Microorganisms of brevibacterium spp. or corynebacterium spp. having improved l-isoleucine productivity and method for producing l-isoleucine using same

Abstract

The present invention relates to microorganisms of the Brevibacterium spp. or Corynebacterium spp. having improved L-isoleucine productivity and a method for producing L-isoleucine using same, the activities of endogenous acetolactate synthase being reduced or deactivated while the activity of exogenous acetolactate synthase II is strengthened to allow the L-isoleucine production level, with reduced by-product production, to be greater than that with the mother strain.

Description

Brevibacterium or Corynebacterium genus microorganism with enhanced L-isoleucine production ability and method for producing L-isoleucine using the same

[0001] The present invention relates to a microorganism of the genus Brevibacterium or the genus Corynebacterium having improved L-isoleucine production ability and a method for producing L-isoleucine using the same.

[0002] L-isoleucine is an essential amino acid that is not synthesized in the human or animal body and must be supplied externally. It is generally produced through fermentation using microorganisms such as bacteria or yeast.

[0003] L-isoleucine shares a major biosynthetic pathway with the branched-chain amino acids L-valine and L-leucine. In particular, L-isoleucine and L-valine have very similar chemical properties, such as chemical structure, isoelectric point, and solubility. Therefore, producing a single amino acid as L-isoleucine with high purity requires many process steps and costs, making it difficult to recover it in high yield. To lower the production cost of L-isoleucine, it is important to discover or develop strains that produce high amounts of L-isoleucine while producing low amounts of L-valine.

[0004] L-isoleucine can be produced using either wild-type strains obtained from nature or mutant strains modified to enhance their L-isoleucine production ability. Microbial biosynthesis of L-isoleucine involves the sequential synthesis of L-threonine using pyruvic acid and oxaloacetic acid as precursors, followed by the sequential synthesis of L-isoleucine.

[0005] Recently, in order to improve the production efficiency of L-isoleucine, genetic recombination technology has been applied to microorganisms such as Escherichia, Corynebacterium, and Brevibacterium, which are widely used in the production of L-amino acids and other useful substances, to develop various recombinant strains or mutants with excellent L-isoleucine production ability, and methods for producing L-isoleucine using them. In particular, there have been attempts to increase the production of L-isoleucine by directly inducing mutations in genes such as enzymes, transcription factors, and transport proteins involved in the biosynthetic pathway of L-isoleucine, or by inducing mutations in the promoters that control their expression. However, since there are various types of proteins such as enzymes, transcription factors, and transport proteins directly or indirectly related to L-isoleucine production, much research is still needed to determine whether changes in the activity of these proteins increase L-isoleucine production.

[0006] [Prior Art Literature]

[0007] [Patent Document]

[0008] Korean Patent No. 10-1747542

[0009] The present invention aims to provide a microorganism of the genus Brevibacterium or the genus Corynebacterium having improved L-isoleucine production ability.

[0010] In addition, the present invention aims to provide a method for producing L-isoleucine using a microorganism of the genus Brevibacterium or the genus Corynebacterium.

[0011] One aspect of the present invention provides a microorganism of the genus Brevibacterium or the genus Corynebacterium in which the activity of acetolactate synthase is weakened or inactivated and the activity of acetohydroxy acid synthase II is enhanced, thereby improving L-isoleucine production ability.

[0012] The “acetolactate synthase (ALS)” used in the present invention is known to play the role of acetohydroxy acid synthase (AHAS) and is composed of a large subunit and a small subunit.

[0013] The above acetohydroxy acid synthase (AHAS) is the first enzyme commonly involved in the biosynthesis of branched-chain amino acids such as L-isoleucine, L-valine, and L-leucine, and uses pyruvate and alpha-ketobutyric acid as substrates. When acetohydroxy acid synthase has high substrate specificity for pyruvate, it participates in the polymerization of pyruvate to produce 2-acetolactate, a precursor of L-valine and L-leucine, whereas when it has high substrate specificity for alpha-ketobutyric acid, it participates in the polymerization of pyruvate and alpha-ketobutyric acid to produce 2-aceto-2-hydroxy-butyrate, a precursor of L-isoleucine.

