Isolated bacteriophage against xylella fastidiosa
A composition of specifically identified bacteriophages targeting Xylella fastidiosa effectively inhibits bacterial growth, addressing the inefficiencies of current methods and offering a sustainable solution for managing plant diseases.
Patent Information
- Application Number
- PCT/EP2025/061314
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-25
- Filing Date
- 2025-04-25
- Publication Date
- 2025-10-30
AI Technical Summary
Current methods for controlling Xylella fastidiosa, a plant-pathogenic bacterium causing significant crop losses and economic damage, are not efficient or environmentally friendly, and there is a need for effective biotechnological solutions.
A composition comprising at least two isolated bacteriophages with specific DNA sequence identities targeting Xylella fastidiosa, capable of inhibiting its growth, is used to prevent or reduce disease symptoms.
The bacteriophage composition effectively inhibits Xylella fastidiosa growth, providing a sustainable and efficient method to manage plant diseases caused by this bacterium.
Smart Images

Figure IMGF000068_0001 
Figure IMGF000069_0001 
Figure IMGF000070_0001
Abstract
Description
[0001] Isolated bacteriophage against Xylella fastidiosa FIELD OF THE INVENTION The present invention relates to the field of plant pathology and biological control agents. More specifically, the invention relates to methods and compositions for treatment of plant diseases caused by Xylella fastidiosa comprising the use of a bacteriophage, a virus of bacteria. BACKGROUND OF THE INVENTIONBacteria can cause many infectious diseases in plants. The bacteria infect plant tissues andcan cause wilting, poor growth, lesions on fruit, and even plant death. Infection can occur through spreading by wind, rain, contaminated equipment, or vector insects, rapidly spreading to other plants, and resulting in deleterious effects to the plant and massive crop losses. Effective treatment of these diseases requires a method of treating the plant to eliminate the bacteria.Xylella fastidiosa (Xf) is a slow-growing Gram-negative plant-pathogenic bacterium emergingin Asia and Europe, and is therefore listed as a quarantine organism [1]. Long known in the Americas, this xylem-specialized bacterium is associated with numerous socio-economicallyimportant plant diseases. The impact of diseases due to Xylella include direct and indirecteconomic damages that were estimated to reach 150 million dollars per year in California when including measures to control vectors [2,3]. In the European olive oil production area, the projected impact of olive quick decline syndrome (OQDS) over 50 years ranges from two to five billion euros [4]. Nonetheless, such diseases have wider impacts; for instance, the impairment was estimated at 30% of the provision of ecosystem services provided by agroecological systems, including landscape value, cultural and natural heritage in the Pugliaprovince of Italy [5]. Xf is transmitted by xylem sap-feeding insects and belongs to theXanthomonadaceae (synonymous with the Lysobacteraceae) family. Xf genome has been thefirst plant pathogen genome sequenced, highlighting its importance as a plant pest [6]. Its genome of 2.6 Mb with a low GC content (52.7%) is smaller than that of otherXanthomonadaceae, even the ones of the phylogenetically closest relatives Xanthomonasalbilineans (Xa) and X. translucens (Xt) whose genomes are composed of 3.7 and 4.7 Mb,respectively [7,8]. It is tempting to link the Xf reduced genome to its fastidious growth.Interestingly, a recent genome-scale metabolic network reconstruction analysis suggested thatthe Xf metabolic network is pretty much complete, although minimalist and not particularlyrobust [9]. Indeed, alternative reactions seem to be missing; the metabolism of the bacteria thus relies on poorly efficient metabolic pathways and lack of flexibility. Moreover, the study also found that the production of some virulence factors, such as exopolysaccharides (EPS), is at a high cost to the plant and is thus detrimental to fast growth [9].Xf has been identified as the causative agent of Pierce’s disease, which has been causingextensive damage to vineyards in California for almost 150 years
[0010] . However, it was only at the end of the 1970s that this fastidious bacterium could be isolated on solid medium
[0011] .Since then, Xf has been associated with various forms of plant diseases on many differentplant hosts
[0012] . Today, this bacterium belongs in the top 10 of the plant pathogens that aremost studied worldwide
[0013] . Xf is endemic in the Americas and is persistently involved in largeepidemics, causing significant damage in vineyards and citrus orchards. Listed as a quarantinepest in Europe, the three main Xf subspecies (pauca (Xfp), multiplex (Xfm) and subsp.fastidiosa (Xff)) were recently detected in Europe, in particular in the Mediterranean area,probably introduced through commercial exchanges and causing a variety of diseases such as the leaf scorch of olive trees in Italy
[0014] . Continuous monitoring using standardized real- time PCR protocols is now performed in southern Europe [15,16]. However, in the absence ofany efficient and authorized chemical method to control Xf, a major challenge is to developenvironmentally friendly biotechnologies to control this plant disease. The current strategyimplemented by the European Commission to prevent Xf spread within the EU consists oferadication and containment measures involving intensive surveillance, vector control treatments, and differential removal of infected plants and specified hosts in foci and buffer zones
[0017] . Additional measures to these economically and socially devastating ones have been proposed, such as the selection of naturally resistant host plants, the thermal treatment of young plants, or the use of a combination of zinc, copper, manganese and citric acid[18,19,20]. Biocontrol strategies have also been proposed using avirulent Xf strains or otheravirulent plant colonizers [21,22]. However, none of these later strategies has been recognized as fully efficient or totally safe by the European authorities. Bacteriophages, the viruses infecting bacteria, have been used to treat infectious diseases since their discovery at the beginning of the twentieth century
[0023] . Their use in therapy has pros and cons, but the clear advantages are that they can multiply in the presence of a hostso there’s no need to apply them regularly and can be adapted to any bacterial species as longas strictly virulent phages can be isolated. Recently, the agricultural sciences community put a great deal of emphasis on phage therapy to develop sustainable strategies of biocontrol for plants and animals [24,25,26]. Currently, a number of phage products are being developed or are already commercially available for a variety of plant pathogens such as variousXanthomonas strains or Ralstonia solanacearum
[0027] . As an example, the OmniLytics™company commercialized several phage products under the AgriPhage™ name to controltomato and pepper bacterial spot and speck caused by Xanthomonas euvesicatoria pv.Euvesicatoria and Pseudomonas syringae pv. tomato, as well as other plant diseases. In thiscontext, a group from Texas A&M University proposed the use of bacteriophages as a treatment for Pierce’s disease [28,29,30], the product name is XylPhi® https: / / inphatec.com / xylphi_pd.Clavijo-Coppens et al. also attempted to isolate Xf-specific phages focusing on the three Xfsubspecies present in the Mediterranean basin.
[0031] .There still exists a need in treatments against diseases caused by Xylella fastidiosa.SUMMARY OF THE INVENTIONThe first subject-matter of the invention is a composition comprising at least two isolatedbacteriophages that are aimed at Xylella fastidiosa (Xf), wherein each of said bacteriophagesis capable of inhibiting the growth of said Xylella fastidiosa; and the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequencesi) SEQ ID NO:1 to SEQ ID NO:3 (Suba, Karst, Horst) (VC1)ii) SEQ ID NO:4 to SEQ ID NO:6 (SERU 84022.1, Darbon, Tourse) (VC1)iii) SEQ ID NO:7 (Sov) (VC2_1)iv) SEQ ID NO:8 to SEQ ID NO:9 (Bosa, Léarch) (VC3)v) SEQ ID NO:10 (Boscavo) (VC3)vi) SEQ ID NO:11 to SEQ ID NO:14 (VC24)vii) SEQ ID NO:15 to SEQ ID NO:27 (VC58)viii) SEQ ID NO:28 to SEQ ID NO:29 (VC135).The second subject-matter of the invention is a method of preventing or reducing symptomsor disease caused by Xylella fastidiosa in a plant, comprising contacting said plant or a part ofsaid plant with a composition according to the invention.The third subject-matter of the invention is a biocontrol composition comprising a compositionaccording to the invention and a carrier. DESCRIPTION OF THE DRAWINGSFigure 1: Genomic comparison tree created using the dRep tool for all the phages in ourlibrary. The abbreviations are as follows: phg = phage, Xant = Xanthomonas, Xyle = Xylella. Published phages are followed by their accession number. The black dotted line is placed at 70% identity.Figure 2: Genomic comparison tree created using the dRep tool for all the phages in ourlibrary. The abbreviations are as follows: phg = phage, Xant = Xanthomonas, Xyle = Xylella. Published phages are followed by their accession number. The dotted black line is placed at 70% identity. Shades of grey correspond to the VCs formed by vConTACT2: VC_1, VC_2_1, VC_3, VC_24, VC_58, VC_135. Figure 3: GBDP phylogenomic tree produced with the amino acid sequence of phages included in VC_1 produced by VICTOR using formula D6. The numbers above the branches are the GBDP pseudo-bootstrap support values from 100 replications. The branch lengths of the resulting VICTOR trees are scaled according to the respective distance formula used. G = genus. Figure 4: VIRIDIC heatmap of the VC_1 phage genomes. Abbreviations: phg = phage, Achr = Achromobacter, Acin = Acinetobacter, Burk = Burkholderia, Para = Paracoccus, Pseu = Pseudomonas, Rhod = Rhodobacter, Sten = Stenotrophomonas, Xant = Xanthomonas, Xyle = Xylella. The genera as they are currently described in the ICTV are added.Figure 5: GBDP phylogenomic tree based on the aminoacid sequence of VC_2_1 phagescomplemented by the Vojvodinavirus genus produced by VICTOR using the D6 formula. The numbers above the branches are the GBDP pseudo-bootstrap support values from 100 replications. The branch lengths of the resulting VICTOR trees are scaled according to the respective distance formula used. G = genus.Figure 6: Cluster VC_2_1 VIRIDIC heatmap. Abbreviations: phg = phage, Bord = Bordetella,Pseu = Pseudomonas, Sten = Stenotrophomonas, Xant = Xanthomonas. The genera as they are currently described in the ICTV are added.Figure 7: GBDP phylogenomic tree based on the amino acid sequence of VC_3 phagessupplemented with Abidjanviruses and Epaquintaviruses produced by VICTOR using the D6 formula. The numbers above the branches are the GBDP pseudo-bootstrap support values from 100 replications. The branch lengths of the resulting VICTOR trees are scaled according to the respective distance formula used. G = genus. The colours of the tree branches correspond to the genera as they are currently present in the ICTV.Figure 8: Cluster VC_3 VIRIDIC heatmap. Abbreviations: phg = phage, Bord = Bordetella,Pseu = Pseudomonas, Sten = Stenotrophomonas, Xant = Xanthomonas. The genera as they are currently described in the ICTV are added.Figure 9: GBDP phylogenomic tree on the amino acid sequence of VC_24 phages producedby VICTOR using formula D6. The numbers above the branches are the GBDP pseudo- bootstrap support values from 100 replications. The branch lengths of the resulting VICTOR trees are scaled according to the respective distance formula used. G = genus.Figure 10: VIRIDIC heatmap of VC_24 phagesAbbreviations: phg = phage, Sten =Stenotrophomonas, Xant = Xanthomonas, Xyle = Xylella. Genera as currently described in the ICTV are added.Figure 11: GBDP phylogenomic tree on the amino acid sequence of VC_58 phages producedby VICTOR deduced using formula D6. The numbers above the branches are the GBDP pseudo-bootstrap support values from 100 replications. The branch lengths of the resulting VICTOR trees are scaled according to the respective distance formula used. G = genus, SF = subfamily.Figure 12: VIRIDIC heatmap of VC_58 phages. Abbreviations: phg = phage, Aqua =Aquamicrobium, Burk = Burkholderia, Caul = Caulobacter, Curv = Curvibacter, Esch = Escherichia, Pseu = Pseudomonas, Rals = Ralstonia, Sphi = Sphingomonas, Sten = Stenotrophomonas, Xant = Xanthomonas, Xyle = Xylella. The genera as they are currently described in the ICTV are added.Figure 13: VICTOR-constructed phylogenetic tree of VC_135 phages predicted byvConTACT2. The Genome-BLAST distance phylogeny tree (GBDP) based on amino acid sequences was deduced using the d4 formula, giving an average support of 21%. The numbers above the branches are the GBDP pseudo-bootstrap support values from 100 replications. Branch lengths of the resulting VICTOR trees are scaled according to the respective distance formula used.Figure 14: VIRIDIC heatmap of VC_135 phages. Abbreviations: phg = phage, Xant =Xanthomonas. These phages are not assigned to a genus in the ICTV classification. Figure 15: Transmission Electron Microscope images of newly isolated phages. Error bar = 200 nm. A. Learch, B. Karst, C. Horst, D. Caracole, E. SERU 79702.1, F. SERU 79703.1, G. SERU 79704.1, H. Sov, I. SERU 79709a1.1, J. SERU 79709b1.1, K. SERU 797010.1, L. SERU 797011.1, M. SERU 797012.1, N. SERU 797013.1, O. SERU 797014.1, P. Steppe, Q. Oroshi, R. SERU 84022.1, S. Darbon, T. Arval, U. Firost, V. Larco, W. Tourse, X. Boscavo, Y. Aoi, Z. Alme.Figure 16: Measurements of phage tail lengths in ascending order in nm. Statistical groupsaccording to the Bonferroni (bon) or Holm (holm) fit and statistical groups resulting from the analysis of these two fits (capitals). Figure 17: Superposition of statistical groups of siphovirus tail lengths on the genomic comparison tree. Figure 18: Overlays optimization of Xf multiplex 8416. A, Without overlay, Xf aggregates. B, after the optimization of all parameters. All phages tested here provoke Xf growth inhibition, unlike the negative control (buffer spot). Figure 19: Growth of Xylella fastidiosa pauca 8402 with an initial OD600of 0.1, 0.05, 0.01 without phages (circles), with 105PFU / mL Bacata (triangles), and 108PFU / mL Bacata (squares). DESCRIPTION OF THE SEQUENCE LISTINGSEQ ID NO:1 = Suba FC41 genomic sequenceSEQ ID NO:2 = Karst SERS 84024.1 genomic sequenceSEQ ID NO:3 = Horst SERS 84024.2 genomic sequenceSEQ ID NO:4 = SERU 84022.1 genomic sequenceSEQ ID NO:5 = Darbon SERU 84023.1 genomic sequenceSEQ ID NO:6 = Tourse SERU 841811.1 genomic sequenceSEQ ID NO:7 = Sov SERU 79705.1 genomic sequenceSEQ ID NO:8 = Bosa FC44 genomic sequenceSEQ ID NO:9 = Léarch SERS 79701.1 genomic sequenceSEQ ID NO:10 = Boscavo SERU 841816.1 genomic sequenceSEQ ID NO:11 = Bacata FC12 genomic sequenceSEQ ID NO:12 = Oroshi SERU 84021.1 genomic sequenceSEQ ID NO:13 = Aoi VP279702.1 genomic sequenceSEQ ID NO:14 = Alme VP284181.1 genomic sequenceSEQ ID NO:15 = Cota FC23 genomic sequenceSEQ ID NO:16 = SERU 79701.1 Caracole genomic sequenceSEQ ID NO:17 = SERU 797010.1 genomic sequenceSEQ ID NO:18 = SERU 797011.1 genomic sequenceSEQ ID NO:19 = SERU 797012.1 genomic sequenceSEQ ID NO:20 = SERU 797013.1 genomic sequenceSEQ ID NO:21 = SERU 797015.1 Steppe genomic sequenceSEQ ID NO:22 = SERU 79702.1 genomic sequenceSEQ ID NO:23 = SERU 79703.1 genomic sequenceSEQ ID NO:24 = SERU 79704.1 genomic sequenceSEQ ID NO:25 = SERU 79709b1.1 genomic sequenceSEQ ID NO:26 = SERU 84027.1 Arval genomic sequenceSEQ ID NO:27 = SERU 84181.1 Firost genomic sequenceSEQ ID NO:28 = Usme FC03 genomic sequenceSEQ ID NO:29 = Larco SERU 84185.1 genomic sequenceSEQ ID NO:30 = primer Cota FSEQ ID NO:31 = primer Cota RSEQ ID NO:32 = primer Usme FSEQ ID NO:33 = primer Usme RSEQ ID NO:34 = primer Bacata FSEQ ID NO:35 = primer Bacata RSEQ ID NO:36 = primer Bosa FSEQ ID NO:37 = primer Bosa RSEQ ID NO:38 = primer Aoi FSEQ ID NO:39 = primer Aoi RSEQ ID NO:40 = primer Alme FSEQ ID NO:41 = primer Alme RSEQ ID NO:42 = primer Horst FSEQ ID NO:43 = primer Horst RSEQ ID NO:44 = primer Learch FSEQ ID NO:45 = primer Learch RSEQ ID NO:46 = primer Oroshi FSEQ ID NO:47 = primer Oroshi RSEQ ID NO:48 = primer Darbon FSEQ ID NO:49 = primer Darbon RSEQ ID NO:50 = primer Arval FSEQ ID NO:51 = primer Arval RSEQ ID NO:52 = primer Caracole FSEQ ID NO:53 = primer Caracole RSEQ ID NO:54 = primer Sov FSEQ ID NO:55 = primer Sov RSEQ ID NO:56 = primer Firost FSEQ ID NO:57 = primer Firost RSEQ ID NO:58 = primer Larco FSEQ ID NO:59 = primer Larco RSEQ ID NO:60 = primer Tourse FSEQ ID NO:61 = primer Tourse RSEQ ID NO:62 = primer Boscavo FSEQ ID NO:63 = primer Boscavo RBacteriophage Name DSMZ number DSMZ date ofGenomic sequence deposit Suba FC41 34832 October 11, 2023 SEQ ID NO:1Karst SERS 84024.1 34820 September 26,SEQ ID NO:2 2023 Horst SERS 84024.2 34788 September 26,SEQ ID NO:3 2023 SERU 84022.1 34823 September 26,SEQ ID NO:4 2023 Darbon SERU 84023.1 34786 September 26,SEQ ID NO:5 2023 Tourse SERU 841834826 September 26,SEQ ID NO:6 11.1 2023 Sov SERU 79705.1 34824 September 26,SEQ ID NO:7 2023 Bosa FC44 34797 October 11, 2023 SEQ ID NO:8Léarch SERS 79701.1 34822 September 26,SEQ ID NO:9 2023 Boscavo SERU 841834784 September 26,SEQ ID NO:10 16.1 2023 Bacata FC12 34796 October 11, 2023 SEQ ID NO:11Oroshi SERU 84021.1 34799 October 11, 2023 SEQ ID NO:12Aoi VP279702.1 34782 September 26,SEQ ID NO:13 2023 Alme VP284181.1 34795 October 11, 2023 SEQ ID NO:14Cota FC23 34798 October 11, 2023 SEQ ID NO:15SERU 7970 1.134785 September 26,SEQ ID NO:16 Caracole 2023 SERU 797010.1 34828 October 11, 2023 SEQ ID NO:17SERU 797011.1 34829 October 11, 2023 SEQ ID NO:18SERU 797012.1 34830 October 11, 2023 SEQ ID NO:19SERU 797013.1 34831 October 11, 2023 SEQ ID NO:20SERU 7970 15.134825 September 26,SEQ ID NO:21 Steppe 2023 SERU 79702.1 34800 October 11, 2023 SEQ ID NO:22SERU 79703.1 34801 October 11, 2023 SEQ ID NO:23SERU 79704.1 34802 October 11, 2023 SEQ ID NO:24SERU 79709b1.1 34827 October 11, 2023 SEQ ID NO:25SERU 84027.1 Arval 34783 September 26,SEQ ID NO:26 2023 SERU 84181.1 Firost 34787 September 26,SEQ ID NO:27 2023 Usme FC03 34833 October 11, 2023 SEQ ID NO:28SERU 84185.1 Larco 34821 September 26,SEQ ID NO:29 2023 DEFINITIONS Throughout this document, values expressed in a range format should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of “about 0.1% to about 5%” or “about 0.1% to 5%” should be interpreted to include not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement “about X to Y” has the same meaning as “about X to about Y,” unless indicated otherwise. Likewise, the statement “about X, Y, or about Z” has the same meaning as “about X, about Y, or about Z,” unless indicated otherwise.In this document, the terms “a”, “an” or “the” are used to include one or more than one unlessthe context clearly dictates otherwise. A bacteriophage, also referred to as a phage, is a virus that infects and replicates withinbacteria. Bacteriophages include proteins that encapsidate a DNA or RNA genome as well asall the equipment required for genome injection, and may have structures that are either simple or elaborate. Their genomes may encode as few as four genes and as many as hundreds of genes. Phages replicate within the bacterium following the injection of their genome into its cytoplasm. Bacteriophages are obligate intracellular parasites that multiply inside