an envelope protein.

[0278] The term "bacterial antigen" refers to any bacterial component having antigenic properties, i.e. being able to provoke an immune response in an individual. The bacterial antigen may be derived from the cell wall or cytoplasm membrane of the bacterium.

[0279] The term "epitope" refers to an antigenic determinant in a molecule such as an antigen, i.e., to a part in or fragment of the molecule that is recognized by the immune system, for example, that is recognized by antibodies, T cells or B cells, in particular when presented in the context of MHC molecules. An epitope of a protein may comprises a continuous or discontinuous portion of said protein and, e.g., may be between about 5 and about 100, between about 5 and about 50, between about 8 and about 30, or about 10 and about 25 amino acids in length, for example, the epitope may be preferably 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, the epitope in the context of the present disclosure is a T cell epitope.

[0280] Terms such as "epitope", "fragment of an antigen", "immunogenic peptide" and "antigen peptide" are used interchangeably herein and, e.g., may relate to an incomplete representation of an antigen which is, e.g., capable of eliciting an immune response against the antigen or a cell expressing or comprising and presenting the antigen. In some embodiments, the terms relate to an immunogenic portion of an antigen. In some embodiments, it is a portion of an antigen that is recognized (i.e., specifically bound) by a T cell receptor, in particular if presented in the context of MHC molecules. Certain preferred immunogenic portions bind to an MHC class I or class II molecule. The term "epitope" refers to a part or fragment of a molecule such as an antigen that is recognized by the immune system. For example, the epitope may be recognized by T cells, B cells or antibodies. An epitope of an antigen may include a continuous or discontinuous portion of the antigen and may be between about 5 and about 100, such as between about 5 and about 50, between about 8 and about 30, or between about 8 and about 25 amino acids in length, for example, the epitope may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, an epitope is between about 10 and about 25 amino acids in length. The term "epitope" includes T cell epitopes.

[0281] The term "T cell epitope" refers to a part or fragment of a protein that is recognized by a T cell when presented in the context of MHC molecules. The term "major histocompatibility complex" and the abbreviation "MHC" includes MHC class I and MHC class II molecules and relates to a complex of genes which is present in all vertebrates. MHC proteins or molecules are important for signaling between lymphocytes and antigen presenting cells or diseased cells in immune reactions, wherein the MHC proteins or molecules bind peptide epitopes and present them for recognition by T cell receptors on T cells. The proteins encoded by the MHC are expressed on the surface of cells, and display both self-antigens (peptide fragments from the cell itself) and non-self-antigens (e.g., fragments of invading microorganisms) to a T cell. In the case of class I MHC / peptide complexes, the binding peptides are typically about 8 to about 10 amino acids long although longer or shorter peptides may be effective. In the case of class II MHC / peptide complexes, the binding peptides are typically about 10 to about 25 amino acids long and are in particular about 13 to about 18 amino acids long, whereas longer and shorter peptides may be effective.

[0282] The peptide and polypeptide antigen can be 2 to 100 amino acids, including for example, 5 amino acids, 10 amino acids, 15 amino acids, 20 amino acids, 25 amino acids, 30 amino acids, 35 amino acids, 40 amino acids, 45 amino acids, or 50 amino acids in length. In some embodiments, a peptide can be greater than 50 amino acids. In some embodiments, the peptide can be greater than 100 amino acids.

[0283] The peptide or polypeptide antigen can be any peptide or polypeptide that can induce or increase the ability of the immune system to develop antibodies and T cell responses to the peptide or polypeptide. In some embodiments, vaccine antigen, i.e., an antigen whose inoculation into a subject induces an immune response, is recognized by an immune effector cell. In some embodiments, the vaccine antigen if recognized by an immune effector cell is able to induce in the presence of appropriate co-stimulatory signals, stimulation, priming and / or expansion of the immune effector cell carrying an antigen receptor recognizing the vaccine antigen. In the context of the embodiments of the present disclosure, the vaccine antigen may be, e.g., presented or present on the surface of a cell, such as an antigen presenting cell.

[0284] In some embodiments, an antigen is expressed in a diseased cell (such as tumor cell or an infected cell).

[0285] In some embodiments, an antigen is presented by a diseased cell (such as tumor cell or an infected cell). In some embodiments, an antigen receptor is a TCR which binds to an epitope of an antigen presented in the context of MHC. In some embodiments, binding of a TCR when expressed by T cells and / or present on T cells to an antigen presented by cells such as antigen presenting cells results in stimulation, priming and / or expansion of said T cells. In some embodiments, binding of a TCR when expressed by T cells and / or present on T cells to an antigen presented on diseased cells results in cytolysis and / or apoptosis of the diseased cells, wherein said T cells release cytotoxic factors, e.g., perforins and granzymes.

[0286] In some embodiments, an antigen is expressed on the surface of a diseased cell (such as tumor cell or an infected cell). In some embodiments, an antigen receptor is a CAR which binds to an extracellular domain or to an epitope in an extracellular domain of an antigen. In some embodiments, a CAR binds to native epitopes of an antigen present on the surface of living cells. In some embodiments, binding of a CAR when expressed by T cells and / or present on T cells to an antigen present on cells such as antigen presenting cells results in stimulation, priming and / or expansion of said T cells. In some embodiments, binding of a CAR when expressed by T cells and / or present on T cells to an antigen present on diseased cells results in cytolysis and / or apoptosis of the diseased cells, wherein said T cells preferably release cytotoxic factors, e.g., perforins and granzymes.

[0287] According to some embodiments, an amino acid sequence enhancing antigen processing and / or presentation is fused, either directly or through a linker, to an antigenic peptide or polypeptide (antigenic sequence). Accordingly, in some embodiments, the RNA described herein comprises at least one coding region encoding an antigenic peptide or polypeptide and an amino acid sequence enhancing antigen processing and / or presentation.

[0288] Such amino acid sequences enhancing antigen processing and / or presentation are preferably located at the C- terminus of the antigenic peptide or polypeptide (and optionally at the C-terminus of an amino acid sequence which breaks immunological tolerance), without being limited thereto. Amino acid sequences enhancing antigen processing and / or presentation as defined herein preferably improve antigen processing and presentation. In some embodiments, the amino acid sequence enhancing antigen processing and / or presentation as defined herein includes, without being limited thereto, sequences derived from the human MHC class I complex (HLA-B51, haplotype A2, B27 / B51, Cw2 / Cw3). Accordingly, in some embodiments, the RNA described herein comprises at least one coding region encoding an antigenic peptide or polypeptide and an amino acid sequence enhancing antigen processing and / or presentation, said amino acid sequence enhancing antigen processing and / or presentation preferably being fused to the antigenic peptide or polypeptide, more preferably to the C-terminus of the antigenic peptide or polypeptide as described herein.

[0289] Furthermore, a secretory sequence may be fused to the N-terminus of the antigenic peptide or polypeptide.

[0290] Amino acid sequences derived from tetanus toxoid of Clostridium tetani may be employed to overcome self- tolerance mechanisms in order to efficiently mount an immune response to self-antigens by providing T-cell help during priming. According to some embodiments, an amino acid sequence which breaks immunological tolerance is fused, either directly or through a linker to the antigenic peptide or polypeptide. Such amino acid sequences which break immunological tolerance are preferably located at the C-terminus of the antigenic peptide or polypeptide (and optionally at the N-terminus of the amino acid sequence enhancing antigen processing and / or presentation), wherein the amino acid sequence which breaks immunological tolerance and the amino acid sequence enhancing antigen processing and / or presentation may be fused either directly or through a linker, without being limited thereto. Amino acid sequences which break immunological tolerance as defined herein preferably improve T cell responses. In some embodiments, the amino acid sequence which breaks immunological tolerance as defined herein includes, without being limited thereto, sequences derived from tetanus toxoid-derived helper sequences p2 and pl6 (P2P16).

[0291] In some embodiments, an antigen receptor is an antibody or B cell receptor which binds to an epitope in an antigen. In some embodiments, an antibody or B cell receptor binds to native epitopes of an antigen.

[0292] The term "expressed on the cell surface" or "associated with the cell surface" means that a molecule such as an antigen is associated with and located at the plasma membrane of a cell, wherein at least a part of the molecule faces the extracellular space of said cell and is accessible from the outside of said cell, e.g., by antibodies located outside the cell. In this context, a part may be, e.g., at least 4, at least 8, at least 12, or at least 20 amino acids. The association may be direct or indirect. For example, the association may be by one or more transmembrane domains, one or more lipid anchors, or by the interaction with any other protein, lipid, saccharide, or other structure that can be found on the outer leaflet of the plasma membrane of a cell. For example, a molecule associated with the surface of a cell may be a transmembrane protein having an extracellular portion or may be a protein associated with the surface of a cell by interacting with another protein that is a transmembrane protein.

[0293] "Cell surface" or "surface of a cell" is used in accordance with its normal meaning in the art, and thus includes the outside of the cell which is accessible to binding by proteins and other molecules. An antigen is expressed on the surface of cells if it is located at the surface of said cells and is accessible to binding by, e.g., antigen-specific antibodies added to the cells. In some embodiments, an antigen expressed on the surface of cells is an integral membrane protein having an extracellular portion which may be recognized by a CAR.

[0294] The term "extracellular portion" or "exodomain" in the context of the present disclosure refers to a part of a molecule such as a protein that is facing the extracellular space of a cell and preferably is accessible from the outside of said cell, e.g., by binding molecules such as antibodies located outside the cell. In some embodiments, the term refers to one or more extracellular loops or domains or a fragment thereof.

[0295] The terms "T cell" and "T lymphocyte" are used interchangeably herein and include T helper cells (CD4+ T cells) and cytotoxic T cells (CTLs, CD8+ T cells) which comprise cytolytic T cells. The term "antigen-specific T cell" or similar terms relate to a T cell which recognizes the antigen to which the T cell is targeted, in particular when presented on the surface of antigen presenting cells or diseased cells such as cancer cells in the context of MHC molecules and preferably exerts effector functions of T cells. T cells are considered to be specific for antigen if the cells kill target cells expressing an antigen. T cell specificity may be evaluated using any of a variety of standard techniques, for example, within a chromium release assay or proliferation assay. Alternatively, synthesis of lymphokines (such as interferon-y) can be measured.

[0296] In some embodiments, the term "target" shall mean an agent such as a cell or tissue which is a target for an immune response such as a cellular immune response. Targets include cells that present an antigen or an antigen epitope, i.e., a peptide fragment derived from an antigen. In some embodiments, the target cell is a cell expressing an antigen and presenting said antigen with class I MHC.

[0297] "Antigen processing" refers to the degradation of an antigen into processing products which are fragments of said antigen {e.g., the degradation of a polypeptide into peptides) and the association of one or more of these fragments {e.g., via binding) with MHC molecules for presentation by cells, such as antigen-presenting cells to specific T-cells. Antigen-presenting cells can be distinguished in professional antigen presenting cells and non- professional antigen presenting cells. The term "professional antigen presenting cells" relates to antigen presenting cells which constitutively express the Major Histocompatibility Complex class II (MHC class II) molecules required for interaction with naive T cells. If a T cell interacts with the MHC class II molecule complex on the membrane of the antigen presenting cell, the antigen presenting cell produces a co-stimulatory molecule inducing activation of the T cell. Professional antigen presenting cells comprise dendritic cells and macrophages.

[0298] The term "non-professional antigen presenting cells" relates to antigen presenting cells which do not constitutively express MHC class II molecules, but upon stimulation by certain cytokines such as interferon-gamma. Exemplary, non-professional antigen presenting cells include fibroblasts, thymic epithelial cells, thyroid epithelial cells, glial cells, pancreatic beta cells or vascular endothelial cells.

[0299] The term "dendritic cell" (DC) refers to a subtype of phagocytic cells belonging to the class of antigen presenting cells. In some embodiments, dendritic cells are derived from hematopoietic bone marrow progenitor cells. These progenitor cells initially transform into immature dendritic cells. These immature cells are characterized by high phagocytic activity and low T cell activation potential. Immature dendritic cells constantly sample the surrounding environment for pathogens such as viruses and bacteria. Once they have come into contact with a presentable antigen, they become activated into mature dendritic cells and begin to migrate to the spleen or to the lymph node. Immature dendritic cells phagocytose pathogens and degrade their proteins into small pieces and upon maturation present those fragments at their cell surface using MHC molecules. Simultaneously, they upregulate cell-surface receptors that act as co-receptors in T cell activation such as CD80, CD86, and CD40 greatly enhancing their ability to activate T cells. They also upregulate CCR7, a chemotactic receptor that induces the dendritic cell to travel through the blood stream to the spleen or through the lymphatic system to a lymph node. Here they act as antigen-presenting cells and activate helper T cells and killer T cells as well as B cells by presenting them antigens, alongside non-antigen specific co-stimulatory signals. Thus, dendritic cells can actively induce a T cell- or B cell- related immune response. In some embodiments, the dendritic cells are splenic dendritic cells.

[0300] The term "macrophage" refers to a subgroup of phagocytic cells produced by the differentiation of monocytes. Macrophages which are activated by inflammation, immune cytokines or microbial products nonspecifically engulf and kill foreign pathogens within the macrophage by hydrolytic and oxidative attack resulting in degradation of the pathogen. Peptides from degraded proteins are displayed on the macrophage cell surface where they can be recognized by T cells, and they can directly interact with antibodies on the B cell surface, resulting in T and B cell activation and further stimulation of the immune response. Macrophages belong to the class of antigen presenting cells. In some embodiments, the macrophages are splenic macrophages.

[0301] By "antigen-responsive CTL" is meant a CD8+T-cell that is responsive to an antigen or a peptide derived from said antigen, which is presented with class I MHC on the surface of antigen presenting cells.

[0302] According to the disclosure, CTL responsiveness may include sustained calcium flux, cell division, production of cytokines such as IFN-y and TNF-a, up-regulation of activation markers such as CD44 and CD69, and specific cytolytic killing of tumor antigen expressing target cells. CTL responsiveness may also be determined using an artificial reporter that accurately indicates CTL responsiveness.

[0303] "Activation" or "stimulation", as used herein, refers to the state of a cell that has been sufficiently stimulated to induce detectable cellular proliferation, such as an immune effector cell such as T cell. Activation can also be associated with initiation of signaling pathways, induced cytokine production, and detectable effector functions. The term "activated immune effector cells" refers to, among other things, immune effector cells that are undergoing cell division.

[0304] The term "priming" refers to a process wherein an immune effector cell such as a T cell has its first contact with its specific antigen and causes differentiation into effector cells such as effector T cells. The term "expansion" refers to a process wherein a specific entity is multiplied. In some embodiments, the term is used in the context of an immunological response in which immune effector cells are stimulated by an antigen, proliferate, and the specific immune effector cell recognizing said antigen is amplified. In some embodiments, expansion leads to differentiation of the immune effector cells.

[0305] The terms "immune response" and "immune reaction" are used herein interchangeably in their conventional meaning and refer to an integrated bodily response to an antigen and may refer to a cellular immune response, a humoral immune response, or both. According to the disclosure, the term "immune response to" or "immune response against" with respect to an agent such as an antigen, cell or tissue, relates to an immune response such as a cellular response directed against the agent. An immune response may comprise one or more reactions selected from the group consisting of developing antibodies against one or more antigens and expansion of antigen-specific T-lymphocytes, such as CD4+and CD8+T-lymphocytes, e.g. CD8+T-lymphocytes, which may be detected in various proliferation or cytokine production tests in vitro.

[0306] The terms "inducing an immune response" and "eliciting an immune response" and similar terms in the context of the present disclosure refer to the induction of an immune response, such as the induction of a cellular immune response, a humoral immune response, or both. The immune response may be protective / preventive / prophylactic and / or therapeutic. The immune response may be directed against any immunogen or antigen or antigen peptide, such as against a tumor-associated antigen or a pathogen-associated antigen {e.g., an antigen of a virus (such as influenza virus (A, B, or C), CMV or RSV)). "Inducing" in this context may mean that there was no immune response against a particular antigen or pathogen before induction, but it may also mean that there was a certain level of immune response against a particular antigen or pathogen before induction and after induction said immune response is enhanced. Thus, "inducing the immune response" in this context also includes "enhancing the immune response". In some embodiments, after inducing an immune response in an individual, said individual is protected from developing a disease such as an infectious disease or a cancerous disease or the disease condition is ameliorated by inducing an immune response.

[0307] The terms "cellular immune response", "cellular response", "cell-mediated immunity" or similar terms are meant to include a cellular response directed to cells characterized by expression of an antigen and / or presentation of an antigen with class I or class II MHC. The cellular response relates to cells called T cells or T lymphocytes which act as either "helpers" or "killers". The helper T cells (also termed CD4+T cells) play a central role by regulating the immune response and the killer cells (also termed cytotoxic T cells, cytolytic T cells, CD8+T cells or CTLs) kill cells such as diseased cells.

[0308] The term "humoral immune response" refers to a process in living organisms wherein antibodies are produced in response to agents and organisms, which they ultimately neutralize and / or eliminate. The specificity of the antibody response is mediated by T and / or B cells through membrane-associated receptors that bind antigen of a single specificity. Following binding of an appropriate antigen and receipt of various other activating signals, B lymphocytes divide, which produces memory B cells as well as antibody secreting plasma cell clones, each producing antibodies that recognize the identical antigenic epitope as was recognized by its antigen receptor. Memory B lymphocytes remain dormant until they are subsequently activated by their specific antigen. These lymphocytes provide the cellular basis of memory and the resulting escalation in antibody response when re- exposed to a specific antigen.

