Sequencing library normalization methods
By employing a dCas or dArgonaute protein-gRNA complex to bind and extract adapter sequences in sequencing libraries, the method addresses the inaccuracies in existing concentration normalization techniques, achieving consistent sequencing results across varying sample concentrations.
Patent Information
- Application Number
- PCT/US2025/026068
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-24
- Filing Date
- 2025-04-23
- Publication Date
- 2025-10-30
Smart Images

Figure US2025026068_30102025_PF_FP_ABST
Abstract
Description
[0001]SEQUENCING LIBRARY NORMALIZATION METHODS RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 638,254, filed April 24, 2024, the entire contents of which are incorporated herein by reference. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The contents of the electronic sequence listing (W109470023WO00-SEQ-EMB.xml; Size: 552,942 bytes; and Date of Creation: April 23, 2025) are herein incorporated by reference in its entirety. BACKGROUND Massively parallel, deep sequencing and next generation sequencing (NGS) enables large-scale DNA and RNA sequencing. These methods involve parallel multiplexed analysis of nucleic acid sequences on a massive scale, allowing for millions to billions of sequences from individual strands to be analyzed separately but simultaneously. The multiplexed analysis can be challenging because different samples to be analyzed often vary in the amount of nucleic acids present, which can lead to inaccuracies where low concentration samples are under-sequenced and high concentration samples are over-sequenced. Therefore, various methods for the normalization of nucleic acid concentrations between samples have been employed. Spectrophotometry, electrophoreses, fluorometry, and quantitative PCR (qPCR) have been used to detect the concentration of nucleic acids in a sample in order to normalize concentrations between samples. Each of these methods has disadvantages such as inaccuracy introduced by manual adjustments being made, lack of sensitivity, and multiple steps involving substantial time and / or expense. SUMMARY This disclosure describes, in some aspects, methods and compositions for normalizing polynucleotide concentrations between two or more polynucleotide sequencing libraries. Polynucleotide preparation for sequencing (e.g., next-generation sequencing (NGS)) often 12372134.1 involves adding adapter polynucleotide sequences to the polynucleotides. Certain technologies, like ELEMENT, PACBIO, and ULTIMA sequencing, use the adapter sequences to perform sequencing of the polynucleotides. It is recognized herein that these adapter sequences can be leveraged to normalize polynucleotide concentrations between different polynucleotide sequencing libraries. Specifically, it is recognized that polynucleotide sequencing library normalization may be achieved by contacting a polynucleotide sequencing library with a predetermined amount of a ribonucleoprotein that binds to an adapter sequence of the polynucleotide library (e.g., a catalytically inactive CRISPR associated protein (dCAS)-guide RNA (gRNA) complex) and extracting the polynucleotides that (1) comprise the adapter and (2) are bound by the ribonucleoprotein complex. Additionally, adapter sequence may comprise an index which can be used for library normalization. Adapter sequence indexes are used in multiplexed sequencing where multiple different samples are combined together and sequenced in the same experiment. Each sample is associated with an index with a sequence that can be used in bioinformatic analysis to determine which sample the polynucleotide came from. It is recognized herein that normalization in multiplexed sequencing libraries could be performed by targeting index regions of adapter. Additionally, the sequences of index regions are far less constrained than static regions of adapter sequences because static regions are used by the sequencer (e.g., for binding to an ILLUMINA sequencing flow cell) but index regions are not. Because of this, a Cas protein protospacer adjacent motif (PAM) or reverse complements of a PAM (rPAM) can easily be inserted into index regions (or adjacent to index regions) to allow for normalization using a guide RNA that is complementary to the index or a reverse complement of the index. In some aspects, this disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence of any one of SEQ ID NOs: 1-4;(ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the adapter sequence, or a reverse complement of the adapter sequence, of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein or the dArgonaute protein is cognate to the guide polynucleotide; (iii) contacting 12372134.1 the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples. In some aspects, the present disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index, or a reverse complement of the index, of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein or the dArgonaute protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples. In some embodiments, the targeting region is complementary to a static region of an adapter sequence or a reverse complement thereof. In some embodiments, the solutions produced from the at least two samples are combined into a single solution after step (ii) and before step (iii). In some aspects, the present disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising: (i) obtaining a mixture of the at least two samples, wherein the target polynucleotides of the at least two samples comprise an adapter sequence and an index, wherein the at least two samples do not have the same index, and, for each sample, obtaining a guide polynucleotide comprising a targeting region that is complementary to the index, or a reverse complement of the index, of the sample; (ii) producing a solution, the producing comprising combining (a) the mixture of the at least two samples, (b) a predetermined concentration of each a guide polynucleotide; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined 12372134.1 concentration of the dCas protein or the dArgonaute protein is cognate to its respective guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples. In some embodiments, the predetermined concentration of each guide polynucleotide is different. In some embodiments, the different predetermined guide polynucleotide concentrations normalize the target polynucleotides of the at least two samples in a predetermined stoichiometric ratio. In some aspects, the present disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a protospacer adjacent motif (PAM); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide comprising a targeting region that is complementary to a reverse compliment of a portion of the adapter sequence that is adjacent to the 5’ end of the PAM of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, the solutions produced from the at least two samples are combined into a single solution after step (ii) and before step (iii). In some embodiments, the portion is 15-30 nucleotides. In some aspects, the present disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a reverse complement of a protospacer adjacent 12372134.1 motif (rPAM); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide comprising a targeting region that is complementary to a portion of the adapter sequence that is adjacent to the 3’ end of the rPAM of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples. In some embodiments, the solutions produced from the at least two samples are combined into a single solution after step (ii) and before step (iii). In some aspects, the present disclosure provides a method of enriching a target polynucleotide in a sample, the method comprising: (i) obtaining the sample, wherein the target polynucleotide of the sample comprises an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that complementary to the index or a reverse complement of the index; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein or the dArgonaute protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase. In some embodiments, the index region is adjacent to a PAM. In some embodiments, the PAM is adjacent to the 5’ terminal of the index. In some embodiments, the index region is adjacent to a rPAM. In some embodiments, the rPAM is adjacent to the 3’ terminal of the index. In some embodiments, the index comprises a nucleic acid sequence of any one of the index sequences described herein. In some embodiments, the guide polynucleotide comprises a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide or an Argonaute guide polynucleotide. In some embodiments, the Cas gRNA polynucleotide targeting region is a homology region. In some 12372134.1 embodiments, the Cas gRNA polynucleotide comprises a homology region of any one of SEQ ID NOs: 5-10. In some embodiments, the Argonaute guide polynucleotide is an siRNA, miRNA, piRNA, shRNA or siDNA. In some embodiments, the guide polynucleotide is a DNA polynucleotide. In some embodiments, the guide polynucleotide is a RNA polynucleotide.In some embodiments, the guide polynucleotide comprises a modified nucleic acid. In some embodiments, the modified nucleic acid comprises 2′F RNA, 2′OMe RNA, and / or a phosphorothioate bonds (PS). In some embodiments, the guide polynucleotide is a Cas gRNA polynucleotide and the Cas gRNA polynucleotide does not comprise a modified nucleic acid in a position that interacts with a Cas protein cognate to the gRNA. In some embodiments, the dCas is a catalytically-inactive Cpf1, C2c1, C2c3, C2c2, CasX, or CasY protein. In some embodiments, the dCas protein comprises an amino acid sequence of SEQ ID NO: 13. In some embodiments, the dArgonaute is a catalytically-inactive LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo. In some embodiments, the affinity tag binding molecule comprises Ni2+ and the affinity tag comprises a His Tag. In some embodiments, the affinity tag binding molecule comprises biotin and the affinity tag comprises avidin. In some embodiments, the affinity tag binding molecule comprises an anti-myc antibody and the affinity tag comprises a myc tag. In some embodiments, the affinity tag and corresponding affinity tag binding molecule are selected from Table 1. In some embodiments, the solid phase comprises magnetic beads. In some embodiments, separating the solution from the solid phase comprises immobilizing the solid phase and washing the solid phase. In some embodiments, extracting the target polynucleotides from the solid phase comprises combining the solid phase and protease. In some embodiments, extracting the target polynucleotides from the solid phase comprises combining the solid phase and proteinase K in a solution sufficient for proteinase K activity. In some embodiments, proteinase K digests the dCas protein or dArgonaute protein that is bound to the solid phase thereby extracting the target polynucleotides. 12372134.1 In some embodiments, steps (i)-(v) are performed in sequential order. In some embodiments, normalizing comprises making the concentration of the of target polynucleotides between the at least two samples within 15% of one another after normalization. In some aspects, the present disclosure provides a guide polynucleotide comprising a targeting region that is complementary to any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4 or a reverse complement of any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4. In some aspects, the present disclosure provides a guide polynucleotide comprising a targeting region that is complementary to an index of any one of the index sequences described herein or a reverse complement the index sequences described herein. In some embodiments, the guide polynucleotide comprises a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide or an Argonaute guide polynucleotide. In some embodiments, the Cas gRNA polynucleotide targeting region is a homology region. In some embodiments, the Cas gRNA polynucleotide comprises a homology region of any one of SEQ ID NOs: 5-10. In some embodiments, the Argonaute guide polynucleotide is an siRNA, miRNA, piRNA, shRNA or siDNA. In some embodiments, the guide polynucleotide is a DNA polynucleotide. In some embodiments, the guide polynucleotide is an RNA polynucleotide. In some embodiments, the guide polynucleotide comprises a modified nucleic acid. In some embodiments, the modified nucleic acid comprises 2′F RNA, 2′Ome RNA, and / or a phosphorothioate bonds (PS). In some embodiments, the guide polynucleotide is a Cas gRNA polynucleotide and the Cas gRNA polynucleotide does not comprise a modified nucleic acid in a position that interacts with a Cas protein cognate to the gRNA. In some aspects, the present disclosure provides a kit comprising: (a) a guide polynucleotide as described herein; and (b) a Cas protein or an Argonaute protein, or a polynucleotide sequence encoding a Cas protein or an Argonaute protein. In some embodiments, the Cas protein is a catalytically-inactive Cas protein (dCas). In some embodiments, the Cas protein is a Cas9 protein that is catalytically-inactive (dCas9). In some embodiments, the Cas9 protein comprises a D10A mutation and a H840A mutation. In some embodiments, the Cas protein is a catalytically-inactive Cpf1, C2c1, C2c3, C2c2, CasX, or CasY protein. In some embodiments, the dCas protein comprises an amino acid sequence 12372134.1 having at least 95% identity to SEQ ID NO: 13. In some embodiments, the dCas protein comprises an amino acid sequence of SEQ ID NO: 13. In some embodiments, the Argonaute protein is catalytically-inactive (dArgonaute). In some embodiments, the Argonaute protein is a CbAgo protein that is catalytically-inactive. In some embodiments, the Argonaute protein is a LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo protein that is catalytically- inactive. In some embodiments, the dArgonaute protein comprises an amino acid sequence having at least 95% identity to any one of SEQ ID NOs: 15-21. In some embodiments, the dArgonaute protein comprises an amino acid sequence of any one of SEQ ID NOs: 15-21. In some embodiments, the kit further comprises a catalytically active Cas protein or a catalytically active Argonaute protein. In some embodiments, the catalytically active Cas protein comprises Cpf1, C2c1, C2c3, C2c2, CasX, Cas9, or CasY. In some embodiments, the catalytically active Argonaute protein comprises LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo. In some embodiments, the guide polynucleotide is capable of binding to the Cas protein or the Argonaute protein to form a ribonucleoprotein complex and the ribonucleoprotein complex is capable of binding to an adapter sequence. In some embodiments, the kit further comprises a primer that is complementary to a portion of an adapter sequence. In some embodiments, the portion of the adapter sequence is located in the proximal portion of the adapter sequence. In some embodiments, the primer is not complementary to an adapter sequence that is complementary to the guide polynucleotide targeting region. In some aspects, the present disclosure provides a reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides comprise an adapter sequence of any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the adapter sequence or a reverse complement of the adapter sequence; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein. In some aspects, the present disclosure provides a reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides comprise an adapter sequence comprising an index; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index or a reverse complement of the index; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein. 12372134.1 In some aspects, the present disclosure provides a reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a PAM; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a reverse complement of a portion of the adapter sequence that is adjacent to the PAM of the target polynucleotides of the sample; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein. In some aspects, the present disclosure provides a reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a rPAM ;(ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a portion of the adapter