[0014] The acetolactate synthase in the present invention may be a polypeptide having acetolactate activity encoded by the YH66_RS06800 and YH66_RS06805 genes, but is not limited thereto.

[0015] Meanwhile, in Escherichia coli, acetohydroxy acid synthase is known to exist as acetohydroxy acid synthase, including acetohydroxy acid synthase I (AHAS I), acetohydroxy acid synthase II (AHAS II), and acetohydroxy acid synthase III (AHAS III), and each acetohydroxy acid synthase is composed of a large subunit and a small subunit. The above acetohydroxy acid synthase I may be a polypeptide having each acetohydroxy acid synthase activity by the ilvB gene encoding the large subunit and the ilvN gene encoding the small subunit, the acetohydroxy acid synthase II may be a polypeptide having each acetohydroxy acid synthase activity by the ilvG gene encoding the large subunit and the ilvM gene encoding the small subunit, and the acetohydroxy acid synthase III may be a polypeptide having each acetohydroxy acid synthase activity by the ilvH gene encoding the large subunit and the ilvI gene, but is not limited thereto.

[0016] Nucleic acid sequence and protein sequence information for the above acetolactate synthase and acetohydroxy acid synthase can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0017] As used herein, “weakening of activity” means that the expression level of a gene encoding a protein such as a target enzyme, transcription factor, transport protein, etc. is reduced compared to the original microorganism, i.e., a wild-type strain or a strain before modification. This weakening of the activity of the target protein includes cases where the activity of the protein itself is reduced compared to the activity of the protein originally possessed by the microorganism due to a nucleotide modification within the endogenous gene encoding the target protein (e.g., substitution, insertion, deletion of some nucleotides within the target gene, or a combination thereof), cases where the overall protein activity level within the cell is lower than that of the wild-type strain or the strain before modification due to a modification to a noncoding region such as a promoter (e.g., modification of all or part of the nucleotides within the promoter sequence, replacement with a weak promoter), etc., due to inhibition of expression or translation of the target gene, and combinations thereof.

[0018] The above nucleotide modification means that all or part of the nucleotide sequence is different from the original nucleotide sequence due to substitution, insertion, deletion, or a combination thereof. The above promoter modification means that all or part of the nucleotides of the promoter sequence are different from the original promoter sequence due to substitution, insertion, deletion, or a combination thereof, and this results in a decrease in the expression level for the target gene or a weakened activity. In addition, the above promoter modification includes replacing the promoter of the original gene with a promoter that has a weaker expression level or activity for the target gene. Here, a substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid. An insertion means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. A deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.

[0019] According to one specific example of the present invention, the weakening of the activity of the acetolactate synthase may be due to a nucleotide modification, a promoter modification, or a combination thereof of the gene encoding the acetolactate synthase (YH66_RS06800 and / or YH66_RS06805).

[0020] “Inactivation” as used in the present invention means a case where the expression of a gene encoding a protein such as an enzyme, transcription factor, or transport protein is not expressed at all compared to the original microorganism, i.e., a wild type strain or a strain before modification, or where the expression is not active.

[0021] According to one specific example of the present invention, the acetolactate synthase is composed of a large subunit encoded by the YH66_RS06800 gene and a small subunit encoded by the YH66_RS06805 gene, and may be endogenous to the genus Brevibacterium or the genus Corynebacterium.

[0022] In the above acetolactate synthase, the large subunit may be encoded by the base sequence of SEQ ID NO: 1 or composed of the amino acid sequence of SEQ ID NO: 2, and the small subunit may be encoded by the base sequence of SEQ ID NO: 3 or composed of the amino acid sequence of SEQ ID NO: 4, but is not limited thereto.

[0023] Each base sequence or amino acid sequence of the acetolactate synthase according to the present invention may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the base sequence or amino acid sequence of SEQ ID NOs: 1 to 4, and may have an original function. Here, “homology” or “identity” means the rate of agreement (%) between a reference base sequence or amino acid sequence and any other base sequence or amino acid sequence when they are aligned and analyzed to correspond as much as possible.