[0309] The term "antibody" as used herein, refers to an immunoglobulin molecule, which is able to specifically bind to an epitope on an antigen. In particular, the term "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. The term "antibody" includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, chimeric antibodies and combinations of any of the foregoing. Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region (CH). Each light chain is comprised of a light chain variable region (VL) and a light chain constant region (CL). The variable regions and constant regions are also referred to herein as variable domains and constant domains, respectively. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The CDRs of a VH are termed HCDR1, HCDR2 and HCDR3, the CDRs of a VL are termed LCDR1, LCDR2 and LCDR3. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of an antibody comprise the heavy chain constant region (CH) and the light chain constant region (CL), wherein CH can be further subdivided into constant domain CHI, a hinge region, and constant domains CH2 and CH3 (arranged from amino-terminus to carboxy-terminus in the following order: CHI, CH2, CH3). The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. Antibodies may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.

[0310] The term "immunoglobulin" relates to proteins of the immunoglobulin superfamily, such as to antigen receptors such as antibodies or the B cell receptor (BCR). The immunoglobulins are characterized by a structural domain, Ze., the immunoglobulin domain, having a characteristic immunoglobulin (Ig) fold. The term encompasses membrane bound immunoglobulins as well as soluble immunoglobulins. Membrane bound immunoglobulins are also termed surface immunoglobulins or membrane immunoglobulins, which are generally part of the BCR. Soluble immunoglobulins are generally termed antibodies. Immunoglobulins generally comprise several chains, typically two identical heavy chains and two identical light chains which are linked via disulfide bonds. These chains are primarily composed of immunoglobulin domains, such as the VL (variable light chain) domain, CL (constant light chain) domain, VH(variable heavy chain) domain, and the CH (constant heavy chain) domains CHI, CH2, CH3, and CH4. There are five types of mammalian immunoglobulin heavy chains, Ze, a, 8, e, y, and p which account for the different classes of antibodies, Ze, IgA, IgD, IgE, IgG, and IgM. As opposed to the heavy chains of soluble immunoglobulins, the heavy chains of membrane or surface immunoglobulins comprise a transmembrane domain and a short cytoplasmic domain at their carboxy-terminus. In mammals there are two types of light chains, Ze, lambda and kappa. The immunoglobulin chains comprise a variable region and a constant region. The constant region is essentially conserved within the different isotypes of the immunoglobulins, wherein the variable part is highly divers and accounts for antigen recognition.

[0311] The terms "vaccination" and "immunization" describe the process of treating an individual for therapeutic or prophylactic reasons and relate to the procedure of administering one or more immunogen(s) or antigen(s) or derivatives thereof, in particular in the form of RNA (especially mRNA) coding therefor, as described herein to an individual and stimulating an immune response against said one or more immunogen(s) or antigen(s) or cells characterized by presentation of said one or more immunogen(s) or antigen(s).

[0312] By "cell characterized by presentation of an antigen" or "cell presenting an antigen" or "MHC molecules which present an antigen on the surface of an antigen presenting cell" or similar expressions is meant a cell such as a diseased cell, in particular a tumor cell or an infected cell, or an antigen presenting cell presenting the antigen or an antigen peptide, either directly or following processing, in the context of MHC molecules, such as MHC class I and / or MHC class II molecules. In some embodiments, the MHC molecules are MHC class I molecules. In some embodiments, a peptide or polypeptide used for vaccination which may be nucleic acid-encoded comprises one or more antigens or one or more epitopes, i.e., administration of the peptide or polypeptide to a subject elicits an immune response against the one or more antigens or one or more epitopes in a subject which may be therapeutic or partially or fully protective. In some embodiments, the peptide or polypeptide used for vaccination comprises at least one epitope, e.g., at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes.

[0313] In some embodiments, the target antigen is a tumor antigen and the antigenic sequence (e.g., an epitope) is derived from the tumor antigen. The tumor antigen may be a "standard" antigen, which is generally known to be expressed in various cancers. The tumor antigen may also be a "neo-antigen", which is specific to an individual's tumor and has not been previously recognized by the immune system. A neo-antigen or neo-epitope may result from one or more cancer-specific mutations in the genome of cancer cells resulting in amino acid changes. If the tumor antigen is a neo-antigen, the vaccine antigen preferably comprises an epitope or a fragment of said neo- antigen comprising one or more amino acid changes.

[0314] Examples of tumor antigens include, without limitation, p53, ART-4, BAGE, beta-catenin / m, Bcr-abL CAMEL, CAP-1 , CASP-8, CDC27 / m, CDK4 / m, CEA, the cell surface proteins of the claudin family, such as CLAUDIN-6, CLAUDIN- 18.2 and CLAUDIN-12, c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, Gap 100, HAGE, HER- 2 / neu, HPV-E7, HPV-E6, HAST-2, hTERT (or hTRT), LAGE, LDLR / FUT, MAGE-A, preferably MAGE-A1 , MAGE-A2, MAGE- A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A 10, MAGE-A 1 1, or MAGE- A12, MAGE-B, MAGE-C, MART- 1 / Melan-A, MC1R, Myosin / m, MUC1, MUM-1, MUM-2, MUM-3, NA88-A, NF1 , NY- ESO-1 , NY-BR-1 , pl90 minor BCR-abL, Pml / RARa, PRAME, proteinase 3, PSA, PSM, RAGE, RU1 or RU2, SAGE, SART-1 or SART-3, SCGB3A2, SCP1 , SCP2, SCP3, SSX, SURVIVIN, TEL / AML1 , TPI / m, TRP-1 , TRP-2, TRP-2 / INT2, TPTE, WT, and WT-1.

[0315] Cancer mutations vary with each individual. Thus, cancer mutations that encode novel epitopes (neo-epitopes) represent attractive targets in the development of vaccine compositions and immunotherapies. The efficacy of tumor immunotherapy relies on the selection of cancer-specific antigens and epitopes capable of inducing a potent immune response within a host. RNA can be used to deliver patient-specific tumor epitopes to a patient. Dendritic cells (DCs) residing in the spleen represent antigen-presenting cells of particular interest for RNA expression of immunogenic epitopes or antigens such as tumor epitopes. The use of multiple epitopes has been shown to promote therapeutic efficacy in tumor vaccine compositions. Rapid sequencing of the tumor mutanome may provide multiple epitopes for individualized vaccines which can be encoded by RNA (in particular, mRNA) described herein, e.g., as a single polypeptide wherein the epitopes are optionally separated by linkers. In some embodiments of the present disclosure, the RNA (in particular, mRNA) encodes at least one epitope, at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes. Exemplary embodiments include RNA (in particular, mRNA) that encodes at least five epitopes (termed a "pentatope") and RNA (in particular, mRNA) that encodes at least ten epitopes (termed a "decatope").

[0316] In some embodiments, the antigen or epitope is derived from a pathogen-associated antigen, in particular from a viral antigen.

[0317] In some embodiments, the antigen or epitope is derived from a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus protein or the immunogenic variant thereof. Thus, in some embodiments, the RNA, e.g., mRNA, used in the present disclosure encodes an amino acid sequence comprising a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus protein or the immunogenic variant thereof. In some embodiments, the antigen or epitope is derived from a coronavirus S protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus S protein or the immunogenic variant thereof. Thus, in some embodiments, the RNA (in particular, mRNA) described in the present disclosure encodes an amino acid sequence comprising a coronavirus S protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus S protein or the immunogenic variant thereof. In some embodiments, the coronavirus is MERS-CoV. In some embodiments, the coronavirus is SARS-CoV. In some embodiments, the coronavirus is SARS-CoV-2.

[0318] The term "immunologically equivalent" means that the immunologically equivalent molecule such as the immunologically equivalent amino acid sequence exhibits the same or essentially the same immunological properties and / or exerts the same or essentially the same immunological effects, e.g., with respect to the type of the immunological effect. In the context of the present disclosure, the term "immunologically equivalent" is preferably used with respect to the immunological effects or properties of antigens or antigen variants used for immunization. For example, an amino acid sequence is immunologically equivalent to a reference amino acid sequence if said amino acid sequence when exposed to the immune system of a subject induces an immune reaction having a specificity of reacting with the reference amino acid sequence. Thus, in some embodiments, a molecule which is immunologically equivalent to an antigen exhibits the same or essentially the same properties and / or exerts the same or essentially the same effects regarding the stimulation, priming and / or expansion of T cells as the antigen to which the T cells are targeted.

[0319] Immunostimulatory RNA

[0320] The present invention provides compositions comprising an immunostimulatory RNA comprising sequences derived from Influenza A virus nucleoprotein-encoding RNA. In some embodiments, the immunostimulatory RNA described herein comprises the sequence of SEQ ID NO: 1 (aacuucuggaggggugagaauggacgaaaaacaagaauugcuu), or a variant thereof. In some embodiments, the immunostimulatory RNA comprises the sequence of SEQ ID NO: 2 (gggcgaacuaguaacuucuggaggggugagaauggacgaaaaacaagaauugcuucucga), or a variant thereof. In some embodiments, the immunostimulatory RNA comprises the sequence of SEQ ID NO: 3 (gggaacuucuggaggggugagaauggacgaaaaacaagaauugcuu), or a variant thereof. In some embodiments, the immunostimulatory RNA does not encode a peptide or polypeptide. In some embodiments, the immunostimulatory RNA does not comprise a 5'-cap structure and / or a poly(A) tail. In some embodiments, the immunostimulatory RNA is substantially free of double stranded RNA (dsRNA). In some embodiments, in the immunostimulatory RNA less than 0.1%, less than 0.05%, less than 0.03%, less than 0.01%, less than 0.005%, less than 0.004%, less than 0.003%, less than 0.002%, less than 0.001%, less than 0.0005%, less than 0.0004%, less than 0.0003%, less than 0.0002%, or less than 0.0001% is dsRNA relative to the total amount of RNA in the composition. In some embodiments, the immunostimulatory RNA described herein is capable of inducing secretion of Type I interferons such as interferon alpha. In some embodiments, secretion of interferon alpha involves plasmacytoid dendritic cells. In some embodiments, the immunostimulatory RNA described herein does not substantially induce secretion of one or more of tumor necrosis factor alpha, interferon gamma and interleukin 10. In some embodiments, the immunostimulatory RNA described herein is a recombinant molecule. In some embodiments, the immunostimulatory RNA described herein is obtainable by in vitro transcription. In various embodiments, the immunostimulatory RNA described herein has a length of 400 nucleotides or less, 200 nucleotides or less, 100 nucleotides or less, 80 nucleotides or less, or 60 nucleotides or less.

[0321] The term "Influenza A virus nucleoprotein-encoding RNA" relates to RNA encoding the nucleoprotein (NP) or nucleocapsid protein of Influenza A virus. Influenza A viruses have genomes comprising eight segments of RNA encoding 10 identified polypeptides. Nine of these polypeptides are incorporated into virions. Three viral polypeptides are inserted into the lipid envelope: the haemagglutinin (HA) and neuraminidase glycoproteins, involved in cell entry and exit, respectively, and M2, a low abundance ion channel involved in uncoating and HA maturation. Underlying the membrane is the matrix or Ml protein, the major structural component of the virion which is thought to act as an adaptor between the lipid envelope and the internal RNP particles and is probably the driving force behind virus budding. Inside the shell of Ml lie the RNPs: these comprise the genomic RNA segments in association with a trimeric RNA polymerase (PB1, PB2 and PA subunits) and stoichiometric quantities of NP. Also found in the virion are small quantities of the NEP / NS2 polypeptide.

[0322] The compositions comprising an immunostimulatory RNA are useful for stimulating an immune response to an antigen associated with a disease or disorder and thus, for the treatment or prevention of diseases or disorders involving the antigen. In some embodiments, a vaccine antigen or a nucleic acid coding for a vaccine antigen, e.g., RNA coding for a vaccine antigen, is administered in conjunction with a composition comprising an immunostimulatory RNA described herein which enhances the immune response to the antigen and thus, acts as adjuvant.

[0323] As used herein, the term "adjuvant" relates to compounds, which when administered in combination with an antigen to an individual, prolong or enhance or accelerate an immune response. It is assumed that adjuvants exert their biological activity by one or more mechanisms, including an increase of the surface of the antigen, a prolongation of the retention of the antigen in the body, a retardation of the antigen release, targeting of the antigen to macrophages, increase of the uptake of the antigen, enhancement of antigen processing, stimulation of cytokine release, stimulation and activation of immune cells such as B cells, macrophages, dendritic cells, T cells and unspecific activation of immune cells.

[0324] The compositions comprising an immunostimulatory RNA described herein induce or enhance immune responses against an antigen when administered in conjunction with the antigen or a nucleic acid such as RNA encoding the antigen. In some embodiments, the immune response comprises a T cell response and / or a B cell response.

[0325] RNA delivery

[0326] RNA described herein may be delivered for therapeutic applications described herein using any appropriate methods known in the art, including, e.g., delivery mediated by delivery vehicles.

[0327] According to the invention it is preferred to administer antigen-encoding RNA, which may be nucleoside-modified RNA such as 1-methylpseudouridine-modified RNA, and immunostimulatory RNA described herein formulated in carriers or delivery vehicles such as in a nanoparticulate formulation, in particular a lipoplex formulation. Accordingly, antigen-encoding RNA and immunostimulatory RNA described herein may be present formulated in carriers or delivery vehicles such as in nanoparticulates or a nanoparticulate formulation, in particular a lipoplex formulation, as described herein. In some embodiments, antigen-encoding RNA and immunostimulatory RNA described herein may be present co-formulated in carriers or delivery vehicles such as in nanoparticulates or a nanoparticulate formulation, in particular a lipoplex formulation, as described herein.

[0328] In some embodiments, delivery vehicles may be used which deliver antigen-encoding RNA and immunostimulatory RNA to antigen presenting cells such as dendrite cells (DCs) in the spleen after systemic administration. For example, nanoparticulate RNA formulations with defined particle size wherein the net charge of the particles is close to zero or negative, such as electro-neutral or negatively charged lipoplexes from RNA and liposomes, e.g. lipoplexes comprising DOTMA and DOPE or DOTMA and Cholesterol, lead to substantial delivery of RNA to spleen DCs after systemic administration. Particularly preferred according to the invention is a nanoparticulate RNA formulation wherein the charge ratio of positive charges to negative charges in the nanoparticles is 1.4:1 or less and / or the zeta potential of the nanoparticles is 0 or less. In some embodiments, the charge ratio of positive charges to negative charges in the nanoparticles is between 1.4:1 and 1:8, preferably between 1.2:1 and 1:4, e.g. between 1:1 and 1:3 such as between 1:1.2 and 1:2, 1:1.2 and 1: 1.8, 1:1.3 and 1:1.7, in particular between 1:1.4 and 1:1.6, such as about 1:1.5. In some embodiments, the zeta potential of the nanoparticles is -5 or less, -10 or less, -15 or less, -20 or less or -25 or less. In various embodiments, the zeta potential of the nanoparticles is -35 or higher, -30 or higher or -25 or higher. In some embodiments, the nanoparticles have a zeta potential from 0 mV to -50 mV, preferably 0 mV to -40 mV or -10 mV to -30 mV. In some embodiments, the positive charges are contributed by at least one cationic lipid present in the nanoparticles and the negative charges are contributed by the RNA. In some embodiments, the nanoparticles comprises at least one helper lipid. The helper lipid may be a neutral or an anionic lipid.

[0329] In some embodiments, the nanoparticles are lipoplexes comprising DOTMA and DOPE in a molar ratio of 10:0 to 1:9, preferably 8:2 to 3:7, and more preferably of 7:3 to 5:5 and wherein the charge ratio of positive charges in DOTMA to negative charges in the RNA is 1.8:2 to 0.8:2, more preferably 1.6:2 to 1:2, even more preferably 1.4:2 to 1.1:2 and even more preferably about 1.2:2.

[0330] In some embodiments, the nanoparticles are lipoplexes comprising DOTMA and Cholesterol in a molar ratio of 10:0 to 1:9, preferably 8:2 to 3:7, and more preferably of 7:3 to 5:5 and wherein the charge ratio of positive charges in DOTMA to negative charges in the RNA is 1.8:2 to 0.8:2, more preferably 1.6:2 to 1:2, even more preferably 1.4:2 to 1.1:2 and even more preferably about 1.2:2.

[0331] In some embodiments, the nanoparticles are lipoplexes comprising DOTAP and DOPE in a molar ratio of 10:0 to 1:9, preferably 8:2 to 3:7, and more preferably of 7:3 to 5:5 and wherein the charge ratio of positive charges in DOTMA to negative charges in the RNA is 1.8:2 to 0.8:2, more preferably 1.6:2 to 1:2, even more preferably 1.4:2 to 1.1:2 and even more preferably about 1.2:2.

[0332] In some embodiments, the nanoparticles are lipoplexes comprising DOTMA and DOPE in a molar ratio of 2:1 to 1:2, preferably 2:1 to 1:1, and wherein the charge ratio of positive charges in DOTMA to negative charges in the RNA is 1.4:1 or less.

[0333] In some embodiments, the nanoparticles are lipoplexes comprising DOTMA and cholesterol in a molar ratio of 2:1 to 1:2, preferably 2:1 to 1:1, and wherein the charge ratio of positive charges in DOTMA to negative charges in the RNA is 1.4: 1 or less.

[0334] In one embodiment, the nanoparticles are lipoplexes comprising DOTAP and DOPE in a molar ratio of 2:1 to 1:2, preferably 2:1 to 1:1, and wherein the charge ratio of positive charges in DOTAP to negative charges in the RNA is 1.4:1 or less.

[0335] In some embodiments, after administration of the RNA (in particular, mRNA) compositions / formulations described herein, at least a portion of the RNA is delivered to a target cell or target organ. In some embodiments, at least a portion of the RNA is delivered to the cytosol of the target cell. In some embodiments, the antigen-encoding RNA is translated by the target cell to produce the encoded peptide or polypeptide. In some embodiments, the target cell is a cell in the lymph nodes. In some embodiments, the target cell is a spleen cell. In some embodiments, the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen. In some embodiments, the target cell is a dendritic cell in the spleen.