bacteria by co-opting the host biosynthetic machineries. Phages contain nucleic acid and protein, and may be enveloped by a lipid membrane. Depending upon the phage, the nucleic acid genome can beeither DNA or RNA but not both, and can exist in either circular or linear forms, single- ordouble-stranded. The size of the phage genome varies depending upon the phage. The simplest phages have genomes that are only a few thousand nucleotides in size, while the more complex phages may contain more than 100,000 nucleotides in their genome, and in rare instances more than 1,000,000. The number and amount of individual types of protein inphage particles will vary depending upon the phage. Some of the proteins play a role ininfection and to protect the nucleic acid genome from environmental nucleases. Phage genomes come in a variety of sizes and shapes (e.g., linear or circular). Most phages range in size from 24-200 nm in diameter. The capsid is composed of many copies of one or more phage proteins, and acts as a protective envelope around the phage genome. Manyphages have tails attached to the phage capsid. The tail is a hollow tube through which thephage nucleic acid is ejected during infection. The size of the tail can vary and some phages do not even have a tail structure. In the more complex phages, the tail is surrounded by a contractile sheath which contracts during infection of the bacterial host cell. At the end of the tail, phages have a baseplate and one or more tail fibers attached to it. The baseplate and tail fibers are involved in the binding of the phage to the host cell’s receptor.An “isolated” molecule is one which has been identified and separated and / or recovered froma component of its natural environment.As used herein, the term “virulent” refers to a virus, particularly a bacteriophage, that replicateexclusively through a lytic cycle, and thus is able to infect, replicate within, and lyse (kill) a host cell.The term “temperate” refers to a bacteriophage that, alternatively to a lytic development, canundergo lysogeny, and commonly able to integrate into the host genome (lysogenize).Phages are propagated in an appropriated host, as is described herein. The term “host” refersto a bacterial cell that is sensitive to bacteriophage. The bacterial host may be a non-natural,for example genetically modified, bacterial host cell or a natural bacterial host cell. The percent identities referred to in the context of the disclosure of the present invention are determined after optimal alignment of the sequences to be compared, which may therefore comprise one or more insertions, deletions, truncations and / or substitutions. This percent identity may be calculated by any sequence analysis method well-known to the person skilled in the art. The percent identity may be determined after global alignment of the sequences to be compared of the sequences taken in their entirety over their entire length. In addition to manual comparison, it is possible to determine global alignment using the algorithm of Needleman and Wunsch (1970). For nucleotide sequences, the sequence comparison may be performed using any software well-known to a person skilled in the art, such as the Needle software. The parameters used may notably be the following: “Gap open” equal to 10.0, “Gap extend” equal to 0.5, and the EDNAFULL matrix (NCBI EMBOSS Version NUC4.4). For amino acid sequences, the sequence comparison may be performed using any software well-known to a person skilled in the art, such as the Needle software. The parameters used may notably be the following: “Gap open” equal to 10.0, “Gap extend” equal to 0.5, and the BLOSUM62 matrix. Preferably, the percent identity as defined in the context of the present invention is determined via the global alignment of sequences compared over their entire length. As used herein, the terms "treatment," "treating," and "treat" are defined as acting upon a disease, disorder, or condition with an agent to reduce or ameliorate the physiologic effects of the disease, disorder, or condition and / or its symptoms. "Treatment," as used herein, covers any treatment of a disease in a plant host {e.g., a plant species, including those of agricultural interest, such as edible plants or those used to produce edible products, as well as ornamental plant species), and includes: (a) reducing the risk of occurrence of the disease in a plant, (b) impeding the development of the disease, and (c) relieving the disease, i.e., causing regression of the disease and / or relieving one or more disease symptoms. "Treatment" is also meant to encompass delivery of an inhibiting agent to provide an effect, even in the absence of a disease or condition. For example, "treatment" encompasses delivery of a disease or pathogen inhibiting agent that provides for enhanced or desirable effects in the plant (e.g., reduction of pathogen load, reduction of disease symptoms, etc.). The term "carrier" refers to a diluent, adjuvant, surfactant, excipient, or vehicle with which the phage is administered. Such carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Saline solutions, including phosphate solution such as sodium monohydrogen phosphate, potassium dihydrogen phosphate and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable excipients may include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skimmilk, glycerol, propylene glycol, water, ethanol, and the like.The term “Siphoviruses” means a morphology of bacteriophages with a long flexible andnoncontractile tail
[0052] .The term “Podoviruses” means a morphology of bacteriophages with a short and non-contractile tail
[0052] .“Inhibiting the growth” means reducing or even halting the growth rate or even killing thebacteria. In particular, this means reducing the growth of biofilm or reducing biofilm formation or preventing biofilm formation. DETAILED DESCRIPTION OF THE INVENTION BacteriophagesThe first subject-matter of the invention is a composition comprising at least two isolatedbacteriophages that are aimed at Xylella fastidiosa (Xf), wherein each of said bacteriophagesis capable of inhibiting the growth of said Xylella fastidiosa; andthe first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequences i) to viii):i) SEQ ID NO:1 to SEQ ID NO:3ii) SEQ ID NO:4 to SEQ ID NO:6iii) SEQ ID NO:7iv) SEQ ID NO:8 to SEQ ID NO:9v) SEQ ID NO:10vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:15 to SEQ ID NO:27viii) SEQ ID NO:28 to SEQ ID NO:29.For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group ii) or iii) or iv) or v) or vi) or vii) or viii). For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group ii), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i) or iii) or iv) or v) or vi) or vii) or viii). For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group iii), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one ofthe sequences of group i) or ii) or iv) or v) or vi) or vii) or viii).For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group iv), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i) or ii) or iii) or v) or vi) or vii) or viii). For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group v), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i) or ii) or iii) or iv) or vi) or vii) or viii). For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group vi), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i) or ii) or iii) or iv) or v) or vii) or viii). For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group vii), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i) or ii) or iii) or iv) or v) or vi) or viii). For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group viii), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i) or ii) or iii) or iv) or v) or vi) or vii).Preferably, the first isolated bacteriophage of the composition according to the inventioncomprises a genome with a DNA sequence having at least 93% sequence identity to one of the sequences of one of the groups of sequences i) to viii), more preferably 94%, even more preferably 95%, 96%, 97%, 98%, 99%, 100%.Preferably, the second isolated bacteriophage of the composition according to the inventioncomprises a genome with a DNA sequence having at least 93% sequence identity to one ofthe sequences of one of the groups of sequences i) to viii), more preferably 94%, even more preferably 95%, 96%, 97%, 98%, 99%, 100%. Preferably, the first and second bacteriophages of the composition according to the invention have two genomes with a DNA sequence having less than 90% sequence identity. Advantageously, the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequences i) to viii):i) SEQ ID NO:2 to SEQ ID NO:3ii) SEQ ID NO:4 to SEQ ID NO:6iii) SEQ ID NO:7iv) SEQ ID NO:8 to SEQ ID NO:9v) SEQ ID NO:10vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:21 and SEQ ID NO:26viii) SEQ ID NO:28.Advantageously, the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequences i) to viii):i) SEQ ID NO:2 to SEQ ID NO:3iv) SEQ ID NO:9vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:21 and SEQ ID NO:26viii) SEQ ID NO:28.Advantageously, the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequences i) to viii):i) SEQ ID NO:2 to SEQ ID NO:3vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:21 and SEQ ID NO:26Advantageously, the first isolated bacteriophage of the composition according to the inventioncomprises a genome with a DNA sequence selected in the group consisting of SEQ ID NO:1to SEQ ID NO:29.Advantageously, the second isolated bacteriophage of the composition according to theinvention comprises a genome with a DNA sequence selected in the group consisting of SEQID NO:1 to SEQ ID NO:29 but does not comprise the DNA sequence selected in the groupconsisting of SEQ ID NO:1 to SEQ ID NO:29 comprised in the genome of the firstbacteriophage. Advantageously, the first bacteriophage comprises a genome with a DNA sequence selected in one of the following groups of sequences and the second isolated bacteriophage comprises a genome with a DNA sequence selected in another one of the following groups of sequences:i) SEQ ID NO:2 to SEQ ID NO:3ii) SEQ ID NO:4 to SEQ ID NO:6iii) SEQ ID NO:7iv) SEQ ID NO:8 to SEQ ID NO:9v) SEQ ID NO:10vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:21 and SEQ ID NO:26viii) SEQ ID NO:28.Advantageously, the first bacteriophage comprises a genome with a DNA sequence selected in one of the following groups of sequences and the second isolated bacteriophage comprises a genome with a DNA sequence selected in another one of the following groups of sequences:i) SEQ ID NO:2 to SEQ ID NO:3iv) SEQ ID NO:9vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:21 and SEQ ID NO:26viii) SEQ ID NO:28.Advantageously, the first bacteriophage comprises a genome with a DNA sequence selected in one of the following groups of sequences and the second isolated bacteriophage comprises a genome with a DNA sequence selected in another one of the following groups of sequences:i) SEQ ID NO:2 to SEQ ID NO:3vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:21 and SEQ ID NO:26Preferably, the first isolated bacteriophage of the composition according to the invention isselected in the group consisting of the bacteriophages deposited respectively under thefollowing DSMZ Accession Numbers : 34832, 34820, 34788, 34823, 34786, 34826, 34824,34797, 34822, 34784, 34796, 34799, 34782, 34795, 34798, 34785, 34828, 34829, 34830,34831, 34825, 34800, 34801, 34802, 34827, 34783, 34787, 34833, 34821 and the secondisolated bacteriophage of the composition according to the invention is selected in the group consisting of the bacteriophages deposited respectively under the following DSMZ Accession Numbers : 34832, 34820, 34788, 34823, 34786, 34826, 34824, 34797, 34822, 34784, 34796, 34799, 34782, 34795, 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800, 34801,34802, 34827, 34783, 34787, 34833, 34821 but is not same than the first bacteriophage.Preferably, the first bacteriophage is one of the bacteriophages of one of the following groupsof bacteriophages a) to h) and the second bacteriophage is one of the bacteriophages ofanother one of the following groups of bacteriophages a) to h):a) DSMZ Accession Numbers = 34832, 34820, 34788b) DSMZ Accession Numbers = 34823, 34786, 34826c) DSMZ Accession Numbers = 34824d) DSMZ Accession Numbers = 34797, 34822e) DSMZ Accession Numbers = 34784f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800,34801, 34802, 34827, 34783, 34787h) DSMZ Accession Numbers = 34833, 34821For example, if the first bacteriophage is the bacteriophage DSMZ 34832 of group a), the second bacteriophage is one of the bacteriophages of groups b) to h).Preferably, the first bacteriophage is one of the bacteriophages of one of the following groupsof bacteriophages and the second bacteriophage is one of the bacteriophages of another oneof the following groups of bacteriophages: a) DSMZ Accession Numbers = 34820, 34788 b) DSMZ Accession Numbers = 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34825, 34783h) DSMZ Accession Numbers = 34833Preferably, the first bacteriophage is one of the bacteriophages of one of the following groupsof bacteriophages and the second bacteriophage is one of the bacteriophages of another oneof the following groups of bacteriophages:a) DSMZ Accession Numbers = 34820, 34788d) DSMZ Accession Numbers = 34822f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34825, 34783h) DSMZ Accession Numbers = 34833Preferably, the first bacteriophage is one of the bacteriophages of one of the following groupsof bacteriophages and the second bacteriophage is one of the bacteriophages of another oneof the following groups of bacteriophages: a) DSMZ Accession Numbers = 34820, 34788 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34825, 34783 The composition according to the invention can comprise 3, 4, 5, 6, 7 or 8 bacteriophages. In this case, each bacteriophage of the composition according to the invention comprises agenome with a DNA sequence having at least 90% sequence identity to one of the sequencesof one of the groups of sequences i) to viii), preferably 93%, more preferably 94%, even morepreferably 95%, 96%, 97%, 98%, 99%, 100%, being understood that two bacteriophages ofthe composition of the invention do not comprise a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of the same group. For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group ii), the third bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group iii) or iv) or v) or vi) or vii) or viii). For example, if the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group i), the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group ii) and the third bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of group iii), the fourth bacteriophage thus comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of iv) or v) or vi) or vii) or viii).In one embodiment, each bacteriophage of the 3, 4, 5, 6, 7 or 8 phages of the composition isselected in one of the following groups of bacteriophages a) to h): a) DSMZ Accession Numbers = 34832, 34820, 34788 b) DSMZ Accession Numbers = 34823, 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800,34801, 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 34821 Two bacteriophages of the composition of the invention are thus preferably selected in two different groups a) to h). For example, if the first bacteriophage is DSMZ 34832 and the second bacteriophage is DSMZ 34823, the third bacteriophage is one of the bacteriophages of the groups c) to h). For example, if the composition comprises 8 bacteriophages, one of them being selected in group a), one of them being selected in group b), one of them being selected in group c), one of them being selected in group d), one of them being selected in group e), one of them being selected in group f), one of them being selected in group g), one of them being selected in group h). In another embodiment, each bacteriophage of the 3, 4, 5, 6, 7 or 8 phages of the composition is selected in one of the following groups of bacteriophages a) to h), at least 2 of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in two of the following groups of bacteriophages a) to h):a) DSMZ Accession Numbers = 34832, 34820, 34788b) DSMZ Accession Numbers = 34823, 34786, 34826c) DSMZ Accession Numbers = 34824d) DSMZ Accession Numbers = 34797, 34822e) DSMZ Accession Numbers = 34784f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800,34801, 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 34821 Preferably, in this embodiment, each bacteriophage of the 3, 4, 5, 6, 7 or 8 phages of the composition is selected in one of the following groups of bacteriophages a) to h), at least 2 of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in two of the following groups of bacteriophages a) to h):a) DSMZ Accession Numbers = 34820, 34788b) DSMZ Accession Numbers = 34786, 34826c) DSMZ Accession Numbers = 34824d) DSMZ Accession Numbers = 34797, 34822e) DSMZ Accession Numbers = 34784f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34825, 34783h) DSMZ Accession Numbers = 34833 Preferably, in this embodiment, each bacteriophage of the 3, 4, 5, 6, 7 or 8 phages of the composition is selected in one of the following groups of bacteriophages, at least 2 of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in two of the following groups of bacteriophages:a) DSMZ Accession Numbers = 34820, 34788d) DSMZ Accession Numbers = 34822f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34825, 34783h) DSMZ Accession Numbers = 34833Preferably, in this embodiment, each bacteriophage of the 3, 4, 5, 6, 7 or 8 phages of the composition is selected in one of the following groups of bacteriophages, at least 2 of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in two of the following groups of bacteriophages:a) DSMZ Accession Numbers = 34820, 34788f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34825, 34783Sub-speciesPreferably, the isolated bacteriophages of the composition according to the invention is virulentto one of the three main Xf subspecies (pauca (Xfp), multiplex (Xfm) and subsp. fastidiosa(Xff)).More preferably, the isolated bacteriophages of the composition according to the invention isvirulent to two of the three main Xf subspecies (pauca (Xfp), multiplex (Xfm) and subsp.fastidiosa (Xff)).Advantageously, the isolated bacteriophages of the composition according to the invention isvirulent to the three main Xf subspecies (pauca (Xfp), multiplex (Xfm) and subsp. fastidiosa(Xff)). Plant diseasesAccording to the host plants, Xf induced diseases are revealed by a large variety of symptomsthat are diverse and non-specific (can be similar to dryness effects); symptoms can be evenlyor unevenly distributed throughout the plant, affecting leave development and fruit production.It's been recognized that Xf capacity to form biofilms in the plant vessels alters water andnutrient transportation. In the most serious cases, the disease can lead to the death of theplant through branch desiccation and drying. Depending on the plant, the following symptomscan be observed:- lack of shoots and persistent petioles- sectorial drying of the leaf blade- leaf chlorosis- yellowing or reddening of leaves.Notably, for some host plants, Xf infection is asymptomatic and those infections may functionas Xf natural reservoirs.PlantsPlant species able to be infected by Xylella are listed, for example, at Annex I and Annex II ofthe Commission Implementing Regulation (EU) 