sequence that is adjacent to the rPAM of the target polynucleotides of the sample; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein. In some embodiments, the predetermined concentration of the guide polynucleotide, or the dCas protein or the dArgonaute protein is lower than the concentration of target polynucleotide in the reaction mixture. In some embodiments, the dArgonaute protein comprises LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo, or a catalytically inactive variant thereof, and the guide polynucleotides are cognate to the dArgonaute protein. In some embodiments, the dCas protein comprises catalytically inactive Cpf1, C2c1, C2c3, C2c2, CasX, Cas9, or CasY, or a variant thereof, and the guide polynucleotides are cognate to the dCas protein. In some embodiments, the reaction mixture further comprises a catalytically active Cas protein or a catalytically active Argonaute protein. In some aspects, the present disclosure provides a ribonucleoprotein (RNP) complex comprising: (i) a guide polynucleotide provided herein; (ii) a Cas protein or an Argonaute protein that is cognate to the guide polynucleotide; and (iii) an adapter sequence of any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4 or an adapter sequence comprising an index of any one of the index sequences described herein, wherein the targeting region of the guide polynucleotide is complementary to the adapter sequence and wherein the guide polynucleotide is cognate to the Cas protein or the Argonaute protein. In some embodiments, the Argonaute protein comprises LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo, or a catalytically 12372134.1 inactive variant thereof. In some embodiments, the Cas protein comprises Cpf1, C2c1, C2c3, C2c2, CasX, Cas9, or CasY, or a catalytically inactive variant thereof. BRIEF DESCRIPTION OF THE FIGURES FIG.1 shows the distribution of ULTIMA Genomics libraries captured using dCas9 ribonucleoprotein (RNP) and ULTIMA Genomics single guide RNA (UG_sgRNA)1, UG_sgRNA_2, and UG_sgRNA_3. FIGs. 2A-2D show a schematic of library molecule denaturation and partial sequence extension to produce a double stranded PAM site. In FIG. 2A, a library molecule is ligated with two Y-shaped adapters at the 3’ and 5’ ends. In FIG. 2B, the library molecule is denatured and bound to a partial primer at the 3’ end. In FIG. 2C, the bound primer is extended with a polymerase, creating a complementary strand (dashed line), which does not span the entire 3’ adapter, but does comprise a double-stranded, full-length 5’ adapter, which contains a PAM site for dCas9 targeting. FIG. 2D illustrates the binding of a dCas9 molecule to the double-stranded PAM site. DETAILED DESCRIPTION Guide polynucleotides In some aspects, this disclosure describes a guide polynucleotide comprising a targeting region that is complementary to an ELEMENT adapter sequence, a PACBIO adapter sequence, an ULTIMA adapter sequence, or an index sequence in an adapter sequence. A “polynucleotide” refers to polymers of nucleotides (e.g., deoxyribonucleotides, ribonucleotides and modified nucleotides). The polymer may be in either single- or double- stranded form. Unless specifically limited, the term encompasses polynucleotides containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the naturally occurring nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs). 12372134.1 A “guide polynucleotide” refers a polynucleotide that (1) comprises a targeting region which is complementary to a target (e.g., an adapter sequence) and (2) that is capable of facilitating binding of a ribonucleoprotein complex comprising the guide polynucleotide to the target. In some embodiments, the guide polynucleotide is a CRISPR associated protein (Cas) guide RNA (gRNA) polynucleotide or an Argonaute guide polynucleotide. In some embodiments, a Cas gRNA polynucleotide refers to a two polynucleotide system comprising a tracrRNA and a crRNA e.g., as described in Karvelis T et al., RNA Biol. 2013 May;10(5):841- 51. PMID: 23535272. The tracrRNA comprises a sequence encoding a stem loop structure that associates with the Cas protein (e.g., dCas9). The crRNA comprises a homology region that is complementary to the target (e.g., an adapter sequence) and a region that is complementary to the tracrRNA. The crRNA and the tracrRNA may form a complex with the Cas protein, which in turn binds to a target DNA or RNA polynucleotide (depending on the Cas type). In some embodiments, a Cas gRNA polynucleotide refers to a single guide RNA (sgRNA) polynucleotide e.g., as described in Jinek M et al., Science. 2012 Aug 17;337(6096):816-21. doi: 10.1126 / science.1225829. A sgRNA comprises a sequence encoding a stem loop structure that associates with the Cas protein and a homology region. Many Cas proteins bind to polynucleotides (e.g., double stranded DNA) in a position that is adjacent to a protospacer adjacent motif (PAM) site. The reverse complement of the PAM is also called the rPAM. In some embodiments, the homology region is complementary to a portion of the adapter sequence that is adjacent to a PAM (e.g., sufficiently adjacent such that Cas binding to the adapter sequence can take place). In some embodiments, the homology region is complementary to a polynucleotide (e.g., an adapter of index) that is adjacent to the 5’ end of a PAM. In some embodiments, the homology region is complementary to a polynucleotide (e.g., an adapter of index) that is adjacent to the 3’ end of a rPAM. Methods of making and using gRNAs are known in the art, e.g., as described in Mohr SE, et al., FEBS J. 2016 Sep;283(17):3232-8. PMCID: PMC5014588. An Argonaute guide polynucleotide refers to a polynucleotide encoding a small interfering RNA (siRNA), microRNA (miRNA), P element-induced wimpy testis (PIWI)- interacting RNA (piRNA) and small interfering DNA (siDNA) e.g., as described in Wu J et al., J Adv Res. 2020 Apr 29;24:317-324, PMID: 32455006. In some embodiments, the Argonaute guide polynucleotide comprises a targeting region that is complementary to an adapter sequence as described herein. In some embodiments, a guide polynucleotide is single stranded (e.g., an 12372134.1 RNA Cas gRNA polynucleotide). In some embodiments, a guide polynucleotide is double stranded (e.g., double stranded DNA encoding a Cas gRNA polynucleotide, or dsRNA used an Argonaute guide polynucleotide). In some embodiments, a guide polynucleotide is an RNA molecule. In some embodiments, a guide polynucleotide is a DNA molecule. In some embodiments, the guide polynucleotide comprises modified nucleic acids (e.g., 2′F RNA, 2′OMe RNA, and / or a phosphorothioate bonds (PS)). Nucleic acids in a guide polynucleotide (e.g., an RNA guide polynucleotide like a Cas guide RNA) may be modified to increase the stability of the guide polynucleotide (e.g., reduce nuclease digestion). A Cas gRNA (e.g., a Cas9 gRNA) may comprise modified nucleic acids (e.g., 2′OMe) in regions of the gRNA that do not interact with the Cas protein (e.g., Cas9), and still maintain an ability to direct the Cas protein to the target, as described in Yin H et al., Nature Biotechnology 2017 Dec; 35(12): 1179-1187. In some embodiments, the Cas guide RNA polynucleotide comprises the modifications of the e-sgRNA as described in Yin et al. 2017. In some embodiments, a Cas9 sgRNA does not comprise a modified nucleic acid (e.g., a 2’OH modification) at one or more positions 22-27, 43-45, 47, 49, 51, 58, 59, 62, 63-65, 68-69, or 82 counted from the 5’ end of the sgRNA (i.e., with reference to an sgRNA of (GGGCGAGGAGCUGUUCACCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUU, (SEQ ID NO: 11)). In some embodiments, the sgRNA comprises 2’-O-methyl RNA bases. In 2’-O-methyl RNA bases, the 2’-hydroxyl (-OH) group of the ribose sugar in the RNA molecule is replaced by a methyl group (-CH3). This modification affects the ribose sugar, and the nitrogenous bases (adenine, guanine, cytosine, uracil) themselves are not typically modified in this context. The 2’-O-methyl RNA bases are 2’O-methyladenosine, 2’O-methylguanosine, 2’O-methylcytidine, and 2’O-methyluridine. In some embodiments, the sgRNA comprises the sequence: 5’- mA*mG*mA* rUrCrG rGrArA rGrArG rCrGrU rCrGrU rGrUrG rUrUrU rUrArG rArGrCrUrArG rArArA rUrArG rCrArA rGrUrU rArArA rArUrA rArGrG rCrUrA rGrUrC rCrGrU rUrArU rCrArA rCrUrU rGrArA rArArA rGrUrG rGrCrA rCrCrG rArGrU rCrGrG rUrGrC mU*mU*mU*rU-3’ (SEQ ID NO: 12) where mA and mG are 2’-O-methyladenosine, 2’O-methylguanosine RNA bases. 12372134.1 A “targeting region” of a guide polynucleotide refers to a region of the guide polynucleotide that is complementary to a target polynucleotide sequence (e.g., an adapter sequence) or a reverse complement of the target polynucleotide sequence. In some embodiments, the targeting region comprises a portion that has the same sequence as the target polynucleotide sequence. In some embodiments, the guide polynucleotide is a Cas gRNA polynucleotide comprising a homology region. A Cas gRNA polynucleotide homology region may comprise a series of contiguous amino acids that are complementary to a target polynucleotide sequence (e.g., an adapter sequence). In some embodiments, the homology region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides in length. In some embodiments, the homology region is 18-26 nucleotides in length. In some embodiments, the homology region is 17-24 nucleotides in length. In some embodiments, the homology region is 18-22 nucleotide in length. In some embodiments, the homology region is 20 nucleotides in length. In some embodiments, the homology region comprises a sequence that has the same sequence as a portion of the target polynucleotide sequence. In some embodiments, the guide polynucleotide is an Argonaute guide polynucleotide. Argonaute guide polynucleotides may be RNA interference (RNAi) polynucleotides. In some embodiments, the Argonaute guide polynucleotide comprises a targeting region of a small interfering RNA (siRNA), microRNA (miRNA), P element-induced wimpy testis (PIWI)- interacting RNA (piRNA) and small interfering DNA (siDNA) e.g., as described in Wu J et al., J Adv Res. 2020 Apr 29;24:317-324, PMID: 32455006. In some embodiments, the targeting region is complementary to an adapter sequence as described herein. In some embodiments, the targeting region is complementary to a static region (e.g., that generally does not change between adapters) of the adapter sequence. In some embodiments, the targeting region is complementary to a sequence comprising a region that was added to the sequence for the purpose of being complementary to a guide polynucleotide targeting region. For example, an additional sequence can be added to an adapter sequence for the purpose of being complementary to a guide polynucleotide targeting region (e.g., for use in library normalization). Such an additional sequence may be a sequence that is specifically bound by a Cas protein-gRNA complex or an Argonaute guide polynucleotide complex compared to other sequences in a polynucleotide sequencing library. In some embodiments, the targeting region is complementary to a next-generation sequencing adapter sequence (e.g., an ELEMENT sequence adapter, a PACBIO sequence 12372134.1 adapter, or an ULTIMA sequence adapter). ELEMENT, PACBIO, and ULTIMA sequence adapters are known in the art and exemplary adapters are in Table 2. In some embodiments, the targeting region is complementary to an index within an adapter sequence. An “index” as used here refers a polynucleotide within an adapter than can be used to identify the sample from which the polynucleotide came. For example, 5’ AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[index]ATCTCGTATGCCGTCTTC TGCTTG 3‘ (SEQ ID NO: 22). Adapters with indexes are typically used when combining multiple different samples together prior to sequencing .For example, prior to combining polynucleotide from different samples, the polynucleotides of the different samples are modified to comprise adapter sequences with an index. Polynucleotides of each sample have a different index. The different samples are then combined and sequenced. Using bioinformatic tools and the index sequence, sequences generated during sequencing can be associated with their corresponding sample. In some embodiments, the index is 2-40 nucleotides (SEQ ID NO: 22 and SEQ ID NOs: 529-566). In some embodiments, the index is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleotides. In some embodiments, the index is 20, 25, 30, 35, or 40 or more nucleotides. In some embodiments, the nucleotides of the index may be any combination or permutation of nucleotides A, T, G, or C. In some embodiments, index sequences do not comprise restriction cut sites that are used in preparations for sequencing. Index sequences are additionally known in the art. For example, ILLUMINA adapters frequently have index sequences as described in ILLUMINA document #1000000002694v16 (thesequencingcenter.com / wp-content / uploads / 2021 / 12 / illumina-adapter-sequences.pdf accessed April 19, 2024), the index sequences of which are incorporated by reference in their entirety. In some embodiments, a targeting region is complementary to an index region. In some embodiments, a targeting region that is complementary to an index may also refer to targeting region that is complementary to a reverse complement of the index. When a targeting region is complementary to an index region that has fewer nucleotides than the targeting region, the guide polynucleotide may also be complementary to nucleotides extending from the 5’ terminal and / or 3’ terminal of the index within the adapter sequence. For example, if the index region is GTTATGCT and the adapter region comprising the index is …GGCGGGTTATGCTATTTCCT (SEQ ID NO: 23), the targeting region may be complementary to the index region and the nucleotide 3’ and / or 5’ of the index. In another 12372134.1 example, the targeting region is complementary to the reverse complement of the index region and the nucleotide 3’ and / or 5’ of the index. In some embodiments, the adapter sequence is modified to comprise a Cas protein protospacer-adjacent motif (PAM) or a reverse complement of a PAM (rPAM)). A “protospacer-adjacent motif (PAM)” is a nucleotide motif (often 3 consecutive nucleotides in the polynucleotide) that is required for Cas protein binding to the target polynucleotide. The PAM is typically located on the DNA strand that is not complementary to the homology region of the guide RNA. In some embodiments, the PAM is adjacent to the 3’ end of the homology region of a Cas9 guide RNA. The canonical Cas9 PAM sequence is 5’-NGG, wherein N is any nucleotide A, G, C, or T. In some embodiments, the adapter sequence is modified to comprise a PAM or rPAM to facilitate binding of the Cas-gRNA complex to a double stranded version of the target polynucleotide. For example, a PAM sequence or a rPAM sequence may be added to the 3’ end or 5’ end of the adapter sequence or index. In some embodiments, the PAM or rPAM is adjacent to the index in the adapter sequence. “Adjacent” as used in the context of two different polynucleotides (e.g., a PAM and an index) means the two different polynucleotides are covalently bound to another with no intervening nucleotides between them. For example, if a PAM sequence is CGG and an index sequence is TTATCGTG the PAM and index would be adjacent in one of two configurations: CGGTTATCGTG (SEQ ID NO: 24) (PAM is on the 5’ terminal of the index) or TTATCGTGCGG (SEQ ID NO: 25) (PAM is on the 3’ terminal of the index). The PAM and index would not be adjacent to another if there were an intervening nucleic acid between them in the primary sequence, e.g., TTATCGTGACGG (SEQ ID NO: 26). In some embodiments, the PAM or rPAM is on the 5’ terminal of the index. In some embodiments, the PAM or rPAM is on the 3’ terminal of the index. In some embodiments, the PAM or rPAM is in the index. In some embodiments, the PAM or rPAM is adjacent to a reverse complement of an index. In some embodiments, the PAM or rPAM is adjacent to the 5’ end of a reverse complement of an index. In some embodiments, the PAM or rPAM is adjacent to the 3’ end of a reverse complement of an index. The term “complementary” as used herein refers to the degree of