Stool-based biomarker of gut inflammation to assist in detection and treatment of inflammatory bowel disease

Abstract

The present invention relates to a biomarker associated with intestinal inflammation, and more particularly, to methods for diagnosing or identifying a risk of developing intestinal inflammation using mitochondrial DNA and methods of treating disorders associated with intestinal inflammation.

Description

STOOL-BASED BIOMARKER OF GUT INFLAMMATION TO ASSIST IN DETECTION AND TREATMENT OF INFLAMMATORY BOWEL DISEASECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application Serial No. 63 / 638,758, filed April 25, 2024, which is incorporated herein by reference in its entirety.STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING

[0002] A Sequence Listing in XML format, entitled 5470-974WO_ST26.xml, 3,663 bytes in size, generated on April 21, 2025, and filed herewith, is hereby incorporated by reference in its entirety for its disclosures.FIELD OF THE INVENTION

[0003] The present invention relates to a biomarker associated with intestinal inflammation, and more particularly, to methods for diagnosing or identifying a risk of developing intestinal inflammation using mitochondrial DNA and methods of treating disorders associated with intestinal inflammation.BACKGROUND OF THE INVENTION

[0004] Inflammatory Bowel Disease (IBD) is an autoimmune disease centered around inflammatory changes in the intestine (e.g., in the intestinal epithelium). Incidence rates of pediatric IBD continue to increase annually. The two types of IBD include Ulcerative Colitis (UC) and Crohn’s Disease (CD). UC is a condition that involves inflammation and ulcers along the lining of the large intestine and rectum. CD is characterized by inflammation of the lining of the digestive tract, which involves deeper layers of the digestive tract and most commonly affects the small intestine. IBD is driven by a combination of genetic susceptibility, microbial interactions, and initial inflammatory triggers, and can be difficult to monitor with serum laboratory tests. Inflammatory markers are often not sensitive due to the primary epithelial nature of the inflammatory changes, leading to patients with normal serum markers of inflammation who none the less have significant disease activity.

[0005] Current practice is to monitor disease activity via a combination of disease scores and recurrent endoscopic evaluations to determine histological remission. Therapeutic challenges involve optimizing therapy despite the common discordance between histologic and symptom severity as well as assessing disease state based on the interpretation of currentlyavailable inflammatory markers. The current standard biomarker is fecal calprotectin (FC), which measures a by-product of neutrophil activity, but does not reliably determine histological status. Furthermore, FC has other limitations in small intestinal diseases, such that as bacteria digest and degrade it, small intestinal disease or proximal colitis appear less significant on the basis of marker assay alone. Further, the reliability of FC as a biomarker is diminished in pediatric populations, and the lack of an effective biomarker leaves endoscopic evaluation as the only way to establish true remission, and the expense of this imaging test further hampers adherence to the recommended screening.

[0006] Environmental Enteropathic Dysfunction (EED) is a condition associated with recurrent exposure to enteropathogens and is thought to be the primary driver of stunted growth to globally impact an estimated 22% of children under five years of age. EED is a chronic disease of the small intestine characterized by intestinal inflammation, barrier disruption, malabsorption, and systemic inflammation. Current biomarkers for EED include fecal neopterin, myeloperoxidase, and alpha-l-anti-trypsin which show variable predictive performance across geographic regions due to variations in pathogens between regions. To date, non-invasive EED biomarkers that maintain high accuracy across populations have yet to be identified.

[0007] Necrotizing Enterocolitis (NEC) is a life-threatening illness almost exclusively affecting neonates with a mortality rate as high as 50%. NEC is characterized by inflammation of the intestine leading to bacterial invasion causing cellular damage and cellular death and necrosis of the colon and intestine. Yet, no ideal biomarker for NEC has been discovered.

[0008] Early and accurate detection of intestinal inflammation is desirable since it allows for a more effective treatment of patients and higher remission rates.SUMMARY OF THE INVENTION

[0009] The present invention is based on the discovery that the levels of mitochondrial DNA (mtDNA) in stool samples can serve as a biomarker for the presence and / or risk of intestinal inflammation as it relates to various gastrointestinal disorders in a subject. Mitochondrial DNA levels can also serve to predict the risk of gastrointestinal disorders as well as staging of disease. In particular, the inventors have shown that the level of mtDNA is indicative of the presence, stage, risk, and / or responsiveness of a disease characterized by intestinal inflammation.

[0010] Thus, one aspect of the present invention relates to a method for detecting intestinal inflammation in a subject, comprising: i) obtaining a stool sample from the subject;and ii) quantitating the amount of mitochondrial DNA (mtDNA) in the sample; wherein the presence of an increased amount of mtDNA in the sample relative to the amount in a control population indicates the presence of intestinal inflammation in the subject.

[0011] In another aspect, the present invention relates to determining the severity of intestinal inflammation in a subject having or suspected of having intestinal inflammation, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the amount of mtDNA in the sample relative to the amount in a control population indicates the severity of intestinal inflammation in the subject.

[0012] In an additional aspect, the present invention relates to a method of determining the risk of intestinal inflammation in a subject, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the presence of an increased amount of mtDNA in the sample relative to the amount in a control population indicates the subject is at risk for intestinal inflammation.

[0013] In another aspect, the present invention relates to a method of treating intestinal inflammation in a subject in need thereof, comprising: i) obtaining a stool sample from the subject; ii) quantitating the amount of mtDNA in the sample; wherein the amount of mtDNA in the sample relative to the amount in a control population indicates the severity of intestinal inflammation in the subject; and iii) administering a therapy to the subject based on the severity of the inflammation.

