Novel bifunctional glutamate n-acetyltransferase / amino-acid acetyltransferase variant, and method for producing glutamate-based amino acids using same
A dual-functional glutamate N-acetyltransferase variant enhances the production efficiency of glutamate-based amino acids in Corynebacterium strains, addressing inefficiencies in existing methods and increasing yields by up to 35%.
Patent Information
- Application Number
- PCT/KR2025/004328
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-25
- Filing Date
- 2025-04-02
- Publication Date
- 2025-10-30
AI Technical Summary
The existing methods for producing glutamate-based amino acids, such as L-ornithine, L-citrulline, and L-arginine, are inefficient, limiting the supply to meet growing demand.
A dual-functional glutamate N-acetyltransferase/amino acid acetyltransferase variant is introduced into Corynebacterium strains, specifically altering the 201st and 355th amino acids in the sequence to enhance the production of glutamate-based amino acids.
The variant increases the production efficiency of glutamate-based amino acids by up to 35% compared to unmodified strains, improving the yield of L-ornithine, L-citrulline, and L-arginine.
Abstract
Description
A novel dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant and a method for producing glutamate-based amino acids using the same.
[0001] Cross-citation with related application(s)
[0002] This application claims the benefit of priority to Korean Patent Application No. 10-2024-0055639, filed April 25, 2024, the entire contents of which are incorporated herein by reference.
[0003] The present disclosure relates to a novel dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant and a method for producing glutamate-based amino acids using the same.
[0004]
[0005] Glutamate is one of the protein-forming amino acids widely found in plants, animals, and microorganisms. It is metabolized in the body by being converted into ornithine (L-ornithine), citrulline (L-citrulline), arginine (L-arginine), and putrescine.
[0006] Ornithine is used as a nutritional supplement because it promotes muscle growth and body fat reduction, and is also used as a medicine to improve cirrhosis and liver dysfunction. Citrulline is known for its physiological effects, including promoting ammonia metabolism, improving blood flow through vasodilation, lowering blood pressure, promoting neurotransmission, enhancing immunity, and scavenging reactive oxygen species. Furthermore, arginine is used medicinally as a liver function enhancer, brain function enhancer, and comprehensive amino acid preparation, and is also used in foods, such as fish jelly additives, health drink additives, and as a salt substitute for hypertensive patients. Putrescine is a type of polyamine found in a wide range of organisms, from bacteria to plants and animals. It plays a crucial role in cell proliferation and normal cell growth, and is also known to be an important substance in the defense mechanism against oxidative stress.
[0007] Microorganisms of the genus Corynebacterium, particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used for amino acid production. For amino acid production, target-substance-specific approaches are primarily used, such as increasing the expression of genes encoding enzymes primarily involved in amino acid biosynthesis in Corynebacterium strains or deleting genes unnecessary for amino acid biosynthesis (US 9644009 B2).
[0008] As the demand for glutamate-based amino acids increases, the need for research on methods for efficiently producing glutamate-based amino acids is emerging.
[0009] One example of the present disclosure provides a bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase (ArgJ) variant, wherein the amino acid corresponding to the 201st amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with phenylalanine (Phe, or F), and the amino acid corresponding to the 355th amino acid is substituted with glutamic acid (Glu, or E).
[0010] Another example of the present disclosure provides a polynucleotide encoding the variant.
[0011] Another example of the present disclosure provides a recombinant vector comprising the polynucleotide.
[0012] Another example of the present disclosure provides a microorganism of the genus Corynebacterium comprising the variant, a polynucleotide encoding the variant, or a recombinant vector comprising the polynucleotide. The Corynebacterium microorganism may have the ability to produce glutamate-based amino acids, or may have an increased ability to produce glutamate-based amino acids compared to a non-modified Corynebacterium microorganism.
[0013] Another example of the present disclosure comprises the steps of culturing a Corynebacterium genus microorganism comprising the variant, a polynucleotide encoding the variant, or a recombinant vector comprising the polynucleotide in a medium, and
[0014] A method for producing a glutamate series amino acid is provided, comprising a step of recovering a glutamate series amino acid from the cultured microorganism, medium, or both.
[0015] Another example of the present disclosure provides a use for producing glutamate series amino acids by a microorganism of the genus Corynebacterium comprising the variant, a polynucleotide encoding the variant, or a recombinant vector comprising the polynucleotide.
[0016]
[0017] This is specifically described as follows. Meanwhile, each description and embodiment disclosed in this disclosure can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this disclosure fall within the scope of this disclosure. Furthermore, the scope of this disclosure is not limited by the specific descriptions set forth below. Furthermore, those skilled in the art will recognize or ascertain, through routine experimentation alone, numerous equivalents to the specific embodiments of the present disclosure described herein. Furthermore, such equivalents are intended to be encompassed by this disclosure.
[0018] Additionally, numerous papers and patents are referenced and cited throughout this disclosure. The disclosures of these cited papers and patents are incorporated by reference into this disclosure in their entirety, thereby providing a clearer understanding of the technical field to which this disclosure pertains and the content of this disclosure.
[0019]
[0020] One example of the present disclosure provides a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant, wherein the amino acid corresponding to the 201st amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with phenylalanine (Phe, or F), and the amino acid corresponding to the 355th amino acid is substituted with glutamic acid (Glu, or E).
[0021] In the amino acid sequence of the above sequence number 1, the amino acid corresponding to the 201st amino acid from the N-terminus may be isoleucine (Ile, or I), and the amino acid corresponding to the 355th amino acid may be aspartic acid (Asp, or D).
[0022] The dual functional glutamate N-acetyltransferase / amino acid acetyltransferase variant of the present disclosure may comprise the amino acid sequence of SEQ ID NO: 3, or may consist of (become) composed of the amino acid sequence.
[0023] In addition, the variant of the present disclosure may include an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO: 3, wherein the amino acid corresponding to position 201 based on the amino acid sequence of SEQ ID NO: 1 is phenylalanine, the amino acid corresponding to position 355 is glutamic acid, and the amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO: 3. In addition, it is obvious that a variant having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present disclosure, as long as it has such homology or identity and exhibits an effect corresponding to the variant of the present disclosure.
[0024] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the variant of the present disclosure at the N-terminus, C-terminus and / or within the amino acid sequence.
[0025] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.
[0026] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant prior to the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide prior to the mutation. Additionally, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The term “variant” above may be used interchangeably with terms such as variant, modification, variant polypeptide, variant protein, variant, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto as long as the term is used in the meaning of variant. For the purpose of the present disclosure, the variant may be a polypeptide including the amino acid sequence set forth in SEQ ID NO: 3, in which the amino acid corresponding to the 201st amino acid of the amino acid sequence of SEQ ID NO: 1 is substituted with phenylalanine, and the amino acid corresponding to the 355th amino acid is substituted with glutamic acid.
[0027] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.
[0028] To describe the variants provided in this disclosure, the following nomenclature is used.
[0029] In the present disclosure, reference to a specific position in an amino acid sequence may include reference to an amino acid present or substituted at that position. Reference to an amino acid at a specific position may be described in various ways. For example, "position 201" may be described as "amino acid 201" or "the 201st amino acid." Furthermore, for example, if the amino acid at position 201 is isoleucine, it may be described as "I" or "Ile201."
