Glutamate-based amino acid-producing microorganism, and method for producing glutamate-based amino acids using same

By introducing a dual-functional glutamate N-acetyltransferase from Thermotoga maritima into Corynebacterium strains, the production of glutamate series amino acids is enhanced, addressing inefficiencies in existing production methods.

WO2025225913A1PCT designated stage Publication Date: 2025-10-30CJ CHEILJEDANG CORP
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/004332
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-25
Filing Date
2025-04-02
Publication Date
2025-10-30

AI Technical Summary

Technical Problem

Existing methods for producing glutamate-based amino acids, such as those using Corynebacterium strains, are inefficient and require improvements to enhance production capabilities.

Method used

Introduction of a dual-functional glutamate N-acetyltransferase/amino acid acetyltransferase derived from Thermotoga maritima into Corynebacterium strains to increase glutamate series amino acid production, specifically through genetic modifications and vector introduction.

Benefits of technology

Significantly enhances the production ability of glutamate series amino acids like L-ornithine, L-citrulline, and L-arginine in modified Corynebacterium strains.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure relates to a Corynebacterium sp. microorganism for producing glutamate-based amid acids, and a method for producing glutamate-based amino acids using the microorganism.
Need to check novelty before this filing date? Find Prior Art

Description

Microorganism producing glutamate-series amino acids and method for producing glutamate-series amino acids using the same

[0001] Cross-citation with related application(s)

[0002] This disclosure claims the benefit of priority to Korean Patent Application No. 10-2024-0055638, filed April 25, 2024, the entire contents of which are incorporated herein by reference.

[0003] The present disclosure relates to a microorganism of the genus Corynebacterium for producing glutamate-series amino acids and a method for producing glutamate-series amino acids using the same.

[0004]

[0005] Glutamate is one of the protein amino acids widely found in plants, animals, and microorganisms, and is metabolized in the body's organs into ornithine, citrulline, arginine, and putrescine.

[0006] Microorganisms of the genus Corynebacterium, particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used for amino acid production. For amino acid production, target-substance-specific approaches are primarily used, such as increasing the expression of genes encoding enzymes primarily involved in amino acid biosynthesis in Corynebacterium strains or deleting genes unnecessary for amino acid biosynthesis (US 9644009 B2).

[0007] As the demand for glutamate-based amino acids increases, the need for research on methods for efficiently producing glutamate-based amino acids is emerging.

[0008] An example of the present disclosure provides a microorganism expressing a bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase ArgJ from Thermotoga maritima.

[0009] Another example of the present disclosure provides a composition for producing glutamate series amino acids, comprising a microorganism expressing a dual functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from the thermotomaritima.

[0010] Another example of the present disclosure comprises the steps of culturing a microorganism expressing a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from the thermoto maritima, and

[0011] A method for producing a glutamate series amino acid is provided, comprising a step of recovering a glutamate series amino acid from the cultured microorganism, medium, or both.

[0012] Another example of the present disclosure provides the use of a microorganism expressing a dual functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from the thermotomaritima for the production of glutamate series amino acids.

[0013] In this disclosure, we searched for foreign proteins for the purpose of increasing the glutamate series amino acid production ability of microorganisms of the genus Corynebacterium, and improved the strain by introducing them into microorganisms of the genus Corynebacterium.

[0014] Accordingly, the present disclosure searches for a novel enzyme having exogenous glutamate N-acetyltransferase activity that increases the glutamate series amino acid production ability of a microorganism of the genus Corynebacterium, and introduces the enzyme into a glutamate series amino acid production strain, thereby providing a recombinant strain with improved glutamate series amino acid production ability.

[0015] In the present disclosure, a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima and a gene encoding the same were selected as a representative example of an enzyme having an exogenous glutamate N-acetyltransferase activity, and when the same was expressed in a microorganism producing glutamate-series amino acids, it was confirmed that the production ability of glutamate-series amino acids was significantly improved compared to a microorganism in which the gene was not expressed and / or a microorganism into which an enzyme having the same activity as the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga neopolitana and / or Corynebacterium glutamicum was additionally introduced (or strengthened).

[0016]

[0017] An example of the present disclosure provides a microorganism expressing a bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase ArgJ from Thermotoga maritima.

[0018] In one example, the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase from Thermotoga maritima may be, for example, a protein comprising an amino acid sequence of SEQ ID NO: 1, or a protein having a sequence identity or homology of at least 87.5%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% with the amino acid sequence of SEQ ID NO: 1.

[0019] The above microorganism may be one that contains or expresses the thermotoga maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase. The microorganism expressing the thermotoga maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase may be a recombinant microorganism into which a polynucleotide encoding the thermotoga maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase described above has been introduced. In one example, the polynucleotide encoding the dual functional glutamate N-acetyltransferase / amino acid acetyltransferase of SEQ ID NO: 1 can be represented by a sequence having at least 87.5%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity or homology with the nucleic acid sequence of SEQ ID NO: 2.

[0020] The term "homology" herein refers to the degree of matching with a given amino acid sequence or base sequence and can be expressed as a percentage. In the present disclosure, a homologous sequence having the same or similar activity as a given amino acid sequence or base sequence is expressed as "% homology." For example, this can be confirmed by using standard software that calculates parameters such as score, identity, and similarity, specifically BLAST 2.0, or by comparing sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the relevant technology and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).

