Nasal commensals and uses thereof
Pharmaceutical compositions with Dolosigranulum pigrum strains address microbiome imbalance in the nasal cavity, reducing pathogenic colonization and treating respiratory conditions by modulating the nasal microbiome.
Patent Information
- Application Number
- PCT/US2025/025823
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-24
- Filing Date
- 2025-04-22
- Publication Date
- 2025-10-30
AI Technical Summary
Existing probiotic bacteria interventions primarily focus on gut colonization and fail to effectively address microbiome imbalance and disease conditions in the upper respiratory tract, particularly the nasal cavity, leading to opportunistic pathogenic colonization and inflammation.
Development of pharmaceutical compositions comprising live, purified populations of Dolosigranulum pigrum strains with specific 16S rRNA gene sequences, formulated for intranasal or oral administration, to promote a balanced microbiome in the nasal cavity and upper respiratory tract.
The compositions effectively reduce pathogenic bacterial colonization and treat conditions such as acute bacterial rhinosinusitis, asthma exacerbations, and viral respiratory infections by modulating the nasal microbiome, thereby improving respiratory health.
Smart Images

Figure US2025025823_30102025_PF_FP_ABST
Abstract
Description
NASAL COMMENSALS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 638,331, filed April 24, 2024, the contents of which is incorporated herein by reference in its entirety.SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on April 15, 2025, is named 200546_010801_SL.xml and is 181,126 bytes in size.BACKGROUND
[0003] Host and environmental factors influence the integrity of the microbiome in subjects. Microbial imbalance can lead to inflammation (or vice versa), resulting in opportunistic pathogenic microorganism colonization and subsequent disease conditions. Similarly, host microbiome’s influence host gene expression and susceptibility to different disease conditions. Probiotic bacteria provide a therapeutic opportunity for addressing microbiome imbalance and disease related conditions. Typically, probiotic bacteria in clinical development to date have focused on gut colonizing bacteria. In some instances, there may be a need for forms of intervention which promote an improved microbiome environment in the upper respiratory tract, in particular the nasal cavity, for the treatment and prevention of conditions in the nasal cavity as well as in systems linked to the upper respiratory tract by a shared mucosal network, such as the lower respiratory' tract.BRIEF SUMMARY
[0004] Described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: a first Dolosigranulum pigrum strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity’ to SEQ ID NO: 1; and a pharmaceutically acceptable excipient. In some embodiments, the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity' over at least 1000 bases to SEQ ID NO: 1. In some embodiments, the first Dolosigranulum pigrum strain comprises the 16S rRNA gene of SEQ ID NO: 1. In some embodiments, the first Dolosigranulum pigrum strain comprises a genome with 4 copies of a 16S rRNA genesequence. In some embodiments, the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprise a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2, 3, 4, or 5. In some embodiments, the one or more strains of Dolosigranulum pigrum comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 2, 3, 4, or 5. In some embodiments, the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprises a 16S rRNA gene sequence of any one of SEQ ID NO: 2, 3, 4, or 5. In some embodiments, the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4, 6, or 7. In some embodiments, the one or more strains of Dolosigranulum pigrum comprises the 16S rRNA gene sequence ■with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 4, 6, or 7. In some embodiments, the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprises a 16S rRNA gene sequence of any one of SEQ ID NO: 4, 6, or 7. In some embodiments, the live, purified population of bacteria further comprises: at least one strain of Corynebacterium. In some embodiments, the pharmaceutical composition is formulated for intranasal administration or oral administration. In some embodiments, the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. In some embodiments, the pharmaceutical composition is in a gel form. In some embodiments, the pharmaceutical composition in a nasal spray bottle. In some embodiments, the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. In some embodiments, wherein the live, purified population of bacteria is lyophilized. In some embodiments, the live, purified population of bacteria comprises at least one bacteriocin. In some embodiments, the bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof. In some embodiments, the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. gluiamicum. C. propiquu or C. striatum. In some embodiments, the Corynebacterium comprises Corynebacterium pseudodiphtheriticum. In some embodiments, the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700. In some embodiments, the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. In some embodiments,the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0005] Also described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: at least two of the following Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; and a fifth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 5; and a pharmaceutically acceptable excipient. In some embodiments, the at least two Dolosigranulum pigrum strains comprises a genome with 4 copies of a 16S rRNA gene sequence. In some embodiments, the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 1. In some embodiments, the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 2. In some embodiments, the third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 3. In some embodiments, the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 4. In some embodiments, the fifth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 5. In some embodiments, the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 1. In some embodiments, the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 2. In some embodiments, the third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 3. In some embodiments, the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4. In some embodiments, the fifth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 5. In some embodiments, the pharmaceutical composition, comprises: a live, purified population of bacteria comprising: the following Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2; a third strain, whichcomprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 4; and a fifth strain, which comprises a 16S rRNA gene sequence yvith at least 99% sequence identity to SEQ ID NO: 5 and a pharmaceutically acceptable excipient.
[0006] Also described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: at least two of the following Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence yvith at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity’ to SEQ ID NO: 6; and a fourth strain, which comprises a 16S rRNA gene sequence yvith at least 99% sequence identity to SEQ ID NO: 7; and a pharmaceutically acceptable excipient. In some embodiments, the at least tyvo Dolosigranulum pigrum strains comprises a genome with 4 copies of a 16S rRNA gene sequence. In some embodiments, the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 1. In some embodiments, the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence yvith at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 4. In some embodiments, third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 6. In some embodiments, the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity' over at least 1000 bases to SEQ ID NO: 7. In some embodiments, the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 1. In some embodiments, the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4. In some embodiments, the third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 6. In some embodiments, the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 7. In some embodiments, the pharmaceutical composition of comprises: a live, purified population of bacteria comprising: the following Dolosigranulum pigrum strains: a first strain, yvhich comprises a 16S rRNA gene sequence yvith at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 4; a third strain, which comprises a 16S rRNA gene sequence yvith at least 99% sequence identity to SEQ ID NO: 6; and a fourthstrain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 7; and a pharmaceutically acceptable excipient. In some embodiments, the live, purified population of bacteria further comprises: at least one strain of Corynebacterium. In some embodiments, the pharmaceutical composition is formulated for intranasal administration or oral administration. In some embodiments, the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. In some embodiments, the pharmaceutical composition is in a gel form. In some embodiments, the pharmaceutical composition is comprised in a nasal spray bottle. In some embodiments, the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. In some embodiments, the live, purified population of bacteria is lyophilized. In some embodiments, live, purified population of bacteria comprises at least one bacteriocin. In some embodiments, the bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof. In some embodiments, the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the Corynebacterium comprises C. accolens. C. pseudodiphtheriticum. C. amycolatum. C. propinquum, C. glutamicum. C. propiquu or C. striatum. In some embodiments, the Corynebacterium comprises Corynebacterium pseudodiphtheriticum. In some embodiments, the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700. In some embodiments, the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0007] Also described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: a mixture of Dolosigranulum pigrum strains that comprise at least about 40% or at least about 45% of the total genes of a Dolosigranulum pigrum pangenome; and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition comprises at least 3, 4, 5 or more strains of Dolosigranulum pigrum. In some embodiments, the Dolosigranulum pigrum strains comprises a 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to one or more of: SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7. In some embodiments, the live, purified population of bacteria further comprises: at least one strain of Corynebacterium. In some embodiments, the pharmaceutical composition is formulated for intranasal administration or oral administration. In some embodiments, the pharmaceutical composition is in a liquid, solid, semisolid, oraerosol dosage form. In some embodiments, the pharmaceutical composition is in a gel form. In some embodiments, the pharmaceutical composition is comprised in a nasal spray bottle. In some embodiments, the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. In some embodiments, the live, purified population of bacteria is lyophilized. In some embodiments, live, purified population of bacteria comprises at least one bacteriocin. In some embodiments, the bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha. macedovicin, or any combination thereof. In some embodiments, the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum.. C. propiquu or C. striatum. In some embodiments, the Corynebacterium comprises Corynebacterium pseudodiphtheriticum. In some embodiments, the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700. In some embodiments, the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0008] Also described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: a mixture of Dolosigranulum pigrum strains from at least3, or optionally 4 different phylogenetic clades, wherein the phylogenetic clades are determined by a core genome single nucleotide polymorphism (SNP) phylogenetic analysis; and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition comprises at least 3, 4, 5 or more strains of Dolosigranulum pigrum. In some embodiments, the Dolosigranulum pigrum strains comprises a 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to one or more of: SEQ ID NO: 1, 2, 3,4, 5, 6, or 7. In some embodiments, the live, purified population of bacteria further comprises: at least one strain of Corynebacterium. In some embodiments, the pharmaceutical composition is formulated for intranasal administration or oral administration. In some embodiments, the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. In some embodiments, the pharmaceutical composition is in a gel form. In some embodiments, the pharmaceutical composition is comprised in a nasal spray bottle. In some embodiments, the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. In some embodiments, the live, purified population of bacteria is lyophilized.In some embodiments, live, purified population of bacteria comprises at least one bacteriocin. In some embodiments, the bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof. In some embodiments, the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolalum, C. proplnquum, C. gluiumicum. C. proplquu or C. striatum. In some embodiments, the Corynebacterium comprises Corynebacterium pseudodiphtheriticum. In some embodiments, the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700. In some embodiments, the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of 10A3 to 10Al 2 cfu.
[0009] Also described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: a mixture of Dolosigranulum pigrum strains that comprise at least 4 different bacteriocins: and a pharmaceutically acceptable excipient. In some embodiments, the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains with at least 99% sequence identity to the 16S rRNA gene sequence of SEQ ID NO: 1-5. In some embodiments, the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains comprising the 16S rRNA gene sequence of SEQ ID NO: 1-5. In some embodiments, the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains with at least 99% sequence identify to the 16S rRNA gene sequence of SEQ ID NO: 1, and / or SEQ ID NO: 4-7. In some embodiments, the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains comprising the 16S rRNA gene sequence of SEQ ID NO: 1, and / or SEQ ID NO: 4-7. In some embodiments, the bacteriocins comprise one or more of the following bacterocins: mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, or macedovicin. In some embodiments, the mixture of Dolosigranulum pigrum strains comprise 5 different bacteriocins. In some embodiments, the live, purified population of bacteria further comprises: at least one strain of Corynebacterium. In some embodiments, the pharmaceutical composition is formulated for intranasal administration or oral administration. In some embodiments, the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. In some embodiments, the pharmaceutical composition is in a gel form. In some embodiments, the pharmaceutical composition is comprised in a nasal spray bottle. In someembodiments, the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. In some embodiments, the live, purified population of bacteria is lyophilized. In some embodiments, the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glulamicum, C. proplquu or C. striatum. In some embodiments, the Corynebacterium comprises Corynebacterium pseudodiphtheriticum. In some embodiments, the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700. In some embodiments, the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of 10A3 to 10Al 2 cfu.
[0010] Also described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: a Dolosigranulum pigrum strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; and a pharmaceutically acceptable excipient. In some embodiments, the Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 4. In some embodiments, wherein the Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4. In some embodiments, the live, purified population of bacteria further comprises: at least one strain of Corynebacterium. In some embodiments, the pharmaceutical composition is formulated for intranasal administration or oral administration. In some embodiments, the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. In some embodiments, the pharmaceutical composition is in a gel form. In some embodiments, the pharmaceutical composition is comprised in a nasal spray bottle. In some embodiments, the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. In some embodiments, the live, purified population of bacteria is lyophilized. In some embodiments, live, purified population of bacteria comprises at least one bacteriocin. In some embodiments, the bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof. In some embodiments, the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the Corynebacterium comprises C. accolens, C. pseudodiphtheriticum. C. amycolatum, C. propinquum, C. glutamicum, C. propiquu or C. striatum. In someembodiments, the Corynebacterium comprises Corynebacterium pseudodiphtheriticum. In some embodiments, the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700. In some embodiments, the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of 10A3 to 10Al 2 cfu.
[0011] Also described herein are pharmaceutical compositions, comprising: a live, purified population of bacteria comprising: a first Dolosigranulum pigrum strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 8; and a pharmaceutically acceptable excipient. In some embodiments, the Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 8. In some embodiments, the Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 8. In some embodiments, the live, purified population of bacteria further comprises: at least one strain of Corynebacterium. In some embodiments, the pharmaceutical composition is formulated for intranasal administration or oral administration. In some embodiments, the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. In some embodiments, the pharmaceutical composition is in a gel form. In some embodiments, the pharmaceutical composition is comprised in a nasal spray bottle. In some embodiments, the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. In some embodiments, the live, purified population of bacteria is lyophilized. In some embodiments, live, purified population of bacteria comprises at least one bacteriocin. In some embodiments, the bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof. In some embodiments, the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the Corynebacterium comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, C. propiquu or C. striatum. In some embodiments, the Corynebacterium comprises Corynebacterium pseudodiphtheriticum. In some embodiments, the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700. In some embodiments, the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. In some embodiments, the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0012] Also described herein are kits, wherein the kit comprises: one or more containers comprising a pharmaceutical composition described above.
[0013] Also described herein are kits, wherein the kit comprises: a first container comprising one or more of the following live and purified Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity7to SEQ ID NO: 1 ; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity7to SEQ ID NO: 2; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 4; a fifth strain, w'hich comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 5; a sixth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 6; a seventh strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity7to SEQ ID NO: 7; and an eighth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 8, wherein the live and purified Dolosigranulum pigrum are lyophilized; and a second container comprising a distilled w'ater. In some embodiments, the first container further comprises a strain of C. pseudodiphtheriticum.
[0014] Also described herein are methods of administering a pharmaceutical composition described above to a subject, comprising administering an amount sufficient to treat a disease in the subject. In some embodiments, the disease is selected from the group consisting of: an acute bacterial rhinosinusitis, an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory7tract infection (including infection with MRSA or MSSA), a tonsilitis. an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD). a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA). a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community7acquired pneumonia (CAP)), a primary7Ciliary7dyskinesia, a Severe acute respiratory syndrome (S ARS), a COVID-19, a tuberculosis, a walking pneumonia, a whooping cough (pertussis), an acuteotitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, an otitis media with or without effusion, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in an immunosuppressed population.
[0015] Also described herein are methods of administering the pharmaceutical composition described above to a subject comprising administering an amount sufficient to reduce the abundance of a pathogenic bacteria in the subject, wherein the pathogenic bacteria are selected from the group consisting of: Staphylococcus aureus, Acinetobacter baumannii, Pseudomonas aeruginosa, Moraxella catarrhalis, Haemophilus influenzae, and any combination thereof.
[0016] Also described herein are pharmaceutical compositions described above use in the treatment of a disease in a subject, wherein the disease is selected from the group consisting of: an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non- allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRSA or MSSA), a tonsilitis, an acute lung injury, an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA). a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary' Ciliary' dyskinesia, a Severe acute respiratory syndrome (S ARS), a COVID-19, a tuberculosis, a walking pneumonia, a whooping cough (pertussis), an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, an otitis media with or without effusion, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in an immunosuppressed population.
[0017] Also described herein is use of the pharmaceutical compositions described above in the manufacture of a medicament for the treatment of a disease in a subject, wherein the disease is selected from the group consisting of: an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, anon-allergic rhinitis, an obstructive sleep apnea, a pharyngitis.an upper respiratory tract infection (including infection with MRS A or MS SA), a tonsilitis, an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary Cili ary dyskinesia, a Severe acute respiratory syndrome (S ARS), a COVID- 19, a tuberculosis, a walking pneumonia, a whooping cough (pertussis), an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, an otitis media with or without effusion, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in an immunosuppressed population.
[0018] Also described herein are methods of treating a recurrent S'. aureus infection in a subject with chronic rhinosinusitis (CRS) comprising administering a pharmaceutical composition described above to the subject, wherein the administering comprises an amount sufficient to treat the recurrent S. aureus infection in the subject with chronic CRS. In some embodiments, the CRS comprises CRS with nasal polyps (CRSwNP). In some embodiments, the CRS comprises CRS without nasal polyps (CRSwNP). In some embodiments, the pharmaceutical composition is administered following an antibiotic therapy, a steroid therapy, an antibody therapy, or any combination thereof. In some embodiments, the antibiotic therapy comprises a macrolide and optionally wherein the macrolide comprises an azithromycin, a clarithromycin, an erythromycin, or any combination thereof. In some embodiments, the steroid therapy comprises a prednisone, a beclomethasone dipropionate, a triamcinolone acetonide, a flunisolide, a budesonide, a fluticasone propionate, a mometasone furoate, a ciclesonide, a fluticasone furoate, or any combination thereof. In some embodiments, the antibody therapy comprises a dupilumab, an omalizumab, a mepolizumab, or any combination thereof. In some embodiments, the antibody therapy comprises an antibody that selectively binds (a) IL-4 and IL- 13, (b) IL-4, or (c) IgE.
[0019] Also disclosed herein are methods for treatment of a viral respiratory infection, comprising: administering to a subject a pharmaceutical composition described above, wherein the live, purified population of bacteria is present in an amount sufficient for treatment of theviral respiratory infection. In some embodiments, the viral respiratory infection is from a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2. In some embodiments, the live, purified population of bacteria is present in an amount sufficient for reduction in colonization of a pathogenic virus in a nasal cavity of the subject. In some embodiments, the live, purified population of bacteria is present in an amount sufficient for reduction in colonization of a pathogenic virus in a lung of the subject. In some embodiments, the pathogenic virus is SARS-CoV-2. In some embodiments, the live, purified population of bacteria is present in an amount sufficient for reduction in protein expression of ACE2 in an airway of the subject. In some embodiments, the live, purified population of bacteria is present in an amount sufficient for reduction in protein expression of ACE2, TMPRSS2, or both proteins in an airway of the subject. In some embodiments, the live, purified population of bacteria is administered intranasally. In some embodiments, the subject is an infant, a child, or an adult. In some embodiments, the subject has obesity, a diabetes, an asthma, a chronic lung disease, a sickle cell disease, or any combination thereof. In some embodiments, the subject is obese, immunocompromised, or both.
[0020] Also described herein are pharmaceutical compositions comprising a conditioned cell free media of one or more of the following live and purified Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 4; a fifth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 5; a sixth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 6; a seventh strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 7; and an eighth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 8. In some embodiments, the conditioned cell free media comprises a fraction of media that is less than 10 kDa in size. In some embodiments, the first strain comprises the 16S rRNA gene sequence of SEQ ID NO: 1. In some embodiments, the second strain comprises the 16S rRNA gene sequence of SEQ ID NO: 2. In some embodiments, the third strain comprises the 16S rRNA gene sequence of SEQ ID NO: 3. In some embodiments, the fourth strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4. In some embodiments, the fifth strain comprisesthe 16S rRNA gene sequence of SEQ ID NO: 5. The In some embodiments, the sixth strain comprises the 16S rRNA gene sequence of SEQ ID NO: 6. In some embodiments, the seventh strain comprises the 16S rRNA gene sequence of SEQ ID NO: 7.BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIGURES 1A-1H are flow chart and diagrams showing the analyses of Nasal ACE2 / TMPRSS2 gene expression associated with COVID- 19 case status. FIG. 1A is a flow chart showing the case and control samples for three analyses. FIG. IB are plots showing nasal ACE2 and TMPRSS2 gene expression in cases versus controls. FIG. 1C is a scatted plot showing nasal TMPRSS2 gene expression levels (Cp) in cases versus controls. FIG. ID is a diagram showing the decision tree algorithm results for identifying ACE2 and TMPRSS2 expression level predictors of COVID-19 case status. FIG. IE is an Alluvial diagram demonstrating individual shifts between gene expression categories across sequential time samples, from visit number 1 (the first available visit prior to infection among cases, or the age- and date-matched sample from a control) to visit number 5 (up to 5 sequential visits prior). FIG. IF and FIG. 1G are scatted plot showing nasal ACE2 (FIG. IF) and TMPRSS2 (FIG. 1G) gene expression levels (Cp). Higher Cp-values correlate with lower expression levels and vice versa. FIG. 1H is a reproduced Alluvial diagram of FIG. 13 with emphasis on visit numbers 1-4. showing dynamics of nasal ACE2 / TMPRSS2 gene expression categories across sequential visits by case / control status.
[0022] FIGURES 2A-2E are diagrams characterizing nasal ACE2 / TMPRSS2 expression level, nasal community state types (CST) composition (stacked barplot) and proportional and absolute abundance of nasal CST indicators. FIG. 2A is a bar plot showing the total nasal bacterial density as measured by 16S rRNA gene copies / swab. FIG. 2B is a bar plot showing prevalence of nasal ACE2 / TMPRSS2 expression categories in each study. FIG. 2C is a chart showing nasal CSTs detected in each ACE2 / TMPRSS2 category7. FIG. 2D is a bar plot showing nasal CSTs detected in each ACE2 / TMPRSS2 category. FIG. 2F is waterfall plot showing the proportional abundance of nasal taxa that compnse nasal microbiome of 428 participants. Each nasal taxon is represented by a color specified in the color legend.
[0023] FIGURES 3A-3D Show7bar plots for odds ratio for increased nasal ACE2 / TMPRSS2 expression and CST membership. FIG. 3A is a bar plot showing the odds ratio (OR) for increased nasal ACE2 / TMPRSS2 expression with each 10-fold increase in absolute abundance as compared to individuals below threshold. FIG. 3B is a bar plot showing the proportion ofCST membership (canonical vs. other CSTs) among individuals with nasal bacteria attribution of interest. FIG. 3C is a bar plot showing the odds ratio for increased nasal ACE / TMPRSS2 as compared to individuals below threshold. FIG. 3D is a bar plot showing the portion of each CST with the specific density attribute.
[0024] FIGURE 4 is a diagram showing the network analysis of nasal CST indicators. Network analysis of all nasal CST indicators along with any bacteria present at >1% mean proportional abundance in the study population that were associated with gene expression category in a random forest model. The gray scale represents the adjusted odds ratio for the association between the taxa and higher ACE2 and TMPRSS2 gene expression categories. Network metrics identified four clusters; an anaerobe cluster with a Peptoniphilus node, a skin- associated taxa cluster with a S. epidermidis node, a separate S. aureus-only node, and other correlated taxa (C. accolens. Dolosigranulum, C. pseudodiptheriticum, M. catarrhalis / nonliquifaciens, H. influenzae, other Corynebacterium) in a final cluster with C. accolens serving as a node.
[0025] FIGURES 5A-5D are bar charts and plot showing the associations between D. pigrum and gene expression, with and without H. influenzae. S. aureus, and M. catarrhalis / nonliquefaciens. In FIGS. 5A-5C, Y axis represents percentage of gene expression categories for M. catarrhalis / nonliquefaciens (FIG. 5A), H. influenzae (FIG. 5B), or medium- or high-density S. aureus (FIG. 5C), while X axis corresponds to the presence or absence of high density D. pigrum. FIG. 5D is a scattered plot showing significant Spearman correlations between taxa.
[0026] FIGURE 6 is a diagram showing the proportional abundance decision tree algorithm results for identifying bacterial clades associated with ACE2 and TMPRSS2 expression levels in nasal microbiome. Dashed lines indicate manual pruning of branches in the figure for simplification.
[0027] FIGURE 7 are plots showing the grow th curves of isolated D. pigrum strains in 96- well plate.
[0028] FIGURE 8 is a cladogram tree graph of the 56 D. pigrum genomes including additional in-house and NCBI public D. pigrum genomes cut with the first dash line by Phytools to generate 3 sub-clades.
[0029] FIGURE 9 is an image showing zone of clearance of S. aureus strain USA300 induced by D. pigrum isolate A49.
[0030] FIGURE 10 are plots of optical density at 600 nm (OD600) of S. aureus strainUS A300 (Y-axis) grown in cell free media conditioned by two D. pigrum strains (“strain A” is strain A4 and “strain B” is A7) or in the absence of D. pigrum cell free media. X-axis represents seven different conditions (from left to right): unfractionated media plus protein digestion; unfractionated media; control media (inactive); >10 kDa fraction; <10 kDa fraction; >10 kDa plus protein digestion; <10 kDa plus protein digestion.