[0014] In a further aspect, the present invention relates to a method of monitoring the effectiveness of a treatment for intestinal inflammation in a subject in need thereof, comprising: i) obtaining a stool sample from the subject at two or more timepoints before, during, and / or after the treatment; and ii) quantitating the amount of mtDNA in each of the samples; wherein an increase or no change in the amount of mtDNA in the sample over time indicates that the treatment is ineffective and a decrease in the amount of mtDNA in the sample over time indicates that the treatment is effective.

[0015] In an additional aspect, the present invention relates to a method of guiding treatment for intestinal inflammation in a subject in need thereof, said method comprising: i) obtaining a stool sample from the subject at two or more timepoints before, during, and / or after the treatment; ii) quantitating the amount of mtDNA in each of the samples; wherein an increase or no change in the amount of mtDNA in the sample over time indicates that the treatment is ineffective and a decrease in the amount of mtDNA in the sample over time indicates that the treatment is effective; and iii) modifying the treatment administered to the subject based on the effectiveness of previous treatment.

[0016] In a further aspect, the present invention relates to a method of determining if a subject being treated for intestinal inflammation is in histological remission, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the presence of an amount of mtDNA in the sample that is equal to or lower than the amount in a control population indicates that the subject is in histological remission.

[0017] Another aspect of the invention relates to kits for carrying out the disclosed methods. In some embodiments, the kits comprise reagents for detecting mtDNA in a stool sample. In one embodiment, the kit comprises one or more primers and / or probes for amplifying mtDNA.

[0018] These and other aspects of the invention are set forth in more detail in the description of the invention below.BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain principles of the invention.

[0020] FIGS. 1A-1D show concentration of fecal calprotectin (FIGS. 1A and 1C) and fecal mtDNA (FIGS. IB and ID) with increasing severity of IBD from histological remission to severe disease from samples from 13 IBD patients (FIGS. 1A and IB). Scatter plot shows non-parametric correlations between scoring from Robart’s Histopathology Index and fecal calprotectin (FIG. 1C) and fecal mtDNA (FIG. ID) from the same 13 samples.

[0021] FIG. 2 shows a summary table of individual patients in Example 1.

[0022] FIG. 3 shows the negative and positive bands by comparing them with the no template controls and positive controls run on each plate. The midpoint value is between the peaks of the positive and negative bands and sets the threshold at the midpoint value.

[0023] FIG. 4 shows the negative extraction controls in the far left two wells, no template controls (UV-treated molecular grade water) in the middle two wells, and positive controls (human stools) in the far right two wells.

[0024] FIG. 5 shows fecal calprotectin and mtDNA concentrations with accompanying metadata of IBD patients.

[0025] FIG. 6 shows increase in concentrations of fecal mtDNA per gram of stool in areas with higher prevalence of enteropathogen carriage in Bangladesh (median logic = 7.7, interquartile range, IQR = 0.66), Mozambique (median logic = 8.0, IQR = 0.91), and Cambodia (median logic = 9.9, IQR = 0.84) versus the United States (median logic = 7.15, IQR = 0.58).

[0026] FIG. 7 shows a principal component analysis on mtDNA and other biomarkers. Results show weak pairwise correlations with each of the EED biomarkers. The mtDNA eigenvector was roughly orthogonal to the other biomarker eigenvectors.DETAILED DESCRIPTION OF THE INVENTION

[0027] The present invention now will be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the invention are shown. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. For example, features illustrated with respect to one embodiment can be incorporated into other embodiments, and features illustrated with respect to a particular embodiment can be deleted from that embodiment. In addition, numerous variations and additions to the embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention.

[0028] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms "a," "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms "comprises" and / or "comprising," when used in this specification, specify the presence of stated features, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, steps, operations, elements, components, and / or groups thereof. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0029] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the specification and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein. Well- known functions or constructions may not be described in detail for brevity and / or clarity.

[0030] It will be understood that, although the terms "first," "second," etc. may be used herein to describe various elements, and these elements should not be limited by these terms. These terms are only used to distinguish one element from another. Thus, a "first" elementdiscussed below could also be termed a "second" element without departing from the teachings of the present invention. The sequence of operations (or steps) is not limited to the order presented in the claims or figures unless specifically indicated otherwise.

[0031] Furthermore, the term "about," as used herein when referring to a measurable value such as an amount of a compound or agent of this invention, dose, time, temperature, and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified amount.

[0032] " Treat" or "treating" or "treatment" refers to any type of action that imparts a modulating effect, which, for example, can be a beneficial effect, to a subject afflicted with a disorder, disease or illness, including improvement in the condition of the subject (e.g., in one or more symptoms), delay or reduction in the progression of the condition, and / or change in clinical parameters, disease or illness, etc., as would be well known in the art.

[0033] " Altered level" or "altered levels" as used with respect to mtDNA herein refer to an increased level (e.g., a 5, 10, 50, 100-fold increase, or more) or a decreased level (e.g., a one or two-fold decrease, or more) in the quantity of one or more biomarker detectable in or via a biological sample from a subject, as compared to a level or levels of one or more biomarker in a control (e.g., corresponding subject not afflicted with intestinal inflammation or a an average level in a population). A presence or absence of a detectable amount mtDNA may also be considered an altered level.

[0034] "Biological sample" as used herein refers to any material taken from the body of a subject that may carry the target compound or compounds of the tests described herein, including both tissue samples and biological fluids such as blood samples, stool samples, saliva samples, urine samples, etc.

[0035] " Stool sample" as used herein refers to whole feces or stool and / or any fraction thereof that may contain detectable levels of the biomarker mtDNA therein (if the biomarker mtDNA is present in the whole feces / stool sample from which said fraction is obtained), and in particular embodiments, refers to a fecal sample.