[0030] Amino acid substitutions can be expressed by listing the amino acid before substitution, the position, and the amino acid being substituted in that order. The amino acids can be expressed using the usual one-letter and three-letter codes. For example, if the amino acid at position 201 of a specific sequence, isoleucine, is substituted with phenylalanine, it can be written as "I201F" or "Ile201Phe."
[0031] Multiple mutations can be described using a "+". For example, a description such as "I201F + D355E" means that the amino acid at position 201, isoleucine, is replaced by phenylalanine, and the amino acid at position 355, aspartic acid, is replaced by glutamic acid, respectively.
[0032] As used herein, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.
[0033] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.
[0034] Whether any two polynucleotide or polypeptide sequences are homologous or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example, as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073). For example, homology or identity can be determined using BLAST or ClustalW of the National Center for Biotechnology Information database.
[0035] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, or in, for example, Needleman et al. (1970), J Mol Biol. 48:443. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and (2) a coding sequence matrix, as disclosed by Gribskov et al. (1986) Nucl. Acids Res. 48:443, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979). 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0036] As an example of the present disclosure, a variant of the present disclosure may have dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase activity. Furthermore, the variant may have an activity that increases glutamate-series amino acid production compared to the wild-type polypeptide.
[0037] In the present disclosure, the term “bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase ArgJ” means an enzyme having both glutamate N-acetyltransferase activity that converts glutamate and acetyl-CoA into N-acetyl glutamate and amino acid acetyltransferase activity that converts acetyl-L-ornithine and L-glutamate into L-ornithine and N-acetyl-L-glutamate. The bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase of the present disclosure may be used interchangeably with arginine biosynthesis bifunctional protein ArgJ, ArgJ protein. The above “glutamate N-acetyltransferase” may be used interchangeably with the terms N2-acetyl-L-ornithine: L-glutamate N-acetyltransferase, ornithine acetyltransferase, ornithine transacetylase, and acetylornithine glutamate acetyltransferase, and the above “amino acid acetyltransferase” may be used interchangeably with the terms acetyl-CoA:L-glutamate N-acetyltransferase, N-acetylglutamate It can be used in combination with the synthetase (N-acetylglutamate synthetase). In the present disclosure, the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase sequence can be obtained from the NCBI's GenBank, a known database (e.g., WP_040967390.1). Specifically, it may be, but is not limited to, a polypeptide having dual functional glutamate N-acetyltransferase / amino acid acetyltransferase activity encoded by the argJ gene.
[0038] In the present disclosure, the term "glutamate series amino acid" refers to an amino acid that can be biosynthesized using glutamate as a precursor. Specifically, the glutamate series amino acid may be any one or more selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine, but is not limited thereto as long as it is an amino acid that can be biosynthesized using glutamate as a precursor. The "glutamate series amino acid" of the present disclosure may be used interchangeably with "glutamic acid series amino acid."
[0039] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.
[0040] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present disclosure can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).
[0041] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.
[0042]
[0043] Another aspect of the present disclosure provides a polynucleotide encoding a variant of the present disclosure.
[0044] In the present disclosure, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the variant.
[0045] A polynucleotide encoding a variant of the present disclosure may comprise a base sequence encoding an amino acid sequence set forth in SEQ ID NO: 3. As an example of the present disclosure, the polynucleotide of the present disclosure may have or comprise the sequence of SEQ ID NO: 4. Furthermore, the polynucleotide of the present disclosure may consist of, or consist essentially of, the sequence of SEQ ID NO: 4. In another example, the polynucleotide of the present disclosure may comprise a nucleic acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the nucleic acid sequence set forth in SEQ ID NO: 4, wherein the base corresponding to position 601 is T and the base corresponding to position 1065 is G based on the nucleic acid sequence of SEQ ID NO: 2. Additionally, it is obvious that a polynucleotide having a nucleic acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted or added is also included within the scope of the present disclosure, provided that the sequence encodes a polypeptide or protein having such homology or identity and exhibiting an effect corresponding to a variant of the present disclosure.
[0046] The polynucleotide of the present disclosure may have various modifications in the coding region within a range that does not change the amino acid sequence of the variant of the present disclosure, taking into account the degeneracy of the codon or the codon preferred in the organism that is to express the variant of the present disclosure. Specifically, the polynucleotide of the present disclosure may have or include a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 4, or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 4, but is not limited thereto. At this time, in the sequence having the above homology or identity, the codon encoding the amino acid corresponding to the 201st position of sequence number 3 may be one of the codons encoding phenylalanine, and the codon encoding the amino acid corresponding to the 355th position may be one of the codons encoding glutamic acid.
[0047] In addition, the polynucleotide of the present disclosure may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present disclosure. The term “stringent conditions” refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, and more specifically 68°C, 0.1×SSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.
[0048] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present disclosure may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.
[0049] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present disclosure can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.
[0050] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).
[0051]
[0052] Another aspect of the present disclosure provides a vector comprising the polynucleotide of the present disclosure. The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a host cell.
[0053] In the present disclosure, a “vector” may include a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, and may be integrated into the genome itself.
[0054] The vector used in the present disclosure is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pDC24, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pCES208 vectors, etc. can be used.
[0055] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.
[0056] As used herein, the term "transformation" refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism, such that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide can be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide can be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all the elements necessary for its own expression. The expression cassette can typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.
[0057] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target variant of the present disclosure.
[0058]
[0059] Another aspect of the present disclosure provides a microorganism of the genus Corynebacterium comprising a variant of the present disclosure or a polynucleotide of the present disclosure.
[0060] The microorganism of the present disclosure may comprise a variant polypeptide of the present disclosure, a polynucleotide encoding the polypeptide, or a vector comprising the polynucleotide of the present disclosure.
[0061] In the present disclosure, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be microorganisms that have had a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein or product.
[0062] The microorganism of the present disclosure may be, but is not limited to, a microorganism comprising at least one of a variant of the present disclosure, a polynucleotide of the present disclosure, and a vector comprising a polynucleotide of the present disclosure; a microorganism modified to express a variant of the present disclosure or a polynucleotide of the present disclosure; a microorganism (e.g., a recombinant strain) expressing a variant of the present disclosure or a polynucleotide of the present disclosure; or a microorganism (e.g., a recombinant strain) having the activity of a variant of the present disclosure.
[0063] The microorganism of the present disclosure may be a microorganism having the ability to produce glutamate series amino acids.
[0064] The microorganism of the present application may have improved glutamate series amino acid production ability.
[0065] The microorganism of the present application may be a microorganism that naturally has dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase activity and / or glutamate-series amino acid production ability, or a parent strain that does not have dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase activity or glutamate-series amino acid production ability, into which a variant of the present disclosure or a polynucleotide encoding the same (or a vector including the polynucleotide) is introduced and / or the glutamate-series amino acid production ability is imparted, but is not limited thereto.
[0066] For example, the microorganism of the present disclosure is a cell or microorganism that is transformed with a vector containing a polynucleotide encoding the polynucleotide of the present disclosure or a variant of the present disclosure, and expresses the variant of the present disclosure. For the purposes of the present disclosure, the microorganism of the present disclosure may include any microorganism capable of producing glutamate-based amino acids, including the variant of the present disclosure. For example, the microorganism of the present disclosure may be a recombinant strain in which a polynucleotide encoding the variant of the present disclosure is introduced into a natural wild-type microorganism or a microorganism that produces glutamate-based amino acids, thereby expressing a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant, thereby increasing the production ability of glutamate-based amino acids.