[0031] FIGURE 11 is a figure illustrating various dosage forms described herein for oral 101 and / or intranasal 102 administration. Dosage forms illustrated include an inhaler 103 for aerosol administration, liquid 104 and capsule 105 for oral administration, and a spray bottle 106 for intranasal administration.DETAILED DESCRIPTION
[0032] Isolation and selection of bacteria as therapeutic compositions is becoming a popular means of developing new therapeutics. However, there is a need to identify promising candidates from a large pool of isolates. The methods herein describe genomic, phylogenetic, functional, and donor-specific traits for selection of isolates for therapeutic compositions. Dolosigranulum pigrum isolates were collected and assessed by their characteristics for inclusion in pharmaceutical compositions. Characteristics of D. pigrum isolates that were analyzed were phenotypic and genotypic traits. For example, selected strains were shown to have: reproducible growth characteristics, inhibition of pathogen growth (e g., S. aureus USA300), association with healthy human donor nasal microbiomes, limited antibiotic resistance genes, diverse genetic backgrounds, and / or various bacterial antagonism mechanisms, among other things. The method of identification and selection of these strains is inventive in light of previous techniques to identify bacterial pharmaceutical compositions.
[0033] Provided herein are composition, methods, kits and devices relating to upper respiratory tract colonizing bacteria for prevention and / or treatment of respiratory tract conditions and conditions of the ear and eustachian tube. Furthermore, provided herein are (1) probiotic bacterial mixtures (2) excipients, dosage forms and routes of administration for such mixtures, (3) and conditions for treatment with such probiotic bacterial mixtures.
[0034] Throughout this disclosure, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of any embodiments. Accordingly, the description of a range should be considered to have specifically disclosed allthe possible subranges as well as individual numerical values within that range to the tenth of the unit of the lower limit unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 5, and 5.9. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included, unless the context clearly dictates otherwise.
[0035] The terminology used herein is for the purpose of describing particular instances only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items.
[0036] Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers + / - 10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.
[0037] The term “subject” as used herein includes human and non-human mammals, including for example: a primate, cow, horse, pig, sheep, goat, dog, cat, or rodent, capable of being colonized by other organisms.
[0038] In some embodiments, provided herein are compositions which include bacteria having a percent identity based on 16S rRNA bacterial genetic sequence, a hypervariable region of the 16S rRNA, or whole genome comparison to a reference strain. Typically, comparison of the 16S rRNA bacterial genetic sequence allows a strain to be identified as within the same species as another strain by comparing sequences with known bacterial DNA sequences using NCBI BLAST search. The level of identity in relation to a nucleotide sequence may be determined for at least 20 contiguous nucleotides, for at least 30 contiguous nucleotides, for at least at least 40 contiguous nucleotides, for at least 50 contiguous nucleotides, for at least 60 contiguous nucleotides, or for at least 100 contiguous nucleotides. The level of identity in relation to a nucleotide sequence may be determined for at least 20 contiguous nucleotides, for at least 200 contiguous nucleotides, for at least at least 300contiguous nucleotides, for at least 400 contiguous nucleotides, for at least 500 contiguous nucleotides, for at least 600 contiguous nucleotides, for at least 700 contiguous nucleotides, for at least 800 contiguous nucleotides, for at least 900 contiguous nucleotides, or for at least 1000 contiguous nucleotides. In some embodiments, the level of identity in relation to a nucleotide sequence is determined for the entire sequence searched. Percent identity7may be at least 70%, 80%, 85%. 90%. 91%. 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to a reference bacterial 16S rRNA sequence, 16S rRNA V4 region sequence, or whole genome sequence. Percent identity may be at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% to a reference bacteria 16S rRNA: VI region, V2 region, V3 region, V5 region, V6 region, V7 region, V8 region or V9 region sequence.
[0039] Provided herein are compositions comprising live bacteria. Various techniques for determining if the bacteria are live include measuring membrane stability, transcription, translation, and cell division. In some embodiments, a live bacterium can comprise a bacterium that retains membrane stability. In some embodiments, a live bacterium can comprise a bacterium that is capable of transcription and translation. In some embodiments, a live bactenum can comprise a bacterium that is capable of cell division. In some embodiments, live bacteria can be determined by a culture dependent or a culture independent technique. In some cases, live bacteria can comprise an individual or a group of bacteria that can either produce a colony -forming unit (CFU) when plated on solid growth media or increase in optical density when grown in liquid media. In some embodiments, live and / or dead bacteria can be determined by imaging, for example with a live / dead stain. In some embodiments, a viability PCR based method can be used to determine live bacteria. In some cases, a metabolomic assay can be used to determine live bacteria.
[0040] In some embodiments, reference to a population of bacteria or a purified population refers to a plurality of bactena. In some embodiments, a purified bacteria is enriched from a source sample. Compositions described herein can comprise about: 10%, 20%, 30%, 40%, 50%, 60%, 70% or more of a single strain of bacteria.
[0041] As used herein, the terms ‘‘treatment’' or “treating'’ are used in reference to a pharmaceutical regimen for obtaining beneficial or desired results in the recipient. Beneficial or desired results include but are not limited to a therapeutic benefit and / or a prophylactic benefit. A therapeutic benefit may refer to eradication or amelioration of symptoms or of an underlying disorder being treated. Also, a therapeutic benefit may be achieved with the eradication or amelioration of one or more of the physiological symptoms and / or complications(e.g., inflammation, infection, tissue damage etc.) associated with the underlying disorder such that an improvement may be observed in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder. A prophylactic effect includes delaying, preventing, or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof. For a prophylactic benefit, a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease may undergo treatment, even though a diagnosis of this disease may not have been made.
[0042] As used herein, a substance is ‘‘pure’' or “substantially pure’' if it is substantially free of other components. The terms “purify,” “purifying” and “purified”, when applied to a bacterium, can refer to a bacterium that has been separated from at least some of the components with which it was associated either when initially produced or generated (e.g., whether in nature or in an experimental setting), or during any time after its initial production. A bacterium or a bacterial population may be considered purified if it is isolated at or after production, such as from a material or environment containing the bacterium or bacterial population, or by passage through culture, and a purified bacterium or bacterial population may contain other materials up to at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%. or above about 90% and still be considered “isolated.” Purified bacteria and bacterial populations can be more than at least about 80%, about 85%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than at least about 99% pure by w eight (w / w). In the instance of microbial compositions provided herein, the one or more bacterial types (species or strains) present in the composition can be independently purified from one or more other bacteria produced and / or present in the material or environment containing the bacterial type. Microbial compositions and the bacterial components thereof are generally purified from residual habitat products.
[0043] An isolated bacterium may have been (1) separated from at least some of the components with which it was associated when initially obtained (whether in nature or in an experimental setting), and / or (2) produced, prepared, purified, and / or manufactured by the hand of man, e.g. using artificial culture conditions such as (but not limited to) culturing on a plate, in liquid media, and / or in a fermenter. Isolated bacteria can include those bacteria that are cultured, even if such cultures are not monocultures. Isolated bacteria can be separated fromat least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%. or more of the other components with which they were initially associated. Isolated bacteria can be more than about 80%, about 85%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. A bacterial population of a biological sample provided herein can comprise one or more bacteria, which may then be isolated from such sample. Isolated bacteria may be provided in a form that is not naturally occurring.1) Probiotic bacterial mixtures
[0044] The nasal cavity of the upper respiratory' tract is a nutrient-poor, high-salinity niche where bacteria compete for limited resources. A healthy nasal microbiome can prevent pathogenic microorganisms from establishing colonization or reduce the bioburden of colonizing pathogens. Persistent colonization by pathogens, especially high bioburden colonization, can increase the risk for subsequent invasive infections by the pathogen. Additionally, pathological interactions between nasal microbiome containing pro- inflammatory pathogens with the host nasal epithelium can lead to acute and / or chronic inflammation, which may result in impaired epithelial integrity ("leaky” cell-cell junctions), mucosal metaplasia / hyperplasia, and other upper and lower respiratory' tract disorders driven by epithelial / mucosal dysfunction. Thus, the nasal cavity' provides an opportunity for utilizing beneficial microbiome changes to prevent and / or treat many infectious, inflammatory, and other health conditions.
[0045] Bacteria described herein are to be used to control, treat, reduce, eliminate, and / or prevent colonization by pathogenic microorganisms on a subject and / or reduce inflammation and / or reduce epithelial pathologies. Compositions described herein may be administered or designed for delivery to particular locations of the subject, in particular, an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above the vocal folds (cords), a lary nx below the vocal folds, a lower respiratory' tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a orophary nx, the paranasal sinuses, a phary nx, a sinonasal cavity, a trachea, and / or a upper respiratory tract. Bacterial strains described herein may be isolated from the upper respiratory tract regions including, without limitation, anterior nares, sinonasal cavity, and / or nasopharynx. Bacterial strains described herein may be isolated from an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above the vocal folds (cords), a larynx below the vocal folds, a lower respiratory' tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a oropharynx, the paranasal sinuses, a pharynx, asinonasal cavity, a trachea, and / or a upper respiratory tract.
[0046] In some cases, 2, 3. 4, 5, 6 or more different strains of bacteria each have different and / or shared bacterial antagonism mechanisms, which include, but are not limited to, bactericidal and bacteriostatic mechanisms. Reference to different bacterial antagonism mechanisms as used herein includes, for example, when two or more strains within a composition provide at least some overlapping bacterial antagonism mechanisms and different bacterial antagonism mechanisms. Alternatively, reference to different bacterial antagonism mechanisms as used herein includes, for example, when two or more strains within a composition provide different bacterial antagonism mechanisms. Examples of different bacterial antagonism mechanisms include, without limitation, iron sequestration, secretion systems (e.g., type IV secretion system, type VI secretion system, type VII secretion system), toxins that target cell wall synthesis, toxins that target ATP production, toxins that target DNA replication, small molecules, antimicrobial proteins (e.g., bacteriocins), phages, nanotubes, and nutrient sequestration. Bacteria that are closely related (e.g., within species, within genus, etc.) can share a set of core genes. In contrast to core genes, closely related bacteria can also have unique genes, also known as accessory genes. Both accessory and core genes can encode bacterial antagonism mechanisms, whereby the presence or absence accessory genes can represent the presence or absence of antagonism mechanisms, whereas sequence variations in core genes can represent diversity of a particular antagonism mechanisms. Collectively, the full collection of core genes and the full range of accessory genomes among strains within the species is the pangenome of the species.
[0047] In some embodiments, the Dolosigranulum bacterial strains provided herein comprise a bacteriocin. In some cases, a bacteriocin is a bacterial antagonism mechanism against pathogenic bacteria. In some cases, a population of D. pigrum herein comprises at least: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more bacteriocins. In some cases, a population of D. pigrum herein comprises at least 1 bacteriocin. In some cases, a population ofD. pigrum herein comprises at least 4 bacteriocins. In some cases, a bacteriocin comprises a class 1 bacteriocin or a class 2 bacteriocin. In some cases, a bacteriocin comprises enterocin beta, haloduracin alpha, macedovicin, mersacidin. pneumolancidin, propionicin, lactococcin, plantaricin, or any combination thereof. In some cases, a bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof.
[0048] In some embodiments, a composition herein can comprise a conditioned cell free media. In some cases, a conditioned cell free media can come from a Dolosigranulum bacterialstrain and / or a Corynebacterium bacterial strain. In some cases, a conditioned cell free media can come from a single bacterial strain or a plurality of bacterial strains. In some embodiments, the pharmaceutical composition comprises a condition cell free media of one or more strains of Dolosigranuliim pigrum listed in Table 1 and / or Table 32. In some cases, a conditioned cell free media can be from one or more D. pigrum strains comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-72. In some cases, a conditioned cell free media can be from a / J. pigrum strain with four 16s rRNA gene copies in its genome. In some cases, a conditioned cell free media can be from one or more of the following D. pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 34; a third strain, which comprises a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 63; a fourth strain, which comprises a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45; a fifth strain, which comprises a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 50; a sixth strain, which comprises a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6 or SEQ ID NO: 44; a seventh strain, which comprises a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7 or SEQ ID NO: 47; and an eighth strain, which comprises a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 8 or SEQ ID NO: 67. In some cases, a conditioned cell free media can be from a D. pigrum strain with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1. In some cases, a conditioned cell free media can be from a D. pigrum strain with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 34. In some cases, a conditioned cell free media can be from aD. pigrum strain with at least 97%, at least 98%, at least 99%. or 100% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 63. In some cases, a conditioned cell free media can be from a D. pigrum strain with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45. In some cases, a conditioned cell free media can be from aD. pigrum strain with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 50. In some cases,a conditioned cell free media can be from aD. pigrum strain with at least 97%, at least 98%, at least 99%. or 100% sequence identity to SEQ ID NO: 6 or SEQ ID NO: 44. In some cases, a conditioned cell free media can be from a D. pigrum strain with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7 or SEQ ID NO: 47. In some cases, a conditioned cell free media can be from aD. pigrum strain with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 8 or SEQ ID NO: 67. In some cases, the conditioned cell free media comprises a fraction of media that is less than 10 kDa or greater l OkDa in size. In some cases, the conditioned cell free media comprises an unfractionated media.
[0049] In some embodiments, provided herein are compositions having bacterial populations having one or more species, and one or more strains for each of the one or more species. In some instances, a composition described herein includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more species of bacteria. In some instances, a composition herein includes plurality of strains of a bacterial species. In some instances, a composition described herein includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more strains of bacteria.
[0050] In some embodiments, provided herein are bacterial populations comprising at least one species of Dolosigranulum. Further provided herein are bacterial populations comprising a plurality of strains of Dolosigranulum. In some embodiments, provided herein are bacterial populations comprising at least one strain of Dolosigranulum pigrum. Further provided herein are bacterial populations comprising a plurality of strains of Dolosigranulum. In some instances, a composition described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 of the D. pigrum strains listed in Table 1 and / or Table 32. In some embodiments, a population of bacteria described herein comprises a D. pigrum strain having a 16S rRNA gene sequence of at least 90, 91, 92, 93. 94. 95. 96. 97. 98. 99, or 100% sequence identity to that of a strain listed in Table 1 and / or Table 32. In some embodiments, a population of bacteria described herein comprises a D. pigrum strain having a 16S rRNA gene sequence of at least 97% sequence identity' with that of a strain listed in Table 1 and / or Table 32. The sequence identity' may be based on a 16S rRNA gene sequence, 16S rRNA gene hypervariable region sequence, such as V4, or whole genome sequence comparison. In some cases, a D. pigrum strain comprises 4 copies of 16s rRNA genes in its genome. In some cases, the one or more copies of 16s rRNA genes in the D. pigrum genome can be the same sequence or different sequences. In some cases, a D. pigrum strain in Table 1 and / or Table 32 comprises 4 copies of 16s rRNA genes in its genome (e.g., strains 01 A1; 02_B4; and 05_A8).
[0051] In some embodiments, the bacterial population is part of a pharmaceutical composition. In some embodiments, the bacteria is live and purified. In some embodiments, a composition described herein comprises one or more D. pigrum strains comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity7to any one of SEQ ID NOs: 1-72. In some embodiments, a composition described herein comprises a . pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-72. In some embodiments, a composition described herein comprises a D. pigrum strain comprising a 16S rRNA gene sequence with at least 98% sequence identity to any one of SEQ ID NOs: 1-72. In some embodiments, a composition described herein comprises a D. pigrum strain comprising a 16S rRNA gene sequence with at least 99% sequence identity to any one of SEQ ID NOs: 1-72. In some embodiments, a composition described herein comprises a D. pigrum strain comprising a 16S rRNA gene sequence comprising any one of SEQ ID NOs: 1-72. In some embodiments, a composition described herein comprises a D. pigrum strain comprising 4 copies of a 16S rRNA sequence (e.g.. strain O1_A1 and SEQ ID NOs: 1, and 11-13; strain 02_B4 and SEQ ID NOs: 14-17; and strain 05_A8 SEQ ID NOs: 19-22)
[0052] In some embodiments, the bacterial population is part of a pharmaceutical composition. In some embodiments, the bacteria is live and purified. In some embodiments, a composition described herein comprises a D. pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 11, 12, and / or 13. In some embodiments, a composition described herein comprises aD. pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%. at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 34. In some embodiments, a composition described herein comprises aD. pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3 or SEQ ID NO 63. In some embodiments, a composition described herein comprises a D. pigrum strain comprising a 16S rRNA gene sequence with at least 95%. at least 96%. at least 97%. at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45. In some embodiments, a composition described herein comprises and aD. pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 50. In some embodiments, a compositiondescribed herein comprises a / ). pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6 or SEQ ID NO: 44. In some embodiments, a composition described herein comprises aD. pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity' to SEQ ID NO: 7 or SEQ ID NO: 47. In some embodiments, a composition described herein comprises aD. pigrum strain comprising a 16S rRNA gene sequence with at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 8 or SEQ ID NO: 67.
[0053] In some embodiments, a composition described herein comprises at least 2 D. pigrum strains. In some cases, the at least 2 D. pigrum strains comprise D. pigrum strains selected from aD. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 11, 12, and / or 13, a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity' to SEQ ID NO: 2 or SEQ ID NO: 34, a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 63. aD. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45, and a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 50. In some embodiments, a composition described herein includes at least 2 D. pigrum strains. In some cases, the at least 2 D. pigrum strains comprise D. pigrum strains selected from a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 11, 12, and / or 13, a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%. at least 99%. or 100% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45, a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6 or SEQ ID NO: 44, and a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7 or SEQ ID NO: 47.
[0054] In some embodiments, a composition described herein includes a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity' to SEQ ID NO: 1, 11, 12, and / or 13. a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identityto SEQ ID NO: 2 or SEQ ID NO: 34, aD. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 63, aD. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45, and aD. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 50. In some embodiments, a composition described herein includes a D. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 11, 12, and / or 13, aD. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45, aD. pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6 or SEQ ID NO: 44, and a . pigrum strain comprising a 16S rRNA gene sequence with at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 7 or SEQ ID NO: 47.
[0055] Further provided herein are mixtures of live, purified Dolosigranulum bacterial strains affording various bacterial antagonism mechanisms to pathogenic bacteria.Table 1. Dolosigranulum strains
[0056] Further provided herein are bacterial populations comprising at least one species of Corynebacterium. Further provided herein are bacterial populations comprising a plurality of species of Corynebacterium. Corynebacterium are gram-stain-positive, non-spore forming and nonmotile bacteria. Exemplary- Corynebacterium species for inclusion in compositions described herein include: C. accolens, C. afermentans. C. ammoniagenes. C. amycolatum, C. argentoratense, C. aquaticum, C. auris, C. bovis, C. diphtheria, C. equi (now Rhodococcusequi), C. efficiens, C. flavescens, C. glucuronolyticum, C. glutamicum, C. granulosum, C. haemolyticum, C. halofytica. C. kroppenstedtii, C. jeikeium. C. macginleyi, C. matruchotii. C. minutissimum, C. parvum (Propionibacterium acnes C. paurometabolum, C. propinquum. C. pseudodiphtheriticum (C. hoftnannii), C. pseudotuberculosis, C. ovis, C. pyogenes — Trueperella pyogenes, C. urealyticum, C. renale, C. spec, C. striatum, C. tenuis, C. ulcerans, C. urealyticum. and C. xerosis. Further provided herein are bacterial populations comprising a plurality of strains of Corynebacterium. In some instances, a composition described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 of the Corynebacterium strains listed in Table 2. In some embodiments, a population of bacteria described herein comprises a Corynebacterium strain having a 16S rRNA gene sequence of at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity to that of a strain listed in Table 2. In some embodiments, a population of bacteria described herein comprises a Corynebacterium strain having a 16S rRNA gene sequence of at least 97% sequence identity with that of a strain listed in Table 2. In some embodiments, the sequence identity is based on a 16S rRNA gene sequence, 16S rRNA gene hypervariable region sequence, such as V4, or whole genome comparison. In some embodiments, the population of bactena is part of a pharmaceutical composition. In some embodiments, the bacteria is live and purified. Further provided herein are mixtures of live, purified Corynebacterium bacterial strains affording various bacterial antagonism mechanisms against pathogenic bacteria and / or supporting D. pigrum growth and colonization.Table 2. Corynebacterium strains
[0057] Further provided herein are populations of bacteria for colonization of the upper respiratory tract having a combination of strains including strains from different species. In some cases, further provided herein are populations of bacteria for colonization of an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above the vocal folds (cords), a lary nx below the vocal folds, a lower respiratory tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a oropharynx, the paranasal sinuses, a pharynx, a sinonasal cavity, a trachea, and / or a upper respiratory tract. In some embodiments, the populations of bacteria comprise at least one strain of Dolosigranulum, and optionally at least one strain of Corynebacterium. In some embodiments, the populations of bacteria comprise at least one strain of C. pseiidodiphtheriticum and at least one strain of D. pigrum. In some embodiments, the populations of bacteria comprise at least one strain listed in Table 1 and / or Table 32, and optionally at least one strain listed in Table 2. In some embodiments, the populations of bacteria comprise at least one strain having a 16S rRNA gene sequence of at least 97% sequence identity7with that of a strain listed in Table 1 and / or Table 32, and at least one strain having a 16S rRNA gene sequence of at least 97% sequence identity with that of a strain listed in Table 2. In further embodiments, 1, 2. 3 or more of the Dolosigranulum strains are D. pigrum strains. The population of bacteria may be part of a pharmaceutical composition. The bacteria may be live and purified. Compositions described herein may have mixtures of species. The mixtures may be up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more species and may include species listed in Table 1 and / or Table 2. Such species may be present in equal amounts or varied amounts. In some embodiments, each different species is present in at least 1%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 100% of the total colony forming units (CFUs) for the total CFUs for the population of bacteria. Compositions described herein may have mixtures of strains within a species. The mixtures may be up to 1. 2, 3, 4. 5, 6, 7. 8, 9, 10 ormore strains and may be from a species listed in Table 1, Table 32 and / or Table 2. Such strains may be present in equal amounts or varied amounts. In some embodiments, different strains are present in at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 100% of the total colony forming units (CFUs) for the total CFUs for the population of bacteria.
[0058] In some embodiments, a pharmaceutical composition herein comprises a mixture of Dolosigranulum pigruin strains that comprise at least about 40%. or at least about 45% of the total genes of the D. pigrum pangenome described herein. In some cases, a pharmaceutical composition herein comprises a mixture of Dolosigranulum pigrum strains that comprise at least about: 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the total genes of the D. pigrum pangenome described herein. In some cases, the pharmaceutical composition comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9 or more D. pigrum strains. In some cases, the pharmaceutical composition comprises at least about 3, 4, or 5 D. pigrum strains. In some cases, the D. pigrum strains comprise a 16S rRNA gene sequence with at least 99% sequence identity7to one or more of: SEQ ID NO: 1, 2, 3, 4, 5, 6. or 7.
[0059] In some embodiments, a pharmaceutical composition herein comprises a mixture of Dolosigranulum pigrum strains from at least 3 or 4 different core genome clades described herein. In some embodiments, a pharmaceutical composition herein comprises a mixture of Dolosigranulum pigrum strains from at least 1. 2, 3 or 4 different core genome clades described herein. In some cases, the pharmaceutical composition comprises at least about 1, 2, 3. 4, 5, 6, 7, 8, 9 or more D. pigrum strains. In some cases, the pharmaceutical composition comprises at least about 3, 4, or 5 D. pigrum strains. In some cases, the D. pigrum strains comprise a 16S rRNA gene sequence with at least 99% sequence identity to one or more of: SEQ ID NO: 1, 2, 3, 4, 5, 6. or 7.