[0024] As used herein, “enhanced activity” means that the expression level of a gene encoding a protein such as a target enzyme, transcription factor, transport protein, etc. is increased compared to the original microorganism, i.e., a wild-type strain or a strain before modification. Such enhanced activity of a target protein includes cases where the activity of the protein itself is increased compared to the activity of the protein originally possessed by the microorganism through modification of nucleotides in the endogenous gene encoding the target protein (e.g., substitution, insertion, deletion of some nucleotides in the target gene, or a combination thereof), cases where the copy number of the gene is increased, cases where the overall protein activity level in a cell is higher than that of a wild-type strain or a strain before modification due to increased expression or increased translation of the target gene due to modification of a noncoding region such as a promoter (e.g., modification of all or part of the nucleotides in the promoter sequence, replacement with a strong promoter), and combinations thereof.

[0025] The above nucleotide modification means that the nucleotide sequence is different from the original nucleotide sequence due to substitution, insertion, deletion, or a combination thereof in all or part of the nucleotide sequence. The above promoter modification means that the nucleotides in the promoter sequence are different from the original promoter sequence due to substitution, insertion, deletion, or a combination thereof in all or part of the nucleotides, thereby increasing the expression level or enhancing the activity of the target gene. In addition, the promoter modification includes replacing the promoter of the original gene with a promoter that has a stronger expression level or activity for the target gene. Here, a substitution means a change in which a base, nucleotide, polynucleotide, or nucleic acid is replaced with another base, nucleotide, polynucleotide, or nucleic acid. An insertion means a change in which another base, nucleotide, polynucleotide, or nucleic acid is added. A deletion means a change in which a base, nucleotide, polynucleotide, or nucleic acid is removed.

[0026] Additionally, enhancing the activity of a target protein involves introducing a foreign gene that the microorganism does not originally have, and in this case, the nucleotides of the foreign gene may be modified.

[0027] According to one specific example of the present invention, the activity enhancement of acetohydroxy acid synthase II may be achieved by nucleotide modification, copy number increase, promoter modification, introduction, or a combination thereof of a gene encoding acetohydroxy acid synthase II.

[0028] For example, the activity enhancement of the above acetohydroxy acid synthase II may be achieved by introducing a gene (ilvG and / or ilvM) encoding acetohydroxy acid synthase II of Escherichia coli.

[0029] In the above acetohydroxy acid synthase II, the large subunit may be encoded by the base sequence of SEQ ID NO: 5 or composed of the amino acid sequence of SEQ ID NO: 6, and the small subunit may be encoded by the base sequence of SEQ ID NO: 7 or composed of the amino acid sequence of SEQ ID NO: 8, but is not limited thereto.

[0030] The base sequence or amino acid sequence of the acetohydroxy acid synthase according to the present invention may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the base sequence or amino acid sequence of SEQ ID NOs: 5 to 8, and may have an original function.

[0031] As used herein, “improved productivity” means increased productivity of L-isoleucine compared to the target of mutation (parent strain). The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain that has no L-isoleucine production ability or has L-isoleucine production ability and is a wild type Brevibacterium or Corynebacterium genus or a Brevibacterium or Corynebacterium genus mutated from the wild type.

[0032] Some members of the genus Corynebacterium were previously classified as Brevibacterium according to the previous classification criteria, but are now integrated into the genus Corynebacterium, which includes microorganisms belonging to the genus Brevibacterium that are biologically or genetically similar to Corynebacterium (BMC Genomics2017, 18(Suppl 1):940;J Bacteriol. 2012 Feb;194(3):742-3).

[0033] According to one specific example of the present invention, the Brevibacterium genus or Corynebacterium genus microorganism is Corynebacterium glutamicum, Brevibacterium divaricatum (Corynebacterium glutamicum), Brevibacterium flavum (Corynebacterium glutamicum), Brevibacterium immariophilum, Brevibacterium lactofermentum (Corynebacterium glutamicum), Brevibacterium roseum, Brevibacterium saccharolyticum, Brevibacterium thiogenitalis, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium Corynebacterium humireducens, Corynebacterium marinum,Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris testudinoris), Corynebacterium pseudopelargi and Corynebacterium flavescens, but are not limited thereto.