[0336] Some aspects of the disclosure involve the targeted delivery of the RNA disclosed herein to certain cells or tissues. In some embodiments, the disclosure involves targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen. Targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen is in particular preferred if the RNA administered comprises RNA encoding an antigen or epitope for inducing an immune response. In some embodiments, the target cell is a spleen cell. In some embodiments, the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen. In some embodiments, the target cell is a dendritic cell in the spleen. The "lymphatic system" is part of the circulatory system and an important part of the immune system, comprising a network of lymphatic vessels that carry lymph. The lymphatic system consists of lymphatic organs, a conducting network of lymphatic vessels, and the circulating lymph. The primary or central lymphoid organs generate lymphocytes from immature progenitor cells. The thymus and the bone marrow constitute the primary lymphoid organs. Secondary or peripheral lymphoid organs, which include lymph nodes and the spleen, maintain mature naive lymphocytes and initiate an adaptive immune response.

[0337] Delivery vehicles

[0338] To overcome the barriers to safe and effective RNA delivery, RNA may be administered with one or more delivery vehicles that protect the RNA from degradation, maximize delivery to on-target cells and minimize exposure to off- target cells. Such RNA delivery vehicles may complex or encapsulate RNA and include a range of materials, including polymers and lipids. In some embodiments, such RNA delivery vehicles may form particles with RNA.

[0339] RNA, in particular mRNA, described herein may be present in particles comprising (i) the RNA, and (ii) at least one cationic or cationically ionizable compound such as a polymer or lipid complexing the RNA. Electrostatic interactions between positively charged molecules such as polymers and lipids and negatively charged RNA are involved in particle formation. This results in complexation and spontaneous formation of RNA particles.

[0340] Different types of RNA containing particles have been described previously to be suitable for delivery of RNA in particulate form (cf., e.g., Kaczmarek, J. C. et al., 2017, Genome Medicine 9, 60). For non-viral RNA delivery vehicles, nanoparticle encapsulation of RNA physically protects RNA from degradation and, depending on the specific chemistry, can aid in cellular uptake and endosomal escape.

[0341] In the context of the present disclosure, the term "particle" relates to a structured entity formed by molecules or molecule complexes, in particular particle forming compounds. In some embodiments, the particle contains an envelope (e.g., one or more layers or lamellas) made of one or more types of amphiphilic substances (e.g., amphiphilic lipids). In this context, the expression "amphiphilic substance" means that the substance possesses both hydrophilic and lipophilic properties. The envelope may also comprise additional substances (e.g., additional lipids) which do not have to be amphiphilic. Thus, the particle may be a monolameliar or multilamellar structure, wherein the substances constituting the one or more layers or lamellas comprise one or more types of amphiphilic substances (in particular selected from the group consisting of amphiphilic lipids) optionally in combination with additional substances (e.g., additional lipids) which do not have to be amphiphilic. In some embodiments, the term "particle" relates to a micro- or nano-sized structure, such as a micro- or nano-sized compact structure. According to the present disclosure, the term "particle" includes nanoparticles.

[0342] An "RNA particle" can be used to deliver RNA to a target site of interest (e.g., cell, tissue, organ, and the like). An RNA particle may be formed from lipids comprising at least one cationic or cationically ionizable lipid. Without intending to be bound by any theory, it is believed that the cationic or cationically ionizable lipid combines together with the RNA to form aggregates, and this aggregation results in colloidally stable particles.

[0343] RNA particles described herein include lipid nanoparticle (LNP)-based and lipoplex (LPX)-based formulations.

[0344] A lipoplex (LPX) described herein is obtainable from mixing two aqueous phases, namely a phase comprising RNA and a phase comprising a dispersion of lipids. In some embodiments, the lipid phase comprises liposomes.

[0345] In some embodiments, liposomes are self-closed unilamellar or multilamellar vesicular particles wherein the lamellae comprise lipid bilayers and the encapsulated lumen comprises an aqueous phase. A prerequisite for using liposomes for nanoparticle formation is that the lipids in the mixture as required are able to form lamellar (bilayer) phases in the applied aqueous environment.

[0346] In some embodiments, liposomes comprise unilamellar or multilamellar phospholipid bilayers enclosing an aqueous core (also referred to herein as an aqueous lumen). They may be prepared from materials possessing polar head (hydrophilic) groups and nonpolar tail (hydrophobic) groups. In some embodiments, cationic lipids employed in formulating liposomes designed for the delivery of RNA are amphiphilic in nature and consist of a positively charged (cationic) amine head group linked to a hydrocarbon chain or cholesterol derivative via glycerol.

[0347] In some embodiments, lipoplexes are multilamellar liposome-based formulations that form upon electrostatic interaction of cationic liposomes with RNAs. In some embodiments, formed lipoplexes possess distinct internal arrangements of molecules that arise due to the transformation from liposomal structure into compact RNA- lipoplexes.

[0348] In some embodiments, an LPX particle comprises an amphiphilic lipid, in particular cationic or cationically ionizable amphiphilic lipid, and RNA (especially mRNA) as described herein. In some embodiments, electrostatic interactions between positively charged liposomes (made from one or more amphiphilic lipids, in particular cationic or cationically ionizable amphiphilic lipids) and negatively charged RNA (especially mRNA) results in complexation and spontaneous formation of RNA lipoplex particles. Positively charged liposomes may be generally synthesized using a cationic or cationically ionizable amphiphilic lipid, such as DOTMA and / or DODMA, and optionally additional lipids, such as DOPE or DSPC. In some embodiments, an RNA (especially mRNA) lipoplex particle is a nanoparticle.

[0349] In general, a lipid nanoparticle (LNP) is obtainable from direct mixing of RNA in an aqueous phase with lipids in a phase comprising an organic solvent, such as ethanol. In that case, lipids or lipid mixtures can be used for particle formation, which do not form lamellar (bilayer) phases in water.

[0350] In some embodiments, LNPs comprise or consist of a cationic / cationically ionizable lipid and helper lipids such as phospholipids, cholesterol, and / or polymer-conjugated lipids (e.g., polyethylene glycol (PEG) lipids). In some embodiments, in the RNA LNPs described herein the RNA (in particular, mRNA) is bound by cationically ionizable lipid that occupies the central core of the LNP. In some embodiments, polymer-conjugated lipid forms the surface of the LNP, along with phospholipids. In some embodiments, the surface comprises a bilayer. In some embodiments, cholesterol and cationically ionizable lipid in charged and uncharged forms can be distributed throughout the LNP.

[0351] In some embodiments, RNA {e.g., mRNA) described herein may be noncovalently associated with a particle as described herein. In embodiments, the RNA (especially mRNA) may be adhered to the outer surface of the particle (surface RNA (especially surface mRNA)) and / or may be contained in the particle (encapsulated RNA (especially encapsulated mRNA)).

[0352] In some embodiments, the particles (e.g., LNPs and LPXs) described herein have a size (such as a diameter) in the range of about 10 to about 2000 nm, such as at least about 15 nm (e.g., at least about 20 nm, at least about 25 nm, at least about 30 nm, at least about 35 nm, at least about 40 nm, at least about 45 nm, at least about 50 nm, at least about 55 nm, at least about 60 nm, at least about 65 nm, at least about 70 nm, at least about 75 nm, at least about 80 nm, at least about 85 nm, at least about 90 nm, at least about 95 nm, or at least about 100 nm) and / or at most about 1900 nm (e.g., at most about 1800 nm, at most about 1700 nm, at most about 1600 nm, at most about 1500 nm, at most about 1400 nm, at most about 1300 nm, at most about 1200 nm, at most about 1100 nm, at most about 1000 nm, at most about 950 nm, at most about 900 nm, at most about 850 nm, at most about 800 nm, at most about 750 nm, at most about 700 nm, at most about 650 nm, at most about 600 nm, at most about 550 nm, or at most about 500 nm), such as in the range of about 20 to about 1500 nm, such as about 30 to about 1200 nm, about 40 to about 1100 nm, about 50 to about 1000 nm, about 60 to about 900 nm, about 70 to about 800 nm, about 80 to about 700 nm, about 90 to about 600 nm, or about 50 to about 500 nm or about 100 to about 500 nm, such as in the range of 10 to 1000 nm, 15 to 500 nm, 20 to 450 nm, 25 to 400 nm, 30 to 350 nm, 40 to 300 nm, 50 to 250 nm, 60 to 200 nm, 70 to 150 nm, or 80 to 150 nm. In some embodiments, the particles (e.g., LNPs and LPXs) described herein have a size (such as a diameter) in the range of from about 40 nm to about 200 nm, such as from about 50 nm to about 180 nm, from about 60 nm to about 160 nm, from about 80 nm to about 150 nm or from about 80 nm to about 120 nm. In some embodiments, the particles (e.g., LNPs and LPXs) described herein have an average diameter that in some embodiments ranges from about 50 nm to about 1000 nm, from about 50 nm to about 800 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 450 nm, from about 50 nm to about 400 nm, from about 50 nm to about 350 nm, from about 50 nm to about 300 nm, from about 50 nm to about 250 nm, from about 50 nm to about 200 nm, from about 100 nm to about 1000 nm, from about 100 nm to about 800 nm, from about 100 nm to about 700 nm, from about 100 nm to about 600 nm, from about 100 nm to about 500 nm, from about 100 nm to about 450 nm, from about 100 nm to about 400 nm, from about 100 nm to about 350 nm, from about 100 nm to about 300 nm, from about 100 nm to about 250 nm, from about 100 nm to about 200 nm, from about 150 nm to about 1000 nm, from about 150 nm to about 800 nm, from about 150 nm to about 700 nm, from about 150 nm to about 600 nm, from about 150 nm to about 500 nm, from about 150 nm to about 450 nm, from about 150 nm to about 400 nm, from about 150 nm to about 350 nm, from about 150 nm to about 300 nm, from about 150 nm to about 250 nm, from about 150 nm to about 200 nm, from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 200 nm to about 700 nm, from about 200 nm to about 600 nm, from about 200 nm to about 500 nm, from about 200 nm to about 450 nm, from about 200 nm to about 400 nm, from about 200 nm to about 350 nm, from about 200 nm to about 300 nm, from about 200 nm to about 250 nm, or from about 80 to about 150 nm. In some embodiments, the particles (e.g., LNPs and LPXs) described herein have an average diameter that in some embodiments ranges from about 40 nm to about 200 nm, such as from about 50 nm to about 180 nm, from about 60 nm to about 160 nm, from about 80 nm to about 150 nm or from about 80 nm to about 120 nm.

[0353] In some embodiments, the particles described herein are nanoparticles. The term "nanoparticle" relates to a nano- sized particle comprising nucleic acid (especially mRNA) as described herein and at least one cationic or cationically ionizable lipid, wherein all three external dimensions of the particle are in the nanoscale, Ze., at least about 1 nm and below about 1000 nm. Preferably, the size of a particle is its diameter.

[0354] RNA particles (especially mRNA particles) described herein may exhibit a polydispersity index (PDI) less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.2, less than about 0.1, or less than about 0.05. By way of example, the RNA particles can exhibit a polydispersity index in a range of about 0.01 to about 0.4 or about 0.1 to about 0.3.

[0355] The N / P ratio gives the ratio of the nitrogen groups in the lipid to the number of phosphate groups in the RNA. It is correlated to the charge ratio, as the nitrogen atoms (depending on the pH) are usually positively charged and the phosphate groups are negatively charged. The N / P ratio, where a charge equilibrium exists, depends on the pH. Lipid formulations are frequently formed at N / P ratios larger than four up to twelve, because positively charged nanoparticles are considered favorable for transfection. In that case, RNA is considered to be completely bound to nanoparticles.

[0356] RNA particles (especially mRNA particles) described herein can be prepared using a wide range of methods that may involve obtaining a colloid from at least one cationic or cationically ionizable lipid and mixing the colloid with RNAto obtain RNA particles.

[0357] The term "colloid" as used herein relates to a type of homogeneous mixture in which dispersed particles do not settle out. The insoluble particles in the mixture are microscopic, with particle sizes between 1 and 1000 nanometers. The mixture may be termed a colloid or a colloidal suspension. Sometimes the term "colloid" only refers to the particles in the mixture and not the entire suspension.

[0358] For the preparation of colloids comprising at least one cationic or cationically ionizable lipid methods are applicable herein that are conventionally used for preparing liposomal vesicles and are appropriately adapted. The most commonly used methods for preparing liposomal vesicles share the following fundamental stages: (i) lipids dissolution in organic solvents, (ii) drying of the resultant solution, and (iii) hydration of dried lipid (using various aqueous media).

[0359] In the film hydration method, lipids are firstly dissolved in a suitable organic solvent, and dried down to yield a thin film at the bottom of the flask. The obtained lipid film is hydrated using an appropriate aqueous medium to produce a liposomal dispersion. Furthermore, an additional downsizing step may be included.

[0360] Reverse phase evaporation is an alternative method to the film hydration for preparing liposomal vesicles that involves formation of a water-in-oil emulsion between an aqueous phase and an organic phase containing lipids. A brief sonication of this mixture is required for system homogenization. The removal of the organic phase under reduced pressure yields a milky gel that turns subsequently into a liposomal suspension.

[0361] The term "ethanol injection technique" refers to a process, in which an ethanol solution comprising lipids is rapidly injected into an aqueous solution through a needle. This action disperses the lipids throughout the solution and promotes lipid structure formation, for example lipid vesicle formation such as liposome formation. Generally, the RNA (especially mRNA) lipoplex particles described herein are obtainable by adding RNA (especially mRNA) to a colloidal liposome dispersion. Using the ethanol injection technique, such colloidal liposome dispersion is, in some embodiments, formed as follows: an ethanol solution comprising lipids, such as cationic or cationically ionizable lipids (like DOTMA and / or DODMA) and additional lipids, is injected into an aqueous solution under stirring. In some embodiments, the RNA (especially mRNA) lipoplex particles described herein are obtainable without a step of extrusion.

[0362] The term "extruding" or "extrusion" refers to the creation of particles having a fixed, cross-sectional profile. In particular, it refers to the downsizing of a particle, whereby the particle is forced through filters with defined pores. Other methods having organic solvent free characteristics may also be used according to the present disclosure for preparing a colloid.

[0363] In some embodiments, LNPs comprise four components: cationically ionizable lipids, neutral lipids such as phospholipids, a steroid such as cholesterol, and a poly er-conjugated lipid. In some embodiments, LNPs may be prepared by mixing lipids dissolved in ethanol rapidly with RNA in an aqueous buffer. While RNA particles described herein may comprise polymer-conjugated lipids such as PEG lipids, provided herein are also RNA particles which do not comprise PEG lipids, or do not comprise any polymer-conjugated lipids.

[0364] In some embodiments, the LNPs comprising RNA and at least one cationic or cationically ionizable lipid described herein are prepared by (a) preparing an RNA solution containing water and a buffering system; (b) preparing an ethanolic solution comprising the cationic or cationically ionizable lipid and, if present, one or more additional lipids; and (c) mixing the RNA solution prepared under (a) with the ethanolic solution prepared under (b), thereby preparing the formulation comprising LNPs. After step (c) one or more steps selected from diluting and filtrating, such as tangential flow filtrating, can follow.

[0365] In some embodiments, the LNPs comprising RNA and at least one cationic or cationically ionizable lipid described herein are prepared by (a7) preparing liposomes or a colloidal preparation of the cationic or cationically ionizable lipid and, if present, one or more additional lipids in an aqueous phase; and (b') preparing an RNA solution containing water and a buffering system; and (o') mixing the liposomes or colloidal preparation prepared under (a*) with the RNA solution prepared under (b*). After step (c') one or more steps selected from diluting and filtrating, such as tangential flow filtrating, can follow.

[0366] The present disclosure describes compositions comprising RNA (especially mRNA) and at least one cationic or cationically ionizable lipid which associates with the RNA to form RNA particles and formulations comprising such particles. The RNA particles may comprise RNA which is complexed in different forms by non-covalent interactions to the particle. The particles described herein are not viral particles, in particular infectious viral particles, i.e., they are not able to virally infect cells. Suitable cationic or cationically ionizable lipids are those that form RNA particles and are included by the term "particle forming components" or "particle forming agents". The term "particle forming components" or "particle forming agents" relates to any components which associate with RNA to form RNA particles. Such components include any component which can be part of RNA particles.

[0367] In some embodiments, RNA particles comprise more than one type of RNA molecules, where the molecular parameters of the RNA molecules may be similar or different from each other, like with respect to molar mass or fundamental structural elements such as molecular architecture, capping, coding regions or other features. In some embodiments, RNA particles comprise antigen-encoding RNA and immunostimulatory RNA within the same particles.

[0368] In particulate formulation, it is possible that each RNA species is separately formulated as an individual particulate formulation. In that case, each individual particulate formulation will comprise one RNA species. The individual particulate formulations may be present as separate entities, e.g. in separate containers. Such formulations are obtainable by providing each RNA species separately (typically each in the form of an RNA-containing solution) together with a particle-forming agent, thereby allowing the formation of particles. Respective particles will contain exclusively the specific RNA species that is being provided when the particles are formed (individual particulate formulations). In some embodiments, a composition such as a pharmaceutical composition comprises more than one individual particle formulation. Respective pharmaceutical compositions are referred to as mixed particulate formulations. Mixed particulate formulations according to the present disclosure are obtainable by forming, separately, individual particulate formulations, followed by a step of mixing of the individual particulate formulations. By the step of mixing, a formulation comprising a mixed population of RNA-containing particles is obtainable. Individual particulate populations may be together in one container, comprising a mixed population of individual particulate formulations. Alternatively, it is possible that all RNA species of the pharmaceutical composition are formulated together as a combined particulate formulation. Such formulations are obtainable by providing a combined formulation (typically combined solution) of all RNA species together with a particle-forming agent, thereby allowing the formation of particles. As opposed to a mixed particulate formulation, a combined particulate formulation will typically comprise particles which comprise more than one RNA species. In a combined particulate composition different RNA species are typically present together in a single particle.