[0060] Dolosigranulum is a gram-positive, non-spore-forming, facultatively anaerobic and non-motile bacterial genus from the family of Camobacteriaceae. Dolosigranulum pigrum is gram-positive, coccus arranged in pairs, tetrads, and clusters. Corynebacteria are Grampositive, non-motile, facultative anaerobes, characterized as having the appearance of straight or slightly curved slender rods with tapered or clubbed ends. Corynebacterium pseudodiphtheriticum, previously designated as Corynebacterium hofmannii, is anonlipophilic, nonfermentive, urease- and nitrate-positive Corynebacterium species, which is part of the respiratory tract bacterial microbiome. Corynebacterium accolens are gram positive rods, irregularly shaped (' coryneforms"). arranged as single cells, in pairs, in V forms, in palisades,or in clusters. Corynebacterium amycolatum, are Gram positive rods, irregularly shaped Ccoryneforms”). they are arranged as single cells, in pairs, in V forms, in palisades, or in clusters.
[0061] In some embodiments, the purified population of bacteria comprises no more than 10 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 9 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 8 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 7 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 6 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 5 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 4 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 3 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 2 antimicrobial resistance genes. In some embodiments, the purified population of bacteria comprises no more than 1 antimicrobial resistance genes. In some cases, the purified population of bacteria comprises 0 antimicrobial resistance genes. In some cases, an antimicrobial resistance gene comprises a glycopeptide antibiotic resistance gene (e.g., vanT, a vanY), an aminoglycoside antibiotic resistance gene, a tetracycline antibiotic resistance gene, a macrolide antibiotic resistance gene, an macrolide antibiotic resistance gene, a lincosamide antibiotic resistance gene, a streptogramin antibiotic resistance gene, a streptogramin A antibiotic resistance gene, a streptogramin B antibiotic resistance gene, a carbapenem resistance gene, an oxazolidinone antibiotic resistance gene, a phenicol antibiotic resistance gene, a diaminopyrimidine antibiotic resistance gene, or any combination thereof.
[0062] In some embodiments, when administered to a subject, bacterial populations described herein reduce or eliminate colonization in an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above the vocal folds (cords), a lary nx below the vocal folds, a lower respiratory' tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a oropharynx, the paranasal sinuses, a pharynx, a sinonasal cavity, a trachea, and / or a upper respiratory tract of pathogenic bacteria. In some embodiments, when administered to a subject, bacterial populations described herein reduce abundance in an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a lary nx above the vocal folds (cords), a lary nx below the vocal folds, a lower respiratory tract, a lung, a middle ear, a nasopharynx, the noseand nasal passages, a oropharynx, the paranasal sinuses, a pharynx, a sinonasal cavity, a trachea, and / or a upper respiratory tract of pathogenic bacteria. In some cases, reduction of colonization and / or abundance can be measured by the amount of pathogenic bacteria present before administration of the bacterial populations described herein as compared to the amount of pathogenic bacteria present after the administration of the bacterial populations described herein. In some cases, bacteria described herein are administered to kill and / or inhibit the growth of pathogenic bacteria in a subject. In some cases, bacteria described herein are administered to promote beneficial host immune responses that will kill and / or inhibit the growth of pathogenic bacteria in a subject. Exemplary' respiratory' tract pathogenic bacteria include, without limitation, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas aeruginosa, Haemophilus, influenzae, Moraxella catarrhalis, Moraxella nonliquefaciens, Acinetobacter baumannii, Haemophilus parainfluenzas, and Burkholderia pseudomallei. In some embodiments, one or more strains of D. pigrum individually or in combination inhibit the growth of Staphylococcus aureus, Acinetobacter baumannii, Pseudomonas aeruginosa, Moraxella catarrhalis, and / or Haemophilus influenzae. Exemplary strains of such pathogenic bactena are listed in Table 3. In some cases, such reduction of pathogenic bactena may be in an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above the vocal folds (cords), a larynx below the vocal folds, a lower respiratory' tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a orophary nx, the paranasal sinuses, a phary nx, a sinonasal cavity, a trachea, and / or a upper respiratory tract. In some embodiments, when administered to a subject, bacterial populations described herein reduce expression of genes associated with increased risk of viral infections. In some cases, when administered to a subject, bacterial populations described herein reduce pathogens that increase ACE2 and / or TMPRSS2 gene expression. In some cases, when administered to a subject, bacterial populations described herein alter the immune system of the host and create a favorable host innate immune profile. In some cases, a viral infection is caused by SARS-CoV-2 or a mutant thereof. In some cases, the viral infection is COVID-19 infection. In some cases, the genes associated with increased risk of viral infection are ACE2 and / or TMPRSS2. For example, a composition comprising D. pigrum is used to reduce expression of ACE2, TMPRSS2, or both genes in the respiratory tract.Table 3. Pathogenic bacteria2) Excipients, Dosage forms and routes of administrations
[0063] To facilitate administration, pharmaceutical compositions described herein may include one or more pharmaceutically acceptable excipients. Example pharmaceutically acceptable excipients include, without limitation, buffers, diluents, adjuvants, excipients, water, oils (including petroleum, animal, vegetable or synthetic oils.). In some cases, a buffer can comprise EPPS, HEPES, MOPS, Tris, or any combination thereof. In some cases, a buffer herein can be in a composition at a concentration of about 1-100 mM, or about 10 rnM, about 20 mM, about 25 mM, about 30 mM, about 40 mM. about 50 mM. about 60 mM, about 70 mM, about 75 mM, about 80 mM, about 90 mM or about 100 mM. In some cases, a composition therein can comprise Cysteine HCL. In some cases, a composition herein can comprise apH of about: 6.5 to 11, 7 to 10.5, 8.9 to 9.4, or 8 to 9.5. In some cases, a composition herein can comprise a pH of about: 6.5, 6.6, 6.7. 6.8, 6.9, 7, 7.1. 7.2, 7.3, 7.4, 7.5. 7.6, 7.7, 7.8, 7.9, 8, 8.1. 8.2, 8.3, 8.4. 8.5, 8.6, 8.7. 8.8. 8.9, 9. 9.1. 9.2, 9.3. 9.4. 9.5, 9.6. 9.7. 9.8, 9.9, 10,10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, or 11. In some cases, the pH of a composition can be at room temperature or about 20 degrees Celsius to about 25 degrees Celsius. Further examples include saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, and urea. Such excipients may include binders such as ethyl cellulose, carboxymethylcellulose, microcrystalline cellulose, or gelatin; excipients such as starch, lactose, dextrose, or dextrins; disintegrating agents such as alginic acid, sodium alginate, Primogel, and cornstarch; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin, a flavoring agent such as peppermint, methyl salicylate or orange flavoring, or coloring agents. Further examples of excipients include polyethylene glycol, cyclodextrin, oils, or any other similar liquid carrier that may be formulated into a capsule. Still further examples of excipients include sterile diluents such as water, saline solution, physiological saline, Ringer's solution, isotonic sodium chloride, fixed oils such as synthetic mono or digylcerides, polyethylene glycols, glycerin, cyclodextrin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose, thickening agents, lubricating agents, and coloring agents. In some embodiments of the invention, the pharmaceutically acceptable carrier can comprise a growth medium that can support the growth and / or static existence of beneficial bacteria described herein in the context of the pharmaceutical composition prior to administration of the pharmaceutical composition to the subject.
[0064] In some instances, a pharmaceutical composition described herein includes materials capable of modifying the physical form of a dosage unit. For example, various dosage forms described herein are illustrated in FIG. 11 for oral 101 and / or intranasal 102 administration. Dosage forms for compositions described herein include a nebulizer or inhaler 103 for aerosol administration, liquid 104 and capsule 105 for oral administration, and a spray bottle 106 for intranasal administration. In some instances, a pharmaceutical composition described herein is located within a nasal spray bottle. In some instances, a pharmaceutical composition described herein is prepared as an aerosol. Aerosols encompass a variety of systems including colloids and pressurized packages. Delivery of a composition in this form may include propulsion of a pharmaceutical composition including the beneficial bacteria described herein through use of liquefied gas or other compressed gas or by a suitable pump system. Aerosols may be delivered in single phase, bi-phasic, or triphasic systems. Compositions, includingpharmaceutical compositions, described herein may be formulated depending on the route of administration. Such forms include, without limitation, solutions, suspensions, emulsions, cream, gel, lotion, ointment, tablets, tabs, films, pills, pellets, capsules, capsules including liquids, powders, sustained-release formulations, directed release formulations, lyophylates (generated by freeze drying), emulsions, aerosols, sprays, granules, powders, or syrups. Dosage forms may be, without limitation, liquid, a solid, semisolid, gel, or aerosol. Methods of administration include, but are not limited to, oral, intranasal, topical, or by inhalation. Pharmaceutical compositions described herein may include kits where bacteria described herein are included in a first container (e.g., lyophilized cells), and one or more pharmaceutical acceptable excipients are included in a second container (e.g., water). In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria that comprises: one or more strains of Dolosigranulum pigrum and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria that comprises: one or more strains of Corynehacterium pseudodiphtheriticunr. and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria that comprises: one or more species of Dolosigranulum.' and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria that comprises: one or more strains of Corynehacterium pseudodiphtheriticum,' and one or more strains of Dolosigranulum pigrum and; and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria present in a total amount of at least 10A3 CFU that comprises: a strain of Dolosigranulum pigrum,' and optionally, a strain of Corynehacterium pseudodiphtheriticum,' and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. Further provided herein are kits, wherein the live, purified, and lyophilized population of bacteria is present in a total amount of up to 10A15 CFU. Further provided herein are kits,wherein the live, purified, and lyophilized population of bacteria is present in a total amount of 10A3 to 10A15 CFU.
[0065] In some embodiments, a kit herein comprises a first container comprising one or more of the following live and purified Dolosigrcmiihim pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2 or SEQ ID NO: 34; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 63; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4 or SEQ ID NO: 45; a fifth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 5 or SEQ ID NO: 50; a sixth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity’ to SEQ ID NO: 6 or SEQ ID NO: 44; a seventh strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 7; and an eighth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 8 or SEQ ID NO: 67, wherein the live and purified Dolosigranulum pigrum are lyophilized; and a second container comprising a distilled water.
[0066] Dosing may include single or multiple administrations of pharmaceutical compositions described herein. Examples include: multiple times a day. daily, even' other day, 1, 2, 3, 5, 6. or 7 times a week, weekly, or less often, a single administration, a course of treatment involving several treatments on a regular or irregular basis, or multiple administrations for a period of time until a diminution of colonization is achieved. In some cases, dosing can occur every day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks. 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, or as needed. The dosing regimen, including the regularity' of and mode of administration, may be dependent on factors including but not limited to the subject being treated; the severity' of the condition; the manner of administration, the stage of colonization, the presence of one or more other conditions such as pregnancy, infancy, or the presence of one or more additional diseases. In some embodiments, the subject is an infant. The infant can be up to 24 months old. In some embodiments, the subject is a child. The child may be 2 years to 21 years old. In some embodiments, the subject is an adult. Adults may be 21 years old or more. In some embodiments, the adult is of advanced age, such as 65 years or older.
[0067] Compositions, including pharmaceutical compositions, described herein may comprise a single (unit) dose of bacteria. Compositions described herein may comprise about102to about 1015colony forming units (CFU) of bacteria or a bacterial strain described herein. Compositions described herein may comprise about 102to about 1012colony forming units (CFU) of bacteria or a bacterial strain described herein. Compositions described herein may comprise about: 102to 1012CFU, 103to 1012CFU, 103to 1011CFU. 103to IO10CFU, 103to 109CFU, 103to 108CFU. 103to 107CFU, 103to 106CFU, 103to about 105CFU, 103to 104CFU, 104to 1012CFU, 104to 1011CFU, 104to 1010CFU, 104to 109CFU, 104to 108CFU, 104to 107CFU, 104to 106CFU, 105to 1012CFU, 105to 1011CFU, about 105to about IO10CFU, 106to 1012CFU, 107to 1012CFU, 108to 1012CFU, 109to 1012CFU, IO10to 1012CFU, 1011to 1012CFU, or 106to IO10CFU of bacteria or a bacterial strain described herein. In some embodiments, compositions comprise about 103CFU, about 104CFU, about 105CFU, about 106CFU, about 107CFU, about 108CFU, about 109CFU, about IO10CFU, about 1011CFU, or about 1012CFU of bacteria or a bacterial strain described herein.
[0068] Compositions, including pharmaceutical compositions, described herein may comprise 102to 1015colony forming units (CFU) of bacteria or a bacterial strain described herein per mL. Compositions described herein may comprise about 102to 1012CFU, 103to 1012CFU, 103to 1011CFU, 103to IO10CFU, 103to 109CFU, 103to 108CFU, 103to 107CFU,103to 106CFU, 103to about 105CFU, 103to 104CFU, 104to 1012CFU, 104to 1011CFU, 104to IO10CFU. 104to 109CFU, 104to 108CFU, 104to 107CFU, 104to 106CFU, 105to 1012CFU, 105to 1011CFU, about 105to about IO10CFU, 106to 1012CFU, 107to 1012CFU, 108to 1012CFU, 109to 1012CFU, IO10to 1012CFU, 1011to 1012CFU, or 106to IO10CFU of bacteria or a bacterial strain described herein per mL.
[0069] Compositions described herein may comprise may at least about 0.01 % by weight, at least about 0.05% by weight, at least about 0. 1 % by weight, at least about 0.2% by weight, at least about 0.3% by weight, at least about 0.4% by weight, at least about 0.5% by weight, at least about 0.6% by weight, at least about 0.7% by weight, at least about 0.8% by weight, at least about 0.9% by weight, at least about 1.0% by weight, at least about 1.5% by weight, at least about 2.0% by weight, at least about 3.0% by weight, at least about 4.0% by weight, at least about 5.0% by weight, at least about 6.0% by weight, at least about 7.0% by weight, at least about 8.0% by weight, at least about 9.0% by weight, at least about 10.0% by weight, at least about 11.0% by weight, at least about 12.0% by weight, at least about 13.0% by weight, at least about 14.0% by weight, at least about 15.0% by weight, at least about 16.0% by weight,at least about 17.0% by weight, at least about 18.0% by weight, at least about 19.0% by weight, at least about 20.0% by weight, at least about 25.0% by weight, at least about 30.0% by weight, at least about 35.0% by weight, at least about 40.0% by weight, at least about 45.0% by weight, or at least about 50.0% by weight of bacteria or bacterial strain described herein. In some embodiments, compositions can include from 0.01 % to 30% by weight, from about 0.01 % to 20% by weight, from 0.01 % to 5% by weight, from 0.1 % to 30% by weight, from 0.1 % to 20% by weight, from 0. 1 % to about 15% by weight, from 0.1 % to 10% by weight, from 0. 1 % to 5% by weight, from 0.2% to 5% by weight, from 0.3% to 5% by weight, from 0.4% to 5% by weight, from 0.5% to 5% by weight, or from 1% to 5% by weight of bacteria or bacterial strain described herein.
[0070] Compositions described herein may comprise may at least about 0.01 % by total CFU, at least about 0.05% by total CFU, at least about 0. 1 % by total CFU, at least about 0.2% by total CFU, at least about 0.3% by total CFU, at least about 0.4% by total CFU, at least about 0.5% by total CFU, at least about 0.6% by total CFU, at least about 0.7% by total CFU, at least about 0.8% by total CFU, at least about 0.9% by total CFU, at least about 1.0% by total CFU, at least about 1.5% by total CFU, at least about 2.0% by total CFU, at least about 3.0% by total CFU, at least about 4.0% by total CFU, at least about 5.0% by total CFU, at least about 6.0% by total CFU, at least about 7.0% by total CFU, at least about 8.0% by total CFU, at least about 9.0% by total CFU, at least about 10.0% by total CFU, at least about 11.0% by total CFU, at least about 12.0% by total CFU, at least about 13.0% by total CFU. at least about 14.0% by total CFU, at least about 15.0% by total CFU, at least about 16.0% by total CFU, at least about 17.0% by total CFU, at least about 18.0% by total CFU, at least about 19.0% by total CFU, at least about 20.0% by total CFU, at least about 25.0% by total CFU, at least about 30.0% bytotal CFU, at least about 35.0% by total CFU, at least about 40.0% by total CFU, at least about 45.0% by total CFU, or at least about 50.0% by total CFU of bacteria or bacterial strain described herein. In some embodiments, compositions can include from 0.01 % to 30% by total CFU, from about 0.01 % to 20% by total CFU, from 0.01 % to 5% by total CFU, from 0.1 % to 30% by total CFU, from 0. 1 % to 20% by total CFU, from 0.1 % to about 15% by total CFU, from 0.1 % to 10% by total CFU, from 0.1 % to 5% by total CFU. from 0.2% to 5% by total CFU, from 0.3% to 5% by total CFU, from 0.4% to 5% by total CFU, from 0.5% to 5% by total CFU, or from 1% to 5% by total CFU of bacteria or bacterial strain described herein.
[0071] Compositions, including pharmaceutical compositions, described herein may comprise a ratio (CFU to CFU) of about: 1: 1. 1:2, 1 :3, 1:4. 1:5, 1:6, 1 :7. 1 :8, 1 :9, 1: 10, 1:20,1:30, 1 :40, 1 :50, 1:60, 1:70, 1 :80, 1 :90, 1: 100, 1 :200, 1:300, 1:400, 1 :500, 1:600, 1 :700, 1:800, 1:900 or about 1: 1000 of a strain in Table 1 or Table 32 to another strain in Table 1 or Table 32 or a strain in Table 2 to another strain in Table 2. Compositions, including pharmaceutical compositions, described herein may comprise a ratio (CFU to CFU) of about: 1 :1, 1 :2, 1:3, 1:4, 1:5, 1 :6, 1:7, 1:8, 1 :9, 1: 10, 1:20, 1:30, 1:40, 1:50, 1 :60, 1 :70, 1:80, 1:90, 1: 100, 1:200, 1 :300, 1:400, 1 :500, 1:600, 1 :700, 1:800, 1:900 or about 1:1000 of a strain in Table 1 or Table 32 to a strain in Table 2. Compositions, including pharmaceutical compositions, described herein may comprise a ratio (CFU to CFU) of about: 1 : 1, 1 :2, 1 :3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8, 1 :9, 1 :10, 1:20, 1 :30, 1:40, 1 :50, 1 :60, 1 :70, 1:80, 1:90, 1 :100, 1:200, 1:300, 1:400, 1:500, 1 :600, 1 :700, 1:800, 1:900 or about 1: 1000 of multiple strains of Dolosigranulum pigrum and / or Corynebacteri um .3) Conditions
[0072] In some embodiments, provided herein are compositions for the prevention or treatment of a condition of the respiratory tract. As described in more detail herein, such conditions are of the upper and / or lower respiratory tract. As described in more detail herein, such conditions are of the an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above the vocal folds (cords), a larynx below the vocal folds, a lower respiratory tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a oropharynx, the paranasal sinuses, a pharynx, a sinonasal cavity, a trachea, and / or a upper respiratory' tract. The upper airways or upper respiratory’ tract generally includes the nose and nasal passages, paranasal sinuses, the pharynx, and the portion of the larynx above the vocal folds (cords). The lower airways or lower respiratory' tract generally includes the portion of the lary nx below the vocal folds, trachea, and the bronchi, bronchioles, and alveoli, which make up the lungs. These structures pull in air from the upper respiratory system, absorb the oxygen, and release carbon dioxide in exchange. In some embodiments, compositions described comprise beneficial bacteria present in an amount sufficient for reducing colonization by pathogenic bacteria. In some embodiments, the condition relates to a bacterial infection. Pharmaceutical compositions described herein can be used to prevent or treat bacterial infections caused by, without limitation, S. aureus (including methicillin-resistant S. aureus (MRSA) and methicillinsensitive 5. aureus (MSSA)), S. pneumoniae, P. aeruginosa, A. baumannii. M. catarrhalis, H. influenzae, H. parainfluenza, M. nonliquefaciens, Burkholderia cepacia complex, Burkholderia pseudomallei, and Bordetella pertussis. Upper respiratory tract conditions for treatment or prevention following administration of a composition described herein include,without limitation, an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRSA or MSSA), and / or a tonsilitis. Lower respiratory tract conditions for treatment or prevention following administration of a composition described herein include, without limitation, an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MS SA), a lung transplant rej ection. a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital-acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary Ciliary' dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID- 19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Conditions of the ear and eustachian tube for treatment or prevention following administration of a composition described herein include, without limitation, an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, an otitis media w ith or without effusion, a recurrent bone infection, a post-surgical soft tissue infection, a post- surgical bone infection, and / or an infection in an immunosuppressed population. Additional conditions for treatment or prevention following administration of a composition described herein include a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, a pharmaceutical composition described herein is administered to a S. aureus positive subject, optionally prior to, receiving a ventilator therapy. In further embodiments, the subject is diagnosed with COVID. In some embodiments, a pharmaceutical composition described herein is administered to a coronavirus (CoV) positive subject (e.g.. SARS-CoV-2, SARS-CoV Tor2, and MERS-CoV), optionally prior to, receiving a ventilator therapy. In some embodiments, the asthma is childhood asthma, adult onset asthma, occupational asthma, severe asthma, or seasonal asthma. In some embodiments, a pharmaceutical composition described herein is administered for treatment of airway inflammation, acute infection, and / or chronic infection of an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above thevocal folds (cords), a larynx below the vocal folds, a lower respiratory tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a oropharynx, the paranasal sinuses, a pharynx, a sinonasal cavity, a trachea, and / or a upper respirator}' tract. In some embodiments, a pharmaceutical composition described herein is administered as treatment for a viral condition, or as an adjuvant to a therapy for treatment of a viral condition. In further embodiments, the virus is a virus of the respiratory tract. Exemplary virus of the respiratory tract include, without limitation, influenza A (e.g.. H1N1 and H1N5), influenza B. an adenovirus, respiratory syncytial virus (RSV), enterovirus (EVs), human rhinovirus (HRV), human metapneumovirus (HMPV), human bocavirus (HBoV), coronavirus (CoV) (e.g., SARS-CoV-2, SARS-CoV Tor2, and MERS-CoV), and parainfluenza virus (PIV). In some cases, a pharmaceutical composition herein can be administered to reduce the risk of COVID- 19 infection. In some cases, a pharmaceutical composition herein can be administered to reduce expression levels of genes associated with increased risk of COVID-19 infection. In some cases, expression levels are measured by quantitative reverse transcription PCR, RNA sequencing, a northern blot, or droplet digital PCR. In some cases, the genes associated with increased risk of COVID-19 infection include ACE2 and / or TMPRSS2. In some cases, a composition herein can be used to reduce the expression of ACE2 and / or TMPRSS2 proteins. In some cases, the expression of proteins can be measured by a Western Blot or immunoassays. Exemplary' therapies for viral conditions include, without limitation, oseltamivir, zanamivir, ribavirin, palivizumab, and aspirin. In some embodiments, a pharmaceutical composition described herein is administered to a SARS-CoV-2 positive subject, optionally prior to, receiving a ventilator therapy. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein comprises at least one species (or strain) listed in Table 1, Table 32, or Table 2. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. In some embodiments, a pharmaceutical composition described herein is administered to a subject having a respiratory' condition, optionally prior to, receiving a ventilator therapy. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory’ condition described herein comprises a strain of D. pigrum. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein comprises a strain of C. pseudodiphtheriticum. In some embodiments, a method for treating nasal colonization by at least one pathogenic microorganism in a subject is provided, the method comprising the steps of administering a pharmaceutical composition tothe subject, wherein the pharmaceutical composition comprises one or more Dolosigranulum strains listed in Table 1 and / or Table 32, and optionally, a Corynebacterium strain listed in Table 2. In some cases, the subject has a pathogenic infection or is at risk of developing a pathogenic infection. For example, a subject may have an influenza infection and may be administered a pharmaceutical composition herein to prevent a secondary bacterial infection. In another example, a subject may have a surgery and may be administered a pharmaceutical composition herein to prevent a bacterial infection. In some embodiments, a method for treating nasal colonization by at least one pathogenic microorganism in a subject is provided, the method comprising the steps of: administering an antibiotic to a subject and administering a pharmaceutical composition to the subject, wherein the pharmaceutical composition comprises one or more Dolosigranulum strains listed in Table 1 and / or Table 32, and optionally, a Corynebacterium strain listed in Table 2. In some embodiments, a method for treating nasal colonization by at least one pathogenic microorganism in a subject is provided, the method comprising the steps of: administering a pharmaceutical composition to the subject, wherein the pharmaceutical composition comprises one or more Dolosigranulum strains listed in Table 1 and / or Table 32, and a Corynebacterium strain listed in Table 2. In some embodiments, a method for treating nasal colonization by at least one pathogenic microorganism in a subject is provided, the method comprising the steps of: administering a pharmaceutical composition to the subj ect, wherein the pharmaceutical composition comprises mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. In some embodiments, provided herein are methods for reducing colonization of a subject’s anterior nares or sinonasal cavity by a pathogenic microorganism, the method comprising the steps of: administering to a subject having a pathogenic microorganism in the subject’s anterior nares or sinonasal cavity', a live, purified population of bacteria, wherein the live, purified population of bacteria comprises one or more strains of Dolosigranulum. Further provided herein are methods wherein the pathogenic microorganism comprises Staphylococcus aureus, Streptococcus pneumoniae, Acinetobacter baumannii, Moraxella catarrhalis, Haemophilus influenzae, or Pseudomonas aeruginosa, Burkholderia cepacia complex. Further provided herein are methods for reducing colonization of a subject’s anterior nares or sinonasal cavity by a pathogenic microorganism, the method comprising the steps of: administering to a subject having a pathogenic microorganism in the subject’s anterior nares or sinonasal cavity, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises one or more species of Corynebacterium. Further provided herein are methods wherein the pluralityof species of Corynebacterium comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein are methods wherein the pathogenic microorganism comprises Staphylococcus aureus. Streptococcus pneumoniae, Acinetobacter baumannii, Moraxella catarrhalis, Haemophilus influenzae, or Pseudomonas aeruginosa, Burkholderia cepacia complex.