[0036] "Diagnosing," "prognosing," "risk, "or "screening" as used herein means providing an indication that a subject may be afflicted with or at risk of developing a disease, particularly a gastrointestinal disorder causing inflammation in the intestine, and includes other terms such as screening for a disease, providing a risk assessment for disease, etc. It will be appreciated that no such technique is perfect and that such diagnosis, prognosis, or the like may be confirmed by other procedures such as physical examination, imaging, histological examination of tissue samples, etc. The term "prognosing" as used herein includes providing anassessment or indication of disease in response to treatment (such as but not limited to antiinflammatory drugs, immunosuppressant drugs, biologies, antibiotics, dietary changes, surgery, and combinations thereof) after initial diagnosis, as an indication of the efficacy of the diagnostic and / or treatment, risk of the disease returning, severity of disease following treatment, or the like.

[0037] " Marker" or "biomarker" as used herein refers to mtDNA that can be detected, directly or indirectly in a biological sample from a subject, an increase or decrease of the amount of which, compared to amounts found in similar subjects without disease or in the general population (e.g., controls), is indicative of the presence or risk of intestinal inflammation.

[0038] " Mitochondrial DNA" "human Mitochondrial DNA" or "fecal mitochondrial DNA" as used herein refers to a circular molecule of about 16,600 base pairs long and comprising 37 genes, which encode 13 proteins, 22 tRNAs, and 2 rRNAs. The vast majority of about 3,000 proteins involved in mitochondrial functions, however, are encoded by the nuclear genome.

[0039] "Cytochrome b" as used herein refers to the region of mtDNA encoding cytochrome b and in some embodiments can be the region targeted for measurement of mtDNA.

[0040] "Subjects" as described herein include human subjects and "patients" as well as other mammals in veterinarian or research settings. The subjects may be male or female and may be of any race or ethnicity, including but not limited to Caucasian, African American, African, Asian, Hispanic, Indian, etc. The subjects may be of any age, including newborn, neonate, infant, child, adolescent, adult, and geriatric. Subjects may also include animal subjects, particularly mammalian subjects such as dog, cat, horse, mouse, rat, etc., e.g., screened for veterinary medicine or pharmaceutical drug development purposes. Subjects include but are not limited to those who may have, possess, have been exposed to, or have been previously diagnosed as afflicted with one or more risk factors for intestinal inflammation. Risk factors include age, gender, race, smoking, diet, obesity, diabetes, work exposure, and family history. These risk factors may be considered in combination with the disclosed methods of detecting intestinal inflammation for a diagnosis, prognosis, or screening. The disclosed methods of detecting intestinal inflammation for a diagnosis, prognosis or screening may also be used in combination with other diagnostic methods.

[0041] A "value" may be an amount of mtDNA in a sample, a score based on the detected amounts of biomarkers mtDNA in a sample, a percentile based on a population of patients, a quantitative amount or semi-quantitative amount of mtDNA in a sample, or other suitable quantities based on the detected biomarkers.Methods

[0042] The present invention is based on the discovery that the levels of mtDNA can serve as a biomarker for the presence and / or risk of intestinal inflammation as it relates to various gastrointestinal disorders in a subject. In some embodiments, mtDNA levels may serve to predict the risk of gastrointestinal disorders as well as staging of disease and monitoring of treatment. In some embodiments, levels of mtDNA may be indicative of the presence, stage, risk, and / or responsiveness of a disease characterized by intestinal inflammation.

[0043] It will be understood by one having skill in the relevant art that elevated levels of extracellular mtDNA may serve as a biomarker of inflammation, e.g., as mtDNA is released into the extracellular environment upon cellular stress, damage, or early immune activation, and often precedes detectable histological or clinical signs of inflammation. In some embodiments, mtDNA levels may increase before overt inflammation, thereby providing predictive value for identifying individuals at risk of developing inflammatory conditions. In some embodiments, when elevated mtDNA levels are detected in conjunction with other biomarkers of immune activation or epithelial barrier dysfunction, elevated mtDNA levels may reflect the presence of active inflammation. It will be further appreciated that elevated levels can refer to predictive and / or diagnostic contexts in which mtDNA levels are analyzed in relation to temporal changes, baseline measurements, and accompanying clinical or molecular features indicative of inflammation severity or onset.

[0044] One advantage of the present invention is the ability of the disclosed methods to detect intestinal inflammation without invasive and / or expensive techniques. Another advantage is the ability of the disclosed methods to detect intestinal inflammation at different severity stages (e.g., at a potentially more treatable stage) then current techniques.

[0045] Thus, some embodiments of the present invention relate to a method for detecting intestinal inflammation in a subject, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mitochondrial DNA (mtDNA) in the sample; wherein the presence of an increased amount of mtDNA in the sample relative to the amount in a control population indicates the presence of intestinal inflammation in the subject. In some embodiments, a control subject or a control population may comprise healthy individuals without clinical or histological evidence of intestinal inflammation, e.g., whose stool mtDNA levels represent a baseline reference level. In some embodiments, a control subject or a control population may be, e.g., age-, gender-, race-, and / or geography-matched to a subject, and confirmed to be devoid or substantially free of enteric infection or gastrointestinal symptoms ata time of sample collection. In some embodiments, a control subject or a control population may comprise individuals with normal levels of established fecal inflammatory markers, as would be understood by the skilled artisan in the relevant art, such as calprotectin or lactoferrin, and no recent history of antibiotic or anti-inflammatory medication use. In some embodiments, a control subject or a control population may be established by obtaining a stool sample from the subject or each member of the control population, and quantitating the amount of mitochondrial DNA (mtDNA) in the sample. For example, a stool sample can be obtained from each member of a population of healthy individuals without clinical or histological evidence of intestinal inflammation, and the amount of mtDNA in each sample quantitated to determine the level of mtDNA therein, e.g., averaging mtDNA levels among all members of the control population to determine a reference level. In some embodiments, a reference level of mtDNA may be established by obtaining a stool sample from a subject (e.g., each member of a control population), and quantitating the amount of mitochondrial DNA (mtDNA) in the sample.

