Modified cells and uses thereof

Abstract

The disclosure provides methods of activating a Kv7 voltage-gated potassium channel in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein. The disclosure also provides a cell that has been genetically modified to express an exogenous variant Kv7 voltage-gated potassium channel. The disclosure also provides methods comprising the contacting a cell with a vector comprising a nucleic acid encoding a carbonic anhydrase protein, and measuring a change in Kv7 voltage-gated potassium channel activation in the cell.

Description

MODIFIED CELLS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims the benefit of priority to U.S. Provisional Application No. 63 / 639,001, filed April 26, 2024.GRANT FUNDING DISCLOSURE

[0002] This invention was made with government support under NS123964 awarded by the National Institutes of Health. The government has certain rights in the invention.INCORPORATION BY REFERENCE OF MATERIALS SUBMITTED ELECTRONICALLY

[0003] This application contains, as a separate part of the disclosure, a Sequence Listing in computer readable form (Filename: 70351 _Seqlisting.xml; Size: 464,437 bytes; Created: April 28, 2025), which is incorporated by reference in its entirety.BACKGROUND

[0004] Voltage-gated K+ channels of the KV7 (KCNQ) family have been identified in the last 10-15 years by discovering the causative genes for three autosomal dominant diseases: cardiac arrhythmia (long QT syndrome) with or without congenital deafness (KCNQ1), neonatal and drug-resistant epilepsy (KCNQ2 and KCNQ3), heritable and adult-onset progressive deafness (KCNQ4). A fifth member of this gene family (KCNQ5) is associated with chronic pain and epilepsy. Kv7 voltage-gated potassium channels are also associated with neurodegenerative diseases (chronic pain, peripheral nerve hyperexcitability (PNH), age-related Alzheimer's, Huntington's, and amyotrophic lateral sclerosis), thus far. Four genes (KCNQ2-5) are expressed in the nervous system. Thus, neuronal KV7 channelopathies are associated with common life-changing neurological disorders with few effective treatment options.

[0005] With regard to the underlying molecular pathophysiology, it has been shown that mutations with very subtle changes restricted to subthreshold voltages can cause neurological disorders, thereby providing ‘human disease models' illustrating the relevant voltage range for these channels to modulate neuronal firing underlying the excitatory disorders associated with the aforementioned neurological disorders.

[0006] Consequently, Kv7 voltage-gated potassium channels represent important targets for new therapeutic approaches to diseases caused by neuronal hyperexcitability and excitatory toxicity.BRIEF DESCRIPTION OF THE FIGURES

[0007] Figure 1 . Electrophysiologic Recordings and Measurements from Small Diameter DRG Neuronal Somata. A. Small diameter DRG neuronal somata were selected for patch clamping by size < 30 pm in bright field microscopy, and by active fluorescent status (F) under green fluorescence microscopy (p: recording micropipette; NF: non-fluorescent cell). B. Schematic representation of measurements of relevantelectrophysiological parameters of recorded AP and of AHP. Measurements were obtained using Clampfit software.

[0008] Figures 2A-2D. Molecular Effects of vHCA8* on Neuronal Excitability. vHCA8WT prolongs the AHP in vHCA8WT infected DRG neuronal somata. Figure 2A: Representative AP traces recorded from vHCA8WT (top) and from vHCA8MT (bottome) infected neuronal somata are shown. AP firing was elicited by brief depolarizing current command steps of 2.5 nA amplitude (shown as black bar under the action potentials). The apparent differences in the peak AHP amplitude and in the duration of the AHP are shown. Figure 2B: Impact of vHCA8WT infection on AHP dimensions. DRG neuronal somata after infection with vHCA8WT versus controls (including vHCA8MT and uninfected cells) show a more negative peak AHP amplitude. Similarly, DRG neuronal somata after infection with vHCA8WT versus controls (including vHCA8MT and non-infected cells) show prolonged AHP duration at baseline level - corresponding to the resting membrane potential level (Figure 2C) and at the level of the 50% of peak AHP amplitude (Figure 2D). Means ± SEM are shown. Horizontal bars above groups indicate statistically significant differences between groups.

[0009] Figures 3A-3E. Evidence the Molecular Effects of vHCA8* are Caused by Activation (Opening) of Kv7 Voltage-Gated Potassium Channels. Kv7 selective inhibitor XE-991 reverses the vHCA8WT prolonged AHP. Figure 3A: Representative AP traces recorded from vHCA8WT infected DRG neuronal somata before (red trace) and after XE-991 (10 piM) administration by perfusion in external bath solution (pink traces). Figure 3B: XE-9991 resulted in a decrease of the peak amplitude of the AHP compared to baseline (P=0.03). Similarly, XE-991 administration (Figure 3C) shortened the duration of AHP at the level corresponding to the resting membrane potential (P=0.006); XE-991 also shortened the duration of AHP at the level corresponding to 50% peak AHP amplitude height (Figure 3D) (P=0.03). Means ± SEM are shown in upper graph series. Horizontal bars above groups indicate statistically significant differences between groups. Decreases of the AHP parameters in individual somata after XE-991 perfusion are shown by arrows in lower graph series (Figure 3E).

[0010] Figures 4A and 4B. Evidence vHCA8* Selectively Activate Kv7 Voltage-Gated Potassium Channels to Produce M-Currents. Differences in Kv7 currents between vHCA8WT (Figure 4A) DRG neuronal somata versus Controls (Figure 4B). Current responses from -20 mV holding potentials to -50 mV hyperpolarizing voltage command steps of 1 s duration were recorded before and after administration of 10 piM XE-991, in vHCA8WT- infected and control neurons. The selective Kv7 inhibitor XE-991 had an inhibitory effect only in vHCA8WT infected cells, indicating the presence of significant Kv7 currents only in vHCA8WT infected cells.

[0011] Figures 5A-5I. Example of vHCA8* Targeting of Neuronal Populations Via Different Routes of Administration: Neuronal DRG were targeted with vHCA8 via injection in skin, peripheral nerve or joints. IHC was performed with NeuN neuronal antigen expression; and V5 antibody to identify exogenous CA8* peptide expression on D14 after vHCA8* I A KJ injections (Figures 5A, 5B, 5C); using three different routes of administration including injection into the knee joint (KJ)(A, D); rear foot pad (RFP) (Figures 5B, 5E); and sciatic nerve (SN)(Figures 5C, 5F). About 35-50% of ipsilateral lumber 4-5 DRG neurons were V5-positive after vHCA8*WT treatment. The percentage of SN V5-positive neurons was higher than that in the KJ and RFPgroups. Only about 5% of DRG neurons were V5-positive after vHCA8*MT treatment (Figure 5G). There was no V5-positive signal from contralateral DRG (Figure 5H). Groups were compared using IBM SPSS Statistics version 28 to do Student's t-test, or ANOVA, followed by Fisher's protected least significant difference (LSD) test, and these data are presented as mean ± SEM. Statistical significance was P < 0.05. Data analyzed with Imaged software. N=4-to-5 animals. Scale = 100 mm

[0012] Figures 6A-6L. Infection After Sciatic Nerve or I ntra-Articular Injection of vHCA8*WT Shows Selective CA8*WT Expression in Small Sensory DRG Neurons. KJ were injected with vHCA8*WT on DO. D14 after KJ or SN administration of vHCA8*WT high-dose (1 E6 PFU), L4-5 DRG were harvested. DRG shown were double immunofluorescence stained with V5 and advillin or TrkA. The percentage of V5-positive cells colocalized with advillin-positive neurons (neuronal marker) is 94% and 92.6% in the KJ group (Figures 6A-6C) and the SN group (Figures 6D-6F), respectively. The percentage of V5-positive colocalized with TrkA-positive neurons is 52.9% and 57.7% in the KJ (Figures 6G-6I) and SN groups (Figures 6J-6L), respectively. Data were analyzed with Imaged software. N=4 animals. Scale = 100 m.

[0013] Figure 7. Model of Peripheral Nerve Hyperexcitability After Knee Joint Administration of MIA. vHCA8*WT Reverses MIA-OA-lnduced Decreases in Weight-Bearing. Male C57BL / 6 mice underwent IA KJ injection with 1 mg of monosodium iodoacetate (MIA) on D1 (after Baseline was established) producing hyperalgesia in all mice. Weight bearing was assessed at about the same time each day as weight (grams) of ipsilateral (treated) limb I weight of ipsilateral limb + weight of contralateral limb (untreated control). On D3 mice were treated with IA KJ injections of either vHCA8*WT at the High-Dose (HD)(1 E6 PFU), Mid-Dose (MD)(1 E5 PFU) or vHCA8*MT High-Dose (HD)(1 E6 PFU)(virus arrow) after weight-bearing assessment. Weight-bearing as measured (grams) dropped starting on D1 after MIA injection in all mice. Weight-bearing increased significantly in mice treated with vHCA8*WT-HD and vHCA8*WT-MD on D27 and D34, respectively, as compared to mice treated with vHCA8*MT-HD (N = 10). Data were analyzed for statistical significance between different time points for each group, as compared to Baseline, by one-way analysis of variance (ANOVA) followed by Fisher's LSD post-hoc test. Repeated measure two-way ANOVA analyses found significant differences in weight distribution between left (OA) and right (contralateral control) hind limbs across all time points [F(14, 196)=9.637, P=3.898E- 16], But there were no significant differences between groups [F(1, 14)=139.24, P=0.745], There were also no significant interactions between time points and groups [F(14, 196)=0.803, P=0.666],

[0014] Figure 8. vHCA8*WT Produces Analgesia and Inhibits MIA-lnduced Peripheral Nerve Hyper-excitability. OA-induced Mechanical Hyperalgesia is inhibited by vHCA8*. Male C57BL / 6 mice were injected with vHCA8*WT at the High-Dose (HD)(1 E6 PFU), Mid-Dose (MD)(1 E5 PFU) and compared with vHCA8*MT High-Dose (HD)(1 E6 PFU) using the KJ route of administration (IA KJ). IA KJ injection of monosodium iodoacetate (MIA) on D1 after Baseline (arrow) produced hyperalgesia in all mice. KJ injections were performed with vHCA8*WT or MT virus after testing mechanical withdrawal responses on D3 after MIA (arrow). Mechanical thresholds in vHCA8*WT dose groups differed from the vHCA8*MT negative controls as shown through D65 after MIA. vHCA8*MT negative control failed to return to Baseline through D65. vHCA8*WT-HD and vHCA8*WT-MDdemonstrated anti-hyperalgesia starting on D 10. vHCA8*WT-HD exceeded Baseline starting on D23 (analgesia) and vHCA8*WT-MD exceeded Baseline starting on D58. (N=10)(One-way ANOVA.) * P<0.05 ** P<0.01 , and *** P<0.001 for vHCA8*WT-HD vs. vHCA8*MT-HD, # P<0.05, ## P<0.01, and ### P<0.001 for vHCA8*WT-MD vs. vHCA8*MT-HD. Repeated measures two-way ANOVA: Significant differences in mechanical threshold were found between groups [F(2,27)=146.5, P=3.19E-15] and across all time points [F(18,486)=10.94, P=2.25E-26], There were also significant differences in interactions between time points and groups [F(36,486)=3.16, P=8.61E-09],

[0015] Figure 9. Kv7 Specific Antagonist Reverses CA8*WT Analgesia in Response to MIA-lnduced Peripheral Nerve Hyperexcitability Associated with Chronic OA. Kv7 specific antagonist XE-991 induced mechanical hyperalgesia at Baseline in a dose-dependent and time-dependent manner (no MIA). XE-991 (2 mg / kg and 5 mg / kg produced hyperalgesia lasting up to 2 hours. vHCA8*WT administration (SN injection) induced analgesia at D16 and XE-991 (5 mg / kg i.p.) reversed the analgesic effects of vHCA8*WT acutely to Baseline (N = 8). * P<0.05; ** P<0.01; *** P< 0.001; one-way ANOVA.)

[0016] Figures 10A-10C. Immunohistochemistry Shows Cellular Effects of KJ vHCA8* Injections on Kv7.2-7.5 Activation Assessed in DRG Using I HO. The left KJ of naive mice was injected with vHCA8*MT or vHCA8*WT. (Figure 10A) Low levels of V5-staining (5.7%) are seen after KJ IA injection of vHCA8*MT-HD (10E6 PFU). (Figures 10B-10D, and 10C) There is no effect on DRG pKv7.2-7.5 / NeuN, pKv7.2-7.5 / Kv7.2 expression ratios in vHCA8*MT-HD (1 E6 PFU) treated animals; (E) vHCA8*WT-HD (1 E6 PFU) treated animals show higher levels of V5-staining (36.0%). (Figures 10F-10H, and 10C) vHCA8*WT-HD treated mice show reduced pKv7.2-7.5 / NeuN, pKv7.2-7.5 / Kv7.2 expression ratios compared to vHCA8*MT-HD treated animals. The ratio of Kv7.2 to NeuN was unchanged by vHCA8*WT or vHCA8*MT KJ injections compared to naive mice. Results from naive mice (Figures 101-1 ON, and 10C) are shown after staining for (I) NeuN, (J) pK7.2-7.5, (K) Kv7.2, (L) pKv7.2-7.5 / Kv7.2, (M) pKv7.2-7.5 / NeuN, (N) Kv7.2 / NeuN. N=4 mice, Scale = 100 m, *** P< 0.001; one-way ANOVA.

[0017] Figures 11A-110. Immunohistochemistry Shows Cellular Effects of KJ vHCA8* Injections on Kv7.3 Activation Assessed in DRG Using I HO. The left KJ of naive mice was injected with vHCA8*MT or vHCA8*WT.(A) V5-staining was lower after KJ injection of vHCA8*MT-HD (1 E6 PFU)(6.8%) as compared to (E) vHCA8*WT- HD (1 E6 PFU)(35.9%). (Figures 11 B-11D, and Figure 110) There is no effect on DRG pKv7.3 / NeuN, pKv7.3 / Kv7.3 expression ratios in vHCA8*MT-HD (1 E6 PFU) treated animals; (Figures 11 F-11 H, and Figure 110) KJ injection with vHCA8*WT-HD reduced pKv7.3 / NeuN, pKv7.3 / Kv7.3 expression ratios compared to vHCA8*MT-HD treated animals. The ratio of Kv7.3 to NeuN was unchanged by vHCA8*WT-HD or vHCA8*MT- HD KJ injections compared to naive mice. Results from naive mice (Figures 111-11 N, and Figure 110) are shown after staining for (I) NeuN, (J) pK7.3, (K) Kv7.3, (L) pKv7.3 / Kv7.3, (M) pKv7.3 / NeuN, and (N) Kv7.3 / NeuN. N=4 mice, Scale = 100 pm, *** P< 0.001; one-way ANOVA.

[0018] Figures 12A and 12B. Molecular Effects of vHCA8*WT. vHCA8* reverses XE-991 -Induced Kv7 Phosphorylation in differentiated SH-SY5Y Cells. SH-SY5Y cells were differentiated using 10 pM retinoic acid (RA). On RA D6, cells were infected by vHCA8* with a MOI 3. At RA D9, cell cultures were treated with XE-991or vehicle control for 20 minutes were collected and protein extracted for western blotting. Figure 12A shows pKv7.2-7.3 phosphorylation is XE-991 dose-dependent. vHCA8*WT inhibited XE-991 -induced phosphorylation at 10 mM, but vHCA8*MT did not. Figure 12B shows 10 mM XE-991 -induced Kv7.3 phosphorylation was inhibited by vHCA8*WT but not by vHCA8*MT treatment. N=5 from 3 different cultures. Western data were normalized to b-tubulin loading standard. *** P< 0.001; one-way ANOVA; NS = not significant.

[0019] Figure 13. Schematic of direct vHCA8 ELISA assay. vHCA8* detection in a cell-based assay. Cells (eg, HEK293, ND, NBL, SH-SY5Y, etc.) are infected with a varying MOI. CA8* cellular lysates are bound to the bottom of plasticware well (Ag) or reference standard (CA8* ref. standard at different concentrations are bound to the bottom of plasticware as controls. Anti-CA8* antibodies are used with HRP-labeling as the primary antibody. TMB substrate is added to produce color development. Colored product is read in a suitable plate reader.

[0020] Figure 14. Schematic of direct vHCA8 (v5 exogenous CA8 only) ELISA assay. vHCA8* direct ELISA is shown for the detection of vHCA8* in a cell-based assay. Cells (eg, HEK293, ND, NBL, SH-SY5Y, etc.) are infected with a varying MOI. CA8* cellular lysates are bound to the bottom of plasticware well (Ag) or reference standard (CA8* ref. standard at different concentrations are bound to the bottom of plasticware as controls. Anti- V5 antibodies are used with HRP-labeling as the primary antibody. TMB substrate is added to produce color development. Colored product is read in a suitable plate reader.

[0021] Figure 15. Example of Gene Expression assay.

[0022] Figure 16. Exemplary CA8 Gene Expression assay kit.

[0023] Figure 17. Exemplary CA8 (V5) Gene Expression ELISA kit.

[0024] Figure 18. Exemplary potency / stability assay (pKv7).

[0025] Figure 19. Schematic of JDNI8-CAGp-CA8*-V5-T2A-GFP vector bioengineered to delete ICP0, ICP27, ICP47, ICP4, UL41, joint and incorporating into the ICP4 locus the CA8 cDNA fused to V5 (C-terminal end) and eGFP downstream of the CAG promoter. Expression within primary rat DRGs was examined at 2 days postinfection (MOI=5). Western data shows staining with anti-V5, anti-CA8 and p-Actin loading control.

[0026] Figure 20A, 20B and 20B'. The Relationship Between Kv7.2, Kv7.3 and Kv7.5 Expression and SH- SY5Y Differentiation by Retinoic Acid (RA). (Figure 20A) vHCA8*WT infection (D3 MOI=3) of SH-SY5Y cells shows high levels of V5 expression on western blotting as compared to vHCA8*MT on D9 of RA differentiation. (Figures 20B and 20B'). Kv7.2 expression apparently increased with RA differentiation on D4 and D9, as compared with baseline (DO), Kv7.3 expression was unchanged with RA differentiation, and Kv7.5 expression decreased over time with RA differentiation. Vinculin was used as loading control.

[0027] Figures 21 A and 21 B. Electrophysiologic Recordings and Measurements from Small Diameter DRGNeuronal Somata. Figure 21 A: Small diameter DRG neuronal somata were selected for patch clamping by size < 30 pm in bright field microscopy and by active fluorescent status. (F) under green fluorescence microscopy (p: recording micropipette; NF: non-fluorescent cell). Figure 21 B: Schematic representation of measurements ofrelevant electrophysiological parameters of recorded AP and of AHP. Measurements were obtained using Clampfit software.

[0028] Figure 22. Example of Kv7.3 Gain-of-Function Mutation Causing Channel Activation (Positive Control)(Sequence). Identification of individual P129 in pedigree demonstrating pain resilience that demonstrates the p.D755N variant in Kv7.3 and 2263C>T mutation in KCNQ3 schematic diagram of Kv7.3 showing the location of p.D755N and (D) D755 residue is highly conserved among various species.

[0029] Figure 23. Example of Kv7.2 Gain-of-Function Mutation Producing Causing Channel Activation and Pain Resilience (Positive Control)(Pedigree). Affected subjects P301 (mother) and P300 (son) carry the NaV1.7- S241T mutation causing erythromelalgia (chronic inherited pain due to Nav1.7 gain of function mutation S241T), whereas P303 (unaffected father) carries only wild-type alleles. Mother P301 demonstrates pain resilience due to the Kv7.2 T730A mutation producing reduced iPSC-SN neuron-like cellular excitability with increased IM currents due to this gain-of-function mutation.

[0030] Figure 24. Example of KCNQ2 Gain-of-Function Mutation Causing Kv7.2 Channel Activation (Positive Control)(DNA sequence and Kv7.2 Mutation Location). Location of the T730A mutation in the Kv7.2 channel. Boxes in the C terminus indicate the four alpha-helical regions (A-D) and the ankyrin-G binding domain. Bottom, Kv7.2 is expressed in P300 and P301; agarose gel electrophoresis showing the amplification of the expected product (512 bp) from cDNA samples of iPSC-SNs (M lane shows the 100 bp molecular weight marker); and a chromatogram of the sequence of the obtained products showing only the Kv7.2-WT allele (ACC) in P300, and both Kv7.2-WT and Kv7.2-T730A (GCC) alleles in P301.

[0031] Figure 25. Example of Kv7.2 Channel Loss-of-Function (lnactivating)(Negative Controls) Mutations (G279D) and (N258K). The predicted position of missense inactivating mutations in the S5-H5 linker and pore loop domain (p.(N258K), p.(G279D)).

[0032] Figure 26. Exemplary Current Clamp Recordings of Kv7.2 Channel Loss-of-Function (Inactivating) Mutations (G279D) and (N258K) as Negative Control. Whole-cell patch clamp recordings of K+ currents of hetero-tetrameric Kv7.2 / Kv7.3 channels. K+ currents recorded in non-transfected cells or cells expressing Kv7.2 / 7.3 WT, p.(N258K) or p.(G279D) co-expressed with WT Kv7.3 or WT Kv7.2 / 7.3 (a) Voltage protocol with voltage-clamp steps above (b-e) represent raw current traces for (b) non-transfected cells (n = 22 (c), Kv7.2 / Kv7.3WT (n = 22) (d) Kv7.2 / p.(N258K) / Kv7.3 (e) p.(G279D) / Kv7.3(n = 14). Both G279 and N258 loss-of- function mutations in Kv7.2 produce more excitable cells in EP recordings.

[0033] Figure 27. Exemplary Lentivirus Vector Map, Coding Sequence and Restriction Map of Lentivirus Incorporating KCNQ2 Coding Insert for Creating Modified Product-Specific Cell Lines Using Transient Transfections and Selection of Stable Cell Lines.