2020 / 1201 of 14 August 2020 as regardsmeasures to prevent the introduction into and the spread within the Union of Xylella fastidiosa (Wells et al.) (as amended on September 28, 2023) (http: / / data.europa.eu / eli / reg_impl / 2020 / 1201 / 2023-09-28) and may include commercial crops. In the Commission Implementing Regulation (EU) 2020 / 1201:(a) ‘specified pest’ means Xylella fastidiosa (Wells et al.) and any of its subspecies;(b) ‘host plants’ means all plants for planting, other than seeds, belonging to the genera orspecies listed in Annex I;(c) ‘specified plants’ means host plants for planting, other than seeds, belonging to the generaor species listed in Annex II and known to be susceptible to the specific subspecies of the specified pest.Preferably, the plant likely to be infected by Xf is a ‘host plant’ listed in Annex I or a ‘specifiedplant’ listed in Annex II of the Commission Implementing Regulation (EU) 2020 / 1201, morepreferably a plant likely to be infected by Xf is a ‘host plant’ listed in Annex I.Preferably, the plant likely to be infected by Xf is a grapevine, olive tree, citrus tree, almondtree, coffee tree, blackberry tree, mulberry tree, maple tree, walnut tree, date tree, pistachiotree, plane tree, plum tree, pear tree or oak tree.MethodThe second subject-matter of the invention is a method of preventing or reducing symptomsor disease caused by Xylella fastidiosa in a plant, comprising contacting said plant or a part ofsaid plant with the composition according to the invention. Preferably, contacting comprises introducing bacteriophage particles into the plant. In another embodiment, contacting comprises seed treatment. Preferably, contacting comprises introducing bacteriophage into the plant by injection, by plantpuncturing, by an insect vector, via the root system by soil-based or watering system delivery,by spray, by mist, or by dust contacting the plant.Preferably, the number of said bacteriophage(s) introduced into said plant is from 1.105 to1.1010PFU / ml. Biocontrol compositionThe third subject-matter of the invention is a biocontrol composition comprising thecomposition according to the invention and a carrier.Depending growing age of tree, the thickness of the stem, the size of the root, the dosage is adjusted appropriately. A plant disease biocontrol composition can be a dry product, a substantially dry product, a liquid product, or a substantially liquid product. In some embodiments, a dry or substantially dry product can be reconstituted in a liquid (e.g., water, etc.), and then applied to a plant. In other embodiments, such a composition can be applied in dry or substantially dry form, where liquid that is already present on the plant, is concurrently applied to the plant, or that subsequently appears on the plant (e.g., by application,condensation, etc.) facilitates exposure of the bacteriophage to target bacteria. In anotherembodiment, such a composition can be applied by spray, mist, or dust on the plant. A plant disease biocontrol composition can take the form of a solution, a suspension, an emulsion, a powder, a tablet, and the like. The timing of application of a plant disease biocontrol composition is not limited, but may for instance be daily, weekly, or twice-weekly, monthly, bimonthly, or quarterly.The biocontrol composition of the invention can include bacteriophage components in a rangeof from 1.104to 1.1012plaque-forming units / g (“PFU / mL”) of the bacteriophage composition, about 1.106to 1.1010PFU / mL, about 1.106to 5.108PFU / mL, less than, equal to, or greater than about 1.104PFU / mL, 1.105, 1.106, 1.107, 1.108, 1.109, or about 1.1010PFU / mL. EXAMPLES MATERIAL AND METHODS Bacterial strain and MediaBacterial strains and culture conditions were mainly taken from the work
[0031] . Bacterial strainsused in this study are listed in Table 1 and were provided by the French Collection of Plant- associated Bacteria (CIRM-CFBP, https: / / www6.inrae.fr / cirm_eng / CFBP-Plant-Associated-Bacteria). Xylella fastidiosa (Xf) strains were cultured on PD3 prepared by substituting solublepotato starch (Sigma) at 2 g.l-1for the BSA in the PD2 medium, thus making the mediumcompletely autoclavable
[0033] . The originally described PD2 media contains Tryptone 4.0 g.l-1,Soytone 2.0 g.l-1, trisodium citrate 1.0 g.l-1, disodium succinate 1.0 g.l-1, hemin chloride 0.01 g.l-1, MgSO4·7H2O 1.0 g.l-1, KH2PO41.0 g.l-1, K2HPO41.5 g.l-1, and bovine serum albumin fraction five 2.0 g.l-1. For solid medium, Bacto-agar 12.0 g.l-1was added to PD3 broth. Cultureson solid medium were incubated at 28°C up to seven days. Liquid cultures of Xf strains wereincubated at 28°C under 160 rpm agitation. Xanthomonas strains were cultured on YPG (yeastextract 7 g.l-1, peptone 7 g.l-1, glucose 7 g.l-1, pH 7.0 to 7.2)
[0035] . For solid medium, 15 g.l-1agar was added to YPG broth. Cultures on solid medium were incubated for up to 48 h at 28 °C. For liquid cultures, Xanthomonas strains were incubated at 28 ◦C under 160 rpm agitation.For Xanthomonas albilineans (Xa) overlays, YPG soft agar medium (YPG broth with agar 7.5g.l-1 added) was used and plates incubated at 28 ◦C for up to three days. For Xf strains storage,cellular suspensions made from fresh cultures were stored at −80 ◦C in YP glycerol medium(yeast extract 5 g.l-1, peptone 5 g.l-1, glycerol 30% v / v). For Xa storage, the cellular suspensionswere stored directly in sterile distilled water at -80°C. Table 1: Strains used in this study NCBI Strain / Genotype Abbreviation Collection CodeXylella fastidiosa subsp. Xff CFBP 7970 PRJNA417585fastidiosa Xylella fastidiosa subsp. pauca Xfp CFBP 8402 PRJNA383475Xylella fastidiosa subsp. Xfm CFBP 8416 PRJNA314983multiplex Xylella fastidiosa subsp. Xfm CFBP 8418 PRJNA314986multiplex Xanthomonas albilineans Xa CFBP 2523 PRJNA338244Environmental samples for phage isolationEnvironmental samples originate from the study of
[0031] . Briefly, sewage effluents werecollected from the wastewater treatment plant of Marseille Provence Metropole (samplingauthorized by Marseille Provence Metropole); post-rain runoff waters were collected from Marseille Vieux-Port, France (GPS coordinates 43.2941456, 5.373712). Samples were filtered through a 0.22 µm pore-size nylon syringe filters and then stored at 4 ºC. Phages were then pelleted by high-speed centrifugation at 90,000 g for one hour at 4 °C. The pellet was resuspended in 10 mL of phage buffer (PB: 100 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2, 10 mM MgSO4) then stored at 4 °C. Phage enrichmentProtocols of document
[0031] were followed for phage enrichments with PD2 medium replacedby PD3. To select directly for Xf-specific phages, enrichments from the environmental sampleswere conducted on Xf cultures. Xf strains were first grown at 28 °C on solid medium for up to15 days. The bacterial lawn was harvested and transferred to 2 mL PD3 broth medium. Then 200 µL of pre-treated environmental samples were added to the cellular suspensions. Thecultures were incubated for 10 days at room temperature (RT) without agitation. Xf cells werethen removed by centrifugation (4,000 g for 15 min) and the supernatants containing phage particles were filtered through a 0.22 µm pore-size Acrodisc® filter. Enrichment products were then stored in sterile conditions at 4 °C. Phage isolation, propagation, purification and titrationThe double agar overlay technique
[0038] on the surrogate host Xa was used to isolate phagesfrom the enriched supernatants. Briefly, Xa was cultured overnight in YPG broth at 28°C under160 rpm agitation. Then 200 µL of bacterial culture were mixed with 5 mL of YPG soft agar kept liquid at 50 ◦C and 10 µL of serial 10-fold dilutions of the enrichment products were added. The mixture was vortexed and plated on YPG agar plates and plates were incubated for twoto three days at 28 °C. Phage lysis plaques were selected and plugged off from the agarsurface bottom using a 1000 µL tip and then resuspended in 200 µL of PB. Tubes were vortexed and incubated under 160 rpm agitation for at least 2 h. Cells were lysed by the addition of 5 µL of chloroform (vortexed for 15 s and incubated for 5 min at room temperature). A centrifugation step (10,000 g, 10 min) was done to pellet cell debris and chloroform. The aqueous supernatant (phage lysate) was then recovered and stored at 4°C. Re-isolation wasperformed on Xa overlay at least three times, repeating plugging and resuspension steps toselect single plaques with a regular shape. Phage particles were then propagated by adding 100 µL of phage suspension to a 6 mL Xaliquid culture in YPG broth at an Optical Density at 600 nm (OD600) of 0.1. This mix wasincubated at 28 °C under 160 rpm shaking during 48 h, then cells were removed by centrifugation at 5000 g for 15 min and supernatants were filtered through a 0.22 µm pore size Acrodisc® syringe filter. For phage purification, phage particles were pelleted three times (20,800 g, 1 hour at 4ºC). Between each centrifugation, the phage pellets were resuspended in PB. Final phage suspensions were filtered through a 0.22 µm filter and stored at 4 °C.Phage titration by the double agar overlay plaque assay was performed according to
[0038] .Phage titers are expressed in Plaque Forming Unit per mL (PFU / mL). PCR In order to reduce the number of isolated phages by eliminating phages too similar topreviously published ones, a selection was operated with specifics primers designed by
[0031] .Thus, whenever a PCR product was detected, the considered phage was excluded from downstream analyses. The remaining phages were considered as potential new phages. A second PCR screening of these remaining phages was performed after genome sequencing a first batch of phage that allowed to design new sets of specific primers. Specific primers are the following: Table 2: Specific primers used for the pre-selection of isolated phages in bold type, otherspecific primers of our collection. Alme primers also amplify Oroshi, and Oroshi primers alsoamplify Alme and Aoi Name Sequence (5’->3’) Tm °C Amplicon sizeCota F GCGCAGTCATGAGATCGAGA53.9 307Cota R GTTGAGTGCACCGAGAGTGA Usme F TGGGTCACTTCGGTGTTACG53.7 320Usme R GTGGTGAAAGGTGCGGTTTC Bacata F CGTAGTCGCGATTGTCGGTA53 340Bacata R ACCACTGCTGACGTTCGATT Bosa F GCTACCGGTACGACTACGTG57 362Bosa R GATCTGGAAACAGCCGTCCA Aoi F TTTCGGTGGCTTGGATTTT 55.6 301 Aoi R ATTTGCGAGAAGTACAACTG 54.0 Alme F ATCCCCTTTGCATCTTCAAT 55.9 324 Alme R TTCCGTCATCTAAGGGAATC 54.2 Horst F TAAGCCCTTCGTAAAGTTCT 54.0 413 Horst R AAGCATTGAAAAACGAAACG 54.0 Learch F ACTAGGAGAAGATTAGATGGC 53.9 448 Learch R CTGGTCCGTAAGGGTG 52.8 Oroshi F GATATACGAGCAACGTCTTC 53.8 493 Oroshi R ATTTGCGAGAAGTACAACTG 54.0 Darbon F GTTATTGCGACGGTTAAAGA 54.1 442 Darbon R TGGATTAAATACTACGCCGA 54.0 Arval F CTGGCAAAACAACCTCATTA 54.1 394 Arval R AGTTACCACGAGGATTTCAT 54.1 Caracole F GTAGATGTTCGGTTCGGTA 54.1 333 Caracole R CAAGCCAATTCACATCGTAG 54.8 Sov F ATTCTGTTTCAACAACCCTG 54.0 456 Sov R CAGACATCCAGGAACTTTTC 53.9 Firost F CATACCTACGATATACGGCA 54.0 300 Firost R GACTACTCGCTCTACATCAA 54.1 Larco F ATGGCCTTTCTTCATTCTTG 53.8 448 Larco R AGAAAATATCCGGGTGTGAT 54.1 Tourse F TAGATTGTGATTCACGCAAC 54.1 345 Tourse R GAAGACGAAAAGGCAAAAAC 54.0 Boscavo F ATATTGAACTCCGAAGTCGT 54.2 333 Boscavo R CTACCAAACTGGGGGATAG 53.9 Phage host range According to the clustering bioinformatic analysis, additional bacterial strains were tested for their sensitivity to the phage collection. Strain names and culture conditions are given in the table below: Table 3: Summary of additional strains tested and conditions of incubation. Strain Media T°C Agitation for liquidculture Pseudomonas aeruginosa PAO1 LB 37°C 170 rpmPseudomonas aeruginosa PAK LB 37°C 170 rpmPseudomonas aeruginosa Pa14 LB 37°C 170 rpmStenotrophomonas maltophilia DSM 24970 LB / LPG 37°C 170 rpmStenotrophomonas maltophilia DSM 50170 NB 37°C 170 rpmPseudomonas fluorescens CFBP2102 LPG 28°C 160 rpmPseudomonas syringae pv. Aptata CFBP5467 LPG 28°C 160 rpmPseudomonas syringae pv. Tomato CFBP7438 LB 28°C 160 rpmPseudomonas syringae CFBP8526 LPG 28°C 160 rpmPseudomonas syringae CFBP8533 LPG 28°C 160 rpmBacteria were grown on plates (LB, LPG or NB) for one day at 37°C for P. aeruginosa andStenotrophomonas strains, and at 28°C for P. syringae and P. fluorescens strains. Liquidprecultures were made O / N from individual colonies and left to grow under the conditions indicated in Table 3. Culture was started at OD600 of 0.05 in 5 mL of medium and left to incubate at the same condition as the preculture until a minimal OD600600 of 1.5 was reached.Media and incubation conditions were adapted to the used strains. Xa overlays wereperformed in parallel as positive controls. Efficiency tests: liquid, biofilm, overlays Overlay assaysSeveral parameters were tested to develop the overlay method with Xf strains:- media: PWG-M (
[0051] ) and PD3- final bacterial OD600 nm: 0.1, 0.25, 0.5- percentage of agar in the soft layer: 0.5 and 0.75 %- soft agar thickness: 3, 5 and 7 mL- without overlayAfter optimization, the overlay assays were performed as follows: X. fastidiosa strains Xff, Xfpand Xfm were cultured at 28 °C on PD3 agar plates up to 7 days. Then, the cultures weresuspended into PD3 and the OD600 was measured. The volume of Xf needed to achieve a finalOD600 of 0.25 was calculated for 7 mL of 0.75% PD3 soft agar poured over a layer of PD3 agar and left to dry. Then, a 15 µL volume of phages at maximum concentration was deposited on this overlay and left to dry. As negative control 15 μl of phage buffer were also spotted on top of each top-agar culture. Spots were dried at room temperature and the plates incubated up to 10 days at 28 °C. Kinetics in liquid media Proof of conceptSeveral parameters were tested to optimize at first the growth of Xf strains in liquid culture andthen the infection by phages:- Initial OD600: 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5- With or without shaking at 160 rpm- Initial titre of phages: 105, 107, 108, 109, 1010 PFU / mL- Phages: Bacata, Learch, Aoi, Arval, Oroshi, (Xylphi-PDTM-PDTM https: / / inphatec.com / Xylphi-PDTM_pd) The strains were cultured on PD3 medium and then resuspended in PD3. OD600of these cultures were measured in order to inoculate 4 mL liquid medium at the desired OD600 into glass tubes. Incubation was carried out at 28°C, and phages were added 24 hours after Xylella inoculation. Growth was monitored for at least 10 days through OD600 measurements. Culture assays in 96-well platesXylella strains were cultured on PWG agar plate for 7 days, then cultured again during 7 days.Liquid assays were performed in 96-well ELISA plates. Xylella strains were diluted to reach anOD600 of 0.1, phages were added at T0 at a final concentration of 1010PFU / mL. Culture plates were incubated at 28°C under 200 rpm agitation and measurements were made every 24 h for 7 days. The late addition of phages was also tested (D4 and D7 after bacterial inoculation). Biofilm assays All biofilm assays were carried out in parallel with a kinetics test in 96-well plates. The conditions were therefore identical to those described above except that the plate material waspropylene and the absence of agitation during incubation. At the end of the 7-day incubationperiod, supernatants were removed, and wells were gently rinse twice with 200 µL of deionizedwater. Then, 200 µL of 0.1% crystal violet was added to each well and allowed to incubate for 15 min at room temperature under static conditions. Cristal violet was removed and gently rinsed with 200 µL of deionized water twice. Labelled exopolysaccharides were solubilized with 200 µL of 100% alcohol and transferred into ELISA plates. Plates were then read on a spectrophotometer using KC4 software (Bio-Tek, Instruments, Winooski, Vermont, USA). Negative Staining and Transmission Electron Microscopy and Phage morphological characterization To obtain the sample to be analyzed under the microscope, a phage isolation step wasperformed from an overlay of Xa (as described in isolation step). Up to a dozen of phage-forming lysis plaques were plugged off from the agar surface and resuspend in 2 mL of PB.After vortexing and incubation 2 hours under agitation 160 rpm, 20 µL of chloroform was added,homogenized, and remove by 10 min centrifugation at 10000 rpm.1900 µL of supernatant wasfiltered through 0.22 µm pore size syringe filter. The phage lysate was stored at 4 °C.Compared to an aliquot of phage liquid propagation, the lysis plaques method allows to limit cell debris which allows a much better image quality and to check the homogeneity of lysis plaques before microscopy. However, the concentration is more difficult to estimate and requires a titration step to be accurate. 2 mL of phage preparations were pelleted by a centrifugation step (1 hour, 20,800× g, 4 ◦C). Pelleted phages were washed with 2 mL of TEM-buffer (0.22 µm filtered 0.1 M NH4-acetate (pH 7)), pelleted again three times and concentrated in a final volume of 20 µL TEM-buffer.Formvar / carbon-coated copper grids were prepared at the Institut de Microbiologie de laMéditerranée (IMM) Microscopy facility. Shortly, 4 µL drops of diluted phage suspensions were spotted on glow discharged carbon-coated grids (EMS) and let stand for 3 min. The grids were then washed with two drops of 2% aqueous uranyl acetate and stained with a third drop for 2 min. Grids were dried on filter paper. Observations were made on an FEI Tecnai G220 TWIN (200KV), laB6, Gatan Oneview 4k × 4k CMOS transmission electron microscope and digital acquisitions were made with a numeric camera (Eagle, FEI). Tail and capsid lengths wereobtained by measurements via ImageJ software
[0046] . Statistics were performed on R in orderto compare phages length between them. The conditions for performing an ANOVA were verified and invalidated, the quantitative variable does not follow a normal distribution for all the populations compared (Shapiro-Wilk test p-value < 0.1 therefore rejection of the hypothesis H0: the sample follows a normal distribution). The nonparametric Kruskall-Wallis test followed by the nonparametric Wilcoxon post hoc test were performed using the Bonferroni and Holm correction for p-value adjustment. Plots are made with R. Phage DNA purificationTotal phage DNA was extracted according to Gendre et al.
[0036] . Briefly, the non-encapsidatednucleic acids of 200 µL of purified phages in PB were removed by the addition to the purified phage suspension of 20 µL of DNAse I (6 mg / mL, EUROMEDEX), 2 µL of RNAse A (4 mg / mL, Promega) and 4 µL of DpnI restriction enzyme (20,000 U / mL, New England Biolabs). The sample was incubated for 1 h at 37 °C then for 20 min at 65 ◦C under shaking to inactivate the DNAse I. To release Phage DNA, the capsid was damaged by the addition of 20 µL of 10% SDS and 20 µL of proteinase K (50 µg / mL, EPICENTRE) and heating at 56 °C for one hour. The sample volume was completed with PB buffer q.s.600 µL. Phage DNA was extracted by adding 600 µL phenol / chloroform / isoamyl alcohol (25:24:1, Sigma-Aldrich) and then vortexing the sample for 30 s. After centrifugation (10,000 g, 10 min, 4 °C), the upper aqueous phase containing the nucleic acids was recovered. This step of extraction was repeated twice. The final aqueous phase-containing DNA was then ethanol-precipitated and finally resuspended in 50 µL DNAse / RNase-free water for storage at −20 ◦C. Phage DNA was quantified with a Nanodrop spectrophotometer. Phage genome sequencingDNA sequencing was realized at the IMM Transcriptomic and Genomic facility following theprotocol of Gendre et al.