[0067] The recombinant strain having increased glutamate series amino acid production ability may be a microorganism having increased glutamate series amino acid production ability compared to a natural wild-type microorganism or a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase unmodified microorganism (i.e., a microorganism expressing a wild-type (SEQ ID NO: 1) protein or a microorganism not expressing a modified (SEQ ID NO: 3) protein), but is not limited thereto. For example, the target strain for comparing the increase in glutamate series amino acid production ability, a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase unmodified microorganism, may be, but is not limited to, a wild-type Corynebacterium glutamicum ATCC13869 strain, a Corynebacterium glutamicum ATCC13869 strain with weakened activity of the ArgR protein and / or the ArgF protein, a Corynebacterium glutamicum ATCC13869 strain with weakened activity of the ArgR protein and / or the ArgG protein, or a Corynebacterium glutamicum CJR100 strain (KR 10-2023-0048232 A).
[0068] For example, the recombinant strain with increased productivity has a glutamate series amino acid productivity of about 1% or more, about 2.5% or more, about 3% or more, about 3.1% or more, about 3.2% or more, about 3.3% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 10.5% or more, about 11% or more, about 11.5% or more, about 12% or more, about 12.5% or more, about 13% or more, about 13.5% or more, about 14% or more, about 14.5% or more, about 15% or more, about 15.5% or more, about 16% or more, about 16.5% or more, or about 17% About 17.5% or more, about 18% or more, about 18.5% or more, about 19% or more, about 19.5% or more, about 20% or more, about 20.5% or more, about 21% or more, about 21.5% or more, about 22% or more, about 22.5% or more, about 23% or more, about 23.5% or more, about 24% or more, about 24.5% or more, about 25% or more, about 25.5% or more, about 26% or more, about 26.5% or more, about 27% or more, about 27.5% or more, about 28% or more, about 28.5% or more, about 29% or more, about 29.5% or more, about 30% or more, about 31% or more, about 32% or more, about 33% or more, about 34% or more, or about 35% The productivity may be increased by more than about 300% (the upper limit is not particularly limited, for example, it may be about 250% or less, or about 200% or less), but is not limited thereto, as long as it has a positive increase compared to the productivity of the parent strain or the non-modified microorganism before mutation. In another example, the recombinant strain with increased productivity may have a glutamate series amino acid productivity of about 1.02 times or more, about 1.03 times or more, about 1.05 times or more, about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, or 1.It may be increased by 15 times or more, 1.16 times or more, 1.17 times or more, 1.18 times or more, 1.19 times or more, about 1.2 times or more, 1.25 times or more, about 1.3 times or more, or about 1.5 times or more (the upper limit is not particularly limited, and may be, for example, about 10 times or less, about 5 times or less, about 4 times or less, or about 3 times or less).
[0069] More specifically, the recombinant strain with increased productivity may have an L-ornithine productivity increased by about 1% or more, about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 7.5% or more, about 8% or more, about 9% or more, about 10% or more, about 12% or more, about 14% or more, about 15% or more, about 16% or more, or about 17% or more (the upper limit is not particularly limited and may be, for example, about 100% or less, about 50% or less, or about 30% or less), compared to the parent strain or the unmodified microorganism before the mutation (before the polynucleotide encoding the variant of the present disclosure is introduced), and an L-citrulline productivity increased by about 1% or more, about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, or about 8%. The L-arginine productivity may be increased by about 1% or more, about 2.5% or more, about 3% or more, about 3.1% or more, about 3.2% or more, or about 3.3% or more (the upper limit is not particularly limited, for example, it may be about 50% or less, about 40% or less, or about 30% or less), and the putrescine productivity may be increased by about 1.3 times or more, or about 1.5 times or more (the upper limit is not particularly limited, for example, it may be about 100% or less, about 50% or less, or about 40% or less). There are no specific limitations, and it may be increased by, for example, about 10 times or less, about 5 times or less, about 4 times or less, or about 3 times or less.
[0070] The term “about” above includes all ranges including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all ranges of values equal to or similar to the value following the term “about,” but is not limited thereto.
[0071] The term "unmodified microorganism" in the present disclosure does not exclude a strain that contains a mutation that may occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its phenotype is changed by a genetic mutation caused by natural or artificial factors. For example, the unmodified microorganism may refer to a strain into which the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant described in the present disclosure has not been introduced or has been introduced. The "unmodified microorganism" may be used interchangeably with "pre-modified strain", "pre-modified microorganism", "unmutated strain", "unmodified microorganism", "unmutated microorganism", or "reference microorganism".
[0072] As another example of the present disclosure, the microorganism of the present disclosure may be a microorganism of the genus Corynebacterium. The above Corynebacterium genus microorganisms include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium pollutisoli, and Corynebacterium. It may be Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens.
[0073]
[0074] As another example of the present disclosure, the Corynebacterium genus microorganism with increased glutamate series amino acid production ability of the present disclosure may be a microorganism with enhanced glutamate series amino acid production ability by further enhancing the activity of a portion of a protein in the glutamate series amino acid biosynthetic pathway, or by further weakening the activity of a portion of a protein in the glutamate series amino acid biosynthetic pathway.
[0075] Specifically, the microorganism of the present disclosure may be a microorganism in which the activity of ornithine carbamoyltransferase subunit F (ArgF) and / or arginine repressor (ArgR) is further weakened, or the argF gene and / or argR gene encoding them is further deleted. In addition, the microorganism of the present disclosure may be a microorganism in which the activity of arginine repressor (ArgR) and / or argininosuccinate synthase (ArgG) is further weakened, or the argR gene and / or argG gene encoding them is further deleted, and / or the activity of ornithine decarboxylase (ODC) is introduced. In addition, the microorganism of the present disclosure may be a microorganism that has been mutated so that the activity of a protein encoded by the NCgl1469 gene, which is an enzyme that synthesizes putrescine into N-acetyl putrescine, is further weakened or the gene encoding it is deleted in order to increase putrescine productivity.
[0076] The amino acid sequences of the above ArgF, ArgR, ArgG, and ODC can be obtained from a known database such as NCBI's Genebank. For example, the amino acid sequence of ArgF of the present disclosure may include ANU33618.1 derived from Corynebacterium glutamicum ATCC13869 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence of ArgR may include ANU33619.1 derived from Corynebacterium glutamicum ATCC13869 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence of ArgG may include ANU33620.1 derived from Corynebacterium glutamicum ATCC13869 or an amino acid sequence having 90% or more homology thereto, and the amino acid sequence of ODC may include Lactobacillus sp. It may include, but is not limited to, an amino acid sequence having 90% or more homology thereto derived from 30A strain AAA64830.1, and it is self-evident that it includes proteins having ArgF, ArgR, ArgG or ODC activity of various origins.
[0077] As used herein, the term "attenuation" of a polypeptide encompasses a reduction in activity or absence of activity compared to its intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
[0078] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The term “inactivation, deficiency, reduction, downregulation, deterioration, attenuation” of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had before the transformation.
[0079] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
[0080]
[0081] Specifically, the weakening of the polypeptide of the present disclosure is
[0082] 1) Deletion of all or part of a gene encoding a polypeptide;
[0083] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;
[0084] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;
[0085] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);
[0086] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0087] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;
[0088] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;
[0089] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE);
[0090] 9) Controlling the cellular localization of polypeptides; or
[0091] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.
[0092] for example,
[0093] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.
[0094] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0095] In addition, the above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0096] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of a gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.