[0034] Figure 28. Example of Vector Map, Coding Sequence, and Restriction Map of Lentivirus Incorporating KCNQ2 Coding Sequence Harboring The Activating Mutation (T730A) Useful for Creating Modified Cell Lines For Product-Specific Assays.

[0035] Figure 29. Example of Vector Map, Coding Sequence, and Restriction Map of Lentivirus Incorporating KCNQ2 Coding Sequence Harboring One of More Inactivating Mutation (eg, G279D, N258K, etc.) Useful for Creating Modified Cell Lines For Product-Specific Assays Using Transient Transfection and The Selection of Stable Cell Lines.

[0036] Figure 30. Example of Product-Specific ELISA to Quantify CA8* Inhibition of ITPR1 Activation (pITPRI Formation) in Forskolin-Stimulated Cells.

[0037] Figure 31 Example of Modified Cell Line for Kv7 Activating Therapeutic Candidate Screening, Identity, Manufacturing Process Development, Drug Characterization, Potency, and Stability Testing

[0038] Figure 32. Exemplary Lentivirus Vector Map, Coding Sequence and Restriction Map of Lentivirus Incorporating KCNQ1 Coding Insert for Creating Modified Product-Specific Cell Lines Using Transient Transfections and Selection of Stable Cell Lines.

[0039] Figure 33. Exemplary Lentivirus Vector Map, Coding Sequence and Restriction Map of Lentivirus Incorporating KCNQ4 Coding Insert for Creating Modified Product-Specific Cell Lines Using Transient Transfections and Selection of Stable Cell Lines.

[0040] Figure 34. Exemplary Lentivirus Vector Map, Coding Sequence and Restriction Map of Lentivirus Incorporating KCNQ5 Coding Insert for Creating Modified Product-Specific Cell Lines Using Transient Transfections and Selection of Stable Cell Lines.SUMMARY

[0041] In one aspect, described herein is a method of activating a Kv7 voltage-gated potassium channel in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein.

[0042] In another aspect, described herein is a method of modulating neuronal excitability in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein.

[0043] Also contemplated are methods of treating a condition associated with aberrant Kv7 voltage-gated potassium channel activity in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein to the subject, wherein the condition to be treated is not pain.

[0044] Also contemplated are methods of treating a condition associated with elevated neuronal excitability in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein to the subject, wherein the condition to be treated is not pain.

[0045] In another aspect, described here are methods comprising contacting a cell with a vector comprising a nucleic acid encoding a carbonic anhydrase protein, and measuring a change in Kv7 voltage-gated potassium channel activation in the cell.

[0046] Also contemplated are methods comprising contacting a cell expressing a mutated Kv7 voltage-gated potassium channel with a candidate agent, and measuring a change in Kv7 voltage-gated potassium channel activation in the cell.

[0047] In another aspect, described herein are cells that has been genetically modified to express an exogenous Kv7 voltage-gated potassium channel.DETAILED DESCRIPTION

[0048] The disclosure provides product-specific assay methods, components, kits, and methods of use in the manufacturing process development, characterization, potency, stability and release of therapeutics, including gene therapy technology. In some embodiments, the therapeutic is a gene therapy vector. In some embodiments, the gene therapy vector is described as AAV-CA8*, AAV-CA10, AAV-CA11, or rdHSV(JDNI8)- pCAG-V5-CA8 vector (referred to as vHCA8*vec, or vHCA8*)) representing a replication-defective herpes simplex virus type 1 (HSV-l)-derived vector with targeted delivery of a variant of the transgene coding for the human carbonic anhydrase 8 (CA8-201) analgesic peptide (CA8*), CA10 or CA11 to neuronal tissues.

[0049] As described herein, by deleting the intrahepatic cholestasis of pregnancy (ICP)-4, ICP-27, and ICP-0 immediate early regulatory genes from this HSV vector, it loses the ability to replicate in human tissues. Because CA8*vec is completely replication-defective, it is disease-free and has limited biodistribution. After delivery to the knee joint it infects somatosensory neurons within the knee capsule and undergoes retrograde transport carrying the vector to the nucleus where it remains as a stable episome producing the CA8* analgesic peptide from the incorporated transgene.

[0050] Manufacture of this vector is possible using a specially modified production cell line that complements the functionality for the deleted immediate early genes (eg, ICP-4, ICP 27, and ICP-0) required for replication. The CAG-promotor drives CA8* production from HCA8*vec, yielding expression in the targeted knee joint sensory neurons accessible from the joint capsule. Similarly, CA8* production can be driven by numerous other promoters to provide long-lived tissue specific therapeutic transgene expression.

[0051] The present disclosure is also based on the discovery that CA8, CA10, and CA11 activate Kv7 voltagegated potassium channel sin neural cells. As shown in the Examples, Kv7 voltage-gated potassium channelsmechanistically link reduced cytosolic free calcium, conferred by vHCA8*WT, and the reduction of peripheral nerve hyper-excitability resulting in reduced neuronal excitability as assessed as analgesia observed (Fig. 2). (Zhuang et al., Gene Then, 25:297-311, 2018; Zhuang et al., PLoS ONE 10:e0118273, 2015; Levitt et al., Mamm Genom., 28:407-415, 2017). KCNQ genes (KCNQ-2, -3 and-5) encode transmembrane channel proteins (Kv7.2, Kv7.3, and Kv7.5) that are known to be widely expressed as tissue-specific heterotetramers in nociceptive DRG neurons and are implicated in pain regulation (Yu et al., Mol. Pain, 17:1744806918793229, 2018). Explicit evidence shows MIA-induced peripheral nerve hyperexcitability associated with chronic OA is maintained by primary afferents in rodent models, strongly supporting our targeting primary afferent pain fiberswith localized vHCA8*WT (or CA10, or CA11) treatment, which acts as a Kv7 activator? and suppressor of neuronal excitability.

[0052] In one aspect, described herein are methods of activating a Kv7 potassium channel in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein. Exemplary Kv7 potassium channels include, but are not limited to, Kv7.1 voltage-gated potassium channel, KV7.2 voltage-gated potassium channel, Kv7.3 voltage-gated potassium channel, Kv7.4 voltage-gated potassium channel, or Kv7.5 voltage-gated potassium channel. In some embodiments, the cell comprises two or more Kv7 voltage-gated potassium channels selected from the group consisting of Kv7.1 , Kv7.2, Kv7.3, Kv7.5 and Kv7.5.

[0053] It is likely that all biological cells have K channels; which are crucial for all transmembrane transport mechanisms. In addition, since the evolutionary appearance of voltage-gated sodium (Nav) and calcium (Cav) channels, K channels are further diversified in relation to their newer function, namely, keeping neuronal excitation within limits (Anderson et al., Comp. Biochem. Physiol. Biochem. Mol. Biol., 129(1): 17-28, 2001). The K-channel family is by far the largest: with at least 70 human genes encoding for different subunits have been discovered since the beginning of K-channel cloning (Coetzee et al. Ann N Y Acad Sci. 1999 Apr 30;868:233-85). With the formation of heteromers, modulating beta subunits, and differential expression, thousands of different K channels are possible. Four alpha subunits are necessary to build a functional K channel.

[0054] Potassium (K) channels are critical to cellular function on many different levels, ranging from direct control of neuronal excitability and homeostasis of ion milieu to indirect effects via metabolism. The largest ion channel group is the Kv channel family, which consists of 12 subfamilies (Kv1-Kv12).

[0055] Kv7 voltage-gated potassium channels are also heteromeric channels and give rise to outward K+ current that is suppressed by muscarinic signaling and is known as the “M” current (Wang et al., Science. 1998; 282(5395): 1890-3; Jentsch, Nature Reviews Neuroscience. 2000; 1 (1):21— 30. M currents are critical in controlling excitability in central nervous system neurons. Low-voltage-activated channels such as Kv1, Kv4, and Kv7 regulate the threshold potential for firing, and limit the number of action potentials generated in response to depolarization (Brown et al., British journal of pharmacology. 2009; 156(8): 1185-95; Brew HM, et al., The Journal of physiology. 2003; 548(1 ): 1—20. Kv channels also critically contribute to cell death and cell survival signaling pathways. These channels critically contribute to the after-hyperpolarizing potential, aid in maintaining resting membrane potential, firing thresholds, and importantly, reduce intrinsic burst firing and repetitive action potential firing in response to excitatory stimuli [Brown, 2009, supra; Jentsch, 2000, supra; Wang et al., 1998;282(5395): 1890-3). Increasing Kv7 channel function decreases neuronal excitability, while suppressing Kv7 channel K+ currents enhances excitability in hippocampal pyramidal, and superior cervical and dorsal root ganglionic neurons, and promotes epileptiform activity in hippocampal neurons [Peters, Nature neuroscience. 2004; 8(1):51— 60).

[0056] Molecular methods of determining activation of a Kv7 potassium channel are known in the art, and include, but are not limited to, patch-clamp, whole-cell voltage-clamp, FluxOR assay, assays utilizing calcium-sensitive dyes, assays using DNA-based sensors, rubidium flux assays, thallium flux assays, Kv7 potassium channel specific ligand assays.

[0057] The Patch-clamp technique allows for recording the electrical activity of individual ion channels, including potassium channels, in a controlled environment. It's a classic method for studying channel properties like conductance and gating. The whole-cell voltage-clamp technique measures the total current flowing across a cell membrane, including the current passing through potassium channels. The FluxOR assay uses a fluorogenic dye that changes fluorescence when thallium ions flow through potassium channels, allowing for the measurement of channel activity. Assays using calcium-sensitive dyes, such as Fura-2 or Fura-3, monitor changes in intracellular calcium concentration, which can be correlated with the activity of some types of potassium channels. DNA-based sensors (DNA nanodevices such as pHlicKer) can be used to detect both pH and K+ levels, allowing for the mapping of channel activity in specific organelles. High-throughput screening assays, such as rubidium flux assays or thallium flux assays, measure the efflux of rubidium or thallium from cells which is an indicator of potassium channel activity. Ligand binding assays measure the binding of ligands to specific potassium channels, which can indicate channel activity.

[0058] In another aspect, the disclosure provides methods of modulating neuronal excitability in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein. In some embodiments, the method decreases neuronal excitability in the cell. Method of measuring neuronal excitability in a cell can be performed using methods known in the art, including the methods described in Example 1 (e.g., whole-cell current clamp recordings).

[0059] In some embodiments, the cell for use in the above-described methods can be any neural cell. Exemplary neural cells include, but are not limited to, a somatosensory neuron, a neural stem cell; a neuroepithelial cell; a Schwann cell; a radial glial cell; an oligodendrocyte; an astrocyte; an immature neuron; mature neurons that are glutamatergic, GABAergic, dopaminergic, serotonergic, or cholinergic; an interneuron or a motor neuron.Carbonic anhydrases

[0060] In some embodiments, the disclosure provides methods of using a nucleic acid sequence encoding a carbonic anhydrase (CA) protein. Exemplary carbonic anhydrase proteins include CA8, CA10 and CA11. In some embodiments, the nucleic acid sequence encodes a human CA protein. In some embodiments, the nucleic acid sequence encodes a rat, canine, cat, or equine CA protein. In some embodiments, the nucleic acid sequence encodes a CA protein fragment, or variant, that retains activity.

[0061] In various aspects, the nucleic acid sequence encodes a carbonic anhydrase 8 (CA8) or a CA8 fragment. The nucleic acid sequence comprises (or consists of) the first three exons of the CA8 (or Car8) coding sequence. In some embodiments, the CA8 fragment is CA8-204C, the nucleic acid sequence of which is set forth in SEQ ID NO: 32 (the amino acid sequence is set forth in SEQ ID NO: 30). In some embodiments, the CA -fragment is CA8-204G, the nucleic acid sequence of which is set forth in SEQ ID NO: 33 (the amino acidsequence is set forth in SEQ ID NO: 31). In some embodiments, the CA-8 fragment is CA8-202 (SEQ ID NO: 34) or CA-203 (SEQ ID NO: 35). In various aspects, the expression vector comprises a nucleic acid sequence having at least 90% identity (e.g., at least 95% or 100% identity) to a CA8-204 nucleic acid sequence described herein. As used herein, "at least 90% identity” and similar terms encompass any integer from, e.g., 90% to 100%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% and the like. The nucleic acid sequence of a CA8 fragment comprising exons 1-3 is provided as SEQ ID NO: 1. The nucleic acid sequence of a CA8 fragment comprising exons 1-5 is provided as SEQ ID NO: 35. The nucleic acid sequence of a CA8 fragment comprising exons 1-8 is provided as SEQ ID NO: 34. The nucleotide and amino acid sequences of CA11 are provided as SEQ ID NOs: 10 and 11. The expression product of any of the sequences described herein exhibits at least one carbonic anhydrase activity, such as analgesia or antagonist of ITPR1 -activation (decreased pITPRI), ITPR1 -mediated intracellular calcium release, lowered cytoplasmic free calcium, Kv7 channel activation (decrease pKv7), prolongation of the afterhyperpolarization (AHP), increased M-current, and increased potassium conductance.

[0062] Carbonic anhydrase 10 (CA10) is a member of the carbonic anhydrase (CA) super gene family and one of three catalytically inactive CA isoforms. While CA10 retains a central carbonic anhydrase motif, it lacks the catalytic zinc coordinating residues critical for enzymatic activity. The functions of CA10 remain were previously unknown. Sequence comparison revealed 100% identity between humans (Homo sapiens), rat (Rattus norvegicus), and mouse (Mus musculus) CA10 proteins, and 90% identity at the amino acid level with zebra fish (Danio rerio). There are nine transcripts encoding human CA10, resulting in seven functional isoforms. Nucleic acid and amino acid sequences of human CA10 are set forth in Genbank Accession Nos. NM_020178 (SEQ ID NO: 3); NP_064563 (SEQ ID NO: 4); NM_001082534 (SEQ ID NO: 5); NP_001076003 (SEQ ID NO: 6); NM_001082533 (SEQ ID NO: 7) and NP_001076002 (SEQ ID NO: 8); the amino acid sequence of human CA10 is also provided in UniProtKB Q9NS85 (SEQ ID NO: 9).

[0063] In various aspects, the nucleic acid sequence encodes a peptide comprising at least 90% identity (e.g., at least 95% identity or 100% identity) to SEQ ID NO: 2. In various aspects, the expression vector comprises a nucleic acid sequence having at least 90% identity (e.g., at least 95% or 100% identity) to SEQ ID NO: 1. As used herein, "at least 90% identity” and similar terms encompass any integer from, e.g., 90% to 100%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% and the like. Also, the term "at least [percentage] identity” encompasses any percentage that is greater than or equal to the number of identical nucleotides or amino acids divided by the total number of nucleotides or amino acids ([at least percentage identity] > [number of identical nucleotides or amino acids] I [total number of nucleotides or amino acids]). The calculation of percent identity of aligned amino acids (or nucleotides) of two or more sequences is well understood in the art and is determined conventionally using known computer programs. For example, alignment of two or more sequences to determine percent sequence identity is optionally performed using the algorithm described by Altschul et al. (Nucleic Acids Res., 25:3389-402 (1997)) as incorporated into BLAST (basic local alignment search tool) programs, available on the National Center for Biotechnology Information website.

[0064] Descriptions of materials and methods concerning CA8, CA10, and CA11 also apply to the mouse, rat, cat, dog and horse (version of the proteins, Car8, Carl 0, and Carl 1), which are contemplated for use in various aspects of the disclosure.

[0065] Vector

[0066] In some embodiments, the nucleic acid encoding a carbonic anhydrase protein described herein (or Kv7 voltage-gated potassium channel or variant thereof) is provided in a vector. A "vector” or "expression vector” is any type of genetic construct comprising a nucleic acid (DNA or RNA) for introduction into a host cell. In various embodiments, the expression vector is a viral vector, i.e. , a virus particle comprising all or part of the viral genome, which can function as a nucleic acid delivery vehicle. Viral vectors comprising exogenous nucleic acid(s) encoding a gene product of interest also are referred to as recombinant viral vectors. As would be understood in the art, in some contexts, the term "viral vector” (and similar terms) may be used to refer to the vector genome in the absence of the viral capsid.

[0067] Viral vectors for use in the context of the disclosure include, for example, a retroviral vectors, a lentiviral vector, a herpes simplex virus (HSV)-based vector, a parvovirus-based vector, an adeno-associated virus (AAV)- based vector, an AAV-adenoviral chimeric vector, and an adenovirus-based vector. In some embodiments, the vector is an AAV vector. In some embodiments, the vector is a HSV vector. In some embodiments, the vector in an adenoviral vector. In some embodiments, the vector is a replication defective viral vector.

[0068] Any of these viral vectors can be prepared using standard recombinant DNA techniques described in, Sambrook et al., Molecular Cloning, a Laboratory Manual, 2d edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and John Wiley & Sons, New York, N.Y. (1994); Coen D. M, Molecular Genetics of Animal Viruses in Virology, 2ndEdition, B. N. Fields (editor), Raven Press, N.Y. (1990) and the references cited therein. Additionally, viral vectors can be prepared with a large genomic coding sequence from humans and other host species, including an entire gene including 5' and 3' regulatory sequences with the application of homologous recombination- mediated cloning and manipulation of target genomic regions using Gateway cloning (Hartley et al., Genome Res 2000, 10:1788-1795) and / or "recombineering” systems (Copeland et al., Nat Rev Genet 2001, 2:769-779).

[0069] In various embodiments, a random or semirandom library is developed in which DNAs encoding precursors of carbonic anhydrase peptides that differ are provided. Such a library may contain hundreds or more different sequences. In various aspects, thousands or more (at least 1000 or at least 10,000) different expression cassettes differing in the sequence of DNAs encoding the precursors of carbonic anhydrase peptides constitute the library. Such a library can be constructed by first generating a population of random or semirandom oligonucleotides encoding precursors of peptides having one or more desired characteristics (e.g., precursors of carbonic anhydrase peptides resembling CA8, CA10 or CA11). This population of oligonucleotides then can be cloned into the cassette backbone (i.e., in frame with the preproprotein signal sequence and optional biomarker).

[0070] An example of a method for constructing random or semi-random libraries employs the GATEWAY™ system (Invitrogen, Carlsbad, Calif.). In the GATEWAY™ system, ccdB is used as a negative selectable marker that, if present, kills the bacteria cell. ccdB is replaced by a random or semi-random sequence through site specific recombination carried out by a modified lambda integrase. Two bacterial strains are used in GATEWAY™ technology, ccdB sensitive and ccdB resistant. The ccdB containing plasmid is propagated in ccdB resistant bacteria and purified. This plasmid is then used for in vitro recombination. The recombination product is transformed into a ccdB sensitive bacteria selecting for plasmids that have had the ccdB gene replaced by the gene-of-interest during the in vitro recombination. By replacing ccdB, the background in cloning and library construction is dramatically reduced or eliminated allowing the shuttling of genes into and out or a variety of plasmids at will. As a starting point the base plasmids are grown in bacteria that are resistant to the toxic effects of ccdB of which there are a very limited number of genotypes available. To employ the GATEWAY™ technology in the context of this disclosure, using a large viral vector system, a bacterial strain amenable to transformation to large DNAs (such as BACs) desirably is modified to express a gene that confers insensitivity to ccdB. A preferred strain is derived from the DH10B bacterial strain used in BAG propagation and manipulation, which also has a mutation (fhuA:IS2) that increases their proclivity to transformation by very large DNAs.

[0071] In some embodiments, the viral vector is an HSV-based vector. HSV is an enveloped, icosahedral, double-stranded DNA virus that infects mammals, including humans. Wild-type HSV infects and replicates in both terminally differentiated non-dividing cells and dividing cells. An advantage of HSV vectors is the virus's ability to enter a latent stage resulting in long-term DNA expression. Additionally, HSV preferentially infects sensory nerves, often escapes immune surveillance, doesn't spread in the CNS / PNS, and exhibits superior retrograde transport (e.g., intradermal, intra-articular or peripheral nerve). Additionally, HSV allows for large genomic inserts using Gateway and / or recombineering techniques. The sequence of HSV is available at ncbi.nlm.nih.gov:80 / entrez / query.fcgi?cmd=Retrieve&db=nucleotide&list_uid- s=9629378&dopt=GenBank&term=hsv-1 &qty =1.

[0072] Optionally, the HSV vector is replication-deficient, i.e.,, at least one HSV gene essential for replication or packaging is rendered non-functional (mutated or deleted). For instance, a replication-deficient HSV vector may lack one or more gene functions of the early regions, the immediate-early regions, or the late regions of the HSV genome. In various aspects, the HSV vector is “multiply-deficient,” meaning that more than one gene function essential for viral replication has been disrupted. For example, multiply-deficient vectors may lack gene functions from two or more of the early, immediate-early, and late regions of the HSV genome. The HSV vector optionally lacks a functional immediate early gene selected from the group consisting of ICP0, ICP4, ICP22, ICP27, ICP47, and any combination thereof, for example, lacks functional ICP0, ICP4, ICP22, ICP27, and ICP47 genes (optionally rendered non-functional by deletion). Non-essential genes also may be removed from a viral vector, such as an HSV vector, to accommodate large pieces of exogenous DNA. For example, an HSV vector can essentially lack the entire HSV genome. In this respect, the vector preferably comprises the viral invertedterminal repeats (ITRs) and / or the packaging signal, although these components are not required in all aspects of the disclosure. Optionally, one or more promoters or the viral ITRs and a packaging signal are left intact (i.e., an HSV amplicon).

[0073] The nucleotide encoding CA8 (or Car8) or CA8 fragment (or Car8 fragment), or a variant containing one or more sequence substitutions or additional sequence, optionally replaces native virus genetic sequences that have been removed (e.g., to render the vector replication-deficient). The nucleotide encoding CA10 (or Car10) or CA11 (or Carl 1), or a variant containing one or more sequence substitutions or additional sequence, optionally replaces native virus genetic sequences that have been removed (optionally to render the vector replication-deficient).