[0046] In some embodiments, intestinal inflammation may be related to various gastrointestinal disorders, including without limitation, Inflammatory Bowel Disease (IBD), which comprises Ulcerative Colitis (UC) and Crohn’s disease (CD), Necrotizing Enterocolitis (NEC), and Environmental Enteropathic Dysfunction (EED).

[0047] In some embodiments, a subject may be a subject having IBD, that has had IBD, or may be at risk for IBD. A subject at risk for IBD may be one that has a family history of the disease, may be genetically predisposed to the disease, or may have symptoms, habits, or other disease(s) known to lead to said disease. In one embodiment, a subject may have NEC, may have had NEC, or may be at risk for NEC. In another embodiment, a subject may have EED, may have had EED, or may become at risk for EED. A subject at risk for EED may be a subject that has a family history of EED, is genetically predisposed to EED, has recurrent exposure to enteropathogens, or has symptoms, habits, or other disease known to lead to EED.

[0048] In some embodiments, the present invention relates to a method of determining the severity of intestinal inflammation in a subject having or suspected of having intestinal inflammation, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the amount of mtDNA in the sample relative to the amount in a control population indicates the severity of intestinal inflammation in the subject.

[0049] In some embodiments, a method of determining the severity of intestinal inflammation in a subject may be used to identify the severity of intestinal inflammation related to a gastrointestinal disorder in a subject at risk for intestinal inflammation, that has exhibited symptoms of intestinal inflammation, or is known to have intestinal inflammation. For example,mtDNA levels in subjects with active inflammation (e.g., mild or moderate inflammation) can be about 0.5 to 2 orders of magnitude, or any value therebetween, greater than mtDNA levels in a control population. In a subject with severe inflammation, mtDNA levels may be at least 2 orders of magnitude greater than a control population, including 2, 3, 4, 5 or greater orders of magnitude greater than a control population. In some embodiments, in a subject with severe inflammation, mtDNA levels may be at least 100-fold (i.e., 10,000%) greater than a control population, including increases of approximately 100-fold (10,000%), 1,000-fold (100,000%), 10,000-fold (1,000,000%), 100,000-fold (10,000,000%) or greater relative to a control population. In some embodiments, the method can provide an indication of severity of IBD that correlates with any of the known scoring systems. For example, the Pediatric Ulcerative Colitis Activity Index (PUCAI) for ulcerative colitis evaluates the severity of ulcerative colitis on a scale of less than 10: the disease is not present; 10-34: mild; 35-64: moderate; 65 or more: severe. Another common scoring system for intestinal inflammation is Pediatric Crohn Disease Activity Index (PCDAI) for Crohn’s disease, where a PCDAI score of >30 has acceptable sensitivity and specificity to indicate disease of moderate / severe activity. A PCDAI decrease of 12.5 points or greater following therapeutic intervention accurately reflects a clinically significant response. Another common scoring system for intestinal inflammation is Robarts Histopathology Index (RHI), which assesses four characteristics of mucosal activity, inflammatory infiltrate, lamina propria neutrophils, neutrophils in epithelium, and erosion or ulceration, all of which are rated on a scale of 0 to 3. Each characteristic is weighted (e.g., using respective multiplicative weights of 1, 2, 3 and 5) to produce a total score ranging from 0 (no disease activity) to 33 (most severe disease activity).

[0050] In some embodiments, fecal mtDNA may offer additional information and potential treatment options for lower and intermediate values of severity, where fecal calprotectin is insufficient for interpreting severity.

[0051] In some embodiments, the present invention relates to a method of determining a risk of intestinal inflammation in a subject, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the presence of an increased amount of mtDNA in the sample relative to the amount in a control population indicates the subject is at risk for intestinal inflammation.

[0052] In some embodiments, the method may be used to analyze the current condition of a subject (e.g., level of intestinal inflammation) and provide a determination of the potential for the subject to develop intestinal inflammation. Such a determination can be used to developa treatment plan for the subject, such as when to start treatment and which treatment option to select or change.

[0053] In some embodiments, the present invention relates to a method of treating intestinal inflammation in a subject in need thereof, comprising: i) obtaining a stool sample from the subject; ii) quantitating the amount of mtDNA in the sample; wherein the amount of mtDNA in the sample relative to the amount in a control population indicates the severity of intestinal inflammation in the subject; and iii) administering a therapy to the subject based on the severity of the inflammation.

[0054] In some embodiments, a method as presented herein may be used to develop a treatment plan for the subject based on severity of inflammation. Common treatments for intestinal inflammation include anti-inflammatory drugs such as, without limitation, aminosalicylates, mesalamine (DELZICOL®, ROWASA®), balsalazide (COLAZAL®) and olsalazine (DIPENTUM®); corticosteroids; immunosuppressants such as azathioprine (AZASAN®, IMURAN®), mercaptopurine (PURINETHOL®, PURIXAN®) and methotrexate (TREXALL®); small molecules such as tofacitinib (XELJANZ), upadacitinib (RINVOQ®) and ozanimod (ZEPOSIA®); biologies, such as anti-TNF-alpha (e.g., REMICADE®, HUMIRA®, SIMPONI®), anti-interleukin (e.g., STELARA®), anti-integrin (e.g., ENTYVIO®); antibiotics such as ciprofloxacin (CIPRO®) and metronidazole (FLAGYL®); nutritional support; and surgery.