[0073] In some embodiments, provided herein are compositions for the prevention or treatment of a condition of the respiratory tract. In some embodiments, provided herein are use of compositions in the manufacture of medicaments for the treatment of diseases, such as a condition of the respiratory tract. For example, compositions can be used to prevent and / or treat a respiratory infection, such as a viral or bacterial respiratory infection. In some cases, a composition herein can be used to prevent and / or treat respiratory tract inflammation. In some cases, inflammation can be inflammation of the middle ear, the upper respiratory tract, and / or the lower respirator}7tract. In some cases, inflammation can be inflammation of an alveoli, an anterior nares, a bronchi, a bronchioles, an eustachian tube, a larynx above the vocal folds (cords), a larynx below the vocal folds, a lower respiratory tract, a lung, a middle ear, a nasopharynx, the nose and nasal passages, a oropharynx, the paranasal sinuses, a pharynx, a sinonasal cavity, a trachea, and / or a upper respiratory tract. In some embodiments, compositions described herein comprise more or more strains from Table 1, Table 32 and / or optionally, one or more strains from Table 2. In some embodiments, compositions described herein comprise Mix 2 and optionally comprise a strain of C. pseudodiphtheriticum. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory infection described herein comprises one or more strains of D. pigrum and optionally one or more strains of C. pseudodiphtheriticum.
[0074] In some embodiments, provided herein are compositions and methods for the prevention or treatment of rhinosinusitis. In some embodiments, provided herein are composition for use in the treatment of diseases, such as sinusitis and chronic rhinosinusitis (CRS). In some embodiments, provided herein are use of compositions in the manufacture of medicaments for the prevention and / or treatment of diseases, such as sinusitis and chronic rhinosinusitis (CRS). In some embodiments, the sinusitis is acute sinusitis (generally swelling of the sinuses for 4 weeks or less), chronic sinusitis (generally swelling of the sinuses for over 3 months), or subacute sinusitis (generally swelling of the sinuses for 1 to 3 months). In some embodiments, provided herein are compositions and methods for the prevention or treatment of chronic rhinosinusitis (CRS) or sinusitis, swelling or inflammation of the lining of the sinus.In some embodiments, the CRS is with nasal polyps (CRSwNP). In some embodiments, the CRS is without nasal polyps (CRSsNP). In some embodiments, the method provides for a reduction in occurrence of nasal polyps in the subject. In some embodiments, provided herein are methods for a reduction in occurrences or severity of pain or pressure in the forehead, nose, or between the eyes in a subject administered a composition described herein. In some embodiments, provided herein are methods for a reduction in occurrences or severity of headache in a subject administered a composition described herein. In some embodiments, provided herein are methods for a reduction in occurrences or severity of nasal discharge in a subject administered a composition described herein. In some embodiments, provided herein are methods for a reduction in occurrences or severity of coughing in a subject administered a composition described herein. In some embodiments, a composition described herein is administered to a subject prior to or after the subject has received endoscopic sinus surgery. In some embodiments, the subject further has cystic fibrosis. In some embodiments, the subject has an at least 12 week history' of CRS. In some cases, the subject has an at least 2, 3, 4, 5. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19. or 20 week history' of CRS. In some embodiments, the subject has endoscopic evidence of CRS and / or evidence of CRS on CT scan. In some embodiments, the subject has polyploid tissue of Grade 1 or less. In some embodiments, the subject has polyploid tissue of Grade 2 or less. In some embodiments, the subject has polyploid tissue of Grade 3 or less. In some embodiments, the subject has polyploid tissue of Grade 4 or less. In some embodiments, the subject further has cystic fibrosis. In some embodiments, the subject further has a S. aureus infection. In some cases, the S. aureus infection is a recurrent S. aureus infection. In some embodiments, the subject further has aP. aeruginosa infection. In some cases, the P. aeruginosa infection is a recurrent P. aeruginosa infection In some embodiments, the composition provides for a reduction in inflammation in lung of the subject. In some embodiments, compositions described comprise beneficial bacteria present in an amount sufficient for a reduction in incidence of colonization of a pathogenic bacteria. In some embodiments, compositions described comprise beneficial bacteria present in an amount sufficient for a reduction in incidence of colonization of Staphylococcus aureus, Pseudomonas aeruginosa. Streptococcus pneumoniae, Haemophilus influenzae. Moraxella catarrhalis or any combination thereof. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein comprises at least one species (or strain) listed in Table 1, Table 32 or Table 2. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory conditiondescribed herein comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein comprises one or more strains of D. pigrum. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein comprises one or more species of Corynebacterium. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein comprises one or more strains of C. pseudodiphtheriticum. In some embodiments, a pharmaceutical composition used to treat or prevent a respiratory condition described herein, such as a CRS, comprises one or more strains of D. pigrum and optionally one or more strains of C. pseudodiphtheriticum.
[0075] In some embodiments, provided herein are methods of secondary prevention and / or treatment following a nasal surgery, a sinus surgery, an antibiotic therapy, a steroid therapy, an antibody therapy, a phage therapy, or any combination thereof. In some embodiments, an additional therapy can be administered to a subject, for example a steroid therapy, a vaccine therapy (e.g., an injectable or nasal vaccine), an antibiotic therapy, an antibody therapy, a phage therapy, or any combination thereof. In some embodiments, a composition described herein is administered to a subject prior to or after the subject has received an antibiotic, a steroid, a vaccine, an antibody, or a phage therapy. In some embodiments, a composition described herein is administered concurrently with an antibiotic, a vaccine, a steroid, an antibody, or a phage. In some cases, the antibiotic comprises a mupirocin. In some cases, the antibiotic comprises a macrolide. In some cases, the macrolide comprises an azithromycin, a clarithromycin, an erythromycin. In some cases, the macrolide comprises an fidaxomicin, dirithromycin. a carbomycin, a josamycin, a kitasamycin, a midecamycin, a midecamycin acetate, an oleandomycin, a solithromycin, a spiramycin, a troleandomycin. or a roxithromycin. In some cases, the steroid comprises a prednisone, a beclomethasone dipropionate, a triamcinolone acetonide, a flunisolide, a budesonide, a fluticasone propionate, a mometasone furoate, a ciclesonide, or a fluticasone furoate. In some cases, the antibody comprises a dupilumab, a omalizumab, a mepolizumab, a benralizumab, a ligelizumab, a reslizumab, a lebrikuzumab, a tralokinumab, a biosimilar of any of these, or any combination thereof. In some cases, the antibody comprises an antibody that selectively binds (a) IL-4 and / or IL-13, (B) IL-4, or (c) IgE.
[0076] In some embodiments, provided herein are compositions for the prevention or treatment of a condition of orophary nx, nasopharynx, eustachian tube, and the middle ear. Insome embodiments, provided herein are compositions for the prevention or treatment of a condition of the middle ear. In some embodiments, provided herein are methods of secondary prevention and / or treatment following a middle ear surgery, a tonsillectomy, an adenoidectomy, or any combination thereof. In some embodiments, provided herein are use of compositions in the manufacture of medicaments for the treatment of diseases, such as a condition of the oropharynx, nasopharynx, eustachian tube, and the middle ear. In some embodiments, provided herein are compositions for the prevention or treatment of otitis media (middle ear infection). In some embodiments, the otitis media is acute otitis media. Acute otitis media occurs suddenly, causes ear swelling and ear redness, traps fluid in the ear, and can result in fever and / or ear pain. In some embodiments, the otitis media is acute otitis media with effusion. Otitis media with effusion can provide mucus build up in the middle ear in a subject, and may negatively impact hearing (auditory perception) in a subject. In some embodiments, the otitis media is chronic otitis media. In some embodiments, the otitis media is chronic otitis media with effusion. In some embodiments, the otitis media is chronic otitis media without effusion. Chronic otitis media with effusion can provide mucus build up in the middle ear in a subject and may negatively impact hearing (auditory perception) in a subject. In some embodiments, the otitis media is chronic otitis suppurative media. Chronic suppurative otitis media can lead to both conductive and sensorineural hearing loss, with conductive hearing loss from tympanic membrane rupture and ossicular chain disruption and sensorineural hearing loss due to outer hair cell damaged by bacterial toxins impacting the inner ear. In some embodiments, compositions described comprise beneficial bacteria present in an amount sufficient for a reduction in incidence of colonization of a pathogenic bacteria. In some embodiments, compositions described herein comprise more or more strains from Table 1, Table 32 and / or optionally, one or more strains from Table 2. In some embodiments, pharmaceutical compositions described herein comprise Mix 2 and optionally comprise a strain of C. pseudodiphtheriticum. In some embodiments, a pharmaceutical composition used to treat or prevent a middle ear condition described herein comprises one or more strains of D. pigrum and optionally one or more strains of C. pseudodiphtheriticum.
[0077] In some embodiments, compositions described comprise beneficial bacteria present in an amount sufficient for a reduction in incidence of colonization of a pathogenic bacteria. In some embodiments, the condition relates to a bacterial infection. Sources for bacterial infections for prevention or treatment with pharmaceutical compositions described herein include, without limitation, S', aureus (including methicillin-resistant S’, aureus (MRSA) andmethicillin-sensitive S. aureus (MS SA)), S. pneumoniae, P. aeruginosa, A. baumannii, M. catarrhalis, Haemophilus influenzae, Haemophilus parainfluenzae, Bordetella pertussis, Burkholderia pseudomallei, and Burkholderia cepacia complex.
[0078] In some embodiments, a pharmaceutical composition described herein is administered as prevention and / or secondary prevention treatment for a viral respiratory infection. In some embodiments, a pharmaceutical composition described herein is administered as treatment for a viral respiratory infection. In some embodiments, a pharmaceutical composition described herein is administered as treatment for a viral condition, or as an adjuvant to a therapy for treatment of a viral condition. In further embodiments, the virus is a virus targeting the respiratory' tract. Exemplary' viruses targeting the respiratory tract include, without limitation, influenza A (e.g.. H1N1 and H1N5). influenza B, an adenovirus, respiratory syncytial virus (RSV), enterovirus (EVs), human rhinovirus (HRV), human metapneumovirus (HMPV), human bocavirus (HBoV), coronavirus (CoV) (e.g., SARS-CoV- 2, SARS-CoV Tor2, and MERS-CoV), and parainfluenza virus (PIV). Exemplary' therapies for viral conditions include, without limitation, oseltamivir, zanamivir, ribavirin, palivizumab, and aspirin. In some embodiments, a method for treating nasal colonization by at least one pathogenic microorganism in a subject is provided, the method comprising the steps of: administering a pharmaceutical composition to the subject, wherein the pharmaceutical composition comprises one or more Dolosigranulum strains listed in Table 1, Table 32, and a Corynebacterium strain listed in Table 2. In some embodiments, a method for treating nasal colonization by at least one pathogenic microorganism in a subject is provided, the method comprising the steps of: administering a pharmaceutical composition to the subject, wherein the pharmaceutical composition comprises one or more Dolosigranulum strains listed in Table 1 and / or Table 32, and optionally, a Corynebacterium strain listed in Table 2. In some embodiments, a method for treating nasal colonization by at least one pathogenic microorganism in a subject is provided, the method comprising the steps of: administering a pharmaceutical composition to the subj ect, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a pharmaceutical composition wherein the plurality of species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum.
[0079] In some embodiments, provided herein are pharmaceutical compositions, wherein the pharmaceutical compositions comprise: a live, purified population of bacteria, wherein the live,purified population of bacteria comprises one or more strains of Dolosigranulum pigrum', and a pharmaceutically acceptable excipient. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is formulated for intranasal administration. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is formulated for oral administration. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of up to 10Al 5 CFU. Further provided herein is a pharmaceutical composition, wherein the wherein the live, purified population of bacteria is present in a total amount of at least 10A3 cfu. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 CFU. Further provided herein is a pharmaceutical composition, wherein the strains of Dolosigranulum pigrum are selected from a strains listed in Table 1 and / or Table 32. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a pharmaceutical composition, wherein the strains of Dolosigranulum pigrum are selected from the strains described herein. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria comprises up to 10 strains. In some embodiments, provided herein is a method, comprising administering to a subject to a subject in need thereof, the pharmaceutical composition described herein, wherein the subject has a respirator}' condition and / or condition of the ear and eustachian tube. Further provided herein is a method, wherein the respirator}- condition is an upper respiratory condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRSA or MSSA), and / or a tonsilitis. Further provided herein is a method, wherein the respirator}7condition is an lower respiratory condition such as an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathicpulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary C iliary dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with or without effusion. Further provided herein is a method, wherein the condition is a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an upper respiratory tract condition, a lower respiratory tract condition, or a condition of the ear and eustachian tube described above in a subject.
[0080] In some embodiments, provided herein are pharmaceutical compositions, wherein the pharmaceutical compositions comprise: a live, purified population of bacteria that comprises: one or more strains of Dolosigranulum pigrum; and at least one strain or species of Corynebacterium; and a pharmaceutically acceptable excipient. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is formulated for intranasal administration. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is formulated for oral administration. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 CFU. Further provided herein is a pharmaceutical composition, wherein the wherein the live, purified population of bacteria is present in a total amount of at least 10A3 CFU. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 CFU. Further provided herein is a pharmaceutical composition, wherein the plurality of strains of Dolosigranulum pigrum areselected from a strains listed in Table 1 and / or Table 32. Further provided herein is a pharmaceutical composition, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the one or more Dolosigranulum pigrum is selected from the strains listed in Table 1 and / or Table 32 and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a pharmaceutical composition wherein the plurality of species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria comprises up to 10 strains. In some embodiments, provided herein is a method, comprising administering to a subject to a subject in need thereof, the pharmaceutical composition described herein, wherein the subject has a respiratory condition and / or a condition of the ear and eustachian tube. Further provided herein is a method, wherein the respiratory’ condition is an upper respiratory condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non- allergic rhinitis, an obstructive sleep apnea, a phary ngitis, an upper respiratory' tract infection (including infection with MRSA or MSSA), and / or a tonsilitis. Further provided herein is a method, wherein the respiratory condition is an lower respiratory condition such as an acute lung injury', an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary' disease (COPD), a cystic fibrosis, an idiopathic pulmonary’ fibrosis (IPF), an interstitial lung disease (ILD). a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community' acquired pneumonia (CAP)), a primary Ciliary' dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with or without effusion. Further provided herein is a method, wherein the condition is a recurrent softtissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an upper respiratory' tract condition, a lower respiratory' tract condition, or a condition of the ear and eustachian tube described above in a subject.
[0081] In some embodiments, provided herein are pharmaceutical compositions, wherein the pharmaceutical compositions comprise: a live, purified population of bacteria present in a total amount of at least 10A3 CFU, and wherein the live, purified population of bacteria comprises: a strain of Dolosigranulum pigrum and optionally a strain or species of Corynebacterium; and a pharmaceutically acceptable excipient, wherein the pharmaceutical composition is formulated for intranasal administration. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu. Further provided herein is a pharmaceutical composition, wherein the Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a pharmaceutical composition, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a pharmaceutical composition wherein the plurality of species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum. C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria comprises up to 10 strains. In some embodiments, provided herein is a method, comprising administering to a subject to a subject in need thereof, the pharmaceutical composition described herein, wherein the subject has a respiratory condition and / or condition of the ear and eustachian tube. Further provided herein is a method, wherein the respiratory condition is an upper respiratory condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non-allergicrhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRSA or MSSA), and / or a tonsilitis. Further provided herein is a method, wherein the respiratory condition is an lower respiratory condition such as an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary Ciliary dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with or without effusion. Further provided herein is a method, wherein the condition is a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an upper respiratory tract condition, a lower respiratory tract condition, or a condition of the ear and eustachian tube described above in a subject.
[0082] In some embodiments, provided herein are pharmaceutical compositions, wherein the pharmaceutical compositions comprise: a live, purified population of bacteria present in a total amount of at least 10A3 CFU, and wherein the live, purified population of bacteria compnses: one or more strains of Dolosigranulum pigrum and optionally a strain or species of Corynebacterium; and a pharmaceutically acceptable excipient, wherein the pharmaceutical composition is formulated for oral administration. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 CFU. Further provided herein is a pharmaceutical composition, wherein the wherein the live, purified population of bacteria is present in a total amount of at least 10A3 CFU. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 CFU. Further provided herein is apharmaceutical composition, wherein the one or more strains of Dolosigranulum pigrum are selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a pharmaceutical composition, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the one or more strains of Dolosigranulum pigrum are selected from a strain listed in Table 1 and / or Table 32 and, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a pharmaceutical composition wherein the plurality of species of Corynebacterium comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a pharmaceutical composition, wherein the live, purified population of bacteria comprises up to 10 strains. In some embodiments, provided herein is a method, comprising administering to a subject to a subject in need thereof, the pharmaceutical composition described herein, wherein the subject has a respiratory condition and / or condition of the ear and eustachian tube. Further provided herein is a method, wherein the respiratory condition is an upper respiratory condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non- allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRSA or MSSA), and / or a tonsilitis. Further provided herein is a method, wherein the respiratory condition is an lower respiratory condition such as an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory7Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary Ciliary dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with orwithout effusion. Further provided herein is a method, wherein the condition is a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an upper respiratory tract condition, a lower respiratory tract condition, or a condition of the ear and eustachian tube described above in a subject.
[0083] In some embodiments, provided herein are methods for microbiome modification in a subject, comprising administering to a subject in need thereof: a population of purified, live bacteria comprising at least one strain of bacteria present in an amount sufficient for prevention or treatment of a lung condition, wherein the at least one strain of bacteria is isolated from upper respirator}' tract of a donor. In some embodiments, provided herein are methods for treatment of an inflammatory lung condition, comprising administering to a subject having an inflammatory lung condition: a population of purified, live bacteria comprising at least one strain of bacteria present in an amount sufficient for reduction in incidence of colonization of a pathogenic bacterium in the nasal cavity, wherein the at least one strain of bactena is isolated from upper respirator}' tract of a donor. Further provided herein are methods, wherein the pathogenic bacterium comprises Staphylococcus aureus, Streptococcus pneumoniae, Acinetobacter baumannii, Moraxella catarrhalis, Haemophilus influenzae, or Pseudomonas aeruginosa. Further provided herein are methods, wherein the pathogenic bacterium is a strain listed in Table 3. In some embodiments, provided herein are methods for treatment of an airway inflammatory condition, comprising: administering to a subject in need thereof, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum,' and optionally a one or more strains or species of C orynebacterium. Further provided herein is a method, wherein the one or more Dolosigranulum pigrum strains are selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein one or more strains of Corynebacterium are selected from a strain listed in Table 2. Further provided herein is a method, wherein the one or more Dolosigranulum pigrum strains are selected from a strain listed in Table 1 and / or Table 32, and wherein the one or more strains of Corynebacterium are selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the plurality of species ofCorynebacteriiim comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the airway condition is an upper respirator}' condition, a lower respiratory condition, and / or condition of the ear and eustachian tube. Further provided herein is a method, wherein the airway condition is an upper respiratory' condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, anon-allergic rhinitis, an obstructive sleep apnea, a phary ngitis, an upper respiratory tract infection (including infection with MRS A or MSS A), and / or a tonsilitis. Further provided herein is a method, wherein the airway condition is an lower respiratory condition such as an acute lung injury, an acute respiratory' distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary' disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory' Syndrome (MERS). a pneumonia (including hospital-acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary' Ciliary' dyskinesia, a Severe acute respiratory' syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with or without effusion. Further provided herein is a method, wherein the condition is a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an airway condition and / or or a condition of the ear and eustachian tube described above in a subject. Further provided herein is a method, wherein the bacterial population is administered intranasally. Further provided herein is a method, wherein the bacterial population is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteriais present in a total amount of up to 10Al 5 CFU. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 CFU.
[0084] In some embodiments, provided herein are methods for treatment of a lower respiratory tract condition, comprising: administering to a subject having a lower respiratory tract infection, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: a strain of Dolosigranulum pigrum; and optionally a strain or species of Corynebacterium. In some embodiments, provided herein is a method for treating an airway inflammatory condition, comprising: administering to a subject in need thereof, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: one or more strains of Dolosigranulum pigrum; and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the one or more Dolosigranulum pigrum strains are selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the one or more Dolosigranulum pigrum strains are selected from a strain listed in Table 1 and / or Table 32, and wherein the one or more strains of Corynebacterium are selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the plurality of species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum. C. propinquum, C. glutamicum. or C. striatum. Further provided herein is a method, wherein the airway condition is an upper respiratory condition, a lower respiratory condition, and / or condition of the ear and eustachian tube. Further provided herein is a method, wherein the airway condition is an upper respiratory condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory' tract infection (including infection with MRS A or MSSA), and / or a tonsilitis. Further provided herein is a method, wherein the airway condition is an lower respiratory condition such as an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory’ tract infection (including infection withMRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital-acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary Ciliary dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with or without effusion. Further provided herein is a method, wherein the condition is a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an airway condition and / or or a condition of the ear and eustachian tube described above in a subject. Further provided herein is a method, wherein the live, purified population of bacteria is administered intranasally. Further provided herein is a method, herein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10Al 2 cfu.