expected Watson-Crick base pairing between a first polynucleotide (e.g., a guide polynucleotide targeting region) and a second polynucleotide (e.g., an adapter sequence). Complementary nucleotides are, generally, A and T (or A and U), and G and C. In some embodiments, complementary refers to 100% 12372134.1 complementarity between two polynucleotides (e.g., a guide polynucleotide targeting region and an adapter sequence). In some embodiments, complementary refers to 70%, 80%, 90%, 95%, or 99% complementarity between two polynucleotides. For example, a targeting region may be complementary to an adapter sequence when one, two, or three nucleic acids in the targeting region are not complementary to the adapter sequence. In some embodiments, complementary refers to a sufficiently degree of Watson-Crick base pairing between a guide polynucleotide targeting region (of a RNP (e.g., dCas9 bound to a guide RNA) and an adapter sequence for the RNP to bind to the adapter sequence. In some embodiments, complementary refers to a sufficient degree of Watson-Crick base pairing between an Argonaute guide polynucleotide (e.g., a miRNA, siRNA, pwRNA, shRNA, or siDNA) and a target sequence (e.g., an adapter sequence) to direct binding of an Argonaute protein comprising the Argonaute guide polynucleotide to bind to the target. An “adapter sequence” refers to a polynucleotide added (e.g., ligated) to an end (e.g., 3’ and / or 5’) of a target polynucleotide for use in sequencing of the polynucleotide. In some embodiments, the adapter sequence refers to a sequence of nucleic acids encoding the adapter. In some embodiments, the adapter sequence may be used for sequencing using a particular sequencing platform. For example, ILLUMINA i5 / p5 and i7 / p7 adapter sequences may be used for sequencing using the ILLUMINA sequencing platform or ULTIMA Genomics ppmSeq adapter sequences may be used for sequencing using an ULTIMA Genomics sequencing platform. In some embodiments, the adapter sequence comprises a static region (e.g., that generally does not change between adapters) and a dynamic region (e.g., that may change between adapters). In some embodiments, the adapter sequence comprises a distal region (generally static), an index region (generally dynamic), and a proximal region (generally static). For example, an ILLUMINA adapter sequence may comprise a p5 region which is static, an index region which is dynamic, and an i5 region which is static; or an ULTIMA Genomics adapter sequence may comprise a ppmSeq adapter sequence, an index region which is dynamic, and a region which is static. In some embodiments, the guide polynucleotide targeting region is complementary to a static region of the adapter sequence. In some embodiments, the guide polynucleotide targeting region is complementary to the dynamic region of the adapter sequence. In some embodiments, the guide polynucleotide comprises a targeting region that is complementary to a static region of an adapter sequence (e.g., a distal region or a proximal region of an adapter sequence). In some 12372134.1 embodiments, the guide polynucleotide comprises a targeting region that is complementary to a dynamic region of an adapter sequence (e.g., an index). In some embodiments, at least some of the target polynucleotides comprise the same static adapter sequences (e.g., the same distal and / or proximal region). In some embodiments, the majority of the target polynucleotides comprise the same static adapter sequence. In some embodiments, all of the target polynucleotides comprise the same static adapter sequence. In some embodiments, the adapter sequence comprises an index. In some embodiments, the adapter sequence is an adapter sequence used in ILLUMINA, ION TORRENT, PACBIO, ELEMENT, ULTIMA, OMNIOME, SINGULAR, or MGI sequencing. In some embodiments, the adapter sequence used is a PACBIO, ELEMENT, or ULTIMA adapter sequence. In some embodiments, an adapter sequence is a PACBIO adapter sequence. In some embodiments, an adapter sequence is an ELEMENT adapter sequence. In some embodiments, an adapter sequence is an ULTIMA adapter sequence. In some embodiments, the adapter sequence is an adapter sequence from any one of the following kits: a WATCHMAKER DNA Library Prep Kit with Fragmentation or a WATCHMAKER RNA Library Prep Kit with Polaris Depletion ILLUMINA TruSeq PCR-Free Library Preparation Kit, a TruSeq Nano DNA Library Prep Kit, a NEXTERA DNA Library Prep Kit, a NEXTERA DNA XT Library Prep Kit, a NEXTERA Rapid Capture Exome Kit, a NEXTERA Rapid Capture Expanded Exome Kit, an AmpliSeq for ILLUMINA Library Prep Kit, an ILLUMINA RNA Prep with Enrichment Kit, an ILLUMINA Stranded mRNA Prep Kit, a TruSeq RNA Library Prep Kit, a TruSeq Stranded Total RNA Kit, a TruSeq Stranded mRNA Kit, a TruSeq Small RNA Kit, or an ULTIMA ppmSeq Kit. In some embodiments, the adapter sequence is an adapter sequence used in any one of the following kits: a NEBNEXT Fast DNA for ION TORRENT, a NEBNEXT Fast DNA Fragmentation & Library Prep Set for ION TORRENT, a THERMOFISHER Precision ID Library Kit, a THERMOFISHER Ion Xpress Plus Fragment Library Kit, a THERMOFISHER Ion Xpress Barcode Adapters 1-96 Kit, and / or a THERMOFISHER Ion AmpliSeq Transcriptome Human Gene Expression Kit. In some embodiments, the adapter sequence is an adapter sequence used in any one of the following kits: a PACBIO SMRTbell Template Prep Kit 1.0, a SMRTbell Barcoded Adapter Complete Prep Kit-96, or a Barcoded Adapter Kit. In some embodiments, the targeting region may be complementary to an adapter sequence used in a QIAGEN QIAseq Stranded RNA Library Kit or a QIAseq UPX 3’ Transcriptome Kit, a Perkin Elmer NEXTFLEX Rapid Directional RNA- 12372134.1 Seq Kit or a NEXTFLEX Small RNA-Seq Kit, or a Takara Bio SMART-Seq mRNA Kit or a SMART-Seq mRNA LP Kit. In some embodiments, the adapter sequence comprises a shared Y-adapter sequence. In certain embodiments, the shared Y-adapter sequence is a 13 bp sequence. In some embodiments, the shared Y-adapter sequence is a 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 bp sequence. Kits In some aspects, this disclosure describes a kit comprising: (a) a guide polynucleotide described herein; and (b) a Cas protein or an Argonaute protein, or a polynucleotide sequence encoding a Cas protein or an Argonaute protein (e.g., as described herein). In some embodiments, the kit comprises a Cas protein. A “Cas protein” refers to a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated protein. In some embodiments, the Cas protein has nuclease activity. In some embodiments, the Cas protein does not have nuclease activity (dCas). In some embodiments, the Cas protein has nicking activity (nickase). In some embodiments, the Cas protein is a Cas9 protein. “Cas9” refers to a Cas9 protein or a fragment thereof present in any bacterial species that encodes a Type II CRISPR / Cas9 system. See, for example, Makarova et al., Nature Reviews, Microbiology, 9: 467-477 (2011), including supplemental information. Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi et al., 2013, RNA Biol. 10(5): 726–37; Hou et al., 2013, Proc. Natl. Acad. Sci. USA 110(39):15644-49; Sampson et al., 2013, 497(7448):254-57; and Jinek et al., 2012, Science 337(6096):816-21. Full-length Cas9 is an RNA-mediated endonuclease comprising a recognition domain and two nuclease domains (HNH and RuvC, respectively). In the amino acid sequence, HNH is linearly continuous, whereas RuvC is separated into three regions, one left of the recognition domain, and the other two right of the recognition domain flanking the HNH domain. Cas9 from Streptococcus pyogenes is targeted to a genomic site in a 12372134.1 cell by interacting with a guide RNA that hybridizes to a 20-nucleotide DNA sequence that immediately precedes an NGG motif recognized by Cas9. In some embodiments, the Cas9 is a catalytically-inactive or nuclease-dead Cas9 (dCas9) that has been modified to inactivate Cas9 nuclease activity. Modifications include, but are not limited to, altering one or more amino acids to inactivate the nuclease activity or the nuclease domain. For example, and not to be limiting, D10A, H840A, and / or R1335K mutations can be made in Cas9 from Streptococcus pyogenes to inactivate Cas9 nuclease activity. In some embodiments, the Cas9 protein comprises a D10A mutation and a H840A mutation. Other modifications include removing all or a portion of the nuclease domain of Cas9, such that the sequences exhibiting nuclease activity are absent from Cas9. Accordingly, a catalytically- inactive Cas9 may include polypeptide sequences modified to inactivate nuclease activity or removal of a polypeptide sequence or sequences to inactivate nuclease activity. The catalytically-inactive Cas9 retains the ability to bind to DNA even though the nuclease activity has been inactivated. Accordingly, dCas9 includes the polypeptide sequence or sequences required for DNA binding but includes modified nuclease sequences or lacks nuclease sequences responsible for nuclease activity. In some embodiments, the catalytically-inactive Cas9 protein is a full-length Cas9 sequence from S. pyogenes lacking the polypeptide sequence of the RuvC nuclease domain and / or the HNH nuclease domain and retaining the DNA binding function. In other embodiments, the catalytically-inactive Cas9 protein sequences have at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identity to Cas9 polypeptide sequences lacking the RuvC nuclease domain and / or the HNH nuclease domain and retains DNA binding function. In some embodiments, the Cas protein is Alt-R™ S.p. dCas9 Protein V3 (IDT). In some embodiments, the Cas protein is a Cpf1 (Cas12a), C2c1, C2c3, C2c2, CasX, or CasY protein. In some embodiments, the Cas protein has been modified to inactivate Cas9 nuclease activity. Modifications include, but are not limited to, altering one or more amino acids to inactivate the nuclease activity or the nuclease domain of the Cas protein. For example, D908, D832, E993, R1226, and / or D1235 mutations can be made in Cpf1 from Acidaminacoccus sp. BV3L6, Lachnospiraceae ND2006, or Francisella tularensis subsp. novicida U112, to inactivate Cpf1 nuclease activity. Other modifications include removing all or a portion of the nuclease domain, such that the sequences exhibiting nuclease activity are absent. Accordingly, a catalytically-inactive Cas protein may include polypeptide sequences 12372134.1 modified to inactivate nuclease activity or removal of a polypeptide sequence or sequences to inactivate nuclease activity. The catalytically-inactive Cas protein retains the ability to bind to DNA even though the nuclease activity has been inactivated. Accordingly, catalytically-inactive Cas protein includes the polypeptide sequence or sequences required for DNA binding but includes modified nuclease sequences or lacks nuclease sequences responsible for nuclease activity. In some embodiments, the catalytically-inactive Cas protein is a full-length Cas sequence lacking the polypeptide sequence of the nuclease domain and retaining the DNA binding function. In other embodiments, the catalytically-inactive Cas protein sequences have at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identity to Cas polypeptide sequences lacking the nuclease domain and retains DNA binding function. In some embodiments, the Cas protein comprises an amino acid sequence having at least 95% identity to SEQ ID NO: 13 or SEQ ID NO: 14. In some embodiments, the Cas protein comprises an amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 14. In some embodiments, the dCas protein comprises an amino acid sequence having at least 95% identity to SEQ ID NO: 13. In some embodiments, the dCas protein comprises an amino acid sequence of SEQ ID NO: 13. In some embodiments, the Cas protein comprise a nuclease localization sequence. In some embodiments, the kit comprising an Argonaute protein. An “Argonaute protein” refers to a protein that binds small noncoding nucleic acids (e.g., an Argonaute guide polynucleotide) and utilizes them for the guided cleavage of complementary nucleic acid targets or indirect gene silencing by recruiting additional factors. Catalytically-active Argonaute proteins are capable of nucleic acid guided binding to a complementary nucleic acid target (e.g., DNA) and cleavage of the nucleic acid target. See, e.g., Kaya et al., 2016, PNAS 113(5):4057- 62. The prokaryotic Argonaute (AGO) gene family encodes several domains: N-terminal (N), PAZ, MID, and a C-terminal PIWI domain. The MID and PAZ domains are responsible for binding of the 5’-end and 3’-end, respectively, of a guide polynucleotide. In contrast to eukaryotic Agos that use exclusively small RNA guides, the majority of characterized prokaryotic Agos bind single-stranded DNA (ssDNA) guides. The Ago PIWI domain comprises nuclease activity. In some embodiments, the Argonaute protein is catalytically-inactive. In some embodiments, the Argonaute protein is a CbAgo protein that is catalytically-inactive. In some embodiments, the Argonaute protein is a LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo protein that is catalytically- 12372134.1 inactive. In certain embodiments, the Argonaute protein has been modified to inactivate nuclease activity or inherently has reduced nuclease activity (see, e.g., Kaya et al., 2016, PNAS 113(5):4057-62). Modifications may include, but are not limited to, altering one or more amino acids to inactivate the nuclease activity or the nuclease domain of the Argonaute protein. For example, in some embodiments, the catalytically-inactive Argonaute protein is a CbAgo protein that comprises a D541A mutation and a D611A mutation. See, e.g., Hegge et al., 2019, Nuc. Acids Res. 47(11):5809-21. Alternatively, all or a portion of the nuclease domain may be removed, such that the sequences exhibiting nuclease activity are absent. Accordingly, a catalytically-inactive Argonaute protein may include polypeptide sequences modified to inactivate nuclease activity or removal of a polypeptide sequence or sequences to inactivate nuclease activity. The catalytically-inactive Argonaute protein retains the ability to bind to DNA even though the nuclease activity has been inactivated. Accordingly, catalytically-inactive Argonaute protein includes the polypeptide sequence or sequences required for DNA binding but includes modified nuclease sequences or lacks nuclease sequences responsible for nuclease activity. In some embodiments, the catalytically-inactive Argonaute protein is a full-length Argonaute sequence lacking the polypeptide sequence of the nuclease domain and retaining the DNA binding function. In other embodiments, the catalytically-inactive Argonaute protein sequences have at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identity to the Argonaute polypeptide sequences lacking the nuclease domain and retains DNA binding function. In some embodiments, the dArgonaute protein comprises an amino acid sequence having at least 95% identity to any one of SEQ ID NOs: 15-21. In some embodiments, the dArgonaute protein comprises an amino acid sequence of any one of SEQ ID NOs: 15-21. In some embodiments, the kit comprises a catalytically inactive Cas protein (dCas protein) or a catalytically inactive Argonaute protein (e.g., dArgonaute) as described herein. In some embodiments, the kit comprises a catalytically inactive Cas protein (dCas protein) and a catalytically active Cas protein as described herein. In some embodiments, the kit comprises a catalytically a catalytically inactive Argonaute protein (e.g., dArgonaute) a catalytically active Argonaute protein as described herein. In some embodiments, the kit comprises a dCas and a cognate dCas guide RNA polynucleotide. In some embodiments, the kit comprises a dCas9 and a cognate dCas9 guide RNA. In some embodiments, the kit comprises a dArgonaute and a cognate dArgonaute guide polynucleotide. 