[0055] In some embodiments, the present invention relates to a method of monitoring effectiveness of a treatment for intestinal inflammation in a subject in need thereof, comprising: i) obtaining a stool sample from a subject at two or more timepoints before, during, and / or after the treatment; and ii) quantitating the amount of mtDNA in each of the samples; wherein an increase or no change in the amount of mtDNA in the sample over time indicates that the treatment is ineffective and a decrease in the amount of mtDNA in the sample over time indicates that the treatment is effective.

[0056] In some embodiments, a time point may be about 24hrs, 48hrs, 72hrs, 96hrs, 120hrs, 144hrs, 168hrs, 192hrs, 216hrs, 240hrs, 264hrs, 288hrs, 312hrs, 336hrs, or any value therebetween, before, during, and / or after the treatment. In some embodiments, a time point may be about from 24hrs to 72hrs, from 48hrs to 96hrs, from 72hrs to 120hrs, from 96hrs to 144hrs, from 120hrs to 168hrs, from 144hrs to 192hrs, from 168hrs to 216hrs, from 192hrs to 240hrs, from 216hrs to 264hrs, from 240hrs to 288hrs, from 264hrs to 312hrs, from 288hrs to 336hrs, or any range of values therebetween. For example, two or more time points can refer toobtaining a stool sample from a subject before and after treatment, such as 24hrs before treatment and 72hrs after treatment.

[0057] The method can also be used to monitor effectiveness of a treatment for IBD after said treatment has been started.

[0058] In some embodiments, the present invention relates to a method of guiding treatment for intestinal inflammation in a subject in need thereof, said method comprising: i) obtaining a stool sample from the subject at two or more timepoints before, during, and / or after the treatment; ii) quantitating the amount of mtDNA in each of the samples; wherein an increase or no change in the amount of mtDNA in the sample over time indicates that the treatment is ineffective and a decrease in the amount of mtDNA in the sample over time indicates that the treatment is effective; and iii) modifying the treatment administered to the subject based on the effectiveness of previous treatment. In some embodiments, the method comprises obtaining one or more samples before initiation of treatment to establish a baseline mtDNA level, followed by obtaining one or more samples during the course of treatment, wherein an increase in mtDNA levels relative to baseline indicates an ineffective treatment response and prompts adjustment or escalation of therapy. In some embodiments, the method comprises obtaining one or more samples following cessation of treatment, wherein persistent elevation or rebound in mtDNA levels post-treatment indicates residual or recurring inflammation, thereby guiding decisions to resume or extend therapy. In some embodiments, samples are collected both during and after treatment, allowing for assessment of both immediate and sustained treatment efficacy. In some embodiments, a progressive decrease in mtDNA concentration across two or more time points may be indicative of a favorable therapeutic response, whereas stable or increasing levels across two or more time points may suggest inadequate treatment of inflammation and advise a change in the therapeutic approach

[0059] The method can also be used to monitor the effectiveness of a treatment after it has been started and modify the treatment based on the severity of the inflammation.

[0060] In some embodiments, the present invention relates to a method of determining if a subject being treated for intestinal inflammation is in histological remission, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the presence of an amount of mtDNA in the sample that is equal to or lower than the amount in a control population indicates that the subject is in histological remission. It will be appreciated by one of skill in the relevant art that histological remission is an important therapeutic objective in treatment of intestinal inflammation. For example, histological remission can reflect amelioration or disappearance of microscopic tissue damage and can beassociated with improved long-term clinical outcomes, including without limitation, reduced relapse rates and complications. Current methods for assessing histological remission typically rely on invasive procedures, including without limitation, endoscopy and / or biopsy, which may be burdensome, costly, and / or unsuitable for frequent monitoring. Thus, one goal of the present invention is to address these challenges for assessing histological remission by enabling non- invasive detection of histological remission through quantitation of mtDNA in stool samples, e.g., to offer a simpler, safer, and more accessible approach to assess mucosal healing and guide clinical decision-making.

[0061] In some embodiments, methods disclosed herein may be used to monitor effectiveness of a treatment after it has started and / or ended, and to determine if a subject is or remains in histological remission.

[0062] In one embodiment, methods disclosed herein may be used to screen for necrotizing enterocolitis (NEC) in premature infants. Premature infants fall within four categories: late preterm: infant bom at 34 and 36 weeks; moderately preterm: infant bom between 32 and 34 weeks; very preterm: infant bom at less than 32 weeks; extremely preterm: infant born at or before 25 weeks. Such a screening can be used to develop a treatment plan for the premature infant, such as when to start treatment and which treatment option to select or change. It will be appreciated by one of skill in the relevant art that NEC is a severe, lifethreatening gastrointestinal disease that primarily affects premature infants, particularly those born before 32 weeks of gestation NEC is characterized by inflammation and necrosis of the intestinal tissue and is one of the leading causes of morbidity and mortality in neonatal intensive care units. Early detection of NEC is critical, as the disease can progress rapidly and lead to intestinal perforation, systemic infection, and death. However, current diagnostic methods rely heavily on non-specific clinical signs and radiographic findings, which often appear after significant tissue damage has occurred.

[0063] Thus, another aim of the present invention is to provide methods for screening for NEC using non-invasive biomarkers, such as mtDNA levels in stool, so as to detect and / or prevent NEC earlier and more accurately. For example, earlier detection can facilitate timely clinical intervention and improve outcomes, such as decreased mortality. In some embodiments, treatment options for NEC may vary depending on disease severity and may include, without limitation, bowel rest with cessation of enteral feeding, administration of broad-spectrum antibiotics, and supportive care such as fluid and electrolyte management. Early identification of NEC through the methods of the invention may allow for more personalized treatmentplanning, including without limitation, improved determination of time(s) to initiate treatment, and to select or to adjust therapeutic strategies based on a condition of a subject.