[0021] In the present disclosure, the term “bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase ArgJ” means an enzyme having both glutamate N-acetyltransferase activity that converts glutamate and acetyl-CoA into N-acetyl glutamate and amino acid acetyltransferase activity that converts acetyl-L-ornithine and L-glutamate into L-ornithine and N-acetyl-L-glutamate. The bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase of the present disclosure may be used interchangeably with arginine biosynthesis bifunctional protein ArgJ, ArgJ protein. The above “glutamate N-acetyltransferase” may be used interchangeably with the terms N2-acetyl-L-ornithine: L-glutamate N-acetyltransferase, ornithine acetyltransferase, ornithine transacetylase, and acetylornithine glutamate acetyltransferase, and the above “amino acid acetyltransferase” may be used interchangeably with the terms acetyl-CoA:L-glutamate N-acetyltransferase, N-acetylglutamate It can be used in combination with a synthetase (N-acetylglutamate synthetase). In the present disclosure, the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase sequence can be obtained from the NCBI's GenBank, a known database (e.g., AKE31408.1).Specifically, it may be, but is not limited to, a polypeptide having dual functional glutamate N-acetyltransferase / amino acid acetyltransferase activity encoded by the argJ gene.

[0022] The above thermoto-microorganism expressing the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Maritima may be a glutamate series amino acid producing microorganism having the ability to produce glutamate series amino acids.

[0023] In the present disclosure, the term “glutamate series amino acid producing microorganism” may be used to mean a case where a microorganism having glutamate series amino acid producing ability is mutated to express a bifunctional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima as described above, thereby causing the microorganism to have increased glutamate series amino acid producing ability, and / or a case where a microorganism not having glutamate series amino acid producing ability is mutated to express a bifunctional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima, thereby causing the microorganism to have glutamate series amino acid producing ability. In the present disclosure, “microorganism” encompasses unicellular bacteria and may be used interchangeably with “cell”. In the present disclosure, the microorganism before being mutated to express the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Maritima may be expressed as a “parent microorganism (parent strain) or host cell” to distinguish it from the mutated microorganism.

[0024] In the present disclosure, the term "glutamate series amino acid" refers to an amino acid that can be biosynthesized using glutamate as a precursor. Specifically, the glutamate series amino acid may be any one selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine, but is not limited thereto as long as it is an amino acid that can be biosynthesized using glutamate as a precursor. The "glutamate series amino acid" of the present disclosure may be used interchangeably with "glutamic acid series amino acid."

[0025] In one example, the microorganism may be selected from all microorganisms capable of producing glutamate-based amino acids. In one example, the microorganism, e.g., the parent strain before mutation, may be (1) a microorganism naturally capable of producing glutamate-based amino acids, or (2) a microorganism in which a mutation is introduced into a microorganism naturally capable of producing glutamate-based amino acids or a strain having no or significantly low glutamate-based amino acid production ability, thereby producing glutamate-based amino acids or having enhanced glutamate-based amino acid production ability.

[0026] In one specific example, the microorganism may be at least one selected from the group consisting of (1) a microorganism naturally having the ability to produce glutamate-based amino acids, or (2) all microorganisms of the genus Corynebacterium that have the ability to produce glutamate-based amino acids or have improved ability to produce glutamate-based amino acids by introducing a mutation into a parent strain that naturally has the ability to produce glutamate-based amino acids or has no or significantly low ability to produce glutamate-based amino acids.

[0027] The above Corynebacterium genus microorganism may include, but is not necessarily limited to, Corynebacterium glutamicum, Corynebacterium stationis, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, etc. More specifically, the Corynebacterium genus microorganism may be Corynebacterium glutamicum.

[0028] In one example, the microorganism expressing the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima may have an increased glutamate series amino acid production ability compared to a non-modified microorganism of the same species and / or a microorganism of a different genus or species that expresses an enzyme having glutamate N-acetyltransferase activity by introducing a mutation that allows the microorganism to express the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima.

[0029] The above-mentioned unmodified microorganism is a microorganism that does not express the Maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase, and may mean a microorganism of the same species in which a mutation that causes the Maritima-derived dual-functional glutamate N-acetyltransferase to be expressed has not been introduced, or a microorganism before the mutation is introduced.

[0030] The enzyme having glutamate N-acetyltransferase activity derived from a genus other than Thermotoga maritima or a species other than Thermotoga maritima may be a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from a microorganism of the genus Thermotoga and / or a microorganism of the genus Corynebacterium, and specifically may be, but is not limited to, a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga neapolitana (represented by the amino acid sequence of SEQ ID NO: 4) or a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Corynebacterium glutamicum (represented by the amino acid sequence of SEQ ID NO: 7).

[0031] In the present disclosure, "a mutation that allows thermoto express a Maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase" may mean any manipulation that allows thermoto express a Maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase in a parent strain as described above. In one example, the mutation that allows thermoto express a Maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase may be a process of introducing a polynucleotide encoding a Maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase, or a recombinant vector comprising the same, into the parent strain.

[0032] The above "microorganism into which a mutation has been introduced to allow Thermotoga maritima to express a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase" or "microorganism into which Thermotoga maritima has been modified to express a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase" may be a microorganism into which a polynucleotide encoding the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase from Thermotoga maritima has been introduced, or a recombinant vector including the same has been introduced, and may have the ability to produce glutamate-series amino acids conferred or increased compared to a non-modified microorganism and / or a microorganism expressing an enzyme having glutamate N-acetyltransferase activity derived from a microorganism of a different genus or a different species.