12372134.1 In some embodiments, the kit comprises a Cas protein comprising an affinity tag or a Argonaute protein comprising an affinity tag. In some embodiments, the affinity tag is Albumin-binding protein (ABP), Alkaline Phosphatase (AP), AU1 epitope, AU5 epitope, Bacteriophage T7 epitope (T7-tag), Bacteriophage V5 epitope (V5-tag), Biotin-carboxy carrier protein (BCCP), Bluetongue virus tag (B-tag), Calmodulin binding peptide (CBP), Chloramphenicol Acetyl Transferase (CAT), Cellulose binding domain (CBP), Chitin binding domain (CBD), Choline-binding domain (CBD), Dihydrofolate reductase (DHFR), E2 epitope, FLAG epitope, Galactose-binding protein (GBP), Green fluorescent protein (GFP), Glu-Glu (EE-tag), Glu-Glu (EE-tag), Human influenza hemagglutinin (HA), HaloTag®, Histidine affinity tag (HAT), Horseradish Peroxidase (HRP), HSV epitope, Ketosteroid isomerase (KSI), KT3 epitope, LacZ, Luciferase, Maltose-binding protein (MBP), Myc epitope, Nus , PDZ domain, PDZ ligand, Polyarginine (Arg-tag), Polyaspartate (Asp-tag), Polyhistidine, (His-tag), Polyphenylalanine (Phe-tag), Profinity eXact, Protein C, S1-tag, S-tag, Streptavadin-binding peptide (SBP), Staphylococcal protein A (Protein A), Staphylococcal protein G (Protein G), Strep-tag, Streptavadin, Small Ubiquitin-like Modifier (SUMO), Tandem Affinity Purification (TAP), T7 epitope, Thioredoxin (Trx), TrpE, Ubiquitin, Universal, and VSV-G as described in Kimple ME et al., Curr Protoc Protein Sci. 2013 Sep 24;73:9.9.1-9.9.23. doi: 10.1002 / 0471140864.ps0909s73. In some embodiments, the affinity tag and corresponding affinity tag binding molecule, in a kit or for use in the method, are selected from Table 1. Table 1: Affinity tag and affinity tag binding molecule. 12372134.1 In some embodiments, the kit comprises a guide polynucleotide that is capable of binding to the Cas protein (e.g., cognate the guide polynucleotide is cognate to the Cas protein) or the Argonaute protein of the kit to form a ribonucleoprotein complex and the ribonucleoprotein complex is capable of binding to an adapter sequence. The term “cognate” as used in the context of the guide polynucleotide and the Cas protein or Argonaute protein refers to a guide polynucleotide that is compatible with the Cas protein or the Argonaute protein (e.g., the guide polynucleotide is capable of directing the Cas protein or the Argonaute protein to a target polynucleotide). For example, a Cas9 sgRNA is cognate to Cas9 and dCas9. The terms “binds” or “specifically binds,” and like terms, refer to a molecule (e.g., a Cas- gRNA complex or a Argonaute-guide polynucleotide complex) that binds to a target nucleic acid with at least 2-fold greater affinity than non-target nucleic acids, e.g., at least any of 2-fold, 3- fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 25-fold, 50-fold, 100-fold, 1,000-fold, 10,000-fold, or greater affinity for the target nucleic acid compared to an unrelated nucleic acid when assayed under the same binding affinity assay conditions. In some embodiments, the term “binds” or “specifically binds,” as used herein, can be exhibited, for example, by a molecule (e.g., a Cas-gRNA complex or a Argonaute-guide polynucleotide complex) having an equilibrium dissociation constant KD for the target nucleic acid of, e.g., 10-2M or smaller, e.g., 10-3M, 10-4M, 10-5M, 10-6M, 10-7M, 10-8M, 10-9M, 10-10M, 10-11M, or 10-12M. In some embodiments, an antibody has a KD of less than 10 nM or less than 100 nM. In some embodiments, the kit further comprises a primer that is complementary to a portion of an adapter sequence (e.g., as described herein). In some embodiments, the primer is complementary to a proximal portion of an adapter sequence. This primer may be used for creating double stranded target nucleotides comprising a double stranded proto-spacer adjacent motif (PAM) site that a dCas protein (e.g., as described herein) can use for binding. In some 12372134.1 embodiments, the primer binds to a proximal portion of the adapter sequences such that the new polynucleotide (which is complementary to the target polynucleotide) does not comprise the distal portion of the adapter sequence and thus cannot be sequenced using next-generation sequencing (e.g., ILLUMINA Sequencing, ULTIMA Genomics Sequencing). Without being bound to theory, this method may be advantageous compared to PCR based methods because errors (e.g., mutations) introduced during elongation of the primer are not sequenced, but double stranded target polynucleotides may still be produced and bound be dCas proteins. In some embodiments, the primer is a DNA primer. In some embodiments, the DNA primer comprises nucleic acid modifications (e.g., as described herein). In some embodiments, the primer is complementary to a 3’ adapter sequence. In some embodiments, the primer is complementary to a 5’ adapter sequence. In some embodiments, the primer is not complementary to an adapter sequence that is complementary to the guide polynucleotide targeting region. In some embodiments, the primer when bound to the adapter sequence and elongated does not elongate the entire adapter sequence. Reaction Mixtures In some aspects, this disclosure describes a reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides comprise an ELEMENT, a PACBIO, or an ULTIMA adapter sequence; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the adapter sequence; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein. In some embodiments, the reaction mixture comprises an aqueous solution (e.g., a buffer that is suitable for performing a method described herein). In some embodiments, the reaction mixture comprises a predetermined concentration of dCas9 protein). In some embodiments, the reaction mixture comprises a predetermined concentration of dArgonaute protein. In some embodiments, the reaction mixture comprises target polynucleotides comprising an adapter sequence of any one of SEQ ID NOs: 1-4, 22, 27, 29, or 34. In some embodiments, the reaction mixture comprises a predetermined concentration of a guide polynucleotide of any one of SEQ ID NOs: 5-10. In some embodiments, this disclosure provides a reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides comprise an adapter sequence comprising an index; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index; and (iii) a predetermined 12372134.1 concentration of a dCas protein or a dArgonaute protein. In some embodiments, the index comprises a nucleic acid sequence of any one of the index sequences described herein. In some embodiments, the adapter sequence comprises a PAM or rPAM adjacent to the index. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 50 femtomoles (fmols) to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 200 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 300 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 500 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 750 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 1,000 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 1,000 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 2,000 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 50 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 3,400 fmols. In some embodiments, the reaction mixture comprises a plurality of target polynucleotides comprising an adapter sequence at a concentration of 500 fmols to 3,400 fmols. In some embodiments, the reaction mixture comprises a predetermined concentration of dCas9 of SEQ ID NO: 13, target polynucleotides comprising an adapter sequence of any one of SEQ ID NO: 1-4, 22, 27, 29, or 34, and a predetermined concentration of a guide polynucleotide (e.g., an RNA guide polynucleotide) that comprises a homology region that is complementary to the adapter sequence. Ribonucleoprotein (RNP) complexes 12372134.1 In some aspects this disclosure provides a ribonucleoprotein (RNP) complex comprising: (i) a guide polynucleotide; (ii) a Cas protein (e.g., dCas) or an Argonaute protein (e.g., dArgonaute); and (iii) an ELEMENT adapter sequence, a PACBIO adapter sequence, or an ULTIMA adapter sequence; wherein the targeting region of the guide polynucleotide is complementary to the adapter sequence. In some embodiments, the RNP complex comprises (i) a RNA Cas gRNA polynucleotide comprising a homology region of any one of SEQ ID NOs: 5-10 (ii) a dCas protein of SEQ ID NO: 37, and (iii) an adapter sequence of any one of SEQ ID NOs: 1-4, 22, 27, 29, or 34; wherein the homology region of the RNA Cas gRNA polynucleotide is complementary to the adapter sequence. In some embodiments, the RNP complex comprises (i) a RNA Cas gRNA polynucleotide (ii) a Cas protein as described herein, and (iii) an adapter sequence comprising an index; wherein the homology region of the RNA Cas gRNA polynucleotide is complementary to the index. In some embodiments of RNP complexes provided herein, the adapter sequence is unmodified. In some embodiments, the adapter sequence is unmodified at the 5’ end. In some embodiments, the RNP complexes are present at a concentration of 250 fmols to 14,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 300 fmols to 14,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 2,000 fmols to 14,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 6,000 fmols to 14,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 10,000 fmols to 14,000 fmols. In some embodiments, the RNP complexes are present at a concentration of at least 250 fmols . In some embodiments, the RNP complexes are present at a concentration of at least 300 fmols. In some embodiments, the RNP complexes are present at a concentration of at least 2,000 fmols. In some embodiments, the RNP complexes are present at a concentration of at least 6,000 fmols. In some embodiments, the RNP complexes are present at a concentration of at least 10,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 250 fmols. In some embodiments, the RNP complexes are present at a concentration of 300 fmols. In some embodiments, the RNP complexes are present at a concentration of 2,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 6,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 10,000 fmols. In some embodiments, the RNP complexes are present at a concentration of 14,000 fmols. 12372134.1 Sequences Table 2: Sequences 12372134.1 12372134.1 12372134.1 Index Sequences Table 3: ILLUMINA TruSeq Indexes: 12372134.1 12372134.1 12372134.1 12372134.1 12372134.1 12372134.1 12372134.1 Table 4: IDT Xgen UDI / UMI Index sequences: 12372134.1 12372134.1 12372134.1 12372134.1 Table 5: Additional Index Sequences (can be used on i5 or i7 side): 1CCATGTCAGT2 ATTGATGCCG3 GCCATTAGGA4 ACATCCACTC5 GATGTAGCGA6 GCTGTTCCAA7 TCTCCTGGAT8 GATCCTGACA9 TGCGATTACG10 TGATAGGCTC11 TAAGGCCTTC12 CCTTAAGGTC13 AGCTAACGGA14 GTCAGCACAT15 CGCGTTATCA16 GCGTAATAGG17 TGTCACGCTA18 ATCCTAACCG19 GTTGGAGTAC20 TAAGCTGGCA21 GCCTCAATTG22 TACTACGCAG23 GCTATAACGG24 GAAGACTAGC25 CCATGTTCTC26 TCGAGACAAG27 GAGCCGAATA28 CCAAGTGGTT29 CCATTCCGAA 12372134.130 GCAATGGACA6731 AGGCACAAGT6832 TGTAACAGGC6933 TGCATACCGT7034 CGCATCTTGT7135 CAGTCTGGTT7236 ACGAGCATTG7337 38 GCTGAGAATG7539 CCGTCAAGAA7640 AACGCAGTCT7741 TAGAACGTGG7842 ACAAGCCTAC7943 TGTTCTCCAG8044 CTAGACACTC8145 CCTATCAAGC8246 CCTACTTCGT8347 AGGCTCATAC8448 CGGCATTACT8549 TCCGAACCTT8650 CTTAACCTGG8751 GCAGGCTATT8852 CCGGAATCAA8953 CTCTCCAAGA9054 CATTGCGTAC9155 TGAAGCACGT9256 GACAAGTAGG9357 ACATATCCGC9458 AAGCCGTCAA9559 CCACAGCTAA9660 CAATCCTTGG9761 CTCGAACTGT9812372134.1 12372134.194 TGCTAATCGC13195 CCAGTATCCT13296 TTGTGCGCAT13397 GCTCCTTGTA13498 TGGTCCTACT13599 AGGTTATCCG136100 CAGTGAATGG137101 AACAGCCTGT138102 TCCACGTGTA139103 GCCTTCTATC140104 GAACTAGCTC141105 AGACCTAGTG142106 AGTGACCTCT143107 GAGTTCAAGC144108 CACGGTTAAG145109 TACACCGACT146110 AGCCACTCTT147111 TGGAACCACA148112 CGGTTGAAGT149113 TTGGTCCGAA150114 GCGATCCATT151115 TGTGTCATGG152116 ACGTGCACAA153117 CCTGATCGTT154118 AGAGGTCCTA155119 TTCAGGCTTG156120 CGAGTACTTC157121 CTCTATAGCG158122 GTAACCTCCA159123 ACTCGTGCAA160124 AAGATGCGGT161125 ACTGAGGCAT16212372134.1126 ATCGGCTAAC163127 TAGGCGTTGT164128 TGTCTCCGTT165129 AACTCCAGGT166130 CGTGAGGTAA167131 TACACTCGGA168132 CGTTAGACTG169133 CGGACTTATC170134 AGCGGAATTC171135 AATTGAGCGC172136 CCTTATCTCG173137 ACACAAGGCA174138 TACGACCTCA175139 TGGTATGCGT176140 GCTAGCTGAT177141 GTATTCGGTC178142 CGTACATGTG179143 TTATGTCCGG180144 TGGCTAACTG181145 AGCTTAGCAC182146 GCGCTGTAAT183147 GAGCCATGAT184148 GTCGTCATCT185149 GAAGGAGTGT186150 CCACATAAGG187151 TCTACACGTC188152 AGCTATGGTG189153 CGGTGTTGAT190154 ATGAGCCGTA191155 AGACAGCATC192156 GCACCAGAAT193157 TCCGTCTAAG19412372134.1 12372134.1190 CCAATCGCTA227191 TATCCAACGC228192 CAAGTAGGAG229193 TGAGCGATAC230194 CCTGGATAAC231195 CTGATACAGC232196 GACACTCTAC233197 GTCTGAAGGT234198 TAGCGGATCA235199 CACTTCCAAC236200 GATGCCATTG237201 CGGCAGATTA238202 GTCGATCAGA239203 CATGTGCAAG240204 GATTCACGAG241205 GACGATGTTG242 206 TTGTAGGCCA243207 AGTTGTGGCT244 208 GTCTGCCTAA245209 ACTCAATCCG246210 CATTGGCTGT247211 CTAAGGCCAA248212 TAGCCTGTTC249213 GCTTGACGTA250214 GATCAACCTG251215 GTGTCTACCA252216 CTTCTTGCTG253217 TCTTAGCTGC254218 TGCTCGACAT255219 ATCGACGGTT256220 AACGTTCCTG257221 GCACTTACAG258 12372134.122222322422522622722822923023123223323423523623723823924024124224324424524624724824925025125225312372134.1254 GTGAAGCGTT291255 AACAGCGCAA292256 CGACTAGTCT293257 ACCGCTTAGT294258 TTAGCGCCTA295259 TCAGTATGGC296260 TCCGAGTAGA297261 TGCCAAGAGT298262 TTACCTTCCG299263 GAGCAAGGTA300264 TCTTGCAACG301265 CGAATTGTGC302266 AATACGGTGC303267 GCAGATTGCT304268 GTACCACTAG305269 CCACGAATTC306270 ACAGACTTGG307271 CCTCTTAGAC308272 TAACGGTAGG 309273 GATAGCCAAC310274 TTAGGCCAGT311275 TGATGGTGAC312276 TCTACTGTGG313277 GTAGTGCTGA314278 TACCTGTCGT315279 AACCGATAGC316280 AATCTTGGCG317281 CAATGGCATC318282 CCAACATGAC319283 TGGCATACAC320284 TTCGCGGTAA321285 ACCGGACAAT322 12372134.1286 TCACGGTCTT323287 AAGGCGGATT324288 CGCAAGGAAT325289 ATGTTGACGG326290 GCGATAAGTC327291 CCGGTGTATA328292 TCTGGCCATA329293 CTAGGCTTCA330294 GCTTGTGAGA331295 TATCGCAGGA332296 GCCTAGGATA333297 TCATCTCGCT334298 ATTCGGTGGA335299 TCAATCGAGG336300 AGTAGAGTCG337301 GTGCGCTATA338302 TTGGCATCCT339303 GTAAGGATCG340304 TCAGCAACCA341305 AACGTGAGCA342306 GCGAGTTAAC343307 GTGTAGGAAC344308 CTGAGCAACT345309 CGGTAACGTT346310 GTGGTTGACA347311 CGGATCAGTA348312 ATGCACCTTC349313 GCTTCGCAAT350314 GAGTAACCGT351315 TCGTTACGAC352316 CACAGTGTCA353317 TGGTTCCTTG35412372134.1318 ACCTTAGTGG355319 GACATTGACG356320 CGCTCGTTAA357321 GACGTCTGTA358322 TAATGGCGCA359323 GTTCACTCGT360324 AATCACGCCT361325 TCCTGGAGTT362326 GATAACAGCG363327 CAAGAGTGGA364328 TGAGGTTGGA365329 AAGCCTAAGG366330 TAGCACCATG367331 TGCGGCATAT368332 CCTGCATTGA369333 CTGGCTCAAT370334 GAAGGTCACT371335 TTGGAAGCTC372336 TTGCCGTTAG373337 TCATAGCCAG374338 TTCCTCTTGC375339 TGTGGAGATG376340 GACTTGAGAC377341 ATGGCAATGC378342 ATAGGACGTC379343 CATGAACGAC380344 CGTGTAAGGA381345 TCAGAGGAAC382346 CACCTGCTAT383347 AGCAGTACGA384348 AACTGGTGCT385349 AGGTATAGGC38612372134.1 12372134.1382 419383 ACGGATTCTG420384 TCCTTAGGCT421385 AACCACAACG422386 GCAGTTCTTG423387 GCATTCACCT424388 CGCACAATAG425389 AGAATGACCG426390 GTTCGAAGCA427391 TTGCAGGTGT428392 AGGCCTGTAT429393 CGGTCTATTG430394 CAAGAACAGG431395 TCCGCCAATT432396 AGTTCGCCTA433397 TCAACGTTGC434398 GCATTGTCAC435399 GAGAATCGCA436400 AGGCGATCAT437401 CTGCTTACGA438402 TAAGACCGAG439403 AGAACGTCTC440404 CAGGACGTTA441405 GATCATGTGC442406 AAGACAGCCA443407 CTTACACGCA 444408 TCCTTCACTG445409 ATAGTCTCCG446410 AGCTGCAACT447411 ACTGTGAGGT448412 TCACTCCTGT449413 TAACAAGCGG45012372134.1414 ACAGTACACG451415 GAACCGTTGA452416 GCGATAGCAA453417 TTCCTAGCGA454418 GAATCTCAGG455419 CACTAACCTC456420 GTAACCAAGG457421 GAATGCTGTG458422 TAGATGCCAC459423 CTCGTACCTA460424 TGTATTGCCG461425 TGCTGTGGAA462426 ACTTGCTCCT463427 GTCAATGCTC464428 TCCGTTGCTA465429 TCTCGCTTAC466430 ATTCCACAGG467431 GCCACCTTAA468432 CGTATCTGAC469433 TTACCTGAGC470434 GCGCATATCT471435 AAGGAGACAG472436 CCGTGAGATT473437 GTCTCACAAC474438 AATGCCGGTA475439 GTATCTTCGC476440 ATTACCGCGT477441 TGGTTAGAGG478442 AAGTCGCTAC479443 CGAGATAGGT480444 CGACTTGGTA481445 ACTGCAAGAC48212372134.1446 ACCATCTTCG483447 AGGAATCCTC484448 AGGTTCGTGT485449 AGCCAACTAC486450 AGGAGGTGTT487451 TCGCTTGAAC488452 CAGCATGTAG489453 CGAGTCTAGA490454 CCTTGACCAT491455 ACCGTCCTTA492456 GTATGGCGAT493457 AGTGGCAGTT494458 TCTCACCGAA495459 ACTTGGTGTC496460 ACTAGCGACA497461 TGCGCACTTA498462 GTGAGGACTA499463 GTTGCGACAA500464 GCTGTTATGC501465 TTGAGACGGT502466 CTAGTGGACT503467 TCGCGAAGTA504468 GTTACGCTTC505469 AGTTGCTAGG506470 TTGCTCAGGT507471 AAGAGGTTCG508472 ACCAAGCGAT509473 CTTCTCCTAC510474 GAATACGGCA511475 ACAAGGTCAG512476 ATGCATGGCT513477 TTCAACACCG51412372134.1 Methods of Polynucleotide Library Normalization In some aspects, this disclosure provides methods of normalizing the concentration of target polynucleotides between two or more samples (e.g., normalizing between two or more polynucleotide libraries). “Normalizing”, “normalization”, and similar terms used herein refer to the process of producing a subsequent sample with a desired concentration of target polynucleotides from an initial sample having a different starting concentration of target polynucleotides than the subsequent sample. In some embodiments, “normalization” of two or more samples results in the production of two or more subsequent samples each having a concentration of target polynucleotides that are more similar to each other after performing the normalization methods than before performing the normalization methods. For example, a first sample (e.g., a first polynucleotide library) may comprise 5-fold more target polynucleotide than a second sample (e.g., a second polynucleotide library). In this example, after normalization of the first sample and the second sample, the difference in concentration between the first sample and the second sample would be less than 5-fold (e.g., less than 4-fold, less than 3-fold, or less than 2-fold). 