[0064] In some embodiments, a biological sample may be any tissue or fluid that contains mtDNA. In some embodiments, a biological sample may be a stool sample.

[0065] A level of mtDNA may be measured by any method known in the art. In some embodiments, an amplification assay may be used. In some embodiments, polymerase chain reaction (PCR) may be used. In some embodiments, quantitative PCR may be used to quantify a target nucleic acid (e.g., mtDNA or fragments thereof) with a high degree of precision. For example, quantitative PCR is commonly performed in real-time (e.g., quantitative real-time PRC) and may use fluorescent dyes that include, but are not limited to, SYBR® GREEN™, EVAGREEN® and / or fluorophore-containing nucleic acid probes (e.g., tetrachloro-6- carboxyfluorescein, TET), such as TAQMAN®, to measure the amount of amplified product in real time. A mtDNA target may be any nucleic acid or fragment thereof originating in the mitochondrial genome of a subject. In some embodiments, a TAQMAN® assay (e.g., hCYTB484) may be used to target a nucleic acid comprising a human cytochrome b or fragment thereof using, e.g., a droplet digital (ddPCR) platform. In some embodiments, stool samples are prepared for histological analysis by any methods known in the art and as described herein.

[0066] In some embodiments, aliquots of mtDNA may be made and stored, e.g., in cryovials without any buffer. For example, for each stool sample, DNA can be extracted from aliquots resulting in biological replicates for each, and at least one extraction blank can be performed with each batch of extractions.

[0067] In some embodiments, methods of the invention as disclosed herein may comprise further steps based on an outcome of a determination. In some embodiments, when a determination indicates that a subject has an increased amount of mtDNA, methods may further comprise the step of indicating the presence of intestinal inflammation in a subject. In some embodiments, methods of the invention may further comprise the step of administering a therapy to a subject based on severity of inflammation. In another embodiment, methods of the invention may further comprise the step of modifying a treatment administered to a subject based on effectiveness of previous treatment.

[0068] In some embodiments, when a determination indicates a risk of intestinal inflammation or a responsiveness of intestinal inflammation treatment, methods of the present invention may further comprise the step of selecting an appropriate treatment or avoidance of treatment based on a risk or a responsiveness. In some embodiments, methods of the presentinvention may further comprise the step of administering to a subject an additional test to confirm the presence and / or severity of the intestinal inflammation. Additional tests may include, without limitation, biopsies, blood tests, and imaging techniques (e.g., X-rays, MRI, CT scans, endoscopic procedures, and the like). In some embodiment, when a determination indicates that the subject does not have intestinal inflammation or indicates an early stage of disease, methods of the present invention may further comprise the step of choosing not to administer a treatment or choosing a less severe treatment.Kits

[0069] Further embodiments of the invention relate to kits performing any of the disclosed methods. In some embodiments, the kit may comprise reagents for detecting mtDNA in a stool sample. A kit may further comprise other components, such as therapeutic agents, carriers, buffers, containers, materials for collecting a stool sample, device for administration, and the like. In some embodiment, a kit may comprise one or more primers and / or probes for amplifying mtDNA. A kit may be designed for therapeutic use, diagnostic use and / or research use and the additional components may be a kit suitable for an intended use. The kit may further comprise labels and / or instructions, e.g., for diagnostic or treatment of a disorder.

[0070] The present invention is more particularly described in the following examples that are intended as illustrative only since numerous modifications and variations therein will be apparent to those skilled in the art.EXAMPLESExample 1 :

[0071] Patients and sample preparation: The study included 26 pediatric and young adult patients (ages 5 to 22 years) with planned endoscopic procedures and collection of stool sample for fecal calprotectin. See Table 1 and FIG. 2.Table 1. Patient demographic information for the IBD samples analyzed in this study (n = 13)

[0072] The stool samples were collected using at-home collection kits, stored at about 4°C until patient appointment, and stored at -80°C upon receipt. Stool sample ranged in consistency from firm to loose. After cataloguing received stool samples, three aliquots for mtDNA analysis were made and stored at -80°C in cryovials without any buffer. Calprotectin was measured by ELISA via Quest Diagnostics Clinical Laboratory as pg per gram of stool.

[0073] DNA extraction'. DNA was extracted in biological triplicates using the QIAGEN® DNEASY® POWERSOIL® PRO™ following manufacturer’s instructions and quantified mtDNA copies using hCYTB484, an assay targeting a human-specific region of the cytochrome b gene, on the QIAGEN® QIACUITY® digital PCR system. Copies of the mtDNA marker to mg of stool were normalized. The quantity of nucleic acids was assessed using an INVITROGEN® QUBIT 4 FLUOROMETER™ and the broad-range double-stranded DNA kit. Mean yields were 120 ng of dsDNA / pL of extract with a standard deviation of 97 ng of dsDNA / pL. One aliquot (QIAGEN® SOLUTION C6™) of each DNA extract was stored at - 80°C for less than 1 month before analysis. To prepare working DNA solution, UV-treated microcentrifuge tubes for 20 minutes and made 1 in 10 dilutions using 5 pL of extract and 45 pL of the respective elution buffer (QIAGEN® SOLUTION C6™). The hCYTB484 starts at the 484 basepair location within the cytochrome b gene of the human mtDNA genome. The hCYTB484 amplicon is 121 basepair in length. In some embodiments, the primer sequence ishCYTB484F: CAATGAATCTGAGGAGGCTAC (SEQ ID NO:1); hCYTB604R: CGTGCAAGAATAGGAGGTG (SEQ ID NO:2); and a probe sequence of hCYTB520TM: ACCCTCACACGATTCTTTACCTTTCACT (SEQ ID NO:3). The hCYTB484 assays has a ZEN QUENCHER™ (INTEGRATED DNA TECHNOLOGIES®, Coraville, IA, USA) located in approximately the middle of the probes. All primers and probes used in this study were manufactured by INTEGRATED DNA TECHNOLOGIES® (Coraville, IA, USA). The dPCR used was QIAGEN® QIACUITY 4 SYSTEM® and the QIACUITY PROBE PCR KIT® (1 ml) (Cat. No. / ID: 250101) and QIACUITY NANOPLATE 8.5K 24-WELL® (10) (Cat. No. / ID: 250011).