[0033] In one example, the parent strain may be a wild type or a mutant strain that has been mutated to increase glutamate series amino acid production, for example, a strain in which the activity of a protein involved in the biosynthesis or metabolism of glutamate series amino acids is regulated (increased (promoted) or decreased (inhibited)) compared to the wild type, but is not limited thereto. For example, the parent strain may be a wild-type Corynebacterium glutamicum strain, a Corynebacterium glutamicum ATCC13869 strain with weakened activity of arginine repressor (ArgR) and / or ornithine carbamoyltransfrase (ArgF), a Corynebacterium glutamicum ATCC13869 strain with weakened activity of arginine repressor (ArgR) and / or argininosuccinate synthase (ArgG), or a strain with weakened activity of argininosuccinate synthase (ArgG) and / or ornithine carbamoyltransfrase (ArgF), and ornithine It may be, but is not limited to, a Corynebacterium glutamicum strain into which ornithine decarboxylase (ODC) activity has been introduced.

[0034] As another example of the present disclosure, the Corynebacterium genus microorganism having increased glutamate series amino acid production ability of the present disclosure may be a microorganism having enhanced glutamate series amino acid production ability by further enhancing the activity of a portion of a protein in the L-amino acid biosynthesis pathway or by further weakening the activity of a portion of a protein in the L-amino acid degradation pathway.

[0035] Specifically, the Corynebacterium microorganism of the present disclosure may be a strain in which the activity of ornithine carbamoyltransferase subunit F (ArgF) and / or arginine repressor (ArgR) is further weakened, or the argF gene and / or argR gene encoding them is further deleted. In addition, the strain of the present disclosure may be a strain in which the activity of arginine repressor (ArgR) and / or argininosuccinate synthase (ArgG) is further weakened, or the argR gene and / or argG gene encoding them is further deleted, and / or the activity of ornithine decarboxylase (ODC) is introduced.

[0036] The amino acid sequences of the above ArgF, ArgR, ArgG, and ODC can be obtained from a known database such as NCBI's Genebank. For example, the amino acid sequence of ArgF of the present disclosure may include ANU33618.1 derived from Corynebacterium glutamicum ATCC13869 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence of ArgR may include ANU33619.1 derived from Corynebacterium glutamicum ATCC13869 or an amino acid sequence having 90% or more homology thereto, the amino acid sequence of ArgG may include ANU33620.1 derived from Corynebacterium glutamicum ATCC13869 or an amino acid sequence having 90% or more homology thereto, and the amino acid sequence of ODC may include Lactobacillus sp. It may include, but is not limited to, an amino acid sequence having 90% or more homology thereto derived from 30A strain AAA64830.1, and it is self-evident that it includes proteins having ArgF, ArgR, ArgG or ODC activity of various origins.

[0037] The term “introduction of activity” in the present invention may mean that the activity of a protein that did not exist or was minimal in a microorganism is newly introduced or increased in the microorganism, and specifically includes inserting or transferring a gene encoding a protein that did not exist in the microorganism into the microorganism so that it can be expressed, or inducing a mutation that enhances the expression of a protein that was not expressed or was barely expressed in the microorganism, but is not limited to the above examples.

[0038] Meanwhile, in the present invention, mutations such as introduction of activity, strengthening of activity, or weakening of activity can occur through a process called transformation, and the term "transformation" in the present invention means introducing a vector containing a polynucleotide encoding a specific protein or a promoter sequence with strong or weak activity into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell or inducing a mutation in the chromosome of the host cell. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can induce expression or mutation when introduced into the host cell. For example, the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0039] Additionally, the term "operably linked" as used herein means that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a specific protein of the present invention.

[0040] The term "vector" as used herein refers to a DNA construct containing a base sequence of a polynucleotide encoding a target protein operably linked to suitable regulatory sequences so as to enable expression of the target protein in a suitable host. The regulatory sequences include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.

[0041] The vector used in the present invention is not particularly limited as long as it is replicable in a host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. The vector usable in the present invention is not particularly limited, and any known expression vector can be used. Specifically, pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, pDC24 vectors, etc. can be used.

[0042]

[0043] As used herein, the term "attenuation" of the activity of a polypeptide encompasses a reduction in activity or absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0044] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The above “intrinsic activity” refers to the activity of a specific polypeptide originally possessed by the parent strain, wild type, or unmodified microorganism before the change in trait when the trait is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with “activity before modification.” The term “inactivation, deficiency, reduction, downregulation, deterioration, attenuation” of the activity of a polypeptide relative to its intrinsic activity means that the activity of a particular polypeptide is lowered compared to the activity that the parent strain or unmodified microorganism originally had before the transformation.

[0045] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0046]

[0047] Specifically, the weakening of the polypeptide of the present disclosure is

[0048] 1) Deletion of all or part of the gene encoding the polypeptide;

[0049] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;

[0050] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;

[0051] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);

[0052] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0053] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;

[0054] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;

[0055] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE); or

[0056] 9) Controlling the cellular localization of polypeptides; or

[0057] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0058] for example,

[0059] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.

[0060] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0061] In addition, the above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0062] In addition, the modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of a gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0063] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0064] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.

[0065] 8) Addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0066] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.

[0067] Such attenuation of polypeptide activity may be, but is not limited to, attenuation of the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0068]

[0069] As used herein, the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity. The term “enhancement” may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or activity before modification. The term “intrinsic activity” refers to the activity of a specific polypeptide that a parent strain or unmodified microorganism originally possessed before the trait change, when the trait change is caused by genetic mutation due to natural or artificial factors. This may be used interchangeably with “activity before modification.” “Enhanced,” “upregulated,” “overexpressed,” or “increased” the activity of a polypeptide relative to its intrinsic activity means that the activity and / or concentration (expression amount) of the specific polypeptide is improved compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had prior to the transformation.