[0097] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0098] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.
[0099] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0100] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.
[0101] Such attenuation of polypeptide activity may be, but is not limited to, attenuation of the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.
[0102]
[0103] As used herein, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.
[0104] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.
[0105] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0106] Specifically, the enhancement of the polypeptide of the present disclosure is
[0107] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;
[0108] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;
[0109] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;
[0110] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;
[0111] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);
[0112] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;
[0113] 7) Codon optimization of a polynucleotide encoding a polypeptide;
[0114] 8) Analyze the tertiary structure of the polypeptide to select the exposed portion and modify or chemically modify it;
[0115] 9) Controlling the cellular localization of polypeptides; or
[0116] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.
[0117] More specifically,
[0118] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.
[0119] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.
[0120] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.
[0121] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.
[0122] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted. The selection marker is as described above.
[0123] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.
[0124] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.
[0125] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.
[0126] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.
[0127] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.
[0128]
[0129] In the microorganism of the present disclosure, modification of part or all of a polynucleotide (e.g., modification to encode the protein variant described above) may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosomal integration into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.
[0130]
[0131] In the microorganism of the present disclosure, the mutant, polynucleotide, and glutamate series amino acid, etc. are as described in the other aspects above.
[0132]
[0133] Another aspect of the present disclosure provides a method for producing a glutamate series amino acid, comprising the step of culturing a Corynebacterium genus microorganism comprising a variant of the present disclosure or a polynucleotide of the present disclosure in a medium.
[0134] The method for producing a glutamate series amino acid of the present disclosure may include a step of culturing a microorganism of the genus Corynebacterium comprising a variant of the present disclosure, a polynucleotide of the present disclosure, or a vector of the present disclosure in a medium.
[0135] In addition, the glutamate series amino acid of the present disclosure may be at least one selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine.
[0136] In this disclosure, the term "cultivation" refers to growing a Corynebacterium microorganism of the present disclosure under appropriately controlled environmental conditions. The culturing process of the present disclosure can be performed using a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing may be batch, continuous, and / or fed-batch, but is not limited thereto.
[0137] In the present disclosure, the term "medium" refers to a material containing nutrients as a main component necessary for culturing a Corynebacterium microorganism of the present disclosure, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing a Corynebacterium microorganism of the present disclosure may be any medium used for culturing a typical microorganism without particular limitation, but the Corynebacterium microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a typical medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid, and / or vitamin.
[0138] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].
[0139] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.
[0140] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.
[0141] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.
[0142] In addition, during the cultivation of the Corynebacterium genus microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.
[0143] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.
[0144] The glutamate series amino acids produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.
[0145]
[0146] The method for producing a glutamate series amino acid of the present disclosure may additionally include a step of preparing a Corynebacterium genus microorganism of the present disclosure, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.
[0147] The method for producing glutamate-based amino acids of the present disclosure may further include a step of recovering glutamate-based amino acids from a culture medium (a culture medium in which culture is performed) or a Corynebacterium genus microorganism. The recovering step may be additionally included after the culturing step.
[0148] The above recovery may be performed by collecting the target glutamate series amino acid using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target glutamate series amino acid can be recovered from the medium or microorganism using a suitable method known in the art.
[0149] In addition, the method for producing glutamate-based amino acids of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing glutamate-based amino acids of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.
[0150] In the method of the present disclosure, the variants, polynucleotides, vectors, strains, etc. are as described in the other aspects above.
[0151]
[0152] Another aspect of the present disclosure provides a composition for producing a glutamate series amino acid, comprising a variant of the present disclosure, a polynucleotide encoding the variant, a vector comprising the polynucleotide, or a microorganism of the genus Corynebacterium comprising the polynucleotide of the present disclosure; a medium for culturing the same; or a combination of two or more thereof.
[0153] The composition of the present disclosure may further comprise any suitable excipient commonly used in compositions for producing amino acids, including, but not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers, or isotonic agents.
[0154] In the composition of the present disclosure, the variant, polynucleotide, vector, microorganism, medium, and glutamate series amino acids are as described in the other aspects above.
[0155]
[0156] Another aspect of the present disclosure provides a use of a variant of the present disclosure, a polynucleotide encoding the variant, a vector comprising the polynucleotide, or a microorganism of the genus Corynebacterium comprising the polynucleotide of the present disclosure for producing glutamate series amino acids.
[0157] The above mutants, polynucleotides, vectors, microorganisms, and glutamate-based amino acids are as described in the other aspects above.
[0158]
[0159] Another aspect of the present disclosure provides a use for the preparation of a composition for producing a glutamate series amino acid of a microorganism of the genus Corynebacterium, comprising a variant of the present disclosure, a polynucleotide encoding the variant, a vector comprising the polynucleotide, or a polynucleotide of the present disclosure.
[0160] The above mutants, polynucleotides, vectors, microorganisms, and glutamate-based amino acids are as described in the other aspects above.
[0161]
[0162] In another aspect of the present disclosure, the present disclosure provides a composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.
[0163]
[0164] When culturing a microorganism of the genus Corynebacterium containing a protein variant of the present disclosure, high yields of glutamate-series amino acids can be produced compared to microorganisms having conventional unmodified polypeptides.
[0165]
[0166] Hereinafter, the present disclosure will be described in more detail through examples. However, the following examples are merely preferred embodiments intended to illustrate the present disclosure and are therefore not intended to limit the scope of the present disclosure. Furthermore, technical details not described in this disclosure can be readily understood and implemented by those skilled in the technical field of the present disclosure or similar technical fields.
[0167]
[0168] Example 1: Construction of wild-type dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase and its mutant expression vectors.
[0169] In order to determine the effect of a mutant (I201F+D355E; SEQ ID NO: 1) in which isoleucine (Ile) at position 201 of the amino acid sequence of a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase (SEQ ID NO: 3) was substituted with phenylalanine (Phe) and aspartic acid (Asp) at position 355 was substituted with glutamic acid (Glu) on the production of glutamate-based amino acids, a vector capable of expressing the argJ gene encoding the wild-type and mutant (I201F+D355E) dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase was constructed as follows.
[0170] Using the genome of wild-type Corynebacterium glutamicum ATCC 13869 (NZ_CP016335.1) as a template, PCR was performed using the primer pair of SEQ ID NO: 5 and 10 to amplify gene fragment A (1167 bp). The PCR reaction was performed by denaturing at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. The PCR fragment was then obtained using a gel purification kit (QIAGEN). In order to amplify gene fragments B (609 bp), C (483 bp), and D (126 bp) for introducing mutation (I201F+D355E), PCR was performed using the primer pairs of SEQ ID NOs: 5 and 6, the primer pairs of SEQ ID NOs: 7 and 8, and the primer pairs of SEQ ID NOs: 9 and 10, respectively, as described above to obtain gene fragments B, C, and D. In addition, in order to secure an expression promoter in the vector, PCR was performed using the primer pairs of SEQ ID NOs: 11 and 12, using the gene upstream of NCgl0856 of wild-type Corynebacterium glutamicum ATCC 13869 as a template, as described above to obtain a 500 bp promoter region gene fragment.
[0171] The promoter region gene fragment and gene fragment A obtained above and the promoter region gene fragment and gene fragments B, C, and D were fusion cloned into the pCES208 vector (SEQ ID NO: 50) cut with the restriction enzymes BamHI and XbaI using an In-fusion Cloning Kit.