[0074] The hCYTB484 had a primer concentration of 200 nM and a probe concentration of 100 nM. The pre-reaction volume was 13 pL per well and composed of 3.25 pL of the QIACUITY® PROB PCR ENZYME™, 0.037 pL of hCYTB484 probe, 0.74 pL of forward and reverse primers, 6.23 pL of molecular-grade water, and 2 pL of template. The thermocycling parameters included 2 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C and 30 seconds at 59°C. The hCYTB484 on the QIACUITY® 4 is optimized by running combinations of primer and probe concentrations to achieve a positive band around 100 RFUs and a negative band around 40 RFUs. Testing for inhibition was determined by running samples undiluted and at 1 : 10 dilutions. No evidence of inhibition was observed. FIGS. 3-4.

[0075] To assess severity of disease, the relevant disease severity score (PUCAI / PCDAI) was used to differentiate disease severity and the Robarts Histopathology Index (RHI) which has been shown to be an applicable histologic assay for both UC and CD to establish histologic remission (RHI < 3). Non-parametric tests (Kendall’s tau) were used to assess correlations between RHI and fecal mtDNA as well as calprotectin to account for nonlinearity observed in the data. See FIG. 5.

[0076] Results'. Of the 26 patients with paired endoscopy results and stool samples, an IBD status was determined for 13 patients, 7 UC and 6 CD. The results suggest that concentrations of fecal mtDNA in children and young adults with IBD increase with increasing severity of disease, with several orders of magnitude difference between histological remission versus moderate to severe cases. For example, about 104copies mtDNA / mg of stool was detected for individuals experiencing active inflammation and about 103copies / mg of stool for individuals that were healthy. Despite both fecal calprotectin and fecal mtDNA having strong correlations to RHI (Kendall’s tau approximately 0.7 for both calprotectin and mtDNA), concentrations of fecal mtDNA were more distinct between cases of histological remission versus mild and moderate severity than that of fecal calprotectin. See FIGS. 1A-1D. Thisdemonstrates that while fecal mtDNA and fecal calprotectin have similar correlations with histopathology scoring across the range of disease severity, fecal mtDNA offers additional diagnostic and / or treatment options in the lower and intermediate values in which there is difficulty in interpreting concentrations of calprotectin.

[0077] The findings suggest assay of fecal mtDNA offers tremendous potential as a reliable and sensitive biomarker for assessing intestinal inflammation. The mtDNA assay utilizes now widespread PCR technology, can be completed in-house at higher speed and lower cost than enzyme-linked immunoassay (ELISA), and due to the fairly high dynamic range of the assay, appear to be more accurate at low disease severity states. The study demonstrates at least equal overall fidelity to disease state as FC, however as FC has had challenges in identifying histologic remission, the clinical implications of higher accuracy at low disease states are substantial for mtDNA. The ability to non-invasively differentiate between clinical and histologic remission for even a subset of patients will improve burden of care, allow providers to have improved insight into disease state, and likely drive improved outcomes. As mtDNA reflects current state rates of cell death and extrusion, it is also highly likely that mtDNA levels will be much more responsive to treatment induced changes, improving clinician agility in care by being able to assess outcomes in days rather than weeks. Additionally, it does not appear to have as strong an age linkage as calprotectin, which is challenging to interpret in young children. This is a promising new technology for the management of intestinal inflammation as it relates to various gastrointestinal disorders, with the potential to improve care decision making curves and decrease endoscopic burden for patients.Example 2:

[0078] Environmental Enteropathic Dysfunction (EED) is a condition associated with recurrent exposure to enteropathogens. EED is thought to be the primary driver of stunted growth, and is estimated to effect up to a third of children under five years of age globally. To date, non-invasive EED biomarkers that maintain high accuracy across populations have yet to be identified; a composite index of fecal neopterin, myeloperoxidase, and alpha- 1 -anti -trypsin shows variable predictive performance across regions, possibly due to variation in pathogens between regions.

[0079] Evidence of human mtDNA in feces increasing in concentration during pathogenic (Zhu et al. 2022 Environ Sci Technol Lett 9:543-550) and non-pathogenic (Boyapati et al. 2018 Inflammatory Bowel Diseases 24: 10, 2113-2122) states of intestinal inflammation suggests its utility as a marker of intestinal inflammation. In this study, fecal mtDNA was firstquantified across geographic populations with varying prevalence of enteropathogen carriage. Second, associations between fecal mtDNA and current, non-invasive EED biomarkers was tested to determine if fecal mtDNA captures novel information.

[0080] Concentrations of fecal mtDNA were quantified using hCYTB484, an assay targeting the cytochrome b gene on the human mitochondrial genome, on the BioRad QX200 droplet digital polymerase chain reaction (PCR) and QIAGEN® QIACUITY® digital PCR platforms. Following extraction for nucleic acids using QIAGEN® 96 Virus and POWERFECAL® QIACUBE® HT kits, 447 child stools collected from the United States, 120 from Bangladesh, 66 from Mozambique, and 1,586 from Cambodia were analyzed. Using the stools from Mozambique, correlations between concentrations of fecal mtDNA versus current widely used, non-invasive biomarkers of EED were also investigated. Fecal mtDNA, neopterin, alpha- 1 -antitrypsin, myeloperoxidase, and calprotectin from 62 Mozambican children were measured.