[0070] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0071] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0072] Specifically, the enhancement of the polypeptide of the present disclosure is

[0073] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0074] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

[0075] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0076] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0077] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0078] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0079] 7) Codon optimization of a polynucleotide encoding a polypeptide;

[0080] 8) Analyzing the tertiary structure of the polypeptide and selecting the exposed portion to modify or chemically modify; or

[0081] 9) Controlling the cellular localization of polypeptides; or

[0082] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0083] More specifically,

[0084] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0085] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0086] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0087] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0088] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not the chromosome has been inserted. The selection marker is as described above.

[0089] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0090] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0091] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0092] The above 9) regulation of the intracellular location of the polypeptide may target the polypeptide to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the polypeptide, but is not limited thereto.

[0093] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0094] In the microorganism of the present disclosure, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosomal integration into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0095]

[0096] Another example of the present disclosure provides a method for increasing glutamate series amino acid production ability of a microorganism of the genus Corynebacterium or a method for imparting glutamate series amino acid production ability to a microorganism, the method comprising a step of introducing (transforming) the above-described Thermotoga maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase, a polynucleotide encoding the same, or a recombinant vector including the polynucleotide into the microorganism.

[0097] The above thermotoga Maritima-derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase, polynucleotide, glutamate-based amino acids and Corynebacterium microorganisms are as described above.

[0098]

[0099] Another example of the present disclosure provides a method for producing a glutamate series amino acid, comprising the step of culturing a Corynebacterium spp. microorganism expressing a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from the above-mentioned thermoto maritima in a medium.

[0100] In this disclosure, the term "cultivation" refers to growing a Corynebacterium microorganism of the present disclosure under appropriately controlled environmental conditions. The culturing process of the present disclosure can be performed using a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0101] In the present disclosure, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the Corynebacterium microorganism of the present disclosure, and supplies nutrients and growth factors, including water essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the Corynebacterium microorganism of the present disclosure may be any medium used for culturing general microorganisms without particular limitation, but the Corynebacterium microorganism of the present disclosure may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.

[0102] In the present disclosure, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0103] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0104] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0105] In addition, during the cultivation of the Corynebacterium genus microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0106] In the culture of the present disclosure, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0107] The glutamate series amino acids produced by the culture of the present disclosure may be secreted into the medium or remain within the cells.

[0108] In the method for producing a glutamate series amino acid of the present disclosure, the glutamate series amino acid may be at least one selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine.

[0109] The method for producing a glutamate series amino acid of the present disclosure may additionally include a step of preparing a Corynebacterium genus microorganism of the present disclosure, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.

[0110] The method for producing glutamate-based amino acids of the present disclosure may further include a step of recovering glutamate-based amino acids from a culture medium (a culture medium in which culture is performed) or a Corynebacterium genus microorganism. The recovering step may be additionally included after the culturing step.

[0111] The above recovery may be performed by collecting the target glutamate series amino acid using a suitable method known in the art according to the culture method of the microorganism of the present disclosure, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the target glutamate series amino acid can be recovered from the medium or microorganism using a suitable method known in the art.

[0112] Additionally, the method for producing glutamate-based amino acids of the present disclosure may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, when the method for producing glutamate-based amino acids of the present disclosure includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of the order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0113] In the method of the present disclosure, the thermoto-maritima derived dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase, glutamate-based amino acids, and Corynebacterium spp. microorganisms are as described in the other examples above.

[0114]

[0115] Another example of the present disclosure provides a composition for producing glutamate series amino acids, comprising a microorganism expressing a dual functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from the thermotomaritima.

[0116] The above thermoto, the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Maritima, the glutamate series amino acids and the microorganisms are as described in the other examples above.

[0117] The composition may further comprise any suitable excipients commonly used in compositions for producing the desired product, and such excipients may be, for example, but are not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0118] Another example provides the use of the microorganism for the production of glutamate-based amino acids.

[0119] Another example provides the use of the microorganism for the preparation of a composition for producing glutamate-based amino acids.

[0120]

[0121] Other examples of the present disclosure provide microorganisms, methods, compositions, products, processes, or uses featuring one or more elements disclosed in the present disclosure.

[0122]

[0123] The present disclosure shows that the Corynebacterium microorganism expressing a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima has an increased glutamate series amino acid production ability compared to the Corynebacterium microorganism expressing an enzyme having glutamate N-acetyltransferase activity derived from the parent strain and / or other species of microorganisms, and thus can be widely utilized for the production of glutamate series amino acids.

[0124] The present disclosure is described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present disclosure and are therefore not intended to limit the scope of the present disclosure. Furthermore, technical details not described in this disclosure can be readily understood and implemented by those skilled in the technical field of the present disclosure or similar technical fields.

[0125]

[0126] Example 1. Production of an expression vector introducing a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from a thermostable microorganism.

[0127] In order to determine the effect of introduction of a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from a thermotolerant microorganism on the production of glutamate-series amino acids, expression vectors introducing two types of dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from a thermotolerant microorganism were constructed as follows.

[0128] Specifically, information on the gene encoding a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase from Thermotoga maritima (SEQ ID NO: 2) and the surrounding base sequence and information on the gene encoding a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase from Thermotoga neapolitana (SEQ ID NO: 5) and the surrounding base sequence were obtained from the National Institutes of Health GenBank (NIH GenBank).

[0129] Gene fragments for constructing vectors were obtained through PCR using sequences obtained through gene synthesis based on the above-mentioned secured sequences as templates. At this time, SolgTM Pfu-X DNA polymerase was used as the polymerase, and the PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 5 minutes.