[0034] For example, the microorganism of the genus Brevibacterium or the genus Corynebacterium may be Brevibacterium flavum or Corynebacterium glutamicum.

[0035] According to the present invention, the activity of the endogenous acetolactate synthase of the microorganism of the genus Brevibacterium or the genus Corynebacterium is weakened or inactivated, and at the same time, the activity of the exogenous acetohydroxy acid synthase II is introduced, so that the activity of the acetohydroxy acid synthase II is strengthened, thereby improving the L-isoleucine production ability.

[0036] Specifically, the microorganism of the genus Brevibacterium or the genus Corynebacterium with enhanced L-isoleucine production ability exhibits increased L-isoleucine production ability compared to the parent strain, and in particular, the L-isoleucine production is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or by 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, It may be increased by 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times, but is not limited thereto. For example, a microorganism of the genus Brevibacterium or the genus Corynebacterium in which the activity of the acetolactate synthase is weakened or inactivated and the activity of the acetohydroxy acid synthase II is enhanced may have an L-isoleucine production increased by 1.1 times or more, specifically 1.1 to 30 times (preferably 2 to 10 times) compared to the parent strain.

[0037] A composition comprising a microorganism of the genus Brevibacterium or the genus Corynebacterium according to the present invention can be used as a composition for producing L-isoleucine.

[0038]

[0039] According to one specific example of the present invention, a microorganism of the genus Brevibacterium or the genus Corynebacterium can be implemented through a gene inactivation method or a recombinant vector to delete an endogenous gene encoding acetolactate synthase from a parent strain or to introduce an exogenous gene encoding acetohydroxy acid synthase II.

[0040] The above gene inactivation method can be performed using a known method. For example, the CaCl₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973)), the Hanahan method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114(1973); and Hanahan, D., J. Mol. Biol., 166:557-580(1983)), and the electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16:6127-6145(1988)) are not limited thereto.

[0041] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene to a mutation target (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory elements operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and "regulatory elements" include a promoter for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0042] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0043] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0044] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0045] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0046] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0047] When transforming prokaryotic cells to produce recombinant microorganisms, host cells may be used, including, but not limited to, Escherichia coli such as E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas genus.

[0048] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0049] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0050] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0051] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0052] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Brevibacterium or the genus Corynebacterium through homologous recombination crossing over.

[0053] According to one specific example of the present invention, the host cell may be a microorganism of the genus Brevibacterium or the genus Corynebacterium.

[0054]

[0055] Another aspect of the present invention provides a method for producing L-isoleucine, comprising the steps of culturing a microorganism of the genus Brevibacterium or the genus Corynebacterium in a medium; and recovering L-isoleucine from the microorganism or the medium in which the microorganism is cultured.

[0056] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0057] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for strains of the genus Brevibacterium or the genus Corynebacterium can be referenced to a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0058] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0059] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0060] According to one specific example of the present invention, the step of recovering L-isoleucine from the cultured transformant or the medium in which the transformant is cultured may collect or recover the L-isoleucine produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but the present invention is not limited thereto.

[0061] According to one specific example of the present invention, the step of recovering the L-isoleucine may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0062] According to one specific example of the present invention, the step of recovering L-isoleucine may include a process of purifying L-isoleucine.

[0063] The microorganism of the genus Brevibacterium or the genus Corynebacterium according to the present invention has the activity of its endogenous acetolactate synthase weakened or inactivated and at the same time has the activity of its exogenous acetohydroxy acid synthase II, so that it can produce less by-products and improve the production yield of L-isoleucine compared to the parent strain.

[0064] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0065]

[0066] Example 1. Production of a mutant strain with weakened ALS activity in Brevibacterium flavum.

[0067] To generate a strain with weakened activity of acetolactate synthase (ALS), which is known to function as acetohydroxy acid synthase (AHAS) in Brevibacterium flavum, the YH66_RS06800 and YH66_RS06805 genes (SEQ ID NOs: 1 and 3) encoding the endogenous ALS were deleted using a one-step inactivation method (Warner et al., PNAS, 6:6640-6645 (2000).