12372134.1 In some embodiments, normalization of two or more samples results in the production of two or more subsequent samples each having equimolar (i.e., 1:1) concentrations. In some embodiments, the method of normalization results in differences in target polynucleotide concentration between two or more samples being less than 50% (e.g., less than 40%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 2.5%). In some embodiments, the method of normalization results in differences in target polynucleotide concentration between two or more samples being 5%-40%, 5%-30%, 5%-20%, 5%-10%, 10%-40%, 10%-30%, or 10%-20% in concentration. In some embodiments, the difference in starting target polynucleotide concentration between two or more samples may be relatively small (e.g., less than 5-10%) prior to performing a method of normalization described herein. In such embodiments, the method of normalization may be performed but the two or more samples may not have a detectably more similar concentration after normalization than before normalization. In some embodiments, normalization refers to altering the concentration of polynucleotide in at least two samples to achieve a given stoichiometric ratio of polynucleotides between the at least two samples. For example, a desired stoichiometric ratio for polynucleotides in a first sample and polynucleotides in a second sample may be 5:1. In some embodiments, normalization comprises multiplexing multiple samples to normalize the concentration of target polynucleotides in the multiple samples. “Multiplexing” refers to the processing of a single pooled sample made by combining multiple samples into the single pooled sample. Multiplexing therefore eliminates the need to quantify the amount of polynucleotides in the multiple samples and to subsequently adjust the volume of the samples prior to pooling or combine different volume of the samples (based on concentration) when pooling. In some embodiments, multiplexing may be accomplished by contacting each sample with a predetermined amount of a ribonucleoprotein (RNP) that binds to the target polynucleotides, pooling the samples in a multiplex normalization reaction, and extracting target polynucleotide that are bound by the RNP. In this case, a predetermined amount of the RNP affects the normalization. Specifically, the predetermined amount of RNP (e.g., the moles of RNP added) for each sample determines the molar amount of target polynucleotides pooled from that sample (so long as the predetermined amount of RNP is limiting compared the target polynucleotides). This pooling of the libraries allows the target polynucleotides to be eluted at a desired molar concentration without needing to determine the concentrations of target polynucleotides in the individual samples, and without having to adjust the volume of the 12372134.1 samples prior to pooling or combine different volume of the samples (based on concentration) when pooling. “Target polynucleotide” or “target polynucleotides” refers to a polynucleotide that comprises nucleic acids encoding an adapter sequence (e.g., an adapter sequence described herein) comprising an index, an ELEMENT adapter sequence, a PACBIO adapter sequence, or an ULTIMA adapter sequence (e.g., SEQ ID NOs: 1-4, 22, 27, 29, and 34) or a static region of an ELEMENT, PACBIO, or ULTIMA sequence. In some embodiments, the target polynucleotide comprises a polynucleotide that comprises (1) adapter sequence comprising an index, an ELEMENT, PACBIO, or ULTIMA adapter sequence (e.g., SEQ ID NOs: 1-4, 22, 27, 29, or 34) or a static region of an ELEMENT, PACBIO, or ULTIMA sequence and (2) nucleic acids encoding a sequence of interest. In some embodiments, the target polynucleotide comprises an adapter sequence comprising a PAM adjacent to an index. In some embodiments, the target polynucleotide comprises nucleic acids encoding an adapter sequence described herein and nucleic acids encoding a sequence of interest. The sequence of interest may be any sequence for which normalization is desired. For example, a sequence of interest may comprise, but is not limited to, DNA, genomic DNA, circulating tumor DNA, RNA, rRNA, mRNA, miRNA, or cDNA. The adapter sequence may be ligated to the 5’ end and / or 3’ end of the sequence of interest. In some embodiments, the target polynucleotide comprises a first adapter sequence (e.g., SEQ ID NO: 1) on the 5’ end of the sequence of interest and a second adapter sequence (e.g., SEQ ID NO: 2) on the 3’ end of target sequence. In some embodiments, the target polynucleotide is double stranded DNA. A “sample” refers to a composition or solution comprising one or more target polynucleotides. In some embodiments, the sample comprises a plurality of target polynucleotides. A “plurality” refers to two or more. For example, a plurality of target polynucleotide comprises two or more target polynucleotides. In some embodiments, the plurality of target polynucleotides comprises multiple copies of a single target polynucleotide sequence (e.g., at least 10, at least 100, at least 1000, at least 10,000, at least 100,000, or at least 1,000,000, or at least 10,000,000, at least 100,000,000 target polynucleotides). In some embodiments, the plurality of target polynucleotides comprises different target polynucleotide sequences (e.g., at least 10, at least 100, at least 1000, at least 10,000, at least 100,000, or at least 1,000,000, or at least 10,000,000, at least 100,000,000 different target polynucleotides), but at least some of the target polynucleotides (e.g., all of the target polynucleotides) comprise the 12372134.1 same adapter sequence. In some embodiments, the sample comprises a target polynucleotide and other molecules (e.g., polynucleotides that are not target polynucleotides and do not comprise an adapter sequence or comprise a different adapter sequence from the one complementary to the guide polynucleotide). In some embodiments, the sample comprises target polynucleotides comprising nucleic acids encoding genomic DNA. In some embodiments, the sample comprises target polynucleotides comprising nucleic acids encoding an RNA. In some embodiments, the sample comprises target polynucleotides comprising nucleic acids encoding a cDNA (e.g., of mRNA or lncRNA). In some embodiments, the sample comprises target polynucleotides comprising nucleic acids encoding an exon. In some embodiments, the sample comprises target polynucleotides comprising nucleic acids encoding an intron. In some embodiments, the plurality of target polynucleotides in the sample is present at a concentration of 50 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 200 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 300 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 500 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 750 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 1,000 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 1,000 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 2,000 fmols to 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 50 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 3,400 fmols. In some embodiments, the plurality of target polynucleotides is present at a concentration of 500 fmols to 3,400 fmols. In some embodiments, the method of normalizing is performed for at least 2 samples (e.g., at least 3 samples, at least 4 samples, at least 5 samples, at least 6 samples, at least 7 samples, at least 8 samples, at least 9 samples, at least 10 samples, at least 25 samples, at least 50 samples, at least 75 samples, at least 100 samples, at least 150 samples, at least 200 samples, at least 300 samples, at least 384 samples, at least 400 samples, at least 500 samples, at least 600 samples, at least 700 samples, at least 800 samples, at least 900 samples, at least 1000 samples, 12372134.1 at least 1500 samples, at least 2000 samples, at least 3000 samples, or at least 5000 samples or more). In some embodiments, the method of normalizing is performed for 2-384 samples. In some embodiments, the method of normalizing is performed for 24-384 samples. In some embodiments, the method of normalizing is performed for 24-500 samples. In some embodiments, the method of normalizing is performed for 24-750 samples. In some embodiments, the method of normalizing is performed for 24-1000 samples. In some embodiments, the method of normalizing is performed for 24-2000 samples. In some embodiments, the method of normalizing is performed for 24-3000 samples. In some embodiments, a plurality of samples, each having an adapter sequence with a different index, are combined prior to next generation sequencing. In some embodiments, the samples comprise target polynucleotides at a pre- normalization concentration of within a 70-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre-normalization concentration of within a 60-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre-normalization concentration of within a 50-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre- normalization concentration of within a 40-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre-normalization concentration of within a 30-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre-normalization concentration of within a 20-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre- normalization concentration of within a 10-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre-normalization concentration of within a 5-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre-normalization concentration of within a 2-fold concentration of each other. In some embodiments, the samples comprise target polynucleotides at a pre- normalization concentration of within a 1.5-fold concentration of each other. In some embodiments, this disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising: (i) obtaining the at least two samples, wherein the target polynucleotides of the at least two samples comprise: a first adapter sequence (e.g., an ILLUMINA, PACBIO, ELEMENT or ULTIMA adapter sequence (e.g., any one of SEQ ID 12372134.1 NOs: 1-4, 22, 27, 29, or 34)); (ii) contacting each of the at least two samples with primers that are complementary to a portion of the first adapter sequence thereby producing partially double stranded polynucleotides; (iii) binding the double stranded polynucleotides of each of the at least two samples with a predetermined amount of a ribonucleotide protein (RNP) complex, the RNP complex comprising: a dCas or a dArgonaute, and a guide polynucleotide that comprises a targeting region which is complementary to a strand of the double stranded second adapter sequence; and (iv) extracting the target polynucleotides from the RNP complex to normalize the concentration of target polynucleotides between the at least two samples. In some embodiments, the method comprises after (iii) and before (iv) combining the at least two samples and optionally removing unbound target polynucleotides from the combined samples. In some embodiments, this disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising: (i) obtaining the at least two samples, wherein the target polynucleotides of the at least two samples comprise: a double stranded polynucleotide comprising an adapter sequence (e.g., an ILLUMINA, PACBIO, ELEMENT or ULTIMA adapter sequence (e.g., any one of SEQ ID NOs: 1-4, 22, 27, 29, or 34)); (ii) binding the double stranded polynucleotides of each of the at least two samples with a predetermined amount of a ribonucleotide protein (RNP) complex, the RNP complex comprising: a dCas or a dArgonaute, and a guide polynucleotide that comprises a targeting region which is complementary to a strand of the double stranded polynucleotide comprising the adaptor sequence; and (iii) extracting the target polynucleotides from the RNP complex to normalize the concentration of target polynucleotides between the at least two samples. In some embodiments, the method comprises after (ii) and before (iii) combining the at least two samples and optionally removing unbound target polynucleotides from the combined samples. In some embodiments, this disclosure provides a method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising: (i) obtaining the at least two samples, wherein the target polynucleotides of the at least two samples comprise: a first adapter sequence comprising: a proximal portion, and a distal portion comprising a sequence that binds to an adapter binding site of a next-generation sequencing platform during next-generation sequencing; and a second adapter sequence; (ii) contacting each of the at least two samples with primers that are complementary to the proximal portion of the first adapter sequence; (iii) extending the primers 12372134.1 in each of the at least two samples to produce reverse complements of the target polynucleotides that do not comprise a reverse complement of the distal portion of the first adapter sequence, thereby producing partially double stranded polynucleotides comprising a double stranded second adapter sequence; (iv) binding the double stranded polynucleotides of each of the at least two samples with a predetermined amount of a ribonucleotide protein (RNP) complex, the RNP complex comprising: a dCas or a dArgonaute, and a guide polynucleotide that comprises a targeting region which is complementary to a strand of the double stranded second adapter sequence; and (v) extracting the target polynucleotides from the RNP complex to normalize the concentration of target polynucleotides between the at least two samples. In some embodiments, the method comprises after (iv) and before (v) combining the at least two samples and optionally removing unbound target polynucleotides from the combined samples. In some embodiments, removing unbound target polynucleotides from the combined samples comprising binding RNP complex to a solid phase (e.g., beads comprising a RNP binding tag) and washing the beads to remove unbound target polynucleotides. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples (e.g., two polynucleotide libraries) each comprising a target polynucleotide, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an ELEMENT, PACBIO, or ULTIMA adapter sequence (e.g., any one of SEQ ID NOs: 1-4, 22, 27, 29, or 34); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a static region of the adapter sequence of the target polynucleotides of the sample, and (c) a predetermined concentration of a dCas or a dArgonaute; (iii) contacting the solution with a solid phase comprising a dCas or a dArgonaute binding molecule; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples (e.g., two polynucleotide libraries) each comprising a target polynucleotide, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an ELEMENT, PACBIO, or ULTIMA adapter sequence (e.g., any one of SEQ 12372134.1 ID NOs: 1-4, 22, 27, 29, or 34); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a reverse complement of static region of the adapter sequence of the target polynucleotides of the sample, and (c) a predetermined concentration of a dCas or a dArgonaute; (iii) contacting the solution with a solid phase comprising a dCas or a dArgonaute binding molecule; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples (e.g., two polynucleotide libraries) each comprising a target polynucleotide, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an ELEMENT, PACBIO, or ULTIMA adapter sequence (e.g., any one of SEQ ID NOs: 1-4, 22, 27, 29, or 34); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the adapter sequence of the target polynucleotides of the sample, and (c) a predetermined concentration of a dCas or a dArgonaute; (iii) contacting the solution with a solid phase comprising a dCas or a dArgonaute binding molecule; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples (e.g., two polynucleotide libraries) each comprising a target polynucleotide, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an ELEMENT OR PACBIO adapter sequence (e.g., any one of SEQ ID NOs: 1-4); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a reverse complement of the adapter sequence of the target polynucleotides of the sample, and (c) a predetermined concentration of a dCas or a dArgonaute; (iii) contacting the solution with a solid phase comprising a dCas or a dArgonaute binding molecule; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. 12372134.1 In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a PAM; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a CRISPR- associated protein (Cas) guide RNA (gRNA) polynucleotide comprising a targeting region that is complementary to a reverse complement of a portion of the adapter sequence that is adjacent to the PAM of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, the PAM is adjacent to the 5’ terminal of the index. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a rPAM; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide comprising a targeting region that is complementary to a portion of the adapter sequence that is adjacent to the rPAM of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, the PAM is adjacent to the 3’ terminal of the index. In some embodiments, the target polynucleotide comprises a first adapter on its 3’ terminal end a second 12372134.1 adapter on its 5’terminal end. In some embodiments, the first adapter comprises a first index. In some embodiments, the second adapter comprises a second index. In some embodiments, the PAM is adjacent to the first index. In some embodiments, the PAM is adjacent to the second index. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas or a dArgonaute comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a reverse complement of the index of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas or a dArgonaute comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. 12372134.1 In some embodiments, the target polynucleotide comprises a first adapter on its 3’ terminal end a second adapter on its 5’terminal end. In some embodiments, the first adapter comprises a first index. In some embodiments, the targeting region is complementary to the first index. In some embodiments, the targeting region is complementary to the second index. In some embodiments, the method of normalizing results in the at least two samples being more similar in polynucleotide concentration after the normalizing than before the normalizing. In some embodiments, the method of normalizing results in the at least two samples having a predetermined stoichiometric ratio of polynucleotides between the samples. For example, the predetermined ratio of polynucleotide may be 5:1, so after performing the method of normalizing, polynucleotides of a first sample may be about 5 times more abundant than polynucleotides of the second sample. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas or a dArgonaute comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the methods comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a reverse complement of the index of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas or a dArgonaute 12372134.1 comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. In some embodiments, the target polynucleotide comprises a first adapter on its 3’ terminal end a second adapter on its 5’ terminal end. In some embodiments, the first adapter comprises a first index. In some embodiments, the targeting region is complementary to the first index. In some embodiments, the targeting region is complementary to the second index. In some embodiments, the method of normalizing results in the at least two samples more similar in polynucleotide concentration after the normalizing than before the normalizing. In some embodiments, the method of normalizing results in the at least two samples having a predetermined stoichiometric ratio of polynucleotides between the samples. For example, the predetermined ratio of polynucleotide may be 5:1, so after performing the method of normalizing, polynucleotides of a first sample may be 5 times more abundant than polynucleotides of the second sample. In some embodiments, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the methods comprising: (i) obtaining a mixture of the at least two samples, wherein the target polynucleotides of the at least two samples comprise an adapter sequence and an index, wherein different samples do not have the same index, and, for each sample, obtaining a guide polynucleotide comprising a targeting region that is complementary to the index, or a reverse complements of the index, of the sample; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of each a guide polynucleotide; and (c) a predetermined concentration of a dCas or a dArgonaute comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples. A 12372134.1 “mixture of at least two samples” refers to the combination of polynucleotides of at least two samples. In some embodiments, the predetermined concentration of each a guide polynucleotide is different. In some embodiments, the different predetermined guide polynucleotide concentrations normalize the target polynucleotides of the different samples in a predetermined stoichiometric ratio. For example, in a method comprising obtaining a mixture of two samples (sample 1 and sample 2), the predetermined stoichiometric ratio of polynucleotides between sample 1 and sample 2 may be 1:2, 1:3, 1:4, 1:5, or 1:10. In some embodiments, the predetermined stoichiometric ratio is determined based on the desired sequencing depth of the polynucleotides of each sample. For example, a first sample may need more sequencing depth than a second sample because the first sample has a greater diversity of target polynucleotides. In some embodiments, normalizing comprises producing a double stranded PAM site on a single stranded target polynucleotide without requiring PCR amplification (e.g., FIGs. 2A- 2D). PCR amplification is a popular strategy in the construction of NGS libraries, in particular because it allows for NGS sequencing on small amounts of sample. However, PCR amplification can be problematic for a number of NGS applications. For example, PCR amplification can introduce GC bias, which interferes with data analysis, such as the identification of novel single-nucleotide polymorphisms (SNPs). To allow polynucleotide normalization while avoiding PCR amplification, a method of normalizing introduces a step of target polynucleotide denaturation and partial extension. This denaturation and extension is performed before a RNP binding complex is combined with the target nucleotides. This step begins with a sample having target polynucleotide comprising a 3’ and a 5’ adapter sequence (e.g., FIG. 2A). The reverse complement of the PAM site is encoded on the 5’ adapter. A partial primer—which is complementary to a portion of the 3’ adapter sequence such that when the partial primer is extended it does not produce a reverse complement of the entire 3’ adapter sequence—is contacted with the target polynucleotide (e.g., FIG. 2B) in conditions such that primer extension can occur (e.g., FIG. 2C), e.g., the conditions include the presence of a DNA polymerase. This produces a double stranded PAM site that can be bound a dCas protein used in the normalization method, as described herein (e.g., FIG. 2D). However, the elongated primer does not comprise a complete 3’ adapter (e.g., does not comprise a portion of the adapter that interacts with a sequencing device (e.g., a ILLUMINA flow cell or ULTIMA wafer binding sequence)), and therefore is not sequenced during next generation sequences. 12372134.1 Thus, sequencing results are not biased by amplified DNA (e.g., the elongated primer). Alternatively, the partial primer can be complementary to a portion of the 5’ adapter sequence such that when the partial primer is extended it does not produce a reverse complement of the entire 5’ adapter resulting in an elongated polynucleotide that is not sequenced during next- generation sequencing because it has an incomplete 5’ adapter (e.g., the incomplete 5’ adapter does not comprise a portion of the adapter that interacts with a sequencing device (e.g., a ILLUMINA flow cell or ULTIMA wafer binding sequence)). This partial primer method is suitable to use with numerous next-generation sequencing adapters including, but not limited to, ILLUMINA, ULTIMA, ELEMENT, and / or PACBIO sequencing adapters. In some embodiments, this disclosure provides a method of enriching a target polynucleotide in a sample, the method comprising: (i) obtaining the sample, wherein the target polynucleotide of the sample comprises an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index; and (c) a predetermined concentration of a dCas or a dArgonaute comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase. In some embodiments, this disclosure provides a method of enriching a target polynucleotide in a sample, the method comprising: (i) obtaining the sample, wherein the target polynucleotide of the sample comprises an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a reverse complement of the index; and (c) a predetermined concentration of a dCas or a dArgonaute comprising an affinity tag, wherein the predetermined concentration of the dCas or the dArgonaute is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase. “Enriching” refers to a method of increasing the concentration of a target polynucleotide in a sample relative to the concentration of other polynucleotides in the sample. For example, 12372134.1 enriching a target polynucleotide may be performed by selectively extracting a target polynucleotide from the sample (e.g., using a Cas9 + guide RNA comprising a homology region that is complementary to the target polynucleotide) and then placing the target polynucleotide into a solution that is not the sample. In some embodiments, a method for normalizing and methods of enriching comprise obtaining one or more samples. The sample may be obtained from any suitable source, including, but not limited to cells (e.g., eukaryotic or prokaryotic cells), tissues (e.g., brain, heart, lung, liver, kidney, adipose, skin, gall bladder, or breast), diseased tissues (e.g., tumor), bodily fluid (e.g., saliva, sweat, blood, urine, mucus, or cerebral spinal fluid), or from in vitro production. In some embodiments, obtaining a sample comprises obtaining polynucleotides of interest (e.g., extracting the polynucleotide of interest from a biological sample) and modifying the polynucleotides of interest to comprise adapters sequences (e.g., modifying the polynucleotides of interest to become target polynucleotides). Modifying the polynucleotides of interest to comprise adapter sequences may be performed using any suitable methods, including, but not limited to using a kit for attaching adapter sequences to polynucleotides described herein. In some embodiments, the sample comprises 1-100 nM of target polynucleotides. In some embodiments, the sample comprises 1-1000 nM of target polynucleotides. In some embodiments, producing a solution, in the context of the method of normalization, refers to combining, the sample and the predetermined concentration of a guide polynucleotide and the predetermined concentration of a dCas or a dArgonaute in an aqueous solution (e.g., a buffer suitable for the method). In some embodiments, producing the solution comprises combining a pre-determined amount of dCas protein or dArgonaute protein and a predetermined amount of guide polynucleotide prior to combining with the sample. In some embodiments, producing a solution comprises combining a predetermined amount of a guide RNA polynucleotide that is RNA with a predetermined amount of dCas9 protein or dArgonaute protein. In some embodiments, producing a solution comprises combining a predetermined amount of a guide polynucleotide that is DNA with a predetermined amount of dArgonaute protein. In some embodiments, producing a solution comprises combining a predetermined amount of a guide RNA comprising a homology region of any one of SEQ ID NOs: 5-10 with a predetermined amount of dCas9 of SEQ ID NO: 13. A “predetermined concentration” refers to a concentration (e.g., nanomolar) or amount (e.g., nanomoles) of a reagent (e.g., a guide polynucleotide, a dCas protein or a dArgonaute 12372134.1 protein) that has been selected for extracting a particular or consistent amount of target polynucleotides from a sample. In some embodiments, the same or similar amounts of a pre- determined concentration of a dCas protein or a dArgonaute protein is added to each sample that is to be normalized. In some embodiments, the same or similar amounts of a pre-determined concentration of a guide RNA polynucleotide is added to each sample that is to be normalized. In some embodiments, a predetermined concentration of a dCas protein or a dArgonaute protein is added to the sample, and a predetermined amount of guide RNA polynucleotide added to the sample is in excess of the predetermined amount of dCas protein or a dArgonaute protein added to the sample. In some embodiments, the predetermined amount of dCas protein or dArgonaute protein is 1-2000 femtomoles. In some embodiments, the predetermined amount of dCas protein or dArgonaute protein is 60-2000 femtomoles. In some embodiments, the predetermined amount of dCas protein or dArgonaute protein is 60-1000 femtomoles. In some embodiments, the predetermined amount of dCas protein or dArgonaute protein is 125-1000 femtomoles. In some embodiments, the predetermined amount of dCas protein or dArgonaute protein is at least 60 femtomoles (e.g., at least 60 femtomoles, at least 125 femtomoles, at least 250 femtomoles, at least 500 femtomoles, at least 750 femtomoles, or at least 1000 femtomoles). In some embodiments, the predetermined amount of dCas protein or dArgonaute protein is 50, 60, 125, 250, 750, 1000, 1500, or 2000 femtomoles. In some embodiments, the predetermined concentration of guide RNA polynucleotides is in excess to the predetermined concentration of dCas9 protein or dArgonaute protein. In some embodiments, ribonucleoprotein (RNP) complex (e.g., the guide RNA, dCas protein or dArgonaute protein, and adapter sequence) is present at in the sample at a concentration of 250 fmols to 14,000 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 300 fmols to 14,000 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 2,000 fmols to 14,000 fmols. In some embodiments, RNP complex is present in the sample at a concentration of 6,000 fmols to 14,000 fmols. In some embodiments, RNP complex is present in the sample at a concentration of 10,000 fmols to 14,000 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of at least 250 fmols. In some embodiments, RNP complex is present in the sample at a concentration of at least 300 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of at least 2,000 fmols. In some embodiments, RNP complex is present in the sample at a concentration of at least 6,000 fmols. In some 12372134.1 embodiments, the RNP complex is present in the sample at a concentration of at least 10,000 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 250 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 300 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 2,000 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 6,000 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 