[0085] In some embodiments, provided herein is a method for treating an airway inflammatory condition, comprising: administering to a subject in need thereof, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: one or more strains of Dolosigranulum pigrum: and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the one or more Dolosigranulum pigrum strains are selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the one or more strains of Corynebacterium are selected from a strain listed in Table 2. Further provided herein is a method, wherein the one or more Dolosigranulum pigrum strains are selected from a strain listed in Table 1, and / or Table 32, and wherein the one or more strains of Corynebacterium are selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C.pseudodiphtheriticum. Further provided herein is a method wherein the plurality of species of Corynebacterium comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the airway condition is an upper respirator}' condition, a lower respirator}' condition, and / or condition of the ear and eustachian tube. Further provided herein is a method, wherein the airway condition is an upper respiratory condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, anon-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respirator}' tract infection (including infection with MRS A or MS SA), and / or a tonsilitis. Further provided herein is a method, wherein the airway condition is an lower respiratory condition such as an acute lung injury, an acute respiratory’ distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respirator}' Syndrome (MERS), a pneumonia (including hospital-acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community' acquired pneumonia (CAP)), a primary' Ciliary' dyskinesia, a Severe acute respiratory' syndrome (SARS), a COVID- 19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with or without effusion. Further provided herein is a method, wherein the condition is a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an airway condition and / or or a condition of the ear and eustachian tube described above in a subject. Further provided herein is a method, wherein the live, purified population of bacteria is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein isa method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10Al 5 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10 12 cfu.
[0086] In some embodiments, provided herein are methods for treatment of an airway inflammatory condition, comprising: administering to a subject having an airway inflammatory condition, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: one or more strains of Dolosigrcmulum pigrum. In some embodiments, provided herein is a method for treating an airway inflammatory' condition, comprising: administering to a subject in need thereof, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: a one or more strains of Dolosigrcmulum pigrum; and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the one or more Dolosigrcmulum pigrum strains are selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the one or more strains of Dolosigranulum pigrum are selected from a strain listed in Table 1 and / or Table 32, and wherein the one or more strains of Corynebacterium are selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the plurality of species of Corynebacterium comprises C. accolens C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the airway condition is an upper respiratory' condition, a lower respiratory condition, and / or condition of the ear and eustachian tube. Further provided herein is a method, wherein the airway condition is an upper respiratory condition such as an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non- allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRSA or MSSA), and / or a tonsilitis. Further provided herein is a method, wherein the airway condition is an lower respiratory condition such as an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an aty pical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathicpulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary C iliary dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, and / or a whooping cough (pertussis). Further provided herein is a method, wherein the condition is a condition of the ear and eustachian tube such as an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, and / or an otitis media with or without effusion. Further provided herein is a method, wherein the condition is a recurrent soft tissue infection, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in immunosuppressed populations (e.g., patients receiving chemotherapy). In some embodiments, provided herein is use of the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of an airway condition and / or or a condition of the ear and eustachian tube described above in a subject. Further provided herein is a method, wherein the live, purified population of bacteria is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, w herein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0087] In some embodiments, provided herein are methods for treatment of asthma, comprising: administering to a subject having asthma a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum and optionally, at least one species or strain of Corynebacterium. Further provided herein is a method, wherein the at least one strain of Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the at least one strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least one strain Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32, and wherein the at least one strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is apharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the plurality of species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the live, purified population of bacteria is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0088] In some embodiments, provided herein are methods for treatment of a viral infection condition, comprising: administering to a subject having a viral infection a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the viral infection is influenza A, influenza B, an adenovirus, respiratory syncytial virus (RSV), enterovirus (EVs), human rhino virus (HRV), human metapneumo virus (HMPV), human bocavirus (HBoV), coronavirus (CoV), or parainfluenza virus (PIV). In some cases, the coronavirus comprises SARS-CoV-2 or a mutated virus thereof. Further provided herein is a method, wherein the live, purified population of bacteria is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further providedherein is a method, wherein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10Al 5 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10 12 cfu.
[0089] In some embodiments, provided herein are methods for treatment of idiopathic pulmonary fibrosis, comprising: administering to a subject having idiopathic pulmonary fibrosis a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the bacterial population is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0090] In some embodiments, provided herein are methods for treatment of MRSA, comprising: intranasally or orally administering to a subject having MRSA (MRSA-positive) a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. In some embodiments, provided herein are methods for the prevention or secondary prevention of MRSA infection, comprising: intranasally or orallyadministering to a subject at risk for MRS A infection or is a MRS A carrier (MRSA-positive) a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. In some cases, a subject at risk for a MRS A infection may be a subject that is scheduled to have a surgery'. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10Al 5 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0091] In some embodiments, provided herein are methods for treatment of MS SA, comprising: intranasally or orally administering to a subject having MSAA (MSSA-positive) a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum. and optionally at least one strain or species of Corynebacterium. In some embodiments, provided herein are methods for the prevention or secondary prevention of MSSA, comprising: intranasally or orally administering to a subject at risk for MS SA infection oris a carrier of MSSA (MSSA-positive) alive, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least oneDolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolalum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein is a method, wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10' 12 cfu.
[0092] In some embodiments, provided herein are methods for treatment of pneumonia, comprising: intranasally or orally administering to a subject having pneumonia a live, purified population of bacteria present in an amount of at least 10A3 cfu, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum. and optionally at least one strain or species of Corynebacterium. In some embodiments, provided herein are methods for the prevention or secondary prevention of pneumonia, comprising: intranasally or orally administering to a subject at risk for pneumonia or has pneumonia a live, purified population of bacteria present in an amount of at least 10A3 cfu, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subject is a child. Further provided herein is a method.wherein the subject is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10Al 2 cfu. Further provided herein are methods wherein the pneumonia is pneumonia is hospital-acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), or community acquired pneumonia (CAP).
[0093] In some embodiments, provided herein are methods for treatment of rhinitis, comprising: administering to a subject having rhinitis a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the bacterial population is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subj ect is a child. Further provided herein is a method, wherein the subj ect is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10Al 5 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10Al 2 cfu.
[0094] In some embodiments, provided herein are methods for treatment of COPD, comprising: administering to a subject having COPD a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain isselected from a strain listed in Table and / or Table 321. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the bacterial population is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Further provided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subj ect is a child. Further provided herein is a method, wherein the subj ect is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0095] In some embodiments, provided herein are methods for treatment of cystic fibrosis, comprising: administering to a subject having cystic fibrosis a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: at least one strain of Dolosigranulum pigrum, and optionally at least one strain or species of Corynebacterium. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a pharmaceutical composition, wherein the pharmaceutical composition comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the bacterial population is administered intranasally. Further provided herein is a method, wherein the live, purified population of bacteria is administered orally. Furtherprovided herein is a method, wherein the subject is an infant. Further provided herein is a method, wherein the subj ect is a child. Further provided herein is a method, wherein the subj ect is an adult. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10Al 5 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0096] In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria that comprises: one or more strains of Dolosigranulum pigrum,' and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. Further provided herein is a kit, wherein the at least one Dolosigranulum pigrum strain is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a kit, wherein the kit comprises Mix 2 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein is a kit, wherein the kit comprises Mix 1 and optionally comprises a strain of C. pseudodiphtheriticum. Further provided herein are kits, wherein the live, purified, and lyophilized population of bacteria is present in an amount sufficient for treatment of a respiratory condition. Further provided herein are kits, wherein the live, purified, and lyophilized population of bacteria is present in a total amount of up to I0A15 cfu. Further provided herein are kits, wherein the live, purified, and lyophilized population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0097] In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria that comprises: one or more strains of Dolosigranulum pigrum,' and one or more strains or species of Corynebacterium and; and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. Further provided herein is a kit, wherein the Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a kit, wherein the Dolosigranulum pigrum is selected from a strain listed in mix 1 or mix 2. Further provided herein is a kit, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a kit wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum. C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein are kits, wherein the live, purified, and lyophilized population of bacteria is present in an amount sufficient for treatment of a respiratory condition. Further provided herein are kits, wherein the live, purified, andlyophilized population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are kits, wherein the live, purified, and lyophilized population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
[0098] In some embodiments, provided herein are kits, wherein the kit comprises: a first container, wherein the first container comprises live, purified, and lyophilized population of bacteria present in a total amount of at least 10A3 cfu that comprises: one or more strains of Dolosigranulum pigrum and optionally a strain or species of Corynebacterium; and a second container, wherein the second container comprises a pharmaceutically acceptable excipient. Further provided herein is a kit, wherein the one or more strains of Dolosigranulum pigrum are selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a kit, wherein the one or more strains of Dolosigranulum pigrum are selected from a strain listed in mix 1 or mix 2. Further provided herein is a kit, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a kit wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein are kits, wherein the live, purified, and lyophilized population of bacteria is present in an amount sufficient for treatment of a respirator}7condition.
[0099] In some embodiments, provided herein are methods for microbiome modification in a subject, comprising: intranasally administering to a subject in need thereof: a population of purified, live bacteria comprising at least one strain of bacteria present in an amount sufficient for the microbiome modification in the subject, wherein the at least one strain of bacteria is isolated from upper respiratory' tract of a donor. In some cases, the at least one strain of bacteria comprises a strain of Dolosigranulum pigrum and optionally a strain or species of Corynebacterium. Further provided herein are methods, wherein the live, purified population of bacteria (e.g., Dolosigranulum pigrum) is administered intranasally. Further provided herein are methods, wherein the live, purified population of bacteria is administered orally. Further provided herein are methods, wherein the subject is an infant. Further provided herein are methods, wherein the subject is a child. Further provided herein are methods, wherein the subject is an adult. Further provided herein are methods, wherein the adult is 65 years or older. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10Al 5 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu. Further provided herein is a method, wherein the Dolosigranulum pigrum is selected from a strainlisted in Table 1 and / or Table 32. Further provided herein is a method, wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the method comprises administering mix 2 and optionally comprises administering a strain of C. pseudodiphtheriticum. Further provided herein is a method, wherein the method comprises administering mix 1 and optionally comprises administering a strain of C. pseudodiphtheriticum.[000100] In some embodiments, provided herein are methods for treatment of a neurological infection, comprising: administering to a subject having a neurological infection, a live, purified population of bacteria, wherein the live, purified population of bacteria comprises: one or more strains of Dolosigranulum pigrum and optionally a strain or species of Corynebacterium. Further provided herein are methods, wherein the live, purified population of bacteria is administered intranasally. Further provided herein are methods, wherein the live, purified population of bacteria is administered orally. Further provided herein are methods, wherein the subject is an infant. Further provided herein are methods, wherein the subject is a child. Further provided herein are methods, wherein the subject is an adult. Further provided herein are methods, wherein the adult is 65 years or older. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu. Further provided herein are methods, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu. Further provided herein is a method, wherein the one or more strains of Dolosigranulum pigrum are selected from a strain listed in Table 1 and / or Table 32. Further provided herein is a method, wherein the one or more strains of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method, wherein the one or more strains of Dolosigranulum pigrum is selected from a strain listed in Table 1 and / or Table 32, and wherein the strain (or strains) of Corynebacterium is selected from a strain listed in Table 2. Further provided herein is a method wherein the species of Corynebacterium comprises C. accolens, C. pseudodiphtheriticum. C. amycolatum, C. propinquum, C. glutamicum, or C. striatum. Further provided herein is a method, wherein the method comprises administering mix 2 and optionally comprises administering a strain of C. pseudodiphtheriticum. Further provided herein is a method, wherein the method comprisesadministering mix 1 and optionally comprises administering a strain of C. pseudodiphtheriticum.EXAMPLES[000101] EXAMPLE 1: Effects of Nasal Microbiome Composition on ACE2 / TMPRSS2 Expression Levels and COVID-19 Infection[000102] General Conditions and Data Collections[000103] Analysis Designs. Students, staff, and faculty underwent regular weekly or biweekly COVID-19 surveillance testing using self-collected anterior nasal swabs in August 2020 to July 2022 at George Washington University in Washington, DC, USA. Cases were identified with people had a positive SARS-CoV-2 test between February 2021 through December 2021 with remnant samples from at least one prior negative test available and controls who are individuals with negative COVID- 19 PCR tests from the same period, matched by test date and age group (18-24y, 25-34y, 35-44y, 45-54y, 55-89y). Additional selection criteria for each Analysis are as follows:[000104] Cross-sectional case-control analysis (Analysis A) . To determine the association between nasal ACE2 / TMPRSS2 gene expression levels with COVID-19 infection risk, analysis was restricted to cases with t-1 samples (t-i defined as the test immediately prior to the positive test). Controls were matched 3: 1 based on case t-i test date and age group.[000105] Longitudinal case-control analysis (Analysis B). To determine the association between the dynamics of nasal ACE2 / TMPRSS2 gene expression levels with COVID-19 infection risk, cases wi th multiple samples available from up to five tests prior to the positive test (t-5 to t-i) were included. Controls were matched 3: 1 based on case test date and age group; however, only controls with remnant RNA available were included in the analysis.[000106] Nasal microbiome study analysis (Analysis C). To determine the association between nasal microbiome and nasal ACE2 / TMPRSS2 gene expression levels in a cross- sectional study that included t-2 samples from cases (t.2 defined as the test immediately prior to t-i test) and controls who were tested on t-2 or t-i- individuals with remnant samples available were included in the analysis.[000107] Nucleic acid isolations. Nasal swabs used in all three analyses were collected into 1ml of either DNA / RNA shield or Viral Transport Media, stored at 4 degrees Celsius, andprocessed within 4 hours of collection. From the nasal swab eluent. RNA was extracted using MagMAX™-96 Viral RNA Isolation Kit with 50uL final elution volume. Remnant samples underwent DNA extraction for the nasal microbiome study for nasal microbiome analysis.[000108] SARS-CoV-2 testing and ACE2 / TMPRSS2 gene expression quantification. Using the extracted RNA, SARS-CoV-2 testing was performed as described by EUA202180 and nasal ACE2 and TMPRSS2 expression levels were quantified by TaqMan assays (Hs01085333_ml and HsOl 122322, ThermoFisher) with QuantiTect One-Step RT-PCR Kit (Qiagen). RPS-18 (F-GTTCCAGCATATTTTGCGAGT (SEQ ID NO: 73); R-GTCAATGTCTGCTTTCCTCAAC (seq id no: 75); Probe-5HEX / TCTTCGGCC / ZEN / CACACCCTTAATGG / / 3IABkFQ (SEQ ID NO: 75); IDT) was also amplified as an internal control.[000109] COVID-19 surveillance testing in a university setting. On-campus students, staff, and faculty at George Washington University underwent COVID-19 surveillance testing by PCR using self-collected anterior nasal swabs on weekly or biweekly basis between August 2020 to December 2021. Based on COVID-19 PCR test results, cases were identified with individuals with a positive COVID-19 PCR test and individuals with negative COVID-19 PCR tests from the same study period were identified as controls, matched by age group and test date. Based on remnant sample available, participants were included in one or more of three studies: analysis A (n = 111 cases and 343 controls), analysis B (n = 97 cases and 286 controls), and analysis C (n = 428) (Table 4).Table 4: Demographic and sample characteristics of participantsAnalysis A (T.i) Analysis B (T.i) Analysis CaCases Controls . Cases Controls , OverallCharacteristic N=lll N=343P~ValueN=97 N=286P~ValueN=428Total samples 111 343 265 829 428Samples / person, 3.0NA 3 2 NA mean (Ql-Q3)NA(2.0-4.0) (2.0-4.0)Sex, n (col %) 0.58 0.65Female 67 (60.4) 217 (63 3) 63 (64.9) 193 (67.5) 275 (64.3)Male 44 (39 6) 126 (367) 34 (35 1) 93 (32 5) 153 (35 8)Mean age (SE) 24.0 (0.8) 24.2 (0.5) 0.70 23.7 (0.8) 24.1 (0.6) 0.44 24.0 (0.4)Test date of0.70 0.12 samples, n (col %)Spring 0 0 39 (11.1) 80 (7.7) 0Summer 23 (20.7) 72 (21.0) 93 (26.6) 315 (30.3) 76 (17.8)Fall 87 (78 4) 270 (787) 202 (57 7) 61 1 (58 8) 350 (81 8)Winter 1 (0.9) 1 (0.3) 16 (4.6) 34 (3.3) 2 (0.5)NA = Not applicable; SE = Standard error a. Controls with either T-l or T-2 samples and cases with T-2 samples with both gene expression data and microbiome data.[000110] i. Elevated nasal ACE2 TMPRSS2 gene expression as a risk factorfor COVID- 19 infection.[000111] In analysis A, the nasal ACE2 and TMPRSS2 gene expression levels were compared in cases immediately prior to their positive COVID- 19 PCR test (t-i) to matched controls. The cases and controls were similar in sex, age. and testing timing, with nasal ACE2 and TMPRSS2 expression levels being measured (t-i) at an average of 12 days (SD = 9.3 days) prior to the positive COVID-19 test (to) (Table 4). The analysis showed that at ti, nasal ACE2 and TMPRSS2 levels were significantly higher in the cases than the controls. Specifically, nasal ACE2 expression was detected in 39.6% of cases (n = 44 / 111) as compared to in 25.4% of controls (n = 87 / 343) (aOR = 1.98, 95% Cl = 1.23-3.04) and detectable nasal TMPRSS2 expression was found in 91.0% of cases (Cp mean=30.3; SD=9.8), as compared to in 84.3% of controls (Cp Mean=28.7; SD=12.5) (aOR = 1.88, 95% CI = 0.92-3.84).[000112] Decision tree analysis showed that nasal ACE2 and TMPRSS2 gene expression levels at t-i are informative for subsequent COVID-19 infection (FIG. 1C). In the highest split, having any ACE2 detection predicts case status, with 34% (44 / 131) of individuals with ACE2 detection being a case. Comparatively, having neither ACE2 nor TMPRSS2 detection provided the lowest risk for case status, with only 13% of individuals with that gene expression profile being a case. Among ACE2-negative, TMPRSS2-positive individuals, having higher quantities of TMPRSS2 predicts case status (33%) compared with low TMPRSS2 densities (23% cases). Using the most informative gene expression thresholds, three nasal ACE2 / TMPRSS2 gene expression categories that correlated with increasing risk for COVID- 19 infection were identified, ranging from low (ACE2- / TMPRSS2-), which was the least common (case: 9.9%, control: 21.3%), medium (ACE2- / TMPRSS2 Cp >32), which was the most common (case: 48.7%, control: 52.2%), to high (Any ACE2 / TMPRSS2 Cp =<32), which was the second most common (case: 41.4%. control: 26.5%) (Table 5). Males tended to have a greater risk increase with high expression (aOR=4.67, 95% CI=1.51-14.46) compared with females (aOR=2.70, 95% CI=1.02-7.12), although interaction by sex was not statistically significant (p=0.34). Themedium expression category at t-i was also associated with increased risk for SARS-CoV-2 infection in the overall population (aOR=2.10, 95% CI=1.03-4.26) (Table 5). Expression categories were not significantly different by age (p=0.33) (Table 7).Table 5: CO VID-19 case status associated with TMPRSS2 and ACE2 expression levels at T-i, adjusted for ageCases (n = 111) Control (n = 343) Logistic regression n (%) n (%) aOR (95% CI)ap-valueNasal Gene Expression CategoriesbAll 0.002High 46 (41.4) 91 (26.5) 3.58 (1.71-7.47)Medium 54 (48.7) 179 (52.2) 2.10 (1.03-4.26)Low 11 (9.9) 73 (21.3) refFemale 0.045High 31 (46.3) 66 (30.4) 2.70 (1.02-7.12)Medium 30 (44.8) 117 (53.9) 1.47 (0.56-3.82)Low 6 (9.0) 34 (15.7) refMale 0.027High 15 (34.1) 25 (19.8) 4.67 (1.51-14.46)Medium 24 (54.6) 62 (49.2) 3.11 (1.09-8.86)Low 5 (11.4) 39 (31.0) ref aOR = adjusted odds ratio; CI = confidence intervals a. Adjusted for age b. High = TMPRSS2 <=32 and / or ACE2 detected; Medium = , TMPRSS2 Cp 32-37 & ACE2 not detected; Low = TMPRSS2 & ACE2 not detected.