[0130] More specifically, primers of SEQ ID NOs: 9 and 10 were designed to amplify a gene derived from Thermotoga neapolitana, and a 1194 bp gene fragment was obtained as a result of performing PCR using SEQ ID NO: 6 as a template. Primers of SEQ ID NOs: 11 and 12 were designed to amplify a gene derived from Thermotoga maritima, and a 1194 bp gene fragment was obtained as a result of performing PCR using SEQ ID NO: 3 as a template.

[0131] In order to amplify the gene (SEQ ID NO: 8) derived from Corynebacterium glutamicum ATCC 13869 as a control, primers of SEQ ID NO: 13 and 14 were prepared using the genome of wild-type Corynebacterium glutamicum ATCC 13869 (NZ_CP016335.1) as a template, and PCR was performed to obtain a 1167-bp gene fragment. In order to secure an expression promoter in the vector, PCR was performed in the same manner as above using the gene upstream of NCgl0856 of wild-type Corynebacterium glutamicum ATCC 13869 as a template and primers of SEQ ID NO: 15 and SEQ ID NO: 16, and as a result, a 500-bp promoter region gene fragment was obtained.

[0132] The promoter region gene fragments obtained above and the gene fragments derived from thermotolerant microorganisms were fusion cloned into the pCES208 vector ("Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes." Journal of microbiology and biotechnology 18.4 (2008): 639-647.) cut with restriction enzymes BamHI and XbaI using an In-fusion Cloning Kit to obtain each gene expression vector. The vector containing the gene fragment and promoter derived from Thermotoga neapolitana was designated as “pCES208-PbetP-arg(T.ne)”, the vector containing the gene fragment and promoter derived from Thermotoga maritima was designated as “pCES208-PbetP-argJ(T.ma)”, Corynebacterium The vector containing the gene fragment and promoter derived from S. glutamicumATCC13869 was named “pCES208-PbetP-argJ(C.gl)”.

[0133] The sequences of the primers used in Example 1 are as shown in Table 1 below.

[0134] Name Sequence (5'-> 3') Sequence number TnJ_FCAAATTCGAAACCGATAATGTTCGTCCCTAGGGG Sequence number 9 TnJ_RGTGGCGGCCGCTCTAGATTAGGTGCGGTAGCGGC Sequence number 10 TmJ_FCAAATTCGAAACCGATAATGTTCACCCCACGCGG Sequence number 11 TmJ_RGTGGCGGCCGCTCTAGATTAGGTGCGATAGCGAC Sequence number 12 CgJ_FCAAATTCGAAACCGATAATGGCCAAAAAAGGCAT Sequence number 13 CgJ_RGTGGCGGCCGCTCTAGATTAAGAGCTGTACGCGG Sequence number 14 PbetP_FTGCAGCCCGGGGGATCCCAGCCGAAGTTTTAGGT Sequence number 15 PbetP_RTATCGGTTTCGAATTTGGGTCAGATGTAGTCATA Sequence number 16

[0135] Example 2. Evaluation of L-ornithine production ability of microorganisms introduced with dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from heat-resistant microorganisms.

[0136] 2-1. Production of L-ornithine-producing microorganisms

[0137] To produce an L-ornithine-producing microorganism, a vector was constructed in which glutamic acid located at position 47 of the amino acid sequence of ArgR (ANU33619.1) was substituted with a stop codon.

[0138] Using the genome of wild-type Corynebacterium glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using the primer pairs of SEQ ID NOs: 17 and 18, and the homologous recombinant B arm was amplified using the primer pairs of SEQ ID NOs: 19 and 20. The PCR conditions were denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. The amplified homologous recombinant arms A and B were cloned into the vector pDC24 (SEQ ID NO: 40) digested with BamHI and XbaI restriction enzymes to obtain a plasmid. This plasmid was named pDC24-argR (E47*).

[0139] To produce a microorganism with improved L-ornithine production ability, a vector was constructed in which serine at position 55 of the protein sequence of ArgF (ANU33618.1) was replaced with a stop codon. Using the genome of Corynebacterium glutamicum ATCC13869 as a template, the homologous recombinant C arm was amplified using the primer pairs of SEQ ID NOs: 21 and 22, and the homologous recombinant D arm was amplified using the primer pairs of SEQ ID NOs: 23 and 24. A plasmid was then obtained using the same method as above, and this plasmid was named pDC24-argF (S55*).

[0140] Using the constructed pDC24-argR(E47*) vector, wild-type Corynebacterium glutamicum ATCC13869 was transformed by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a second crossover process was performed to construct a microorganism in which the 139th base sequence of argR was substituted from guanine (G) to thymine (T), and the 47th base sequence was substituted with a stop codon. PCR and base sequence analysis were performed using a pair of primers of SEQ ID NOs: 17 and 20 that can amplify the adjacent region including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism thus obtained was named C.gl::argR*.

[0141] Using the pDC24-argF(S55*) vector in the above C.gl::argR*, a microorganism was constructed in which the 164th base sequence of argF was substituted from cytosine (C) to adenine (A), and the 55th base sequence was substituted with a stop codon. PCR and base sequence analysis were performed using a pair of primers of SEQ ID NOs: 21 and 24 capable of amplifying adjacent regions including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism thus obtained was named C.gl::argR*_argF*.

[0142] The primer sequences used in Example 2-1 are as shown in Table 2 below.