[0081] Results demonstrated an increase in concentrations of fecal mtDNA per gram of stool in areas with higher prevalence of enteropathogen carriage in Bangladesh (median loglO = 7.7, interquartile range, IQR = 0.66), Mozambique (median loglO = 8.0, IQR = 0.91), and Cambodia (median loglO = 9.9, IQR = 0.84) versus the United States (median loglO = 7.15, IQR = 0.58). See FIG. 6. mtDNA showed weak pairwise correlations with each of the EED biomarkers. Performing a principal component analysis on mtDNA and the biomarkers, the biomarkers captured similar information to each other, but the mtDNA eigenvector was roughly orthogonal to the biomarker eigenvectors suggesting that mtDNA may capture information different from the specific inflammatory responses associated with EED biomarkers. See FIG. 7.

[0082] The results demonstrating increasing fecal mtDNA with enteropathogen carriage align with prior work demonstrating increased EED severity with pathogen burden (Jamil et al. 2021 PLOS Neglected Tropical Diseases 15:7, e0009584). The results in comparison with current EED biomarkers suggests that fecal mtDNA captures information from intestinal inflammation that differs from current biomarkers, and as a measure of epithelial behaviour may be more generalizable than pathogen-type specific inflammatory responses.

[0083] The foregoing examples are illustrative of the present invention, and are not to be construed as limiting thereof. Although the invention has been described in detail with reference to preferred embodiments, variations and modifications exist within the scope and spirit of the invention as described and defined in the following claims.

Claims

THAT WHICH IS CLAIMED IS:

1. A method for detecting intestinal inflammation in a subject, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mitochondrial DNA (mtDNA) in the sample; wherein the presence of an increased amount of mtDNA in the sample relative to the amount in a control population indicates the presence of intestinal inflammation in the subject.

2. A method of determining the severity of intestinal inflammation in a subject having or suspected of having intestinal inflammation, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the amount of mtDNA in the sample relative to the amount in a control population indicates the severity of intestinal inflammation in the subject.

3. A method of determining the risk of intestinal inflammation in a subject, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the presence of an increased amount of mtDNA in the sample relative to the amount in a control population indicates the subject is at risk for intestinal inflammation.

4. A method of treating intestinal inflammation in a subject in need thereof, comprising: i) obtaining a stool sample from the subject; ii) quantitating the amount of mtDNA in the sample, wherein the amount of mtDNA in the sample relative to the amount in a control population indicates the severity of intestinal inflammation in the subject; and iii) administering a therapy to the subject based on the severity of the inflammation.

5. A method of monitoring the effectiveness of a treatment for intestinal inflammation in a subject in need thereof, comprising: i) obtaining a stool sample from the subject at two or more timepoints before, during, and / or after the treatment; and ii) quantitating the amount of mtDNA in each of the samples;wherein an increase or no change in the amount of mtDNA in the sample over time indicates that the treatment is ineffective and a decrease in the amount of mtDNA in the sample over time indicates that the treatment is effective.

6. A method of guiding treatment for intestinal inflammation in a subject in need thereof, the method comprising: i) obtaining a stool sample from the subject at two or more timepoints before, during, and / or after the treatment; ii) quantitating the amount of mtDNA in each of the samples, wherein an increase or no change in the amount of mtDNA in the sample over time indicates that the treatment is ineffective and a decrease in the amount of mtDNA in the sample over time indicates that the treatment is effective; and iii) modifying the treatment administered to the subject based on the effectiveness of previous treatment.

7. A method of determining if a subject being treated for intestinal inflammation is in histological remission, comprising: i) obtaining a stool sample from the subject; and ii) quantitating the amount of mtDNA in the sample; wherein the presence of an amount of mtDNA in the sample that is equal to or lower than the amount in a control population indicates that the subject is in histological remission.

8. The method of any one of claims 1-7, wherein the subject is a human.

9. The method of any one of claims 1-8, wherein the subject is a pediatric subject.

10. The method of any one of claims 1-9, wherein the subject has mild, moderate, or severe intestinal inflammation.

11. The method of any one of claims 1-10, wherein the intestinal inflammation is due to inflammatory bowel disease (IBD).

12. The method of claim 11, wherein the IBD is ulcerative colitis.

13. The method of claim 11, wherein the IBD is Crohn’s disease.

14. The method of any one of claims 1-10, wherein the intestinal inflammation is due to necrotizing enterocolitis (NEC).

15. The method of claim 14, wherein the subject is a premature infant.

16. The method of any one of claims 1-10, wherein the intestinal inflammation is due to environmental enteropathic dysfunction (EED).

17. The method of any one of claims 4-16, wherein the therapy is anti-inflammatory drugs, immunosuppressant drugs, biologies, antibiotics, dietary changes, and / or surgery.

18. The method of any one of claims 1-17, wherein the mtDNA is quantitated by extraction from the sample and DNA amplification.

19. The method of claim 18, wherein the mtDNA is quantitated by polymerase chain reaction.

20. The method of claim 18 or 19, wherein a conserved region of mtDNA is detected.

21. The method of claim 20, wherein the conserved region is a human-specific sequence.

22. The method of claim 21, wherein the conserved region is the cytochrome b gene.

23. A kit for assessing intestinal inflammation, comprising reagents for detecting mtDNA in a stool sample.

24. The kit of claim 23, comparing one or more primers and / or probes for amplifying mtDNA.

Images