[0074] The HSV vector, when made replication deficient by the deletion of multiple genomic segments, optionally includes a spacer element to provide viral growth in a complementing cell line similar to that achieved by singly replication deficient HSV vectors. The spacer element can contain any nucleic acid sequence or sequences that are of the desired length and encode the desired Kv7 voltage-gated potassium channel activating carbonic anhydrase molecule. The spacer element sequence can be coding or non-coding and native or nonnative with respect to the HSV genome, but does not restore the replication essential function(s) to the deficient region. In addition, the inclusion of a spacer element in any or all of the deficient HSV regions will decrease the capacity of the HSV vector for large inserts.

[0075] In various embodiments, the HSV vectors are replication-defective HSV (rdHSV) vectors that are functionally deleted for all IE genes. An advantage to removing additional IE genes includes, but is not limited to, reducing toxicity in neurons and other cell types. The structure of a representative vector backbone comprises transgene cassettes inserted at, for example, two selected sites in the latency (LAT) locus that are protected against epigenetic silencing by resident insulator / chromatin boundary elements (CTRLs or CTCFs). These elements, along with the HSV LAP2 promoter, provide for long-term expression. The placement of an ectopic insulator adjacent to a transgene cassette inserted into the viral UL50-UL51 intergenic region also enhances prolonged transgene expression from this locus in primary human cells. As merely an example of a suitable vector system, HSV vector propagation reaching high titers has been demonstrated using a ICP4 / ICP27 / Cre- expressing U2OS cell line that eliminates the inhibitory BAG sequences present in vector constructs by Cre recombination.

[0076] It should be appreciated that the deletion of different regions of the HSV vector can alter the immune response of a host. In particular, the deletion of different regions can reduce the inflammatory response generated by the HSV vector. Furthermore, the HSV vector's protein coat can be modified so as to decrease the HSV vector's ability or inability to be recognized by a neutralizing antibody directed against the wild-type protein coat.

[0077] Base rdHSV vectors, complementing cells, and engineering technology can generate safe vectors for long-term expression of CA10 (or Carl 0), CA11 (or Carl 1), CA8 (or Car8) and / or CA8 fragments (or Car8fragments) for Kv7 voltage-gated potassium channel activation from the following promoters within the Gateway transfer plasmid: sensory neuron specific Nav1.8 (e.g., sodium channel); neuron specific Nav1.7 (e.g., sodium channel); high affinity nerve growth factor receptor (TrkA); somatosensory-specific advillin CA8 driver; the nonspecific constitutive CMV promoter, and the GAG promoter comprising (C cytomegalovirus early enhancer element; A the promoter region, first exon and the first intron of the chicken beta-Actin gene; and G the splice acceptor of the rabbit beta-Globin gene) that is known to be active in a broad array of cell types including neurons (Zhuang et al., 2018).

[0078] Inducible promoter sequences, such as the tetracycline responsive promoter, also are appropriate in the context of the disclosure. Advantages of using HSV vectors to deliver human therapeutics include distinct tissue specificity, lack of immune response, and lack of latent reactivation, even in immunocompromised hosts.

[0079] In some embodiments, a nucleic acid encoding a carbonic anhydrase protein described herein is operably linked to a neural cell specific promoter. Exemplary promoters in this regard include, but are not limited to, a promoter associated with a gene selected from the group consisting of TrkB, TrkC, Nav1.9, advillin, betaamyloid, ApoE, presenilin 1 or 2, tau, TREM2, DJ-1, GBA, LRRK2, Parkin, PINK1, alpha-synuclein, UCHL1, VPS35, C9orf72, FUS, SOD1, SQSTM1, TDP43, VGLUT1, VGLUT2, ADORA2A, DARPP-32, GAD1, GAD2 , neuropeptide Y, Penk, ALDH1A1, FoxA2, GIRK2, Lmx1 B, tyrosine hydroxylase, FEV, SERT, TPH2, tryptophan hydroxylase, ChAT, calbindin, calretinin, 5HT3A receptor, parvalbumin, somatostatin, VIP, HB9, Islet-1 , Islet-2, neurogenin-2, and Olig2. In some embodiments, the promoter is a sensory neuron specific promoter (such as the Nav1.8 promoter or Nav1.7), a somatosensory-specific promoter (such as the advillin promoter), the p175 promoter, or the TrkA (nerve growth factor receptor) promoter. In some embodiments, the promoter is but are not limited to, TrkB, TrkC, Nav1.7, Nav1.8, Nav1.9, advillin, CGRP, ASIC3, NPY, NK1, 5HT, GRIN3A, or NF200 promoters. In some embodiments, the promoter is a promoter are provided herein in Figures 21A-30.

[0080] In various aspects, the HSV vector comprises an HSV latency-associated transcript (LAT) insulator.

[0081] HSV-based vectors are further described in, for example, U.S. Patent Nos. 5,837,532; 5,846,782; 5,849,572; and 5,804,413; as well as International Patent Publication Nos. WO 91 / 02788, WO 96 / 04394, WO 98 / 15637, and WO 99 / 06583, which are incorporated herein by reference in their entireties.

[0082] An example of an HSV vector for use in the context of the disclosure contains expanded ICP4, ICP0, or ICP27 deletions, and in some embodiments, each of the ICP4, ICP0 and ICP27 deletions. By "expanded" deletions is meant that the HSV vector contains no homologous sequences at either or both of these loci relative to the complementing cell line used for their production. Desirably, the virus has no remaining ICP4, ICP0, or ICP27 (or both) coding or promoter sequences. Preferably, the deletion in ICP27 extends as well into the UL55 locus, and desirably both genes are deleted. Thus, a virus for use in the context of the disclosure contains extended deletions in ICP4, ICP0, ICP27 and UL 55 such that there is no viral homology to these genes used in a complementing cell line. Desirably, the vector further does not include any homologous DNA sequences to thatemployed in the complementing cell line (e.g., even using different regulatory sequences and polyadenylation sequences).

[0083] It will be understood that vectors other than HSV-based vectors can be used in the context of the disclosure. For example, adenoviral, adeno-associated viral (AAV) and retroviral vectors are suitable for use in the methods and compositions of the disclosure. Construction of such vectors is known to those of ordinary skill in the art (see, e.g., U.S. Patent Nos. 4,797,368, 5,691,176, 5,693,531, 5,880,102, 6,210,393, 6,268,213, 6,303,362, and 7,045,344). Non-viral methods can also be utilized for gene delivery and include, but are not limited to, viral-like particles (VLPs), gene-gun application of plasmids (e.g., non-viral expression vector encoding precursors of one or more carbonic anhydrases described herein). Another non-viral method of gene delivery is electroporation. Alternative, implantable cell lines can be engineered to produce the desired peptide (or library).

[0084] In various aspects, the viral vector is an AAV vector. AAV is a DNA virus not known to cause human disease, making it a desirable gene therapy options. The AAV genome is comprised of two genes, rep and cap, flanked by inverted terminal repeats (ITRs), which contain recognition signals for DNA replication and viral packaging. AAV requires co-infection with a helper virus (i.e., an adenovirus or a herpes virus), or expression of helper genes, for efficient replication. AAV vectors used for administration of a therapeutic nucleic acid typically have a majority of the parental genome deleted, such that only the ITRs remain, although this is not required. Delivering the AAV rep protein enables integration of the AAV vector comprising AAV ITRs into a specific region of genome, if desired. Host cells comprising an integrated AAV genome show no change in cell growth or morphology. As such, prolonged expression of therapeutic factors from AAV vectors can be useful in treating persistent and chronic diseases. The AAV vector is optionally based on AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, or AAV type 11 . The genomic sequences of AAV, as well as the sequences of the ITRs, Rep proteins, and capsid subunits are known in the art. See, e.g., International Patent Publications Nos. WO 00 / 28061, WO 99 / 61601, WO 98 / 11244; as well as U.S. Patent No. 6,156,303, Srivistava et al. (1983) J Virol. 45:555; Chiorini et al (1998) J Virol. 71 :6823; Xiao et al (1999) J Virol. 73:3994; Shade et al (1986) J Virol. 58:921; and Gao et al (2002) Proc. Nat. Acad. Sci. USA 99:11854.

[0085] Expression vectors typically contain a variety of nucleic acid sequences necessary for the transcription and translation of an operably linked coding sequence. For example, expression vector can comprise origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters, enhancers, and the like. The vector of the disclosure preferably comprises a promoter operably linked to the CA10 (or Car10) or CA11 (or Carl 1) coding sequence and carbonic anhydrase variants. In various aspects, the vector of the disclosure preferably comprises a promoter operably linked to the CA8 (or Car8) or CA8 fragment (or Car8 fragment) coding sequence and variants. "Operably linked" means that a control sequence, such as a promoter, is in a correct location and orientation in relation to another nucleic acid sequence to exert its effect (e.g., initiation of transcription) on the nucleic acid sequence. A promoter can be native or non-native to the nucleic acid sequence to which it is operably linked and native or non-native to a particular target cell type, and the promoter may be, invarious aspects, a constitutive promoter, a tissue-specific promoter, or an inducible promoter (e.g., a promoter system comprising a Tet on / off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, or a metallothionein promoter). For example, in various embodiments, an inducible promoter system is employed that allows the use of a small molecule to induce or stop production of analgesic peptide production.

[0086] Optionally, the virus coat or capsid (i.e. , particle surface) is modified to adjust viral tropism. For example, the genome of one serotype of virus can be packaged into the capsid of a different serotype of virus to, e.g., evade the immune response. Alternatively (or in addition), components of the capsid can be modified to, e.g., expand the types of cells transduced by the resulting vector, avoid (in whole or in part) transduction of undesired cell types, or improve transduction efficiency of desired cell types. For example, transduction efficiency is generally determined by reference to a control (i.e., an unmodified, matched viral vector).Improvements in transduction efficiency can result in, e.g., at least about 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 100% improvement in transduction rate of a given cell type. If desired, the capsid can be modified such that it does not efficiently transduce non-target tissues, such as liver or germ cells (e.g., 50% or less, 30% or less, 20% or less, 10% or less, 5% or less of the level of transduction of desired target tissue(s)).

[0087] In some embodiments, the vector comprises a nucleotide sequence set forth in SEQ ID NO: 36 (encoding hKv7.1), SEQ ID NO: 37 (encoding hKv7.2), SEQ ID NO: 38 (encoding hKv7.3), SEQ ID NO: 39 (encoding hKv7.4) or SEQ ID NO: 40 (encoding hKv7.5).

[0088] The disclosure further provides a composition comprising a plurality of the gene transfer vectors encoding one or more carbonic anhydrase peptides described herein (or candidate 7vK voltage-gated potassium channels described herein). The composition can have any desired titer of vector, typically measured in plaque forming units (pfu) in the context of viral vectors. In some embodiments, the composition comprises a vector in an amount ranging from about 103pfu / ml to about 1014pfu / ml, or about 104pfu / ml to about 109pfu / ml, or about 105pfu / ml to about 108pfu / ml. In some embodiments, the composition comprises a vector in an amount of about 103pfu / ml, 104pfu / ml, 105pfu / ml, 106pfu / ml, 107pfu / ml, 108pfu / ml, 109pfu / ml, 1010pfu / ml, 1011pfu / ml, 1012pfu / ml, 1013pfu / ml, or 1014pfu / ml.

[0089] In some embodiments, the composition comprises the same type of vector as a homogenous composition. In some embodiments, the composition comprises different vectors (i.e., as a heterogenous composition). In some embodiments, the DNA sequences encoding the candidate analgesic peptide(s) (or precursors thereof) differ between the vectors in the composition. In a various embodiments, respective DNA sequences encoding the carbonic anhydrase peptides described herein (or candidate 7vK voltage-gated potassium channels described herein) among the vectors within the composition define a random or semirandom peptide library. Optionally, the DNA sequences encode precursors of carbonic anhydrase peptides and variants thereof.

[0090] Modified Cells

[0091] In some aspect, the disclosure provides cells modified to express an exogenous Kv7 voltage-gated potassium channel proteins (wildtype and / or mutant versions, which are optionally used as positive and negative controls) at high levels that enable the measurement of CA8* biologic function, vector characterization and potency determination during manufacturing process development and lot assessment, vHCA8* release, and stability assays. The term "non-native” or "exogenous” refers to a nucleic acid or protein that is naturally present in a cell.

[0092] The present disclosure also provides cells modified to express an exogenous carbonic anhydrase protein or variant thereof described herein.

[0093] The nucleic acid encoding the Kv7 voltage-gated potassium channel protein or carbonic anhydrase protein described herein may be stably integrated into the genome of the cell or may be present in a separate expression vector construct. The cell can be a cell from a mammalian cell. Mammalian cells include those isolated or derived from, e.g., humans, non-human primates (such as apes, chimpanzees, monkeys, and orangutans), domesticated animals (including dogs and cats), livestock (such as horses, cattle, pigs, sheep, and goats), or other mammalian species including, without limitation, mice, rats, guinea pigs, rabbits, hamsters, and the like. The cells also may be isolated or derived from any tissue. In various aspects, the cells are central nervous system cells, frontal cortex cells, glial cells, microglial cells, or striatum cells. Examples of cells include, but are not limited to, Chinese Hamster Ovary (CHO) cells and derivatives thereof (e.g., CHO-K1, CHO pro-3), mouse myeloma cells (e.g., NS0, GS-NS0, Sp2 / 0), human embryonic kidney 293 (HEK293) cells or derivatives thereof (e.g., HEK293T, HEK293-EBNA), green African monkey kidney cells (e.g., COS cells, VERO cells), human cervical cancer cells (e.g., HeLa and derivatives such as HeRC32), human bone osteosarcoma epithelial cells U2-OS, adenocarcinomic human alveolar basal epithelial cells A549, human fibrosarcoma cells HT1080, mouse brain tumor cells CAD, embryonic carcinoma cells P19, mouse embryo fibroblast cells NIH 3T3, mouse fibroblast cells L929, mouse neuroblastoma cells N2a, human breast cancer cells MCF-7, retinoblastoma cells Y79, human retinoblastoma cells SC-Rb50, human neuroblastoma cells SH-SY5Y, human liver cancer cells Hep G2, mouse B myeloma cells J558L, and baby hamster kidney (BHK) cells (Gaillet et al. 2007; Khan, Adv Pharm Bull 3(2): 257-263 (2013)).

[0094] In some aspects, the cell has been modified with an exogenous nucleic acid comprising a nucleotide sequence encoding a Kv7 voltage-gated potassium channel or variant thereof (or carbonic anhydrase protein or variant thereof described herein). The cell is optionally engineered to stably overexpress the Kv7 voltage-gated potassium channel or variant thereof (or to over express a carbonic anhydrase protein or variant thereof). By "overexpress” is meant increasing the overall amount of Kv7 voltage-gated potassium channel or variant thereof in the cell (i.e., the cell produces more of an Kv7 voltage-gated potassium channel or variant thereof than a matched cell which has not been modified). In some embodiments, the Kv7 voltage-gated potassium channel is Kv1, Kv2, Kv3, Kv4 or Kv5. In some embodiments, the variant Kv7 voltage-gated potassium channel comprises a loss of function mutation (i.e., a mutation that results in prevention of activation of the Kv7 voltage-gated potassium channel). In some embodiments, the variant Kv7 voltage-gated potassium channel is encoded byKCNQ2-N258K or KCNQ2-G269D) .In some embodiments, the cell does not express a native Kv7 voltage-gated potassium channel or a native variant Kv7 voltage-gated potassium channel. In some embodiments, the variant Kv7 voltage-gated potassium channel comprises a gain of function mutation (i.e., a mutation that results in activation of the Kv7 voltage-gated potassium channel). In some embodiments, the variant Kv7 voltage-gated potassium channel is Kv7.3-D755N or Kv7.3-T730A.

[0095] Similarly, and in the context of carbonic anhydrase proteins, "overexpress” is meant increasing the overall amount of carbonic anhydrase protein or variant thereof in the cell (i.e., the cell produces more of a carbonic anhydrase protein or variant thereof than a matched cell which has not been modified).

[0096] The disclosure also provides methods of making the modified cells comprising contacting the cell with a vector comprising a nucleic acid encoding a Kv7 voltage-gated potassium channel protein or variant thereof. In some embodiments, the Kv7 voltage-gated potassium channel protein is Kv1, Kv2, Kv3, Kv5 or Kv5. In some embodiments, the variant Kv7 voltage-gated potassium channel comprises a gain of function mutation (i.e., a mutation that results in activation of the Kv7 voltage-gated potassium channel). In this regard, a modified cell expressing a variant Kv7 voltage-fated potassium channel comprising a gain of function mutation would be used as a positive control. In some embodiments, the mutated Kv7 voltage-gated potassium channel is Kv7.3-D755N or Kv7.3-T730A.

[0097] Potency Infectivity Assays

[0098] To demonstrate the infectivity of a vector encoding a CA protein, such as the vHCA8*WT vector, cellbased assays were used to characterize the product (size) and quantify yield (western). The correct-sized CA8* product was detected with both antibodies, while the vHCA8*MT negative control vector expressed greatly reduced levels of the CA8* protein in comparison to the B-acti n loading control, similar to that seen previously with the AAV-CA8*WT and -MT vectors.2Figure 19 provides data from an infectivity assay showing the correct sized CA8* peptide product on western blot after infection of rat primary dispersed DRG neurons in culture were infected with vHCA8*.

[0099] In this regard, the disclosure provides methods comprising contacting a cell with a vector comprising a nucleic acid encoding a carbonic anhydrase protein, such as a vector described herein and measuring a change in Kv7 voltage-gated potassium channel activation in the cell. In some embodiments, the Kv7 voltage-gated potassium channel activation is measured in a patch clamp assay. In some embodiments, the Kv7 voltage-gated potassium channel activation is measured by potassium flux assay, wherein potassium flux is measured by fluorescence-based methods. In some embodiments, the Kv7 voltage-gated potassium channel activation is measured by rubidium flux assay. In some embodiments, the Kv7 voltage-gated potassium channel activation is measured by thalium flux assay. In some embodiments, the Kv7 voltage-gated potassium channel activation is measured by ligand binding assay. In some embodiments, the Kv7 voltage-gated potassium channel activation is measured indirectly by calcium-sensitive dyes.

[0100] The Examples include additional CA8* or V5 (CA8* variants), CA10 (or CA10 variants) and CA11 (or CA11 variants), ELISA methods, kits, and specifications that provide product-specific identification using human anti-CA8, anti-CA10, anti-CA11 or anti-tag specific detection. These methods and kits provide potency assessments of carbonic anhydrases during process development / optimization, stability testing for optimal storage conditions, drug expiration dating based on a significant drop in potency over time, container-closure compatibility testing, and product release (vHCA8* meets a predetermined 'infectivity' range), etc. This assessment provides a quantitative assessment of vHCA8* in vitro functioning to measure production by intact rdHSV vector-mediated CA8* transgene (peptide) within infected cells. In this case, it establishes that the rdHSV construct is assembled correctly, the modified rdHSV genome incorporates the CA8* transgene that correctly expresses the CA8* peptide in the expected quantities using highly controlled cell-based testing conditions.Candidate Screening Assays

[0101] The disclosure provides a method for detecting an agent (e.g., a peptide) having a desired analgesic property, or the ability to activate a Kv7 potassium channel in a cell. A population of expression vectors encoding a candidate peptide is introduced into a population of host cells (e.g., as NBL or HEK293 cells) under conditions suitable for expression of the encoded peptides. One or more host cells are then assayed for a desired effect representative of the desired analgesic property or activation of a Kv7 potassium channel in a cell. If desired, the host cell(s) is assayed in comparison with a positive and / or negative control agent, such as those described herein for Car8 / CA8. The control agent can be an agent known to precipitate the desired effect (positive control) or an agent known not to exhibit the desired effect (negative control). Optionally, the method further comprises deducing the DNA sequence encoding a peptide demonstrating the desired analgesic property, or ability to activate a Kv7 voltage-gated potassium channel in the cell.

[0102] The host cell(s) can be in vivo or in vitro. For in vitro applications, the assay is optionally conducted in multi-well plates (e.g., 96 well plates), which can facilitate high-throughput screening for desired pharmacodynamics and / or analgesic effect. For such applications, expression vectors from the library are optionally introduced into wells at a calculated titer of less than 1 vector per well (typically about 0.5 vectors per well) to minimize the statistical likelihood that more than one vector will transfect or infect the cells. In some embodiments, the expression vector is a viral vector, and in others, it is a plasmid or phage. Where a plasmid or phage (e.g., BAG) includes a viral genome, however, the cells within the wells will produce viral particles. Alternatively, a BAG system containing viral genomes (which comprise the respective DNA sequences and promoters) can be used to transform a larger number of cells, and viral particles rescued. The resultant viral particles then can be used in the assay. For example, if about 10,000 BACs containing HSV backbones that carry the random or semi-random library are introduced into host cells in a 6-well dish, after about 24 hours, about 100,000 viral particles typically can be harvested. These can be employed in the assay. Desirably, about 30,000 viral particles should be used (about three times the number of original vectors) to increase the likelihood that all members of the library are being assayed. The desired effect to be assayed can be any suitably measurable effect, such as apoptosis, antagonism of ITPR1 activation and calcium release or other aspects ofthis cell signalizing pathway, etc. Exemplary assays and methodologies are provided in the Example, which should not be construed to be limiting.