[0143] Name Sequence (5'-> 3') Sequence number Primer 1 CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAGSeq number 17 Primer 2 ATCCAGCAATTCAGACASEQ number 18 Primer 3 CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCASEQ number 19 Primer 4 ATCGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTGSEQ number 20 Primer 5 CGGTACCCGGGGATCCTGACCCCAGGCAAGCACGGSEQ number 21 Primer 6 GAAGCGAGTACGAGTTTAAGTCTTATCSEQ number 22 Primer 7 AAACTCGTACTCGCTTCTCCSEQ number 23 Primer 8 ATCGCCTGCAGGTCGACCGGCGCCGGCAACCTCGTCSEQ number 24

[0144] The vectors produced in Example 1 were transformed into the C.gl::argR*_argF* strain produced in Example 2-1 by electroporation to obtain a strain into which the vectors were introduced.

[0145] Specifically, the strain into which pCES208-PbetP-argJ(C.gl) was introduced was named “C.gl::argR*_argF*-argJ(C.gl)”, the strain into which pCES208-PbetP-argJ(T.ne) was introduced was named “C.gl::argR*_argF*-argJ(T.ne)”, and the strain into which pCES208-PbetP-argJ(T.ma) was introduced was named “C.gl::argR*_argF*-argJ(T.ma)”.

[0146]

[0147] 2-2. Confirmation of increased L-ornithine production by microorganisms introduced with dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima.

[0148] To analyze L-ornithine production ability, the control strain C.gl::argR*_argF*-argJ (C.gl), Corynebacterium glutamicum C.gl::argR*_argF*-argJ (T.ne), and C.gl::argR*_argF*-argJ (T.ma) strains were cultured using the following method and OD 562 , L-ornithine production and L-ornithine production yield were measured.

[0149] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium below and cultured at 33°C for 48 hours with shaking at 200 rpm. After the culture was completed, the culture was diluted 100-fold in 0.1 N HCl solution and OD was measured using a spectrophotometer. 562 The production amount and yield of L-ornithine were measured using HPLC. The yield was calculated as the ratio (%) of the production amount divided by the consumption amount, as shown in the following calculation formula 1.

[0150] [Calculation Formula 1]

[0151] Yield (%) = (Product production (g / L) / Consumption sugar (g / L) X 100

[0152]

[0153] <Production medium (pH 7.2)>

[0154] 50 g of raw sugar, 40 g of (NH4)2SO4, 1 g of yeast extract, 1.1 g of KH2PO4, 1.2 g of MgSO4·7H2O, 0.2 g of L-arginine, 1 mg of biotin, 5 mg of thiamine hydrochloride, 5 mg of calcium-pantothenic acid, 15 mg of nicotinamide, 10 mg of MnSO4, 10 mg of FeSO4, 0.5 mg of ZnSO4, 0.5 mg of CuSO4, 30 g of CaCO3, 25 mg of kanamycin (based on 1 liter of distilled water)

[0155]

[0156] The above experiment was repeated three times, and the average value of the analysis results is shown in Table 3 below.

[0157] Strain name OD 562 Consumption (g / L) L-ornithine production (g / L) L-ornithine yield (%) C.gl::argR*_argF*-argJ(C.gl) 36.85 0.015.63 1.2 C.gl::argR*_argF*-argJ(T.ne) 38.15 0.015.73 1.6 C.gl::argR*_argF*-argJ(T.ma) 38.85 0.016.73 3.4

[0158] As a result, as shown in Table 3 above, it was confirmed that the L-ornithine production ability increased by an average of 7% in the C.gl::argR*_argF*-argJ(T.ma) strain expressing the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima compared to the C.gl::argR*_argF*-argJ(C.gl) strain in which Corynebacterium-derived argJ was enhanced.

[0159] From the above results, it was confirmed that introduction of the argJ gene encoding a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima increased the L-ornithine production ability of Corynebacterium glutamicum.

[0160]

[0161] Example 3. Evaluation of L-citrulline production ability of microorganisms introduced with dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from heat-resistant microorganisms.

[0162] 3-1. Production of L-citrulline-producing microorganisms

[0163] To produce an L-citrulline-producing microorganism, a vector was constructed in which phenylalanine located at position 68 of the protein sequence of ArgG (ANU33620.1) was substituted with a stop codon.

[0164] Using the genome of wild-type Corynebacterium glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs: 25 and 26, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs: 27 and 28. Thereafter, a plasmid was obtained using the same method as in Example 2-1, and this plasmid was named pDC24-argG(F68*).

[0165] In order to create a microorganism with further improved L-citrulline production in C.gl::argR* created in Example 2-1, the pDC24-argG(F68*) vector was used to create a microorganism in which the 203rd base sequence of argG was substituted from thymine (T) to adenine (A), the 204th base sequence was substituted from cytosine (C) to adenine (T), and the 68th protein sequence was substituted with a stop codon. PCR and base sequence analysis were performed using a pair of primers of SEQ ID NOs: 25 and 28 that can amplify the adjacent region including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism thus obtained was named C.gl::argR*_argG*.

[0166] The primer sequences used in Example 3-1 are as shown in Table 4 below.

[0167] Name Sequence (5'-> 3') Sequence number Primer 9CGGTACCCGGGGATCCTTCATCGATAGGGTGGGSequence number 25 Primer 10GTACTCCTCAGCTTACTCATCCTTTGCATCAACASequence number 26 Primer 11AGTAAGCTGAGGAGTACTGCCTGCCAACCATCAASequence number 27 Primer 12ATGCCTGCAGGTCGACCGACTGGCTTGCCACCCTSequence number 28

[0168] The vectors produced above were transformed into the C.gl::argR*_argG* strain produced in Example 3-1 by electroporation to obtain a strain into which the vectors were introduced.