[0369] Polymers

[0370] Given their high degree of chemical flexibility, polymers are commonly used materials for nanopartide-based delivery. Typically, cationic polymers are used to electrostatically condense the negatively charged RNA into nanoparticles. These positively charged groups often consist of amines that change their state of protonation in the pH range between 5.5 and 7.5, thought to lead to an ion imbalance that results in endosomal rupture. Polymers such as poly-L-lysine, polyamidoamine, protamine and polyethyleneimine, as well as naturally occurring polymers such as chitosan have all been applied to nucleic acid delivery and are suitable as cationic polymers herein. In addition, some investigators have synthesized polymers specifically for nucleic acid delivery. Poly(p-amino esters), in particular, have gained widespread use in nucleic acid delivery owing to their ease of synthesis and biodegradability. Such synthetic polymers are also suitable as cationic polymers herein.

[0371] A "polymer," as used herein, is given its ordinary meaning, i.e., a molecular structure comprising one or more repeat units (monomers), connected by covalent bonds. The repeat units can all be identical, or in some cases, there can be more than one type of repeat unit present within the polymer. In some cases, the polymer is biologically derived, i.e., a biopolymer such as a protein. In some cases, additional moieties can also be present in the polymer, for example targeting moieties. If more than one type of repeat unit is present within the polymer, then the polymer is said to be a "copolymer." It is to be understood that the polymer being employed herein can be a copolymer. The repeat units forming the copolymer can be arranged in any fashion. For example, the repeat units can be arranged in a random order, in an alternating order, or as a "block" copolymer, i.e., comprising one or more regions each comprising a first repeat unit (e.g., a first block), and one or more regions each comprising a second repeat unit (e.g., a second block), etc. Block copolymers can have two (a diblock copolymer), three (a triblock copolymer), or more numbers of distinct blocks.

[0372] In certain embodiments, the polymer is biocompatible. Biocompatible polymers are polymers that typically do not result in significant cell death at moderate concentrations. In certain embodiments, the biocompatible polymer is biodegradable, i.e., the polymer is able to degrade, chemically and / or biologically, within a physiological environment, such as within the body.

[0373] In certain embodiments, polymer may be protamine or polyalkyleneimine.

[0374] The term "protamine" refers to any of various strongly basic proteins of relatively low molecular weight that are rich in arginine and are found associated especially with DNA in place of somatic histones in the sperm cells of various animals (as fish). In particular, the term "protamine" refers to proteins found in fish sperm that are strongly basic, are soluble in water, are not coagulated by heat, and yield chiefly arginine upon hydrolysis. In purified form, they are used in a long-acting formulation of insulin and to neutralize the anticoagulant effects of heparin.

[0375] According to the disclosure, the term "protamine" as used herein is meant to comprise any protamine amino acid sequence obtained or derived from natural or biological sources including fragments thereof and multimeric forms of said amino acid sequence or fragment thereof as well as (synthesized) polypeptides which are artificial and specifically designed for specific purposes and cannot be isolated from native or biological sources.

[0376] In some embodiments, the polyalkyleneimine comprises polyethylenimine and / or polypropylenimine, preferably polyethyleneimine. A preferred polyalkyleneimine is polyethyleneimine (PEI). The average molecular weight of PEI is preferably 0.75-102to 107Da, preferably 1000 to 105Da, more preferably 10000 to 40000 Da, more preferably 15000 to 30000 Da, even more preferably 20000 to 25000 Da.

[0377] Preferred according to the disclosure is linear polyalkyleneimine such as linear polyethyleneimine (PEI).

[0378] Cationic polymers (including polycationic polymers) contemplated for use herein include any cationic polymers which are able to electrostatically bind nucleic acid. In some embodiments, cationic polymers contemplated for use herein include any cationic polymers with which nucleic acid can be associated, e.g. by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated.

[0379] Particles described herein may also comprise polymers other than cationic polymers, i.e., non-cationic polymers and / or anionic polymers. Collectively, anionic and neutral polymers are referred to herein as non-cationic polymers.

[0380] Lipids

[0381] The terms "lipid" and "lipid-like material" are broadly defined herein as molecules which comprise one or more hydrophobic moieties or groups and optionally also one or more hydrophilic moieties or groups. Molecules comprising hydrophobic moieties and hydrophilic moieties are also frequently denoted as amphiphiles. Lipids are usually insoluble or poorly soluble in water, but soluble in many organic solvents. In an aqueous environment, the amphiphilic nature allows the molecules to self-assemble into organized structures and different phases. One of those phases consists of lipid bilayers, as they are present in vesicles, multilamellar / unilamellar liposomes, or membranes in an aqueous environment. Hydrophobicity can be conferred by the inclusion of apolar groups that include, but are not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s). The hydrophilic groups may comprise polar and / or charged groups and include carbohydrates, phosphate, carboxylic, sulfate, amino, sulfhydryl, nitro, hydroxyl, and other like groups.

[0382] As used herein, the term "hydrophobic" refers to any a molecule, moiety or group which is substantially immiscible or insoluble in aqueous solution. The term hydrophobic group includes hydrocarbons having at least 6 carbon atoms. The monovalent radical of a hydrocarbon is referred to as hydrocarbyl herein. The hydrophobic group can have functional groups (e.g., ether, ester, halide, etc.) and atoms other than carbon and hydrogen as long as the group satisfies the condition of being substantially immiscible or insoluble in aqueous solution.

[0383] The term "hydrocarbon" includes non-cyclic, e.g., linear (straight) or branched, hydrocarbyl groups, such as alkyl, alkenyl, or alkynyl as defined herein. It should be appreciated that one or more of the hydrogen atoms in alkyl, alkenyl, or alkynyl may be substituted with other atoms, e.g., halogen, oxygen or sulfur. Unless stated otherwise, hydrocarbon groups can also include a cyclic (alkyl, alkenyl or alkynyl) group or an aryl group, provided that the overall polarity of the hydrocarbon remains relatively nonpolar.

[0384] The term "alkyl" refers to a saturated linear or branched monovalent hydrocarbon moiety which may have one to thirty, typically one to twenty, often six to eighteen carbon atoms. Exemplary nonpolar alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, hexyl, decyl, dodecyl, tetradecyl, hexadecyl, octadecyl, and the like.

[0385] The term "alkenyl" refers to a linear or branched monovalent hydrocarbon moiety having at least one carbon- carbon double bond in which the total carbon atoms may be six to thirty, typically six to twenty often six to eighteen. Generally, the maximal number of carbon-carbon double bonds in the alkenyl group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkenyl group by 2 and, if the number of carbon atoms in the alkenyl group is uneven, rounding the result of the division down to the next integer. For example, for an alkenyl group having 9 carbon atoms, the maximum number of carbon-carbon double bonds is 4. Preferably, the alkenyl group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, carbon-carbon double bonds.

[0386] The term "alkynyl" refers to a linear or branched monovalent hydrocarbon moiety having at least one carbon- carbon triple bond in which the total carbon atoms may be six to thirty, typically six to twenty, often six to eighteen. Alkynyl groups can optionally have one or more carbon-carbon double bonds. Generally, the maximal number of carbon-carbon triple bonds in the alkynyl group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkynyl group by 2 and, if the number of carbon atoms in the alkynyl group is uneven, rounding the result of the division down to the next integer. For example, for an alkynyl group having 9 carbon atoms, the maximum number of carbon-carbon triple bonds is 4. Preferably, the alkynyl group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, more preferably 1 or 2 carbon-carbon triple bonds.

[0387] The term "alkylene" refers to a saturated linear or branched divalent hydrocarbon moiety which may have one to thirty, typically two to twenty, often four to twelve carbon atoms. Exemplary nonpolar alkylene groups include, but are not limited to, methylene, ethylene, trimethylene, hexa methylene, decamethylene, dodecamethylene, tetradecamethylene, hexadeca methylene, octadecmethylene, and the like.

[0388] The term "alkenylene" refers to a linear or branched divalent hydrocarbon moiety having at least one carbon- carbon double bond in which the total carbon atoms may be two to thirty, typically two to twenty, often four to twelve. Generally, the maximal number of carbon-carbon double bonds in the alkenylene group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkenylene group by 2 and, if the number of carbon atoms in the alkenylene group is uneven, rounding the result of the division down to the next integer. For example, for an alkenylene group having 9 carbon atoms, the maximum number of carbon-carbon double bonds is 4. Preferably, the alkenylene group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, carbon-carbon double bonds.

[0389] The term "cycloalkyl" represents cyclic non-aromatic versions of "alkyl" and "alkenyl" with preferably 3 to 14 carbon atoms, such as 3 to 12 or 3 to 10 carbon atoms, i.e., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 carbon atoms (such as 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms), more preferably 3 to 7 carbon atoms. Exemplary cycloalkyl groups include cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, cyclononyl, cyclononenyl, cylcodecyl, cylcodecenyl, and adamantyl. The cycloalkyl group may consist of one ring (monocyclic), two rings (bicyclic), or more than two rings (polycyclic).

[0390] The term "aryl" refers to a monoradical of an aromatic cyclic hydrocarbon. Preferably, the aryl group contains 3 to 14 (e.g., 5, 6, 7, 8, 9, or 10, such as 5, 6, or 10) carbon atoms which can be arranged in one ring (e.g., phenyl) or two or more condensed rings (e.g., naphthyl). Exemplary aryl groups include cyclopropenylium, cyclopentadienyl, phenyl, indenyl, naphthyl, azulenyl, fluorenyl, anthryl, and phenanthryl. Preferably, "aryl" refers to a monocyclic ring containing 6 carbon atoms or an aromatic bicyclic ring system containing 10 carbon atoms. Preferred examples are phenyl and naphthyl. Aryl does not encompass fullerenes.

[0391] The term "aromatic" as used in the context of hydrocarbons means that the whole molecule has to be aromatic. For example, if a monocyclic aryl is hydrogenated (either partially or completely) the resulting hydrogenated cyclic structure is classified as cycloalkyl for the purposes of the present disclosure. Likewise, if a bi- or polycyclic aryl (such as naphthyl) is hydrogenated the resulting hydrogenated bi- or polycyclic structure (such as 1,2- dihydronaphthyl) is classified as cycloalkyl for the purposes of the present disclosure (even if one ring, such as in 1,2-dihydronaphthyl, is still aromatic).

[0392] As used herein, the term "amphiphilic" refers to a molecule having both a polar portion and a non-polar portion. Often, an amphiphilic compound has a polar head attached to a long hydrophobic tail. In some embodiments, the polar portion is soluble in water, while the non-polar portion is insoluble in water. In addition, the polar portion may have either a formal positive charge, or a formal negative charge. Alternatively, the polar portion may have both a formal positive and a negative charge, and be a zwitterion or inner salt. For purposes of the disclosure, the amphiphilic compound can be, but is not limited to, one or a plurality of natural or non-natural lipids and lipid-like compounds.

[0393] The term "lipid-like material", "lipid-like compound" or "lipid-like molecule" relates to substances, in particular amphiphilic substances, that structurally and / or functionally relate to lipids but may not be considered as lipids in a strict sense. For example, the term includes compounds that are able to form amphiphilic layers as they are present in vesicles, multilamellar / unilamellar liposomes, or membranes in an aqueous environment and includes surfactants, or synthesized compounds with both hydrophilic and hydrophobic moieties. Generally speaking, the term includes molecules, which comprise hydrophilic and hydrophobic moieties with different structural organization, which may or may not be similar to that of lipids. Examples of lipid-like compounds capable of spontaneous integration into cell membranes include functional lipid constructs such as synthetic function-spacer- lipid constructs (FSL), synthetic function-spacer-sterol constructs (FSS) as well as artificial amphipathic molecules. Lipids comprising two long alkyl chains and a polar head group are generally cylindrical. The area occupied by the two alkyl chains is similar to the area occupied by the polar head group. Such lipids have low solubility as monomers and tend to aggregate into planar bilayers that are water insoluble. Traditional surfactant monomers comprising only one linear alkyl chain and a hydrophilic head group are generally cone shaped. The hydrophilic head group tends to occupy more molecular space than the linear alkyl chain. In some embodiments, surfactants tend to aggregate into spherical or elliptoid micelles that are water soluble. While lipids also have the same general structure as surfactants - a polar hydrophilic head group and a nonpolar hydrophobic tail - lipids differ from surfactants in the shape of the monomers, in the type of aggregates formed in solution, and in the concentration range required for aggregation. As used herein, the term "lipid" is to be construed to cover both lipids and lipid-like materials unless otherwise indicated herein or clearly contradicted by context. Generally, lipids may be divided into eight categories: fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, polyketides (derived from condensation of ketoacyl subunits), sterol lipids and prenol lipids (derived from condensation of isoprene subunits). Although the term "lipid" is sometimes used as a synonym for fats, fats are a subgroup of lipids called triglycerides. Lipids also encompass molecules such as fatty adds and their derivatives (including tri-, di-, monoglycerides, and phospholipids), as well as steroids, Ze., sterol-containing metabolites such as cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'- hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof.

[0394] Fatty acids, or fatty acid residues are a diverse group of molecules made of a hydrocarbon chain that terminates with a carboxylic acid group; this arrangement confers the molecule with a polar, hydrophilic end, and a nonpolar, hydrophobic end that is insoluble in water. The carbon chain, typically between four and 24 carbons long, may be saturated or unsaturated, and may be attached to functional groups containing oxygen, halogens, nitrogen, and sulfur. If a fatty acid contains a double bond, there is the possibility of either a cis or trans geometric isomerism, which significantly affects the molecule's configuration. Cis-double bonds cause the fatty acid chain to bend, an effect that is compounded with more cis double bonds in the chain. Other major lipid classes in the fatty acid category are the fatty esters and fatty amides.

[0395] Glycerolipids are composed of mono-, di-, and tri-substituted glycerols, the best-known being the fatty acid triesters of glycerol, called triglycerides. The word "triacylglycerol" is sometimes used synonymously with "triglyceride". In these compounds, the three hydroxyl groups of glycerol are each esterified, typically by different fatty acids. Additional subclasses of glycerolipids are represented by glycosylglycerols, which are characterized by the presence of one or more sugar residues attached to glycerol via a glycosidic linkage.

[0396] The glycerophospholipids are amphipathic molecules (containing both hydrophobic and hydrophilic regions) that contain a glycerol core linked to two fatty acid-derived "tails" by ester linkages and to one "head" group by a phosphate ester linkage. Examples of glycerophospholipids, usually referred to as phospholipids (though sphingomyelins are also classified as phospholipids) are phosphatidylcholine (also known as PC, GPCho or lecithin), phosphatidylethanolamine (PE or GPEtn) and phosphatidylserine (PS or GPSer).

[0397] Sphingolipids are a complex family of compounds that share a common structural feature, a sphingoid base backbone. The major sphingoid base in mammals is commonly referred to as sphingosine. Ceramides (N-acyl- sphingoid bases) are a major subclass of sphingoid base derivatives with an amide-linked fatty acid. The fatty acids are typically saturated or mono-unsaturated with chain lengths from 16 to 26 carbon atoms. The major phosphosphingolipids of mammals are sphingomyelins (ceramide phosphocholines), whereas insects contain mainly ceramide phosphoethanolamines and fungi have phytoceramide phosphoinositols and mannose-containing headgroups. The glycosphingolipids are a diverse family of molecules composed of one or more sugar residues linked via a glycosidic bond to the sphingoid base. Examples of these are the simple and complex glycosphingolipids such as cerebrosides and gangliosides.

[0398] Sterol lipids, such as cholesterol and its derivatives, or tocopherol and its derivatives, are an important component of membrane lipids, along with the glycerophospholipids and sphingomyelins.

[0399] Saccharolipids describe compounds in which fatty acids are linked directly to a sugar backbone, forming structures that are compatible with membrane bilayers. In the saccharolipids, a monosaccharide substitutes for the glycerol backbone present in glycerolipids and glycerophospholipids. The most familiar saccharolipids are the acylated glucosamine precursors of the Lipid A component of the lipopolysaccharides in Gram-negative bacteria. Typical lipid A molecules are disaccharides of glucosamine, which are derivatized with as many as seven fatty-acyl chains. The minimal lipopolysaccharide required for growth in E. coli is Kdo2-Lipid A, a hexa-acylated disaccharide of glucosamine that is glycosylated with two 3-deoxy-D-manno-octulosonic acid (Kdo) residues. Polyketides are synthesized by polymerization of acetyl and propionyl subunits by classic enzymes as well as iterative and multimodular enzymes that share mechanistic features with the fatty acid synthases. They comprise a large number of secondary metabolites and natural products from animal, plant, bacterial, fungal and marine sources, and have great structural diversity. Many polyketides are cyclic molecules whose backbones are often further modified by glycosylation, methylation, hydroxylation, oxidation, or other processes.

[0400] According to the disclosure, lipids and lipid-like materials may be cationic, anionic or neutral. Neutral lipids or lipid- like materials exist in an uncharged or neutral zwitterionic form at a selected pH.

[0401] Cationic / Cationically ionizable lipids

[0402] In some embodiments, the RNA compositions and formulations and RNA particles described herein comprise at least one cationic or cationically ionizable lipid as particle forming agent. Cationic or cationically ionizable lipids contemplated for use herein include any cationic or cationically ionizable lipids (including lipid-like materials) which are able to electrostatically bind nucleic acid. In some embodiments, cationic or cationically ionizable lipids contemplated for use herein can be associated with nucleic acid, e.g. by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated.

[0403] As used herein, a "cationic lipid" refers to a lipid or lipid-like material having a net positive charge. Cationic lipids bind negatively charged nucleic acid by electrostatic interaction. Generally, cationic lipids possess a lipophilic moiety, such as a sterol, an acyl chain, a diacyl or more acyl chains, and the head group of the lipid typically carries the positive charge.

[0404] In some embodiments, a cationic lipid has a net positive charge only at certain pH, in particular acidic pH, while it has preferably no net positive charge, preferably has no charge, i.e., it is neutral, at a different, preferably higher pH such as physiological pH. This ionizable behavior is thought to enhance efficacy through helping with endosomal escape and reducing toxicity as compared with particles that remain cationic at physiological pH.