[0103] In some embodiments, the host cell(s) are in vivo (i.e., an animal model), which is particularly suitable when the desired effect to be assayed is behavioral in nature. For example, an analgesic effect can include a decrease in hyperalgesia or allodynia brought on by, for example, an external stimulus or a medical condition. In such embodiments, the library can be clonally expanded into a plurality of random stocks of vectors (each of which is substantially homologous), and the respective stocks introduced into an animal model of pain. The vector DNA from those stocks, which decrease the pain response in the animal, can then be sequenced to identify the encoded candidate analgesic peptide, or candidate peptide having the ability to activate a Kv7 voltage-gated potassium channel. In some embodiments, the method further comprises administering the candidate peptide to a subject in need thereof (e.g., to treat a condition associated with aberrant Kv7voltage- gated potassium channel activity, or to treat a condition associated with elevated neuronal excitability).Therapeutic methods

[0104] The disclosure also provides methods of treating a condition associated with aberrant Kv7 voltagegated potassium channel activity in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein described herein to the subject, wherein the condition to be treated is not pain. In another aspect, the disclosure provides methods of treating a condition associated with elevated neuronal excitability in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein described herein to the subject, wherein the condition to be treated is not pain.

[0105] Conditions associated with aberrant Kv7 voltage-gated potassium channel activity or elevated neuronal excitability include, but are not limited to, amyotrophic lateral sclerosis (ALS) (Huang et al, 2021 Cell Rep. 2021 June 08; 35(10): 109224), epilepsy (Cold Spring Harb Perspect Med 2016;6:a022871 ), peripheral nerve hyperexcitability (Hart et al., 2002, Brain 125, 1887-1895; Wuttke et al., ,2007, Neurology 69, 2045-2053), Alzheimer's Disease (Sanchez-del-Rey et al., 2024, Front. Cell. Neurosci. 18:1406709., Huntington's disease (Cansches-del-Ret, 2024, supra), or hearing loss (Rim et al., 2021, Int. J. Mol. Sci., 22:2510). In some embodiments, the condition is epilepsy. In some embodiments, the condition is hearing loss.

[0106] Efficacy in treating (i.e., reducing, easing, suppressing, or alleviating) or preventing the conditions described herein in a subject in need thereof is determined using any suitable method known in the art.Formulations, Administration Regimens

[0107] In various aspects, the vector is provided in a composition (e.g., a pharmaceutical composition) comprising a physiologically-acceptable (i.e., pharmacologically-acceptable) carrier, buffer, excipient, or diluent. Any suitable physiologically-acceptable (e.g., pharmaceutically acceptable) carrier can be used within the context of the disclosure, and such carriers are well known in the art. The choice of carrier will be determined, in part, by the particular site to which the composition is to be administered and the particular method used to administerthe composition. The composition also can comprise agents, which facilitate uptake of the expression vector into host cells. Suitable composition formulations include aqueous and non-aqueous solutions, isotonic sterile solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood, and aqueous and non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. The composition can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, water, immediately prior to use.

[0108] In various embodiments, the expression vector is incorporated into lipid vesicles (which optionally enhances uptake) or provided in the form of a nanoparticle (e.g., by incorporation with a protein, lipid, carbohydrate, or combination thereof). Physical bombardment may be utilized to increase vector uptake by cells. Optionally, the expression vector is provided with chemical-based transduction enhancers. An example of a transduction enhancer includes lipoplex technology, wherein positively charged DNA is combined with anionic and neutral lipids to construct lipoplexes to enhance uptake. Polyplexes represent another form of chemical delivery complex for expressing units. In general, polyplexes consist of cationic polymers, and fabrication is based on ionic interactions and self-assembly. Another example, cationic liposomes, interact with cell membranes to enhance uptake through endocytosis. To improve transfection efficiency, electro-neutral lipids, such as DOPE are added to enhance release into the cytoplasm and escape lysosomal degradation. In another embodiment, polymersomes are used as an alternative to liposomes. Polymersomes are synthetic versions of liposomes (vesicles with a lipid bilayer) that tend to be more stable than liposomes, mechanically stronger, and have a longer storage self-life. Endosome-lytic agents include inactivated adenovirus that facilitate nanoparticle escape from the endocytic vesicle made during uptake.

[0109] Due to their low toxicity, greater carrying capacity, and ease of fabrication, polycationic nanoparticles are an advantageous embodiment. Polyethyleneimine and chitosan are among the polymeric carriers suitable for expression vector delivery. Other polycationic carriers include poly (beta-amino esters) and polyphosphoramidate. Dendrimers are highly branched macromolecules with a spherical shape useful in aiding the cellular targeting of expressing units.

[0110] One embodiment includes the use of cationic dendrimers. These molecules naturally attract negatively charged genetic material such as DNA or RNA and this complex is taken into the target cells via endocytosis. Recently, dendrimers have been produced using kinetically driven chemistry that reduces cost and process time. "Priostar" dendrimers can carry a variety of expressing units including DNA or RNA and efficiently transfect target cells at a high efficiency with little or no toxicity.

[0111] Inorganic nanoparticles, such as gold, silica, iron oxide, and calcium phosphates represent another chemical means to deliver nucleic acid to target cells. Benefits of inorganic nanoparticles include stable prolonged storage, low cost manufacturing, minimal immunogenicity, and resistance to microbial attack. Nanosized inorganic particles (e.g., less than 500 nm, preferably less than 250 nm, and most preferred less than 100nm) represent another option for enhancing transduction, if desired. The nanoparticles can efficiently trap DNA or RNA and allow escape from the endosome without degradation.

[0112] Cell-penetrating peptides, also termed peptide transduction domains (PTDs), are short peptides (< 40 amino acids) that efficiently pass through cell membranes while being covalently or non-covalently bound to various expressing units, facilitating their entry into cells. PTDs can be constructed to release exogenous nucleic acid to specific cell organelles by incorporating localization peptide sequences.

[0113] Some well-known physical methods of delivery of expressing units to target cells include the use of electroporation, sonoporation (ultrasonic frequencies to cavitate membranes making them more permeable to the expressing unit entry), magnetofection (expressing unit is complexed with magnetic particles enhancing the entry into target cells with a magnet), and hydrodynamic methods.

[0114] In various embodiments, the expression vector is incorporated into a viral capsid (viral particles) representing an infectious viral particle (including capsid, single or double stranded DNA, RNA, or other nucleic acid capable of coding for necessary peptide(s)), which can be advantageous to support latent infection and stable long-term analgesic peptide production. Peptide expression may be intracellular, and impact neuronal excitability and functioning in a way that produces analgesia or anti-hyperalgesia.

[0115] The expression vector (e.g., viral particle) is administered in an amount and at a location sufficient to provide some improvement or benefit to the subject, i.e. , 7vK voltage-gated potassium channel activation, decreased, neuronal hyexcitability, and / or diminish or inhibit the sensation or perception of pain in the subject. Depending on the circumstances, a composition comprising the expression vector is applied or instilled into body cavities, applied directly to target tissue, and / or introduced into circulation. For example, in various circumstances, it will be desirable to deliver the composition comprising the expression vector by intravenous, intraperitoneal, intra-oral; intra-luminal (e.g., urinary bladder, gall bladder, bile ducts, pancreatic ducts, or sinus); intramuscular, intra-ocular, transcorneal, intraarterial, intraportal, intralesional, intradermal, intraarticular, intrathecal, intraneuronal, intraganglion, periganglion, intra-dermal, transdermal, subcutaneous, intraperitoneal, intranasal, intracochlear, intralabyrinthine inhalation (e.g., upper and / or lower airways), enteral, vaginal, or rectal means.

[0116] In some embodiments, the vectors is administered via a route selected from intraneural, intradermal, intracochlear, epidural, intrathecal, or directly into central nervous system via stereotactic injection.

[0117] In various aspects, the expression vector is administered directly to the pancreatic ducts, which is useful for, e.g., treating pain associated with pancreatic cancer or pancreatitis). In various aspects, the expression vector is administered to the trigeminal ganglia. If desired, the expression vector is administered regionally via intraarterial or intravenous administration feeding the region of interest. In various aspects, the expression vector described herein is administered directly or indirectly to peripheral somatosensory nerves. In one embodiment, the route of administration involves direct administration (e.g., injection or infusion) to dorsal root ganglion, other ganglia or somatosensory neurons, or the spinal cord. Optionally, the expression vector isadministered via intra-articular injection or peripheral (e.g., sciatic) nerve injection. In various aspects, the expression vector is administered by intra-articular insertion to treat chronic nociceptive pain by, e.g., quieting the somatosensory nerves supplying an affected arthritic joint. In other embodiments, the expression vector is administered to various cavities, ducts, sinuses, or organs via a microcatheter or with direct visualization using an endoscope.

[0118] In some

[0119] Other embodiments include the use of needles to facilitate localization of expression vector to regions of pain. For example, the disclosure contemplates administration of the expression vector to sites (e.g., organ or other bodily site, such as joint) where pain arises using a catheter or needle. Still other embodiments include the use of imaging to guide the deposition of expression vector using for example, fluoroscopy, ultrasound, CT or MRI. A further embodiment includes the use of formulations that facilitate the delivery of expression vector via intradermal routes and to the gut by avoiding degradation in the stomach or upper gastrointestinal track.

[0120] In various aspects, enteric-coated encapsulation may be used to prevent degradation by gastric acid and inactivation of an expression vector. A formulation may include incorporation of a capsule composed of enteric-coated granules developed using Eudragit L30D-55 as a enteric polymer encasing expression vectors. Optimization of the capsule formulation may be achieved with an optimal protective coating with Eudragit L30D- 55 demonstrating maximum viable vector count after two hours of incubation in acid medium and disintegration time of one hour in buffer pH 6.8. The amount of Eudragit L30D-55 in the capsules correlates with gastric juice resistance. Protective qualities against artificial gastric juice are observed when capsules were prepared from granules composed of vectors, corn starch, lactose monohydrate, polyvinylpyrrolidone and coated with 12.5 % (mA / ) of Eudragit L30D-55. Other coatings may be used to provide enteric-protective properties of a commercially available polymer EUDRAGITOL100-55 on gelatin capsules and also on DRcaps®. Still other enteric coatings include, e.g., Vcaps® (Lonza) enteric coated capsules incorporating a polymer blend that enables effective delayed release, gastric protection, and protection of compounds with mild-to-moderate acid sensitivity; and enTRinsic Drug Delivery Technology incorporating capsule technologies described as a polymer blend that provides enteric protection to small and large molecules that are highly acid-sensitive.

[0121] Still other embodiments to provide gastric resistance to labile vectors can be also obtained by adding enteric polymeric systems to other dosage forms. Tablets, mini-tablets, pellets and granules (usually filled into capsule shells) are the most common enteric-coated dosage forms utilizing polymers noted elsewhere.

[0122] In various aspects, the expression vector is injected into a peripheral nerve (e.g., sciatic, femoral, infraorbital, trigeminal, facial, or suprascapular) or via intra-ganglion injection. In other embodiments, the expression unit maybe a naked single or double stranded DNA expression unit that is circular and resistant to nuclease destruction. In other embodiments, the vector may be incorporated into lipid vesicles for better absorption. Still other embodiments include single or double stranded DNA expressing units that are incorporated into a protein, lipid, carbohydrate molecules, or combinations of these as nanoparticles. Still otherembodiments include physical methods of entry into target cells. An exemplary embodiment includes the use of chemical methods to enhance the uptake of expression vector entry into target cells. Other embodiments utilize a combination of physical, chemical, and biological methods for enhanced uptake of expression vectors into target cells.

[0123] Alternatively, the composition is administered locally via implantation of a membrane, sponge, or another appropriate material onto which the composition has been absorbed or encapsulated. Where an implantation device is used, the device is, in one aspect, implanted into a suitable tissue, and delivery of the expression vector is, for example, via diffusion, timed-release bolus, or continuous administration.

[0124] A particular administration regimen for a particular subject will depend, in part, upon the amount of therapeutic administered, the route of administration, and the cause and extent of any side effects. The amount administered to a subject (e.g, a mammal, such as a human) in accordance with the disclosure should be sufficient to affect the desired response over a reasonable time frame. In various embodiments of the method of treating or preventing pain in a subject, an expression vector encoding CA8 (or Car8), CA8 (or Car8) fragments (including CA8-204, CA8-204c, CA8-204G, CA8-202 and CA8-203), CA10 (or Carl 0) or CA11 (or Carl 1) is administered in an amount to induce analgesia. Put another way, the dose of composition administered is sufficient to reduce, ease, suppress, or alleviate pain. Exemplary doses of viral particles in genomic equivalent titers of 104-1015transducing units (e.g., 107-1012transducing units), or at least about 105, 106, 107, 108, 109, 1010,1011. 1012. 1013. 1014, or 1015transducing units or more (e.g., at least about 107, 108, 109, 1010, 1011, 1012, 1013or 1014transducing units, such as about 1010or 1012transducing units). Some conditions require prolonged treatment, which may or may not entail multiple administrations over time. Equivalent doses of vectors in genomic equivalents are 104-1015, which can be quantified in vitro using quantitative PCR (qPCR) in term of expressing units (wherein an expressing unit is a discrete genetic unit capable of producing one peptide described herein). In various aspects, the dose comprises 107-1012expressing units, or at least about 104, 105,106. 107. 108. 109. 1010. 1011. 1012. 1013. 1014, or 1015expressing units or more (e.g, at least about 107, 108, 109, 1010, 1011, 1012, 1013, or 1014expressing units, such as about 1010or 1012expressing units).

[0125] When appropriate, the expression vector comprising a nucleic acid encoding CA8, CA8 fragment (including CA8-204, CA8-2O40, CA8-204G, CA8-202 and CA8-203), CA10 or CA11 (or mouse versions thereof) is administered in combination with other substances (e.g, therapeutics) and / or other therapeutic modalities to achieve an additional (or augmented) biological effect. This aspect includes concurrent administration (i.e, substantially simultaneous administration) and non-concurrent administration (i.e, administration at different times, in any order, whether overlapping or not) of the expression vector and one or more additionally suitable agents(s). It will be appreciated that different components are, in certain aspects, administered in the same or in separate compositions, and by the same or different routes of administration.

[0126] Kits

[0127] In another aspect, the disclosure provides a kit comprising a cell that has been genetically modified to express a variant Kv7 voltage-gated potassium channel and one or more reagents. Exemplary reagents include, but are not limited to, fluorescent dyes(s), rubidium, thallium, or other potassium flux measures.

[0128] In some embodiments, the variant Kv7 voltage-gated potassium channel comprises a gain of function mutation (i.e., a mutation that results in activation of the Kv7 voltage-gated potassium channel). In this regard, a modified cell expressing a variant Kv7 voltage-fated potassium channel comprising a gain of function mutation would be used as a positive control. In some embodiments, the mutated Kv7 voltage-gated potassium channel is Kv7.3-D755N or Kv7.3-T730A.

[0129] In some embodiments, the variant Kv7 voltage-gated potassium channel comprises a loss of function mutation (i.e., a mutation that results in prevention of activation of the Kv7 voltage-gated potassium channel). In this regard, a modified cell expressing a mutated Kv7 voltage-fated potassium channel comprising a loss of function mutation would be used as a negative control. In some embodiments, the mutated Kv7 voltage-gated potassium channel is encoded by KCNQ2-N258K or KCNQ2-G269D).

[0130] In some embodiments, the cell does not express a native Kv7 voltage-gated potassium channel or a native variant Kv7 voltage gated potassium channel. In some embodiments, the cell is a HEK293 cell.

[0131] The invention, thus generally described, will be understood more readily by reference to the following example, which is provided by way of illustration and is not intended to limit the invention.EXAMPLESExample 1 - CA8 produced Kv7 channel activation, which decreased nociceptor excitability

[0132] Introduction

[0133] Chronic pain is common and inadequately treated, making the development of safe and effective analgesics a high priority. Our previous studies unraveled a novel analgesic pathway, that involves the expression of carbonic anhydrase-8 (CA8) in primary afferent neurons. CA8 mediates analgesia (4-6) via inhibition of neuronal ER inositol trisphosphate receptor-1 (ITPR1 ), subsequent decrease in ER calcium release, and a reduction of cytoplasmic free calcium, essential to the regulation of neuronal excitability(4-10). This novel analgesic pathway has the potential to address the unmet need for effective new non-opioid analgesics to treat chronic pain conditions. (11). The impact of chronic pain disorders is enormous and costly (12, 13). In the absence of suitable analgesic alternatives to treat chronic noncancer pain, an epidemic of opioid overuse, abuse, and life-threatening complications has occurred (14-19).

[0134] To address the hypothesis that V5-CA8 ( modified human CA8) represents a novel non-opioid analgesic, we have previously delivered V5-CA8 to DRG via sciatic nerve injection in mice using adeno- associated virus-based (AAV) gene therapy. This AAV-V5-CA8 gene therapy vector transduced DRG of mice to produce profound long-lasting analgesia (equivalent >100mg of oral morphine in 60kg adult for more than 4 weeks) and treated chronic pain in various models (6-10, 20). Unlike local anesthetics, V5-CA8-related analgesiaoccurred without motor blockade and without any clinical pathology (4-10, 20). Yet, despite the fundamental role of CA8 in regulating intracellular calcium signaling, our understanding of how CA8 regulates neuronal excitability to produce analgesia remains unknown.

[0135] One potential mechanism is via opening of Kv7 voltage-gated potassium channels. Kv7 voltage-gated potassium channels are the only known neuronal potassium channels that are activated by lower cytoplasmic calcium to produce M-currents (IM) through calmodulin-dependent and -independent mechanisms (21-25). IM regulate neuronal excitability and produce analgesia by prolonging neuronal AHP, which restricts the firing of action potentials and the propagation of afferent nociceptive signals (26, 27). Kv7 voltage-gated potassium channel openers (e.g., flupirtine, retigabine) are well-known to produce non-opioid-based analgesia in a variety of animal models and human chronic pain conditions (28-35). However, despite their utility in treating chronic pain, all previous Kv7 channel openers were removed from the market due to adverse events after their oral use and systemic exposure (35, 36). Nonetheless, Kv7 voltage-gated potassium channels remain important analgesic targets. Based on our findings, we speculate that the activation of Kv7 voltage-gated potassium channels by CA8-mediated reduction of cytoplasmic free calcium potentially explains the analgesia observed through prolonged AHP and reduced neuronal excitability.

[0136] A major limitation of AAV strains used in our prior studies was their limited potential to transduce DRG neurons except after direct intra-neural injections (37, 38). To address this limitation, rdHSV vectors were utilized for neuronal transduction in the current study. rdHSV-based gene therapy has the potential to transduce DRG neurons after intra-articular, intradermal and intra-neural injections commonly used in chronic pain treatments. JDNI8 HSV gene therapy vectors are replication defective and disease-free due to the deletion of all the viral immediate early (IE) genes (42-44). These replication defective (rd)HSV vectors provide an efficient delivery system to the peripheral nervous system that selectively establishes natural lifelong latency within the nucleus os infected neurons, following retrograde transport of viral particles to the nerve cell bodies in DRG. Together these viral modifications provide a non-cytotoxic vector capable of long-term episomal maintenance in neurons with at least six-months of continued, robust transgene expression (44). These vectors are non-cytotoxic, provide no viral antigen targets for immune effector cells and consequently much less likely to produce local inflammation.

[0137] The primary goal of this study was to apply this novel gene therapy system to test the hypothesis that expression of a human V5-CA8 peptide variant in small primary afferents, likely nociceptors, can attenuate their excitability, via a mechanism that involves CA8-induced prolongation of their afterhyperpolarization (AHP) resulting from the activation of their Kv7 voltage-gated potassium channels. The specificity of the treatment was confirmed using a null-mutant CA8 gene vector (CA8*MT), and in vitro drug-mediated (XE-991 ) selective antagonism of the Kv7 channels.

[0138] Materials and Methods

[0139] Engineering of vHCA8WT and vHCA8MT viruses'. The WT and MT vHCA8 HSV vectors were made by simply digesting the HCA8-V5-AAV-MCS4650 plasmids both wild-type (WT) and mutant (MT) (10) with Bglll 1enzyme (New England Biolabs) (20). Gibson Reaction (NEBuilder HiFi DNA Assembly, New England Biolabs, Ipswich, MA) was used to clone those Bglll fragments upstream of a PCR fragment of T2A-GFP sequence from a glycoprotein C (gC)-T2A-eGFP fusion plasmid (45) using the following primers: T2A-GFP-F: 5- 'CTCGGTCTCGATTCTACGGAGGGCAGAG- GAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAGAGAGCGACGAGAGCGGCCT-3' (SEQ ID NO: 41), GFP-R: 5'-AGGGATGCCACCCGTAGATCT-tta-GCGAGATCCG-GTGGAGCCGG-3' (SEQ ID NO: 42). The final products from the Gibson Reaction, pAAV-CAGp-hsCA8(WT)-V5-T2A-GFP (SEQ ID NO: 43) and pAAV-CAGp-hsCA8(MT)-V5-T2A-GFP (SEQ ID NO: 44) were then transferred as 3473-bp Notl-digested gel isolated bands into the Notl site of ccdB- pENTER 1 A between the attL recombination sites to create the final products named pE-CAGp-hsCA8(WT)-V5-T2A-GFP and pE-CAGp-hsCA8(MT)-V5-T2A-GFP (42, 45). The LR gateway reaction using LR Clonase (ThermoFisher, Pittsburgh, PA) was used to insert the cassettes from these plasmids into JDNI8-GW41 BAG vector purified from HH8 bacteria (42). Recombinants were screened by PCR across the GW cassette and confirmed by field inversion gel electrophoresis (FIGE) analysis (FIGE mapper, BioRad, Hercules, CA) of restriction enzyme digests of the recombinants (46).