[0169] Specifically, the strain into which pCES208-PbetP-argJ was introduced was named “C.gl::argR*_argG*-argJ”, the strain into which pCES208-PbetP-argJ(T.ne) was introduced was named “C.gl::argR*_argG*-argJ(T.ne)”, and the strain into which pCES208-PbetP-argJ(T.ma) was introduced was named “C.gl::argR*_argG*-argJ(T.ma)”.

[0170]

[0171] Example 3-2: Confirmation of increased L-citrulline production by microorganisms introduced with dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima.

[0172] To analyze L-citrulline production ability, the control strains Corynebacterium glutamicum C.gl::argR*_argG*-argJ (C.gl), Corynebacterium glutamicum C.gl::argR*_argG*-argJ (T.ne), and C.gl::argR*_argG*-argJ (T.ma) strains were cultured using the following method and OD 562 , L-citrulline production and L-citrulline production yield were measured.

[0173] Specifically, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium below, and cultured at 33°C for 48 hours with shaking at 200 rpm. After the culture was completed, the OD of the culture solution 562 The production amount of L-citrulline and the yield of L-citrulline were measured using HPLC in the same manner as in Example 2-2.

[0174]

[0175] <Production medium (pH 7.2)>

[0176] 50 g of raw sugar, 40 g of (NH4)2SO4, 1 g of yeast extract, 1.1 g of KH2PO4, 1.2 g of MgSO4·7H2O, 0.2 g of L-arginine, 1 mg of biotin, 5 mg of thiamine hydrochloride, 5 mg of calcium-pantothenic acid, 15 mg of nicotinamide, 10 mg of MnSO4, 10 mg of FeSO4, 0.5 mg of ZnSO4, 0.5 mg of CuSO4, 30 g of CaCO3, 25 mg of kanamycin (based on 1 liter of distilled water)

[0177]

[0178] The above experiment was repeated three times, and the average value of the analysis results is shown in Table 5 below.

[0179] Strain name OD 562 Consumption (g / L) L-citrulline production (g / L) L-citrulline yield (%) C.gl::argR*_argG*-argJ(C.gl)44.450.04.89.6 C.gl::argR*_argG*-argJ(T.ne)46.250.04.69.1 C.gl::argR*_argG*-argJ(T.ma)47.350.05.811.5

[0180] As a result, as shown in Table 5 above, it was confirmed that the L-citrulline production ability increased by an average of 21% in the C.gl::argR*_argG*-argJ(T.ma) strain expressing the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima compared to the C.gl::argR*_argG*-argJ(C.gl) strain in which argJ derived from Corynebacterium was enhanced.

[0181] From the above results, it was confirmed that introduction of the argJ gene encoding a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima increased the L-citrulline production ability of Corynebacterium glutamicum.

[0182]

[0183] Example 4. Evaluation of putrescine production ability of microorganisms introduced with dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from heat-resistant microorganisms.

[0184] 4-1. Production of putrescine-producing microorganisms

[0185] To construct a putrescine-producing microorganism, information on the gene encoding ornithine decarboxylase and the surrounding base sequence derived from Lactobacillus sp. 30A strain was obtained from the National Institutes of Health (NIH GenBank) (SEQ ID NO: 29).

[0186] Gene fragments for producing vectors were obtained through PCR using sequences obtained through gene synthesis based on the above-mentioned secured sequences as templates.

[0187] SolgTM Pfu-X DNA polymerase was used as the polymerase, and the PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, polymerization at 72°C for 2 minutes, repeated 30 times, and then polymerization was performed at 72°C for 5 minutes.

[0188] More specifically, primers of sequence numbers 31 and 32 were designed to amplify the LODC (odci) gene derived from Lactobacillus sp. 30A strain, and a 2196 bp gene fragment was obtained as a result of performing PCR using the base sequence of sequence number 30 as a template.

[0189] In order to secure the expression promoter within the vector, PCR was performed in the same manner as above using the wild-type Corynebacterium glutamicum ATCC13869 as a template and the primers of SEQ ID NO: 33 and SEQ ID NO: 34, and as a result, a 318 bp promoter region gene fragment was obtained.

[0190] To delete NCgl1469 (SEQ ID NO: 41), the genome of wild-type Corynebacterium glutamicum ATCC13869 was used as a template to amplify the homologous recombinant A arm using the primer pairs of SEQ ID NOs: 35 and 36, and the homologous recombinant B arm using the primer pairs of SEQ ID NOs: 37 and 38. The PCR conditions were denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes.

[0191] The amplified promoter region, gene fragments derived from Lactobacillus sp. 30A strain, and homologous recombinant arms were ligated with the vector pDC24 digested with BamHI and XbaI restriction enzymes using the In-fusion Cloning Kit to obtain a deletion vector. This plasmid was named pDC24-ΔNCgl1469::Pcj7_LODC.

[0192] The sequences of the primers used in Example 4-1 are as shown in Table 6 below.

[0193] Name Sequence (5'-> 3') Sequence number LODC_FGAAAGGAAACACTCATGTCCTCTTCACTTAAAATTGC Sequence number 31 LODC_RCTTAAATCGCCTTCAGGGTTAATTATTATACCGGTCGTC Sequence number 32 Pcj7_FCGCTATTCTGGTATCCAGAAACATCCCAGCGC Sequence number 33 Pcj7_RTTTTAAGTGAAGAGGACATGAGTGTTTCCTTTCGTTGG Sequence number 34 Primer 13 agctcggtacccggggaTCCCAGGAATACAGCTGTTC Sequence number 35 Primer 14 CTGGGATGTTTCTGGATACCAGAATAGCGAAATG Sequence number 36 Primer 15 GACGACCGGTATAATAATTAACCCTGAAGGCGATTTAAG Sequence number 37 Primer 16gcctgcaggtcgactcTAGAAATGGCAGAGTTGGSEQ ID NO: 38

[0194] The vectors produced above were transformed into the C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC strain produced in Example 4-1 by electroporation to obtain a strain into which the vectors were introduced.