[0405] As used herein, a "cationically ionizable lipid" refers to a lipid or lipid-like material which has a net positive charge or is neutral, i.e., which is not permanently cationic. Thus, depending on the pH of the composition in which the cationically ionizable lipid is solved, the cationically ionizable lipid is either positively charged or neutral. For purposes of the present disclosure, cationically ionizable lipids are covered by the term "cationic lipid" unless contradicted by the circumstances.

[0406] In some embodiments, the cationic or cationically ionizable lipid comprises a head group which includes at least one nitrogen atom (N) which is positive charged or capable of being protonated, e.g., under physiological conditions.

[0407] Examples of cationic or cationically ionizable lipids include, but are not limited to N,N-dimethyl-2,3- dioleyloxypropylamine (DODMA), l,2-dioleoyl-3-trimethylammonium propane (DOTAP); l,2-di-O-octadecenyl-3- trimethylammonium propane (DOTMA), 3-(N— (N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethyldioctadecylammonium (DDAB); l,2-dioleoyl-3-dimethylammonium-propane (DODAP); l,2-diacyloxy-3- dimethylammonium propanes; l,2-dialkyloxy-3-dimethylammonium propanes; dioctadecyldimethyl ammonium chloride (DODAC), l,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 2,3-di(tetradecoxy)propyl-(2- hydroxyethyl)-dimethylazanium (DMRIE), l,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2- dimyristoyl-3-trimethylammonium propane (DMTAP), l,2-dioleyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide (DORIE), and 2,3-dioleoyloxy- N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate (DOSPA), l,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), l,2-dilinolenyloxy-N,N- dimethylaminopropane (DLenDMA), dioctadecylamidoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3- beta-oxybutan-4-oxy)-l-(cis,cis-9,12-oc-tadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5-en-3-beta-oxy)-3'- oxapentoxy)-3-dimethyl-l-(cis,cis-9',12'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4- dioleyloxybenzylamine (DMOBA), l,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 2,3-

[0408] Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP), l,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane

[0409] (DLincarbDAP), l,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-dilinoleyl-4- dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane (DLin-K-

[0410] XTC2-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6, 9,28,31- tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), N-(2-Hydroxyethyl)-N,N-dimethyl-2,3- bis(tetradecyloxy)-l-propanaminium bromide (DMRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(cis-9- tetradecenyloxy)-l-propanaminium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(dodecyloxy)-l-propanaminium bromide (GAP-DLRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(tetradecyloxy)-l-propanaminium bromide (GAP-DMRIE), N-(2-Aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)- 1-propanaminium bromide (0AE-DMRIE), N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), 2-({8-[(30)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l- yloxy]propan-l-amine (Octyl-CLinDMA), l,2-dimyristoyl-3-dimethylammonium-propane (DMDAP), l,2-dipalmitoyl-3- dimethylammonium-propane (DPDAP), Nl-[2-((lS)-l-[(3-aminopropyl)amino]-4-[di(3-amino- propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5), l,2-dioleoyl-sn-glycero-3- ethylphosphocholine (DOEPC), 2,3-bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N-dimethylpropan-l-amonium bromide (DLRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-l-aminium bromide (DMORIE), di((Z)-non-2- en-l-yl) 8,8'-((((2(dimethylamino)ethyl)thio)carbonyl)azanediyl)dioctanoate (ATX), N,N-dimethyl-2,3- bis(dodecyloxy)propan-l-amine (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-l-amine (DMDMA), Di((Z)- non-2-en-l-yl)-9-((4-(dimethylaminobutanoyl)oxy)heptadecanedioate (L319), N-Dodecyl-3-((2-dodecylcarbamoyl- ethyl)-{2-[(2-dodecylcarbamoyl-ethyl)-2-{(2-dodecylcarbamoyl-ethyl)-[2-(2-dodecylcarbamoyl-ethylamino)-ethyl]- amino}-ethylamino)propionamide (lipidoid 98N12-5), l-[2-[bis(2-hydroxydodecyl)amino]ethyl-[2-[4-[2-[bis(2 hydroxydodecyl)amino]ethyl]piperazin-l-yl]ethyl]amino]dodecan-2-ol (lipidoid C12-200).

[0411] In some embodiments, the cationic or cationically ionizable lipid is DOTMA. In some embodiments, the cationic or cationically ionizable lipid is DODMA.

[0412] DOTMA is a cationic lipid with a quaternary amine headgroup. The structure of DOTMA may be represented as follows: ci-

[0413] DODMA is an ionizable cationic lipid with a tertiary amine headgroup. The structure of DODMA may be represented as follows:

[0414] In some embodiments, the cationic or cationically ionizable lipid may comprise from about 10 mol % to about 95 mol %, from about 20 mol % to about 95 mol %, from about 20 mol % to about 90 mol %, from about 30 mol % to about 90 mol %, from about 40 mol % to about 90 mol %, or from about 40 mol % to about 80 mol % of the total lipid present in the particle.

[0415] Additionai lipids

[0416] The RNA compositions and formulations and RNA particles described herein may also comprise lipids (including lipid-like materials) other than cationic or cationically ionizable lipids (also collectively referred to herein as cationic lipids), i.e., non-cationic lipids (including non-cationic or non-cationically ionizable lipids or lipid-like materials). Collectively, anionic and neutral lipids or lipid-like materials are referred to herein as non-cationic lipids. Optimizing the formulation of RNA particles by addition of other hydrophobic moieties, such as cholesterol and lipids, in addition to a cationic or cationically ionizable lipid may enhance particle stability and efficacy of RNA delivery.

[0417] One or more additional lipids may or may not affect the overall charge of the RNA particles. In some embodiments, the one or more additional lipids are a non-cationic lipid or lipid-like material. The non-cationic lipid may comprise, e.g., one or more anionic lipids and / or neutral lipids. As used herein, an "anionic lipid" refers to any lipid that is negatively charged at a selected pH. As used herein, a "neutral lipid" refers to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH.

[0418] In some embodiments, the RNA compositions and formulations and RNA particles described herein comprise a cationic or cationically ionizable lipid and one or more additional lipids.

[0419] Without wishing to be bound by theory, the amount of the cationic or cationically ionizable lipid compared to the amount of the one or more additional lipids may affect important RNA particle characteristics, such as charge, particle size, stability, tissue selectivity, and bioactivity of the RNA. Accordingly, in some embodiments, the molar ratio of the cationic or cationically ionizable lipid to the one or more additional lipids is from about 10:0 to about 1:9, about 4: 1 to about 1:2, about 4:1 to about 1:1, about 3:1 to about 1:1, or about 3:1 to about 2:1.

[0420] In some embodiments, the one or more additional lipids comprised in the RNA compositions and formulations and RNA particles described herein comprise one or more of the following: neutral lipids, steroids, and combinations thereof.

[0421] In some embodiments, the one or more additional lipids comprise a neutral lipid which is a phospholipid. In some embodiments, the phospholipid is selected from the group consisting of phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines and sphingomyelins. Specific phospholipids that can be used include, but are not limited to, phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines or sphingomyelin. Such phospholipids include in particular diacylphosphatidylcholines, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipentadecanoylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), diarachidoylphosphatidylcholine (DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), l-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn- glycero-3-phosphocholine (C16 Lyso PC) and phosphatidylethanolamines, in particular diacylphosphatidylethanolamines, such as dioleoylphosphatidylethanolamine (DOPE), distearoyl- phosphatidylethanolamine (DSPE), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl- phosphatidylethanolamine (DMPE), dilauroyl-phosphatidylethanolamine (DLPE), diphytanoyl- phosphatidylethanolamine (DPyPE), l,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPG), 1,2-dipalmitoyl- sn-glycero-3-phospho-(l'-rac-glycerol) (DPPG), l-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), N- palmitoyl-D-erythro-sphingosylphosphorylcholine (SM), and further phosphatidylethanolamine lipids with different hydrophobic chains. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DOPC, DMPC, DPPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC. In some embodiments, the neutral lipid is DOPE.

[0422] In some embodiments, the additional lipid comprises one of the following: (1) a phospholipid, (2) cholesterol or a derivative thereof; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof.

[0423] Thus, in some embodiments, the RNA compositions and formulations and RNA particles described herein comprise (1) a cationic or cationically ionizable lipid, and a phospholipid such as DSPC or DORE or (2) a cationic or cationically ionizable lipid and a phospholipid such as DSPC or DOPE and cholesterol.

[0424] In some embodiments, the RNA particles (especially the particles comprising mRNA) described herein comprise (1) DOTMA and DOPE, (2) DOTMA, DOPE and cholesterol, (3) DODMA and DOPE or (4) DODMA, DOPE and cholesterol.

[0425] DSPC is a neutral phospholipid. The structure of DSPC may be represented as follows:

[0426] The structure of cholesterol may be represented as follows:

[0427] In some embodiments, RNA compositions and formulations and RNA particles described herein do not include a polymer conjugated lipid such as a pegylated lipid. The term "pegylated lipid" refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art.

[0428] In some embodiments, the additional lipid (e.g., one or more phospholipids and / or cholesterol) may comprise from about 0 mol % to about 90 mol %, from about 0 mol % to about 80 mol %, from about 2 mol % to about 80 mol %, from about 5 mol % to about 80 mol %, from about 5 mol % to about 60 mol %, from about 5 mol % to about 50 mol %, from about 7.5 mol % to about 50 mol %, or from about 10 mol % to about 40 mol % of the total lipid present in the particle. In some embodiments, the additional lipid (e.g., one or more phospholipids and / or cholesterol) comprises about 10 mol %, about 15 mol %, or about 20 mol % of the total lipid present in the particle.

[0429] In some embodiments, the additional lipid comprises a mixture of: (i) a phospholipid such as DOPE; and (ii) cholesterol or a derivative thereof. In some embodiments, the molar ratio of the phospholipid such as DOPE to the cholesterol or a derivative thereof is from about 9:0 to about 1:10, about 2:1 to about 1:4, about 1:1 to about 1:4, or about 1:1 to about 1:3.

[0430] Polymer-conjugated lipids In some embodiments, RNA compositions and formulations and RNA particles described herein may comprise at least one polymer-conjugated lipid. A polymer-conjugated lipid is typically a molecule comprising a lipid portion and a polymer portion conjugated thereto. In some embodiments, a polymer-conjugated lipid is a PEG-conjugated lipid, also referred to herein as pegylated lipid or PEG-lipid. The term "pegylated lipid" refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art. In some embodiments, a polymer-conjugated lipid is a polysarcosine-conjugated lipid, also referred to herein as sarcosinylated lipid or pSar-lipid. The term "sarcosinylated lipid" refers to a molecule comprising both a lipid portion and a polysarcosine portion.

[0431] In some embodiments, a polymer-conjugated lipid is designed to sterically stabilize a lipid particle by forming a protective hydrophilic layer that shields the hydrophobic lipid layer. In some embodiments, a polymer-conjugated lipid can reduce its association with serum proteins and / or the resulting uptake by the reticuloendothelial system when such lipid particles are administered in vivo.

[0432] Polyethyleneglycol (PEG)-conjugated lipids

[0433] In some embodiments, RNA compositions / formulations and RNA particles described herein comprise a PEG- conjugated lipid.

[0434] Various PEG-conjugated lipids are known in the art and include, but are not limited to pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O-(2' ,3 '- di(tetradecanoyloxy)propyl-l-O-(<»-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as w-methoxy(polyethoxy)ethyl-N-(2,3- di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(a> methoxy(polyethoxy)ethyl)carbamate, and the like.

[0435] In some embodiments, the PEG-conjugated lipid (pegylated lipid) is DMG-PEG 2000, e.g., having the following structure:

[0436] In some embodiments, the PEG-conjugated lipid (pegylated lipid) has the following structure: wherein n has a mean value ranging from 30 to 60, such as about 50. In some embodiments, the PEG-conjugated lipid (pegylated lipid) is PEG2000-C-DMA which preferably refers to 3-N-[(w-methoxy poly(ethylene glycol)2000)carbamoyl]-l,2-dimyristyloxy-propylamine (MPEG-(2 kDa)-C-DMA) or methoxy-polyethylene glycol-2,3- bis(tetradecyloxy)propylca rba mate (2000) .

[0437] In some embodiments, the pegylated lipid comprises from about 1 mol % to about 10 mol %, preferably from about 1 mol % to about 5 mol %, more preferably from about 1 mol % to about 2.5 mol % of the total lipid present in the RNA compositions / formulations and RNA particles described herein. Embodiments of Lipoplex Partides

[0438] In some embodiments of the present disclosure, the RNA described herein may be present in RNA lipoplex particles.

[0439] Lipoplexes (LPX) are electrostatic complexes which are generally formed by mixing preformed cationic lipid liposomes with anionic RNA. Formed lipoplexes possess distinct internal arrangements of molecules that arise due to the transformation from liposomal structure into compact RNA-lipoplexes.

[0440] In certain embodiments, the RNA lipoplex particles include both a cationic lipid and an additional lipid. In an exemplary embodiment, the cationic lipid is DOTMA and the additional lipid is DOPE.

[0441] In some embodiments, the molar ratio of the at least one cationic lipid to the at least one additional lipid is from about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1. In specific embodiments, the molar ratio may be about 3:1, about 2.75:1, about 2.5:1, about 2.25: 1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1. In an exemplary embodiment, the molar ratio of the at least one cationic lipid to the at least one additional lipid is about 2: 1.

[0442] RNA lipoplex particles described herein have an average diameter that in some embodiments ranges from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 250 to about 700 nm, from about 400 to about 600 nm, from about 300 nm to about 500 nm, or from about 350 nm to about 400 nm. In specific embodiments, the RNA lipoplex particles have an average diameter of about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm. In some embodiments, the RNA lipoplex particles have an average diameter that ranges from about 250 nm to about 700 nm. In some embodiments, the RNA lipoplex particles have an average diameter that ranges from about 300 nm to about 500 nm. In an exemplary embodiment, the RNA lipoplex particles have an average diameter of about 400 nm.

[0443] The RNA lipoplex particles and compositions comprising RNA lipoplex particles described herein are useful for delivery of RNA to a target tissue after parenteral administration, in particular after intravenous administration.

[0444] Spleen targeting RNA lipoplex particles are described in WO 2013 / 143683, herein incorporated by reference. It has been found that RNA lipoplex particles having a net negative charge may be used to preferentially target spleen tissue or spleen cells such as antigen-presenting cells, in particular dendritic cells. Accordingly, following administration of the RNA lipoplex particles, RNA accumulation and / or RNA expression in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for expressing RNA in the spleen. In an embodiment, after administration of the RNA lipoplex particles, no or essentially no RNA accumulation and / or RNA expression in the lung and / or liver occurs. In some embodiments, after administration of the RNA lipoplex particles, RNA accumulation and / or RNA expression in antigen presenting cells, such as professional antigen presenting cells in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for targeting RNA, e.g., RNA encoding an antigen or at least one epitope, to the lymphatic system, in particular secondary lymphoid organs, more specifically spleen. Targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen is in particular preferred if the RNA administered is RNA encoding vaccine antigen. In some embodiments, the target cell is a spleen cell. In some embodiments, the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen. In some embodiments, the target cell is a dendritic cell in the spleen.

[0445] The electric charge of the RNA lipoplex particles of the present disclosure is the sum of the electric charges present in the at least one cationic lipid and the electric charges present in the RNA. The charge ratio is the ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the RNA. The charge ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the RNA is calculated by the following equation: charge ratio= [(cationic lipid concentration (mol)) * (the total number of positive charges in the cationic lipid)] / [(RNA concentration (mol)) * (the total number of negative charges in RNA)]. The concentration of RNA and the at least one cationic lipid amount can be determined using routine methods by one skilled in the art.

[0446] In some embodiments, at physiological pH the charge ratio of positive charges to negative charges in the RNA lipoplex particles is from about 1.6:2 to about 1:2, or about 1.6:2 to about 1.1:2. In specific embodiments, the charge ratio of positive charges to negative charges in the RNA lipoplex particles at physiological pH is about 1.6:2.0, about 1.5:2.0, about 1.4:2.0, about 1.3:2.0, about 1.2:2.0, about 1.1:2.0, or about 1:2.0.

[0447] Embodiments of Lipid nanopartides (LNPs)

[0448] In some embodiments, RNA described herein is present in the form of lipid nanoparticles (LNPs).

[0449] LNPs typically comprise four components: cationically ionizable lipid, neutral lipids such as phospholipids, a steroid such as cholesterol, and a polymer-conjugated lipid such as PEG-lipid. LNPs may be prepared by mixing lipids dissolved in ethanol with RNA in an aqueous buffer.

[0450] In some embodiments, in the RNA LNPs described herein the RNA is bound by cationically ionizable lipid that occupies the central core of the LNP. Polymer-conjugated lipid forms the surface of the LNP, along with phospholipids. In some embodiments, cholesterol and cationically ionizable lipid can be distributed throughout the LNP.

[0451] In some embodiments, the LNP comprises one or more cationically ionizable lipids, and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and polymer-conjugated lipids.

[0452] In some embodiments, the LNP comprises a cationically ionizable lipid, a neutral lipid, a steroid, a polymer- conjugated lipid; and the RNA, encapsulated within or associated with the lipid nanoparticle.

[0453] In some embodiments, the LNP comprises from 35 to 65 mol percent, 40 to 60 mol percent, 40 to 55 mol percent, from 45 to 55 mol percent, or from 45 to 50 mol percent of the cationically ionizable lipid.

[0454] In some embodiments, the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, from 7 to 13 mol percent, or from 9 to 11 mol percent.

[0455] In some embodiments, the steroid is present in a concentration ranging from 30 to 50 mol percent, from 30 to 45 mol percent, from 35 to 45 mol percent or from 35 to 43 mol percent.

[0456] In some embodiments, the LNP comprises from 1 to 10 mol percent, from 1 to 5 mol percent, or from 1 to 2.5 mol percent of the polymer-conjugated lipid.