[0140] Preparation, purification, and authentication of HSV-V5-CA8 virus particles: The JDNI8-CAGp-V5- CA8WT-T2A-GFP (SEQ ID NO: 45) (vHCA8WT) or JDNI8-CAGp-V5-CA8MT-T2A-GFP (SEQ ID NO: 46) (vHCA8MT) vectors were produced by transfection of U2OS-4 / 27 complementing cells with DNA purified from BAG preps for each of the vectors. Individual isolates were purified using limiting dilution analysis and then small virus stocks were used to infect Cre-expressing ICP4 / ICP27-complementing (U2OS-4 / 27-Cre) cells to eliminate the BAG sequences by Cre-mediated recombination (46, 47). Limiting dilution analyses were again performed and individual isolates lacking the BAG were identified by X-gal staining of individual plaques in 96-well plates (Thermo-Fisher, Pittsburgh, PA). Following BAG deletion, viral stocks were grown to high titer (47-50), and used to infect 1x 10-layer Cell Factory (Corning, Corning, NY) of U2OS-4 / 27 complementing cells at MQI=0.0005 in VP-SFM MEDIA (Thermo-Fisher, Pittsburgh, PA) for 1 -hr at 37oC in a CO2 incubator. On -day 8, the CFs displayed -90% CPE, and the next day NaCI was added to 0.45M, and the CFs rocked for 4-hr. Virus supernatant was harvested and processed by 0.8-micron GN filtration (Thermo-Fisher, Pittsburgh, PA) and subjected to centrifugation at 43,000xg for 45-90 min, followed by a dPBS wash and a second identical centrifugation step. The vector was finally resuspended in dPBS with sterile glycerol added to a final volume of 10%, and the virus was vialed in 10pil (actual volume 12.5pil) aliquots in cryovials and stored at -80°C. The overall titers were determined by standard plaque assay on U2OS-4 / 27 complementing cells (47). Aliquots of 10pil were used for QA / QC testing, and expression / toxicity in primary rat DRGs. Toxicity was assessed by MTT assay that showed the vHCA8WT vector was like the vHCA8MT control vector on primary rat DRG, or mock infected DRG.

[0141] DRG neuronal primary culture: DRG were dissected from 1-2 weeks old Sprague Dawley (SD) rats anesthetized with isoflurane and decapitated under deep isoflurane anesthesia. DRG were harvested and then enzymatically digested with 5 mg / ml collagenase / Dispase (Roche) for 2 hours at 37°, followed by 0.25% trypsin(Gibco) for 10 minutes at 37°C. The enzymatic reaction was stopped by adding 0.25% trypsin inhibitor and DMEM containing 10% fetal bovine serum and 1% penicillin and streptomycin. The ganglia were then mechanically triturated with a fire-polished Pasteur pipette of three different sizes and passed through a 40-piM cell strainer. The dissociated neurons were then centrifuged and resuspended in complete neurobasal medium (neurobasal medium (Gibco) containing 1% penicillin and streptomycin (Gibco), 1% L-glutamine (Gibco), 2% B27 supplement (Gibco), 100 ng / ml nerve growth factor.

[0142] For electrophysiological (EP) recording, dissociated neuronal somata were plated on 15mm glass coverslip (Electron Microscopy Sciences, PA) coated with Poly-D-Lysine / laminin at a density of 2x104cells / well. Cells were maintained at 37°C in a water saturated atmosphere containing 5% CO2and 95% air. Cultured DRG neurons were transduced with 2 x 104PFU of either vHCA8WT, or vHCA8MT vectors or remained non-infected as a negative control.

[0143] Whole-cell patch-clamp recordings: EP experiments were performed 48-72h after transduction. Neuronal somata were viewed using Hoffman modulation optics under a Nikon Eclipse Ti inverted microscope, and then only small diameter (<30pm) neurons (as determined by microscope eyepiece reticle), selected by GFP fluorescence, were further studied (Fig. 1 A). These small-diameter (<30pm) neurons correlate with electrophysiological characteristics corresponding to nociceptive C-fibers (51).

[0144] Recordings were obtained using the whole-cell configuration of the patch-clamp technique in currentclamp mode, wherein APs were elicited by brief depolarizing square step current commands, in external Tyrode's solution at room temperature. Recordings were conducted via an Axon Multiclamp 700B amplifier, an Axon 1550A digitizer, and analyzed using Clampfit. Initially, resting membrane potential (RMP) were recorded at baseline, and neurons with RMP more depolarized than -45 mV, indicating large leak current, were rejected. Neurons with unstable or distorted recordings or excess "noise” were also rejected. Firing of AP was evoked in response to a sequence of five 3 ms square current commands, repeated every 2000 ms, and increasing from 500 to 2500pA (i.e; 1st step 500pA, 2nd step 10OOpA, 3rd step 1500pA, 4th step 2000pA and 5th step 2500pA). Monomorphic AP and their AHPs were captured in subsequent recordings lasting 2000ms (to measure both AP and longer lasting AHP parameters), and the APs elicited by the fifth current command (2500pA) were used for further analysis. Parameters of AP were measured in Clampfit and compared between groups. AP duration was measured at baseline (at the beginning of the sharp upward rise of the depolarizing phase until returning to baseline) as well as at 50% amplitude (from the point where a horizontal diachronic line was drawn from the rising phase at 50% amplitude to the point where the descending, repolarizing phase crosses this line). AP amplitude was measured from RMP to the AP peak, while AHP amplitude was measured from the RMP to the most hyperpolarized (negative) level of the AHP phase. AHP duration was measured at points representing 50% and 100% recovery back to RMP (see Fig. 1 B). Figure 1 B provides a schematic representation of relevant EP parameters measured, including those of resting membrane potential (RMP), of action potential (AP) and of AHP phase.

[0145] For voltage-clamp recordings, neurons were first patched in a current-clamped mode, and after switching to voltage-clamp, currents in DRG cells were recorded by holding the membrane potential at -20mV and applying a square-form hyperpolarizing pulse to -50 mV, for a duration of 1s, and then back to -20mV (Fig. 4).

[0146] Patch pipettes were pulled from borosilicate glass capillaries (Sutter instrument O.D. :1.5mm, I. D. :0.86mm) using Sutter Instrument P-87 Flaming I Brown Micropipette Puller and flame polished with a micro forge polisher (Narishige, Japan) with a tip resistance of 4-8 MO when filled with internal solution.

[0147] For current-clamp recording, pipettes were filled with an internal solution containing (in mM): 120 KCI, 5 Na-ATP, 0.4 Na-GTP, 5 EGTA, 2.25 CaCI2, 5 MgCI2and 20 HEPES (adjusted to pH 7.4 with KOH). The external Tyrode's solution contained (in mM): 140 NaCI, 4 KCI, 2 CaCI2, 10 glucose, 2 MgCI2, and 10 HEPES (adjusted to pH 7.4 with NaOH).

[0148] For voltage-clamp recording, pipettes were filled with an internal solution containing (in mM): 144 NaCI, 2.5 KCI, 2 CaCI2, 10 glucose, 0.5 MgCI2, 5 HEPES (adjusted to pH 7.4 with Tris base). The external solution contained (in mM): 80 K acetate, 30 KCI, 40 HEPES, 3 MgCI2, 3 EGTA and 1 CaCI2 (adjusted to pH 7.4 with NaOH). A gravity-driven whole bath perfusion was used in all recordings.

[0149] The Kv7 blocker XE-991 was prepared in the external solution at a final concentration of 10 piM and perfused in the bath via the same gravity-driven perfusion.

[0150] Only fluorescent small-sized DRG neurons with diameter <30 piM, as determined by microscope eyepiece reticle, were selected for the electrophysiological recordings.

[0151] Results

[0152] Expression of WT and MT HCA8 in Cultured Primary DRG Neurons After Transduction with vHCA8 Vectors

[0153] For these studies, we used JDNI8-CAGp-V5-CA8WT-T2A-GFP (SEQ ID NO: 45) (vHCA8WT) and JDNI8-CAGp-V5-CA8MT-T2A-GFP (SEQ ID NO: 46) (vHCA8MT) constructs containing the wildtype CA8-201 (WT) and CA8 mutant (MT)(CA8 cDNAs containing the S100P null point mutation (52) modified with a V5 tag. These transgenes were inserted downstream of the GAG promoter into these later-generation nontoxic replication-defective vectors at the ICP4 site (data not shown) (42). The CA8MT (CA8 S100P) represents a rigorous negative control due to the nearly complete loss of CA8 cellular protein associated with rapid proteasome-mediated degradation (52). We used a strong promoter system based on the cytomegalovirus early enhancer element; the promoter region, first exon and the first intron of the chicken beta-Actin gene; and the splice acceptor of the rabbit beta-Globin gene (GAG) that is known to be active in a broad array of cell types including neurons to evaluate the possibility that expression of CA8 in additional cell types may occur and contribute to the metabolic control of the analgesic response (10). These viral particles were used to transduce cultured rat primary DRG neurons (data not shown). To verify that the vectors produce the proper sized CA8protein product in DRG neurons in culture, vector-infected DRG cell lysates harvested 2-days post-infection were employed in western blot analyses using the CA8 and V5 tag antibodies (data not shown). We demonstrated that the vHCA8WT vector yielded high levels of V5-CA8 product detected with both V5 and CA8 antibodies while the vHCA8MT vector expressed greatly reduced levels of the CA8 protein in comparison to the B-actin loading control, similar to that seen previously with the AAV-CA8WT and MT vectors. We showed that the eGFP reporter gene by IHC, was co-expressed from the same GAG promoter-driven message that encodes vHCA8WT / MT due to the use of a T2A self-cleaving site (53) almost exclusively in neurons using the pan-neuronal advillin (AVIL) antibody and in specifically in Navi .8-specific C-fiber neurons. These in vitro studies confirmed that our vectors produce high levels of the correct sized WT gene product in neuronal cells transduced by the HSV replicationdefective vectors.

[0154] vHCA8 Prolongs AHP in Primary Afferent Neurons

[0155] To test the hypothesis that vHCA8 infection reduces neuronal excitability, we obtained whole-cell current clamp recordings from isolated small-sized (< 30 microns) DRG neuronal somata (Fig. 2; Table 1) infected with vHCA8WT and controls (vHCA8MT and non-infected). Small diameter vHCA8 infected neurons (vHCA8WT) were selected under bright field microscopy and under green fluorescence microscopy (Figure 1A), to detect GFP expression, since eGFP is linked to HCA8 via the T2A site.

[0156] Table 1 . Comparison of electrophysiological parameters between small-sized DRG neuronal somata infected with vHCA8WT versus controls (infected with vHCA8MT or uninfected).

[0157] Neuronal somata infected with vHCA8WT and controls did not differ in size, RMP, AP peak amplitude and AP duration (Table 1). However, neuronal somata infected with vHCA8WT exhibited much larger AHP.Representative traces are shown in Fig 2A. Specifically, vHCA8WT AHPs, when compared to controls, exhibited significantly larger AHP peak amplitude with -11 ,65±3.25 vs -6.72±2.5 mV (P<0.01), longer AHP duration 321 ,77±170.45 vs 134.24±72 msec (P<0.05) and longer AHP duration at 50% amplitude 91 ,93±51.39 vs 36.63±20.96 msec (P<0.05), respectively (Table 1; Fig. 2B, 2C, 2D).

[0158] Because prolonged AHP results in decreased neuronal excitability, firing, and reduced nociceptive traffic to primary afferent synaptic terminals, these findings suggest a mechanism that results in vHCA8WT- driven antinociception and analgesia.

[0159] vHCA8 Prolongs AHP via Activation of Kv7 Voltage-Gated Potassium Channels

[0160] We further tested the hypothesis that vHCA8 prolongs AHP via activation of Kv7 voltage-gated potassium channels (apparently as a result of altered calcium signaling). It is known that increased CA8 expression leads to decreased ER calcium release, (4-6, 9, 10) resulting in lower cytosolic free calcium concentration. The Kv7 voltage-gated potassium channels are the only potassium channels activated by low cytosolic calcium concentrations, in contrast to all other potassium channels involved in mediating AHP, which need higher calcium for activation. Then, Kv7 channel activation prolongs AHP.

[0161] To test whether the activation of Kv7 was involved in AHP prolongation after vHCA8WT treatment, we obtained recordings before and after perfusion of the Kv7-specific inhibitor XE-991 onto vHCA8WT-infected small DRG somata. Original representative action potential traces recorded from vHCA8WT-infected neurons before (red trace) and after (magenta trace) perfusion with XE-991 (10 piM) are shown in Fig. 3A. As shown, XE-991 administration resulted in a decrease of the AHP peak amplitude, in shortening of the duration of the AHP, and of the AHP duration at 50% peak (magenta circles) versus baseline (red circles), (Fig. 3B, 3C, 3D, respectively).

[0162] This AHP reversal occurs consistently in all individual neurons, as shown by the direction of changes from pre- to post-perfusion with XE-991, in the lower graphs in Fig. 3E.

[0163] Table 2 provides detailed EP parameters in vHCA8WT infected small neuronal DRG somata before (baseline) and after XE-991 perfusion (10 piM). XE-991 administration resulted in a significant decrease of peak AHP amplitude (-9.3±4.9 mV vs -6.2±3.4 mV, P=0.03), of duration of AHP (419±187 ms vs 232±148 msec, P=0.006), and of duration of AHP at 50% amplitude (107±49 ms vs 65±36 ms, P=0.03) respectively. No other changes were observed.

[0164] Table 2. Comparison of electrophysiological parameters at baseline (untreated) and after the specific Kv7 inhibitor XE-991 in vHCA8WT-lnfected small DRG neurons.

[0165] In contrast to the significant decrease in AHP parameters in vHCA8-infected DRG neurons, XE-991 did not reverse any AHP parameters in control cells (data not shown), indicating the increased activity of Kv7 voltage-gated potassium channels in the vHCA8* infected but not in the control group.

[0166] Furthermore, the values of the reversed AHP parameters by XE-991 in vHCA8-infected neurons did not differ significantly from those values in controls, indicating reversal back to a baseline status (data not shown).. These data show that there are no significant differences in AHP parameters between vHCA8WT- infected neurons treated with XE-991 and controls. Furthermore, a further comparison of AHP parameters after administration of XE-991 (10 piM) in uninfected DRG neuronal somata (data not shown) showed no change in AHP parameters with the Kv7 channel inhibitor. These data indicate that the selective upregulation of the Kv7 M-current occurs in vHCA8WT-infected neurons only, but not in controls, presumably because of CA8-mediated reduction of intracellular calcium levels and Kv7 channel activation in the former.

[0167] A few other potassium channels have been implicated in controlling AHP in DRG neurons, and although those are mainly activated by higher cytosolic calcium (54), we additionally tested if those might have also affected AHP. In contrast to the selective Kv7 blocker, XE-991, which diminished the AHP parameters (Fig. 3; Table 2), blockers that are selective for other potassium channels failed to reduce AHP parameters. Specifically, the selective blocker for the ATP -sensitive potassium (KATP) channels, glibenclamide the selective blocker for the calcium-activated large conductance potassium (BK) channels, iberiotoxin, and the selective blocker for the calcium-activated small conductance potassium (SK) channels, apamin failed to reduce AHP parameters (data now shown), ruling out these other channels as mediators of the prolonged AHP after vHCA8* treatment. This further supports our notion that the prolonging effect on AHP of vHCA8* is mediated predominantly via Kv7 voltage-gated potassium channels.

[0168] The prolonged AHP may drive reduced neuronal excitability, where neuronal hyper-excitability for example responsible for disease symptoms in amyotrophic lateral sclerosis (ALS) (Huang et al, 2021 Cell Rep. 2021 June 08; 35(10): 109224), epilepsy (Cold Spring Harb Perspect Med 2016;6:a022871 ), peripheral nerve hyperexcitability (Hart et al., 2002, Brain 125, 1887-1895; Wuttke et al., ,2007, Neurology 69, 2045-2053), Alzheimer's Disease (Sanchez-del-Rey et al., 2024, Front. Cell. Neurosci. 18:1406709., Huntington's disease (Cansches-del-Ret, 2024, supra), or hearing loss (Rim et al., 2021, Int. J. Mol. Sci., 22:2510).

[0169] Activity suggestive of active Kv7 voltage-gated potassium channels is present in vHCA8 infected neurons but no similar prolongation of AHP was observed after vHCA8MT infection or non-infected cells.

[0170] Current clamp recordings in Tyrode's solution again exhibited prolonged AHP durations in vHCA8WT (262±83.6 ms) vs controls (101 ,7±84.8 ms) (p=0.005), consistent with the previous experiments. To further confirm that this was due to activation of Kv7 voltage-gated potassium channels that convey M-current, after the current-clamp recordings, we proceeded to acquire voltage-clamp recordings from vHCA8 infected small DRG neuron and from controls (Fig. 2). Currents were recorded as per previously published protocol (29, 55) by holding the membrane potential at -20mV and applying a square hyperpolarizing pulse at -50 mV for 1 secondand then back to -20 mV, at baseline and after perfusion of 10 pM XE-991 in the bath. Since Kv7 is a noninactivating current, this protocol minimized contributions from other inactivating currents and the selective blocker XE-991 ensured additional selectivity. XE-991 resulted in statistically significant current inhibition only in DRG neuronal somata infected with vHCA8WT (Fig.2A), but not in controls (Fig. 2B). Our results indicate the presence of upregulated Kv7 currents in vHCA8* infected neuronal somata but not in controls.

[0171] Our results confirm that treatment by vHCA8WT in nociceptors results in selective activation of Kv7 voltage-gated potassium channels, prolonging AHP and enhancing refractoriness, thus reducing the frequency of action potential firing and neuronal excitability and the subsequent propagation of afferent nociceptive signals (29). This may translate into symptom improvement where increased neuronal excitability is responsible for the disease.

[0172] Discussion

[0173] Most patients suffering from chronic neuronal hyper-excitability, which are very common and disabling conditions, that are inadequately treated. Therefore, there is an urgent need for the development of better molecular and cellular targeting or the underlying etiology with novel treatment approaches that reverse neuronal hyperexcitability. Chronic pain is one of many example of peripheral nerve hyperexcitability where iln the absence of alternatives, long-term opioid use in treating chronic pain has increased dramatically over the past few decades, and opioid unwanted effects, including dependence and abuse, are major public health concerns (15-19). In this context, the advantages of the JDNI8 rdHSV for delivery of genes that mediate antinociception to nociceptors may come to cover the unmet need for novel analgesics.

[0174] Herein we exploit this novel HSV-based gene delivery system that takes advantage of the natural tropism of HSV for sensory nerves. Establishing a molecular mechanism of Kv7 channel activation for CA8*- induced reduction in peripheral nerve hyperexcitability producing analgesia and anti-hyperalgesia lending further support to the potential clinical-translational value of these findings for treating human disorders of neuronal excitability, including amyotrophic lateral sclerosis (ALS) (Huang et al, 2021 Cell Rep. 2021 June 08; 35(10): 109224), epilepsy (Cold Spring Harb Perspect Med 2016;6:a022871 ), peripheral nerve hyperexcitability (Hart et al., 2002, Brain 125, 1887-1895; Wuttke et al., ,2007, Neurology 69, 2045-2053), Alzheimer's Disease (Sanchez-del-Rey et al., 2024, Front. Cell. Neurosci. 18:1406709., Huntington's disease (Cansches-del-Ret, 2024, supra), or hearing loss (Rim et al., 2021, Int. J. Mol. Sci., 22:2510). In some embodiments, the condition is epilepsy. In some embodiments, the condition is hearing loss.

[0175] Our previous studies have reported a novel analgesic effect of CA8. In the current study, we have identified the corresponding underlying mechanism of neuronal hyperexcitability associated with hyperanalgesia. For example, we have found that vHCA8WT mediates analgesia via decreased nociceptor excitability and reduced trafficking of nociceptive signals to the CNS. In particular, vHCA8 suppresses primary afferent excitability via activated Kv7 potassium channels (Fig. 3, 4). These channels provide a mechanistic link between reduced cytosolic calcium mobilization, conferred by vHCA8WT gene therapy and CA8 expression,and resulting analgesia. This conclusion is based on following supporting evidence. Our whole cell currentclamp recordings show that infection of small-sized DRG neurons (corresponding to nociceptors) (51) with vHCA8WT causes prolongation of AHP (Fig. 2, Table 1), but not impacted by other potassium channel inhibitors. This highlights the role of Kv7 channels as mediators of the enhancement of AHP in this setting. Furthermore, the presence of active, upregulated Kv7 currents reversed by XE-991 in vHCA8WT-infected nociceptors but not in controls is indicated by our voltage clamp recording.

[0176] Transmembrane Kv7.2, Kv7.3, Kv7.4 (Li et al., Pharmacol., 108:138-146, 2023), and KV7.5 channel proteins (encoded by KCNQ genes) are widely expressed as tissue-specific hetero-tetramers in nociceptors (26), wherein they mediate IM currents resulting in inhibitory effects. Experimental chronic OA pain in rodent models is maintained by primary afferent nociceptors, and this strongly supports our targeting primary afferent nociceptors with localized vHCA8WT-infection, which acts as a Kv7 activator (56) and suppressor of neuronal excitability.

[0177] While other potassium channels involved in attenuating neuronal excitability, such as the calcium- activated potassium channels (54) or the ATP-sensitive potassium channels (57) are activated by elevated cytosolic calcium, this is not the case with Kv7 channels. Kv7 voltage-gated potassium channels are instead activated by lower cytosolic calcium, such as after suppression by CA8, thus resulting in upregulated M-currents (IM) (21, 58, 59). IM has been known to exert a powerful control on neuronal excitability (60, 61), and even small reductions in the IM, from pharmacological inhibition, physiological modulation or mutation, can result in dramatic increases in neuronal excitability (62, 63). IM are also involved in controlling the AHP, serving as a major regulator of neuronal excitability (62, 64, 65), as well as the frequency at which neurons fire while receiving continuous excitatory input (65, 66). It is further well-established that all DRG neurons express Kv7 immunoreactivity and IM currents (29), which is not significantly altered by inflammation (67).