[0068]

[0069] 1-1. Vector production

[0070] Chromosomal DNA of Brevibacterium flavum ATCC15168 was isolated, and PCR was performed using the primer pairs of primers 1 and 2, 3 and 4, 5 and 6, and 7 and 8 as a template, and fragments were obtained and purified. In addition, fragments were obtained by performing PCR using the primer pairs of primers 9 and 10 and 11 and 12 as a template, using pK19mobSacB (Gene, 145: 69-73, 1994). Takara PrimeSTAR Max DNA polymerase was used, and the PCR amplification conditions were 30 cycles of denaturation at 95°C for 10 seconds, annealing at 57°C for 15 seconds, and polymerization at 72°C for 10 seconds. And the recombinant plasmid was obtained by cloning the corresponding gene fragments using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)), and it was named pKBN.

[0071]

[0072] 1-2. Production of mutant strains

[0073] The constructed vector pKBN was introduced into Brevibacterium flavum ATCC15168, which was prepared using an electrocompetent cell production method based on the method of van der Rest et al., by electroporation at 2.5 kV. The resulting colonies were then subjected to secondary recombination, diluted, and plated on a plate containing 10% sucrose to select strains that were not resistant to kanamycin and grew on the 10% sucrose medium. The selected strain was confirmed to have deletions of the YH66_RS06800 and YH66_RS06805 genes by PCR using the primer pair 18 and 19. The deletion strain was designated IBN.

[0074]

[0075] Example 2. Production of a mutant strain in which ALS activity is weakened and foreign AHAS II is introduced in Brevibacterium flavum.

[0076] After disrupting the YH66_RS06800 and YH66_RS06805 genes encoding ALS in Brevibacterium flavum, ilvGM (SEQ ID NOs: 5 and 7) encoding AHAS II from Escherichia coli was introduced.

[0077]

[0078] 2-1. Vector production

[0079] The chromosomal DNA of Brevibacterium flavum ATCC15168 was isolated, and PCR was performed using the primer pairs of primers 1 and 2, 3 and 4, 5 and 6, and 17 and 8 as a template, and fragments were obtained and purified. In addition, fragments were obtained by performing PCR using the primer pairs of primers 9 and 10 and 11 and 12 as a template, using pK19mobSacB (Gene, 145: 69-73, 1994). The ilvGM gene fragment derived from Escherichia coli was obtained by performing PCR using the chromosomal DNA of Escherichia coli DS44 (accession number KCTC11602BP) as a template, and primer pairs of primers 13 and 14 and 15 and 16. Takara PrimeSTAR Max DNA polymerase was used as the polymerase, and PCR amplification conditions were 30 cycles of denaturation at 95°C for 10 seconds, annealing at 57°C for 15 seconds, and polymerization at 72°C for 10 seconds. The corresponding gene fragments were cloned using the self-assembly cloning method (BioTechniques 51:55-56 (July 2011)) to obtain a recombinant plasmid, which was named pKGM.

[0080]

[0081] 2-2. Production of mutant strains

[0082] The constructed vector pKBN was introduced into Brevibacterium flavum ATCC15168, which was prepared using an electrocompetent cell production method based on the method of van der Rest et al., by electroporation at 2.5 kV. The resulting colonies were then subjected to secondary recombination, diluted, and plated on a plate containing 10% sucrose to select for strains that were not resistant to kanamycin and grew on a 10% sucrose medium. The selected strain was confirmed to have deleted the YH66_RS06800 and YH66_RS06805 genes and introduced Escherichia coli-derived ilvGM through PCR using the primer pair 18 and 19. The deleted strain was named IGM.

[0083]

[0084] The primers used in Examples 1 and 2 are shown in Table 1 below.