[0457] In some embodiments, the LNP comprises from 45 to 55 mol percent of a cationically ionizable lipid; from 5 to 15 mol percent of a neutral lipid; from 30 to 45 mol percent of a steroid; from 1 to 5 mol percent of a polymer- conjugated lipid; and the RNA, encapsulated within or associated with the lipid nanoparticle.

[0458] In some embodiments, the mol percent is determined based on total mol of lipid present in the lipid nanoparticle. In some embodiments, the mol percent is determined based on total mol of cationically ionizable lipid, neutral lipid, steroid and polymer-conjugated lipid present in the lipid nanoparticle.

[0459] In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC.

[0460] In some embodiments, the steroid is cholesterol.

[0461] In some embodiments, the polymer conjugated lipid is a pegylated lipid, e.g., a pegylated lipid as described above. Doses

[0462] The term "dose" as used herein refers in general to a "dose amount" which relates to the amount of RNA administered per administration, i.e., per dosing.

[0463] In some embodiments, administration of RNA of the present disclosure may be performed by single administration or boosted by multiple administrations.

[0464] In some embodiments, an amount the RNA described herein from 0.1 pg to 300 pg, 0.5 pg to 200 pg, or 1 pg to 100 pg, such as about 1 pg, about 3 pg, about 10 pg, about 30 pg, about 50 pg, or about 100 pg may be administered per dose.

[0465] In some embodiments, a regimen described herein includes at least one dose. In some embodiments, a regimen includes a first dose and at least one subsequent dose. In some embodiments, a regimen includes a first dose and two subsequent doses. In some embodiments, the first dose is the same amount as at least one subsequent dose. In some embodiments, the first dose is the same amount as all subsequent doses. In some embodiments, the first dose is a different amount as at least one subsequent dose. In some embodiments, the first dose is a different amount than all subsequent doses. In some embodiments, a regimen comprises two doses. In some embodiments, a regimen consists of two doses. In some embodiments, a regimen comprises three doses. In some embodiments, a regimen consists of three doses.

[0466] In some embodiments, the disclosure envisions administration of a single dose. In some embodiments, the disclosure envisions administration of a priming dose followed by one or more booster doses.

[0467] Compositions comprising RNA

[0468] A composition comprising one or more RNAs described herein, e.g., in the form of RNA particles, may comprise salts, buffers, or other components as further described below.

[0469] In some embodiments, a salt for use in the compositions described herein comprises sodium chloride. Without wishing to be bound by theory, sodium chloride functions as an ionic osmolality agent for preconditioning RNA prior to mixing with lipids. In some embodiments, the compositions described herein may comprise alternative organic or inorganic salts. Alternative salts include, without limitation, potassium chloride, dipotassium phosphate, monopotassium phosphate, potassium acetate, potassium bicarbonate, potassium sulfate, disodium phosphate, monosodium phosphate, sodium acetate, sodium bicarbonate, sodium sulfate, lithium chloride, magnesium chloride, magnesium phosphate, calcium chloride, and sodium salts of ethylenediaminetetraacetic acid (EDTA).

[0470] Generally, compositions for storing RNA particles such as for freezing RNA particles comprise low sodium chloride concentrations, or comprises a low ionic strength. In some embodiments, the sodium chloride is at a concentration from 0 mM to about 50 mM, from 0 mM to about 40 mM, or from about 10 mM to about 50 mM.

[0471] According to the present disclosure, the RNA particle compositions described herein have a pH suitable for the stability of the RNA particles and, in particular, for the stability of the RNA. Without wishing to be bound by theory, the use of a buffer system maintains the pH of the particle compositions described herein during manufacturing, storage and use of the compositions. In some embodiments of the present disclosure, the buffer system may comprise a solvent (in particular, water, such as deionized water, in particular water for injection) and a buffering substance. The buffering substance may be selected from 2-[4-(2-hydroxyethyl)piperazin-l-yl]ethanesulfonic acid (HEPES), 2-amino-2-(hydroxymethyl)propane-l,3-diol (Tris), acetate, and histidine. In some embodiments, the buffering substance is HEPES. In some embodiments, the buffering substance is Tris.

[0472] Compositions (in particular, RNA compositions / formulations) described herein may also comprise a cryoprotectant and / or a surfactant as stabilizer to avoid substantial loss of the product quality and, in particular, substantial loss of RNA activity during storage, freezing, and / or lyophilization, for example to reduce or prevent aggregation, particle collapse, RNA degradation and / or other types of damage.

[0473] In some embodiments, the cryoprotectant is a carbohydrate. The term "carbohydrate", as used herein, refers to and encompasses monosaccharides, disaccharides, trisaccharides, oligosaccharides and polysaccharides.

[0474] In some embodiments, the cryoprotectant is a monosaccharide. The term "monosaccharide", as used herein refers to a single carbohydrate unit (e.g., a simple sugar) that cannot be hydrolyzed to simpler carbohydrate units. Exemplary monosaccharide cryoprotectants include glucose, fructose, galactose, xylose, ribose and the like.

[0475] In some embodiments, the cryoprotectant is a disaccharide. The term "disaccharide", as used herein refers to a compound or a chemical moiety formed by 2 monosaccharide units that are bonded together through a glycosidic linkage, for example through 1-4 linkages or 1-6 linkages. A disaccharide may be hydrolyzed into two monosaccharides. Exemplary disaccharide cryoprotectants include sucrose, trehalose, lactose, maltose and the like. In some embodiments, the cryoprotectant is sucrose.

[0476] The term "trisaccharide" means three sugars linked together to form one molecule. Examples of a trisaccharides include raffinose and melezitose.

[0477] In some embodiments, the cryoprotectant is an oligosaccharide. The term "oligosaccharide", as used herein refers to a compound or a chemical moiety formed by 3 to about 15, such as 3 to about 10 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a linear, branched or cyclic structure. Exemplary oligosaccharide cryoprotectants include cyclodextrins, raffinose, melezitose, maltotriose, stachyose, acarbose, and the like. An oligosaccharide can be oxidized or reduced.

[0478] In an embodiment, the cryoprotectant is a cyclic oligosaccharide. The term "cyclic oligosaccharide", as used herein refers to a compound or a chemical moiety formed by 3 to about 15, such as 6, 7, 8, 9, or 10 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a cyclic structure. Exemplary cyclic oligosaccharide cryoprotectants include cyclic oligosaccharides that are discrete compounds, such as a cyclodextrin, p cyclodextrin, or y cyclodextrin.

[0479] Other exemplary cyclic oligosaccharide cryoprotectants include compounds which include a cyclodextrin moiety in a larger molecular structure, such as a polymer that contains a cyclic oligosaccharide moiety. A cyclic oligosaccharide can be oxidized or reduced, for example, oxidized to dicarbonyl forms. The term "cyclodextrin moiety", as used herein refers to cyclodextrin (e.g., an o, p, or y cyclodextrin) radical that is incorporated into, or a part of, a larger molecular structure, such as a polymer. A cyclodextrin moiety can be bonded to one or more other moieties directly, or through an optional linker. A cyclodextrin moiety can be oxidized or reduced, for example, oxidized to dicarbonyl forms.

[0480] Carbohydrate cryoprotectants, e.g., cyclic oligosaccharide cryoprotectants, can be derivatized carbohydrates. For example, in an embodiment, the cryoprotectant is a derivatized cyclic oligosaccharide, e.g., a derivatized cyclodextrin, e.g., 2-hydroxypropyl-p-cyclodextrin, e.g., partially etherified cyclodextrins (e.g., partially etherified p cyclodextrins).

[0481] An exemplary cryoprotectant is a polysaccharide. The term "polysaccharide", as used herein refers to a compound or a chemical moiety formed by at least 16 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a linear, branched or cyclic structure, and includes polymers that comprise polysaccharides as part of their backbone structure. In backbones, the polysaccharide can be linear or cyclic. Exemplary polysaccharide cryoprotectants include glycogen, amylase, cellulose, dextran, maltodextrin and the like.

[0482] In some embodiments, RNA particle compositions may include sucrose. Without wishing to be bound by theory, sucrose functions to promote cryoprotection of the compositions, thereby preventing RNA (especially mRNA) particle aggregation and maintaining chemical and physical stability of the composition. In some embodiments, RNA particle compositions may include alternative cryoprotectants to sucrose. Alternative stabilizers include, without limitation, trehalose and glucose. In a specific embodiment, an alternative stabilizer to sucrose is trehalose or a mixture of sucrose and trehalose.

[0483] A preferred cryoprotectant is selected from the group consisting of sucrose, trehalose, glucose, and a combination thereof, such as a combination of sucrose and trehalose. In a preferred embodiment, the cryoprotectant is sucrose. Some embodiments of the present disclosure contemplate the use of a chelating agent in an RNA composition described herein. Chelating agents refer to chemical compounds that are capable of forming at least two coordinate covalent bonds with a metal ion, thereby generating a stable, water-soluble complex. Without wishing to be bound by theory, chelating agents reduce the concentration of free divalent ions, which may otherwise induce accelerated RNA degradation in the present disclosure. Examples of suitable chelating agents include, without limitation, ethylenediaminetetraacetic acid (EDTA), a salt of EDTA, desferrioxamine B, deferoxamine, dithiocarb sodium, penicillamine, pentetate calcium, a sodium salt of pentetic acid, succimer, trientine, nitrilotriacetic acid, trans- diaminocyclohexanetetraacetic acid (DCTA), diethylenetriaminepentaacetic acid (DTPA), and bis(aminoethyl)glycolether-N,N,N',N'-tetraacetic acid. In some embodiments, the chelating agent is EDTA or a salt of EDTA. In some embodiments, the chelating agent is EDTA disodium dihydrate. In some embodiments, the EDTA is at a concentration from about 0.05 mM to about 5 mN, from about 0.1 mM to about 2.5 mM or from about 0.25 mM to about 1 mM.

[0484] In an alternative embodiment, the RNA particle compositions described herein do not comprise a chelating agent.

[0485] Pharmaceutical compositions

[0486] The agents described herein may be administered in pharmaceutical compositions or medicaments and may be administered in the form of any suitable pharmaceutical composition. In some embodiments, the pharmaceutical composition is for therapeutic or prophylactic treatments, e.g., for use in treating or preventing a disease involving an antigen, such as a cancer disease or an infectious disease.

[0487] The term "pharmaceutical composition" relates to a composition comprising a therapeutically effective agent, preferably together with pharmaceutically acceptable carriers, diluents and / or excipients. Said pharmaceutical composition is useful for treating, preventing, or reducing the severity of a disease by administration of said pharmaceutical composition to a subject.

[0488] The pharmaceutical compositions of the present disclosure may comprise one or more adjuvants or may be administered with one or more adjuvants. The term "adjuvant" relates to a compound which prolongs, enhances or accelerates an immune response. Adjuvants comprise a heterogeneous group of compounds such as oil emulsions {e.g., Freund's adjuvants), mineral compounds (such as alum), bacterial products (such as Bordetella pertussis toxin), or immune-stimulating complexes. Examples of adjuvants include, without limitation, LPS, GP96, CpG oligodeoxynucleotides, growth factors, and cytokines, such as monokines, lymphokines, interleukins, chemokines. The chemokines may be IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, INFa, INF-y, GM-CSF, LT-a. Further known adjuvants are aluminum hydroxide, Freund's adjuvant or oil such as Montanide® ISA51. Other suitable adjuvants for use in the present disclosure include lipopeptides, such as Pam3Cys, as well as lipophilic components, such as saponins, trehalose-6,6-dibehenate (TDB), monophosphoryl lipid-A (MPL), monomycoloyl glycerol (MMG), or glucopyranosyl lipid adjuvant (GLA).

[0489] The pharmaceutical compositions of the present disclosure may be in a storable form {e.g., in a frozen or lyophilized / freeze-dried form) or in a "ready-to-use form" {i.e., in a form which can be immediately administered to a subject, e.g., without any processing such as diluting). Thus, prior to administration of a storable form of a pharmaceutical composition, this storable form has to be processed or transferred into a ready-to-use or administrable form. E.g., a frozen pharmaceutical composition has to be thawed, or a freeze-dried pharmaceutical composition has to be reconstituted, e.g. by using a suitable solvent (e.g., deionized water, such as water for injection) or liquid (e.g., an aqueous solution).

[0490] The pharmaceutical compositions according to the present disclosure are generally applied in a "pharmaceutically effective amount" and in "a pharmaceutically acceptable preparation".

[0491] The term "pharmaceutically acceptable" refers to the non-toxicity of a material which does not interact with the action of the active component of the pharmaceutical composition.

[0492] The term "pharmaceutically effective amount" refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In some embodiments relating to the treatment of a particular disease, the desired reaction may relate to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in some embodiments, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease may also be delay of the onset or a prevention of the onset of said disease or said condition, or symptoms thereof. An effective amount of the pharmaceutical compositions described herein will depend on the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration and similar factors. Accordingly, the doses administered of the pharmaceutical compositions described herein may depend on various of such parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.

[0493] The pharmaceutical compositions of the present disclosure may contain buffers, preservatives, and optionally other therapeutic agents. In some embodiments, the pharmaceutical compositions of the present disclosure comprise one or more pharmaceutically acceptable carriers, diluents and / or excipients.

[0494] Suitable preservatives for use in the pharmaceutical compositions of the present disclosure include, without limitation, benzalkonium chloride, chlorobutanol, paraben and thimerosal.

[0495] The term "excipient" as used herein refers to a substance which may be present in a pharmaceutical composition of the present disclosure but is not an active ingredient. Examples of excipients, include without limitation, carriers, binders, diluents, lubricants, thickeners, surface active agents, preservatives, stabilizers, emulsifiers, buffers, flavoring agents, or colorants

[0496] The term "diluent" relates a diluting and / or thinning agent. Moreover, the term "diluent" includes any one or more of fluid, liquid or solid suspension and / or mixing media. Examples of suitable diluents include ethanol, glycerol and water.

[0497] The term "carrier" refers to a component which may be natural, synthetic, organic, inorganic in which the active component is combined in order to facilitate, enhance or enable administration of the pharmaceutical composition. A carrier as used herein may be one or more compatible solid or liquid fillers, diluents or encapsulating substances, which are suitable for administration to subject. Suitable carriers include, without limitation, sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide / glycolide copolymers or polyoxyethylene / polyoxy- propylene copolymers. In some embodiments, the pharmaceutical composition of the present disclosure includes isotonic saline.

[0498] Pharmaceutically acceptable carriers, excipients or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edit. 1985).

[0499] Pharmaceutical carriers, excipients or diluents can be selected with regard to the intended route of administration and standard pharmaceutical practice.

[0500] In some embodiments, the composition, in particular the pharmaceutical composition, is a vaccine. As used herein, the term "vaccine" relates to a pharmaceutical preparation (pharmaceutical composition) or product that upon administration induces an immune response, which recognizes and attacks a pathogen or a diseased cell such as a cancer cell. A vaccine may be used for the prevention or treatment of a disease. In particular, the term "vaccine" refers to a composition that includes an antigen or a nucleic acid, preferably RNA, encoding an antigen, as defined herein.

[0501] Routes of administration of pharmaceutical compositions

[0502] In some embodiments, the pharmaceutical compositions described herein may be administered intravenously, intraarterially, subcutaneously, intradermally, dermally, intranodally, or intramuscularly. In some embodiments, the pharmaceutical compositions described herein may be administered intramuscularly. In some embodiments, the pharmaceutical composition is formulated for local administration or systemic administration. Systemic administration may include enteral administration, which involves absorption through the gastrointestinal tract, or parenteral administration. As used herein, "parenteral administration" refers to the administration in any manner other than through the gastrointestinal tract, such as by intravenous injection. In some embodiments, the pharmaceutical compositions are formulated for systemic administration. In some embodiments, the systemic administration is by intravenous administration. In some embodiments, the pharmaceutical compositions are formulated for intramuscular administration.

[0503] Use of compositions

[0504] Compositions described herein may be used in the therapeutic or prophylactic treatment of various diseases, in particular diseases in which provision of a vaccine antigen to a subject results in a therapeutic or prophylactic effect, e.g., a disease characterized by the presence of diseased cells expressing an antigen such as cancer diseases or infectious diseases. For example, provision of an antigen or epitope which is derived from a virus may be useful in the treatment of a viral disease caused by said virus. Provision of a tumor antigen or epitope may be useful in the treatment of a cancer disease wherein cancer cells express said tumor antigen.

[0505] The term "disease" (also referred to as "disorder" herein) refers to an abnormal condition that affects the body of an individual. A disease is often construed as a medical condition associated with specific symptoms and signs. A disease may be caused by factors originally from an external source, such as infectious disease, or it may be caused by internal dysfunctions, such as autoimmune diseases. In humans, "disease" is often used more broadly to refer to any condition that causes pain, dysfunction, distress, social problems, or death to the individual afflicted, or similar problems for those in contact with the individual. In this broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, isolated symptoms, deviant behaviors, and atypical variations of structure and function, while in other contexts and for other purposes these may be considered distinguishable categories. Diseases usually affect individuals not only physically, but also emotionally, as contracting and living with many diseases can alter one's perspective on life, and one's personality.

[0506] The term "disease involving an antigen" refers to any disease which implicates an antigen, e.g. a disease which is characterized by the presence of an antigen. The disease involving an antigen can be an infectious disease., or a cancer disease or simply cancer. The antigen may be a disease-associated antigen, such as a tumor-associated antigen, a viral antigen, or a bacterial antigen. In some embodiments, a disease involving an antigen is a disease involving cells expressing an antigen, and preferably presenting the antigen on the cell surface, e.g., in the context of MHC.

[0507] The term "infectious disease" refers to any disease which can be transmitted from individual to individual or from organism to organism, and is caused by a microbial agent (e.g. common cold). Infectious diseases are known in the art and include, for example, a viral disease, a bacterial disease, or a parasitic disease, which diseases are caused by a virus, a bacterium, and a parasite, respectively. In this regard, the infectious disease can be, for example, hepatitis, sexually transmitted diseases (e.g. chlamydia or gonorrhea), tuberculosis, HIV / acquired immune deficiency syndrome (AIDS), diphtheria, hepatitis B, hepatitis C, cholera, severe acute respiratory syndrome (SARS), the bird flu, and influenza.