[0178] Our findings that the prolongation of the AHP by activation of Kv7.2 / IM currents is consistent with other published studies (63, 65, 68) and mechanistically links Kv7 channel activation to decreased intracellular calcium ([Ca2+]i) (22). Upregulated IM result in suppressed nociceptor excitability which leads to antinociception. This mechanism is clinically pertinent because of its translational capacity to provide significant non-opioid analgesia. By enhancing AHP, IM hyperpolarizes the membrane, makes it refractory to excitation and to generation of spikes, and reduces the release of excitatory neurotransmitters at presynaptic terminals thus resulting in decreased transmission of pain signaling.

[0179] Three phases of AHP contribute to refractoriness: fast AHP (fAHP) lasting 2-5 ms, medium AHP (mAHP) ranging between 100-300 ms, and slow AHP (sAHP) > 1s to 2 s (66, 69). Considering their time course, the changes we have observed likely correspond to mAHP, a phase that has been shown to depend on Kv7 channels. Yet, other channels have been suggested as potential mediators of mAHP, such as SK calcium- activated potassium channels, and HCN channels conveying Ih current (70, 71). However, there is variability, and distinct channels are responsible for mAHP depending on specific neuronal types and on membrane potentials (68). Our findings highlight the Kv7.2 / IM as a dominant contributor to mAHP, since SK are calcium-activated (requiring higher [Ca2+]i for activation), and since apamin did not reverse any effect in AHP. Regarding the HCN channels, they activate at much more hyperpolarized potential range (around -80mV) (68) and not at the voltage range where our neurons operated, which is around -60 to -50 mV. Furthermore, HCN / lh currents are activated by higher [Ca2+]i, too, released via IP3 receptors (72), which is not the case in our vHCA8-infected cells.

[0180] Our findings are also consistent with those by Peters et al (63) who reported that 10 pM XE991 reduce mAHP amplitude by ~75% after trains of four spikes, and that this is mediated via IM but not via any apamin-sensitive SK currents. Gu et al have also reported that at membrane potentials around -60 mV, mAHP is generated mainly by Kv7.2-7.5 / IM, with little or no contribution from apamin-sensitive SK channels, whereas at more hyperpolarized membrane potentials (~ -80 mV), the Ih becomes the main contributor to mAHP. Ih is deactivated at around -60 mV thus unlikely to contribute to AHP at this range (70).

[0181] Regarding sAHP, again Kv7.2-7.5 / IM has been reported as the major contributor to sAHP (65) but we think that our findings correspond more to mAHP, taking into consideration the time-course, as well as the notion that sAHP is active at membrane potentials more negative than those at which IM activity is typically observed (65), and since sAHP is calcium-dependent.

[0182] Though the identity of Kv7.2-7.5 were identified pharmacologically, XE991 is recognized as a highly selective antagonist for Kv7.2-7.5 (68, 73-75, and Lee et al., Pflugers Arch., 472:89-102, 2020), and others have also reported on the suppression of mAHP mainly by M-channel blockade by XE991 (68, 70).

[0183] Kv7.2-7.5 / IM currents have a threshold for activation usually higher than the typical neuronal resting potentials, with greater activity upon depolarization. Because of this and its lack of inactivation, these currents have a major impact on neuronal excitability (76). Kv7.2-7.5 / IM currents have slow kinetics and traditionally have been considered as unlikely to be significantly induced by a single action potential. To account for this in our protocol, we selected for analysis the AP-AHP traces elicited by the fifth in a sequence of five AP complexes, elicited by a supramaximal 2.5 nA current pulse to ensure spike firing. On the other hand, it should also be noted that even a single action potential can elicit Kv7.2-7.5 / IM activity to affect AHP (66, 68), and also in a fashion that does not require high [Ca2+]i (thus consistent with IM) (70).

[0184] In fact, although there is a relative lack of data on native IM kinetics in mammalian neurons at depolarized potentials above -20 mV (68, 73), studies have confirmed that even single depolarizing AP spikes can generate substantial IM currents. Gu et al have specifically reported that IM currents are activated significantly during a single AP that lasts only 1-2 ms, that this can generate quite prominent mAHPs even after a single AP spike (68), and that IM blockade attenuates the mAHP at -60 mV. They have specifically reported that, due to their slow kinetics, the Kv7.2 channels open late by a single AP, with IM increases up to 30 to 40% of their full open probability, and of their full IM-conductance by a single AP. However, this 30 to 40% fraction of full conductance is sufficient to account for the observed single-AP mAHP duration at — 60 mV (68), and this agrees with our findings as well.

[0185] Other potassium channels may be blocked by XE 991 as well, such as the Kv1.2 (77), but at a much higher IC50 (>100 M) versus 0.98 M for IM. Furthermore, any contribution of Kv1.2 in our studies is extremely low. In neurons Kv1.2 are mainly present in motor neurons, while in DRG neurons these channels are primarily expressed in larger-diameter neurons (larger myelinated fibers) (78, 79) but not in small neurons, as in our studies. Additionally, these channels in neurons are mainly involved in contributing to the resting membrane potential and mediating the repolarization of action potentials (80, 81) but not AHP.

[0186] Neuronal mAHP has been suggested to be primarily mediated by IM (at depolarized potentials) and Ih (at more negative potentials), with little or no contribution by SK (68, 70) So, our results are in agreement with those of Gu et al, who showed that specific IM blocker XE991 (10 pM) suppressed the mAHP following even one AP evoked by current injection at -60 mV. Conversely, the M-channel opener retigabine reduced excitability. The HCN / lh blocker ZD7288 (4-ethylphenylamino-1 ,2-dimethyl-6-methylaminopyrimidinium chloride; 10 pM) fully suppressed the mAHP at -80 mV, but had little effect at -60 mV, whereas XE991 did not measurably affect the mAHP at -80 mV (68, 70). So, although we did not block Ih, we think that this current is unlikely to have affected the AHP in our setting, which is also at the -60 mV range wherein these neurons operate. Gu et al also found that blockade of calcium activated potassium channels of the SK type by apamin (100-400 nm) failed to affect the mAHP, also in agreement with our results.

[0187] In our studies, the contribution of large conductance BK channels is likely low since they contribute to fast AHP. As for the small conductance SK channels, their contribution to medium AHP is either minimal or none (68, 70). Contribution by the HCN / lh current to medium AHP in our setting of -60 mV is also considered to be minimal. Previous studies have shown that HCN / lh blocker ZD7288 (4-ethylphenylamino-1 ,2-dimethyl-6- methylaminopyrimidinium chloride; 10 pM) fully suppressed the mAHP at -80 mV, but had little effect at -60 mV, whereas XE991 did not measurably affect the mAHP at -80 mV (68, 70). Although, Kir6 containing KATP channels have been also implicated in controlling the AHP (82), we do not think that these may have contributed to the differences that we observed because they are also activated by higher [Ca2+]i concentrations (57) (contrary to our proposed mechanism) and their specific blocker glibenclamide had no effects.

[0188] Kv7 voltage-gated potassium channels have been implicated in controlling the RMP, but this effect has been reported only on axons, on the nodes of Ranvier, and on axon initial segment (AIS) wherein they are highly concentrated, as well as on axon terminals (65, 83). However, no significant changes in the RMP were observed in our findings. This is likely due to the fact that our recordings involved neuronal somata, and not axons or AIS.

[0189] It seems that during a single AP, (especially after four preceding AP spikes), 30 to 40% of IM full conductance would be enough to prolong AHP but would not hyperpolarize the RMP. Furthermore, while Kv7.2 control RMP only in axons, it is unclear whether they also do the same in somata but is seems in the later location are more involved in attenuating afterdepolarization responses, rather than RMP(84). Interestingly, and in support of our findings, Hu et al have reported that application of retigabine or XE991 to neuronal somata hadno significant effect on the RMP. Peters et al (63) also reported no changes in RMP at baseline conditions between mutants and controls, and no changes in AP parameters, using experiments in neurons of transgenic mice that conditionally express dominant-negative KCNQ2 subunits, suggestive of no contribution of M-current to RMPs, but they attributed changes in excitability to AHP and spike-frequency adaptation.

[0190] Though Kv7 is a highly relevant molecular target for chronic pain therapy, there are no Kv7 activators currently available for clinical use (35, 36). Thus, our proposed HSV-based vHCA8WT gene therapy, which results in downstream activation of Kv7, may provide a reasonable, more efficacious, and potentially safer localized target-specific alternative to opioids for clinical analgesia and anti-hyperalgesia.

[0191] Our studies demonstrate the electrophysiological actions of vHCA8*, a novel Kv7 activating gene therapy reduces neuronal hyper-excitability. The localized application of this disease-free rdHSV facilitates the delivery of the CA transgene specifically to the nucleus of targeted neurons where CA8 expression is associated with reduced neuronal excitability to produce profound analgesia. Localized delivery of this Kv7 activator is likely to avoid the off-target effects and other safety concerns seen with the systemic administration of prior Kv7 activators used to treat various forms of neuronal hyperexcitability including chronic pain. This novel gene therapy may address among other therapeutic needs, the major unmet need for non-opioid analgesics for the treatment of chronic pain.

[0192] References for Example 11. Vitaloni M, Botto-van Bemden A, Sciortino Contreras RM, Scotton D, Bibas M, Quintero M, et al. Global management of patients with knee osteoarthritis begins with quality of life assessment: a systematic review. BMC Musculoskelet Disord. 2019;20(1 ):493.2. Cleveland RJ, Alvarez C, Schwartz TA, Losina E, Renner JB, Jordan JM, et al. The impact of painful knee osteoarthritis on mortality: a community-based cohort study with over 24 years of follow-up. Osteoarthritis Cartilage. 2019;27(4):593-602.3. Cleveland RJ, Nelson AE, Callahan LF. Knee and hip osteoarthritis as predictors of premature death: a review of the evidence. Clin Exp Rheumatol. 2019;37 Suppl 120(5):24-30.4. Fu ES, Erasso DM, Zhuang GZ, Upadhyay U, Ozdemir M, Wiltshire T, et al. Impact of human CA8 on thermal antinociception in relation to morphine equivalence in mice. Neuroreport. 2017;28(18): 1215-20.5. Levitt RC, Zhuang GY, Kang Y, Erasso DM, Upadhyay U, Ozdemir M, et al. Car8 dorsal root ganglion expression and genetic regulation of analgesic responses are associated with a cis-eQTL in mice. Mamm Genome. 2017;28(9-10):407-15.6. Upadhyay U, Zhuang GZ, Diatchenko L, Parisien M, Kang Y, Sarantopoulos KD, et al. Profound analgesia is associated with a truncated peptide resulting from tissue specific alternative splicing of DRG CA8- 204 regulated by an exon-level cis-eQTL. PLoS Genet. 2019; 15(6):e1008226.7. Berridge MJ. Inositol trisphosphate and calcium signalling. Nature. 1993;361 (6410):315-25.8. Hirasawa M, Xu X, Trask RB, Maddatu TP, Johnson BA, Naggert JK, et al. Carbonic anhydrase related protein 8 mutation results in aberrant synaptic morphology and excitatory synaptic function in the cerebellum. Mol Cell Neurosci. 2007;35(1):161-70.9. Zhuang GZ, Keeler B, Grant J, Bianchi L, Fu ES, Zhang YP, et al. Carbonic anhydrase-8 regulates inflammatory pain by inhibiting the ITPR1 -cytosolic free calcium pathway. PLoS One. 2015; 10(3):e0118273.10. Zhuang GZ, Upadhyay U, Tong X, Kang Y, Erasso DM, Fu ES, et al. Human carbonic anhydrase-8 AAV8 gene therapy inhibits nerve growth factor signaling producing prolonged analgesia and anti-hyperalgesia in mice. Gene Ther. 2018;25(4):297-311.11. Relieving Pain in America: A Blueprint for Transforming Prevention, Care, Education, and Research. The National Academies Collection: Reports funded by National Institutes of Health. Washington (DC)2011.12. Busse JW, Wang L, Kamaleldin M, Craigie S, Riva JJ, Montoya L, et al. Opioids for Chronic Noncancer Pain: A Systematic Review and Meta-analysis. JAMA. 2018;320(23):2448-60.13. McNicol ED, Midbari A, Eisenberg E. Opioids for neuropathic pain. Cochrane Database Syst Rev. 2013;2013(8):CD006146.14. Ostling PS, Davidson KS, Anyama BO, Helander EM, Wyche MQ, Kaye AD. America's Opioid Epidemic: a Comprehensive Review and Look into the Rising Crisis. Curr Pain Headache Rep. 2018;22(5):32.15. Paulozzi LJ, Xi Y. Recent changes in drug poisoning mortality in the United States by urban-rural status and by drug type. Pharmacoepidemiol Drug Saf. 2008; 17(10):997-1005.16. Edlund MJ, Martin BC, Devries A, Fan MY, Braden JB, Sullivan MD. Trends in use of opioids for chronic noncancer pain among individuals with mental health and substance use disorders: the TROUP study. Clin J Pain. 2010;26(1):1-8.17. Edlund MJ, Martin BC, Fan MY, Braden JB, Devries A, Sullivan MD. An analysis of heavy utilizers of opioids for chronic noncancer pain in the TROUP study. J Pain Symptom Manage. 2010; 40(2) :279-89.18. Boudreau D, Von Korff M, Rutter CM, Saunders K, Ray GT, Sullivan MD, et al. Trends in long-term opioid therapy for chronic non-cancer pain. Pharmacoepidemiol Drug Saf. 2009;18(12): 1166-75.19. Compton WM, Volkow ND. Major increases in opioid analgesic abuse in the United States: concerns and strategies. Drug Alcohol Depend. 2006;81 (2): 103-7.20. Upadhyay U, Zhuang GZ, Diatchenko L, Parisien M, Kang Y, Sarantopoulos KD, et al. Reversion mutation of cDNA CA8-204 minigene construct produces a truncated functional peptide that regulates calcium release in vitro and produces profound analgesia in vivo. Mamm Genome. 2020;31(9-12):287-94.21. Selyanko AA, Brown DA. Intracellular calcium directly inhibits potassium M channels in excised membrane patches from rat sympathetic neurons. Neuron. 1996; 16(1): 151-62.22. Gamper N, Shapiro MS. Calmodulin mediates Ca2+-dependent modulation of M-type K+ channels. J Gen Physiol. 2003;122(1):17-31.23. Delmas P, Brown DA. Pathways modulating neural KCNQ / M (Kv7) potassium channels. Nat Rev Neurosci. 2005;6(11):850-62.24. Burgoyne RD. Neuronal calcium sensor proteins: generating diversity in neuronal Ca2+ signalling. Nat Rev Neurosci. 2007;8(3): 182-93.25. Kosenko A, Hoshi N. A change in configuration of the calmodulin-KCNQ channel complex underlies Ca2+-dependent modulation of KCNQ channel activity. PLoS One. 2013;8(12):e82290.26. Wu Z, Li L, Xie F, Du J, Zuo Y, Frost JA, et al. Activation of KCNQ Channels Suppresses Spontaneous Activity in Dorsal Root Ganglion Neurons and Reduces Chronic Pain after Spinal Cord Injury. J Neurotrauma. 2017;34(6):1260-70.27. Lombardo J, Harrington MA. Nonreciprocal mechanisms in up- and downregulation of spinal motoneuron excitability by modulators of KCNQ / Kv7 channels. J Neurophysiol. 2016;116(5):2114-24.28. Wulff H, Castle NA, Pardo LA. Voltage-gated potassium channels as therapeutic targets. Nat Rev Drug Discov. 2009;8(12):982-1001.29. Passmore GM, Selyanko AA, Mistry M, Al-Qatari M, Marsh SJ, Matthews EA, et al. KCNQ / M currents in sensory neurons: significance for pain therapy. J Neurosci. 2003;23(18):7227-36.30. Munro G, Dalby-Brown W. Kv7 (KCNQ) channel modulators and neuropathic pain. J Med Chem. 2007;50(11):2576-82.31. Blackburn-Munro G, Jensen BS. The anticonvulsant retigabine attenuates nociceptive behaviours in rat models of persistent and neuropathic pain. Eur J Pharmacol. 2003; 460(2-3): 109-16.32. Erichsen HK, Hao JX, Xu XJ, Blackburn-Munro G. A comparison of the antinociceptive effects of voltage-activated Na+ channel blockers in two rat models of neuropathic pain. Eur J Pharmacol.2003;458(3):275-82.33. Mastronardi P, D'Onofrio M, Scanni E, Pinto M, Frontespezi S, Ceccarelli MG, et al. Analgesic activity of flupirtine maleate: a controlled double-blind study with diclofenac sodium in orthopaedics. J Int Med Res. 1988;16(5):338-48.34. McMahon FG, Arndt WF, Jr., Newton J J, Montgomery PA, Perhach JL. Clinical experience with flupirtine in the U.S. Postgrad Med J. 1987;63 Suppl 3:81-5.35. Perdigoto DN, Amaro P, Ferreira M, Tome L. Flupirtine drug-induced liver injury in a patient developing acute liver failure. BMJ Case Rep. 2018;2018.36. Konishi K, Fukami T, Ogiso T, Nakajima M. In vitro approach to elucidate the relevance of carboxylesterase 2 and N-acetyltransferase 2 to flupirtine-induced liver injury. Biochem Pharmacol. 2018;155:242-51.37. Chakrabarti S, Pattison LA, Doleschall B, Rickman RH, Blake H, Callejo G, et al. Intraarticular Adeno- Associated Virus Serotype AAV-PHP.S-Mediated Chemogenetic Targeting of Knee-Innervating Dorsal Root Ganglion Neurons Alleviates Inflammatory Pain in Mice. Arthritis Rheumatol. 2020;72(10):1749-58.38. Chan KY, Jang MJ, Yoo BB, Greenbaum A, Ravi N, Wu WL, et al. Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat Neurosci. 2017;20(8): 1172-9.39. Wu Y, Li J, Kong Y, Chen D, Liu B, Wang W. [HSV-1 based vector mediated IL-1 Ralpha gene for knee osteoarthritis in rabbits], Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2013;38(6):590-6.40. Oligino T, Poliani PL, Marconi P, Bender MA, Schmidt MC, Fink DJ, et al. In vivo transgene activation from an HSV-based gene therapy vector by GAL4:vp16. Gene Ther. 1996;3( 10):892-9.41. Lu Y, McNearney TA, Wilson SP, Yeomans DC, Westlund KN. Joint capsule treatment with enkephalin- encoding HSV-1 recombinant vector reduces inflammatory damage and behavioural sequelae in rat CFA monoarthritis. Eur J Neurosci. 2008;27(5):1153-65.42. Miyagawa Y, Marino P, Verlengia G, Uchida H, Goins WF, Yokota S, et al. Herpes simplex viral-vector design for efficient transduction of nonneuronal cells without cytotoxicity. Proc Natl Acad Sci U S A.2015;112(13):E1632-41.43. Miyagawa Y, Verlengia G, Reinhart B, Han F, Uchida H, Zucchini S, et al. Deletion of the Virion Host Shut-off Gene Enhances Neuronal-Selective Transgene Expression from an HSV Vector Lacking Functional IE Genes. Mol Ther Methods Clin Dev. 2017;6:79-90.44. Verlengia G, Miyagawa Y, Ingusci S, Cohen JB, Simonato M, Glorioso JC. Engineered HSV vector achieves safe long-term transgene expression in the central nervous system. Sci Rep. 2017;7(1 ): 1507.45. Mazzacurati L, Marzulli M, Reinhart B, Miyagawa Y, Uchida H, Goins WF, et al. Use of miRNA response sequences to block off-target replication and increase the safety of an unattenuated, glioblastoma-targeted oncolytic HSV. Mol Ther. 2015;23(1):99-107.46. LaBranche TP, Bendele AM, Omura BC, Gropp KE, Hurst SI, Bag! CM, et al. Nerve growth factor inhibition with tanezumab influences weight-bearing and subsequent cartilage damage in the rat medial meniscal tear model. Ann Rheum Dis. 2017;76(1 ):295-302.47. Goins WF, Huang S, Hall B, Marzulli M, Cohen JB, Glorioso JC. Engineering HSV-1 Vectors for Gene Therapy. Methods Mol Biol. 2020;2060:73-90.48. Goins WF, Huang S, Cohen JB, Glorioso JC. Engineering HSV-1 vectors for gene therapy. Methods Mol Biol. 2014;1144:63-79.49. Ozuer A, Wechuck JB, Russell B, Wolfe D, Goins WF, Glorioso JC, et al. Evaluation of infection parameters in the production of replication-defective HSV-1 viral vectors. Biotechnol Prog. 2002; 18(3):476-82.50. Wechuck JB, Ozuer A, Goins WF, Wolfe D, Oligino T, Glorioso JC, et al. Effect of temperature, medium composition, and cell passage on production of herpes-based viral vectors. Biotechnol Bioeng. 2002;79(1 ): 112-9.51. Lawson SN. Phenotype and Function of Somatic Primary Afferent Nociceptive Neurones with C-, Adelta- or Aalpha / beta-Fibres. Exp Physiol. 2002;87(2):239-44.52. Turkmen S, Guo G, Garshasbi M, Hoffmann K, Alshalah AJ, Mischung C, et al. CA8 mutations cause a novel syndrome characterized by ataxia and mild mental retardation with predisposition to quadrupedal gait. PLoS Genet. 2009;5(5):e1000487.53. Szymczak AL, Vignali DA. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 2005;5(5):627-38.54. Sarantopoulos CD, McCallum JB, Rigaud M, Fuchs A, Kwok WM, Hogan QH. Opposing effects of spinal nerve ligation on calcium-activated potassium currents in axotomized and adjacent mammalian primary afferent neurons. Brain Res. 2007;1132(1):84-99.55. Zheng Q, Fang D, Liu M, Cai J, Wan Y, Han JS, et al. Suppression of KCNQ / M (Kv7) potassium channels in dorsal root ganglion neurons contributes to the development of bone cancer pain in a rat model. Pain. 2013; 154(3):434-48.56. Okun A, Liu P, Davis P, Ren J, Remeniuk B, Brion T, et al. Afferent drive elicits ongoing pain in a model of advanced osteoarthritis. Pain. 2012; 153(4):924-33.57. Kawano T, Zoga V, Gemes G, McCallum JB, Wu HE, Pravdic D, et al. Suppressed Ca2+ / CaM / CaMKII- dependent K(ATP) channel activity in primary afferent neurons mediates hyperalgesia after axotomy. Proc Natl Acad Sci U S A. 2009; 106(21 ):8725-30.58. Selyanko AA, Brown DA. Regulation of M-type potassium channels in mammalian sympathetic neurons: action of intracellular calcium on single channel currents. Neuropharmacology. 1996;35(7):933-47.59. Marrion NV, Zucker RS, Marsh SJ, Adams PR. Modulation of M-current by intracellular Ca2+. Neuron. 1991;6(4):533-45.60. Brown DA, Passmore GM. Neural KCNQ (Kv7) channels. Br J Pharmacol. 2009; 156(8): 1185-95.61. Wang J J, Li Y. KCNQ potassium channels in sensory system and neural circuits. Acta Pharmacol Sin. 2016;37(1):25-33.62. Luebke JI, Chang YM. Effects of aging on the electrophysiological properties of layer 5 pyramidal cells in the monkey prefrontal cortex. Neuroscience. 2007; 150(3):556-62.63. Peters HC, Hu H, Pongs O, Storm JF, Isbrandt D. Conditional transgenic suppression of M channels in mouse brain reveals functions in neuronal excitability, resonance and behavior. Nat Neurosci. 2005;8(1 ):51 -60.64. Sanchez G, Rodriguez MJ, Pomata P, Rela L, Murer MG. Reduction of an afterhyperpolarization current increases excitability in striatal cholinergic interneurons in rat parkinsonism. J Neurosci. 2011 ;31 (17):6553-64.65. Greene DL, Hoshi N. Modulation of Kv7 channels and excitability in the brain. Cell Mol Life Sci.2017;74(3):495-508.66. Madison DV, Nicoll RA. Control of the repetitive discharge of rat CA 1 pyramidal neurones in vitro. J Physiol. 1984;354:319-31.67. Cisneros E, Roza C, Jackson N, Lopez-Garcia JA. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons. Front Cell Neurosci. 2015;9:470.68. Gu N, Vervaeke K, Hu H, Storm JF. Kv7 / KCNQ / M and HCN / h, but not KCa2 / SK channels, contribute to the somatic medium after-hyperpolarization and excitability control in CA1 hippocampal pyramidal cells. J Physiol. 2005;566(Pt 3):689-715.69. Storm JF. Potassium currents in hippocampal pyramidal cells. Prog Brain Res. 1990;83:161-87.70. Storm JF. An after-hyperpolarization of medium duration in rat hippocampal pyramidal cells. J Physiol. 1989;409:171-90.71. Stocker M, Krause M, Pedarzani P. An apamin-sensitive Ca2+-activated K+ current in hippocampal pyramidal neurons. Proc Natl Acad Sci U S A. 1999;96(8):4662-7.72. Neymotin SA, McDougal RA, Bulanova AS, Zeki M, Lakatos P, Terman D, et al. Calcium regulation of HCN channels supports persistent activity in a multiscale model of neocortex. Neuroscience. 2016;316:344-66.73. Wang HS, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, et al. KCNQ2 and KCNQ3 potassium channel subunits: molecular correlates of the M-channel. Science. 1998;282(5395): 1890-3.74. Wang HS, Brown BS, McKinnon D, Cohen IS. Molecular basis for differential sensitivity of KCNQ and l(Ks) channels to the cognitive enhancer XE991. Mol Pharmacol. 2000;57(6): 1218-23.75. Greene DL, Kang S, Hoshi N. XE991 and Linopirdine Are State-Dependent Inhibitors for Kv7 / KCNQ Channels that Favor Activated Single Subunits. J Pharmacol Exp Ther. 2017;362(1 ): 177-85.76. Hernandez CC, Zaika O, Tolstykh GP, Shapiro MS. Regulation of neural KCNQ channels: signalling pathways, structural motifs and functional implications. J Physiol. 2008;586(7): 1811-21.77. Zhong XZ, Harhun Ml, Olesen SP, Ohya S, Moffatt JD, Cole WC, et al. Participation of KCNQ (Kv7) potassium channels in myogenic control of cerebral arterial diameter. J Physiol. 2010;588(Pt 17):3277-93.78. Rasband MN, Park EW, Vanderah TW, Lai J, Porreca F, Trimmer JS. Distinct potassium channels on pain-sensing neurons. Proc Natl Acad Sci U S A. 2001 ;98(23): 13373-8.79. Fan L, Guan X, Wang W, Zhao JY, Zhang H, Tiwari V, et al. Impaired neuropathic pain and preserved acute pain in rats overexpressing voltage-gated potassium channel subunit Kv1.2 in primary afferent neurons. Mol Pain. 2014;10:8.80. Baronas VA, Yang RY, Morales LC, Sipione S, Kurata HT. Slc7a5 regulates Kv1.2 channels and modifies functional outcomes of epilepsy-linked channel mutations. Nat Commun. 2018;9(1 ):4417.81. Zhang J, Rong L, Shao J, Zhang Y, Liu Y, Zhao S, et al. Epigenetic restoration of voltage-gated potassium channel Kv1.2 alleviates nerve injury-induced neuropathic pain. J Neurochem. 2021 ; 156(3):367-78.82. Tanner GR, Lutas A, Martinez-Francois JR, Yellen G. Single K ATP channel opening in response to action potential firing in mouse dentate granule neurons. J Neurosci. 2011 ;31 (23):8689-96.83. Devaux J J, Kleopa KA, Cooper EC, Scherer SS. KCNQ2 is a nodal K+ channel. J Neurosci. 2004;24(5): 1236-44.84. Hu H, Vervaeke K, Storm JF. M-channels (Kv7 / KCNQ channels) that regulate synaptic integration, excitability, and spike pattern of CA1 pyramidal cells are located in the perisomatic region. J Neurosci. 2007;27(8): 1853-67.85. Gierasch WW, Zimmerman DL, Ward SL, Vanheyningen TK, Romine JD, Leib DA. Construction and characterization of bacterial artificial chromosomes containing HSV-1 strains 17 and KOS. J Virol Methods. 2006; 135(2): 197-206.86. Uchida H, Chan J, Goins WF, Grandi P, Kumagai I, Cohen JB, et al. A double mutation in glycoprotein gB compensates for ineffective gD-dependent initiation of herpes simplex virus type 1 infection. J Virol. 2010;84(23): 12200-9.Example 2 - vH CA8 produced opiod-like analgesia in an osteoarthritis animal model