[0172] The plasmid prepared above was transformed into Escherichia coli DH5α and plated on LB solid medium containing kanamycin (25 mg / L). Plasmids were obtained from selected colonies using a commonly known plasmid extraction method, and the vector containing gene fragment A and the promoter was named “pCES208-PbetP-argJ”, and the vector containing gene fragments B, C, D and the promoter was named “pCES208-PbetP-argJ(I201F, D355E)”.
[0173] The sequences of the primers used in Example 1 are as shown in Table 1 below.
[0174] Name Sequence (5'->3') Sequence number Primer 1CAAATTCGAAACCGATAATGGCCAAAAAAGGCATSequence number 5 Primer 2CAGCGCAAaCTGAGCCATTTCCTGAGTAACGGATSequence number 6 Primer 3TGGCTCAGtTTGCGCTGGCTAATGCTACGGCCGTSequence number 7 Primer 4CAATTCGGACcTCAATGTCAGCGCCGGAAAGATCSequence number 8 Primer 5CATTGAgGTCCGAATTGATTTGGGCACCAGTGGGSequence number 9 Primer 6GTGGCGGCCGCTCTAGATTAAGAGCTGTACGCGGSequence number 10PbetP_FTGCAGCCCGGGGGATCCCAGCCGAAGTTTTAGGTSequence number 11PbetP_RTATCGGTTTCGAATTTGGGTCAGATGTAGTCATASequence number 12
[0175] Example 2. Evaluation of L-ornithine production ability of microorganisms expressing dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variants.
[0176] 2-1. Production of L-ornithine-producing microorganisms
[0177] To produce an L-ornithine-producing microorganism, a vector was constructed in which glutamic acid located at position 47 of the amino acid sequence of ArgR (ANU33619.1) was substituted with a stop codon.
[0178] Using the genome of wild-type Corynebacterium glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using the primer pairs of SEQ ID NOs: 13 and 14, and the homologous recombinant B arm was amplified using the primer pairs of SEQ ID NOs: 15 and 16. The PCR conditions were denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. The amplified homologous recombinant arm was cloned into the vector pDC24 (SEQ ID NO: 51) digested with BamHI and XbaI restriction enzymes to obtain a plasmid. This plasmid was named pDC24-argR(E47*).
[0179] To produce a microorganism with improved L-ornithine production ability, a vector was constructed in which serine at position 55 of the protein sequence of ArgF (ANU33618.1) was replaced with a stop codon. Using the genome of Corynebacterium glutamicum ATCC13869 as a template, the homologous recombinant C arm was amplified using the primer pairs of SEQ ID NOs: 17 and 18, and the homologous recombinant D arm was amplified using the primer pairs of SEQ ID NOs: 19 and 20. A plasmid was then obtained using the same method as above, and this plasmid was named pDC24-argF (S55*).
[0180] Using the constructed pDC24-argR(E47*) vector, wild-type Corynebacterium glutamicum ATCC13869 was transformed by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a second crossover process was performed to create a microorganism in which the 139th base sequence of argR was substituted from guanine (G) to thymine (T), and the 47th base sequence was substituted with a stop codon. PCR and base sequence analysis were performed using a pair of primers of SEQ ID NOs: 13 and 16 that can amplify the adjacent region including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism thus obtained was named C. gl::argR*.
[0181] A microorganism was constructed using the pDC24-argF(S55*) vector in C. gl::argR* in which the 164th base sequence of argF was substituted from cytosine (C) to adenine (A), resulting in a stop codon at base 55 of the protein sequence. PCR and base sequence analysis were performed using primer pairs of SEQ ID NOs: 17 and 20 that can amplify adjacent regions including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism thus obtained was named C. gl::argR*_argF*.
[0182] The primer sequences used in Example 2 are as shown in Table 2 below.
[0183] Name Sequence (5'->3') Sequence number Primer 7CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG Sequence number 13 Primer 8ATCCAGCAGCAATTCAGACA Sequence number 14 Primer 9CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA Sequence number 15 Primer 10ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG Sequence number 16 Primer 11CGGTACCCGGGGATCCTGACCCCAGGCAAGCACGG Sequence number 17 Primer 12GAAGCGAGTACGAGTTTAAGTCTTATC Sequence number 18 Primer 13AAACTCGTACTCGCTTCTCC Sequence number 19 Primer 14ATGCCTGCAGGTCGACCGGCGCCGGCAACCTCGTC Sequence number 20
[0184] 2-2. Confirmation of increased L-ornithine production by microorganisms expressing dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variants.
[0185] The vectors produced in Example 1 were transformed into the C. gl::argR*_argF* strain produced in Example 2-1 by electroporation to obtain a strain into which the vectors were introduced.
[0186] Specifically, the strain into which pCES208-PbetP-argJ was introduced was named “C. gl::argR*_argF*-argJ”, and the strain into which pCES208-PbetP-argJ(I201F, D355E) was introduced was named “C. gl::argR*_argF*-argJ(I201F, D355E)”.
[0187] To analyze L-ornithine production ability, the control strains C. gl::argR*_argF*-argJ strain and C. gl::argR*_argF*-argJ(I201F, D355E) strain were cultured using the following method and OD 562 , L-ornithine production and L-ornithine production yield were measured.
[0188] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium below and cultured at 33°C for 48 hours with shaking at 200 rpm. After the culture was completed, the culture was diluted 100-fold in 0.1 N HCl solution and OD was measured using a spectrophotometer. 562 The production amount and yield of L-ornithine were measured using HPLC. The yield was calculated as the ratio (%) of the production amount divided by the consumption amount, as shown in the following calculation formula 1.
[0189]
[0190] [Calculation Formula 1]
[0191] Yield (%) = (Product production (g / L) / Consumption sugar (g / L) X 100
[0192]
[0193] <Production medium (pH 7.2)>
[0194] 50 g of raw sugar, 40 g of (NH4)2SO4, 1 g of yeast extract, 1.1 g of KH2PO4, 1.2 g of MgSO4·7H2O, 0.2 g of L-arginine, 1 mg of biotin, 5 mg of thiamine hydrochloride, 5 mg of calcium-pantothenic acid, 15 mg of nicotinamide, 10 mg of MnSO4, 10 mg of FeSO4, 0.5 mg of ZnSO4, 0.5 mg of CuSO4, 30 g of CaCO3, 25 mg of kanamycin (based on 1 liter of distilled water)
[0195]
[0196] The above experiment was repeated three times, and the average value of the analysis results is shown in Table 3 below.
[0197] Strain name OD 562 Consumption (g / L) L-ornithine production (g / L) L-ornithine yield (%) C. gl::argR*_argF*-argJ 38.0 5 0.0 16.2 3 2.5 C. gl::argR*_argF*-argJ(I201F + D355E) 36.9 5 0.0 19.0 38.0
[0198] As a result, as shown in Table 3 above, it was confirmed that the L-ornithine production ability increased by an average of 17% in the C. gl::argR*_argF*-argJ(I201F + D355E) strain into which the mutant argJ (I201F + D355E) was introduced compared to the C. gl::argR*_argF*-argJ strain into which the wild-type argJ was introduced.
[0199] From the above results, it was confirmed that the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase mutant ArgJ (I201F + D355E) selected in the present disclosure increases the L-ornithine production ability of Corynebacterium glutamicum.
[0200]
[0201] Example 3. Evaluation of L-citrulline production ability of microorganisms expressing dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variants.