[0036] . Phage dsDNA was first quantified with a Qubit™ fluorometer incombination with the Qubit™ dsDNA HS Assay kit (Invitrogen). Around 750 ng of purifiedphage genomic DNA was then mechanically fragmented in 50 µL microtubes using a Covaris M220 sonifier with the following parameters: peak power 75W, duty factor 10%, Cycles / Burst 200. Fragmentation (size and distribution profile) was assessed with a Tapestation 4200 System (Agilent) in combination with the D5000 DNA ScreenTape System (Agilent). DNA libraries for high throughput sequencing were prepared from fragmented DNA with theNEBNext® Ultra™ II DNA Library Prep kit for Illumina® (Biolabs) according to themanufacturer’s protocol. DNA libraries (size and distribution profile) were assessed with a Tapestation 4200 System (Agilent) in combination with the D5000 DNA ScreenTape System (Agilent). DNA libraries were then diluted at 4 nM in the appropriate buffer. Paired-end (2 × 150 bp) DNA sequencing was performed on the MiSeq sequencer (Illumina®, San Diego, CA, USA) with a MiSeq v2 (300-cycles) flow cell (Illumina®, San Diego, CA, USA) according to the manufacturer’s protocol. Genome clustering For genome clustering, vContact2 0.9.19 (with the ProkaryoticViralRefSeq201 database accessed on 26 October 2022), a taxonomy classification tool that performs network-based clustering of viral sequences and specifically designed to work on metagenomics data was used. vConTACT2 uses whole-genome gene-sharing profiles between a reference database of curated and annotated bacteriophages and the user’s viral sequences to build networks forphage taxonomy
[0045] . Genomes are grouped based on protein content and similarity, and theresulting clusters are largely concordant with the International Committee on Taxonomy ofViruses (ICTV) viral taxa
[0032] . vConTACT2 compares the protein sequences of the studiedphages to the BLASTp virus database. Protein clustering is performed by the MCL (Markov cluster) tool built on the basis of shared homologous proteins. ClusterONE then performs the clustering of the viral genomes based on the MCL results. The clustering scores (PC or VC) were calculated by Vcontact2. Taxonomic classification Virus Classification and Tree Building Online Resource (VICTOR) was used to better understand the phylogenetic relationships between phages of the same VC with the amino acid option. When relevant, the VICTOR analysis is expanded with phages close to those contained in the VC in the ICTV taxonomic classification. Phage sequences were obtained from the NCBI nucleotide database. This tool is available online: https: / / ggdc.dsmz.de / victor.php (accessed on 15 November 2022). VICTOR is a method forthe genome-based phylogeny and classification of prokaryotic viruses
[0041] . It performs allpairwise comparisons of the protein sequences of the phages studied using the Genome-BLAST Distance Phylogeny (GBDP) method
[0040] under settings recommended for prokaryoticviruses
[0041] . All distances are calculated from matches (local alignments) between twoproteome sequences. These matches are known as HSPs (high-scoring segment pairs). The branch lengths of the resulting VICTOR trees are scaled in terms of these distance formulas:d4 is the sum of all identities found in HSPs divided by overall HSP length (correspond toGenome to Genome Distance Calculator (GGDC) formula 2) and d6 is the sum of all identities found in HSPs divided by total genome length (correspond to GGDC formula 3). The resulting intergenomic distances were used to infer a balanced minimum evolution tree with branchsupport via FASTME including SPR postprocessing
[0039] for each formula. Branch support wasinferred from 100 pseudo-bootstrap replicates each. Trees were rooted at the midpoint
[0034] and visualized with ggtree
[0048] . A tree with on average higher support values is on averagebetter resolved. The D6 formula, which is recommended when amino-acid sequences of prokaryotic viruses are analysed, was preferentially chosen unless it presented too many contradictions with the VIRIDIC analyses and the current ICTV ranking. In this case, the D4 formula was chosen as a replacement. Taxon boundaries at the species, genus and family level were estimated with the OPTSILprogram
[0037] , the recommended clustering thresholds
[0041] and an F value (fraction of linksrequired for cluster fusion) of 0.5
[0042] .This proposition of classification was confronted with dRep and VIRIDIC analyses based on nucleic acids.dRep software
[0044] forms clusters with organisms that share similar DNA content based onaverage nucleotide identity (ANI). To do this, dRep relies on a fast primary algorithm (Mash), complemented by a more sensitive algorithm (ANIm) that is more robust to incomplete genomes. We used dRep with the default settings except for the primary clustering thresholds set to 0.7 and secondary clustering set to 0.95 to best match the thresholds set by the International Committee on Taxonomy of Viruses (ICTV) for genus and family classification
[0047] . According to ICTV recommendations, the phage’s taxonomy was further delineated using ViralIntergenomic Distance Calculator VIRIDIC
[0043] , (Available online: http: / / rhea.icbm.uni-oldenburg.de / VIRIDIC / accessed on May 2023) which calculates the virus intergenomicdistance under the BLASTn default settings. It also calculates intergenomic similarities based on the percentage of identity between two genomes determined by BLASTN. Defaults parameters were used : 95% and 70% for the species and genus threshold, respectively, and the following BLASTN parameters: ‘-word_size 7-reward 2-penalty-3-gapopen 5-gapextend 2’. VIRIDIC is said to be more efficient in estimating the relatedness between very distant phages that would be overestimated by other tools. Finally, this software also calculates the aligned fractions for each genome in a pair (equivalent to coverage) and the length ratio between the two genomes. Protein clusters analysis We have extracted the information from the vConTACT2 PCs on which it is based to form this VC in order to analyze them in detail to select proteins which are responsible of the hostXanthomonas or Xylella specificity. Occurrences are attributed for each Protein Cluster (PC)in a Viral Cluster (VC) determinate. Core genes are PC presents in all phages of a determined VC; Soft-core genes are PCs presents in at least 95% of phages in a VC; Shell genes are the PCs presents between 5 and 95% of the considered genomes and Cloud genes are rare PCs which are present in less than 5% of the phages in a VC. Then, all the Cloud PCs are excluded from the study unless those which are presents in several VCs. All PCs with less than 50% ofphages of Xanthomonas or Xylella are also excluded. PCs shared between several VCs arethen studied one by one. RESULTS Phages Phages were isolated from water samples taken from the Marseille Provence Métropole wastewater treatment plant and from rainwaters collected at the Vieux Port in Marseille, France (GPS Position 43.2941456, 5.373712).These samples were then independently enriched with the four strains of Xylella fastidiosa (Xf)present around the mediterranean bassin: CFBP 7970 Xylella fastidiosa fastidiosa (Xff), CFBP8402 Xylella fastidiosa pauca (Xfp), CFBP 8416 Xylella fastidiosa multiplex (Xfm) andCFBP8418 Xfm. These enrichments were successively isolated three times using the overlay method on semi-solid medium using Xanthomonas albilineans as a propagating strain.The phage code was designed according to these steps and was constructed as follows:- The reference to the original sample: combined sewer system (Station d'Epuration RéseauUnitaire, SERU), sanitary sewer system (Station d'Epuration Réseau Sanitaire, SERS), Vieux Port of Marseille (VP2).- The Xf strain on which the sample was enriched: 7970, 8402, 8416, 8418.- The (arbitrary) number of successive isolations: first isolation.second isolation.third isolation.The phages studied always result from the third isolation, which number is omitted for clarity. Finally, for ease of reference, some phages have been renamed and these names will be used hereafter (Table 4).Table 4: Correspondence between isolation codes and names of newly isolated phagesIsolation code NameSERS 79701.1 LearchSERS 84024.1 KarstSERS 84024.2 HorstSERU 79701.1 CaracoleSERU 79702.1 SERU 79703.1 SERU 79704.1 SERU 79705.1 SovSERU 79709a1.1 SERU 79709b1.1 SERU 797010.1 SERU 797011.1 SERU 797012.1 SERU 797013.1 SERU 797014.1 SERU 797015.1 SteppeSERU 84021.1 OroshiSERU 84022.1SERU 84023.1 DarbonSERU 84027.1 ArvalSERU 84181.1 FirostSERU 84185.1 LarcoSERU 841811.1 TourseSERU 841816.1 BoscavoVP279702.1 AoiVP284181.1 AlmeIn this work, we also included several phages isolated previously and described in
[0031] . Theyare summarized in Table 5 and will be referred to hereafter by their name.Table 5: Correspondence between isolation codes and names of previously isolated phages
[0031] Isolation code NameFC03 UsmeFC08 OlayaFC12 BacataFC14 FC15 BolivarFC17 UsaquenFC23 CotaFC24 TejaFC25 AlcalaFC28 SopoFC30 TabioFC31 FC33 FC34 CajicaFC39 TenjoFC41 SubaFC42 FC44 BosaFC47 FontebonFC57 Sumapaz Clusters Genome de novo assembly and annotation Assembly was performed on the following phage genomes: Learch, Karst, Horst, Caracole, SERU 79702.1, SERU 79703.1, SERU 79704.1, Sov, SERU 79709b1.1, SERU 797010.1, SERU 797011. 1, SERU 797012.1, SERU 797013.1, SERU 797014.1, Steppe, Oroshi, SERU 84022.1, Darbon, Arval, Firost, Larco, Tourse, Boscavo, Aoi, Alme. quality assessment and cleaning of the raw reads, quality assessment of the cleaned reads, assembly of these reads followed by quality control steps, circularization of the contigs, quality assessment of the assembly, search for similarity between the phage genomes by BLAST alignment. The sequences obtained turned out to be of good quality for all the sequenced genomes, except one (see below), and the assembly process allowed to obtain single molecule genomes compatible with the sizes of phage genomes (between 42 and 64 kbp). Only Boscavo phage genome assembly resulted into 3 contigs (contig_1 of 47,614 bp, contig_2 of 6,984 bp, contig_3 of 6,413 bp), which could be explained by the poor quality of the sequencing reads. Given its size, contig_1 could correspond to a complete phage genome by itself, we thus checked that contigs_2 and 3 corresponded to phage sequences (presence of capsid protein encoding genes). These phage-origin contigs could be the result of a contamination by another phage. However, if this was the case, there should be a secondwhole genome, unless the genomes differ only in these fragments. Another round of DNAextraction and sequencing should thus be performed in the future. Among the 25 genomes assembled, only the genomes of phages SERU 797012.1 and SERU 7970 14.1 were strictly identical. Phage SERU 7970 14.1 will therefore be excluded from further analysis. With these initial assemblies, we performed a genomic comparison tree by including the phages from our collection as well as the genomes of the four virulent phages active againstXylella fastidiosa fastidiosa previously characterized
[0028] (Figure 1) using the dRep software.dRep makes it possible to group organisms that share similar DNA content in terms of averagenucleotide identity (ANI)
[0044] . To achieve this, dRep relies on a fast primary algorithm (Mash),complemented by a more sensitive algorithm (ANIm) that is more robust to incomplete genomes. We used dRep with the default parameters, with the exception of the primary clustering threshold set to 0.7 and the secondary clustering threshold set to 0.95 to best match the thresholds set by the International Committee on Taxonomy of Viruses (ICTV) forclassification into genus and family
[0047] .Altogether, 42 phage genomes were included in the dataset. According to dRep, the genomes are divided into seven completely independent branches, confirming the genetic diversity of the sequenced genomes. There are 9 groups formed by phages with more than 70% identity, suggesting 9 distinct genera according to the ICTV. The classification will be discussed in more detail in the section describing the phylogenetic description of the phages.We then compared all these genomes with VIRIDIC
[0043] , which is well adapted to phylogeneticclassification of phages. It also calculates intergenomic similarities based on the percentage of identity between two genomes determined by BLASTN. VIRIDIC is said to be more efficient at estimating the relatedness between very distant phages that would be overestimated by other tools. We will find examples in our datasets. Finally, this software also calculates thealigned fractions for each genome in a pair (equivalent to coverage) and the length ratiobetween the two genomes. VIRIDIC classified the genomes present in the dataset into 14 genera: 1. Bosa and Learch, 2. Boscavo, 3. Sov, 4. Kart and Horst, 5. Suba and SERU 84022.1, 6. Tourse, 7. Darbon, 8. Cota, 9. Firost and Prado, 10. Steppe, Arval and the nine SERUs (Caracole, SERU 79702.1, SERU 79703.1, SERU 79704.1, SERU 79709b1.1, SERU 797010.1, SERU 797011.1, SERU 797012.1, SERU 797013.1), 11. Paz, 12. Salvo, Bacata, Aoi, Alme, Oroshi, 13. Sano, 14. Tenjo, Larco, Tabio, Sopo, Usme, Olaya, Bolivar, Usaquen, Alcala, Fontebon, Sumapaz. This confirms the over-estimation of kinship made by dRep, which formed only 9 groups with a threshold of 70%. Based on this analysis, we decided to entrust the annotation of the Learch, Horst, Caracole, Sov, Oroshi, Darbon, Arval, Firost, Larco, Tourse, Boscavo, Aoi and Alme phages. Between 52% and 75% of the genes in each genome were functionally annotated. Based on annotations, we were able to confirm the absence from all the sequenced genomes of problematic annotated proteins such as toxins, virulence factors and antibiotic resistance, which would hinder the use of these phages in biocontrol. The Sov phage was the only one to possess a gene encoding an integrase protein, suggesting its ability to operate a lysogenic cycle. This is a delicate point in the context of biocontrol. Unlike virulent phages, which only perform lytic cycles, a temperate phage will be able to perform a lysogenic cycle, characterised by the integration of its genome directly into the bacterial genome and transmission during cell division. Viral clusters and phylogenetic description of phage genomes Below a certain level of similarity between phage genomes (65% for VIRIDIC), analyses basedon proteins should be used, as they are better able to identify distant relationships
[0043] . Inaddition, comparisons based on amino acids provide a more functional viewpoint, which is important when looking for phage efficacy on a given host. We therefore used a clustering method based on distant protein homology. This method makes it possible to bring together phages that have diverged genetically but retain protein homologies and therefore have common functions. To do this, we combined two approaches based on the whole proteome: vConTACT2 andVICTOR (whole genome analysis - amino acids). vConTACT2 compares the proteinsequences of the phages studied with the BLASTp virus database. The proteins are clustered using the MCL (Markov cluster) tool. ClusterONE then clusters the viral genomes based onthe MCL results. vConTACT2 was therefore used to locate our Xf and Xa infecting phages inViral Clusters (VCs) built on the basis of shared homologous proteins. We then used VICTOR to compare all the phages in the same VCs with each other. VICTOR performs all pairwise comparisons of the protein sequences of the phages studied using the Genome-BLAST Distance Phylogeny (GBDP) method. It then constructs a phylogenetic treefrom the intergenomic distances obtained. The branch lengths of the resulting VICTOR trees are scaled in terms of these distance formulas: the D6 formula, which is recommended when amino-acid sequences of prokaryotic viruses are analyzed, was preferentially chosen unless it presented too many contradictions with the VIRIDIC analyses and the current ICTV ranking. In this case, the D4 formula was chosen as a replacement. Taxon boundaries at the species, genus and family level were estimated with the OPTSILprogram
[0037] with the recommended clustering thresholds
[0041] .This method enabled us to distribute our phages in six distinct VCs. Four of them were Siphovirus clusters VC_1, VC_2_1, VC_3, and VC_24, and two are Podovirus clusters VC_58 and VC_135. It is interesting to put this coverage into perspective by considering the 16 VCs containingXanthomonas and / or Xylella phages in vConTACT2. Our dataset covers 5 of the 6 VCscovering most of Xanthomonadacaes phage genomes. Each of these VC contains between 10 and 25 Xanthomonadaceae phages. The other 9 are more anecdotal with only 1 to 3Xanthomonas and Xylella phages. The genetic diversity of the phages making up our datasettherefore appears to be fairly representative of the genetic diversity of the Xanthomonas andXylella phages (Xa / Xf phages) characterized so far.The phylogenetic tree based on DNA comparison (Figure 1) is consistent with the viral clusters formed from vConTACT2 amino acid comparisons (Figure 2). Thanks to this analysis, phage Cota, which formed a separate branch in the phylogenetic tree built on the comparison of DNA sequences, was now linked to a VC shared with other phages in our collection (VC_58). Cota displayed a divergent genome but the protein sequences were conserved with the phages contained in VC_58. It may therefore have had a different evolutionary history. This phage was isolated from a plant sample enriched on Xfm. For each of the six above mentioned VCs, we are providing a brief presentation of the VC predicted by vConTACT2, carry out a VICTOR analysis of the phages in these VCs and observe in parallel the ICTV taxonomic classification of the phages already characterised. VC_1 (Figures 3 and 4) VC_1 is the largest of the four siphovirus VCs and includes 23 phages (vConTACT2 database from 2020). Horst, Darbon and Tourse are the newly isolated phages grouped together in this VC, which already included the Suba phage. The phages in this VC display a fairly high host diversity including, one Achromobacter, one Burkholderia, one Paracoccus, two Acinetobacter,two Rhodobacter, two Stenotrophomonas, four Pseudomonas aeruginosa and tenXanthomonas phages. Despite this diversity, Xanthomonas phages were well represented inthis VC (43%). The GBDP phylogenomic tree recommended by VICTOR is the one deduced using the D6 formula and producing an average support of 62%. The OPTSIL grouping gave fourteen species groups. At the genus level, one group was obtained, whereas four are alreadydescribed in the ICTV database (Septimatrevirus, Kilnuavirus, Titanvirus and Lokivirus). A sub-family and a family have been predicted. Loki, IME_AB3 and XAJ2 were rooted at the base of the dRep tree, meaning that they are very distant in nucleotide sequence (Figure 3). They were nevertheless both included in VC_1 by vConTACT2. VICTOR amino acid analysis branched the two phages IME_AB3 and Loki independently in the tree, confirming that these phages are the most distant from the others. However, XAJ2 is included in the function-based tree showing functions closer to the others. All the phages in this VC belong to the Caudoviricetes class. To propose a classification, we relied on VIRIDIC clustering, which is adapted to this purpose and compare the nucleotide sequences of the phages (Figure 4). In this cluster, VIRIDIC considered 13 genera, some of which having only one representative, such as phAxp-1, IME_AB3 and Loki, which are grouped together in the ICTV genus Lokivirus, KL1, which already forms the genus Kilunavirus, PmasS-R3, Horst, Suba, Tourse and XAJ2, which are not affiliated to any genus. RcSpartan and RcTitan are grouped together in a genus called Titanvirus, while Langgrundblatt1, Langgrundblatt2 and Pfeifenkraut belong to a genuswhoch is not describe in the ICTV classification. Finally, two other genera were predicted, each grouping four phages which are combined in the already