[000113] Having the high nasal ACE2 / TMPRSS2 expression category at t-i was associated with significantly higher risk for COVID-19 infection in both sexes (Overall OR = 3.58, 95% CI = 1.71-7.47; Male OR = 4.67, 95% CI = 1.51-14.46; Female OR = 2.70, 95% CI = 1.02- 7.12) (Fig. 1A ACE2 M / F, Fig. IB TMPRSS2 M / F and levels) (Table 5). In contract, the medium expression category was only associated with significantly higher risk for COVID- 19 infection in male participants (Male OR = 3.11 , 95% CI = 1.09-8.86) (Table 5). To address potential confounding between undetected COVID-19 infection and elevated nasal ACE2 expression, a sensitivity analysis was performed, excluding cases wo were less than one weekaway from their positive COVID-19 PCR test, which showed consistent results as the primary analysis (p = 0.016) (Table 6). Cases were more likely to have persistently high expression categories across timepoints (t-s to t-i) leading up to the infection (aOR=1.62, p=0.016) (Table 6).Table 6: COVID-19 case status associated with TMPRSS2 and ACE2 expression levels, among individuals at least 7 days from their positive test date, adjusted for age and sex.Case Control Regression3Gene Expression Categories n (%) n (%) a OR (95% CI) p-valueA. At least seven days from positive test date N=111 N=343 0.016High, TMPRSS2 <-32 and / or ACE2 + 34 (40.0%) 91 (26.5%) 2.92 (1.29-6.60)Medium, TMPRSS232-37 & ACE2 - 42 (49.4%) 179 (52.2%) 1.90 (0.87-4.13)Low, TMPRSS2 - & ACE2 - 9 (10.6%) 73 (21.3%) refB. All longitudinal samples (T.i to T.s) N=97 N=286High, TMPRSS2 <=32 and / or ACE2 + - - 1.62 (1.00-2.63) 0.049Medium, TMPRSS232-37 & ACE2 - - - 1.24 (0.82-1.87) 0.31Low, TMPRSS2 - & ACE2 - - - ref aOR=adjusted odds ratio aFor analysis A, logistic regression adjusted for age and sex. For analysis B. Generalized estimating equation, using an independent correlation structure, adjusted for age and sex.Table 7: TMPRSS2 and ACE2 expression categories by age categoryUnder 21-24y 25- Over p-(49.1) (54.9) (66.7)Low, TMPRSS2-negative & ACE2-negative 30 28 21 (22.6) 5(17.8) (17.3) (16.7)Cp=Crossing point. The crossing point is inversely associated with density. Specifically, the Cp is the qPCR cycle number at which the fluorescence from the amplifying nucleic acid exceeds a threshold, indicating an increase in signal intensity.[000114] ii. Longitudinal patterns of nasal ACE2 and TMPRSS2 gene expression also predict risk CO VID- 19 infection.[000115] In an addition to nasal ACE2 / TMPRSS2 expression at t-i, cases also had distinct nasal ACE2 / TMPRSS2 gene expression patterns at timepoints prior to t-1, including having greater fluctuations in nasal ACE2 / TMPRSS2 gene expression levels. Specifically, prior to COVID-19 infection, cases transitioned more frequently across nasal ACE2 / TMPRSS2 gene expression categories between sequential visits than controls (54.4% vs. 45.8%, p=0.029).[000116] Cases also had other distinct longitudinal nasal ACE2 / TMPRSS2 gene expression patterns. Specifically, at categories t-2 to t-i, cases were more likely to shift towards higher nasal ACE3 / TMPRSS2 expression category-from low to medium or high, or from medium to high - prior to COVID infection as compared to the controls (42.6% vs. 22.0%, p=0.002) (FIG. ID). Additionally, having medium or high nasal ACE2 / TMPRSS2 expression level at even earlier timepoints were also associated with higher risk for COVID-19 infection. Cases were more likely to have persistently high expression categories across timepoints (t-5 to ti) leading up to the infection (aOR=1.62, p=0.016) (FIG. IE and FIG. 1H, Table 7). Analysis of up to five surveillance tests (t-5 to t-i) from cases (n = 97) and matched controls (n = 286) (Table 4) showed that medium and high nasal ACE2 / TMPRSS2 expression was more common over time among individuals who eventually become infected (p = 0.016, p < 0.001, respectively) (Table 8), showing that longitudinal patterns of elevated nasal ACE2 / TMPRSS2 expression levels are associated with the risk of COVID- 19 infection.Table 8: CO VID-19 case (n=97) and control (n=286) status associated with TMPRSS2 and ACE2 expression levels, using longitudinal samples, adjusted for age.Unstructured correlation structure (QIC=1221.8)Category Estimate SE p-valueGene Expression CategoriesHigh, TMPRSS2 <=32 and / or ACE2 +0 02 0 006 <0 001Medium, TMPRSS232-37 & ACE2 -0 01 0 004 0 016aOR=adjusted odds ratio a. Adjusted for age[000117] Hi. Nasal microbiome and COVID- 19 Infection.[000118] Seven nasal microbiome profiles, or community state types (CSTs). were previously defined based on the fidelity and high proportional abundance of specific nasal bacteria (Liu CM, Aziz M, Kachur S, et al. BactQuant: An enhanced broad-coverage bacterial quantitative real-time PCR assay. BMC Microbiol 2012; 12: 56.). In the analyzed population (n = 428), six of the seven previously nasal CSTs was identified. While the previously identified Enlerobacleriaceae-dommaiQd CST (CST-2) was not detected in this analysis. In addition, a new nasal CST, CST-8, was also identified. CST-8 was dominated by Haemophilus influenzae (FIGs. 2A-C stacked barplot and density boxplots; Table 9).[000119] The most prevalent CST in the analyzed population was Corynebacterium- dominated CST (CST-5) (n = 158, 36.9%), which were defined by indicator bacteria Corynebacterium accolens (CST-5A) or Corynebacterium pseudodiphtheriticum / propiquum (CST-5C). The next most prevalent CST was Culibacterium-dominaled CST (CST-4) (n = 78, 18.2%), followed by Staphylococcus epidermidis-domma od CST (CST-3) (n = 68, 15.9%), Dolosigranulum-dommaled CST (CST-7) (n = 52, 12.1%), and Staphylococcus aureus- dominated CST (CST1) (n = 39). While Enterobacteriaceae-dominated CST (CST2) was absent, a new' nasal CST dominated by Haemophilus influenzae (CST8) was detected (FIG. 2A and FIG. 2E, Table 9). H. influenza-dominated CST (CST-8) (n = 18, 4.2%) and Moraxella catarrhalis / nonliquefaciens-dominated CST (CST-6) (n = 5, 1.2%) were the two least common nasal CSTs (Table 9).Table 9. Nasal community state types detected and their associated indicator bacteria (IV > 0.35)[000120] Among the participants. 22.0%, 51.0%, and 27% had the low, medium, and high nasal ACE2 / TMPRSS2 gene expression categories. All nasal CSTs were detected in all nasal ACE2 / TMPRSS2 expression categories (FIG. 2C), except for the least prevalent CST, CST- 6, which was not detected in the lowest gene expression category. And while individuals with CST-1 (36.7%) or CST-8 (38.9%) were the most likely to have high gene expression category', as compared to individuals with CST-5B (18.6%), who were the least likely, overall nasal microbiome composition as represented by nasal CST prevalence did not differ significantly across the three nasal ACE2 / TMPRSS2 gene expression categories (chi2p = 0.58) (FIG. 2D). However, the CSTs did not differ significantly across nasal expression categories C / j p=0.58).[000121] However, nasal CSTs are generated not only based on proportional abundance of nasal bacteria but also other attributes of nasal microbiome, such as bacteria absolute abundance, may better represent the bacterial populations and communities that could affect host nasal gene expression and immune environment. To determine the other effects, their absolute abundances of nasal CST indicators were estimated and select nasal bacteria of clinical interest (e.g., Streptococcus pneumoniae) by combining total nasal bacterial densities with proportional abundance data. Decision tree analysis identified nasal bacteria that could potentially be associated with nasal ACE2 / TMPRSS2 gene expression in a thresholddependent manner. Six nasal bacteria were eventually included in the final multivariate regression model.[000122] As shown in Table 13, the multivariate logistic regression model determined that having high absolute abundance of Al catarrhalis / nonliquid (p < 0.001), H. influenzae (p = 0.008) and intermediate absolute abundance of S', aureus were significantly associated with elevated ACE2 / TMPRSS2 expression (Table 13). Specifically, having high-density H. influenzae and high-density Al catarrhalis / nonliquidfaciens were associated with 4-fold and 8-fold higher odds of showing higher ACE2 / TMPRSS2 expression, respectively, as compared to individuals with less of each nasal bacteria. S. aureus was associated with two distinct patterns of ACE2 / TMPRSS2 expression. Having low abundance of S. aureus (<1.3 x 10416S rRNA gene copies per swab) was associated with higher ACE2 / TMPRSS2 gene expression (aOR=1.8; p=0.025), while having high abundance of S. aureus was associated lower geneexpression (aOR=0.5; p=0.34), as compared to individuals with medium-abundance S. aureus. D. pigrum was the sole nasal indicator to be negatively associated with ACE2 / TMPRSS2 expression (aOR= 0.55, 95%CI 0.29-1.04). (Table 10, Table 11, Table 12 pre2 only).[000123] Random forest analysis likewise confirms the importance of these four nasal taxa for predicting ACE2 / TMPRSS2 gene expression levels. A random forest analysis including all nasal bacteria was performed to identify nasal bacteria attributes associated with ACE2 / TMPRSS2 expression categories. After splitting the dataset into training (2 / 3) and test sets (1 / 3), the model was tuned using variations of the number of trees, the number of random variables in the tree, and reductions in out-of-bag error rates. Among the 20 most-informative genera or species based on mean-decrease in Gini scores, 13 with a mean proportional abundance >1% were selected for further evaluation (which included all but one of the indicator taxa).[000124] To identify informative nasal bacteria attributes for ACE2 / TMPRSS2 expression categories, absolute abundances of nasal CST indicators in decision tree analysis were used, including indicator taxa and genera or species identified from the random forest model. Two decision trees w ere run, using assumptions of expression categories as either categorical or continuous outcomes. Trees were pruned using the complexify parameter of the smallest tree within one standard deviation of the tree with the smallest cross-validation error, and outputs were merged into one set of attributes. A sensitivity analysis was performed using proportional abundance data.[000125] Lastly, the association between all indicator taxa and genera and species were identified from the random forest analysis and ACE2 / TMPRSS2 expression categories were evaluated using an ordinal logistic regression with backw ards selection (p<0.6), adjusted for sex. Thresholds identified from decision tree algorithm were included. If the threshold was not informative based on exclusion using backwards selection in the regression model, the absolute abundance of the taxa was included as a continuous variable unless that was also removed via backw ards selection. Model AIC values were utilized to compare model fit.Table 10: Top 20 most informative nasal bacteria associated with nasal ACE2 / TMPRSS2 gene expression category from random forest modelMean proportionalTaxa Mean Prevalence, % abundance, % (SD)Decrease Gini Mediu High Overal Low Mediu HigBh Overal Low' in1 n=9 m n=ll 1 n=9 n=ll n=428 4 n=218 6 n=428 4 n=218 618.0S. epidermidis 17.8 98.4 97.9 98.6 98.3 (18.3) 16.7 19.0 17 39 1Propionibacterium 16.5 99.3 98.9 99.1 100.0 (10.8) 10.2 8.8 8.7Actinomycetales 4.5 (Unclassified) 16.0 83.2 90.4 82.1 79.3 (6.4) 5.0 4.1 4.62.0Anaerococcus 12.4 69.6 73.4 66.1 73.3 (3.3) 2.5 1.8 2.223.5C. accolens 11.4 68.5 72.3 67.0 68.1 (26.1) 24.7 23.8 21 92.6Peptoniphilus 11.3 62.2 64.9 58.7 66.4 (4.4) 3.4 2.2 2.74.5 tuberculostearicum 10.2 48.6 47.9 49.5 47.4 (7.4) 4.2 4.8 4.11.7P'inegoldia 9.7 61.9 63.8 60.6 62.9 (3.2) 2.4 1.5 1.51.2S. pneumoniae 8.7 54.9 53.2 55.1 56.0 (3.2) 1.3 1.2 1.25.4S. aureus 7.4 28.3 24.5 27.1 33.6 (15.8) 7.2 3.8 6.90.7Enterobacteriaceae 6.7 31.8 38.3 26.6 36.2 (3.7) 0.7 0.5 1.06.0Dolosigranulum 6.6 32.0 29.8 31.7 34.5 (13.2) 5.9 6.1 5.90.2Prevotella 5.7 26.9 22.3 22.9 37.9 (1.0) 0.2 0.3 0.3Snodgrassella 0.96 (<0.8) 5.7 22.9 14.9 26.2 23.3 (3.6) 1.2 1.1 0.6 pseudodiptheriticu 5.3 m 5 4 27 6 27 7 28 0 26 7 (13 9) 40 6 5 4 30.2Pseudomonas 4.5 21.0 21.3 21.6 19.8 (1.3) 0.1 0.1 0.40 1Rothia 4.2 18.5 14.9 18.8 20.7 (0.5) 0.1 0.1 0.20.1Acinetobacter 4.1 17.1 20.2 15.1 18.1 (1.2) 0.1 0.2 0.13.1H. influenzae 4.0 11.7 8.5 10.1 17.2 (13.9) 1.4 3.0 4.5Table 11: Top 20 most informative nasal bacteria from random forest models and additional indicator taxa associated with nasal ACE2 / TMPRSS2 gene expression categoryTable 12: Network analysis overviewTaxa Clustering Eigencentrality ClusterPeptoniphilus 0.72 0.92 3Anaerococcus 0.89 0.88 3Finegoldia 0.89 0.88 3C. accolens 0.51 0.97 2Dolosigranulum 0.29 0.48 2C. pseudodiptheriticum 0.7 0.45 2M. catarrhalis / nonliquifaciens 0.33 0.34 2H. influenzae 0.67 0.29 2Corynebacterium (other) 0 0.06 2S. epidermidis 0.55 1 1Propionibacterium 0.89 0.88 1C. tub rculostearicum 0.75 0.84 1Actinomycetales* 0.68 0.81 1.S', pneumoniae 1 0.68 1S aureus 1 0.24 0[000126] Further sensitivity analysis with proportional abundance data showed similar associations between high proportional abundances of M. catarrhalis / nonliquidfaciens, H. influenzae, and S. aureus thresholds with nasal ACE2 / TMPRSS2 gene expression levels (FIGs. 3A-3D) (Prop abundance Table 13, Table 14 pre2 only. Table 15). In contrast, high D. pigrum proportional abundance was not a significant negative predictor. This finding suggests that high absolute abundance of D. pigrum was essential for its negative association with nasal ACE2 / TMPRSS gene expression.[000127] Using random forest analysis, 13 taxa that predicted nasal ACE2 / TMPRSS2 expression were identified, including seven of the eight nasal CST indicators (Table 11). Further investigation showed that four species — D. pigrum, M. catarrhalis nonliquefaciens, H. influenzae, and S. aureus — significantly affected nasal ACE2 / TMPRSS2 gene expression when their colonizing abundances reached specific thresholds (Tables 16-17).[000128] D. pigrum was the only nasal bacteria species for which high absolute abundance was linked to reduced nasal ACE2 / TMPRSS2 expression (aOR=0.57; 95% CI=0.30-l.l 1; p=0. 10) (Fig. 3 A). In contrast, having S. aureus. M. catarrhalis / nonliquefaciens, and H. influenzae above specific absolute abundance thresholds was associated with elevated nasal ACE2 / TMPRSS2 expression and thus increased risk for SARS-CoV-2 infection. Specifically, if AY. catarrhalis / nonliquefaciens absolute abundance reached 6.3xl0416S rRNA gene copies per swab, there were 7.4-fold higher odds of elevated nasal ACE2 / TMPRSS2 expression(p<0.001), while if H. influenzae absolute abundance reached 5.0xl05, there were 4.7-fold higher odds of elevated ACE2 / TMPRSS2 expression (p=0.01) (Fig. 3A). In contrast, S. aureus showed two distinct patterns; when compared to individuals with low or no S. aureus, those with S. aureus absolute abundance ranging from 3.2\ 10’ to 7.9xl0516S rRNA gene copies per swab had nearly double the odds of having elevated nasal ACE2 / TMPRSS2 expression (aOR=1.9; 95% CI=1.2-3.0; p=0.011). However, although not statistically significant, having 7.9x105or more S. aureus 16S rRNA gene copies per swab was associated with reduced nasal ACE2 / TMPRSS2 expression (Table 16).[000129] Further analysis indicated that a high absolute abundance off), pigrum may uniquely reduce nasal ACE2 / TMPRSS2 expression (aOR=0.6; 95% CI=0.3-1.1; p=0.10), whereas a high proportional abundance of D. pigrum had limited effect (aOR=0.9; 95% CI=0.7-1.3; p=0.60), In contrast, having S. aureus, M. catarrhalis / nonliquefaciens, or H. influenzae above specific proportional abundance thresholds also impacted nasal ACE2 / TMPRSS2 expression (Table S7). These findings suggest that the impact of D. pigrum on host susceptibility to SARS- CoV-2 infection is likely driven by its absolute abundance rather than its proportional abundance relative to other bacteria. The overall patterns for these four taxa were generally consistent when evaluating any ACE2 detection and TMPRSS2 gene expression as independent outcomes (Tables 18-19).[000130] A substantial portion of individuals with nasal CSTs defined by M. catarrhalis / nonliquefaciens (CST6), H. influenzae (CST8), and S. aureus (CST1) have the density attributes associated with elevated SARS-CoV-2 infection risk. Specifically, all individuals with CST6 (n=5 / 5), 61.1% of individuals with CST8 (n=l l / 18), and 75.5% of individuals with CST1 (n=37 / 49) have these density attributes. Similarly, the majority (82.7%) of individuals with CST7 (n=43 / 52) have the high-density D. pigrum attribute that may reduce SARS-CoV-2 infection risk (FIG. 3B, FIG. 3D).[000131] Individuals who do not have CST6, CST8, or CST1 may also have density attributes associated with elevated risk for SARS-CoV-2 infection, but this is less common. Specifically, 2.8% of those without CST6 (n=12 / 423), 0.2% without CST8 (n=l / 410), and 13.5% without CST1 (n=51 / 379) have the high-risk density attributes associated with M. catarrhalis / nonliquefaciens, H. influenzae, and S. aureus, respectively. And 4% (n=15 / 361) individuals without CST7 have the high-density D. pigrum attribute that may reduce SARS- CoV-2 infection risk.[000132] While S. aureus was associated with relatively lower odds of elevated nasal ACE2 / TMPRSS2 expression (1.9-fold higher) than M. catarrhalis / nonliquefaciens (7.4-fold higher) or H. influenzae (4.7-fold higher), the high-risk S. aureus nasal microbiome attributes are much more common. High-risk S. aureus absolute abundance was detected in 20.6% of our study population (n=88), as compared to high-risk M. catarrhalis / nonliquefaciens (n=17, 3.2%) or high-risk H. influenzae (n=12, 2.8%) absolute abundance.Table 13: Multivariate regression model using absolute abundance data of select nasal CST indicatorsOdds Ratio Estimates (n=428); AIC=859.9Effect Odds Ratio 95% Wald P-valueConfidence LimitsS. aureus (4.1-6.3 vs. <4.1 logic) 1.78 1.08 2.93 0.0255. aureus (>6.3 vs. <4.1 logic) 0.51 0.13 2.03 0.34S. epidermidis (1 logic increase) 1.16 0.93 1.43 0.19Dolosigranulum (>5.8 vs. <5.8 logic) 0.55 0.29 1.05 0.07S. pneumoniae (1-3 vs. 0 logic) 0.83 0.40 1.71 0.615. pneumoniae (>3 vs. 0 logic) 1-23 0.83 1.81 0.30H. influenzae (>5 A vs. <5.4 logic) 4.61 1.49 14.27 0.008M. catarrhalis / nonliquefaciens (>4.7 vs. <4.7 logic) 8.30 2.76 24.91 <0.001Propionibacterium (1 logic increase) 1.20 0.91 1.60 0.20C. pseudododiptheriticum (>6.7 vs. < 6.7 logic) 2.10 0.75 5.84 0.16Female sex (vs. Male) 2.10 1.42 3.11 <0.001HD = High-density; LD = Low densityOdds ratios for taxa included as logic copies / swab reflect a 1-logio increase in absolute abundanceTable 14: Multivariate regression model using absolute abundance data of select nasal CST indicators, Pre2 OnlyOdds Ratio Estimates (n=204); AIC=447.3Effect Odds 95% Wald P-valueRatio Confidence LimitsS. aureus (4.1-6.3 vs. <4.1 logic) 1.21 0.55 2.65 0.63X aureus (>6.3 vs. <4.1 logic) 2.05 0.23 18.45 0.52S. epidermidi s (1 logic increase) 1.26 0.85 1.89 0.26Dolosigranulum (>5.8 vs. <5.8 logic) 0.40 0.12 1.38 0.15S'. pneumoniae (1-3 vs. 0 logio) 0.86 0.36 2.06 0.73S. pneumoniae (>3 vs. 0 logio) 1.28 0.73 2.27 0.39H. influenzae (>5.4 vs. <5.4 logio) 5.15 0.75 35.57 0.10M.catarrhalistnonliquefaciens (>4.7 vs. <4.7 2.42 0.55 10.62 0.24 logio)Propionib acterium (1 logio increase) 0.75 0.43 1.30 0.30C. pseudododiptheriticum (>6.7 vs. < 6.7 6.78 0.34 135.18 0.21 logio)Female sex (vs. Male) 2.05 1.18 3.54 0.010HD = High-density; LD = Low densityOdds ratios for taxa included as logio copies / swab reflect a 1 -logio increase in absolute abundanceTable 15: Multivariate regression model using proportional abundance data of select nasal CST indicatorsHP = High-proportion; LP = Low proportionTable 16: Association between increasing ACE2 and TMPRSS2 gene expression category with absolute abundance of select nasal CST indicators.a. Odds ratios for taxa included as logio copies / swab reflect a 1 -logic increase in absolute abundance. Odds ratios derived using an ordinal logistic regression, adjusted for sex. N=428. AIC=861.1 b. Benjamini-Hochberg adjusted F-value.Table 17: Association between increasing ACE2 and TMPRSS2 gene expression category with proportional abundance of select nasal CST indicators.a. Adjusted odds ratio using an ordinal logistic regression, adjusted for sex. N=428. AIC=864.1 b. Benjamini-Hochberg adjusted P-valueTable 18: Association between increasing ACE2 detection and TMPRSS2 gene expression with absolute abundance of select nasal CST indicators.Odds ratios for taxa included as log 10 copies / swab reflect a 1 -log 10 increase in absolute abundance Odds ratios derived using an ordinal logistic regression, adjusted for sex and total density. N=428.Table 19: Association between increasing ACE2 detection and TMPRSS2 gene expression with absolute abundance of select nasal CST indicators.Adjusted odds ratio using an ordinal logistic regression, adjusted for sex. N=428.[000133] Then analysis was conducted to investigate whether M. catarrhalis I nonliquidfaciens , H. influenzae, and S. aureus interact directly with either ACE2 / TMPRSS2 gene expression or via interactions with the host innate immune environment. After excluding six taxa that were present at <1% mean proportional abundance, correlations between the taxa were evaluated using a network analysis. Network metrics identified four distinct clusters; an anaerobe cluster with Peptoniphilus serving as anode, a skin-associated taxa cluster with a S. epidermidis node, a separate S. aureus -on\\ node, and other correlated taxa (C. accolens. Dolosigranulum. C. pseudodiptheriticum, M. catarrhalis / nonliquifaciens . H. influenzae, other Corynebacterium) in a final cluster with C. accolens identified as anode. All indicator taxa, cluster nodes, and AT catarrhalis / nonliquifaciens (key node in the decision tree) were included in the multivariate logistic regression model evaluating associations between taxa and gene expression categories.[000134] In some cases, D. pigrum exerts its effect by threshold-dependent antagonism against M. catarrhalis / nonliquidfaciens . H. influenzae, and S. aureus. D. pigrum had strong negative correlations with S. aureus (FIG. 5C. r=-0. 13, p<0.001). Further, in absence of 5. aureus. H. influenzae, and M. catarrhalis nonliquefaciens , D. pigrum was not associated with ACE2 / TMPRSS2 gene expression category (Chi-squared p=0.50). Finally, although there was a positive correlation between D. pigrum and M. catarrhalis'nonliquefaciens abundance, the latter is likely responsible for increases in gene expression category when both taxa are present. Higher gene expression categories are found with high-density Af catarrhalis nonliquefaciens, both with and without D. pigrum (p=0.026 and 0.071, respectively; FIG. 5A). In contrast, high- density7D. pigrum does not appear to impact gene expression category in with or without high- density M. calarrhalis / nonliquefaciens (p=1.0 and 0.33, respectively).[000135] To conclude, the assays demonstrate that the combined expression of nasal ACE2 and TMPRSS2 was a significant and a strong predictor for future SARS-CoV-2 infection in adults. Higher absolute abundance of D. pigrum reduces nasal ACE2 / TMPRSS2 expression, likely providing protection against SARS-CoV-2 infection.[000136] EXAMPLE 2: Manufacturing of Dolosigranulum pigrum[000137] Solid media. D. pigrum was grown on solid media for whole genome sequencingand plate-based antagonism assays. Solid media was prepared using IX Columbia. 50 mM Tris, 2% agar. 1% Tween 80 media in 100 mM petri dishes. Liquid media. D. pigrum growth characteristics were monitored using two approaches in liquid media, where a high throughput (96-well) method was used for growth curv e characterization and high-volume method in flasks was used for harvesting of D. pigrum cells and media for phenotypic characterization. Liquid media growth for the generation of Cell-Free Media (CFM) and high throughput growth curves was performed using IX Columbia, 50 mM EPPS, 1.5% Dextrose. 1% Tween 80 and normalized to pH 8.76-8.86. Liquid media growth for the generation of inoculum stocks was performed using IX Columbia, 1.5% Dextrose, 2% Tween 80 and normalized to pH 8.76-8.86.[000138] Solid media growth. All D. pigrum growth on solid media was performed at 37°C with 5% CO2.[000139] Monitoring of 96-well plate growth (liquid). D. pigrum growth in 96-well plates was performed using 300 pL of liquid media in each 350 pL well using BreatheEasy seal to prevent splashing. The 96-well plate was incubated in plate reader at 37°C with 50% shaking at medium intensity and automated reading (OD600) was obtained even' 10 minutes. Exemplary growth curves in 96-w'ell plate are shown in FIG. 7.[000140] Monitoring of high-volume flasks (liquid). D. pigrum growth in high-volume growth was performed in either 125 rnL flasks (for volumes less than 25 mL) or 250 mL flasks (for volumes between 25 and 50 mL). D. pigrum in flasks w ere incubated at 37°C with shaking at 150 RPM. Intermittent OD testing was performed to determine timing for D. pigrum harvesting. All media and sample handling was performed in a biological safety cabinet (BSC) using sterile techniques.[000141] D. pigrum growth in 96-w'ell plate was summarized in Table 20, showing the stationary phase OD600, time to lag phase (mid-point of log growth curve), and doubling time for 56 DP isolates from 3 independent trials. Bold strains were selected for inclusion in pharmaceutical composition mixtures “Mix 1 ” or “Mix 2” (see Example 12).Table 20 Summary characteristics of D. pigrum growth in 96-well plate.[000142] The in vitro liquid culture of one or more strains of the bacterium Dolosigranulum pigrum demonstrated a doubling times less than 60 minutes or less than 50 minutes. The in vitro liquid culture of Dolosigranulum pigrum demonstrated a culture optical density at 600 nm greater than 0.8 or 1.0 in stationary phase when grown in 96 well plates using 300 uL reaction volumes. Doubling time and OD can depend on methods for culture and measurement.[000143] EXAMPLE 3: Strain Isolation of Dolosigranulum pigrum[000144] Anterior nare swabs were self-collected by study participants (ages 18-49) by swabbing both nares at least three times and leaving the swab to absorb nasal fluid for 10 seconds in each nare. Swabs were immediately placed in up to 500 pL of Amies media and stored at 4 degrees Celsius until processing. Samples were processed, then stored at -80 degrees Celsius within 4 hours of collection.[000145] D. pigrum was isolated by growing 10-fold serial dilutions of Amies media on solid media (IX Columbia, sheep’s blood plates with 700 pL of 140 mM Tris) and incubated at 37 degrees Celsius with 5% CO2 for 48 hours. Colonies with D. pigrum morphology were selected and further grown overnight at 37 degrees Celsius shaking (100 RPM) in liquid media (IX Columbia, 50 mM EPPS, 1% Tween 80. 1.5% Dextrose, pH 8.76-8.86). D. pigrum isolate identity was confirmed by extracting DNA from growth in liquid media by murJ qPCR. Isolates with murJ qPCR Cp < 30 were confirmed as D. pigrum and grown on solid media (IX Columbia, 50 mM tris, 1% Tween 80, 2% agar) overnight at 37 degrees Celsius and 3-5 colonies were selected and stored in 1 mL of 20% glycerol dPBS.[000146] / ). pigrum purification and generation of master stock was performed as follows: The above glycerol stock was streaked onto a 1st purity’ plate (IX Columbia, 50 mM tris. 1% Tween 80, 2% agar), grown overnight at 37 C. A single colony was selected from the 1st purity plate and subcultured onto a 2nd purity plate and grown overnight at 37 C. A single purified colony was selected from the second purity’ plate for DNA extraction and testing by murJ qPCR. Isolates with murJ CP<30 were confirmed as pure D pigrum and stored in 20% glycerol dPBS in triplicate as master stock.[000147] EXAMPLE 4: Pangenome Analysis[000148] Sequencing & Assembling the genome[000149] Generation of closed D. pigrum genomes using Pac-Bio long reads[000150] DNA Sequencing'. Complete D. pigrum genomes (n = 3) were sequenced on the PacBio platform using methods as previously described (PMID: 35861554), producing -29,000 Circular Consensus Sequencing (CCS) reads total. Sequence Assembly Pac-bio reads were corrected, trimmed, and assembled with Canu (v2. 1.1; coverage limit, 1,500; target genome size, 2 Mbp; minimum read length, 1 kbp) (PMID: 28298431). The resultant assemblies were circularized using Simple-Circularise (vl; default settings) (https: / / github.com / Kzra / Simple-Circularise) . rotated using Circlator (vl.5.5; default setings) (PMID: 26714481), and assigned taxonomy using GTDB-Tk (vl.5. 