[0193] Introduction

[0194] Chronic osteoarthritis (OA) pain, like most prevalent noncancer pain conditions, remains inadequately treated.4The impact of OA and other chronic pain disorders are enormous, costing the USA about $650 billion annually.5’6In the absence of suitable analgesic alternatives to treat chronic noncancer pain, an epidemic of opioid overuse, abuse, and life-threatening complications has occurred.7 12To address this unmet need, we set out to identify novel non-opioid analgesics to treat chronic OA pain. We discovered that dorsal root ganglia(DRG) carbonic anhydrase-8 (Car8, murine) expression regulates analgesic responses.13Car8 is an allosteric inhibitor of neuronal inositol trisphosphate receptor-1 (ITPR1 ). ITPR1 serves as a major endoplasmic reticulum (ER) calcium release channel, converting and amplifying inositol trisphosphate (IP3) responses into intracellular calcium signaling.14Car8 inhibits ITPR1 activation by phosphorylation (pITPRI ), which decreases ER calcium release and reduces cytoplasmic free calcium, essential to the regulation of neuronal excitability. We later showed that modified human carbonic anhydrase-8 (CA8*) retained the same functions, despite the significant variation in peptide sequence between species.1315-17To address the hypothesis that CA8* represents a novel non-opioid analgesic that could be delivered locally, we administered CA8* via sciatic nerve injection using adeno-associated virus-based (AAV) gene therapy to mice.15This AAV-CA8* gene therapy vector transduced mouse DRG after sciatic nerve injections to produce profound long-lasting analgesia (equivalent >100mg of oral morphine in 60kg adult for more than 4 weeks) and treated chronic pain in various models.1315’16’18Unlike current local anesthetics, CA8* related analgesia occurred without motor blockade, complete sensor loss, or clinical pathology.1315-17’19Despite the demonstrated fundamental role of CA8 in regulating intracellular calcium signaling, our understanding of how CA8 regulates neuronal excitability to produce analgesia remains unknown.

[0195] One potential mechanism is via opening of Kv7 voltage-gated potassium channels. Kv7 channels are activated by lower cytoplasmic calcium to produce M-currents (IM) through calmodulin-dependent and - independent mechanisms.20 24IM regulate neuronal excitability and produce analgesia by prolonging neuronal AHP, which restricts the firing of action potentials25 26and the propagation of afferent nociceptive signals. Previously, Kv7.2 and Kv7.3 phosphorylation sites were identified as critical to channel regulation by protein kinase A, protein kinase C, and src tyrosine kinase.27Using mass spectrometry, mutagenesis and electrophysiological studies, Surti et al, (2005) reported a mechanism of critical channel inhibition by specific phosphorylation of Kv7.2 at Threonine 217 and Kv7.3 at Threonine 246,27which are the most abundant Kv7 channel subunits in peripheral sensory neurons.27These sites are located within the S4 -S5 intracellular loop. Kv7 voltage-gated potassium channel openers (e.g., flupirtine, retigabine) are well-known to produce non-opioid- based analgesia in a variety of animal models and human chronic pain conditions.28 35However, despite their utility in treating various forms of chronic noncancer pain, all Kv7 channel openers were removed from the market due to adverse events related to their oral use and systemic exposure.35 36Nonetheless, Kv7 voltagegated potassium channels remain important therapeutic targets. Based on our findings, we conclude that Kv7 channel activation by CA8*- contributes to reduced neuronal excitability responsible for analgesia observed in animal models.

[0196] A major limitation of AAV strains used in our prior studies was their limited potential to transduce DRG neurons except after direct intra-neural injections.15’37 38In contrast, HSV-based gene therapy has the potential to transduce DRG neurons after IA KJ injections,39 41commonly used for short-term localized treatment of chronic OA KJ pain. Direct IA KJ route of administration is appealing because it is expected to greatly limit peripheral nervous system (PNS) exposure and potential toxicity related to gene therapy, as compared to intra-neural, direct DRG or systemic injections. Nonetheless, an important consideration regarding direct joint injections is thepreservation of joint cartilage.42The HSV gene therapy used in our current study is based on JDNI8, which are highly defective non-replicating viral vectors that are deleted for functional expression of all the viral immediate early (IE) genes.4345These replication defective (rd)HSV vectors provide an efficient delivery system to the PNS that selectively establishes natural lifelong latency within infected neurons following retrograde transport of viral particles to the nerve cell body in DRG. Together these viral modifications provide a non-cytotoxic disease-free vector capable of long-term episomal maintenance in sensory neuron somata with greater than six months of continued, robust transgene expression.45These viral vectors provide no viral antigen targets for immune effector cells, and consequently are much less likely to produce exaggerated immune responses observed with other gene therapy vectors.43’45

[0197] The primary goal of this study was to make use of this novel gene therapy system to test the hypothesis that vHCA8*WT vector delivery and expression of a human CA8* transgene as a CA8 peptide variant can treat neuronal hyperexcitability associated with chronic pain by producing long-lasting analgesia and antihyperalgesia in a well-known mouse OA model.46’50This OA model consists of direct IA KJ administration of MIA to induce prolonged painful mechanical allodynia.46Our results show disease-modifying analgesia following CA8* transgene expression in the relevant ganglia by several clinically relevant routes of administration, including the clinically preferred IA KJ injection. The mechanism of action is consistent with CA8* activation of the Kv7 voltagegated potassium channels and the specificity of the treatment was confirmed using negative controls and drug- mediated (XE-991 ) selective antagonism of Kv7 voltage-gated potassium channels in vitro and in vivo.

[0198] Materials and Methods

[0199] MIA-OA chronic complex pain model: The osteoarthritis (OA) persistent inflammatory pain model was generated by a single intra articular (I. a.) injection of 1 mg monosodium iodoacetate (MIA, Sigma, St. Louis, MO) in 10 pl saline into the left KJ cavity using a 50 pl micro syringe with a 30-gauge needle under anesthesia by intraperitoneal (i.p.) injection of ketamine, xylazine and acepromazine (VEDCO, Saint Joseph, MO). The mice were allowed to recover from the effect of anesthesia on the heating pad before being returned to their home cages.

[0200] Engineering of vHCA8*WT and vHCA8*MT viruses: The WT and MT vHCA8* contructs were made by digesting the HCA8*-AAV-MCS4650 plasmids both wild-type (WT) and mutant (MT),1574with Bglll enzyme (New England Biolabs).18Gibson Reaction (NEBuilder HIFI DNA Assembly, New England Biolabs, Ipswich, MA) was used to clone those Bglll fragments upstream of a PCR fragment of T2A-GFP sequence from a glycoprotein C (gC)-T2A-eGFP fusion plasmid75using the following primers: T2A-GFP-F: 5- 'CTCGGTCTCGATTCTACGGAGGGCAGAG-GAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAGAGAGCGACGAGAGCGGCCT-3' (SEQ ID NO: 41), GFP-R: 5'-AGGGATGCCACCCGTAGATCT-tta-GCGAGATCCG-GTGGAGCCGG-3' (SEQ ID NO: 42). The final products from the Gibson Reaction, pAAV-CAGp-hsCA8(WT)-V5-T2A-GFP and pAAV-CAGp- hsCA8(MT)-V5-T2A-GFP were then transferred as 3473-bp Notl-digested gel isolated bands into the Notl site of ccdB’ pENTER 1 A between the attL recombination sites to create the final products named pE-CAGp-hsCA8*(WT)-T2A-GFP and pE-OAGp-hsOA8*(MT)-T2A-GFP.43 5The LR gateway reaction using LR Clonase (ThermoFisher, Pittsburgh, PA) was used to insert the cassettes from these plasmids into JDNI8-GW41 BAG vector purified from HH8 bacteria.43Recombinants were screened by PGR across the GW cassette and confirmed by field inversion gel electrophoresis (FIGE) analysis (FIGE mapper, BioRad, Hercules, CA) of restriction enzyme digests of the recombinants.43

[0201] Preparation, purification, and authentication of vHCA8* virus particles: The JDNI8-CAGp-V5- CA8WT-T2A-GFP (SEQ ID NO: 45) (vHCA8*WT) or JDNI8-CAGp-V5-CA8MT-T2A-GFP (SEQ ID NO: 46) (vHCA8*MT) vectors were produced by transfection of U2OS-4 / 27 complementing cells with DNA purified from BAG preps for each of the vectors. Individual isolates were purified using limiting dilution analysis and then small virus stocks were used to infect Ore-expressing ICP4 / ICP27-complementing (U2OS-4 / 27-Cre) cells to eliminate the BAG sequences by Ore-mediated recombination.43 0Limiting dilution analyses were again performed and individual isolates lacking the BAG were identified by X-gal staining of individual plaques in 96-well plates (Thermo-Fisher, Pittsburgh, PA). Following BAG deletion, viral stocks were grown to high titer,707678and used to infect 1x 10-layer Cell Factory (Corning, Corning, NY) of U2OS-4 / 27 complementing cells at MCI=0.0005 in VP- SFM MEDIA (Thermo-Fisher, Pittsburgh, PA) for 1 -hr at 37°C in a CO2 incubator. On ~D8, the CFs displayed -90% CPE, and the next day NaCI was added to 0.45M, and the CFs rocked for 4-hr. Virus supernatant was harvested and processed by 0.8-micron ON filtration (Thermo-Fisher, Pittsburgh, PA) and subjected to centrifugation at 43,000xg for 45-90 min, followed by a dPBS wash and a second identical centrifugation step. The vector was finally resuspended in dPBS with sterile glycerol added to a final volume of 10%, and the virus was vialed in 1 Opil (actual volume 12.5pil) aliquots in cryovials and stored at -80°C. The overall titers were determined by standard plaque assay on U2OS-4 / 27 complementing cells.70Aliquots of 1 Opil were used for QA / QC testing, and expression / toxicity in primary rat DRGs. Toxicity was assessed by MTT assay that showed the vHCA8*WT vector was like the vHCA8*MT control vector on primary rat DRG or mock-infected DRG.

[0202] Virus transduction of DRG cell culture: DRGs were micro-dissected from 2-week-old rats, dissociated with 3 mg / mL type-l collagenase (Sigma, St. Louis, MO) in Leibovitz's L-15 media (Thermo-Fisher, Pittsburgh, PA) for 30 min at 37°C with constant shaking, and plated on poly-D-lysine (Sigma) laminin-coated coverslips at ~105cells per well in 24-well plates (Thermo-Fisher, Pittsburgh, PA) in 500 pL of defined Neurobasal medium with B27 supplement, Glutamax-I, Albumax-I I, and P / S (Gibco / I nvitrogen / Thermo-Fisher), supplemented with 100 ng / mL 7. OS NGF (Sigma). At 1-3 d post-plating, cultures were treated with 10 pM uridine and 10 pM fluorodeoxyuridine (Sigma) in the above media for 1-2 d to limit the expansion of dividing cells, such as fibroblasts and glia. Cells were then washed with PBS and incubated with NGF-supplemented Neurobasal medium as above. Virus infections were performed at D1 after plating at an apparent MOI of 5.0. Cell lysates were harvested as described elsewhere,43and western blots were probed with antibodies to CA8, V5, or p-actin (Abeam, Waltham, MA).

[0203] HSV virus delivery: Three days later after MIA injection, male mice were anesthetized by intraperitoneal (i.p.) injection of ketamine, xylazine and acepromazine. vHCA8*WT or vHCA8*MT viral particles(10 pl of 1.4E8 PFU / mL or 1.4E6 total particles) were injected into the KJ or RFP using a 50 uL microsyringe with a 30-gauge needle. SN injections of viral particles (1.5 pL of 1.4E8 PFU / mL or 2.1 E5 total particles) were made using a 35-gauge needle NanoFil syringe (World Precision Instruments, Sarasota, FL). The injection site was ~45 mm from the tip of the third toe. The needle remained at the injection site for one additional minute, before it was slowly removed to prevent leakage from the needle track.

[0204] Immunohistochemistry: After 14 days survival times, mice were terminally anesthetized with isoflurane and perfused through the ascending aorta with saline followed by 4% paraformaldehyde (JT Baker, Fisher Scientific) with 1.5% picric acid in 0.16 M PB (pH 7.2-7.4, 4°C). After the perfusion, the L4-5 DRGs were removed and post-fixed in the same fixative for 2-4 h, then replaced with 20% sucrose overnight. DRG sections (16 pm) were cut in a cryostat and processed for immunofluorescence.79All the sections were blocked with 2% donkey serum in 0.3% Triton X-100 for 1.5h at RT and incubated overnight at 4°C with anti-V5 (lnvitrogen)(specifically for exogenous CA8* expression, anti-chicken, 1 :5000, Abeam), anti-CA8 (Santa Cruz, Santa Cruz, CA), anti-pKv7.2-7.3 (Rabbit, Biorbyt), anti-Kv7.2 (Guinea pig, Alomone), anti-pKv7.3 (Rabbit, Biorbyt), anti-Kv7.3 (Goat, MyBiosorce or Rabbit, Alomone), anti-vinculin and b-tubulin (Abeam), or anti-p-actin (Sigma). The sections were then incubated for 1h at RT with Alexa Fluor 488-AffiniPure donkey anti-chicken secondary antibody (1 :1000, Jackson ImmunoResearch lab). For double immunofluorescence, sections were incubated with a mixture of chicken V5 and Rb advillin (sensory neuronal marker, 1 :500, Abeam), Rb TrkA (NGF receptor, 1 :100, Abeam), overnight at 4°C, followed by a mixture of Alexa Fluor 488- and 594-AffiniPure donkey secondary antibodies for 1h at RT. The stained sections were captured with a Leica fluorescence microscope. All DRG sections after IHC staining were analyzed using ImageJ v1.54 for colocalization and quantification. Data were analyzed using SPSS.

[0205] Cell culture: SH-SY5Y cells were purchased from ATCC (CRL-2266) and were cultured in a 1 :1 mix of DMEM and F12 with 1% glutamax, 1% penicillin-streptomycin, 10% FBS (Invitrogen). Cells were seeded in 6- well plates with a cell density of 1 x 105per well. On D1, 10 pM retinoic acid (RA, Fisher Scientific) was added to the media to differentiate SH-SY5Y cells, and the media was changed every 48 h. until D9. On D6, vHCA8 virus was loaded in cultures at a dose of MOI = 3. After the application of 10 pM XE-991 to the culture media (20 minutes) on D9 to cells differentiated with RA, cell cultures were collected for protein extraction with RIPA buffer plus proteinase inhibitor and phosphatase inhibitors. Western blotting was used to evaluate protein levels of exogenous CA8*, endogenous pKv7, and Kv7. DMSO was used as a vehicle control.

[0206] Western blotting: SH-SY5Y cultures were homogenized after various treatments in RIPA buffer with a mixture of proteinase and phosphatase inhibitors. Protein samples were generally separated on 4-15% SDS polyacrylamide gels and transferred to PVDF membranes. Western blots were prepared, handled, and analyzed essentially as presented elsewhere80using anti-CA8 (Santa Cruz, Santa Cruz, CA), anti-V5 (Invitrogen), anti- pKv7.2-7.3 (Rabbit, Biorbyt), anti-Kv7.2 (Guinea pig, Alomone), anti-pKv7.3 (Rabbit, Biorbyt), anti-Kv7.3 (Goat, MyBiosorce or Rabbit, Alomone), anti-vinculin and b-tubulin (Abeam), or anti-p-actin (Sigma). Density analysiswas performed using UN-SCAN-IT, standardized to p-tubulin, p-actin, or vinculin, and a one-way analysis of variance (ANOVA) was used for statistical analysis.