existing genus Septimatrevirus with PaMx42, Samson, Darbon, and vB_Xar_IVIA-DoCa1 for the first one and Pae-Kakheti25, vB_PaeS_SCH_Ab26, vB_SmaS-DLP_1, vB_SmaS-DLP_2 for the second. To classify our newly isolated phages, we propose to create 3 new genera: Subavirus containing the phage Suba; Horstvirus containing the phage Horst; and Toursevirus containing the phage Tourse. The Darbon phage would naturally be classified in the Septimatreviruses, the branch to which it belongs. Of note, VICTOR predicts only one genus, whereas there are already several in the ICTV classification. In contrast, VIRIDIC sometimes predicts several genera, even though they may group together in a single ICTV genus. The underestimation by VICTOR and the overestimation by VIRIDIC of the number of genera will be encountered in the other VCs and are due to the different methods used by these tools. VC_2_1 (Figures 5 and 6) VC_2_1 is a very small VC which contains only seven Siphovirus phages. Five phages in this VC are Pseudomonas phages (aeruginosa, oryzihabitans) and one is a Stenotrophomonasphage. Phage Sov is the only Xanthomonas phage in this VC. The phages in this group haveintegrases and other genes (phage repressor for example) suggesting that they are temperate phages. The GBDP phylogenomic tree deduced using formula D6 gave an average support of 48% (Figure 5). Although not included in VC_2_1, we added the Vojvodinavirus genus, which belongs in the Rabinowitzvirinae subfamily, to complete the tree and to increase bootstrapsignificance. All the phages in this tree are included in the Mesyanzhinovviridae family and theRabinowitzvirinae subfamily, with the exception of Sonora, which is the only linked to the Caudoviricetes but is nevertheless clustered in VC2_1. The OPTSIL clustering produced three groups of species. These phages are classified in a single genus, when 2 already exist in theICTV (Yuavirus and Vojvodinavirus). The dRep tree of these genomes is consistent with thephyla shown by VICTOR (Figure 5). The VIRIDIC analysis fits perfectly with what is currently described by the ICTV (Figure 6) and with the phyla of the VICTOR tree by grouping the phages into two genera: the first, named Yuavirus, includes LKO4, PAE1, Yua, MP1412 and the second, Vojvodinavirus, includes theBordetella phages CN1, CN2, FP1, MW2, etc. We naturally propose that Sov should join theYuavirus genus. VC_3 (Figures 7 and 8) VC_3 is a small VC of 13 Siphoviruses including Learch, Boscavo and Bosa. There is a verygood representation of Xanthomonas phages with nine phages (69%), two Strenotrophomonasphages and two Pseudomonas aeruginosa phages.In our preliminary lysogeny tests, the phages Boscavo and Bosa showed no sign of integration. However, the Learch phage, which is very close to AXL1 (Figure 7), showed the same characteristics as the latter: genomic analysis concluded it was a virulent phage whereas it showed non-stable maintenance experimentally using PCR detection. This remains to be confirmed. This GBDP phylogenomic tree deduced using formula D6 gives an average support of 53%. The OPTSIL grouping gave nine groups of species, two groups of genera, two groups of subfamilies and one family. All the phages in this VC belong to the Caudoviricetes; Mesyanzhinovviridae; Bradleyvirinae with the exception of the genus Pamexvirus (PaMx28, PaMx74) currently classified in the Caudiviricetes which could also be classified in the Bradleyvirinae. Here, the genusPamexvirus does not agree with the tree because these two phages are distributed in two verydistinct branches, whereas this phylum has 100% support. We have extended the analysis of the VC_3 phages to include all the phages in the Bradleyvirinae subfamily, thus including the Abidjanvirus and Epaquintavirus genera, even though we can see that they are branched off separately from the others, justifying their absence from VC_3. The tree obtained with dRep is once again consistent with that obtained with the protein sequences (Figure 7). The VIRIDIC heatmap (Figure 8) is generally consistent with the above analyses. However, it separates PaMx28 and PaMx74 into two distinct genera. Unlike the VICTOR tree and ICTV, it places Elanor and Xoo-sp2 in the same genus. We propose that the Boscavo and Learch phages should be attached to the Bradleyvirinae subfamily. Learch can be integrated into the Bosavirus genus (confirmed by VIRIDIC, figure 8). Before proposing the creation of a new Boscavovirus genus, its genome needs to be completely assembled to confirm these results. VC_24 (Figures 9 and 10) The small VC_24 contains only eight Siphoviruses, four of which belong to our collection:Oroshi, Aoi, Alme and Bacata. Notably, Oroshi, Aoi, Alme phage genomes are less than 92%identical to previously published Bacata genome, therefore representing a new group ofphages. This VC has the particularity of containing only Xanthomonadaceae phages, 87% ofwhich infect Xanthomonas and Xylella. More specifically, it contains one Stenotrophomonasphage, three Xylella phages (Bacata, Sano and Salvo) and four Xanthomonas phages.The resulting GBDP tree has an average support of 50%. The OPTSIL grouping gave four groups of species, one genus, one family and one subfamily. The phages in this VC all belong to the family Casjensviridae, which itself contains two genera, Salvovirus and Sanovirus. Oroshi, Aoi and Alme can join Bacata within the Salvoviruses (classification confirmed by VIRIDIC).VC_58 (Figures 11 and 12)VC_58 contains 38 phages of Podovirus morphology. It includes the Caracole, Steppe, Arvaland Firost phages and the Cota phage already characterised. This VC includes phages with various hosts: one Aquamicrobium, one Sphingomonas, two Burkholderia, two Escherichia,three Caulobacter, three Stenotrophomonas, four Pseudomonas (including a phage of P.syringae, which is an opportunist of certain tree species, a phage of P. tolaasii that causesbacterial spotting of fungi, a phage of a Pseudomonas isolated from Prunus avium and a phageof P. fluorescens sometimes described as "Plant Growth-Promoting Rhizobacteria" but alsocapable of food contamination of cheeses in particular), six Ralstonia, 13 Xanthomonas andthree Xylella (Cota, Paz, Prado).Taking this VC as it stands and despite its diversity, Xanthomonas and Xylella phages are wellrepresented (42%). However, this VC is made up of two main branches that could be considered as two sub-clusters (Figure 11). Our phages are grouped in just one of these branches, which nevertheless contains 22 phages: one Aquamicrobium, one Sphingomonas, two Caulobacter, three Stenotrophomonas, 13 Xanthomonas, three Xylella phages. Thisbranch is made up of 69% Xanthomonas and Xylella phages.The GBDP phylogenomic tree of this VC has an average support of 55%. The OPTSIL clustering yielded 29 groups of species grouped into a single genus. Once again, although there is only one genus predicted by VICTOR, there are already 15 in the ICTV. The bottom branch of this tree is divided into two subfamilies. These phages represent the Autographiviridae family and phages Caracole, Steppe, Arval and Firost can be included in the existing Pradovirus genus, although VIRIDIC separates this genus into two (Prado and Firost on one side and the others on the other). We can also propose the creation of two new genera: Ponderosavirus with the phages Paz, XaavBphi3, Ponderosa and Pepon (although VIRIDIC separates the first two from the others in two separate genera) and the genus Cotavirus. The proposal to separate the two branches of the tree into two sub- families is tricky because they are not at all found in this way after the dRep analysis, which nevertheless justifies our amino acid analysis for the function search.VC_135 (Figures 13 and 14)VC135 comprises 14 phages. However, it is strongly enriched by the 11 phages of our collection which are close to each other. Larco is one of the newly isolated phages that joins Alcala, Bolivar, Fontebon, Olaya, Sopo, Soumapaz, Tabio, Tenjo, Usaquen and Usme in thisVC. This VC contains only Xanthomonas (13) and Xylella (1) phages. The known phages inthis VC are all from the Caudoviricetes class. The GBDP phylogenomic tree based on the protein sequences giving the best average support (21%) is produced using formula D4. Although formula D6 is recommended by VICTOR, its average support is 15% and is much less consistent with the VIRIDIC and dREp analyses based on nucleotide sequences (figure 13). This tree is therefore exceptionally favoured. In fact, with the D4 formula, even with low average support, we end up with a tree that is consistent with the tree given by dRep. The OPTSIL clustering shows that all the phages in this tree are contained in one family, one subfamily and a single genus, but it differentiates four groups of species. The VIRIDIC analysis (on nucleotide sequences) also concludes that there is a single genus for all these phages. It divides these phages into 6 species: Olaya, Usme, Bolivar, Usaquen,Sumapaz, Alcala and Fontebon constitute one species. Larco is classified in the same speciesas Tenjo, while Sopo and Tabio from a third species. JUN5, CP2 and MET23 P3 were classified in 3 independent species (Figure 14). We can therefore classify all phages in the class Caudoviricetes. We propose the creation of a new genus, Fernanvirus, insofar as the blast of the Usme genome gives 3% coverage with the closest phage not belonging to this VC. There are therefore no nearby phages already classified in a genus that could include this VC. Viral clusters conclusions In summary, phages from our collection are divided into six viral clusters. VC_1 and VC_58 contain the higher numbers of phages and are therefore the least “specific”to Xanthomonas or Xylella, but VC_58 can be separated into two viral sub-clusters, thusincreasing its specificity. VCs 3, 24 and 135 are more restricted, with a good representation ofXanthomonas or Xylella phages.Protein clusters and the search for genetic determinants of efficacy against Xf A protein cluster (PC) is a set of orthologous proteins. The aim of the work on protein clusters was to find proteins grouped within the same protein cluster that were specific to Xanthomonasand Xylella phages (Xa / Xf phages). The function of these proteins was then studied in orderto determine whether they were potentially responsible for the specific efficacy of a phage against Xanthomonas and Xylella. In theory, if a protein is needed to lyse these bacteria, then it will be found in all the phages of this bacterium. This is why we are looking for protein clusterscontaining mainly Xanthomonas and Xylella phage proteins, which will then be consideredspecific, but also clusters with a good diversity of both Xanthomonas and Xylella phages.We began by determining the occurrences of each PC in a given VC: Core genes = genes absolutely conserved in the genomes considered, Soft-core genes = genes present in at least 95% of the genomes, Shell genes = genes frequently encountered in the genomes considered,Cloud genes = very infrequent genes less than 5% of the genomes considered (Table 6).Table 6: Proportion of proteins shared by all phages of a given VCs (core), shared by at least95 % of phages of a given VC (Soft-core), shared by 5-95% of phages of a given VC (Shell), or shared by less than 5% of phages of a given VC (Cloud) Core Soft Core Shell CloudVC_1 (202 PCs) 6.44 % 4.95 % 63.86 % 24.75 %VC_2 (151 PCs) 9.3 % 0 % 90.7 % 0 %VC_3 (112 PCs) 41.96 % 0 % 47.32 % 10.71 %VC_24 (104 PCs) 50.96 % 0 % 49.04 % 0 %VC_58 (346 PCs) 1.73 % 0.58 % 33.81 % 63.87 %VC_135 (71 PCs) 47.89 % 0 % 52.11 % 0 %906 PCs were derived from all the phages belonging to the 6 VCs. Intuitively, the more phages a VC contains, the more likely it is to have a high level of genetic diversity. This is why it is less likely to find a PC in all the phages of a large VC than in a small one. The % of the core genome therefore decreases in favour of the Cloud genome, which is made up of proteins that are rare in the VC under consideration, contributed by just a few individuals. If we compare the small VC_24, all the phages have almost 51% of proteins in common and 49% of shell proteins. As this VC is really small (n=8), it is not possible to have proteins in the cloud, as 1 phage alone already represents more than 12% of the phages in the VC. This highlights the difficulty of finding a suitable threshold for all the VCs. In contrast, our large VC_58 (n=38) contains only 1.7% of its PCs that are common to all phages and 64% of PCs that are part of the Cloud genome, highlighting that the greater number of individuals in this VC is also accompanied by greater genetic diversity. There are PCs shared between several VCs (Table 7) but there is no common PC between allthe Xa / Xf phages or between the six VCs concerned in this study. There is therefore no proteinspecific to phages infecting Xanthomonas and / or Xylella that would be absent from otherphages. To process all the data, the PCs were first sorted. All the PCs from the cloud genomes of the VCs were discarded except when they were present in several VCs. First, we looked at the PCs shared by several VCs in our study. A total of 91 PCs are shared: 58 are present in 2 of our VCs, 12 in 3 of our VCs and 3 in 4 of our VCs. It should be noted that there are no PCs present in 5 or 6 different VCs in our study. Based on the hypothesis thata protein important for host specificity should be found in as many Xylella / Xanthomonasphages as possible and in few phages infecting other bacterial species, we sorted the PCsagain. PCs containing less than 50% Xanthomonas or Xylella phages were discarded. Afterthis sorting, 17 PCs remained present in two of our VCs, two present in three of our VCs and two present in four of our VCs. PCs shared by 4 VCs in our study: PCs PC001115 and PC001081 are promising. They are shared between VC_1, VC_2_1, VC_58 and VC_135 but also include phages from VC_10 consisting of 2 phages (Stenotrophomonas_phage_Pokken and Xanthomonas_phage_RiverRider) and other phages not associated with a VC (2 Pseudomonas phages, 1 Xanthomonas phage common to both PCs and 1 Colwellia phage for PC001081 only). These two PCs are annotated "tail fiber". Tail fibers enable recognition and adsorption of the phage to its cellular host and are thereforecrucial for host specificity
[0050] . These two PCs possess 85% and 81% of Xanthomonas andXylella phages (Table 7). It is important to note that among the phages of these PCs that are not Xa / Xf phages, there are 4 and 5 phages of Stenotrophomonas, which is a bacterium that also belongs to the Xanthomonadaceae family. What's more, we can see that not all the phages in a VC, which are therefore close to each other, are necessarily included in a PC. It is interesting to see which phages of the VCs concerned by a PC are not included in that PC. The sum of the phages in the VCs covered by PCs 001115 and 001081 is 87 and 88. These PCs include 41 and 42 phages respectively, so they exclude 46. 83% of them and 80% of these 46 excluded phages are phages infecting other bacteria. This PC therefore discriminatesbetween Xa / Xf phages and others among phages that are very close genetically. This showsthat these PCs are not necessary (because some Xanthomonas and Xylella phages areexcluded) but are still very specific. We wanted to find out whether it was possible to differentiate the proteins of Xa / Xf phages from the proteins of phages with other hosts within a PC. We carried out an alignment of the amino acid protein sequences of each phage. Xa / Xf phages are not clearly separated from phages with other hosts (data not shown). One may wonder about the host range of the phagesconcerned: are these Stenotrophomonas or Pseudomonas phages capable of infecting certainstrains of Xanthomonas and / or Xylella? This is the case of two virulent phages belonging tothe Autographiviridae family capable of infecting pathovars of the Pseudomonas andXanthomonas genera
[0049] . In this case, it would be impossible (and probably irrelevant) todifferentiate these proteins. PCs shared by 3 VCs in the study: Of the 12 PCs common to three of our VCs, only two have more than 50% Xa / Xf phages and are annotated 'tail assembly protein'. A priori, this annotation does not seem to explain either host specificity or efficacy against Xylella. PC002866 includes 19 phages from VCs 1, 3 and24, 12 (63%) of which are Xa / Xf phages. However, it excludes 14 (56%) Xanthomonas orXylella phages present in the VCs covered by this PC. Similar results were found forPC002580, which has 57% Xa / Xf phages (12) but excludes 54% of the Xa / Xf phages (14) present in the VCs covered by this PC. These two PCs are therefore of limited interest for our research. PCs shared by 2 VCs in the study: Of the 17 PCs that include phages spread across 2 VCs in our study and have more than 50% Xanthomonas or Xylella phage, we can already rule out one that includes only 2 phages and is too small to be of interest. On the other hand, one PC is very interesting in terms of its size and percentages: PC001312. It has 31 / 35 (88%) Xa / Xf phages distributed in VCs 58, 135 and 10. The 19 phages in these VCs not included in this PC are all phages from another bacterium. This PC also has a tail fibre annotation. These two cases, which are relatively easy to interpret, are exceptions. Analysis of the other PCs was more difficult. For example, PC010399 seems interesting at first sight: it has 100% Xa / Xf phage and excludes only 41%, but this actually corresponds to 4 Xa / Xf phages included and 24 excluded. It can therefore be considered of little interest. To compensate for this biasin percentages, we could focus on the amount of phage: number of Xa / Xf phage included -excluded. Using this method, the second best PC after 001312 described above is 002309.However, when looking more closely, numbers are less convincing: with 62% of Xa / Xf phage(15 / 24) included in this PC and 57% (4 / 7) of Xa / Xf phage excluded, which suggests a poorspecificity. This highlights the complexity of the analysis and the importance of putting all the data into perspective for the analysis of other PCs which are smaller, have less marked percentages orexclude a significant number of Xanthomonas or Xylella phages.Table 7: Phage composition of PCs shared by several VCs. Phages from these VCs that areexcluded from the PCs. VCs in bold correspond to VCs including phages from our collection. Phages represented in Phages excluded from the PC PC VCs with nb % % phg at nb of % least nb of % PC phage Xa / phage phage PC Xf other o phages phag annotation s in phage specie ne s in exclu other s s protei a de e PC ll specie n in VCs d Xa / Xf s this PC 1, PC0011 2_1, 15Tail fiber 41 85.4 14.658,87 46 17.4 82.6135, 10 1, PC0010 2_1, 81Tail fiber 42 81.0 19.058,88 46 19.6 80.4135, 10 PC0028 tail 66 assembly19 63.2 36.81, 3, 2444 25 56.0 44.0PC0025 tail sembly21 57.11, 3, 80 as42.924, 947 26 53.8 46.2PC0261 41Hypothetical 2 50.0PC0127 53Tail 5 80.0 20.0 1, 2_1 30 25 28.0 72.0PC0104 72Hypothetical 6 83.3 16.7 3, 135 27 21 85.7 14.3PC0104 09tail fiber 6 83.3 16.7 1, 2_1 30 24 25.0 75.0PC0104 08putative tail 6 83.3 16.7 1, 2_1 30 24 25.0 75.0PC0103 L-shapped4 100.0 0.01, 58, 99 tail fiber 1063 59 40.7 59.3PC0090 88Hypothetical 7 85.7 14.3 1, 2_1 30 23 21.7 78.3PC0090 86Hypothetical 7 57.1 42.9 1, 58 61 54 40.7 59.3Tail / PC0080 putative cell 37 wall8 75.0 25.0 1, 2_1 31 23 21.7 78.3peptidase PC0055Hypothe1, 24, 67tical 10 90.0 10.013833 23 39.1 60.9PC0051Hypothetical 12 100.024, 090,013522 10 90.0 10.0 18Hypothetical 14 64.3 35.7 1, 3 36 22 45.5 54.5PC0033 Hypothetical 97 / RNA pol18 55,6 44.4 1, 2_1 30 12 8.3 91.7bindind PC0033 96Hypothetical 14 100.0 0.0 1, 58 61 47 25.5 74.5PC0027 3, 24, 11tail fiber 21 66.7 33.3138,29 8 50.0 50.0246 PC0023 tail 09 assembly25 62.5 37.53, 24, 13831 7 57.1 42.9PC0013 58, 12Tail fiber 35 88.6 11.4135,54 19 0.0 100.010 Protein clusters conclusions In summary, the most convincing PCs were VC_1, VC_2_1, VC_58 and VC_135 for PCs 001115 and 001081 and VCs 58 and 135 for PC 001312. As these PCs are tail fiber clusters, we thus looked for interesting PCs with this annotation for our last two VCs 3 and 24. There are 2 additional PCs with a Tail Fiber annotation for VC_3. The first is very limited (3 phages) and does not contain any phage from our collection and is therefore of no immediate interest. The second (PC009070) contains 7 phages from VC_3 alone, including 5 / 7 Xa / Xf phages (71%). However, of the phages from this VC that do not belong to this PC, 4 / 6 areXanthomonas phages.All the phages in VC_24 include a protein clustered in PC005121 annotated Tail Fibercontaining 11 phages. 9 / 11 phages in this PC are Xa / Xf phages (82%), the other two areStenotrophomonas phages. This PC is therefore also of interest.Microscopy The morphological characterisation of our isolated phages was carried out using patches isolated on a double layer of agar, negative staining and observed by Transmission ElectronMicroscopy (TEM). Our phages are no exception to the Xanthomonas phages alreadycharacterised to date and belong to the phages with tails with podovirus morphologies - smallnon-contractile tail - (Caracole, SERU 79702.1, SERU 79703.1, SERU 79704.1, SERU 79709a1.1, SERU 79709b1.1, SERU 797010.1, SERU 797011.1, SERU 797012.1, SERU 797013.1, SERU 7970 14.1, Steppe, Arval, Firost, Larco) and siphoviruses - long non-contractiletail - (Learch, Karst, Horst, Sov, Oroshi, SERU 84022.1, Darbon, Tourse, Boscavo, Aoi, Alme)(Figure 15). All have a classic icosahedral capsid morphology, except for Boscavo, Learch and Sov, which have an elongated capsid. While there is no doubt about the striated nature of the phage tails for phages Q. Oroshi, Y. Aoi and Z. Alme, whose tails end in a point surmounted by small fibers, it is more difficult to determine for the other siphoviruses and certainly depends on the quality of the preparations. However, based on all the observations made on each of our phages, we can conclude that striations are present on all the tails of newly isolated phage siphoviruses, whatever the capsid morphology. To further characterize the morphology of our phages, we measured capsid size and tail length using ImageJ software. The measurements are reported in Table 8. For this analysis, weincluded the other Xanthomonas and Xylella phages present in our collection andcharacterized in the publication