[0202] 3-1. Production of L-citrulline-producing microorganisms
[0203] To produce an L-citrulline-producing microorganism, a vector was constructed in which phenylalanine located at position 68 of the protein sequence of ArgG (ANU33620.1) was substituted with a stop codon.
[0204] Using the genome of wild-type Corynebacterium glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs: 21 and 22, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs: 23 and 24. Thereafter, a plasmid was obtained using the same method as in Example 2-1, and this plasmid was named pDC24-argG(F68*).
[0205] In order to create a microorganism with further improved citrulline production in C. gl::argR* created in Example 2-1, the pDC24-argG(F68*) vector was used to create a microorganism in which the 203rd base sequence of argG was substituted from thymine (T) to adenine (A), the 204th base sequence was substituted from cytosine (C) to adenine (T), and the 68th protein sequence was substituted with a stop codon. PCR and base sequence analysis were performed using a pair of primers of SEQ ID NOs: 21 and 24 that can amplify adjacent regions including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism thus obtained was named C. gl::argR*_argG*.
[0206] The primer sequences used in Example 3 are as shown in Table 4 below.
[0207] Name Sequence (5'->3') Sequence number Primer 15CGGTACCCGGGGATCCTTCATCGATAGGGTGGGSequence number 21 Primer 16GTACTCCTCAGCTTACTCATCCTTTGCATCAACASequence number 22 Primer 17AGTAAGCTGAGGAGTACTGCCTGCCAACCATCAASequence number 23 Primer 18ATGCCTGCAGGTCGACCGACTGGCTTGCCACCCTSequence number 24
[0208] Example 3-2: Confirmation of increased L-citrulline production by microorganisms expressing a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant.
[0209] The vectors produced in Example 1 were transformed into the C. gl::argR*_argG* strain produced in Example 3-1 by electroporation to obtain a strain into which the vectors were introduced.
[0210] Specifically, the strain into which pCES208-PbetP-argJ was introduced was named “C. gl::argR*_argG*-argJ”, and the strain into which pCES208-PbetP-argJ(I201F + D355E) was introduced was named “C. gl::argR*_argG*-argJ(I201F + D355E)”.
[0211] To analyze L-citrulline production ability, the control strains, Corynebacterium glutamicum C. gl::argR*_argG*-argJ strain and Corynebacterium glutamicum C. gl::argR*_argG*-argJ(I201F + D355E) strain were cultured using the following method and OD 562 , L-citrulline production and L-citrulline production yield were measured.
[0212] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium below, and cultured at 33°C for 48 hours with shaking at 200 rpm. After the culture was completed, the OD of the culture solution 562 The production volume and yield of L-citrulline were measured using HPLC.
[0213]
[0214] <Production medium (pH 7.2)>
[0215] 50 g of raw sugar, 40 g of (NH4)2SO4, 1 g of yeast extract, 1.1 g of KH2PO4, 1.2 g of MgSO4·7H2O, 0.2 g of L-arginine, 1 mg of biotin, 5 mg of thiamine hydrochloride, 5 mg of calcium-pantothenic acid, 15 mg of nicotinamide, 10 mg of MnSO4, 10 mg of FeSO4, 0.5 mg of ZnSO4, 0.5 mg of CuSO4, 30 g of CaCO3, 25 mg of kanamycin (based on 1 liter of distilled water)
[0216]
[0217] The above experiment was repeated three times, and the average value of the analysis results is shown in Table 5 below.
[0218] Strain name OD 562 Consumption (g / L) L-citrulline production (g / L) L-citrulline yield (%) C. gl::argR*_argG*-argJ 44.45 0.04.8 9.6 C. gl::argR*_argG*-argJ(I201F + D355E) 46.05 0.06.1 12.2
[0219] As a result, as shown in Table 5 above, it was confirmed that the L-citrulline production ability increased by an average of 27% in the C. gl::argR*_argG*-argJ(I201F + D355E) strain into which the mutant argJ (I201F + D355E) was introduced compared to the C. gl::argR*_argG*-argJ strain into which the wild-type argJ was introduced.
[0220] From the above results, it was confirmed that the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase mutant ArgJ (I201F + D355E) selected in the present disclosure increases the L-citrulline production ability of Corynebacterium glutamicum.
[0221]
[0222] Example 4. Evaluation of L-arginine, L-ornithine, and L-citrulline production capacity of L-arginine-producing microorganisms expressing dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variants.
[0223] Example 4-1. Production of L-arginine-producing microorganisms
[0224] A Corynebacterium glutamicum CJR2 strain in which the argR gene was deleted and an argB (M54V) gene mutation was introduced into the Corynebacterium glutamicum ATCC13869 strain, and a Corynebacterium glutamicum CJR100 strain in which the argR gene was deleted and an argB (M54V) gene mutation and an argC gene enhancement were introduced, and were prepared as follows.
[0225] First, to construct the Corynebacterium glutamicum CJR2 strain, a vector for introducing argR deletion and argB (M54V) mutation was constructed as follows. Using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template, PCR was performed using the primer pairs of SEQ ID NOs: 25 and 26, 27 and 28, and overlapping PCR was performed using the primer pairs of SEQ ID NOs: 25 and 28 to obtain a homologous recombination fragment having the argR deletion mutation sequence. In the same manner as above, PCR was performed using the primer pairs of SEQ ID NOs: 29 and 30, 31 and 32, and overlapping PCR was performed using the primer pairs of SEQ ID NOs: 29 and 32 to produce a homologous recombination fragment having the argB (M54V) mutation. The PCR reaction was performed at 95°C for 30 seconds, denaturing; Annealing at 55°C for 30 seconds and elongation at 72°C for 2 minutes were repeated 30 times. Then, each homologous recombination fragment was fusion cloned with the linearized pDC24 vector (SEQ ID NO: 51) using the same method as described in Example 2. The constructed vectors (recombinant plasmids) were named pDC24-ΔargR and pDC24-argB (M54V), respectively.
[0226] To introduce the argR deletion mutation into wild-type Corynebacterium glutamicum ATCC13869, the pDC24-ΔargR plasmid constructed above was used for transformation by electric pulse method. Then, PCR was performed on the transformant that completed the second recombination using the primer pair of SEQ ID NOs: 25 and 28 to confirm that the deletion mutation was introduced into the chromosomal argR gene. The PCR reaction was performed by repeating the following processes: denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and extension at 72°C for 2 minutes, 30 times. The transformant was designated CJR1.
[0227] The argB (M54V) mutation was introduced into the above-mentioned Corynebacterium glutamicum CJR1 using the same method as above. The above-mentioned constructed pDC24-argB (M54V) plasmid was used, and PCR was performed using a primer pair (SEQ ID NO: 29 and SEQ ID NO: 32) on the transformant strain in which the second recombination was completed, confirming that the M54V mutation was introduced into the argB gene on the chromosome, and the transformant strain was named Corynebacterium glutamicum CJR2 strain.
[0228] Using the above-mentioned Corynebacterium glutamicum CJR2 strain, the N-acetyl-gamma-glutamyl-phosphate reductase gene (hereinafter, argC) was further strengthened to produce the CJR100 strain with improved L-arginine productivity.