[0085] Sequence number Primer name Primer sequence (5'-3') 9 Primer 1 CCACAGTGTTGGAACGAGGG 10 Primer 2 GACTTTCTGGCTCCTTTACT 11 Primer 3 gaggatccccCCACAGTGTTGGAACGAGGG 12 Primer 4 CTCCTTTACTAAATAAGGAT 13 Primer 5 ACAGCAATTAATCTGATTGC 14 Primer 6 ATAAAGCAGTTCAATAGCCA 15 Primer 7 CCAGAAAGTCACAGCAATTAATCTGATTGC 16 Primer 8 TCAATAGCCATGGGAGAAAA 17 Primer 9 gggtaccgagctcgaattcactg 18 Primer 10 ggggatcctctag agtcgacct19primer11ACTGCTTTATgggtaccgagctcgaattca20primer12tagagtcgacctgcaggcatgc21primer13ATGAATGGCGCACAGTGGGT22primer14TCAGGCGCGGATTTGTTGTG23primer15CCAGAAAGTCATGAATGGCGCACAGTGGGT24primer16ATTTGTTGTGATGTGGTTGT25primer17CCGCGCCTGAACAGCAATTAATCTGATTGC26primer18TGCGTTGTGGAATTGGAAAC27primer19CCTTCTCTGCGGACTTGGAG

[0086]

[0087] Experimental Example 1. Evaluation of L-isoleucine production capacity

[0088] The L-isoleucine production ability of the Brevibacterium flavum mutant strains produced in Examples 1 and 2 was evaluated compared to the parent strain.

[0089] Each strain (parent strain or mutant) was inoculated at 1% of the volume in a 100 mL flask containing 10 mL of the medium for isoleucine production in Table 2 below and cultured under conditions of 34°C and a stirring speed of 200 rpm. After completion of the culture, the concentrations of L-leucine and L-valine, which are produced as byproducts along with L-isoleucine in the medium, were measured using HPLC (Agilent), and the results are shown in Table 3 below.

[0090] ContentGlucose50 g / LKH2PO41 g / LK2HPO41 g / LUrea2 g / L(NH4)2SO420 g / LBiotin100 ㎍ / LThi-HCl100 ㎍ / LFeSO410 ㎎ / LMnSO410 ㎎ / LZnSO415 ㎍ / LCuSO4400 ㎍ / LMgSO41 g / LCaCO30.5g / 10㎖Leucine50 mg / LValine50 mg / LIsoleucine50 mg / LpH7.2

[0091] Strain culture time (hr) L-isoleucine (%) L-leucine (%) L-valine (%) ATCC15168 (parent strain) 300.2290.0410.088 IBN300.0000.0000.000 IGM300.5170.0110.020

[0092] As shown in Table 3 above, when the activity of acetolactate synthase in Brevibacterium flavum was weakened (IBN), L-isoleucine was not produced at all, but when the expression of AHAS Ⅱ derived from Escherichia coli was induced (IGM), L-isoleucine production was restored, and compared to the parent strain, L-isoleucine production was further enhanced, while L-leucine and L-valine production decreased. Specifically, compared to ATCC15168, L-isoleucine production of IGM increased by approximately 2.5 times, while L-leucine and L-valine production decreased by approximately 73% and 77%, respectively.

[0093]

[0094] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0095] [Accession number]

[0096] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)

[0097] Accession number: KCTC11602BP

[0098] Date of acceptance: 20091120

[0099]

Claims

1. A microorganism of the genus Brevibacterium or Corynebacterium in which the activity of acetolactate synthase is weakened or inactivated and the activity of acetohydroxy acid synthase II is enhanced, thereby improving L-isoleucine production ability.

2. In claim 1, A microorganism of the genus Brevibacterium or the genus Corynebacterium, wherein the activity of the above acetolactate synthase is weakened by a nucleotide modification, a promoter modification, or a combination thereof of a gene encoding acetolactate synthase.

3. In claim 1, A microorganism of the genus Brevibacterium or the genus Corynebacterium, wherein the activity of the above acetohydroxy acid synthase II is enhanced by nucleotide modification, copy number increase, promoter modification, introduction, or a combination thereof.

4. In claim 3, The above-mentioned enhancement of the activity of acetohydroxy acid synthase II is a microorganism of the genus Brevibacterium or the genus Corynebacterium into which a gene encoding acetohydroxy acid synthase II of Escherichia coli has been introduced.

5. A step of culturing a microorganism of the genus Brevibacterium or the genus Corynebacterium of claim 1 in a medium; and A method for producing L-isoleucine, comprising a step of recovering L-isoleucine from the microorganism or a medium in which the microorganism is cultured.

Images