[0031] (Usme, Olaya, Bacata, FC14, Bolivar, Usaquen, Teja,Alcala, Tabio, FC31, FC33, Caljica, Tenjo, Suba, FC42, Bosa, Fontebon, Sumapaz). These phages have an icosahedral capsid podovirus morphotype (Usme, Olaya, Bolivar, Usaquen, Teja, Alcala, Tabio, FC33, Caljica, Tenjo, Fontebon, Sumapaz), icosahedral capsid siphovirus (Bacata, FC14, FC31, Suba, FC42) and elongated capsid siphovirus (Bosa).Table 8: Morphological characteristics of the phages in our collectionPhage MorphotypeCapsid Average Capsid Average Tail shape length nm length nm Learch - SERS 79701.1Siphovirus B2 Elongate 89.4 ± 3.3 (n=87) 145.4 ± 7.6 (n=60)Karst - SERS 84024.1 Siphovirus B1 Icosahedral 64.8 ± 2.7 (n=29) 177.4 ± 6.2 (n=21)Karst - SERS 84024.1 Siphovirus B1 Icosahedral 67.2 ± 2.2 (n=15) 177.0 ± 4.7 (n=15)Horst - SERS 84024.2 Siphovirus B1 Icosahedral 59.2 ± 3.1 (n=23) 180.4 ± 5.6 (n=16)Caracole - SERU 79701.1Podovirus C1 Icosahedral 63.4 ± 3.4 (n=12) 14.4 ± 4.6 (n=9)SERU 79702.1 Podovirus C1 Icosahedral 66.3 ± 2.8 (n=34) 16.9 ± 4.0 (n=27)SERU 79703.1 Podovirus C1 Icosahedral 60.6 ± 3.7 (n=24) 17.8 ± 3.8 (n=16)SERU 79704.1 Podovirus C1 Icosahedral 61.3 ± 4.5 (n=14) 18.1 ± 3.4 (n=11)Sov - SERU 79705.1 Siphovirus B2 Elongate 89.2 ± 2.5 (n=23) 160.2 ± 6.3 (n=23)SERU 79709a1.1 Podovirus C1 Icosahedral 63.0 ± 2.7 (n=7) 14.2 ± 1.8 (n=6)SERU 79709b1.1 Podovirus C1 Icosahedral 61.5 ± 3.0 (n=50) 17.5 ± 3.3 (n=22)SERU 797010.1 Podovirus C1 Icosahedral 57.7 ±3.2 (n=70) 19.2 ± 2.7 (n=38)SERU 797011.1 Podovirus C1 Icosahedral 62.0 ± 3.3 (n=37) 21.5 ± 2.7 (n=20)SERU 797012.1 Podovirus C1 Icosahedral 61.7 ± 2.8 (n=34) 21.9 ± 2.2 (n=21)SERU 797013.1 Podovirus C1 Icosahedral 67.6 ± 2.6 (n=63) 23.3 ± 3.3 (n=17)SERU 797014.1 Podovirus C1 Icosahedral 58.9 ± 2.9 (n=35) 22.0 ± 2.8 (n=12)Steppe - SERU 797015.1Podovirus C1 Icosahedral 63.2 ± 2.9 (n=17) 20.3 ± 3.1 (n=9)Oroshi - SERU 84021.1 Siphovirus B1 Icosahedral 65 ± 3.2 (n=118) 239.1 ± 7.6 (n=91)SERU 84022.1 Siphovirus B1 Icosahedral 66.7 ± 2.6 (n=50) 197.9 ± 6.5 (n=51)Darbon - SERU 84023.1Siphovirus B1 Icosahedral62.7 ± 3.6 (n=136) 210.4 ± 6.6 (n=101) Arval - SERU 84027.1 Podovirus C1 Icosahedral 64.8 ± 2.1 (n=46) 20.4 ± 3.0 (n=30)Firost - SERU 84181.1 Podovirus C1 Icosahedral 61.1 ± 3.8 (n=41) 20.7 ± 2.2 (n=12)Larco - SERU 84185.1 Podovirus C1 Icosahedral 57.4 ± 2.5 (n=37) 18.8 ± 3.4 (n=10)Tourse - SERU 841811.1Siphovirus B1 Icosahedral 65.2 ± 3.0 (n=74) 196.4 ± 7.3 (n=52)Boscavo - SERU 841816.1Siphovirus B2 Elongate 85.0 ± 2.9 (n=88) 146.6 ± 5.3 (n=74)Aoi - VP279702.1 Siphovirus B1 Icosahedral 64.7 ± 3.2 (n=33) 238.1 ± 7.6 (n=26)Alme - VP284181.1 Siphovirus B1 Icosahedral 65.4 ± 2.9 (n=54) 236.4 ± 8.1 (n=39)Usme - FC03 Podovirus C1 Icosahedral 65.0 ± 2.4 (n=16) 12.5 ± 1.7 (n=10)Olaya - FC08 Podovirus C1 Icosahedral 65.8 ± 1.3 (n=9) 9.5 ± 2.3 (n=8)Bacata - FC12 Siphovirus B1 Icosahedral 70.2 ± 2.6 (n=15) 226.7 ± 4.0 (n=15)FC14 Siphovirus B1 Icosahedral 70.7 ±3.0 (n=9) 226.5 ± 3.6 (n=10)Bolivar - FC15 Podovirus C1 Icosahedral 66.8 ± 1.3 (n=6) 13.5 ± 1.3 (n=5)Usaquen - FC17 Podovirus C1 Icosahedral 61.0 ± 2.6 (n=13) 17.8 ± 3.4 (n=13)Teja - FC24 Podovirus C1 Icosahedral 68.3 ± 2.8 (n=45) 14.5 ± 3.0 (n=34)Alcala - FC25 Podovirus C1 Icosahedral 67.2 ± 4.2 (n=6) 18.0 ± 2.7 (n=6)Tabio - FC30 Podovirus C1 Icosahedral 67.9 ± 3.2 (n=6) 13.5 ± 2.1 (n=3)FC31 Siphovirus B1 Icosahedral 69.5 ± 5.4 (n=16) 190.4 ± 4.5 (n=19)FC33 Podovirus C1 Icosahedral 68.9 ± 2.6 (n=43) 14.2 ± 3.3 (n=19)Cajica - FC34 Podovirus C1 Icosahedral 68.0 ± 3.3 (n=37) 16.5 ± 3.8 (n=24)Tenjo - FC39 Podovirus C1 Icosahedral 64.0 ± 1.5 (n=6) 24.0 ± 4.4 (n=6)Suba - FC41 Siphovirus B1 Icosahedral 64.9 ± 3.0 (n=31) 202.7 ± 4.3 (n=32)FC42 Siphovirus B1 Icosahedral 65.1 ± 3.4 (n=27) 194.0 ± 4.3 (n=13)Bosa - FC44 Siphovirus B2 Elongate 91.2 ± 1.2 (n=12) 148.8 ± 3.6 (n=11)Fontebon - FC47 Podovirus C1 Icosahedral 62.9 ± 2.7 (n=17) 16.8 ± 3.3 (n=15)Sumapaz - FC57 Podovirus C1 Icosahedral 62.2 ± 1.9 (n=11) 15.7 ± 3.0 (n=11)Whatever the podovirus or siphovirus morphotype, the size of icosahedral capsids ranged from 57.4 ± 2.5 nm (Larco) to 70.7 ± 3 nm (FC14). The elongated capsids have an average length of 85.0 ± 2.9, 89.2 ± 2.5, 89.4 ± 3.3, 91.2 ± 1.2 nm for the Boscavo, Sov, Learch and Bosa phages respectively. This raises the question of a link between capsid size and genome size. Icosahedral capsid size is not correlated with genome size. However, phages with elongated capsids have the largest genomes. The quality of the sequencing of the Boscavo phage only allowed an assembly fragmented into 3 contigs of 47,614 bp, 6,984 bp and 6,413 bp. While the two small contigs are indeed of phage origin, it is difficult to determine whether they actually belong to Boscavo. The size of the Boscavo genome is therefore between 47614 and 61011 bp. Sov has a genome of 62014 bp, Learch 63771 bp and Bosa 63828 bp. As the tail lengths of podoviruses cannot be measured properly, the measurements are given for information only. However, all siphovirus tail lengths were measured and compared using statistical tools. As the quantitative variable (tail length) did not follow a normal distribution for all the populations compared (shapiro-Wilk test p-value << 0.1, therefore rejecting hypothesis H0: the sample follows a normal distribution), we performed the non-parametric Kruskall-Wallis test followed by the non-parametric Wilcoxon post hoc test (Figure 16). The Bonferroni and Holm corrections were used to adjust the p-value. The Kruskall-Wallis test indicates that not all samples are equivalent (p-value < 2.2e-16). Depending on the p-value adjustment chosen for the Wilcoxon test, the statistical groups differ slightly. We can identify seven distinct groups: Group A consists of Learch, Boscavo and Bosa; Group B is represented solely by Sov; Group C corresponds to the Karst and Horst phages;group D includes SERU 84022.1, Tourse, FC31, Suba and FC42, and group E is representedsolely by Darbon; Group F includes Bacata with FC14; Group G includes Oroshi, Aoi and Alme. Groups A, B, C and E are clearly defined whatever the p-value adjustment. Groups F and G, clearly distinct in the case of the Holm adjustment, are more ambiguous in the case of the Bonferroni adjustment: while Bacata and FC14 are different from Oroshi and Aoi and vice versa, Alme is not statistically different from any of the other 4 (p value = 1.000 Aoi, 0.057 Bacata, 0.319 FC14, 1.000 Oroshi) with this adjustment. We decide to separate groups F and G which are effectively separated with the Holm adjustment as well as for most of the good fit comparisons. Finally, group D is ambiguous whatever the p-value adjustment. With Holm adjustment, it is separated into three subgroups: FC31 and FC42, FC 42 with Tourse and SERU 84022.1 and a final Suba group. The Bonferroni adjustment also distinguishes 3 subgroups: FC31, FC42, Tourse for the first, FC42, Tourse, SERU 84022.1 for the second and Tourse, SERU 84022.1 and FC41 for the third. As these subgroups differ according to the statistical method, with phages in several subgroups, we have grouped them together in a well-defined group D for greater clarity. If we put this analysis into perspective with the VCs previously obtained, we can see that each siphovirus VC is represented by one or more adjacent groups with statistically different tail lengths. Group A corresponds to VC_3, group B corresponds to VC_2_1, groups C, D and E belong to VC_1 and groups F and G belong to VC_24. To take the analysis a step further, we superimposed the tail length statistical groups on the phage genome comparison tree (Figure 17). Sov, alone in its statistical group, is branched alone in the tree. Learch, Boscavo and Bosa are also well branched together and grouped in their tail length statistical group. The analysis of tail lengths makes it possible to distinguish two distinct branches belonging to the same main branch corresponding to VC_24. On one side we find Bacata and FC14 (FC14 is genetically 100% identical to Bacata and is therefore not represented on the tree) and on the other Oroshi, Aoi and Alme. In VC_1, the tail length groups separate Horst and Karst (group C) from the rest of the VC and also Darbon (group E) from the rest of the VC. Analysis of tail lengths does not give any further indication of the rest of VC_1 between phages FC31, FC42, Tourse, SERU 84022.1 and Suba (FC42 is genetically very close to Suba and FC31 has not been sequenced). Note that the groups of tail lengths do not allow us to assume a % difference between the phage genomes. For example, Oroshi and Bacata stand out even though they are 91.706% identical out of 87.306% coverage, but Tourse and Suba, which are further apart (17.38% identical), are grouped together in the same tail-length statistical group. It is also interesting to note that the tail length measurements are extremely close on independent samples from identical phages: Karst was measured twice as part of a sample preparation protocol optimisation and its measurements are 177.4 ± 6.2 (n=21) and 177.0 ± 4.7 (n=15) and Bacata and FC14 are 100% genetically identical and their measurements are 226.7 ± 4.0 (n=15) and 226.5 ± 3.6 (n=10) respectively. Efficiency tests Results OverlaysAs Xylella has a strong tendency to aggregate, the overlay allows the bacteria to grow morehomogeneously and avoids the formation of granules, which makes the effectiveness of the phages less visible (Fig.18). Optimization was crucial to obtain homogenous overlays and, toour knowledge, it was the first time that environmental Xylella strains were grown in overlays.For each strain, at least 1 phage of each VC has been tested in triplicate. A test was considered positive when inhibition of the bacterial overlay could be observed at the phage spot, otherwise it was considered negative. These results are therefore not quantitative. To summarize all the tests carried out, an efficacy frequency was determined for each tested phage (positive test / number of tests). Three levels were determined from these frequencies:- Non-efficient [0, 0.4[- Mitigate [0.4, 0.5]- Efficient ]0.5, 1]Table 9: Summary of efficacy frequencies of each phage_ in overlays against the 2 Xylellasubspecies. E = efficient (frequency between 50 and 100%), M = mitigate (frequency between40 and 50%), NE = non-efficient (frequency below 40%)Efficacy frequencies Efficacy frequencies VC Phageoverlay overlay 7970 8416 VC_2_1 Sov 0.0 NE 0.4 NEVC_1 Horst 0.0 NE 0.7 EVC_1 Karst 0.0 NE 0.7 EVC_1 Tourse 0.0 NE 0.8 EVC_1 Darbon 0.0 NE 0.5 MVC_3 Bosa 0.0 NE 1.0 EVC_3 Learch 0.2 NE 0.6 EVC_3 Boscavo 0.0 NE 0.8 EVC_24 Bacata 0.4 M 0.7 EVC_24 Alme 0.5 M 0.8 EVC_24 Oroshi 0.5 M 0.9 EVC_24 Aoi 0.5 M 0.8 EVC_58 Steppe 0.0 NE 1.0 EVC_58 Arval 0.1 NE 0.9 EVC_135 Usme 0.0 NE 0.5 MXylphi- PDTM 0.6 E 1.0 EStrain Xfm 8416 is more sensitive than Xff 7970. Against Xff, VC_24 shows efficacy: phagesshowed a frequency between 40 and 50% efficiency over 14, 4, 8, 4 tests for Bacata, Alme,Oroshi and Aoi, respectively. In comparison, Xylphi- PDTM was effective in only 3 out of 5 cases.All VCs contained phages effective in overlays against Xfm 8416 with good frequencies.Looking in more details, phages with very similar genomes had consistent efficacy. For example, within VC_1, phages Horst and Karst (more than 99.99% similar according to our dREp analysis) were both effective 7 times out of 10. In VC_58, phages that stood out for theirefficacy were Steppe (5 tests) and Arval (7 tests) (97.1% intergenomic similarities according toViridic), which together constitute a sub-branch. Kinetics in liquid media Proof of conceptDespite various attempts to optimize Xylella growth in liquid media, optimal parameters couldnot be identified. Agitation at 160 rpm and initial OD600 do not seem to be decisive parameters for growth, as they make no significant difference once growth has been observed. The key toensuring Xf growth in liquid media could lie in optimizing the preculture of Xylella on plates:number of replicates, number of days after the last replicate, etc.A total of 7 infection experiments with different phages were carried out. Xff grew 6 times, 5times for 8402, 4 times for 8416 and 6 times for 8418.In an experiment comparing different initial OD600 and phage concentrations (Bacata – FC12),we concluded that the lower the initial OD600and the higher the phage concentration, the greater the growth inhibition (Figure 19). With the highest initial OD600, the phage did not inhibit growth in the overlay regardless of the concentration added. However, with an initial OD600of 0.05 of Xfp, Bacata at 108PFU / mL allows a decrease from 0.21 to 0.16, i.e. a decrease of 0.05 OD600units at 10 days. With an initial OD600 of 0.01, this phage concentration totally inhibits bacterial growth. Another point revealed by our tests is that the absence of a decrease in OD600 does not exclude a relative efficacy of the phage. In fact, checking phage production in the presence of the bacteria confirms that the phage recognizes and replicates. We carried out this measurementon three of the seven tests. The phage's ability to increase its titre depends on the initialquantity added. In fact, given the previous observation, phages are added in large quantitiesand are already at a plateau. This plateau seems to differ according to the Xf strain tested. Theinitial phage concentration sufficient to see a reduction in OD600 but low enough to be able to quantify an increase in titre has yet to be defined. Finally, among the phages titrated, those that showed an increase in titer were Bacata, Arval and Xylphi-PDTM. These observations need to be confirmed. To gain a better understanding of the dynamics between OD600, bacterial numbers and phages, we have begun developing digital PCR on Xf, after having developed it on Xa. Note that Xylphi-PDTMonly prevent growth of 8416, with the lowest concentration outof the two tested, suggesting that the optimum concentration is not always the highest.Liquid testsDifferent times after Xf infection were tested for phage addition. In these tests, a phage istested against all four Xf with addition at day 0, 4 and 7 after Xf inoculation. We chose to addthe phages at the same time as the bacteria, as this seemed more favorable, and themanipulation was redesigned to test a set of phages against one of the Xf strains, making itpossible to compare them. In these experiments, streptomycin was added as a positive control at a concentration of 20 mg / mL. Phages tested were: Cota, Horst, Karst, Darbon, Learch, Bacata, Alme, Oroshi, Aoi, Arval, Usme and Xylphi-PDTM. Review To summarize all these tests and results, we have determined a threshold value above which a phage effect was observed. This threshold consists of a difference in OD600of at least 0.05 between the condition with phage and the control condition without phage, whether we observed a decrease (efficiency) or an increase. This threshold is chosen to correspond as closely as possible to the growth of the four strains, to be high enough to avoid non-significant differences, and low enough to allow differences to be detected. As an indication, with this threshold 28 / 66 tests exceed this threshold (42%) for 7970, 20 / 31 (65%) for 8402, 24 / 37 (65%)for 8416 and 8 / 23 (35%) for 8418. A second threshold of 0.1 has been chosen as a guideline,so that phages can be compared with each other in tests comparing several phages on the same strain. Using the 0.05 threshold, we distinguished three trends to characterize the efficacy of a phage in liquid medium (Table 10):- Non-efficient: the phage has shown no efficacy to date (no difference and / or increase in OD600above the first threshold).- Mitigated: the phage has already shown a reduction but also an increase in OD600- Efficient: phage has already shown efficacyTable 10: Summary of efficacy of each phage in liquid media against the 4 Xylella subspecies.Considering our thresholds: X = showed efficiency a least one time, Y = showed efficiency butalso antagonistic effect, Z = showed no efficiency and / or antagonistic effects. The numbersindicate the number of times the phage has been tested against the strain. VC Phage Efficacy onEfficacy on Efficacy on Efficacy on 7970 liquid 8402 liquid 8416 liquid 8418 liquid growth growth growth growth VC_1 Horst 3 Z 1 X 3 X 1 ZVC_1 Karst 5 Z 1 X X Z 1 XVC_1 Tourse 1 Z 1 Z 1 Z 1 YVC_1 Darbon 5 Z 2 X 3 X 1 XVC_2_1 Sov 1 X 1 X 1 X 1 YVC_3 Learch 6 Z 2 Z 1 Z 2 ZVC_24 Bacata 8 Y 4 Y 3 X 4 XVC_24 Alme 4 Z 2 X 2 X 1 ZVC_24 Oroshi 6 Z 3 X 4 X 2 XVC_24 Aoi 6 Y 2 Z 4 Y 2 ZVC_58 Cota 5 Z 2 X 3 Y 1 ZVC_58 Steppe 1 X 1 Y 1 X 1 YVC_58 Arval 6 Y 3 Y 1 X 2 ZVC_135 Usme 3 Z 2 X 3 X 1 ZXylphi-PDTM 6 Z 3 X 4 X 2 XThe subspecies least sensitive to phages under planktonic conditions appeared to be Xff 7970,but unlike the overlayers, Xfp 8402 and Xfm 8418 showed sensitivity to phages. Here too, Xfm8416 remained the most sensitive. Sov from VC_2_1 has been tested once in liquid, withpromising results. Due to the difficulty of growing Xf in liquid medium, triplicates could not beperformed under all conditions. At least one phage from each VC was tested at least 3 times for 7970, twice for 8402 and once for 8416 and 8418. Among the phages tested on Xff 7970, five were effective: Sov (VC_2_1), Bacata and Aoi (VC_24) and Steppe and Arval (VC_58). Sov, Bacata and Aoi showed a reduction in OD600of at least 0.1 in one test. Unlike these phages, Xylphi-PDTMnever showed a reduction in OD600on 7970 in this test. All VCs except VC_3 contains phages efficient against 8402 and 8416. Less experiments were conducted on Xfm 8418 but some phages in VC_1, VC_2_1 and VC_24 seems efficient against this strain. Biofilms As the biofilm tests mirrored the liquid media tests in 96-well plates, the same bacterialprecultures and cultures were used. Similarly, the same difficulties were encountered withbacterial growth, whether in preculture or during testing. To summarize all these results, we have determined a threshold value above which a phage effect is noted. This threshold consists of a difference in OD600 of at least 0.2 between the condition with phage and the control condition without phage, whether a decrease (efficiency) or an increase. As before, this threshold is chosen to correspond as closely as possible to the biofilm production of the four strains, to be high enough to avoid non-significant differences, and low enough to allow differences to be detected. As an indication, 27 / 55 tests exceeded this threshold (49%) for 7970, 15 / 22 (68%) for 8402, 11 / 33 (33%) for 8416 and 3 / 12 (25%) for 8418. A second threshold of 0.4 has been chosen as a guideline, so that phages can be compared with each other in tests comparing several phages on the same strain. Using the 0.2 threshold, we distinguished three trends to characterize the efficacy of a phage to reduce biofilm formation (Table 11):- Non-efficient: the phage has shown no efficacy to date (no difference and / or increase in OD600above the first threshold).