[0229] Specifically, in order to enhance the activity of the N-acetyl-gamma-glutamyl-phosphate reductase gene argC (NCBI registration number BBD29_RS07535), a plasmid was constructed by replacing the wild-type promoter of the argC gene with Po2 using the o2 promoter (Korean Patent No. 10-1632642, hereinafter Po2), which is known as a strong promoter. Specifically, in order to construct a strain into which argC with Po2 was introduced, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13869 as a template, using the primers of SEQ ID NO: 33 and SEQ ID NO: 34 to amplify a gene fragment in the upstream region of the argC gene, and using the primers of SEQ ID NO: 35 and SEQ ID NO: 36 to amplify a gene fragment in the downstream region of the argC gene. Additionally, an o2 promoter fragment was obtained using the primer pair of SEQ ID NO: 37 and SEQ ID NO: 38 using Po2 (SEQ ID NO: 39) as a template.
[0230] PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction, and the PCR conditions were denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and polymerization reaction at 72°C for 1 minute. The denaturation, annealing, and polymerization reactions under the above conditions were repeated 28 times. As a result, an 86-bp DNA fragment (SEQ ID NO: 39) of the o2 promoter region, a 610-bp DNA fragment upstream of Corynebacterium glutamicum ATCC13869argC, and a 1086-bp DNA fragment downstream were obtained, respectively. After DNA purification, the obtained PCR fragments were ligated to the pDC24 plasmid treated with SmaI restriction enzyme for fusion cloning using the In-Fusion® HD cloning kit (Clontech). The vector obtained as a result was named pDC24-Po2-argC.
[0231] Then, the Corynebacterium glutamicum CJR2 strain was transformed using the above-constructed pDC24-Po2_argC plasmid by the electric pulse method. Subsequently, a second recombination was performed on a solid plate medium containing 4% glucose, and PCR was performed on the transformant that completed the second recombination using the primer pair of SEQ ID NOs: 36 and 37 to confirm that the argC gene on the chromosome was strengthened by Po2. At this time, the PCR reaction was performed by repeating the process of denaturation at 95°C for 30 seconds; annealing at 55°C for 30 seconds; and elongation at 72°C for 2 minutes 30 times. The above transformant was named Corynebacterium glutamicum CJR100 strain.
[0232]
[0233] <Composite plate (pH 7.0)>
[0234] Glucose 10 g, peptone 10 g, beef extract 5 g, yeast extract 5 g, brain heart infusion 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (per 1 liter of distilled water)
[0235]
[0236] The sequences of the primers used in Example 4-1 above are shown in Table 6 below.
[0237] Name Sequence (5'-> 3') Sequence number argR-5'-FtgaattcgagctcggtaccccactggtgaactccttgtccSEQ ID NO. 25argR-5'-RttgaactaggggcgctttaaaagttttccggtgttgacggSEQ ID NO. 26argR-3'-FccgtcaacaccggaaaacttttaaagcgcccctagttcaaSEQ ID NO. 27argR-3'-RgtcgactctagaggatcccccgttgaactgcttgccagccSEQ ID NO. 28argB-5'-FtgaattcgagctcggtaccctgcggctcgcacggttgctcSEQ ID NO. 29argB-5'-RacggtgcgcaagaagaccacgtcggcagcaaaagcagcctSEQ ID NO. 30argB-3'-FggctgcttttgctgccgacgtggtcttcttgcgcaccgtgSEQ ID NO: 31argB-3'-RgtcgactctagaggatccccctcttatcaggccaatcggtSEQ ID NO: 32argC-5'-FGTGAATTCGAGCTCGGTACCCGCCCCGAAAAGCCGTTAAAAGSEQ ID NO: 33argC-5'-RtgccaaaattcacgattattgCTCGAGTCTAGAGACGGGTTASEQ ID NO: 34argC-3'-FttattggaggagatcaaaacaATGACAATCAAGGTTGCAATCSEQ ID NO: 35argC-3'-RCAGGTCGGCGTCGCACCTTAAGGGGATCCTCTAGAGTCGACCSEQ ID NO: 36Po2-FCAATAATCGTGAATTTTGGCAGCAACAGAATTATSEQ ID NO: 37Po2-RTGTTTTGATCTCCTCCAATAATCTATGCTTTTGCSEQ ID NO: 38
[0238] Example 4-2. Evaluation of L-arginine, L-ornithine, and L-citrulline production capacity of L-arginine-producing microorganisms expressing dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variants.
[0239] The L-arginine-producing strain Corynebacterium glutamicum CJR100 produced in Example 4-1 was transformed with the two vectors produced in Example 1 by electroporation to produce strains expressing the wild type and mutant argJ. The produced strains were named CJR100-argJ and CJR100-argJ(I201F + D355E).
[0240] To compare the L-arginine, L-citrulline, and L-ornithine production capacities of the above strains, they were cultured using the following method. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium described below, and cultured at 30°C for 44 hours with shaking at 200 rpm. The composition of the production medium used in this example is as follows.
[0241]
[0242] <Production medium (pH 7.2)>
[0243] Glucose 50 g, (NH4)2SO4 57 g, MgSO4·7H2O 2 g, beet molasses 5 g, calcium chloride 1 mg, cobalt chloride 1 mg, KH2PO4 2 g, biotin 0.01 mg, thiamine-HCl 0.1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, FeSO4 10 mg, MnSO4 10 mg, ZnSO4 0.02 mg, CuSO4 0.5 mg, CaCO3 30 g, kanamycin 25 mg (based on 1 liter of distilled water)
[0244]
[0245] After the culture was completed, the production capacity (concentration) of L-arginine, L-citrulline, and L-ornithine was analyzed three times using liquid high-performance chromatography (HPLC) (Waters 2478), and the analyzed L-arginine, L-citrulline, and L-ornithine concentrations are shown in Table 7 below.
[0246] Strain nameL-arginine concentration (g / L)L-citrulline concentration (g / L)L-ornithine concentration (g / L)3BT average improvement (%)3BT average3BT averageControl groupCJR100 / pCES2085.9-1.000.20CJR100 / pCES208-PbetP_argJ6.1-1.010.24CJR100 / pCES208-PbetP_argJ(I201F + D355E)6.33.31.090.26
[0247] As a result, as shown in Table 7 above, the parent strain, Corynebacterium glutamicum CJR100, produced approximately 5.9 g / L of L-arginine, the strain into which the wild-type argJ was introduced produced 6.1 g / L of L-arginine, and the strain into which the argJ (I201F + D355E) mutant was introduced produced 6.3 g / L of L-arginine, showing a 3.3% improvement in L-arginine production compared to the strain into which the wild-type argJ was introduced.
[0248] Additionally, L-citrulline and L-ornithine production was improved by 8.5% and 7.9%, respectively, in the strain introducing the argJ (I201F + D355E) mutant compared to the strain introducing the wild-type argJ.
[0249] From the above results, it was confirmed that the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase mutant ArgJ (I201F + D355E) selected in the present invention produces L-arginine more efficiently as well as L-citrulline and L-ornithine, thereby increasing the L-arginine production ability of a Corynebacterium genus microorganism.
[0250]
[0251] Example 5. Evaluation of putrescine production ability of microorganisms expressing dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variants.
[0252] 5-1. Production of putrescine-producing microorganisms
[0253] To construct a putrescine-producing microorganism, information on the gene encoding ornithine decarboxylase and the surrounding base sequence derived from Lactobacillus sp. 30A strain was obtained from the National Institutes of Health (NIH GenBank) (SEQ ID NO: 40).
[0254] Gene fragments for producing vectors were obtained through PCR using sequences obtained through gene synthesis based on the above-mentioned secured sequences as templates.