1; default setings) (PMID: 36218463).[000151] Sequencing of diverse D. pigrum collection on Illumina platform[000152] DNA Sequencing'. Paired-end next generation sequencing of a diverse D. pigrum collection was performed for / ), pigrum isolates on the Illumina NovaSeq 6000 platform. This resulted in an average of 2,838,922 paired-end reads per isolate and with an overall average read length of 15 Ibp for the short reads. Sequence Assembly Paired end Illumina short read sequences from D. pigrum isolates were assembled into contigs using a de Bruijn graph based assembler, St. Petersburg genome assembler -SPAdes (v3.13) (PMID: 24093227). Quality' of the assemblies were assessed using metrics generated by the Quality7Assessment Tool for Genome Assemblies QUAST (v5.0.2) (PMID: 23422339). The assembled genomes were annotated using Bakta (vl.6.1) (PMID: 34739369). The 16S rRNA gene sequence of several D. pigrum isolates were generated by Pacbio and / or Illumina sequencing data and are shown in Table 1. A summary of the pairwise similarity of the 16S rRNA sequences from the D. pigrum isolates is shown in Table 21.Table 21. Pairwise Similarity of 16S rRNA Sequences from WGS D. pigrutn isolates[000153] Pangenome by Nucleic Acid Sequence[000154] Nucleotide gene sequences from closed genomes (n = 3) and paired-end short read assemblies (n = 53) for D. pigrum were clustered at a sequence identity threshold of 95% with alignment coverage for shorter sequences at least 90% using CD-HIT-EST (v4.8.1; -c 0.95 -aS 0.90 -g 1 -p 1 -d 200) (PMID: 16731699). The software takes in the Bakta annotated nucleotide gene sequences and sorts them from the longest to shortest. Processed in sequential order from longest to shortest, the sequences that fall within the alignment percentage parameters listed above are clustered together. Those that do not are made into new clusters, with the clustering process repeating until all sequences are clustered. A gene cluster co-occurrence matrix across all the genomes was generated using an in-house python script - which identified the following number of each gene type within the D. pigrum pangenome. Table 22 contains gene counts for the core and accessory pangenome of 56 D. pigrum isolates. The core genes are annotated genes that are present in 99 to 100% of genomes. The soft core genes are annotated genes that are present in 95% to <99% of genomes. The shell genes are annotated genes that are present in 15% to <95% of genomes. The cloud genes are annotated genes that are present in 0% to <15% of genomes.Table 22. Nucleotide-based Pangenome Summary[000155] Pangenome by Predicted Amino Acid Sequence[000156] Amino acid gene sequences from annotated in-house closed genomes (n = 3) and short read assemblies (n = 53) for D. pigrum were used to generate a D. pigrum pangenome using panaroo (vl.3.2; -t 35 -a pan -clean-mode strict -remove-invalid-genes) (PMID: 32698896). The software takes in the bakta annotated amino acid gene sequences and identifies all unique genes across all submitted D. pigrum genomes. From this list of unique genes, panaroo aligns and marks if they are present or not within each of the submitted D. pigrum as a matrix format in the gene_presence_absence.csv. A summary statistic file was also generated and can summarize the pangenome as the table below. Table 23 contains gene counts for the core and accessory7pangenome of 56 D. pigrum isolates.Table 23. Amino Acid-based Pangenome Summary[000157] Generating Core genome single nucleotide polymorphisms (SNPs)[000158] D. pigrum core genome SNP identification using Illumina short reads. A multi- genomic SNP identification pipeline. Northern Arizona SNP Pipeline (NASP) (vl.2.0) (PMID: 28348869) was used to identify single nucleotide polymorphisms in-house closed genomes (N = 3) and D. pigrum illumina short reads (N = 53) and publicly available genomes (N=26).Briefly, NASP aligned illumina short reads of D. pigrum isolates to the chromosome of a published D. pigrum genome (strain 83VPs-KB5; GenBank accession number CP041626. 1) using alignment algorithm BWA-MEM (v.0.7.12) (69 - PMID). It uses Mummer (PMID) to align closed genome sequences and assembled contigs to the reference. NASP then runs GATK (v.3.5) (70 - PMID) to call single nucleotide polymorphisms (SNPs) for alignments generated using short reads. It uses a sliding window method to compare the reference with the aligned genome sequence to call SNPs on closed genomes and assemblies. It then generated an all genome SNP matrix where the rows were the D. pigrum isolates and the columns were the SNP loci on the reference genome. Recombinant regions were removed from the SNP matrix using Gubbins (v2.4. 1) (PMID: 25414349).[000159] D. pigrutn core genome SNP clustering to identify D. pigrum core genome SNP clusters.[000160] Additional D. pigrum core genome SNP analysis was performed by clustering the core-genome SNP matrix. The SNP matrix was clustered using K-modes machine learning algorithm suited for clustering categorical data, where each SNP position was an input feature. The K-Modes algorithm (https: / / github.com / nicodv / kmodes) was used as a python package to cluster the core-SNP matrix using k = 3, 4, 5. which produced 3-cluster, 4-cluster, and 5-cluster solutions respectfully for the D. pigrum core genome SNP clusters. The numbers denote the clustering groups assigned by kmodes. Table 24 shows the clustering results for the D. pigrum isolates based on core genome SNPs. Bold strains were selected for inclusion in pharmaceutical composition mixtures “Mix 1 or “Mix 2’".Table 24. K-mode Clustering results for D. pigrutn isolates[000161] Data[000162] To identify the D. pigrum strain mixtures - defined as maximizing pan-genome (nucleic acid) with at least one representative D. pigrum from each major D. pigrum core genome cluster - in silico analysis was performed using D. pigrum strains meeting donor criteria* in rarefaction analysis of D. pigrum strain mixtures of 3 strains.[000163] *Donor criteria: Donors with high (cut off = 10A6 16S rRNA gene copies / swab) in vivo D. pigrum absolute abundance and no or minimal (cut off = 10A4 16S rRNA gene copies / swab) S. aureus. Table 25 shows D. pigrum mixtures generated from kmodes clusters generated form the core-genomes SNP matrix. The top 5 mixtures that maximized the number of genes present in the core-genome are shown in the table.Table 25. D. pigrum mixtures generated from kmodes clusters[000164] EXAMPLE 5: Clade Analysis[000165] Clade Analysis - phylogenetic tree: The fastq reads for the sequenced DP genomes were collected together along with in-house closed DP genomes. 83VPs-KB5 is a closed genome used as a reference genome for all other genomes to be compared to using the NASP pipeline, which identifies and calculates single nucleotide polymorphism differences. This was cleaned up with gubbins that mitigated the effect of mechanisms of horizontal sequence transfer on phylogenetic reconstructions, which was then put through phyML to build phylogenetic trees with maximum likelihood.[000166] NASP is a suite of tools meant to collect and report on statistically-relevant high- confidence positions in a collection of genomes, with emphasis on variant positions, especially single nucleotide polymorphisms (SNPs).[000167] Gubbins (Genealogies Unbiased By recomBinations In Nucleotide Sequences) is an algorithm that iteratively identifies loci containing elevated densities of base substitutions while concurrently constructing a phylogeny based on the putative point mutations outside of these regions.[000168] PhyML is a software package that uses modem statistical approaches to analyze alignments of nucleotide or amino acid sequences in a phylogenetic framework. The main tool in this package builds phylogenies under the maximum likelihood criterion. It implements a large number of substitution models coupled to efficient options to search the space of phylogenetic tree topologies.[000169] Clades by core-SNP matrix[000170] D. Pigrum core genome SNP phylogenetic analysis to identify D. pigrum clades. The core genome SNP matrix was used to construct a phylogenetic tree (FIG. 8) using a phylogeny modeling maximum likelihood algorithm implemented in the PhyML (PMID:) General Time Reversal evolutionary model was selected using Smart Model selection (v.3.0) (PMID: 20525638) and support values for the phylogeny were calculated by bootstrap sampling (n=100). The phy logeny was used to identify 3 or 4 major D. pigrum clades (Table 26) utilizing an R package called phytools. The Phylogeny was cut at a level (red cut) to generate 3 clades (Clade 1 N=9, Clade 2 N=12, Clade 3 N=35). Alternatively the blue cut was also performed ata lower level to generate 4 clades (Clade 1 N=9, Clade 2 N=12, Clade 3 N=7, Clade 4 N=28).Table 26. Phylogenetic tree based clade membership of D.pigrum isolates.[000171] EXAMPLE 6: Quorum Sensing[000172] Characterizing the agrBDCA operon in Dolosigranulum pigrum[000173] Profile Hidden Markov models, a protein sequence similarity based probabilistic modeling based approach, were used to identify the agrBDCA genes in Dolosigranulum pigrum genomes.[000174] The genes from D. pigrum annotated genome collection were screened against a publicly available hmm profile for agrBDCA operon (ID) downloaded from the Pfam database using a model profile searching tool - HMMER (PMID). Multiple copies ( agrA and and agrC were detected in each genome however no homologs were detected for agrB and agrD. genes in any genome.[000175] agrA & agrC variants[000176] To investigate the sequence homology between the multiple copies in a single genome, the genes identified by HMMER as agrA and agrC were extracted in a closed genome and the nucleotide as well as amino acid sequences of the respective gene copies were aligned using MUSCLE - Multiple Sequence Comparison by Log- Expectation. Average pairwise percent sequence alignment identity between the gene copies for agrA was 55.61%(SD=1.85) for nucleotide alignments and 29.63%(SD=4.14). agrC nucleotide alignment had 55.76%(SD=0.91) and 25.8%(SD=4.29) for amino acid alignments.[000177] Screening agrA & agrC variants against Dolosigranulum pigrum collection[000178] To determine the prevalence of the variants in the D. pigrum collection, the genomes were screened against the agrA and agrC nucleotide reference database using nucleotide blastn. Hits with greater than 80% percent match over 80% of the entire length of the genes were converted into a isolate - agrA / C presence absence matrix (Table 27).Table 27. Presence-absence results of agrA and agrC variants in 56 D.pigrum isolates[000179] EXAMPLE 7: Bacteriocin Analysis[000180] Nucleotide gene sequences from closed genomes (n = 3) and paired-end short read assemblies (n = 53) for D. pigrum were screened using BAGEL4 (vl.2) (PMID: 29788290) to detect the presence of bacteriocins, which are a type of antimicrobial peptides. The softwareidentified open reading frames, which are chunked, translated to amino acids, and individually submitted to be blast and hmm motifs searched against a curated bacteriocin database. The database is publicly available in the software’s github repository. Table 28 shows a summary of the bacteriocins present in the D. pigrum genomes. Table 29 shows the number of distinct bacteriocins and top match bacteriocin in D. Pigrum isolates and groups.Table 28. Bacteriocin analysis in D. pigrum genomes using BAGEL4 (vl.2)Table 29. Number of Distinct Bacteriocins and Top Match Bacteriocin in Individual Isolates and Groups D. pigrum[000181] EXAMPLE 8: Antimicrobial Resistance Gene Analysis[000182] Nucleotide gene sequences from closed genomes (n = 3) and D. pigrum paired-end short read assemblies (n = 53) were screened using rgi_CARD (v5.1.1) (PMID: 31665441) to detect antimicrobial resistance genes. The software first translates the nucleotide sequences into protein sequences for each submitted genome. A combination of blastp and curatedbitscore cut-offs were used against the software’s specialized database called Comprehensive Antibiotic Resistance Database (CARD), which is publicly available in the software’s github repository. The software uses 4 different search models: protein homology models, protein variant models, protein overexpression models, and ribosomal RNA gene variant models, which each screens for different types of potential antibiotic resistance, to ensure variants of resistance genes are appropriately checked and covered. The results are shown in Table 30, which shows the sequence alignment percentage based on protein sequence similarity for antimicrobial resistance genes with drug class in 56 D. pigrum strains. Table 31 shows the number of distinct antimicrobial resistance genes and top match in individual isolates and groups of D. pigrum.Table 30. Protein Sequence Similarity for Antimicrobial Resistance Genes with DrugClass in 56 D. pigrum StrainsTable 31. Number of Distinct and Top Match Antimicrobial Resistance Genes in Individual Isolates and Groups of D. pigrum[000183] EXAMPLE 9: Pathogen Antagonism[000184] Preparation of D. pigrum inoculum stocks for testing. D. pigrum frozen inoculum stocks were prepared by growing D. pigrum on solid media at 37 C with 5% CO2 for ~22 hours,which was used to inoculate 20 mL of IX Columbia, 1.5% dextrose, 2% Tween 80, pH 8.76- 8.86 media, then grown to OD = 0.45-0.80 at 37 C with shaking at 150 RPM (-4-10 hours). The resultant liquid growth was diluted to OD = 0.45-0.55 and after 20% glycerol, it was flash frozen in LN2 and stored at -80 C for future experiments. S. aureus inoculum stocks were prepared identically using IX Brain Heart Infusion, 2% Tween 80. All media and samples were handled in a biosafety cabinet.[000185] D. pigrum Spot-on-spot testing on solid media. Plates w ere prepared with 18 mL of D. pigrum solid media in each 100 mM petri dish, then dried in the biosafety cabinet (BSC) for 30-60 minutes to remove excessive liquid on plate surface. After drying, up to four 10 uL of diluted / ), pigrum inoculum stock -thawed and diluted 50-fold in dPB-were spotted in each quadrant. Spots were allowed to dry for 30 minutes without lids in the BSC, then plates were moved to a 37 C incubator with 5% CO2 and incubated for 22 hours. After growth, 120 pL of S. aureus inoculum stock-thawed and diluted 500-fold in dPBS-was spotted onto each D. pigrum spot. An additional positive control X aureus spot was spotted on the same plate. The plates were then returned to incubate at 37 C, 5% with CO2 for 16-72 hours. Images are captured on Hamilton STAR (FIG. 9 as an example) and the resultant images were processed and analyzed in MATLAB. FIG. 9 shows the zone of clearance induced by D. pigrum isolate A49 demonstrating the antagonism ofD. pigrum against S. aureus strain USA300. D. pigrum cells w ere spotted onto solid growth media at t = 0. X. aureus cells were spotted on top of D. pigrum at t=24 hours. The zone of clearance w as assessed at t=40-48 hours. The average zone of clearance (mm) against X aureus, A. baumannii, P. aeruginosa, H. influenzae, and M. catarrhalis induced by D. pigrum isolates are shown in Table 32. All strains showed varying levels of ability to inhibit growth of X aureus, A. baumannii, P. aerguinosa, and AT catarrhalis. Only a few' strains inhibited growth of H. influenzae. Additionally, Cell Free Media (CFM) conditioned by D. pigrum growth exhibits an antagonistic effect on the growth of X aureus strain US A300, quantified by measuring optical density at 600 nm (OD600) of a liquid culture a X aureus culture grown in CFM from D. pigrum as shown in FIG. 10. FIG. 10 shows plots of optical density at 600 nm (OD600) of X aureus strain USA300 (Y -axis) grown in cell free media conditioned by two D. pigrum strains (strain A and strain B ) or in the absence of D. pigrum cell free media. Both D. pigrum strain A and strain B conditioned cell free media inhibited X aureus growth. The unfractionated media plus protein digestion, unfractionated media, <10 kDa fraction, and <10 kDa plus protein digestion inhibited the X aureus growth. Molecular weight fractionation of CFM demonstrates that CFM from D. pigrum containsmultiple active compounds.Table 32 Average Zone of Clearance Induced by D. pigruin[000186] Example 11: Rationale for Strain Mix Generation[000187] Characterization of nasal microbiome of human donors from which D. pigrum was isolated[000188] DNA was extracted from nasal swabs using an enzymatic cocktail of Tris-EDTA, lysozyme, mutanolysin, and lysotaphin. followed by MagMax DNA Multi-Sample Ultra 2.0 Kit (including Proteinase K treatment) on aHamilton liquid handler. The eluted DNA solutions were run through 16S rRNA gene-based boardrange real-time PCR (PMID 22510143) and library was prepped using Fadrosh primers (F: 5’- ACTCCTACGGGAGGCAGCAG -3' (SEQID NO: 76); R: 5’- GGACTACHVGGGTWTCTAAT -3'(SEQ ID NO: 77)) (PMID 24558975), in-house i5 and i7 primer indexers for identification, and PCR. The DNA was then pooled together and submitted for MiSeq platform sequencing using MiSeq Reagent Kit v3 (600- cycle).[000189] Sequencing results were processed by removing primer sequences with cutadapt v2.4 (doi: 10. 14806 / ej. 17.1.200) and checked for ualit -trimmed using Trimmomatic v0.39 (PMID: 24695404). The DADA2 vl.10 pipeline (PMID: 27214047) filtered the reads, checked the chimera, and used inferred error models to identify Amplicon Sequencing Variants (AS Vs). A trained Naive Bayesian Classifier (v.2.12) (PMID: 17586664) classified the species taxonomy of the AS Vs at an 80% bootstrap confidence level. ASVs of untrained species taxonomy groups of interests were identified using NCBI blast+ terminal and its 16S_ribosomal_RNA and taxdb databases (PMID: 18567917). The results from the qPCR and taxonomic classified read counts from the DADA2 pipeline were combined to generate absolute abundances for taxons per swab. The proportional abundance of the taxon times the bacterial load per swab was determined. Table 33 shows absolute abundance of nasal bacteria from human donors from which D. pigrum strains were isolated.Table 33. Absolute abundance of nasal bacteria from human donors[000190] Characterization of nasal mucosal inflammatory profile of human donors from whichD. pigrum was isolated. Table 34 shows the host immune profile for IL6, IL8, and IL13normalized to the highest concentration that was detected among the 200 participants for the56 DP Isolates. In the table. means data unavailable. Bold strains were selected for inclusion in pharmaceutical composition mixtures “Mix 1” or “Mix 2”Table 34. Host immune profile for IL6, IL8, and IL13[000191] EXAMPLE 12: D. pigrum Consortia Design[000192] Combinations of bacterial strains were identified to be incorporated in a pharmaceutical composition for the treatment of airway inflammation and acute and chronic infection of the upper respiratory tract by defining the selection criteria outlined below.[000193] Phenotypic and Genotypic C aracteristics of Strains[000194] Within the species of D. pigrum, specific strains for incorporation in a pharmaceutical composition were selected based on phenotypic and genotypic characteristics.[000195] All selected strains exhibited robust growth in vitro to ensure that the pharmaceutical composition component strains would be developable from a pharmaceutical composition manufacturing perspective. Robust grow th was defined as (i) reproducibly having a doubling time in logarithmic growth phase that is at or below7the average of the doubling times measured in a collection of 56 D. pigrum strains, and (ii) reproducibly having a maximum optical density in stationary phase that is at or above the average of the maximum optical densities measured in a collection of 56 D. pigrum strains.[000196] All selected strains demonstrated direct antagonism against S', aureus strain USA300 to ensure that the pharmaceutical composition contained strains capable of direct pathogen killing and / or inhibition.[000197] Individual strains of D. pigrum were also screened in pairwise fashion for ability- to be co-cultured in vitro. Strains of D. pigrum that inhibited growth of other strains of D. pigrum or that were resistant to the growth inhibitory effect of other strains of D. pigrum in pairwise comparisons were preferentially selected for inclusion in the pharmaceutical composition.[000198] Strains that had the strongest association with healthy human nasal microbiomes were selected based on the assumption that these strains are the most likely to confer benefits to the host with respect to prevention, reduction, or elimination of nasal microbes of pathogenic potential and reducing host susceptibility to infection and pathologic inflammation. All selected strains were originally isolated from human hosts who exhibited a consistently healthy nasal microbiome at and around the time of strain collection. A healthy nasal microbiome in the host was defined as: (i) high absolute and proportional abundance of D. pigrum in the host’s nasal microbiome observed on two or more separate occasions in the same individual, (ii) minimal or no bacterial pathogens S. aureus, Moraxella caiarr halis. and Haemophilus influenzae in the host’s nasal microbiome, (iii) low levels of innate immune factors known to be associated with viral and bacterial pathogen susceptibility and colonization in the host’s nasal mucosa. Innate immune factors associated with pathogen susceptibility and colonization include: the pro-inflammatory cytokines IL-6 and IL-8. Overall, high absolute abundance of D. pigrum is the most important selection criteria because high-abundance colonization in vivo is considered to be indicative of the ability for that strain to colonize other individuals at high absolute abundance.[000199] To avoid generating a pharmaceutical composition that introduces harmful antibiotic resistance genes into the microbiomes of patients, strains with no more than one class of resistance-conferring genes (based on genomic sequencing data and homology analysis) were selected.[000200] Genetically diverse combinations of D. pigrum strains were selected to be incorporated into a single pharmaceutical composition consortium based on the assumption that a genetically diverse consortium would (i) maximize the likelihood that one or more strains from the pharmaceutical composition consortium colonizes the nasal cavity of a high percentage of pharmaceutical composition recipients, since human nasal niches are diverse environments and individual strains may differ in their ability to colonize a given nasal niche; and (ii) maximize the number of beneficial, protective mechanisms of D. pigrum introduced in a single pharmaceutical composition. Identification of genetically diverse strain combinations can be achieved by (i) maximizing the calculated pangenome size in a set of 3, 4 or 5 strains,(ii) performing a cluster analysis based on single nucleotide polymorphisms in the genomes of the strains and selecting at least one strain per cluster, (hi) maximizing the number of distinct bacteriocins predicted to be expressed (based on genomic sequencing data and homology analysis) in a set of 3, 4 or 5 strains, or (iv) a combination of two or more of these approaches.[000201] Tn the analysis of genetic relatedness of the collection of D. pigrum strains, strains isolated from several unrelated, non-cohabitating human donors were grouped in a single closely related lineage and core genome cluster. This finding suggests that these closely related strains reflect a clonal expansion within the D. pigrum species, which can correspond to the ability of a particular lineage of D. pigrum to stably colonize diverse hosts as compared to most other D. pigrum strains. The mixtures of D. pigrum for incorporation in pharmaceutical compositions are described in Table 35. These mixtures were selected based on the criteria described above.Table 35 - Pharmaceutical composition mixtures of D. pigrum strains[000202] Additionally, single strain pharmaceutical compositions were identified using the selection criteria described above. K087-C3 (A27 SEQ ID NO: 4) was identified for inclusion in a therapeutic pharmaceutical composition. A27 had a strong antagonism profile versus pathogens in vitro and was the most competitive D. pigrum that inhibits other strains of D. pigrum in in vitro assays.[000203] K835_E5 (A51 SEQ ID NO: 8) is another strain of interest for a pharmaceutical composition due to its strong antagonism profile versus pathogens in vitro and also the inability of other D. pigrum to inhibit this strain in in vitro competition assays. It could complementA27 (SEQ ID NO: 4) because it is from another cluster.[000204] EXAMPLE 13: Effects of pH in D. pigrum[000205] Multiple growth conditions for D. pigrum were tested to identify conditions that maximized culture densify as determined by optical densify (OD) reached at stationary phase. To identify’ the growth condition for D. pigrum with maximized culture densify, multiple growth conditions for D. pigrum were tested. Liquid media broths were generated with pH adjusted to 7.2, but with different buffering agents with differing buffering capacities. In addition to buffering agent (shown in Table 36), liquid media for this optimization experiment consisted of IX Columbia broth base, 1.5% (weight / volume) Dextrose, and 2% (volume / volume) Tween 80. The pH of the broths were adjusted and measured at 60 degrees Celsius. A comparison of eight buffering conditions demonstrated that growth was maximized in 25 mM EPPS (3-[4-(2-Hydroxyethyl)piperazin-l-yl]propane-l-sulfonic acid). D. pigrum w as grow n for 16 hours at 37 degrees Celsius before OD measurements were taken.Table 36 - Comparisons of buffering solutions for D. pigrum growth[000206] Additionally, broths were generated with EPPS as the buffering agent at different pH levels and with different supplements. Liquid media for this optimization experiment was made of IX Columbia broth base, variable amounts of dextrose (as indicated in Table 37), 2% (volume / volume) Tween 80, and buffering agent as indicated in Table 37. Multiple pHconditions were tested as indicted in Table 37; pH was measured at 60 degrees Celsius. D. pigrum was inoculated and grown for overnight at 37 degrees Celsius before OD measurements were taken. A comparison of fifteen conditions demonstrated that growth was maximized in broth containing 25 mM EPPS adjusted to pH 8.5 and supplemented with 1% (w / v) dextrose. The pH of this media increased to about 9. 1 when cooled to room temperature (23 degrees Celsius).[000207] Table 37. Comparisons of supplemented buffering solutions for D. pigrum growth[000208] EXAMPLE 14: 16s rRNA Gene Sequences of D. pigrutn[000209] The strains of D. pigrum described above were sequenced using whole genome sequencing and genomes or 16s rRNA gene sequences were assembled. The 16s rRNA gene sequences from the isolated strains are shown below in Table 38, which shows the DP isolate name, the WGS status, and the sequence annotation source (SeqSource). The sequencing showed strains of D. pigrum had 4 variable copies of the 16s rRNA sequence, which is shown in the SeqSource column as “1”, ”2". “3”, or “4'’.[000210] Table 38 - 16S rRNA Sequences from D. pigruin isolates[000211] While preferred embodiments of the present disclosure have been shown and described herein, such embodiments are provided by way of example only. Numerous variations, changes, and substitutions are within the scope of the disclosure. Various alternatives to the embodiments of the disclosure described herein can be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.