[0508] The terms "cancer disease" or "cancer" refer to or describe the physiological condition in an individual that is typically characterized by unregulated cell growth. Examples of cancers include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particularly, examples of such cancers include bone cancer, blood cancer lung cancer, liver cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, colon cancer, breast cancer, prostate cancer, uterine cancer, carcinoma of the sexual and reproductive organs, Hodgkin's Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the bladder, cancer of the kidney, renal cell carcinoma, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), neuroectodermal cancer, spinal axis tumors, glioma, meningioma, and pituitary adenoma. The term "cancer" according to the disclosure also comprises cancer metastases.

[0509] In the present context, the term "treatment", "treating" or "therapeutic intervention" relates to the management and care of a subject for the purpose of combating a condition such as a disease. The term is intended to include the full spectrum of treatments for a given condition from which the subject is suffering, such as administration of the therapeutically effective compound to alleviate the symptoms or complications, to delay the progression of the disease, disorder or condition, to alleviate or relief the symptoms and complications, and / or to cure or eliminate the disease, disorder or condition as well as to prevent the condition, wherein prevention is to be understood as the management and care of an individual for the purpose of combating the disease, condition or disorder and includes the administration of the active compounds to prevent the onset of the symptoms or complications.

[0510] The term "therapeutic treatment" relates to any treatment which improves the health status and / or prolongs (increases) the lifespan of an individual. Said treatment may eliminate the disease in an individual, arrest or slow the development of a disease in an individual, inhibit or slow the development of a disease in an individual, decrease the frequency or severity of symptoms in an individual, and / or decrease the recurrence in an individual who currently has or who previously has had a disease.

[0511] The terms "prophylactic treatment" or "preventive treatment" relate to any treatment that is intended to prevent a disease from occurring in an individual. The terms "prophylactic treatment" or "preventive treatment" are used herein interchangeably.

[0512] The terms "individual" and "subject" are used herein interchangeably. They refer to a human or another mammal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate), or any other non-mammal-animal, including birds (chicken), fish or any other animal species that can be afflicted with or is susceptible to a disease (e.g., cancer, infectious diseases) but may or may not have the disease, or may have a need for prophylactic intervention such as vaccination. In many embodiments, the individual is a human being. Unless otherwise stated, the terms "individual" and "subject" do not denote a particular age, and thus encompass adults, elderlies, children, and newborns. In some embodiments of the present disclosure, the "individual" or "subject" is a "patient".

[0513] The term "patient" means an individual or subject for treatment, in particular a diseased individual or subject. In some embodiments, a subject is a mammal. In some embodiments, a mammal is a human.

[0514] In some embodiments of the disclosure, the aim is to induce an immune response in a subject by providing a vaccine.

[0515] A person skilled in the art will know that one of the principles of immunotherapy and vaccination is based on the fact that an immunoprotective reaction to a disease is produced by immunizing a subject with an antigen or an epitope, which is immunologically relevant with respect to the disease to be treated. Accordingly, RNA described herein is applicable for inducing or enhancing an immune response. RNA described herein is thus useful in a prophylactic and / or therapeutic treatment of a disease involving an antigen or epitope.

[0516] In some embodiments of the disclosure, the aim is to provide an immune response against diseased cells expressing an antigen such as cancer cells expressing a tumor antigen, and to treat a disease such as a cancer disease involving cells expressing an antigen such as a tumor antigen.

[0517] In some embodiments of the disclosure, the aim is to treat cancer by vaccination.

[0518] In some embodiments of the disclosure, the aim is to provide an immune response against cancer cells expressing a tumor antigen and to treat a cancer disease involving cells expressing a tumor antigen.

[0519] In some embodiments of the disclosure, the aim is to provide protection against an infectious disease by vaccination.

[0520] Citation of documents and studies referenced herein is not intended as an admission that any of the foregoing is pertinent prior art. All statements as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the contents of these documents.

[0521] The description (including the following examples) is presented to enable a person of ordinary skill in the art to make and use the various embodiments. Descriptions of specific devices, techniques, and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those of ordinary skill in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Thus, the various embodiments are not intended to be limited to the examples described herein and shown, but are to be accorded the scope consistent with the claims.

[0522] The present invention is further illustrated by the following examples which are not be construed as limiting the scope of the invention.

[0523] EXAMPLES

[0524] The techniques and methods used herein are described herein or carried out in a manner known per se and as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. All methods including the use of kits and reagents are carried out according to the manufacturers' information unless specifically indicated.

[0525] Materials and Methods

[0526] Animals

[0527] Female Balb / cJRj and C57BL / 6 Albino mice were purchased from Janvier Laboratories (France) and Envigo (Netherlands), respectively. Mice were 8 to 10 weeks of age at the onsite experiments and were used according to local guidelines. All animals were maintained under pathogen-free conditions. Animal studies were approved by the local regulatory authority (Landesuntersuchungsamt Rheinland-Pfalz).

[0528] In vivo Bioluminescence Measurements

[0529] Mice were injected Intravenously (tail vein) with LPX-formulated luciferase mRNA and, when indicated, with isRNA. In vivo imaging was carried out 6-, 24-, 48-, 72- and 96-hours post-immunization using an IVIS Spectrum analyzer (Spectrum IVIS® System; Perkin Elmer). To visualize translation efficiency mice were intraperitoneally injected with 200 pl L-Luciferin at given time-points. In some experiments, mice were sacrificed 24-hours post-immunization and post-bioluminescence imaging and organs (spleen, lung, liver) removed and ex vivo imaged. Analysis was performed by using Living Image 4.5.6 (PerkinElmer) software.

[0530] In vivo Prime-Boost Experiments

[0531] Mice were injected on day 0 and 7 i.v. with 200 pl LPX. Animals were sacrificed 7 days after the last immunization and spleen and peripheral blood collected. isRNA constructs and in vitro Transcription (IVT)

[0532] Plasmid templates for the in vitro transcription (IVT) of isRNAs were based on the pSTl-A120 vector, which are described elsewhere (Kuhn et al. Gene Ther, 2010. 17(8): p. 961-71) and generation of dsDNA template is described further below. In some cases, hybridized complementary ssDNA oligonucleotides were used as DNA template.

[0533] Briefly, plasmid DNA (pDNA) was amplified in E.Coli (BL21 (DE3)) culture medium (LB medium + 0.025 mg / mL kanamycin) overnight and plasmid DNA isolated using a plasmid extraction kit (Qiagen). Next, plasmid DNA was linearized by Xhol restriction enzyme (20 units / Ipg pDNA; New England BioLabs) for 4 hours at 37°C and 400 RPM (ThermoMixer) and linearized pDNA was purified using carboxylic acid magnetic beads (ThermoFisher 65012). Plasmid DNA solution was supplemented with sodium chloride (final concentration 0.5M), ethanol (48%) and magnetic beads and placed for 10 minutes in a magnetic rack. Excess liquid was removed, and magnetic beads washed in 80% ethanol. After removal of excess liquid, magnetic beads were dried for 10 minutes at room temperature before DNA was eluted by the addition of water and concentration quantified by using a NanoDrop.

[0534] NP71-Seq4 Gl: DNA-template was in vitro transcribed in reaction buffer (7,5mM ATP, CTP, UTP, GTP; IX T7 Transcriptionbuffer; 0,05 U / pl RiboLock; 0,002 U / pl Pyrophosphatase and 20 U / pl T7 RNA polymerase) and incubated for 6 hours at 37°C and 350 RPM (ThermoMixer). Reaction was stopped by the addition of 50U / pl TURBO DNase to digest residual DNA template followed by 0.5M EDTA. NP71-Sea4 G2 + G3: DNA-template was in vitro transcribed using the TranscriptAid T7 High Yield Transcription Kit (ThermoFisher K0441) according to manufacturer's instructions. Briefly, 2,5 - 5 pg template DNA was combined with 4pl 5X TranscriptAid reaction buffer, 8pl ATP / CTP / GTP / UTP mix, 2 pl TranscriptAid Enzyme Mix and water to 20 pl total volume. Reaction mixture as incubated at 37°C for 4 hours and 350 RPM (ThermoMixer).

[0535] IVT RNA was isolated by using carboxylic acid magnetic beads (ThermoFisher 65012) as described above. ssDNA Oligonucleotide Hybridization

[0536] Complementary ssDNA oligonucleotides were hybridized by PCR reaction. PCR was performed in 20pl reaction buffer containing Ipl (lOOpM) of sense and anti-sense oligos, 2pl 10X PCR buffer (Qiagen 22374) and 16pl water. The reaction mixture was heated up to 95°C for 15 minutes, followed by a gradual decrease of 10°C every 30 minutes to 60°C, followed by 56°C, 52°C and 48°C for 30 minutes with the final step being 45°C. Hybridized oligonucleotide DNA was stored at -20°C until further use.

[0537] Preparation of isRNA-LPX

[0538] The isRNA formulation in liposome F12 were applied in a laminar air flow cabinet (HERAsafe, Hanau, Germany) under RNAse free and sterile conditions. Lipoplex formation was performed by diluting the isRNA candidate with RNAse free water and 1.5 M NaCI solution followed by adding the needed amount of the liposomes to achieve the desired charge ratio (1,3:2 lipid to RNA ratio) at a final NaCI concentration of 150 mM.

[0539] FACS Analysis

[0540] Single-cell suspensions (splenocytes) were generated using a gentleMACS Octo dissociater (program m_spleen_01). Isolated spleens were transferred to gentleMACS C tubes (Miltenyi Biotec) and prepared according to manufacturer's instructions. Samples were immediately filtered through a 70 pM cell strainer, followed by lysis of red blood cells (8,25 g NH4CL + 1 g KHCO3 + 0,2 mL 0.5M EDTA was dissolved in 1 L H2O and sterile filtered). Lysis was stopped by addition of DPBS and cell suspension was filtered through a second 70 pM cell strainer. Cells were then re-suspended in DC medium (RPMI-1640 GlutaMAX + 10% FCS h.i. + 1% NEAA + 1% 0.5% penicillin / streptavidin). Next, samples were added to a 96-well plate and first incubated with viability dye. After 25 minutes incubation at 4°C, the plate was washed. Next, an antibody mixture for surface molecules was added to the cells and incubated for 25 minutes at 4°C. Before proceeding to intracellular staining, the plate was washed and thereafter the cells were incubated with Foxp3 fixation / permeabilization solution (eBioscience 00-5523-00) for 25 minutes at 4°C according to manufacturer's instructions. Intracellular staining was conducted in IX permeabilization buffer (eBioscience) for 25min at 4°. Excess intracellular antibody was removed by washing cells in permeabilization buffer. Samples were acquired on a 5-laser A5SE (BD) flow cytometer. Analysis was performed by using FlowJo software.

[0541] IFN-y ELISpot

[0542] Single-cell suspensions of splenocytes were generated as described under FACS Analysis. Pre-coated ELISpot plates (Mabtech 3321-4APT-10) plates were washed with PBS and conditioned with DC medium as per manufacturer instructions (RPMI1640 GlutaMAX + 10% FCS h.i. + 1% NEAA + 1% sodium pyruvate + 1% HEPES + 0.5% penicillin streptavidin + 500 pl p-Mercaptoethanol) according to manufacturer's instructions. Next, plates were washed and 100 pl peptide solution (2pg / mL; H-SPSYVYHQF-OH) added. Thereafter, samples were added in 100 pl and incubated for 24 hours at 37°C and 5% CO2. After the incubation period the medium was removed, and the plates washed. Detection antibody (R4-6A2-biotin) and Streptavidin-ALP reagent were added to the plate according to manufacturer's instructions. Briefly, plates were washed and incubated for 2 hours at room temperature with diluted detection antibody. Next, plates were washed again and incubated in diluted Streptavidin-ALP reagent for 1 hour at room temperature. For color development the substrate solution (BCIP / NBT-plus) was first filtered through a 45 pM filter and then added to the plate. Color development was stopped by washing the plates extensively with tap water. Plates were dried overnight, and spots counted the following day using an CTL analyzer (ImmunoSpot). Analysis was performed using ImmunoSpot 7.0.17.0 software.

[0543] In vitro hPBMC Assays

[0544] Human PBMCs were isolated from healthy donor blood by density gradient centrifugation. Blood was layered onto 10 mL of Ficoll-Paque (Sigma GE17-1440-02) in a 50 mL falcon tube. Density centrifugation was used at 400xg for 25 minutes with no brake at RT to give rise to the intermediate layer which contains the PBMCs. PBMCs were washed twice, resuspended in DPBS and counted using an automated cell counter (CASY). For cytokine analysis, PBMCs were then re-suspended in media (RPMI-1640 GlutaMAX + 10% FCS h.i. + 1% NEAA + 1% 0.5% penicillin / streptavidin) and added to a U-shaped 96-well plate (500,000 PBMCs / well) in a volume of 190 pl. Next, lipoplexes were added in a volume of 10 pl and plates incubated at 37°C and 5% COj. The following day, supernatant was collected (20 - 24 hours post-stimulation) and stored at -20°C until analysis.

[0545] Cytokine Analysis

[0546] Serum concentrations of murine cytokines were determined using a custom multiarray-based multiplex assay (MSD Mesoscale) according to manufacturer's instructions. Mesoscale data was collected on a MESO QuickPlex SQ 120MM and analysis performed with Discovery Workbench 4.0 (MSD Mesoscale).

[0547] For the detection of human cytokines in vitro, an uncoated IFN-o ELISA kit (ThermoFisher BMS216MST) was used according to manufacturer's instructions. 96-well plates (ThermoFisher 442404) were coated overnight with coating antibody and sealed plates stored at 4°C. ELISA data was collected with a Tecan instrument (Infinite 200Pro) or with a BMG reader (CLARIOstar Plus). Cytokine analysis was supplemented with custom multiplex assay (MSD Mescoscale) and used according to manufacturer's instructions.

[0548] Reporter Cell Lines

[0549] Wildtype human embryonic kidney (HEK) 293 cells or HEK293 cells stably co-expressing human TLR3, TLR7 / 8 or TLR9 and an NF-xB-inducible luciferase reporter gene were obtained from (Invivogen) and cultured in DMEM supplemented with 10% (v / v) heat-inactivated FBS, 1% (v / v) NEAA, 1% (v / v) sodium pyruvate and 0.5% (v / v) Penicillin / Streptomycin solution. Depending on the HEK293 transfectant used, the medium was additionally supplemented with Blasticidin (10 pg / ml), Zeocin (100 pg / ml) or Geneticin (250 pg / ml), all from Invivogen. In order to test TLR activation, 10,000 cells / well in a flat-bottom 96-well plate were incubated 24-hours prior to stimulation at 37°C and 5% CO2. Following day, medium was removed and cells stimulated for 24 hours in a total volume of 100 pl. Afterwards, TLR activation was determined by quantification of firefly luciferase production using BrightGlo reagent (Promega). Change in absorbance was measured at 655nm with a BMG reader (CLARIOstar Plus).

[0550] J2 Dot Blot Analysis

[0551] Nytran SPC membrane (Whatman) was loaded with 5 pl RNA (Ipg RNA), dried at 37°C for 2 minutes and placed into a 50ml falcon tube containing blocking solution (TBS-T + 5% nonfat dry skim milk) for 1 hour on a tube roller at room temperature. The membrane was then incubated with primary J2 antibody (TBS-T + 1% nonfat dry skim milk; 1:1,000) overnight at 4°C. Next, the membrane was washed three times in TBS-T, followed by incubation with the secondary antibody (TBS-T + 1% nonfat dry skim milk; 1:10,000) at room temperature. Antibody detection was conducted using chemiluminescence detection kit (Cytiva RPN2232) as per manufacturer's instructions and visualized using an ChemiDoc instrument (Bio-Rad). Immunoblot analysis was performed by using ImageLab 6.1 software. Antibody against dsRNA (J2-1513) was from English & Scientific Consulting and HRP secondary antibody from Jackson ImmunoResearch (715-035-150).

[0552] Example 1: Sequence optimization of the already identified immunostimulatory single-stranded (is)RNA NP71-Seq4 enables the identification of new sequence candidate with modified secondary structure and cytokine induction profile

[0553] Based on the observation that defined, short immunostimulatory single-stranded RNA molecules (isRNA) induce TLR7-dependent IFN-a in plasmacytoid dendritic cells (pDCs), we selected a previously identified isRNA (NP71- Seq4) for further optimization and characterization (WO2018172426A1). TLR7 is an endosomal receptor recognizing single-stranded RNA (ssRNA) often but not limited to viral origin. GU motif in the duplex region of NP71-Seq4 could be responsible for the TLR7 stimulation. It is known that RNAs which formed a duplex region in their secondary structure can contribute to increased immunostimulatory activity (Lan, T., et al., Biochemical and biophysical research communications, 2009. 386(3): p. 443-448). Linearized plasmid DNA, PCR products, oligo- hybridized or cDNA can be used as templates for in vitro transcription if they contain a double-stranded RNA polymerase promoter region in the correct orientation. Applying oligo-hybridized DNA or PCR products as template for IVT enabled us to deplete the unwanted flanked short stretches in isRNAs derived from the applied plasmid template (restriction sites, linker....).