- Mitigated: the phage has already shown a reduction but also an increase in OD600- Efficient: phage has already shown efficacyTable 11: Summary of efficacy of each phage against biofilm formation of the 4 Xylellasubspecies. Considering our thresholds: X = showed efficiency a least one time, Y = showedefficiency but also antagonistic effect, Z = showed no efficiency and / or antagonistic effects.The numbers indicate the number of times the phage has been tested against the strain.VC Phage Efficacy onEfficacy on Efficacy on Efficacy on 7970 biofilm 8402 biofilm 8416 biofilm 8418 biofilm VC_1 Horst 3 Z 2 X 3 Z 1 ZVC_1 Karst 5 Y 1 X 3 Z 1 ZVC_1 Darbon 5 Y 2 Z 3 Z 1 ZVC_3 Learch 5 Z 2 X 2 Z 1 ZVC_24 Bacata 5 Y 2 X 3 X 1 XVC_24 Alme 5 Z 2 X 3 X 1 XVC_24 Oroshi 5 Z 2 Z 3 X 1 ZVC_24 Aoi 4 X 1 X 3 X 1 ZVC_58 Cota 5 Z 2 X 3 Z 1 ZVC_58 Arval 5 Z 2 X 1 Z 1 XVC_135 Usme 3 Z 2 X 3 Z 1 ZXylphi-PDTM 5 Z 2 X 3 X 1 ZThe subspecies least sensitive to phages under biofilm conditions appears to be Xff 7970, butin this assay Xfp 8402 is the most sensitive.On 8402, phages Learch, Arval and Usme all exceeded the 0.4 threshold, unlike the other 8 phages tested, Cota, Horst, Karst, Learch, Bacata, Alme, Aoi, and Xylphi-PDTM, which reduced OD600by at least 0.2 but less than 0.4. Out of 8416, for the first test comparing several phages, only the Oroshi phage reduced OD600more than 0.2 units, and for the second, only the VC_24 phages significantly reduced biofilm formation above the first threshold for Bacata and the second for Alme, Oroshi and Aoi, as well as Xylphi-PDTM. It should be noted that Xylphi-PDTMnever showed a reduction in biofilm production by either 7970 or 8418, unlike some of our phages tested alone. REFERENCES1. EFSA Panel on Plant Health (EFSA PLH Panel) Jeger M., Caffier D., Candresse T.,Chatzivassiliou E., Dehnen-Schmutz K., Gilioli G., Grégoire J.-C., Jaques Miret J.A., MacLeodA., et al. Updated Pest Categorisation of Xylella Fastidiosa. EFSA J.2018;16:e05357.doi: 10.2903 / j.efsa.2018.5357.2. Alston J.M., Fuller K.B., Kaplan J.D., Tumber K.P. Assessing the Returns to R&D onPerennial Crops: The Costs and Benefits of Pierce’s Disease Research in the CaliforniaWinegrape Industry. Aust. J. Agric. Resour. Econ.2015;59:95–115. doi: 10.1111 / 1467-8489.12045.3. Tumber K.P., Alston J.M., Fuller K. Pierce’s Disease Costs California $104 Million perYear. Calif. Agric.2014;68 doi: 10.3733 / ca.v068n01p20.4. Schneider K., van der Werf W., Cendoya M., Mourits M., Navas-Cortés J.A., Vicent A.,Lansink A.O. Impact of Xylella Fastidiosa Subspecies Pauca in EuropeanOlives. PNAS. 2020;117:9250–9259. doi: 10.1073 / pnas.1912206117.5. Ali B.M., van der Werf W., Oude Lansink A. Assessment of the Environmental Impacts ofXylella Fastidiosa Subsp. Pauca in Puglia. Crop Prot.2021;142:105519.doi: 10.1016 / j.cropro.2020.105519.6. Simpson A.J., Reinach F.C., Arruda P., Abreu F.A., Acencio M., Alvarenga R., Alves L.M.,Araya J.E., Baia G.S., Baptista C.S., et al. The Genome Sequence of the Plant Pathogen Xylella Fastidiosa. The Xylella Fastidiosa Consortium of the Organization for NucleotideSequencing and Analysis. Nature.2000;406:151–159. doi: 10.1038 / 35018003.7. Falahi Charkhabi N., Booher N.J., Peng Z., Wang L., Rahimian H., Shams-Bakhsh M., LiuZ., Liu S., White F.F., Bogdanove A.J. Complete Genome Sequencing and Targeted Mutagenesis Reveal Virulence Contributions of Tal2 and Tal4b of Xanthomonas TranslucensPv. Undulosa ICMP11055 in Bacterial Leaf Streak of Wheat. Front.Microbiol.2017;8 doi: 10.3389 / fmicb.2017.01488.8. Pieretti I., Royer M., Barbe V., Carrere S., Koebnik R., Cociancich S., Couloux A., DarrasseA., Gouzy J., Jacques M.-A., et al. The Complete Genome Sequence of Xanthomonas Albilineans Provides New Insights into the Reductive Genome Evolution of the Xylem-LimitedXanthomonadaceae. BMC Genom.2009;10:616. doi: 10.1186 / 1471-2164-10-616.9. Gerlin L., Cottret L., Cesbron S., Taghouti G., Jacques M.-A., Genin S., Baroukh C. Genome-Scale Investigation of the Metabolic Determinants Generating Bacterial FastidiousGrowth. mSystems.2020;5 doi: 10.1128 / mSystems.00698-1910. Kyrkou I, Pusa T., Ellegaard-Jensen L., Sagot MF, Hestbjerg Hansen L., Pierce’s Diseaseof Grapevines : A Review of Control Strategies and an Outline of an Epidemiiological Model, frontiers in Microbiology, 12 September 2028, doi: 10.3389 / fmicb.2018.0214111. Richard A. Redak, Alexander H. Purcell, Joao R.S. Lopes, Matthew J. Blua, Russell F.Mizell III, Peter C. Andersen, The biology of xylem fluid – feeding insect vectors of Xylellafastidiosa and their relation to disease Epidemiology, Annu. Rev. Entomol. 2004, doi : 10.1146 / annurev.ento.49.061802.12340312. Wells J.M., Raju B.C., Hung H.-Y., Weisburg W.G., Mandelco-Paul L., Brenner D.J. XylellaFastidiosa Gen. Nov., Sp. Nov: Gram-Negative, Xylem-Limited, Fastidious Plant BacteriaRelated to Xanthomonas Spp. Int. J. Syst. Evol. Microbiol.1987;37:136–143.doi: 10.1099 / 00207713-37-2-136.13. Mansfield J., Genin S., Magori S., Citovsky V., Sriariyanum M., Ronald P., Dow M., VerdierV., Beer S.V., Machado M.A., et al. Top 10 Plant Pathogenic Bacteria in Molecular PlantPathology: Top 10 Plant Pathogenic Bacteria. Mol. Plant Pathol. 2012;13:614–629.doi: 10.1111 / j.1364-3703.2012.00804.x.14. Jacques M.-A., Arlat M., Boulanger A., Boureau T., Carrère S., Cesbron S., Chen N.W.G.,Cociancich S., Darrasse A., Denancé N., et al. Using Ecology, Physiology, and Genomics toUnderstand Host Specificity in Xanthomonas. Annu. Rev. Phytopathol.2016;54:163–187.doi: 10.1146 / annurev-phyto-080615-100147.15. Bragard C., Dehnen-Schmutz K., Serio F.D., Gonthier P., Jacques M.-A., Miret J.A.J.,Justesen A.F., MacLeod A., Magnusson C.S., Milonas P., et al. Effectiveness of in PlantaControl Measures for Xylella Fastidiosa. EFSA J. 2019;17:e05666.doi: 10.2903 / j.efsa.2019.5666.16. Dupas E., Briand M., Jacques M.-A., Cesbron S. Novel Tetraplex Quantitative PCR Assaysfor Simultaneous Detection and Identification of Xylella Fastidiosa Subspecies in PlantTissues. Frontiers in Plant Science.2019. doi: 10.3389 / fpls.2019.01732.17. Directive 2006 / 7 / EC of the European Parliament and of the Council of 15 February 2006Concerning the Management of Bathing Water Quality and Repealing Directive76 / 160 / EEC. Off. J. Eur. Union.2006;L64:37–51.18. Andrea Luvisi; Francesca Nicolì; Luigi De Bellis Sustainable Management of PlantQuarantine Pests: The Case of Olive Quick Decline Syndrome. Sustainability.2017;9:659.doi: 10.3390 / su9040659.19. EFSA Panel on Plant Health (PLH) Treatment Solutions to Cure Xylella FastidiosaDiseased Plants. EFSA J.2016;14 doi: 10.2903 / j.efsa.2016.4456.20. Scortichini M., Chen J., Caroli M.D., Dalessandro G., Pucci N., Modesti V., L’aurora A.,Petriccione M., Zampella L., Mastrobuoni F., et al. A Zinc, Copper and Citric Acid Biocomplex Shows Promise for Control of Xylella Fastidiosa Subsp. Pauca in Olive Trees in Apulia Region(Southern Italy) Phytopathol. Mediterr. 2018;57:48–72. doi: 10.14601 / Phytopathol_Mediterr-21985.21. Hopkins D.L. Biological Control of Pierce’s Disease in the Vineyard with Strains of XylellaFastidiosa Benign to Grapevine. Plant Dis.2005;89:1348–1352. doi: 10.1094 / PD-89-1348.22. Baccari C., Antonova E., Lindow S. Biological Control of Pierce’s Disease of Grape by anEndophytic Bacterium. Phytopathology.2019;109:248–256. doi: 10.1094 / PHYTO-07-18-0245-FI.23. Lisa O’Sullivan, Colin Buttimer, Olivia McAuliffe, Declan Bolton, Aidan Coffey,Bacteriophage-based tools : recent advances and novel applications, 29 March 2022, F1000Research24. Manyi-Loh C., Mamphweli S., Meyer E., Okoh A. Antibiotic Use in Agriculture and ItsConsequential Resistance in Environmental Sources: Potential Public HealthImplications. Molecules. 2018;23:795. doi: 10.3390 / molecules23040795.25. Żaczek M., Weber-Dąbrowska B., Górski A. Phages in the Global Fruit and VegetableIndustry. J. Appl. Microbiol.2015;118:537–556. doi: 10.1111 / jam.12700.26. Sieiro C., Areal-Hermida L., Pichardo-Gallardo Á., Almuiña-González R., de Miguel T.,Sánchez S., Sánchez-Pérez Á., Villa T.G. A Hundred Years of Bacteriophages: Can PhagesReplace Antibiotics in Agriculture and Aquaculture? Antibiotics.2020;9:493.doi: 10.3390 / antibiotics9080493.27. Buttimer C., McAuliffe O., Ross R.P., Hill C., O’Mahony J., Coffey A. Bacteriophages andBacterial Plant Diseases. Front. Microbiol.2017;8 doi: 10.3389 / fmicb.2017.00034.28. Ahern S.J., Das M., Bhowmick T.S., Young R., Gonzalez C.F. Characterization of NovelVirulent Broad-Host-Range Phages of Xylella Fastidiosa and Xanthomonas. J.Bacteriol.2014;196:459–471. doi: 10.1128 / JB.01080-13.29. Das M., Bhowmick T.S., Ahern S.J., Young R., Gonzalez C.F. Control of Pierce’s Diseaseby Phage. PLoS ONE.2015;10:e0128902. doi: 10.1371 / journal.pone.0128902.30. Gonzalez C.F., Ahern S.J., Das M., Young I.R.F., Bhowmick T.S. Methods andCompositions for Treatment and Control of Plant Disease. No. 10,499,650. U.S. Patent.2015Dec 10. 31. Clavijo-Coppens F., Ginet N., Cesbron S., Briand M., Jacques M-A, Ansaldi M., Novel Virulent Bacteriophages Infecting Mediterranean Isolates of the Plant Pest Xylella fastidiosaand Xanthomonas albilineans, Viruses.2021 Apr 21;13(5):725. doi: 10.3390 / v13050725.32. Bin Jang, H., Bolduc, B., Zablocki, O., Kuhn, J. H., Roux, S., Adriaenssens, E. M., Brister, J. R., Kropinski, A. M., Krupovic, M., Lavigne, R., Turner, D., & Sullivan, M. B. (2019). Taxonomic assignment of uncultivated prokaryotic virus genomes is enabled by gene-sharing networks. Nature Biotechnology, 37(6), 632–639. https: / / doi.org / 10.1038 / s41587-019-0100-8 33. Davis, M. J., French, W. J., & Schaadw, N. W. (1981). Axenic Culture of the Bacteria Associated with Phony Disease of Peach and Plum Leaf Scald. In CURRENTMICROBIOLOGY (Vol.6). 34. Farris, J. S. (n.d.). ESTIMATING PHYLOGENETIC TREES FROM DISTANCE MATRICES». 35. Fischer-Le Saux, M., Bonneau, S., Essakhi, S., Manceau, C., & Jacques, M. A. (2015). Aggressive emerging pathovars of Xanthomonas arboricola represent widespread epidemic clones distinct from poorly pathogenic strains, as revealed by multilocus sequence typing. Applied and Environmental Microbiology, 81(14), 4651–4668. https: / / doi.org / 10.1128 / AEM.00050-15 36. Gendre, J., Ansaldi, M., Olivenza, D. R., Denis, Y., Casadesús, J., & Ginet, N. (2022). Genetic Mining of Newly Isolated Salmophages for Phage Therapy. International Journal of Molecular Sciences, 23(16). https: / / doi.org / 10.3390 / ijms23168917 37. Göker, M., García-Blázquez, G., Voglmayr, H., Tellería, M. T., & Martín, M. P. (2009). Molecular taxonomy of phytopathogenic fungi: A case study in Peronospora. PLoS ONE, 4(7). https: / / doi.org / 10.1371 / journal.pone.0006319 38. Kropinski, A. M., Mazzocco, A., Waddell, T. E., Lingohr, E., & Johnson, R. P. (2009).Enumeration of Bacteriophages by Double Agar OverlayPlaque Assay (M. R. J. Clokie & A. M.Kropinski, Eds.; Vol.501). Humana Press. https: / / doi.org / 10.1007 / 978-1-60327-164-6 39. Lefort, V., Desper, R., & Gascuel, O. (2015). FastME 2.0: A comprehensive, accurate, and fast distance-based phylogeny inference program. Molecular Biology and Evolution, 32(10), 2798–2800. https: / / doi.org / 10.1093 / molbev / msv150 40. Meier-Kolthoff, J. P., Auch, A. F., Klenk, H.-P., & ¨ Oker, M. G. (2013). Genome sequence- based species delimitation with confidence intervals and improved distance functions. In BMCBioinformatics (Vol.14). http: / / www.biomedcentral.com / 1471-2105 / 14 / 6041. Meier-Kolthoff, J. P., & Göker, M. (2017). VICTOR: genome-based phylogeny and classification of prokaryotic viruses. Bioinformatics (Oxford, England), 33(21), 3396–3404. https: / / doi.org / 10.1093 / bioinformatics / btx440 42. Meier-Kolthoff, J. P., Hahnke, R. L., Petersen, J., Scheuner, C., Michael, V., Fiebig, A., Rohde, C., Rohde, M., Fartmann, B., Goodwin, L. A., Chertkov, O., Reddy, T., Pati, A., Ivanova,N. N., Markowitz, V., Kyrpides, N. C., Woyke, T., Göker, M., & Klenk, H.-P. (2014). E X T E ND E D G E N Complete genome sequence of DSM 30083 T , the type strain (U5 / 41 T ) of Escherichia coli, and a proposal for delineating subspecies in microbial taxonomy. http: / / www.standardsingenomics.com / content / 9 / 1 / 2 43. Moraru, C., Varsani, A., & Kropinski, A. M. (2020). VIRIDIC—A novel tool to calculate the intergenomic similarities of prokaryote-infecting viruses. Viruses, 12(11). https: / / doi.org / 10.3390 / v12111268 44. Olm, M. R., Brown, C. T., Brooks, B., & Banfield, J. F. (2017). DRep: A tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. ISME Journal, 11(12), 2864–2868. https: / / doi.org / 10.1038 / ismej.2017.126 45. Pandolfo, M., Telatin, A., Lazzari, G., Adriaenssens, E. M., & Vitulo, N. (2022). MetaPhage: an Automated Pipeline for Analyzing, Annotating, and Classifying Bacteriophages in Metagenomics Sequencing Data. MSystems, 7(5). https: / / doi.org / 10.1128 / msystems.00741- 22 46. Schneider, C. A., Rasband, W. S., & Eliceiri, K. W. (2012). NIH Image to ImageJ: 25 yearsof Image Analysis HHS Public Access. In Nat Methods (Vol.9, Issue 7).47. Turner, D., Kropinski, A. M., & Adriaenssens, E. M. (2021). A roadmap for genome-based phage taxonomy. Viruses, 13(3). https: / / doi.org / 10.3390 / v13030506 48. Yu, G. (2020). Using ggtree to Visualize Data on Tree-Like Structures. Current Protocols in Bioinformatics, 69(1). https: / / doi.org / 10.1002 / cpbi.96 49. Korniienko, N., Kharina, A., Zrelovs, N., Jindřichová, B., Moravec, T., Budzanivska, I., Burketová, L., & Kalachova, T. (2022). Isolation and Characterization of Two Lytic Phages Efficient Against Phytopathogenic Bacteria From Pseudomonas and Xanthomonas Genera. Frontiers in Microbiology, 13. https: / / doi.org / 10.3389 / fmicb.2022.853593 50. Taslem Mourosi, J., Awe, A., Guo, W., Batra, H., Ganesh, H., Wu, X., & Zhu, J. (2022). Understanding Bacteriophage Tail Fiber Interaction with Host Surface Receptor: The Key “Blueprint” for Reprogramming Phage Host Range. In International Journal of MolecularSciences (Vol.23, Issue 20). MDPI. https: / / doi.org / 10.3390 / ijms23201214651. Campanharo, J. C., Lemos, M. V. F., & De Macedo Lemos, E. G. (2003). Growth optimization procedures for the phytopathogen Xylella fastidiosa. Current Microbiology, 46(2), 99–102. https: / / doi.org / 10.1007 / s00284-002-3829-z52. Dann Turner et al., Abolishment of morphology-based taxa and change to binomial speciesnames: 2022 taxonomy update of the ICTV bacterial viruses subcommitteeDOI: 10.1007 / s00705-022-05694-2
[0002] CLAIMS 1. A composition comprising at least two isolated bacteriophaat Xylella fastidiosa (Xf), wherein each of said bacteriophages is capable of inhibiting thegrowth of said Xylella fastidiosa; and the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequencesi) SEQ ID NO:1 to SEQ ID NO:3ii) SEQ ID NO:4 to SEQ ID NO:6iii) SEQ ID NO:7iv) SEQ ID NO:8 to SEQ ID NO:9v) SEQ ID NO:10vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:15 to SEQ ID NO:27viii) SEQ ID NO:28 to SEQ ID NO:29.2. The composition according to claim 1, wherein the first isolated bacteriophagecomprises a genome with a DNA sequence selected in the group consisting of SEQ ID NO:1 to SEQ ID NO:29 and the second isolated bacteriophage comprises a genome with a DNA sequence selected in the group consisting of SEQ ID NO:1 to SEQ ID NO:29 but does not comprise the DNA sequence selected in the group consisting of SEQ ID NO:1 to SEQ ID NO:29 comprised in the genome of the first bacteriophage. 3. The composition according to claim 1 or 2, wherein the first isolatedbacteriophage is selected in the group consisting of the bacteriophages deposited respectively under the following DSMZ Accession Numbers : 34832, 34820, 34788, 34823, 34786, 34826, 34824, 34797, 34822, 34784, 34796, 34799, 34782, 34795, 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800, 34801, 34802, 34827, 34783, 34787, 34833, 34821 and the second isolated bacteriophage is selected in the group consisting of the bacteriophages deposited respectively under the following DSMZ Accession Numbers : 34832, 34820, 34788, 34823, 34786, 34826, 34824, 34797, 34822, 34784, 34796, 34799, 34782, 34795, 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800, 34801, 34802, 34827, 34783, 34787, 34833, 34821 but is not same than the first bacteriophage.4. The composition of claim 3, the first bacteriophage is one ofof one of the following groups of bacteriophages a) to h) and the second of the bacteriophages of another one of the following groups of a) DSMZ Accession Numbers = 34832, 34820, 34788 b) DSMZ Accession Numbers = 34823, 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800,34801, 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 34821. 5. The composition according to any one of claims 1 to 4, comprising 3, 4, 5, 6, 7or 8 bacteriophages, each bacteriophage of the composition comprising a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the groups of sequences i) to viii), being understood that two bacteriophages of the composition do not comprise a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of the same group. 6. The composition according to claim 5, wherein each bacteriophage of thecomposition is selected in one of the following groups of bacteriophages a) to h): a) DSMZ Accession Numbers = 34832, 34820, 34788 b) DSMZ Accession Numbers = 34823, 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800,34801, 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 34821. 7. The composition according to any one of claims 1 to 4, comprising 3, 4, 5, 6, 7 or 8 bacteriophages, each bacteriophage of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in one of the following groups of bacteriophages a) to h) and at least 2 of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in two of the following groups of bacteriophages a) to h): a) DSMZ Accession Numbers = 34832, 34820, 34788 b) DSMZ Accession Numbers = 34823, 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831, 34825, 34800,34801, 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 34821 8. A method of preventing or reducing symptoms or disease caused by Xylellafastidiosa in a plant, comprising contacting said plant or a part of said plant with a compositionaccording to any one of claims 1 to 7. 9. The method according to claim 8, wherein contacting comprises introducingbacteriophage particles into the plant. 10. The method according to claim 8 or 9 wherein the plant is a grapevine, olivetree, citrus tree, almond tree, coffee tree, blackberry tree, mulberry tree, maple tree, walnut tree, date tree, pistachio tree, plane tree, plum tree, pear tree, oak tree. 11. The method according to any one of claims 8 to 10, wherein the number ofbacteriophage(s) introduced into said plant is from 1.105to 1.1010PFU / ml. 12. A biocontrol composition comprising a composition according to any one ofclaims 1 to 7 and a carrier.