[0195] Specifically, the strain into which pCES208-PbetP-argJ was introduced was named “C.gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ”, the strain into which pCES208-PbetP-argJ(T.ne) was introduced was named “C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(T.ne)”, and the strain into which pCES208-PbetP-argJ(T.ma) was introduced was named “C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(T.ma)”.

[0196]

[0197] 4-2. Confirmation of increased putrescine production in microorganisms introduced with dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima.

[0198] To analyze the putrescine production ability, the control strains C.gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ strain, C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(T.ne) strain, C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(T.ne) strain, and C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(T.ma) strain were cultured using the following method and OD 562 , Putrescine production and putrescine yield were measured.

[0199] Specifically, each strain was inoculated into a 300 ml corner-baffle flask containing 25 ml of the production medium described below, and cultured at 33°C for 47 hours with shaking at 200 rpm. After completion of culture, the production amount of putrescine and the putrescine production yield were measured using HPLC in the same manner as in Example 2-2.

[0200]

[0201] <Production medium (pH 7.2)>

[0202] Glucose 60 g, CM (cane molasses) stock solution 20 g, (NH4)2SO4 50 g, KH2PO4 0.72 g, MgSO4·7H2O 1.13 g, MgCl2 0.4 g, MnSO4 0.18 g, ZnSO4 0.9 mg, CuSO4 0.9 mg, FeSO4 0.18 g, biotin 0.9 mg, thiamine hydrochloride 9 mg, calcium pantothenic acid 9 mg, nicotinamide 60 mg, L-arginine 0.15 g, CSL (corn steep liquor) 8.12 g, CaCO3 50 g, kanamycin 25 mg (based on 1 liter of distilled water)

[0203]

[0204] The above experiment was repeated three times, and the average value of the analysis results is shown in Table 7.

[0205] Strain name OD 562 Consumption (g / L) Putrescine production (g / L) Putrescine yield (%) C.gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ(C.gl)44.947.83.67.5 C.gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ(T.ne)42.340.01.84.6 C.gl::argR*_argF*- ΔNCgl1469::Pcj7_LODC-argJ(T.ma)33.460.011.118.5

[0206] As a result, as shown in Table 7, it was confirmed that the putrescine production ability increased by an average of 1.5 times in the C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(T.ma) strain expressing the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima compared to the C.gl::argR*_argF*-ΔNCgl1469::Pcj7_LODC-argJ(C.gl) strain in which Corynebacterium-derived argJ was enhanced.

[0207] From the above results, it was confirmed that introduction of the argJ gene encoding a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Thermotoga maritima increased the putrescine production ability of Corynebacterium glutamicum.

[0208]

[0209] From the above description, those skilled in the art will understand that the present disclosure can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present disclosure should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A microorganism of the genus Corynebacterium expressing a bifunctional glutamate N-acetyltransferase / amino-acid acetyltransferase derived from Thermotoga maritima.

2. A microorganism of the genus Corynebacterium, wherein the thermoto is a dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase derived from Maritima, and comprises an amino acid sequence having sequence number 1 or at least 90% sequence identity therewith.

3. In the first paragraph, the microorganism of the genus Corynebacterium is a microorganism of the genus Corynebacterium, into which a polynucleotide encoding the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase has been introduced.

4. A microorganism of the genus Corynebacterium, wherein the polynucleotide is composed of a nucleic acid sequence of sequence number 2.

5. In any one of claims 1 to 4, the Corynebacterium microorganism has increased production of glutamate-series amino acids compared to a Corynebacterium microorganism that does not express the dual-functional glutamate N-acetyltransferase / amino acid acetyltransferase.

6. In paragraph 5, the glutamate series amino acid is any one selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine, a microorganism of the genus Corynebacterium.

7. A Corynebacterium microorganism according to any one of claims 1 to 4, wherein the Corynebacterium microorganism is Corynebacterium glutamicum.

8. A step of culturing a microorganism of the genus Corynebacterium in a medium according to any one of the preceding clauses, and A method for producing a glutamate series amino acid, comprising a step of recovering a glutamate series amino acid from the cultured microorganism, medium, or both.

9. A method for producing a glutamate series amino acid, wherein the glutamate series amino acid in paragraph 8 is any one selected from the group consisting of L-ornithine, L-citrulline, L-arginine, and putrescine.

10. A method for producing a glutamate series amino acid, wherein the microorganism of the genus Corynebacterium in paragraph 8 is Corynebacterium glutamicum.

11. Use of a microorganism of the genus Corynebacterium according to any one of claims 1 to 4 for producing glutamate series amino acids.

12. A composition, method, product, process, or use characterized by one or more elements disclosed in the present disclosure.

Citation Information

Patent Citations

  • Promoter and uses thereof

    US10273491B2

  • Promoter and use thereof

    US10584338B2

  • Promoter sequences from Corynebacterium ammoniagenes

    US7662943B2

  • L-amino acid-producing bacterium and a method for producing an L-amino acid

    US9644009B2

  • Microorganisms for producing putrescine or ornithine and process for producing putrescine or ornithine using them

    KR101735935B1