[0255] SolgTM Pfu-X DNA polymerase was used as the polymerase, and the PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, polymerization at 72°C for 2 minutes, repeated 30 times, and then polymerization was performed at 72°C for 5 minutes.
[0256] More specifically, primers of sequence numbers 42 and 43 were designed to amplify the LODC gene derived from Lactobacillus sp. 30A strain, and a 2196 bp gene fragment was obtained as a result of performing PCR using sequence number 41 as a template.
[0257] In order to secure the expression promoter in the vector, PCR was performed in the same manner as above using the wild-type Corynebacterium glutamicum ATCC13869 as a template and the primers of SEQ ID NO: 44 and SEQ ID NO: 45, and as a result, a 318 bp promoter region gene fragment was obtained.
[0258] To delete NCgl1469 (SEQ ID NO: 52), a gene encoding an enzyme that acetylates putrescine, the genome of wild-type Corynebacterium glutamicum ATCC13869 was used as a template to amplify the homologous recombinant A arm using the primer pairs of SEQ ID NOs: 46 and 47, and the homologous recombinant B arm using the primer pairs of SEQ ID NOs: 48 and 49. The PCR conditions were denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes.
[0259] The amplified promoter region, gene fragments derived from Lactobacillus sp. 30A strain, homologous recombinant arm, and vector pDC24 (SEQ ID NO: 50) digested with BamHI and XbaI restriction enzymes were ligated using the In-fusion Cloning Kit to obtain a deletion vector. This plasmid was named pDC24-ΔNCgl1469::Pcj7_LODC.
[0260] The sequences of the primers used in Example 5 are as shown in Table 8 below.
[0261] Name Sequence (5'->3') Sequence number LODC_FGAAAGGAAACACTCATGTCCTCTTCACTTAAAATTGC Sequence number 42 LODC_RCTTAAATCGCCTTCAGGGTTAATTATTATACCGGTCGTC Sequence number 43 Pcj7_FCGCTATTCTGGTATCCAGAAACATCCCAGCGC Sequence number 44 Pcj7_RTTTTAAGTGAAGAGGACATGAGTGTTTCCTTTCGTTGG Sequence number 45 Primer 19 agctcggtacccggggaTCCCAGGAATACAGCTGTTC Sequence number 46 Primer 20 CTGGGATGTTTCTGGATACCAGAATAGCGAAATG Sequence number 47 Primer 21 GACGACCGGTATAATAATTAACCCTGAAGGCGATTTAAG Sequence number 48 Primer 22gcctgcaggtcgactcTAGAAATGGCAGAGTTGGSEQ ID NO: 49
[0262] 5-2. Confirmation of increased putrescine production by microorganisms expressing dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variants.
[0263] The vectors produced in Example 1 were transformed into the C. gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC strain produced in Example 5-1 by electroporation to obtain a strain into which the vectors were introduced.
[0264] Specifically, the strain into which pCES208-PbetP-argJ was introduced was named “C. gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ”, and the strain into which pCES208-PbetP-argJ(I201F + D355E) was introduced was named “C. gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ(I201F, D355E)”.
[0265] To analyze the putrescine production ability, the control strains C. gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ strain and C. gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(I201F + D355E) strain were cultured using the following method and OD 562 , Putrescine production and putrescine yield were measured.
[0266] Specifically, each strain was inoculated into a 300 ml corner-baffle flask containing 25 ml of the production medium described below, and cultured at 33°C for 47 hours with shaking at 200 rpm. After completion of culture, the production amount of putrescine and the putrescine production yield were measured using HPLC.
[0267]
[0268] <Production medium (pH 7.2)>
[0269] Glucose 60 g, CM (cane molasses) stock solution 20 g, (NH4)2SO4 50 g, KH2PO4 0.72 g, MgSO4·7H2O 1.13 g, MgCl2 0.4 g, MnSO4 0.18 g, ZnSO4 0.9 mg, CuSO4 0.9 mg, FeSO4 0.18 g, biotin 0.9 mg, thiamine hydrochloride 9 mg, calcium pantothenic acid 9 mg, nicotinamide 60 mg, L-arginine 0.15 g, CSL (corn steep liquor) 8.12 g, CaCO3 50 g, kanamycin 25 mg (based on 1 liter of distilled water)
[0270]
[0271] The above experiment was repeated three times, and the average value of the analysis results is shown in Table 9.
[0272] Strain name OD 562Consumption (g / L) Putrescine production (g / L) Putrescine yield (%) C. gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ 44.9 47.8 3.67.5 C. gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ(I201F + D355E) 32.66 0 11.2 18.8
[0273] As a result, as shown in Table 9 above, in the C. gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(I201F, D355E) strain in which the mutant argJ (I201F + D355E) was introduced, compared to the C. gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ strain in which the wild-type argJ was introduced, it was confirmed that the putrescine productivity increased by an average of 2.1 times based on the production amount and by an average of 1.5 times based on the production yield.
[0274] From the above results, it was confirmed that the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase mutant ArgJ (I201F + D355E) selected in the present invention increases the putrescine production ability of a microorganism of the genus Corynebacterium.
[0275]
[0276] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.
Claims
1. A dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant in which the amino acid corresponding to the 201st amino acid from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is substituted with phenylalanine, and the amino acid corresponding to the 355th amino acid is substituted with glutamic acid.
2. A dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant in the first paragraph, wherein the amino acid corresponding to the 201st amino acid is isoleucine, and the amino acid corresponding to the 355th amino acid is aspartic acid.
3. A dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase variant according to claim 1, wherein the variant comprises an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO:
3.
4. A polynucleotide encoding a variant of any one of claims 1 to 3.
5. In the fourth paragraph, the polynucleotide comprises a nucleic acid sequence having a sequence identity of 90% or more with the nucleic acid sequence of SEQ ID NO:
4.
6. A recombinant vector comprising the polynucleotide of paragraph 4.
7. A microorganism of the genus Corynebacterium, comprising a variant of any one of claims 1 to 3, a polynucleotide encoding the variant, or a recombinant vector comprising the polynucleotide.
8. In the 7th paragraph, the microorganism is a Corynebacterium microorganism having increased glutamate series amino acid production ability compared to a Corynebacterium microorganism comprising a polypeptide of sequence number 1 or a polynucleotide encoding the same.
9. A microorganism of the genus Corynebacterium, wherein the glutamate series amino acid is at least one selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine.
10. A step of culturing a microorganism of the genus Corynebacterium containing a variant of any one of claims 1 to 3, a polynucleotide encoding the variant, or a recombinant vector containing the polynucleotide in a medium, and A method for producing a glutamate series amino acid, comprising a step of recovering a glutamate series amino acid from the cultured microorganism, medium, or both.
11. A method for producing a glutamate series amino acid in claim 10, wherein the glutamate series amino acid is at least one selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine.
12. Use of a microorganism of the genus Corynebacterium of Article 7 for producing glutamate series amino acids.
13. A composition, method, product, process, or use characterized by one or more elements disclosed herein.
Citation Information
Patent Citations
Novel promoter and uses thereof
KR101632642B1
Microorganism having increased activity of pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase and method for producing L-amino acid using the same
KR1020240152455A
Novel bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase variant and a method for producing glutamate family amino acids using the same
KR102919411B1
Promoter and uses thereof
US10273491B2
Promoter and use thereof
US10584338B2