[0003] ABSTRACTThe invention relates to a composition comprising at least two isolatedaimed at Xylella fastidiosa (Xf), wherein each of said bacteriophages isthe growth of said Xylella fastidiosa; and the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequencesi) SEQ ID NO:1 to SEQ ID NO:3ii) SEQ ID NO:4 to SEQ ID NO:6iii) SEQ ID NO:7iv) SEQ ID NO:8 to SEQ ID NO:9v) SEQ ID NO:10vi) SEQ ID NO:11 to SEQ ID NO:14vii) SEQ ID NO:15 to SEQ ID NO:27viii) SEQ ID NO:28 to SEQ ID NO:29.
[0004] BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0005] INTERNATIONAL FORM
[0006] Centre National de la Recherche
[0007] Scientifique (CNRS), Paris
[0008] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0009] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0010] Bioline Agrosciences, Livron-sur-Drome
[0011] FRANCE
[0012] ' Where Rule 6.4 (d) applies, such date is the date on which the status of *ional depositary authority was acquired. Form DSMZ-BP / 4 (sole page) 07 / 2019 67 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0013] INTERNATIONAL FORM
[0014] Centre National de la Recherche
[0015] Scientifique (CNRS), Paris
[0016] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0017] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0018] Bioline Agrosciences, Livron-sur-Drome
[0019] FRANCE
[0020] 1Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0021] Form DSMZ-BP / 4 (sole page) 07 / 2019 68 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0022] INTERNATIONAL FORM
[0023] Centre National de la Recherche
[0024] Scientifique (CNRS), Paris
[0025] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7. 1 by the
[0026] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0027] Bioline Agrosciences, Livron-sur-Drome
[0028] FRANCE
[0029] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0030] INTERNATIONAL FORM
[0031] Centre National de la Recherche
[0032] Scientifique (CNRS), Paris
[0033] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0034] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0035] Bioline Agrosciences, Livron-sur-Drome
[0036] FRANCE
[0037] 1Where Rule 6.4 (d) applies, such date is the date on which the status of i itional depositary authority was acquired.
[0038] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREATY ON THE INTERNATIONAL 'T®fcRECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0039] DSMZ
[0040] INTERNATIONAL FORM nj !
[0041] Centre National de la Recherche
[0042] Scientifique (CNRS), Paris
[0043] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0044] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0045] Bioline Agrosciences, Livron-sur-Drome
[0046] FRANCE
[0047] 1Where Rule 6.4 (d) applies, such date is the date on which the status of r" tional depositary authority was acquired.
[0048] Form DSMZ-BP / 4 (sole page) 07 / 2019 71 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0049] INTERNATIONAL FORM
[0050] Centre National de la Recherche
[0051] Scientifique (CNRS), Paris
[0052] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0053] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0054] Bioline Agrosciences, Livron-sur-Drome
[0055] FRANCE BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0056] INTERNATIONAL FORM
[0057] Centre National de la Recherche
[0058] Scientifique (CNRS), Paris
[0059] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7. 1 by the
[0060] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0061] Bioline Agrosciences, Livron-sur-Drome
[0062] FRANCE
[0063] 1Where Rule 6.4 (d) applies, such date is the date on which the status of itional depositary authority was acquired.
[0064] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREAT Y UN 1HH INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0065] INTERNATIONAL FORM
[0066] Centre National de la Recherche
[0067] Scientifique (CNRS), Paris
[0068] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0069] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0070] Bioline Agrosciences, Livron-sur-Drome
[0071] FRANCE
[0072] ' Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0073] Form DSMZ-BP / 4 (sole page) 07 / 2019 74 BUDAPEST TREATY UN THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0074] INTERNATIONAL FORM
[0075] Centre National de la Recherche
[0076] Scientifique (CNRS), Paris
[0077] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0078] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0079] Bioline Agrosciences, Livron-sur-Drome
[0080] FRANCE
[0081] 1Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0082] Form DSMZ-BP / 4 (sole page) 07 / 2019 75 BUDAPEST TREATT TERNATIONAL
[0083] RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0084] INTERNATIONAL FORM
[0085] Centre National de la Recherche
[0086] Scientifique (CNRS), Paris
[0087] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0088] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0089] Bioline Agrosciences, Livron-sur-Drome
[0090] FRANCE
[0091] ' Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0092] Form DSMZ-BP / 4 (sole page) 07 / 2019 76 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0093] INTERNATIONAL FORM
[0094] Centre National de la Recherche
[0095] Scientifique (CNRS), Paris
[0096] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0097] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0098] Bioline Agrosciences, Livron-sur-Drome
[0099] FRANCE BUDAPEST TREATS UN 1 HE IN fERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0100] INTERNATIONAL FORM
[0101] Centre National de la Recherche
[0102] Scientifique (CNRS), Paris
[0103] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0104] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0105] Bioline Agrosciences, Livron-sur-Drome
[0106] FRANCE
[0107] 1Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0108] Form DSMZ-BP / 4 (sole page) 07 / 201 78 APEST TREATY ON THE INTERNATIONAL STION OF THE DEPOSIT OF MICROORGANISMS THE PURPOSES OF PATENT PROCEDURE
[0109] INTERNATIONAL FORM
[0110] Centre National de la Recherche
[0111] Scientifique (CNRS), Paris
[0112] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0113] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0114] Bioline Agrosciences, Livron-sur-Drome
[0115] FRANCE
[0116] ' Where Rule 6.4 (d) applies, such date is the date on which the status of i~‘ - tional depositary authority was acquired.
[0117] Form DSMZ-BP / 4 (sole page) 07 / 2019 79 BUDAPEST TREATY UN THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0118] INTERNATIONAL FORM
[0119] Centre National de la Recherche
[0120] Scientifique (CNRS), Paris
[0121] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0122] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0123] Bioline Agrosciences, Livron-sur-Drome
[0124] FRANCE
[0125] 1Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0126] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0127] INTERNATIONAL FORM
[0128] Centre National de la Recherche
[0129] Scientifique (CNRS), Paris
[0130] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0131] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0132] Bioline Agrosciences, Livron-sur-Drome
[0133] FRANCE
[0134] ' Where Rule 6.4 (d) applies, such date is the date on which the status of i"h•tional depositary authority was acquired.
[0135] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0136] INTERNATIONAL FORM
[0137] Centre National de la Recherche
[0138] Scientifique (CNRS), Paris
[0139] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0140] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0141] Bioline Agrosciences, Livron-sur-Drome
[0142] FRANCE
[0143] 1Where Rule 6.4 (d) applies, such date is the date on which the status of i- -tional depositary authority was acquired.
[0144] Form DSMZ-BP / 4 (sole page) 07 / 2019 ^2 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0145] INTERNATIONAL FORM
[0146] Centre National de la Recherche
[0147] Scientifique (CNRS), Paris
[0148] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0149] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0150] Bioline Agrosciences, Livron-sur-Drome
[0151] FRANCE
[0152] ' Where Rule 6.4 (d) applies, such date is the date on which the status of tional deposi ary authority was acquired.
[0153] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0154] INTERNATIONAL FORM
[0155] Centre National de la Recherche
[0156] Scientifique (CNRS), Paris
[0157] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0158] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0159] Bioline Agrosciences, Livron-sur-Drome
[0160] FRANCE
[0161] 1Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0162] Form DSMZ-BP / 4 (sole page) 07 / 2019 84 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0163] INTERNATIONAL FORM
[0164] Centre National de la Recherche
[0165] Scientifique (CNRS), Paris
[0166] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0167] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0168] Bioline Agrosciences, Livron-sur-Drome
[0169] FRANCE BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0170] DSMZ
[0171] INTERNATIONAL FORM •
[0172] Centre National de la Recherche .
[0173] Scientifique (CNRS), Paris
[0174] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0175] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0176] Bioline Agrosciences, Livron-sur-Drome
[0177] FRANCE
[0178] ' Where Rule 6.4 (d) applies, such date is the date on which the status of ' itional depositary authority was acquired.
[0179] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0180] Centre National de la Recherche
[0181] Scientifique (CNRS), Paris
[0182] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0183] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0184] Bioline Agrosciences, Livron-sur-Drome
[0185] FRANCE BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0186] INTERNATIONAL FORM
[0187] Centre National de la Recherche
[0188] Scientifique (CNRS), Paris
[0189] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0190] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0191] Bioline Agrosciences, Livron-sur-Drome
[0192] FRANCE BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0193] INTERNATIONAL FORM
[0194] Centre National de la Recherche
[0195] Scientifique (CNRS), Paris
[0196] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0197] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0198] Bioline Agrosciences, Livron-sur-Drome
[0199] FRANCE
[0200] ' Where Rule 6.4 (d) applies, such date is the date on which the status of inf«™-*ional depositary authority was acquired.
[0201] Form DSMZ-BP / 4 (sole page) 07 / 2019 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0202] INTERNATIONAL FORM
[0203] Centre National de la Recherche
[0204] Scientifique (CNRS), Paris
[0205] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the
[0206] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0207] Bioline Agrosciences, Livron-sur-Drome
[0208] FRANCE
[0209] ' Where Rule 6.4 (d) applies, such date is the date on which the status of international depositary authority was acquired.
[0210] Form DSMZ-BP / 4 (sole page) 07 / 2019 90 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE
[0211] INTERNATIONAL FORM
[0212] Centre National de la Recherche
[0213] Scientifique (CNRS), Paris
[0214] RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7,1 by the
[0215] Aix-Marseille Universite, Marseille INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this page
[0216] Bioline Agrosciences, Livron-sur-Drome
[0217] FRANCE
Claims
CLAIMS1 . A composition comprising at least two isolated bacteriophages that are aimed at Xylella fastidiosa (Xf), wherein each of said bacteriophages is capable of inhibiting the growth of said Xylella fastidiosa’, and the first bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the following groups of sequences i) to viii) and the second bacteriophage comprises a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of another one of the following groups of sequences i) SEQ ID NO:1 to SEQ ID NO:3 ii) SEQ ID NO:4 to SEQ ID NO:6 iii) SEQ ID NO:7 iv) SEQ ID NO:8 to SEQ ID NO:9 v) SEQ ID NQ:10 vi) SEQ ID NO:11 to SEQ ID NO:14 vii) SEQ ID NO:15 to SEQ ID NO:27 viii) SEQ ID NO:28 to SEQ ID NO:29.
2. The composition according to claim 1 , wherein the first isolated bacteriophage comprises a genome with a DNA sequence selected in the group consisting of SEQ ID NO:1 to SEQ ID NO:29 and the second isolated bacteriophage comprises a genome with a DNA sequence selected in the group consisting of SEQ ID NO:1 to SEQ ID NO:29 but does not comprise the DNA sequence selected in the group consisting of SEQ ID NO:1 to SEQ ID NO:29 comprised in the genome of the first bacteriophage.
3. The composition according to claim 1 or 2, wherein the first isolated bacteriophage is selected in the group consisting of the bacteriophages deposited respectively under the following DSMZ Accession Numbers : 34832, 34820, 34788, 34823, 34786, 34826, 34824, 34797, 34822, 34784, 34796, 34799, 34782, 34795, 34798, 34785, 34828, 34829, 34830, 34831 , 34825, 34800, 34801 , 34802, 34827, 34783, 34787, 34833, 34821 and the second isolated bacteriophage is selected in the group consisting of the bacteriophages deposited respectively under the following DSMZ Accession Numbers : 34832, 34820, 34788, 34823, 34786, 34826, 34824, 34797, 34822, 34784, 34796, 34799, 34782, 34795, 34798, 34785, 34828, 34829, 34830, 34831 , 34825, 34800, 34801 , 34802, 34827, 34783, 34787, 34833, 34821 but is not same than the first bacteriophage.
4. The composition of claim 3, the first bacteriophage is one of the bacteriophages of one of the following groups of bacteriophages a) to h) and the second bacteriophage is one of the bacteriophages of another one of the following groups of bacteriophages a) to h): a) DSMZ Accession Numbers = 34832, 34820, 34788 b) DSMZ Accession Numbers = 34823, 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795 g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831 , 34825, 34800, 34801 , 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 34821.
5. The composition according to any one of claims 1 to 4, comprising 3, 4, 5, 6, 7 or 8 bacteriophages, each bacteriophage of the composition comprising a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of one of the groups of sequences i) to viii), being understood that two bacteriophages of the composition do not comprise a genome with a DNA sequence having at least 90% sequence identity to one of the sequences of the same group.
6. The composition according to claim 5, wherein each bacteriophage of the composition is selected in one of the following groups of bacteriophages a) to h): a) DSMZ Accession Numbers = 34832, 34820, 34788 b) DSMZ Accession Numbers = 34823, 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795 g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831 , 34825, 34800, 34801 , 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 34821.
7. The composition according to any one of claims 1 to 4, comprising 3, 4, 5, 6, 7 or 8 bacteriophages, each bacteriophage of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in one of the following groups of bacteriophages a) to h) and at least 2 of the 3, 4, 5, 6, 7 or 8 phages of the composition being selected in two of the following groups of bacteriophages a) to h):a) DSMZ Accession Numbers = 34832, 34820, 34788 b) DSMZ Accession Numbers = 34823, 34786, 34826 c) DSMZ Accession Numbers = 34824 d) DSMZ Accession Numbers = 34797, 34822 e) DSMZ Accession Numbers = 34784 f) DSMZ Accession Numbers = 34796, 34799, 34782, 34795 g) DSMZ Accession Numbers = 34798, 34785, 34828, 34829, 34830, 34831 , 34825, 34800, 34801 , 34802, 34827, 34783, 34787 h) DSMZ Accession Numbers = 34833, 348218. A method of preventing or reducing symptoms or disease caused by Xylella fastidiosa in a plant, comprising contacting said plant or a part of said plant with a composition according to any one of claims 1 to 7.
9. The method according to claim 8, wherein contacting comprises introducing bacteriophage particles into the plant.
10. The method according to claim 8 or 9 wherein the plant is a grapevine, olive tree, citrus tree, almond tree, coffee tree, blackberry tree, mulberry tree, maple tree, walnut tree, date tree, pistachio tree, plane tree, plum tree, pear tree, oak tree.
11. The method according to any one of claims 8 to 10, wherein the number of bacteriophage(s) introduced into said plant is from 1.105to 1.1010PFU / ml.
12. A biocontrol composition comprising a composition according to any one of claims 1 to 7 and a carrier.
Citation Information
Patent Citations
Methods and compositions for treatment and control of plant disease
WO2014063070A2