[0554] Figure 1 shows a schematic overview of three generations of isRNA NP71-Seq4. The aim was to optimize the previously identified isRNA to induce a defined favorable cytokine profile, improve translation efficiency and tolerability in vivo to mRNA-based vaccine. In the first instance we aimed to analyze the secondary structure of three generations of isRNA NP71-Seq4 (G1 - G3). Generation 1 consisted of the Influenza NP fragment flanked on both sites by short stretches derived from the pSTl plasmid template, whereas generation 2 had the short stretches of the pSTl plasmid included within the oligonucleotide DNA sequence of the template. Generation 1 and 2 are identical in the RNA sequence and only differ in the manufacturing process (Figure 2). The sequences of these fragments including pSTl derived sequence parts and their predicted secondary structure (RNAfold Web Server ®) are shown in Figure 1. Importantly, the prediction of the secondary structure shows a GU-rich duplex region. For plasmid-based DNA templates restriction enzyme cutting sites are necessary but for oligonucleotide- based DNA templates it is not. Therefore, a new sequence was designed that only consisted of the immunostimulatory Influenza NP fragment and the obligatory three G's (guanin) of the T7 polymerase transcription start site (Generation 3). The aim of isRNA NP71-Seq4 G3 was to reduce the RNA sequence to its immunostimulatory sequence core (NP viral sequence) and to investigate if this improves its TLR7 specificity and cytokine profile. By shortening the RNA sequence, we also changed the secondary structure. Nonetheless, a GU- rich duplex region was predicted, albeit slightly shorter than in isRNA Seq4 G1 and G2 (Figure 1).

[0555] Example 2: Manufacturing process of immunostimulatory RNA by in vitro transcription and quality control after purification.

[0556] In vitro transcription using bacteriophage T7 polymerase transcribes the RNA with high fidelity from a DNA template. However, during transcription one of the major contaminants generated is double-stranded RNA (dsRNA) (Kariko, K., et al., Nucleic acids research, 2011. 39(21): p. el42-el42; Baiersdorfer M. et al. Moi Ther Nucleic Acids. 2019;15:26-35). It is crucial to reduce or eliminate dsRNA from any RNA vaccine to improve translation, minimize unwanted innate immune activation and boosts tolerability in vivo.

[0557] To optimize the TLR7 specificity and accordingly better modulate the innate immunity and thus improve adjuvant efficacy to the applied mRNA-based antigens, the isRNA produced by IVT should contain a low-concentrated and thus biologically inactivated or even no ds contamination. In the first instance we started to optimize the encoding Influenza NP fragment Seq4 (NP71-Seq4). The DNA sequence encoding NP71-Seq4 was cloned downstream of a bacteriophage T7 RNA polymerase promotor into plasmid pSTl using SpA and Xhol restriction sites. Xhol linearized plasmids served as DNA template for the following in vitro transcription (IVT) (Process 1; Figure 2A). IVT RNA was purified by a magnetic beads-based method. To further optimize and standardize the manufacturing process chemically synthesized DNA oligonucleotides were used as template DNA in IVT (Process 2; Figure 2A). The manufacturing process 2 was unchanged to process 1 except for the generation of the template DNA. In process 2 complementary single-stranded DNA oligos were annealed by standard thermocycler protocols to generate dsDNA oligos. After purification isRNAs were quality controlled using a variety of analytical methods. Size, homogeneity, and integrity of purified isRNA was analyzed by denaturing 2,5% agarose gel electrophoresis, by on chip capillary electrophoresis using the Bioanalyzer 2100 system (Agilent). In addition, dsRNA contamination was quantified using dot blot analysis performed with J2 dsRNA-specific monoclonal antibody. Results are shown in Figure 2B - D. NP71-Seq4 G1 - G3 was characterized by a distinct single band of the expected size in 2,5% agarose gel (Figure 2B) and a sharp peak in capillary electrophoresis (Figure 2C) indicating a homogenous population without any signs of RNA integrity loss. Dot blot analysis revealed that plasmid DNA-based IVT (isRNA NP71-Seq4 Gl) resulted in significant dsRNA contamination above the used standard range (Figure 2D). This is in stark contrast to oligonucleotide DNA-based IVT, which resulted in low levels of dsRNA in the range of 0-100 pg dsRNA I pg RNA.

[0558] Taken together these results indicate that the manufacturing process has no impact on the size, homogeneity, and integrity of the RNA, but can significantly influence the production of side-products.

[0559] Example 3: Optimizing the manufacturing process of IVT isRNA test candidates reduced dsRNA contamination and thus TLR3 stimulation without affecting TLR7 specificity.

[0560] DsRNA contamination as major side product of IVT RNA is known to be the endogenous ligand for TLR3 (Kariko, K., et al., Journal of Biological Chemistry, 2004. 279(13): p. 12542-12550). To assess RNA mediated TLR3 activation and in order to analyze which nucleotide sensing endosomal TLR is activated by isRNA NP71-Seq4 Gl - G3, HEK293 cells stably co-expressing human TLR3, TLR7, TLR8 or TLR9 under the control of a NF-KB-inducible luciferase reporter gene were incubated with F12-formulated isRNA NP71-Seq4 and luciferase signals were compared to untreated (medium only) cells (Figure 3). To investigate any dose-related effects three concentrations (500, 250 and 62,5 ng) were used. Poly(I:C) (TLR3), CL-097 (TLR7 / 8) and CpG ODN 2006 (TLR9) were used as positive controls. Empty F12-liposome treated cells served as negative control. Addition of isRNA NP71-Seq4 resulted in an inverse dose-dependent activation of TLR7 co-expressing HEK293 cells (Figure 3A), whereas no luciferase signals could be detected in TLR8, TLR9 and TLRNull (Figure 3B-D). However, highly dsRNA contaminated isRNA NP71-Seq4 Gl resulted in a dose-dependent induction of luciferase signal in TLR3 co- expressing HEK293 cells, whereas for isRNA NP71-Seq4 G2 and G3 no luciferase signal could be detected at any concentration (Figure 3E). These results revealed that liposomal formulated isRNA NP71-Seq4 G2 and G3 acts as a specific ligand for human TLR7, while isRNA NP71-Seq4 Gl also activates TLR3. Example 4: F12-formulated isRNA generation 1 - 3 induce differential cytokine profiles in human PBMCs.

[0561] A key parameter for the selection of isRNAs as vaccine adjuvants was their ability to induce high levels of type IFN responses mainly IFN-a and no or low levels of strongly pro-inflammatory cytokines like IL-ip and TNF-a that might cause harmful systemic side effects upon vaccination and thereby negatively affecting the safety profile. In addition, isRNA-based adjuvants should not induce any anti-inflammatory cytokines such as IL-10 which inhibit immune responses.

[0562] To analyze the cytokine profile induced by IsRNA NP71-Seq4 G1 - G3 MSD multiplex immunoassay was performed. 0.5 xlOA6 freshly isolated human PBMCs per well were stimulated with F12-formulated isRNA NP71-Seq4 G1 - G3 alone or co-formulated with modified (Nl-methylpseudouridine-5'-triphosphate; mlY) antigen RNA (Figure 4). ...

Claims

CLAIMS1. A composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 1 or a variant thereof, which composition comprises 1000 pg or less dsRNA / pg RNA.

2. The composition of claim 1, wherein the immunostimulatory RNA comprises a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 2 or a variant thereof, and the nucleotide sequence of SEQ ID NO: 3 or a variant thereof.

3. A composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof.

4. The composition of claim 3, which comprises 1000 pg or less dsRNA / pg RNA.

5. The composition of any one of claims 1 to 4, wherein the immunostimulatory RNA is a toll-like receptor(TLR) agonist.

6. The composition of claim 5, wherein the TLR is TLR7.

7. The composition of any one of claims 1 to 6, wherein the immunostimulatory RNA is capable of inducing secretion of type I interferon, e.g., interferon alpha.

8. The composition of any one of claims 1 to 7, which comprises 750 pg or less, 500 pg or less, 400 pg or less, 300 pg or less, 200 pg or less, 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

9. The composition of any one of claims 1 to 8, wherein the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linearized plasmid encoding the immunostimulatory RNA.

10. The composition of any one of claims 1 to 8, wherein the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linear oligo-hybridized oligonucleotide DNA encoding the immunostimulatory RNA or PCR amplified DNA encoding the immunostimulatory RNA.

11. The composition of claim 9 or 10, wherein the in vitro transcription uses T7-RNA-polymerase.

12. The composition of any one of claims 9 to 11, wherein the process further comprises magnetic beads purification of in vitro transcribed immunostimulatory RNA.

13. The composition of any one of claims 9 to 12, wherein the process further comprises the removal of dsRNA from in vitro transcribed immunostimulatory RNA.

14. The composition of claim 13, wherein the dsRNA is removed from in vitro transcribed immunostimulatory RNA using cellulose based purification.

15. The composition of any one of claims 1, 2, and 5 to 14, which comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 2 or a variant thereof and which comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

16. The composition of any one of claims 1, 2, and 5 to 15, which comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 2 and which comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

17. The composition of any one of claims 1 to 14, which comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof and which comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

18. The composition of any one of claims 1 to 14, and 17, which comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 and which comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

19. The composition of any one of claims 1 to 18, which is a pharmaceutical composition.

20. The composition of claim 19, which comprises a pharmaceutically acceptable carrier.

21. The composition of any one of claims 1 to 20, which comprises an antigen or a nucleic acid encoding an antigen.

22. A kit comprising the composition of any one of claims 1 to 21 and an antigen or a nucleic acid encoding an antigen.

23. The kit of claim 22, wherein the composition comprising an immunostimulatory RNA and the antigen or nucleic acid encoding an antigen are present in the same or different receptacles.

24. The composition or kit of any one of claims 21 to 23, wherein the antigen is useful for vaccination against cancer or infection.

25. The composition or kit of claim 24, wherein the infection is a viral, bacterial, fungal, or parasite infection.

26. The composition or kit of any one of claims 21 to 25, wherein the antigen is selected from the group consisting of cancer, virus, bacterial, fungal, or parasite antigens.

27. The composition or kit of any one of claims 21 to 26, wherein the nucleic acid encoding an antigen is RNA encoding an antigen.

28. The composition or kit of claim 27, wherein the RNA encoding an antigen is single-stranded RNA.

29. The composition or kit of claim 27 or 28, wherein the RNA encoding an antigen is mRNA.

30. The composition or kit of any one of claims 27 to 29, wherein the RNA encoding an antigen comprises a5' cap, a 5' UTR, a 3' UTR, and a poly(A) sequence.

31. The composition or kit of claim 30, wherein the poly-A sequence is an interrupted sequence of A nucleotides.

32. The composition or kit of any one of claims 27 to 31, wherein the RNA encoding an antigen comprises a modified nucleoside in place of uridine.

33. The composition or kit of any one of claims 27 to 32, wherein the RNA encoding an antigen comprises a modified nucleoside in place of each uridine.

34. The composition or kit of claim 32 or 33, wherein the modified nucleoside is pseudouridine (qj) and / or Nl- methyl-pseudouridine (mlψ ).

35. The composition or kit of any one of claims 32 to 34, wherein the modified nucleoside is Nl-methyl- pseudouridine (mlψ ).

36. The composition or kit of any one of claims 27 to 35, wherein the immunostimulatory RNA and / or the RNA encoding an antigen are formulated in particles.

37. The composition or kit of any one of claims 27 to 36, wherein the immunostimulatory RNA and the RNA encoding an antigen are co-formulated in particles.

38. The composition or kit of claim 36 or 37, wherein the particles are lipid particles.

39. The composition or kit of any one of claims 36 to 38, wherein the particles are lipoplex particles (LPX).

40. The composition or kit of claim 39, wherein the LPX particles are obtainable by combining the immunostimulatory RNA and the RNA encoding an antigen with liposomes.

41. The composition or kit of claim 39 or 40, wherein the LPX particles comprises DOTMA and DOPE.

42. The composition or kit of any one of claims 36 to 41, wherein the particles have an average size of about50 to 400 nm.

43. The composition or kit of any one of claims 36 to 42, wherein the particles are negatively charged.

44. The composition or kit of any one of claims 36 to 43, wherein the particles have a zeta potential of about-10 to -80 mV.

45. A method for stimulating an immune response in a subject comprising providing a composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 1 or a variant thereof, which composition comprises 1000 pg or less dsRNA / pg RNA, and providing an antigen to the subject.

46. The method of claim 45, wherein the immunostimulatory RNA comprises a nucleotide sequence selected from the group consisting of the nucleotide sequence of SEQ ID NO: 2 or a variant thereof, and the nucleotide sequence of SEQ ID NO: 3 or a variant thereof.

47. A method for stimulating an immune response in a subject comprising providing a composition comprising an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof, and providing an antigen to the subject.

48. The method of claim 47, which composition comprises 1000 pg or less dsRNA / pg RNA.

49. The method of any one of claims 45 to 48, wherein the immunostimulatory RNA is a toll-like receptor (TLR) agonist.

50. The method of claim 46, wherein the TLR is TLR7.

51. The method of any one of claims 45 to 50, wherein the immunostimulatory RNA is capable of inducing secretion of type I interferon, e.g., interferon alpha.

52. The method of any one of claims 45 to 51, wherein the composition comprising an immunostimulatory RNA comprises 750 pg or less, 500 pg or less, 400 pg or less, 300 pg or less, 200 pg or less, 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

53. The method of any one of claims 45 to 52, wherein the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linearized plasmid encoding the immunostimulatory RNA.

54. The method of any one of claims 45 to 52, wherein the immunostimulatory RNA is obtainable by a process comprising in vitro transcription using as template linear oligo-hybridized oligonucleotide DNA encoding the immunostimulatory RNA or PCR amplified DNA encoding the immunostimulatory RNA.

55. The method of claim 53 or 54, wherein the in vitro transcription uses T7-RNA-polymerase.

56. The method of any one of claims 53 to 55, wherein the process further comprises magnetic beads purification of in vitro transcribed immunostimulatory RNA.

57. The method of any one of claims 53 to 56, wherein the process further comprises the removal of dsRNA from in vitro transcribed immunostimulatory RNA.

58. The method of claim 57, wherein the dsRNA is removed from in vitro transcribed immunostimulatory RNA using cellulose based purification.

59. The method of any one of claims 45, 46, and 49 to 58, wherein the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 2 or a variant thereof and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

60. The method of any one of claims 45, 46, and 49 to 59, wherein the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO:2 and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

61. The method of any one of claims 45 to 58, wherein the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO: 3 or a variant thereof and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

62. The method of any one of claims 45 to 58, and 61, wherein the composition comprising an immunostimulatory RNA comprises an immunostimulatory RNA comprising the nucleotide sequence of SEQ ID NO:3 and comprises 150 pg or less, 100 pg or less, 90 pg or less, 80 pg or less, 70 pg or less, 60 pg or less, 50 pg or less, 40 pg or less, 30 pg or less, 20 pg or less, or 10 pg or less dsRNA / pg RNA.

63. The method of any one of claims 45 to 62, wherein the immunostimulatory RNA is administered in a pharmaceutical composition.

64. The method of claim 63, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier.

65. The method of any one of claims 45 to 64, wherein the antigen is provided by administering the antigen or a nucleic acid encoding the antigen.

66. The method of any one of claims 45 to 65, wherein the antigen is useful for vaccination against cancer or infection.

67. The method of claim 66, wherein the infection is a viral, bacterial, fungal, or parasite infection.

68. The method of any one of claims 45 to 67, wherein the antigen is selected from the group consisting of cancer, virus, bacterial, fungal, or parasite antigens.

69. The method of any one of claims 65 to 68, wherein the nucleic acid encoding the antigen is RNA encoding the antigen.

70. The method of claim 69, wherein the RNA encoding the antigen is single-stranded RNA.

71. The method of claim 69 or 70, wherein the RNA encoding the antigen is mRNA.

72. The method of any one of claims 69 to 71, wherein the RNA encoding the antigen comprises a 5' cap, a5' UTR, a 3' UTR, and a poly(A) sequence.

73. The method of claim 72, wherein the poly-A sequence is an interrupted sequence of A nucleotides.

74. The method of any one of claims 69 to 73, wherein the RNA encoding the antigen comprises a modified nucleoside in place of uridine.

75. The method of any one of claims 69 to 74, wherein the RNA encoding the antigen comprises a modified nucleoside in place of each uridine.

76. The method of claim 74 or 75, wherein the modified nucleoside is pseudouridine (ip) and / or Nl-methyl- pseudouridine (mlip).

77. The method of any one of claims 74 to 76, wherein the modified nucleoside is Nl-methyl-pseudouridine (mlip).

78. The method of any one of claims 69 to 77, wherein the immunostimulatory RNA and / or the RNA encoding the antigen are formulated in particles.

79. The method of any one of claims 69 to 78, wherein the immunostimulatory RNA and the RNA encoding the antigen are co-formulated in particles.

80. The method of claim 78 or 79, wherein the particles are lipid particles.

81. The method of any one of claims 78 to 80, wherein the particles are lipoplex particles (LPX).

82. The method of claim 81, wherein the LPX particles are obtainable by combining the immunostimulatoryRNA and the RNA encoding the antigen with liposomes.

83. The method of claim 81 or 82, wherein the LPX particles comprises DOTMA and DOPE.

84. The method of any one of claims 78 to 83, wherein the particles have an average size of about 50 to 400 nm.

85. The method of any one of claims 78 to 84, wherein the particles are negatively charged.

86. The method of any one of claims 78 to 85, wherein the particles have a zeta potential of about -10 to -80 mV.

87. The method of any one of claims 45 to 86, wherein the immunostimulatory RNA and the antigen are capable of inducing an antigen specific immune response in the subject.

88. The method of any one of claims 45 to 87, wherein the immune response comprises a T cell response, a B cell response, or both.

89. The method of any one of claims 45 to 88, wherein the immune response comprises a T cell response.

90. The method of any one of claims 45 to 89, wherein the subject is a mammal.

91. The method of any one of claims 45 to 90, wherein the subject is a human.

Citation Information

Patent Citations

  • Modification of RNA, producing an increased transcript stability and translation efficiency

    WO2007036366A2

  • RNA formulation for immunotherapy

    WO2013143683A1

  • Stabilization of poly(a) sequence encoding DNA sequences

    WO2016005324A1

  • Methods for providing single-stranded RNA

    WO2017182524A1

  • 5'-cap-trinucleotide- or higher oligonucleotide compounds and their uses in stabilizing RNA, expressing proteins and in therapy

    WO2019175356A1