Claims
CLAIMSWhat is claimed is:1 . A pharmaceutical composition, comprising: a live, purified population of bacteria comprising: a first Dolosigranulum pigrum strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; and a pharmaceutically acceptable excipient.
2. The pharmaceutical composition of claim 1, wherein the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 1.
3. The pharmaceutical composition of claim 1. wherein the first Dolosigranulum pigrum strain comprises the 16S rRNA gene of SEQ ID NO: 1.
4. The pharmaceutical composition of claim 1, wherein the first Dolosigranulum pigrum strain comprises a genome with 4 copies of a 16S rRNA gene sequence.
5. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprise a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2, 3, 4, or 5.
6. The pharmaceutical composition of claim 5, wherein the one or more strains of Dolosigranulum pigrum comprises the 16S rRNA gene sequence with at least 99% sequence identity7over at least 1000 bases to SEQ ID NO: 2, 3, 4, or 5.
7. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprises a 16S rRNA gene sequence of any one of SEQ ID NO: 2, 3, 4, or 5.
8. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4, 6, or 7.
9. The pharmaceutical composition of claim 8. wherein the one or more strains of Dolosigranulum pigrum comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 4, 6, or 7.
10. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria further comprises one or more strains of Dolosigranulum pigrum which comprises a 16S rRNA gene sequence of any one of SEQ ID NO: 4, 6, or 7.
11. The pharmaceutical composition of claim 1 wherein the live, purified population of bacteria further comprises: at least one strain of Corynebacterium.
12. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is formulated for intranasal administration or oral administration.
13. The pharmaceutical composition of any one of claims 1 -12, wherein the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form.
14. The pharmaceutical composition of any one of claims 1-13, wherein the pharmaceutical composition is in a gel form.
15. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition in a nasal spray bottle.
16. The pharmaceutical composition of any one of claims 1-11, wherein the pharmaceutical composition is in a dosage form of a suspension, capsule, gel. tablet, lozenge, pill, or powder.
17. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria is lyophilized.
18. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria comprises at least one bacteriocin.
19. The pharmaceutical composition of claim 18, wherein the bacteriocin comprises mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof.
20. The pharmaceutical composition claim 1, wherein the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes.21 . The pharmaceutical composition of claim 11, wherein the Corynebacterium comprises C. accolens, C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, C. propiquu or C. striatum.
22. The pharmaceutical composition of claim 11, wherein the Corynebacterium comprises Corynebacterium pseudodiphtheriticum.
23. The pharmaceutical composition of claim 22, wherein the at least one strain of Corynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700.
24. The pharmaceutical composition of claim 1, wherein the live, purified population ofbacteria is present in a total amount of at least 10A3 cfu.
25. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria is present in a total amount of up to 10A15 cfu.
26. The pharmaceutical composition of claim 1, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
27. A pharmaceutical composition, comprising: a live, purified population of bacteria comprising: at least two of the following Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; and a fifth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 5; and a pharmaceutically acceptable excipient.
28. The pharmaceutical composition of claim 27, wherein the at least two Dolosigranulum pigrum strains comprises a genome with 4 copies of a 16S rRNA gene sequence.
29. The pharmaceutical composition of claim 27, wherein the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 1 .
30. The pharmaceutical composition of claim 27, wherein the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 2.31 . The pharmaceutical composition of claim 27, wherein the third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 3.
32. The pharmaceutical composition of claim 27, wherein the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequenceidentity over at least 1000 bases to SEQ ID NO: 4.
33. The pharmaceutical composition of claim 27, wherein fifth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 5.
34. The pharmaceutical composition of claim 27, wherein the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 1.
35. The pharmaceutical composition of claim 27, wherein the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 2.
36. The pharmaceutical composition of claim 27, wherein the third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 3.
37. The pharmaceutical composition of claim 27, wherein the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4.
38. The pharmaceutical composition of claim 27, wherein the fifth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 5.
39. The pharmaceutical composition of claim 27, wherein the pharmaceutical composition, comprises: a live, purified population of bacteria comprising: the following Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; and a fifth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 5 and a pharmaceutically acceptable excipient.
40. A pharmaceutical composition, comprising: a live, purified population of bacteria comprising: at least two of the following Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1;a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 6; and a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 7; and a pharmaceutically acceptable excipient.
41. The pharmaceutical composition of claim 40, wherein the at least two Dolosigranulum pigrum strains comprises a genome with 4 copies of a 16S rRNA gene sequence.
42. The pharmaceutical composition of claim 40, wherein the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 1.
43. The pharmaceutical composition of claim 40, wherein the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 4.
44. The pharmaceutical composition of claim 40, wherein the third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 6.
45. The pharmaceutical composition of claim 40, wherein the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 7.
46. The pharmaceutical composition of claim 40, wherein the first Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 1.
47. The pharmaceutical composition of claim 40, wherein the second Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4.
48. The pharmaceutical composition of claim 40, wherein the third Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 6.
49. The pharmaceutical composition of claim 40, wherein the fourth Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 7.
50. The pharmaceutical composition of claim 40, comprising: a live, purified population of bacteria comprising: the following Dolosigranulum pigrum strains:a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; a third strain, which comprises a 16S rRNA gene sequence w ith at least 99% sequence identity to SEQ ID NO: 6; and a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity’ to SEQ ID NO: 7; and a pharmaceutically acceptable excipient.
51. A pharmaceutical composition, comprising: a live, purified population of bacteria comprising: a mixture of Dolosigranulum pigrum strains that comprise at least about 40% or at least about 45% of the total genes of a Dolosigranulum pigrum pangenome; and a pharmaceutically acceptable excipient.
52. The pharmaceutical composition of claim 51, wherein the pharmaceutical composition comprises at least 3, 4, 5 or more strains of Dolosigranulum pigrum.
53. The pharmaceutical composition of claim 51, wherein the Dolosigranulum pigrum strains comprises a 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to one or more of: SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7.
54. A pharmaceutical composition, comprising: a live, purified population of bacteria comprising: a mixture of Dolosigranulum pigrum strains from at least 3, or optionally 4 different phylogenetic clades, wherein the phylogenetic clades are determined by a core genome single nucleotide polymorphism (SNP) phylogenetic analysis; and a pharmaceutically acceptable excipient.
55. The pharmaceutical composition of claim 54, wherein the pharmaceutical composition comprises at least 3, 4, 5 or more strains of Dolosigranulum pigrum.
56. The pharmaceutical composition of claim 54, wherein the Dolosigranulum pigrum strains comprises a 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to one or more of: SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7.
57. A pharmaceutical composition, comprising: a live, purified population of bacteria comprising:a mixture of Dolosigranulum pigrum strains that comprise at least 4 different bacteriocins; and a pharmaceutically acceptable excipient.
58. The pharmaceutical composition of claim 57, wherein the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains with at least 99% sequence identity to the 16S rRNA gene sequence of SEQ ID NO: 1-5.
59. The pharmaceutical composition of claim 57, wherein the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains comprising the 16S rRNA gene sequence of SEQ ID NO: 1-5.
60. The pharmaceutical composition of claim 57, wherein the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains with at least 99% sequence identity to the 16S rRNA gene sequence of SEQ ID NO: 1, and / or SEQ ID NO: 4-7.
61. The pharmaceutical composition of claim 57, wherein the mixture of Dolosigranulum pigrum strains comprises two or more of Dolosigranulum pigrum strains comprising the 16S rRNA gene sequence of SEQ ID NO:
1. and / or SEQ ID NO: 4-7.
62. The pharmaceutical composition of claim 57, wherein the bacteriocins comprise one or more of the following bacterocins: mersacidin, propionicinsm, lactococcinlcn, haloduracinalpha, or macedovicin.
63. The pharmaceutical composition of claim 57, wherein the mixture of Dolosigranulum pigrum strains comprise 5 different bacteriocins.
64. A pharmaceutical composition, comprising: a live, purified population of bacteria comprising: a Dolosigranulum pigrum strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 4; and a pharmaceutically acceptable excipient.
65. The pharmaceutical composition of claim 64, wherein the Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 4.
66. The pharmaceutical composition of claim 64, wherein the Dolosigranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4.
67. A pharmaceutical composition, comprising: a live, purified population of bacteria comprising: a first Dolosigranulum pigrum strain, which comprises a 16S rRNAgene sequence with at least 99% sequence identity to SEQ ID NO: 8; and a pharmaceutically acceptable excipient.
68. The pharmaceutical composition of claim 67, wherein the Dolosigranuhim pigrum strain comprises the 16S rRNA gene sequence with at least 99% sequence identity over at least 1000 bases to SEQ ID NO: 8.
69. The pharmaceutical composition of claim 67, wherein the Doloslgranulum pigrum strain comprises the 16S rRNA gene sequence of SEQ ID NO: 8.
70. The pharmaceutical composition of any one of claims 27-69, wherein the live, purified population of bacteria further comprises: at least one strain of Corynebacteri um.
71. The pharmaceutical composition of any one of claims 27-70, wherein the pharmaceutical composition is formulated for intranasal administration or oral administration.
72. The pharmaceutical composition of any one of claims 27-71, wherein the pharmaceutical composition is in a liquid, solid, semisolid, or aerosol dosage form.
73. The pharmaceutical composition of any one of claims 27-72, wherein the pharmaceutical composition is in a gel form.
74. The pharmaceutical composition of any one of claims 27-73, wherein the pharmaceutical composition is comprised in a nasal spray bottle.
75. The pharmaceutical composition of any one of claims 27-70, wherein the pharmaceutical composition is in a dosage form of a suspension, capsule, gel, tablet, lozenge, pill, or powder.
76. The pharmaceutical composition of any one of claims 27-75, wherein the live, purified population of bacteria is lyophilized.
77. The pharmaceutical composition of any one of claims 27-56 or 64-69, wherein the live, purified population of bacteria comprises at least one bacteriocin.
78. The pharmaceutical composition of claim 77, wherein the bacteriocin comprises mersacidin. propionicinsm, lactococcinlcn, haloduracinalpha, macedovicin, or any combination thereof.
79. The pharmaceutical composition of any one of claims 27-78, wherein the live, purified population of bacteria comprises no more than 2 antimicrobial resistance genes.
80. The pharmaceutical composition of claim 70, wherein the Corynebacterium comprises C. accolens. C. pseudodiphtheriticum, C. amycolatum, C. propinquum, C. glutamicum, C. propiquu or C. striatum.
81. The pharmaceutical composition of claim 70, wherein the Corynebacterium comprises Corynebacterium pseudodiphtheriticum.
82. The pharmaceutical composition of claim 81, wherein the at least one strain ofCorynebacterium pseudodiphtheriticum comprises JCM 1320 or ATCC 10700.
83. The pharmaceutical composition of any one of claims 27-82, wherein the live, purified population of bacteria is present in a total amount of at least 10A3 cfu.
84. The pharmaceutical composition of any one of claims 27-83, wherein the live, purified population of bacteria is present in a total amount of up to 10 15 cfu.
85. The pharmaceutical composition of any one of claims 27-84, wherein the live, purified population of bacteria is present in a total amount of 10A3 to 10A12 cfu.
86. A kit, wherein the kit comprises: one or more containers comprising the pharmaceutical composition of any one of claims 1-85.
87. A kit, wherein the kit comprises: a first container comprising one or more of the following live and purified Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 1 S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 4; a fifth strain, which comprises a 16S rRNA gene sequence w ith at least 99% sequence identity to SEQ ID NO: 5; a sixth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 6; a seventh strain, which comprises a 16S rRNA gene sequence with at least99% sequence identity to SEQ ID NO: 7; andan eighth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 8, wherein the live and purified Dolosigranuhim pigrum are lyophilized; and a second container comprising a distilled water.
88. The kit of claim 87, wherein the first container further comprises a strain of C. pseudodiphtherilicum.
89. A method of administering the pharmaceutical composition of any one of claim 1-85 to a subject, comprising administering an amount sufficient to treat a disease in the subj ect.
90. The method of claim 89, wherein the disease is selected from the group consisting of: an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, anon-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory7tract infection (including infection with MRSA or MSSA), a tonsilitis, an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory' tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community' acquired pneumonia (CAP)), a primary' Ciliary dyskinesia, a Severe acute respiratory- syndrome (SARS), a COVID- 19, a tuberculosis, a walking pneumonia, a whooping cough (pertussis), an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, an otitis media with or without effusion, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in an immunosuppressed population.91 . A method of administering the pharmaceutical composition of any one of claim 1-85 to a subject comprising administering an amount sufficient to reduce the abundance of a pathogenic bacteria in the subject, wherein the pathogenic bacteria are selected from the group consisting of: Staphylococcus aureus, Acinetobacter baumannii,Pseudomonas aeruginosa, Moraxella catarrhalis, Plaemophilus influenzae, and any combination thereof.
92. The pharmaceutical composition of any one of claims 1-85 for use in the treatment of a disease in a subject, wherein the disease is selected from the group consisting of: an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, a non-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRS A or MSSA), a tonsilitis, an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e.g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, a lower respiratory tract infection (including infection with MRS A or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital- acquired pneumonia (HAP), ventilator-associated pneumonia (VAP). and community- acquired pneumonia (CAP)), a primary Ciliary dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, a whooping cough (pertussis), an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, an otitis media with or without effusion, a recunent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in an immunosuppressed population.
93. Use of the pharmaceutical composition of any one of claims 1-85 in the manufacture of a medicament for the treatment of a disease in a subject, wherein the disease is selected from the group consisting of: an acute bacterial rhinosinusitis, an adenoid and / or tonsil hypertrophy, an allergic rhinitis, a chronic rhinosinusitis (including with or without a nasal polyposis), an epiglottitis, anon-allergic rhinitis, an obstructive sleep apnea, a pharyngitis, an upper respiratory tract infection (including infection with MRS A or MSSA), a tonsilitis, an acute lung injury, an acute respiratory distress syndrome (ARDS), an asthma exacerbation, an atypical pneumonia, a bacterial pneumonia, a bronchiolitis, a bronchitis (e g., emphysema or chronic bronchitis), a chronic obstructive pulmonary disease (COPD), a cystic fibrosis, an idiopathic pulmonary fibrosis (IPF), an interstitial lung disease (ILD), a Kartagener syndrome, alower respiratory tract infection (including infection with MRSA or MSSA), a lung transplant rejection, a Middle East Respiratory Syndrome (MERS), a pneumonia (including hospital-acquired pneumonia (HAP), ventilator-associated pneumonia (VAP), and community acquired pneumonia (CAP)), a primary Ciliary dyskinesia, a Severe acute respiratory syndrome (SARS), a COVID-19, a tuberculosis, a walking pneumonia, a whooping cough (pertussis), an acute otitis media, an acute otitis media, a chronic suppurative otitis media, an eustachian tube dysfunction, an otitis externa, a recurrent otitis media, an otitis media with or without effusion, a recurrent bone infection, a post-surgical soft tissue infection, a post-surgical bone infection, and / or an infection in an immunosuppressed population.
94. A method of treating a recunent S. aureus infection in a subject with chronic rhinosinusitis (CRS) comprising administering the pharmaceutical composition of any one of claims 1-85 to the subject, wherein the administering comprises an amount sufficient to treat the recurrent S. aureus infection in the subject with chronic CRS.
95. The method of claim 94, wherein the CRS comprises CRS with nasal polyps (CRSwNP).
96. The method of claim 94, w herein the CRS comprises CRS without nasal polyps (CRSwNP).
97. The method of any one of claims 94-96, wherein the pharmaceutical composition is administered following an antibiotic therapy, a steroid therapy, an antibody therapy, or any combination thereof.
98. The method of any one of claims 94-97, wherein the antibiotic therapy comprises a macrolide and optionally wherein the macrolide comprises an azithromycin, a clarithromycin, an erythromycin, or any combination thereof.
99. The method of any one of claims 94-97, wherein the steroid therapy comprises a prednisone, a beclomethasone dipropionate, a triamcinolone acetonide, a flunisolide, a budesonide, a fluticasone propionate, a mometasone furoate, a ciclesonide, a fluticasone furoate, or any combination thereof.
100. The method of any one of claims 94-97, wherein the antibody therapy comprises a dupilumab, an omalizumab, a mepolizumab, or any combination thereof.
101. The method of any one of claims 94-97, w herein the antibody therapy comprises an antibody that selectively binds (a) IL -4 and IL-13, (b) IL -4, or (c) IgE.
102. A method for treatment of a viral respiratory infection, the method comprising:administering to a subject the pharmaceutical composition of any one of claims 1-85 , wherein the live, purified population of bacteria is present in an amount sufficient for treatment of the viral respiratory infection.
103. The method of claim 102, wherein the viral respiratory infection is from a coronavirus.
104. The method of claim 103, wherein the coronavirus is SARS-CoV-2.
105. The method of claim 102, wherein the live, purified population of bacteria is present in an amount sufficient for reduction in colonization of a pathogenic virus in a nasal cavity of the subject.
106. The method of claim 102, wherein the live, purified population of bacteria is present in an amount sufficient for reduction in colonization of a pathogenic virus in a lung of the subject.
107. The method of any one of claims 105-106. wherein the pathogenic vims is SARS- CoV-2.
108. The method of claim 102, wherein the live, punfied population of bacteria is present in an amount sufficient for reduction in protein expression of ACE2 in an airway of the subject.
109. The method of claim 102, wherein the live, purified population of bacteria is present in an amount sufficient for reduction in protein expression of ACE2, TMPRSS2, or both proteins in an airway of the subj ect.
110. The method of any one of claims 102 to 109, wherein the live, purified population of bacteria is administered intranasally.
111. The method of any one of claims 102 to 110, wherein the subject is an infant, a child, or an adult.
112. The method of any one of claim 102 to 111, wherein the subject has obesity, a diabetes, an asthma, a chronic lung disease, a sickle cell disease, or any combination thereof.
113. The method of any one of claim 102 to 112, wherein the subject is obese, immunocompromised, or both.
114. A pharmaceutical composition comprising a conditioned cell free media of one or more of the following live and purified Dolosigranulum pigrum strains: a first strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 1; a second strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 2; a third strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 3; a fourth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity' to SEQ ID NO: 4; a fifth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 5; a sixth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 6; a seventh strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 7; and an eighth strain, which comprises a 16S rRNA gene sequence with at least 99% sequence identity to SEQ ID NO: 8.
115. The pharmaceutical composition of claim 114, wherein the conditioned cell free media comprises a fraction of media that is less than 10 kDa in size.
116. The pharmaceutical composition of claim 114, wherein the first strain comprises the 16S rRNA gene sequence of SEQ ID NO: 1.
117. The pharmaceutical composition of claim 114, wherein the second strain comprises the 16S rRNA gene sequence of SEQ ID NO: 2.
118. The pharmaceutical composition of claim 114. wherein the third strain comprises the 16S rRNA gene sequence of SEQ ID NO: 3.
119. The pharmaceutical composition of claim 114, wherein the fourth strain comprises the 16S rRNA gene sequence of SEQ ID NO: 4.
120. The pharmaceutical composition of claim 114, wherein the fifth strain comprises the 16S rRNA gene sequence of SEQ ID NO: 5.
121. The pharmaceutical composition of claim 114, wherein the sixth strain comprises the 16S rRNA gene sequence of SEQ ID NO: 6.
122. The pharmaceutical composition of claim 114. wherein the seventh strain comprises the 16S rRNA gene sequence of SEQ ID NO: 7.
Citation Information
Patent Citations
Airway medicaments
US20220072066A1
Methods and compositions for treating ulcerative colitis
US20230030056A1