10,000 fmols. In some embodiments, the RNP complex is present in the sample at a concentration of 14,000 fmols. In some embodiments, the method comprising producing a solution comprising a predetermined concentration of a dCas protein comprising an affinity tag or dArgonaute protein comprising an affinity tag as described herein. In some embodiments, the affinity tag binding molecule comprises a metal ion (e.g., Ni2+) and the affinity tag comprises a His Tag. In some embodiments, the affinity tag binding molecule comprises biotin and the affinity tag comprises avidin. In some embodiments, the affinity tag binding molecule comprises an anti-myc antibody and the affinity tag comprises a myc tag. In some embodiments, the affinity tag binding molecule and a corresponding affinity tag is selected from Table 1. In some embodiments, the dArgonaute or dCas of the method does not comprise an affinity tag. In some embodiments, the method comprises contacting the solution with a solid phase comprising a molecule that binds to the dCas or the dArgonaute (e.g., an antibody that binds to the dCas or dArgonaute). In some aspects, the method comprises contacting the solution and a solid phase. In some embodiments, the solid phase comprises a molecule that binds to dArgonaute or dCas (e.g., an antibody or an affinity tag binding molecule). In some embodiments, the solid phase comprises a beads (e.g., a microparticle or a nanoparticle). In some embodiments, the bead is a metal bead, a polymer bead, a protein bead, or a lipid bead. In some embodiments, the bead (e.g., metal bead) comprises metal ions (e.g., Ni2+, Co2+, Cu2+, and / or Zn2+ ions) on the surface of the bead. In some embodiments, the metal bead is magnetic (e.g., paramagnetic, diamagnetic, or ferromagnetic). In some embodiments, the method comprises incubating the solid phase and the solution. In some embodiments, the incubation is at room temperature. In some embodiments, the incubation is at 30-40 ˚C. In some embodiments, the incubation is at 35-38 ˚C. In some 12372134.1 embodiments, the incubation is at or about 37 ˚C. In some embodiments, the incubation is at least 15 minutes (e.g., at least 30 minutes, at least 45 minutes, at least 60 minutes, or at least 2 hours). In some embodiments, the incubation is at least 60 minutes. In some embodiments, the incubation is 15 minutes to 2 hours. In some embodiments, the method further comprises separating the solution from the solid phase. “Separating” as used in the context of this method, refers to removing the solution from the solid phase or removing the solid phase from the solution. In some embodiments, separating is not a perfect separation, e.g., there may small amount of solution (e.g., less than about 1 microliter of solution) and solid phase that are still in contact with one another after separation. In some embodiments, the purpose of the separating step is to separate the unbound target polynucleotide of the solution from the target polynucleotides bound to the solid phase, which is part of normalizing concentration. This may be done by (1) capturing the magnetic beads bound to target polynucleotides (e.g., using a magnet) (2) removing the solution from the solid phase (e.g., using a pipette) and (3) repeatedly rinsing the solid phase with a buffer (e.g., a buffer that does not denature the Cas protein or the Argonaute protein). In some embodiments, the method comprises washing the solid phase at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5, or more times). In some embodiments, the method further comprises extracting the target polynucleotide from the solid phase. In some embodiments, the extracting comprising contacting the solid phase with a protease, which proteolyzes the Cas protein or Argonaute protein releasing the target polynucleotides. The protease may be any suitable protease, including but not limited to trypsin, chymotrypsin, endoproteinase Lys-C, endoprotease AspN, endoprotease GluC, elastase, proteinase K, or papain. Corresponding protease reaction conditions and incubation times are known in the art. In some embodiments, the extracting comprising contacting the solid phase with a protein denaturing agent (e.g., a detergent, and organic solvent, or a chaotropic agent). In some embodiments, extracting comprising increasing the temperature of the solid phase (e.g., by warming a liquid in which the solid phase is located) to denature the Cas protein or Argonaute protein). In some embodiments, extracting comprises increasing or decreasing the pH of liquid in which the solid phase is located. In some aspects, this disclosure provides methods for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, wherein the target polynucleotides that are not captured during normalization are digested. In 12372134.1 some embodiments, the method comprises, for each sample of the at least two samples: (i) obtaining the sample (e.g., as described herein), wherein the target polynucleotides of the sample comprise an adapter sequence; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the adapter sequence of the target polynucleotides of the sample, and (c) a predetermined concentration of a dCas or a dArgonaute comprising an affinity tag; and (iii) contacting the solution with a nuclease (e.g., a catalytically active Cas or Argonaute protein 9) to normalize the concentration of target polynucleotides between the two or more samples (e.g., digest the target polynucleotides that are not bound to the solid phase). In some embodiments, the method comprises contacting the solution with a nuclease. In some embodiments, the nuclease is an exonuclease. In certain embodiments, the exonuclease is an exonuclease I, exonuclease II, exonuclease III, exonuclease IV, exonuclease V, exonuclease VI, exonuclease VII, or exonuclease VIII. In some embodiments, the nuclease is a catalytically- active Cas RNP or Argonaute RNP. In some embodiments, the catalytically-active Cas RNP or Argonaute RNP comprises a guide polynucleotide that is complementary to an adapter sequence. In some embodiments, the Cas endonuclease is a Cas9 endonuclease. In some embodiments, the Cas endonuclease is a Cpf1, C2c1, C2c3, C2c2, CasX, or CasY endonuclease. In some embodiments, the catalytically-active is an Argonaute protein (e.g., an Argonaute endonuclease). In some embodiments, the Argonaute protein is a CbAgo endonuclease. In certain embodiments, the Argonaute protein is a LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo endonuclease. In some aspects, the two more samples being normalized (e.g., using the methods described herein) comprise target polynucleotides comprising a first adapter sequence and a second adapter sequence. In some embodiments, the guide polynucleotide targeting region is complementary to the first adapter sequence. In some embodiments, the method further comprises contacting the sample with a primer encoding a nucleic acid sequence that is complementary to a portion of the second adapter sequence and a polymerase (e.g., a DNA polymerase) in conditions sufficient for primer elongation. As described in the “Kits” section, this primer may be used to elongate a target polynucleotide such that first adapter sequence comprises a double stranded PAM for Cas (e.g., dCas) binding. In some embodiments, the primer is complementary to the proximal portion of an adapter sequence (e.g., the second adapter sequence). In such embodiments, elongating the primer to produce a double stranded 12372134.1 polynucleotide may not produce an elongated strand that is capable of being sequenced by next- generation sequence because the elongated strand does not comprise the distal portion of the second adapter sequence. This may be advantageous because elongation (e.g., DNA amplification), can introduce artifacts (e.g., mutations) into polynucleotides that may bias or distort sequencing results. In some embodiments, the second adapter sequence is a 3’ adapter sequence. In some embodiments, the second adapter sequence is a 5’ adapter sequence. As used in herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “an antibody” optionally includes a combination of two or more such molecules, and the like. The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. The terms “may,” “may be,” “can,” and “can be,” and related terms are intended to convey that the subject matter involved is optional (that is, the subject matter is present in some examples and is not present in other examples), not a reference to a capability of the subject matter or to a probability, unless the context clearly indicates otherwise. The terms “optional” and “optionally” mean that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present as well as instances where it does not occur or is not present. The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements. As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations where interpreted in the alternative (“or”). EXAMPLES Example 1: Normalization with ELEMENT and PACBIO sequence adapters ELEMENT 12372134.1 Element Adapter 1 with the relevant Cas9 PAM site in bold 5’ GATCAGGTGAGGCTGCGACGACTTATGGCAATAGTTGACAAGCGGTAGCCTGCACA CCTTCCGACAT 3’ (SEQ ID NO: 1) Element guide RNA 1A (CGG PAM site) 5’ UUAUGGCAAUAGUUGACAAG 3’ (SEQ ID NO: 5) Element Adapter 2 There are 2 relevant PAM sites AGG, GGG, 5’ CATGTAATGCACGTACTTTCAGGGTATATTGGTGCGTGCTGGATTGGCTCACCAGAC ACCTTCCGACA 3’ (SEQ ID NO: 2) Element guide RNA 2A 5’ CAUGUAAUGCACGUACUUUC 3’ (SEQ ID NO: 6) Element guide RNA 2B 5’ AUGUAAUGCACGUACUUUC 3’ (SEQ ID NO: 7) PacBio Onso Onso Adapter SP1 with relevant PAM site in bold 5’ ATCGATTCGTGCTTGTCCGTGGTACTCGGCA 3’ (SEQ ID NO: 3) 12372134.1 Onso Guide RNA SP1_A 5’ UCGUGCUUGUCCGUGGUACU 3’ (SEQ ID NO: 8) Onso adapter SP2 with two PAM sites - CGG and GGG in bold 5’ TCGATTCGTGCTCGATGAACCGGGCGCTTA 3’ (SEQ ID NO: 4) Onso Guide RNA SP2_A 5’ UCGAUUCGUGCUCGAUGAAC 3’ (SEQ ID NO: 9) Onso Guide RNA SP2_B 5’ CGAUUCGUGCUCGAUGAACC 3’ (SEQ ID NO: 10) Example 2: Normalizing by targeting index regions of sequence adapters Exemplary generalized adapter sequence below: 5’AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[index]ATCTCGTATGCCGTCTTCT GCTTG 3’ (SEQ ID NO: 22) An example index: AGGNNNNNNNNNN Where N can be defined bases (and can vary in length). 12372134.1 5’ AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGNNNNNNNNNNATCTCGTATGC CGTCTTCTGCTTG 3’ (SEQ ID NO: 27) Here the index begins with a PAM site (bold). The guide RNA homology region for the above sequence could be: 5’ ACGUCUGAACUCCAGUCACA 3’ (SEQ ID NO: 28) Adding PAMs adjacent to index sequences allows normalizing libraries which do not normally have a PAM site built in. By making the PAM site part of the index sequence the sequencing performance will not be affected but normalization will be possible for non-PAM-site containing adapter types. In general, the idea is to introduce a constant PAM site into the index sequence of an adapter. This can also work in reverse - if we put the PAM site in a different orientation in the adapter like this: 5’ AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNNNAGGATCTCGTATGC CGTCTTCTGCTTG 3’ (SEQ ID NO: 29) This allows design of index-specific guide RNAs, which only capture specific indexes, since the hybridization region is upstream of the PAM site and thus include the index sequence. For example Index 1 12372134.1 5’ AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTAGGACTGAGGATCTCGTATGC CGTCTTCTGCTTG 3’ (SEQ ID NO: 30) With the corresponding guide RNA 5’ CUCCAGUCACCGUAGGACUGA 3’ (SEQ ID NO: 31) Index 1 5’ AGATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGTACAGATAGGATCTCGTATGC CGTCTTCTGCTTG 3’ (SEQ ID NO: 32) With the corresponding guide RNA 5’ UCCAGUCACAGGUACAGAUA 3’ (SEQ ID NO: 33) Example 3: Capture of ULTIMA Genomics Libraries using dCas9 ribonucleoprotein (RNP) formulated with either UG_sgRNA_1, UG_sgRNA_2, or UG_sgRNA_3 Library normalization: design of sgRNA and RNP testing for the ULTIMA Genomics sequencer sgRNA design The ULTIMA Genomics sequencer uses the following “UG_A” adapter 5’-CCATCTCATCCCTGCGTGTCTCCGACTGCACAT[sample index]-3’ (SEQ ID NO: 34; SEQ ID NOs: 567-605) The sample index sequence is variable but the region 5’ of it is conserved. sgRNAs were designed for the conserved region of the “UG_A” adapter. “*” denotes a phosphorothioate bond “mA” / ”mU” / ”mG” denote 2'-O-Methyl RNA Bases UG_sgRNA_1 12372134.1 “UG_A” adapter with target sequence underlined below: 5’-CCATCTCATCCCTGCGTGTCTCCGACTGCACAT[sample index]-3’ (SEQ ID NO: 34; SEQ ID NOs: 567-605) UG_sgRNA_1 sequence 5’mA*mU*mG*rUrGrCrArGrUrCrGrGrArGrArCrArCrGrCrGrUrUrUrUrArGrArGrCrUrArGr ArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCr UrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU3’ (SEQ ID NO: 35) UG_sgRNA_2 “UG_A” adapter with target sequence underlined below: 5’-CCATCTCATCCCTGCGTGTCTCCGACTGCACAT[sample index]-3’ (SEQ ID NO: 34; SEQ ID NOs: 567-605) UG_sgRNA_2 sequence 5’mG*mG*mA*rGrArCrArCrGrCrArGrGrGrArUrGrArGrArGrUrUrUrUrArGrArGrCrUrArGr ArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCr UrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU3’ (SEQ ID NO: 36) UG_sgRNA_3 “UG_A” adapter with target sequence underlined below: 5’-CCATCTCATCCCTGCGTGTCTCCGACTGCACAT[sample index]-3’ (SEQ ID NO: 34; SEQ ID NOs: 567-605) UG_sgRNA_3 sequence 5’mU*mG*mU*rGrCrArGrUrCrGrGrArGrArCrArCrGrCrArGrUrUrUrUrArGrArGrCrUrArGr ArArArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCr UrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU3’ (SEQ ID NO: 37) 12372134.1 RNP formation sgRNAs were dissolved in water and made up to a concentration of 15 uM. dCas9 RNP solutions was formed by combining 100 picomoles of dCas9 with 150 picomoles of sgRNA (either UG_sgRNA_1, UG_sgRNA_2 or UG_sgRNA_3) in the presence of 50 mM HEPES pH 6.5, 100 mM NaCl, 5 mM MgCl2 and 0.02% Tween-20 and incubating for 20 minutes at 25℃ in a volume of 100 ul. The resulting 1 picomole / ul (1000 nM) RNP solutions were diluted to 25 nM with 50 mM HEPES pH 6.5, 100 mM NaCl, 5 mM MgCl2 and 0.02% Tween-20. Library preparation An ULTIMA Genomics library containing the “A” adapter sequences was prepared from human genomic DNA (genotype NA12878), using the Watchmaker Genomics Library Preparation kit with Fragmentation, followed by PCR amplification. The library was made up to a molar concentration of 50 nM (50 femtomoles / ul) with water. Library capture using limiting amounts of RNP combined with excess library 500 femtomoles of the library (10 ul) were combined with 250 fmoles of each RNP and incubated at 37C for 15 minutes to bind RNP to library molecules. After the RNP binding, 5 ul of Dynabeads His-Tag Isolation and Pulldown beads (Thermo Fisher Scientific) were added to each binding reaction, followed by incubation at room temperature for 5 minutes, to bind the library:RNP complexes to the beads. Beads were washed with 100 ul of 50 mM HEPES pH 6.5, 100 mM NaCl, 5 mM MgCl2 and 0.04% Tween-20. Libraries were eluted by resuspending the beads in 10 mM Tris-Cl pH 8.0, 0.1% SDS and incubated at 70C for 5 minutes. After the elution, 10 ul of water was added to each eluate and the libraries were analysed using the Agilent TapeStation HSD5000 assay. (FIG. 1). Table 6: Library Recovery 12372134.1 As expected, all three RNPs recovered between 10 and 25% of the input library. This demonstrates that the sgRNAs designed for the ULTIMA Genomics adapter are functional and can be used for normalization. UG_sgRNA_1 and UG_sgRNA_2 showed better capture efficiency than UG_sgRNA_3. Additionally, different ratios of index-specific guide RNAs can be used to normalize libraries accordingly to specific stoichiometric ratios in a predictable manner. This may also be used to enrich a polynucleotides of a given sample from a library of polynucleotides from many different samples using the index of the given sample. 12372134.1
Claims
CLAIMS What is claimed is:
1. A method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence of any one of SEQ ID NOs: 1-4; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the adapter sequence, or a reverse complement of the adapter sequence, of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein or the dArgonaute protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples.
2. The method of claim 1, wherein the targeting region is complementary to a static region of an adapter sequence or a reverse complement thereof.
3. The method of claim 1 or claim 2, wherein the solutions produced from the at least two samples are combined into a single solution after step (ii) and before step (iii). 12372134.
14. A method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index, or a reverse complement of the index, of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein or the dArgonaute protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples.
5. The method of claim 4, wherein the solutions produced from the at least two samples are combined into a single solution after step (ii) and before step (iii).
6. A method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising: (i) obtaining a mixture of the at least two samples, wherein the target polynucleotides of the at least two samples comprise an adapter sequence and an index, wherein the at least two samples do not have the same index, and, for each sample, obtaining a guide polynucleotide comprising a targeting region that is complementary to the index, or a reverse complement of the index, of the sample; 12372134.1(ii) producing a solution, the producing comprising combining (a) the mixture of the at least two samples, (b) a predetermined concentration of each a guide polynucleotide; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein or the dArgonaute protein is cognate to its respective guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples.
7. The method of claim 6, wherein the predetermined concentration of each guide polynucleotide is different.
8. The method of claim 7, wherein the different predetermined guide polynucleotide concentrations normalize the target polynucleotides of the at least two samples in a predetermined stoichiometric ratio.
9. A method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a protospacer adjacent motif (PAM); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide comprising a targeting region that is complementary to a reverse compliment of a portion of the adapter sequence that is adjacent to the 5’ end of the PAM of the target polynucleotides of the sample; and (c) a predetermined concentration 12372134.1of a dCas protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the two or more samples.
10. The method of claim 9, wherein the solutions produced from the at least two samples are combined into a single solution after step (ii) and before step (iii).
11. The method of claim 9 or claim 10, wherein the portion is 15-30 nucleotides.
12. A method for normalizing the concentration of target polynucleotides between at least two samples each comprising target polynucleotides, the method comprising, for each sample of the at least two samples: (i) obtaining the sample, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a reverse complement of a protospacer adjacent motif (rPAM); (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide comprising a targeting region that is complementary to a portion of the adapter sequence that is adjacent to the 3’ end of the rPAM of the target polynucleotides of the sample; and (c) a predetermined concentration of a dCas protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and 12372134.1(v) extracting the target polynucleotides from the solid phase to normalize the concentration of target polynucleotides between the at least two samples.
13. The method of claim 12, wherein the solutions produced from the at least two samples are combined into a single solution after step (ii) and before step (iii).
14. A method of enriching a target polynucleotide in a sample, the method comprising: (i) obtaining the sample, wherein the target polynucleotide of the sample comprises an adapter sequence comprising an index; (ii) producing a solution, the producing comprising combining (a) the sample, (b) a predetermined concentration of a guide polynucleotide comprising a targeting region that complementary to the index or a reverse complement of the index; and (c) a predetermined concentration of a dCas protein or a dArgonaute protein comprising an affinity tag, wherein the predetermined concentration of the dCas protein or the dArgonaute protein is cognate to the guide polynucleotide; (iii) contacting the solution with a solid phase comprising an affinity tag binding molecule that is capable of binding to the affinity tag; (iv) separating the solution from the solid phase; and (v) extracting the target polynucleotides from the solid phase.
15. The method of any one of claims 4, 5, 9, or 10, wherein the index region is adjacent to a PAM.
16. The method of any one of claims 6-13, wherein the PAM is adjacent to the 5’ terminal of the index.
17. The method of any one of claims 4, 5, 9, or 10, wherein the index region is adjacent to a rPAM.
18. The method of claim 12 or claim 13, wherein the rPAM is adjacent to the 3’ terminal of the index. 12372134.
119. The method of any one of claims 4-18, wherein the index comprises a nucleic acid sequence of any one of the index sequences described herein.
20. The method of claim 1 or claim 2, wherein the guide polynucleotide comprises a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide or an Argonaute guide polynucleotide.
21. The method of any one of claims 1-20, wherein the Cas gRNA polynucleotide targeting region is a homology region.
22. The method of claim 1, wherein the Cas gRNA polynucleotide comprises a homology region of any one of SEQ ID NOs: 5-10.
23. The method of claim 1, wherein the Argonaute guide polynucleotide is an siRNA, miRNA, piRNA, shRNA or siDNA.
24. The method of any one of claims 1-23, wherein the guide polynucleotide is a DNA polynucleotide.
25. The method of any one of claims 1-24, wherein the guide polynucleotide is a RNA polynucleotide.
26. The method of claim 24 or claim 25, wherein the guide polynucleotide comprises a modified nucleic acid.
27. The method of claim 26, wherein the modified nucleic acid comprises 2′F RNA, 2′OMe RNA, and / or a phosphorothioate bonds (PS).
28. The method of claim 27, wherein the guide polynucleotide is a Cas gRNA polynucleotide and the Cas gRNA polynucleotide does not comprise a modified nucleic acid in a position that interacts with a Cas protein cognate to the gRNA.
29. The method of any one of claims 1-28, wherein the dCas is a catalytically-inactive Cpf1, C2c1, C2c3, C2c2, CasX, or CasY protein.
30. The method of claim 29, wherein the dCas protein comprises an amino acid sequence of SEQ ID NO:
13. 12372134.
131. The method of any one of claims 1-5, wherein the dArgonaute is a catalytically-inactive LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo.
32. The method of any one of claims 1-31, wherein the affinity tag binding molecule comprises Ni2+ and the affinity tag comprises a His Tag.
33. The method of any one of claims 1-31, wherein the affinity tag binding molecule comprises biotin and the affinity tag comprises avidin.
34. The method of any one of claims 1-31, wherein the affinity tag binding molecule comprises an anti-myc antibody and the affinity tag comprises a myc tag.
35. The method of any one of claims 1-34, wherein the affinity tag and corresponding affinity tag binding molecule are selected from Table 1.
36. The method of any one of claims 1-35, wherein the solid phase comprises magnetic beads.
37. The method of any one of claims 1-36, wherein separating the solution from the solid phase comprises immobilizing the solid phase and washing the solid phase.
38. The method of any one of claims 1-37, wherein extracting the target polynucleotides from the solid phase comprises combining the solid phase and protease.
39. The method of any one of claims 1-38, wherein extracting the target polynucleotides from the solid phase comprises combining the solid phase and proteinase K in a solution sufficient for proteinase K activity.
40. The method of claim 39, wherein proteinase K digests the dCas protein or dArgonaute protein that is bound to the solid phase thereby extracting the target polynucleotides.
41. The method of any one of claims 1-40, wherein steps (i)-(v) are performed in sequential order. 12372134.
142. The method of any one of claims 1-13, wherein normalizing comprises making the concentration of the of target polynucleotides between the at least two samples within 15% of one another after normalization.
43. A guide polynucleotide comprising a targeting region that is complementary to any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4 or a reverse complement of any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4.
44. A guide polynucleotide comprising a targeting region that is complementary to an index of any one of the index sequences described herein or a reverse complement the index sequences described herein.
45. The guide polynucleotide of claim 43 or claim 44, wherein the guide polynucleotide comprises a CRISPR-associated protein (Cas) guide RNA (gRNA) polynucleotide or an Argonaute guide polynucleotide.
46. The guide polynucleotide of any one of claims 43-45, wherein the Cas gRNA polynucleotide targeting region is a homology region.
47. The guide polynucleotide of claim 43, wherein the Cas gRNA polynucleotide comprises a homology region of any one of SEQ ID NOs: 5-10.
48. The guide polynucleotide of any one of claims 43-47, wherein the Argonaute guide polynucleotide is an siRNA, miRNA, piRNA, shRNA or siDNA.
49. The guide polynucleotide of any one of claims 43-48, wherein the guide polynucleotide is a DNA polynucleotide.
50. The guide polynucleotide of any one of claims 43-48, wherein the guide polynucleotide is an RNA polynucleotide.
51. The guide polynucleotide of claim 49 or claim 50, wherein the guide polynucleotide comprises a modified nucleic acid. 12372134.
152. The guide polynucleotide of claim 51, wherein the modified nucleic acid comprises 2′F RNA, 2′Ome RNA, and / or a phosphorothioate bonds (PS).
53. The guide polynucleotide of claim 52, wherein the guide polynucleotide is a Cas gRNA polynucleotide and the Cas gRNA polynucleotide does not comprise a modified nucleic acid in a position that interacts with a Cas protein cognate to the gRNA.
54. A kit comprising: (a) the guide polynucleotide of any one of claims 43-53; and (b) a Cas protein or an Argonaute protein, or a polynucleotide sequence encoding a Cas protein or an Argonaute protein.
55. The kit of claim 54, wherein the Cas protein is a catalytically-inactive Cas protein (dCas).
56. The kit of claim 54 or claim 55, wherein the Cas protein is a Cas9 protein that is catalytically-inactive (dCas9).
57. The kit of any one of claims 54-56, wherein the Cas9 protein comprises a D10A mutation and a H840A mutation.
58. The kit of any one of claims 54-56, wherein the Cas protein is a catalytically-inactive Cpf1, C2c1, C2c3, C2c2, CasX, or CasY protein.
59. The kit of any one of claims 54-58, wherein the dCas protein comprises an amino acid sequence having at least 95% identity to SEQ ID NO:
13.
60. The kit of any one of claims 56-59, wherein the dCas protein comprises an amino acid sequence of SEQ ID NO:
13.
61. The kit of claim 54, wherein the Argonaute protein is catalytically-inactive (dArgonaute).
62. The kit of claim 54, wherein the Argonaute protein is a CbAgo protein that is catalytically-inactive. 12372134.
163. The kit of claim 54, wherein the Argonaute protein is a LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo protein that is catalytically-inactive.
64. The kit of any one of claims 61-63, wherein the dArgonaute protein comprises an amino acid sequence having at least 95% identity to any one of SEQ ID NOs: 15-21.
65. The kit of any one of claims 61-63, wherein the dArgonaute protein comprises an amino acid sequence of any one of SEQ ID NOs: 15-21.
66. The kit of any one of claims 54-65, further comprising a catalytically active Cas protein or a catalytically active Argonaute protein.
67. The kit of claim 66, wherein the catalytically active Cas protein comprises Cpf1, C2c1, C2c3, C2c2, CasX, Cas9, or CasY.
68. The kit of claim 67, wherein the catalytically active Argonaute protein comprises LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo.
69. The kit of any one of claims 54-58, wherein the guide polynucleotide is capable of binding to the Cas protein or the Argonaute protein to form a ribonucleoprotein complex and the ribonucleoprotein complex is capable of binding to an adapter sequence.
70. The kit of any one of claims 54-69, further comprising a primer that is complementary to a portion of an adapter sequence.
71. The kit of claim 70, wherein the portion of the adapter sequence is located in the proximal portion of the adapter sequence.
72. The kit of claim 70 or claim 71, wherein the primer is not complementary to an adapter sequence that is complementary to the guide polynucleotide targeting region.
73. A reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides comprise an adapter sequence of any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4; 12372134.1(ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the adapter sequence or a reverse complement of the adapter sequence; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein.
74. A reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides comprise an adapter sequence comprising an index; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to the index or a reverse complement of the index; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein.
75. A reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a PAM ; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a reverse complement of a portion of the adapter sequence that is adjacent to the PAM of the target polynucleotides of the sample; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein.
76. A reaction mixture comprising: (i) a plurality of target polynucleotides, wherein the target polynucleotides of the sample comprise an adapter sequence comprising an index that is adjacent to a rPAM ; (ii) a predetermined concentration of a guide polynucleotide comprising a targeting region that is complementary to a portion of the adapter sequence that is adjacent to the rPAM of the target polynucleotides of the sample; and (iii) a predetermined concentration of a dCas protein or a dArgonaute protein.
77. The reaction mixture of any one of claims 73-76, wherein the predetermined concentration of the guide polynucleotide, or the dCas protein or the dArgonaute protein is lower than the concentration of target polynucleotide in the reaction mixture. 12372134.
178. The reaction mixture of claim 77, wherein the dArgonaute protein comprises LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo, or a catalytically inactive variant thereof, and the guide polynucleotides are cognate to the dArgonaute protein.
79. The reaction mixture of any one of claims 73-76, wherein the dCas protein comprises catalytically inactive Cpf1, C2c1, C2c3, C2c2, CasX, Cas9, or CasY, or a variant thereof, and the guide polynucleotides are cognate to the dCas protein.
80. The reaction mixture of any one of claims 73-79, further comprising a catalytically active Cas protein or a catalytically active Argonaute protein.
81. A ribonucleoprotein (RNP) complex comprising: (i) the guide polynucleotide of any one of claims 43-53; (ii) a Cas protein or an Argonaute protein that is cognate to the guide polynucleotide; and (iii) an adapter sequence of any one of SEQ ID NOs: 34, 22, 27, 29, or 1-4 or an adapter sequence comprising an index of any one of the index sequences described herein, wherein the targeting region of the guide polynucleotide is complementary to the adapter sequence and wherein the guide polynucleotide is cognate to the Cas protein or the Argonaute protein.
82. The RNP complex of claim 81, wherein the Argonaute protein comprises LrAgo, PfAgo, TtAgo, AaAgo, AfAgo, MjAgo, MpAgo, NgAgo, RsAgo, CpAgo, IbAgo, KmAgo, or SeAgo, or a catalytically inactive variant thereof.
83. The RNP complex of claim 81, wherein the Cas protein comprises Cpf1, C2c1, C2c3, C2c2, CasX, Cas9, or CasY, or a catalytically inactive variant thereof. 12372134.1
Citation Information
Patent Citations
Normalization of nucleic acid samples and compositions for use in the same
WO2020131383A1
Methods of sample normalization
WO2021146601A1
Single-stranded splint strands and methods of use
WO2023168444A1
Blocked asymmetric hairpin adaptors
WO2024015962A1
Methods and compositions for sequencing library normalization
WO2024086805A2
Cited By
Multiplexed polynucleotide normalization
WO2026148075A1