[0207] Pain behavior analysis: Animals were habituated to the testing environment daily for 4 consecutive days, and Baseline collected on D5. The room temperature and humidity remained stable for all experiments. For testing mechanical sensitivity, animals were put under inverted round plastic box (Radius: 9 cm, Height: 11 cm) on an elevated metal mesh floor and allowed 60 min for habituation before the threshold test. The plantar surface of each hind paw was stimulated with a series of von Frey hairs (from 0.4 to 6 g). The threshold was taken as the lowest force that evoked a consistent brisk withdrawal response.1380The test was performed once a day in the first week after MIA, once every other day in the 2nd week then twice a week. The Baseline was established just prior MIA injection. The up-down method was used to calculate 50% mechanical thresholds.1381All testing was performed by a trained investigator masked to treatment groups.

[0208] Motor function was assessed using weight-bearing and automated voluntary wheel running distance: Weight-bearing distribution between the left (MIA) and right (contralateral) hind limbs were tested by the Librae Incapacitance Tester (Ugo Basile) in mice after various treatments. Data are presented as the percentage of weight distributed on the left hindlimb calculated by the formula: [weight on the left hindlimb / (weight on the left + weight on the right)] x 100. Measurements were performed before and after KJ I A MIA injection and compared with vHCA8* and with and without XE-991 administration.82

[0209] Automated voluntary wheel running was assessed using stainless-steel activity wheels designed for mice (diameter 23 cm; width 5 cm) with ball-bearing axles in clear polycarbonate cages (20.5 cm wide x 36.5 cm long x 14 cm high)(Bioseb) were used to measure spontaneous motor activity in mice. The wheels could be turned in either direction. Multiple activity cages were contained within a testing room. The wheels were connected to a computer that automatically recorded the distance run by each mouse in the wheel during 1 -hour evaluation sessions at approximately the same time of day. Mice were habituated in individual home cages for 1 session each day for 4 days. The Baseline was collected one day after the last habituation session. Mice that ran less than 275m during Baseline measurements were removed from further evaluation. After the Baseline was obtained, the left KJ was injected with MIA (monosodium iodoacetate) to induce chronic OA pain or with saline as a control. vHCA8*WT virus was injected into the same KJ 3 days after MIA delivery. vHCA8*MT was used as a negative treatment control.51

[0210] Quantification and Statistics: To quantify immunoreactive staining of V5 for exogenous CA8, advillin, TrkA, pKv7 and Kv7 expression in the DRG, the percentages of positive neurons in the L5 and L4 DRG from four non-adjacent sections were determined as described previously.13Briefly, the DRGs were serially sectioned at 16pm. The percentage of positive DRG neurons was estimated by calculating the average total number of V5-positive cells divided by the total number of NeuN-positive cells from three to four sections of each animal. Results represent three to four mice in each group. Quantitative evaluations were made by an investigator masked to the arrangement of DRG sections analyzed. Groups were compared using Student's t- test, or ANOVA, followed by Fisher's protected least significant difference test, and data presented as mean ±SEM. The criterion for statistical significance was P<0.05. The sample size was N = 8-to-10 per group for all in vivo behavior experiments. IBM SPSS Statistics version 29 was used to calculate the significance between groups at each time point, incorporating a Fisher's LSD test. The number of mice used per assay group was based on power analyses using the observed variation in prior AAV8-CA8 assays.13We estimated that N = 8 animals per group would provide 95% power at P=0.05. No animals were excluded in our analyses.

[0211] Results

[0212] vHCA8* Transduced Lumbar DRG Neurons Via Different Routes of Administration

[0213] For these studies, we created JDNI8-CAGp-CA8WT-V5-T2A-GFP (SEQ ID NO: 45) (vHCA8*WT) and JDNI8-CAGp-CA8MT-V5-T2A-GFP (SEQ ID NO: 46) (vHCA8*MT) constructs containing the wildtype CA8-201 (WT) and CA8 mutant (MT)(CA8-201 with S100P null point mutation51) cDNAs modified with a V5 tag. The CA8*MT represents a rigorous negative control because this vector and transgene are identical in every way to vHCA8*WT except for this point mutation that produces a nearly complete loss of CA8* cellular protein associated with rapid proteasome-mediated degradation.51The vHCA8*WT vector is depicted in Figure 19. These transgenes were inserted downstream of the CAG promoter (C cytomegalovirus early enhancer element; A the promoter region, first exon and the first intron of the chicken beta-Actin gene; and G the splice acceptor of the rabbit beta-Globin gene) that is known to be active in a broad array of cell types including neurons.15To verify that the vectors produce the proper sized CA8* protein product in DRG neurons in culture, vector-infected DRG cell lysates harvested 2-days post-infection were employed in western blot analyses using the CA8 and V5 tag antibodies (data not shown). We demonstrated that the vHCA8*WT vector yielded high levels of the correct sized CA8* product detected with both antibodies, while the vHCA8*MT negative control vector expressed greatly reduced levels of the CA8* protein in comparison to the B-acti n loading control, similar to that seen previously with the AAV-CA8*WT and -MT vectors.15

[0214] To directly compare the ability of our HSV constructs to transduce DRG neurons in vivo using different clinically relevant routes of administration, we examined DRG expression using V5-immunohistochemistry (IHC). D14 after injections with vHCA8*WT or vHCA8*MT using the IA KJ, sciatic nerve (SN), or rear footpad (RFP) routes of delivery, L4 and L5 DRG were collected. Fig. 5 shows exogenous DRG expression of V5-tagged CA8 (see Fig. 5A-C; I). At D14 after vHCA8*WT injection -40% of ipsilateral lumbar 4 and 5 DRG (L4 / L5) neurons are V5-positive (identifying only exogenous CA8) in the CA8*WT group. CA8*WT expression was higher in DRG after SN injections (47.3 ± 4.1%), compared to KJ (35 ± 3.2%) or RFP (39.1 ± 3.7%) (Fig. 5I). In contrast, less than 5% of neurons were V5-positive in the ipsilateral DRG after injections with vHCA8*MT (Fig. 5G; 5I). There were no V5 positive neurons observed from contralateral lumbar DRG (Fig. 5H), again demonstrating the lack of replication seen when using these rdHSV vectors.

[0215] Remarkably, despite the CAG promoter used, which expresses in all cells, CA8*WT (exogenous CA8*) expression co-localized largely with somatosensory DRG neurons as ascertained with double IHC staining. After KJ injections DRG CA8*WT expression showed co-localization of V5- with advillin-positiveneurons (a marker for pan-sensory neurons) (Fig. 6 A-C), or V5- and TrkA-positive DRG neurons (generally small sensory neurons expressing the high-affinity NGF receptor)(Fig. 6 G-l). DRG CA8*WT neuronal expression after SN injections also showed co-localization of V5- and advillin-positive neurons (Fig. 6 D-F), or V5- and TrkA- positive DRG neurons (Fig. 6 J-L).

[0216] Dose-Dependent vHCA8* Reversal of MIA-lnduced Weight-Bearing Reduction

[0217] IA left KJ injection of 1 mg of MIA induced a significant reduction in weight-bearing in all groups starting from D1 as assessed as weight in grams of ipsilateral (treated) limb / weight of ipsilateral (treated) + weight of contralateral limb (untreated control). Three days after IA KJ MIA injection, the ipsilateral KJ was again injected with either vHCA8*WT at one of two doses, high-dose (HD, 1 E6 PFU; or mid-dose (MD, 1 E5 PFU) or high-dose vHCA8*MT (HD, 1 E6 PFU) (Fig. 7). After the initial drop, weight-bearing significantly improved as compared to vHCA8*MT-HD treated mice, when treated with vHCA8*WT-HD starting D27 and D34 in mice treated with vHCA8*WT-MD and persisted to D65 in both groups. These weight-bearing improvements corresponded with anti-hyperalgesia and analgesia (increase above Baseline in mechanical withdrawal thresholds in the vHCA8*WT-HD groups (Fig. 8). Data were analyzed for statistical significance between different time points for each group, as compared to Baseline, by one-way analysis of variance (ANOVA) followed by Fisher's LSD post-hoc test. Repeated measures two-way ANOVA analyses found significant differences in weight distribution between left (OA) and right (contralateral controls) hind limbs across all time points [F(14, 196)=9.637, P=3.898E-16], But there were no significant differences between groups [F(1, 14)=139.24, P=0.745], There were also no significant interactions between time points and groups [F(14, 196)=0.803, P=0.666],

[0218] Additional studies were run to test the impact of I A KJ MIA treatment on voluntary activity as assessed with AVWR (Automated Voluntary Wheel Running) in male C57BL / 6 mice. Baseline voluntary wheel running behaviors were collected for one hour of free access to the activity wheel after 4 habituation sessions. I A KJ injection of 1 mg of MIA induced a significant reduction in voluntary wheel running. Three days after IA KJ MIA injection, the ipsilateral KJ was again injected with either vHCA8*WT (HD 1 E6 PFU) or vHCA8*MT (HD 1 E6 PFU). After the initial drop in both groups, voluntary wheel running distance improved in vHCA8*WT-HD as compared to vHCA8*MT on D9-D11, with both groups improving to Baseline by D13.

[0219] Dose-Dependent vHCA8* Analgesia and Reversal of MIA-lnduced Hyperalgesia After Knee Joint Injection

[0220] Three days after left KJ MIA administration, the KJ was again injected with either vHCA8*WT or vHCA8*MT (negative control). Mechanical thresholds in the IA KJ injected vHCA8*WT dose groups were significantly higher than those in the vHCA8*MT-HD group starting on D10 (Figure 8). Mechanical thresholds for the IA KJ injected vHCA8*MT-HD group never returned to the Baseline through D65. In contrast, the vHCA8*WT- HD treated group was significantly higher than vHCA8*MT HD negative controls and exceeded Baseline (analgesia) after D20, which persisted to D65. Mechanical thresholds in the vHCA8*WT-MD (1 E5 PFU) treatedgroup were significantly higher than vHCA8*MT-HD after D 10 but only exceeded Baseline (analgesia) after D58. Data were analyzed for statistical significance between different time points for each group, as compared to Baseline, by one-way analysis of variance (ANOVA) followed by Fisher's least significance difference (LSD) post- hoc test. Repeated measures two-way ANOVA found significant differences in mechanical thresholds between groups [F(2,27)=146.5, P=3.19E-15] and across all time points [F(18,486)=10.94, P=2.25E-26], There were also significant differences in interactions between time points and groups [F(36,486)=3.16, P=8.61E-09],

[0221] Kv7 Specific Inhibitor XE-991 Reversed vHCA8* Analgesia

[0222] The effects of the Kv7-specific antagonist XE-991 on vHCA8*WT analgesia in naive mice are shown in Fig. 9A and 9B. XE-991 reduced mechanical thresholds in a time- and dose-dependent fashion in naive mice compared to Baseline (pre-treatment) or vehicle control (Fig. 9A). Mechanical thresholds returned to Baseline in approximately 2 hours after intraperitoneal (IP) administration of XE-991 low-dose groups (e.g., 2 and 5 mg / kg)(data Fig. 9A). In separate experiments, mechanical thresholds increased above baseline (analgesia) on D16 after IA KJ injection of vHCA8*WT, but vHCA8*MT had no effect (Fig. 9B). Mechanical thresholds returned to Baseline at 30 minutes after IP after IP administration of XE-991 (5 mg / kg). These data are consistent with vHCA8*WT-induced analgesia and anti-hyperalgesia being mediated selectively by Kv7 channel activation.

[0223] Reduction of DRG pKv7 by IA KJ Injections of vHCA8*WT

[0224] To explore whether vHCA8* affects in vivo Kv7 channel activity, which is negatively regulated by channel phosphorylation,27vHCA8* was injected into the left KJ and on D14 DRG samples were collected and analyzed using immunofluorescence. Representative IHC sections stained for V5, pKv7.2-7.5, pKv7.3, Kv7.2, and Kv7.3 are shown in Figs. 10 and 11. The percentage of pKv7-positive cells were normalized to NeuN-, Kv7.2-, or Kv7.3-positive neurons (ratios)(Fig. 10 and 11). DRG V5 expression (exogenous CA8*) was barely detectable after vHCA8*MT injections (Fig. 10A, 11 A). For the vHCA8*MT IA KJ treated group, DRG pKv7.2- 7.5 / Kv7.2 (Fig. 10 A-D, and 10O) and DRG pKv7.3 / Kv7.3 (Fig. 7 A-D and 70) did not differ from naive animals (Fig. 101-L and 10O, and Fig. 111-L and 110, respectively). After vHCA8*WT KJ injection, the ratio of DRG pKv7.2-7.5 / NeuN and pKv7.2-5 / Kv7.2 and pKv7.3 / NeuN and pKv7.3 / Kv7.3 were significantly reduced, as compared to after treatment with vHCA8*MT negative control or naive mice (Fig. 10E-H, 10M, and 100, 11 E-H, 11 M, and 110, respectively). DRG Kv7.2 / NeuN and Kv7.3 / NeuN were unaffected by vHCA8*WT or vHCA8*MT (Fig. 10N and 10O, and 11 N and 110, respectively), demonstrating rdHSV infection had no significant impact on Kv7 channel expression. About 35% of DRG neurons were V5-positive after vHCA8*WT treatment (Fig. 10E and 10O, and Fig. 11 E and 11O)(V5 tag was fused to CA8 C-terminal region).

[0225] vHCA8*WT Reversed XE-991 Stimulated pKv7 in Differentiated SH-SY5Y Cells

[0226] SH-SY5Y cells after RA differentiation expressed high levels of CA8*WT peptide (using V5-tag) on western blots after infection with vHCA8*WT, as compared to CA8*MT (V5-tag) after vHCA8*MT infection, or vehicle control at Baseline. The expression of Kv7 voltage-gated potassium channels in SH-SY5Y cells differed in response to retinoic acid (RA) differentiation. Kv7.2 expression increased with RA differentiation through D9,while Kv7.3 expression peaked about D4. Kv7.5 expression decreased with RA differentiation and was not studied in SH-SY5Y cells, any further. Because both Kv7.2 and Kv7.3 subunits are prominently expressed in DRG small sensory fibers,52we focused our further analyses on Kv7.2 and Kv7.3 channels in SH-SY5Y on D9 after RA-differentiated.

[0227] Treatment of SH-SY5Y cells with XE-991 (1-10 mM) produced a dose-dependent increase of pKv7.2- 7.5 (Fig. 8A) as detected using western blotting. SH-SY5Y cells were infected with vHCA8*WT or vHCA8*MT on RA D6. On RA D9, the cells were treated with 10 mM XE-991 for 20 minutes, which induced a significant increase in pKv7.2-7.5 and pKv7.3 in control and vehicle-treated cells (Fig. 12A and 12B). XE-991 (10 mM), as compared to vHCA8*MT, PBS, or DMSO control treatments (Fig. 12A and 12B). Phosphorylation (inactivation) of Kv7.2-7.5 induced by XE-991 treatment was inhibited by vHCA8*WT, but not vHCA8*MT pretreatment.

[0228] These data are consistent with CA8*WT-mediated activation of Kv7.2-7.5 channels. However, these data are derived from optimized conditions using differentiated neuron-like cells that naturally express Kv7 voltage-gated potassium channels at low levels. Despite optimal conditions, these cells only show a small drop in pKv7 (activation).

[0229] Discussion

[0230] The data provided in this Example demonstrates that:

[0231] (1) DRG transduction of primary afferent neurons with rdHSV-based vHCA8*WT gene therapy using IHC after intra-articular KJ route of vector delivery (Figs. 5 and 6). Double IHC staining using the V5-tag for exogenous CA8*WT showed selective vHCA8*WT uptake by DRG somatosensory neurons (advillin -90%) and (TrkA ~60%)(Fig. 6), but minimal CA8 expression after vHCA8MT (negative control) administration on the ipsilateral side (Fig. 6). There was no CA8*WT expression detected in contralateral lumbar DRGs, confirming these vectors are incapable of viral replication and spread following peripheral injection. Moreover, despite the GAG promoter used, only sensory neurons (e.g., overlap with advillin staining) appeared to express CA8* ex vivo (Fig. 6A-6C); and these were largely smaller TrkA expressing primary afferents (Fig. 6G-6I).

[0232] (2) KJ injections of vHCA8*WT virus treated chronic MIA-induced OA mechanical pain with increased mechanical thresholds as compared to vHCA8*MT negative controls by D9 post-MIA (D6 after virus injection), returned to Baseline mechanical thresholds of 1.71g by D13 post-MIA; and exceeded Baseline (analgesia) by D20 post-MIA. Mechanical thresholds achieved a maximum of 2.74 g at D56, representing significant analgesia in morphine milligram equivalents.17

[0233] (3) Motor functions were assessed by weight-bearing after MIA-induced chronic OA pain. KJ injections of vHCA8*WT virus reversed the chronic MIA-induced OA reduction in the ipsilateral lower extremity weightbearing, in a dose- and time-dependent fashion. Weight-bearing increased in mice treated with vHCA8*WT-HD and vHCA8*WT-MD on D27 and D34, respectively, as compared to mice treated with vHCA8*MT-HD. There was a difference in weight distribution between left (OA) and right (contralateral control) hind limbs across all timepoints [F(14, 196)=9.637, P=3.898E-16] using repeated measures two-way ANOVA. Voluntary motor functions were further assessed by automated voluntary wheel running that was suppressed for 10 days (D13-post MIA), which was a significantly shorter period as compared to mechanical hypersensitivity following MIA treatment and OA chronic pain. Voluntary wheel running distance was less impacted after vHCA8*WT as compared to controls, and wheel running distance was restored to Baseline levels by D13, indicating no significant or lasting impact on motor function from vHCA8* treatments.

[0234] (4) Parenteral administration of specific Kv7 channel inhibitor XE-991 inhibited vHCA8*WT analgesia and anti-hyperalgesia, similar to data reported by Teng et al (2016)(Fig. 9A and 9B).53These results suggest that vHCA8*WT mediates analgesia via decreased primary afferent excitability and reduced trafficking of nociceptive signals to the CNS associated with Kv7 channel activation that can be reversed by XE-991.

[0235] (5) We also show that I A KJ injection of vHCA8*WT is associated with reduced DRG pKv7.2-5 / Kv7.2 and pKv7.3 / Kv7.3 as compared to vHCA8*MT treatment in this MIA-induced chronic OA pain model (Fig. 10 and 11).

[0236] (6) Finally, we show that XE-991 -induced phosphorylation (inactivation) of Kv7 voltage-gated potassium channels was inhibited (channel activation) by vHCA8*WT pretreatment in differentiated SH-SY5Y cells, for Kv7.2-7.5 and less so Kv7.3 channels. Specifically at threoni ne-246, whereas vHCA8*MT treatment produced no anti-hyperalgesia, analgesia (Figs 7 and 8), and had no effect on activation by Kv7.3 dephosphorylation (Figs. 10, 11 and 12).

[0237] Kv7 Voltage-Gated Potassium Channels Mediate vHCA8* Analgesia and Anti-hyperalgesia.

[0238] Kv7 voltage-gated potassium channels provide a mechanistically plausible link between reduced cytosolic free calcium, conferred by vHCA8*WT, and the resulting analgesia observed (Figs. 7 and 8).13’15’19KCNQ genes (KCNQ-2, -3 and-5) encode transmembrane channel proteins (Kv7.2, Kv7.3, and Kv7.5) that are known to be widely expressed as tissue-specific heterotetramers in nociceptive DRG neurons.52Explicit evidence shows MIA-induced chronic OA pain is maintained by primary afferents in rodent models, strongly supporting our targeting primary afferent pain fibers with localized vHCA8*WT treatment which acts as a Kv7 activator47and suppressor of neuronal excitability Figs. 7-9).

[0239] All other K+channels involved in attenuating neuronal excitability such as the calcium-activated K+channes54or the ATP-sensitive K+channels55are activated by elevated cytosolic Ca2+, this is not the case with Kv7 channels. Kv7 voltage-gated potassium channels are uniquely activated instead by lower cytosolic Ca2+producing M-currents (IM) and reducing neuronal excitability.20’56’57IM exert a stabilizing effect on neuronal excitability,58’59It is also well-established that virtually all DRG neurons express Kv7 ‘M'-currents and immunoreactivity.29Fig. 6N and 7N show colocalization of Kv7.2 and Kv7.3 with neuronal marker (NeuN) confirming DRG neurons express these particular channels, Kv7 voltage-gated potassium channels implicated in M-current production in sensory neurons.60

[0240] These findings are highly relevant to chronic pain management because Kv7 activating therapies are highly valuable non-opioid analgesics; no available Kv7 activators are currently available for clinical use.3536Our proposed rdHSV-based vHCA8*WT gene therapy may provide a reasonable, more efficacious, and potentially safer localized target-specific alternative to opioids for clinical analgesia and anti-hyperalgesia.

[0241] Great Unmet Need for Non-Opioid Analgesics to Treat OA.

[0242] Chronic non-cancer pain is common among our population and most of these patients are inadequately treated making the development of safer analgesics is a high priority. In the absence of alternatives, long-term opioid use in treating chronic non-cancer pain has increased dramatically over the past few decades, and opioid abuse, tolerance and dependence are major public health concerns.8 12In the United States, prescription opioid abuse costs alone were estimated at about $55.7 billion in 2007. Almost half this cost was attributed to lost workplace productivity, 45% to healthcare costs (e.g., abuse treatment), and 9% to criminal justice costs.61Knee OA is one of the primary causes of chronic pain, disability and increased mortality worldwide.1-3OA pain is a major contributor to loss of quality-adjusted life-years and addressing pain and the related disability may reduce the increased mortality attributed to lower extremity OA.23Not surprisingly, the high disease burden of chronic lower extremity OA is accompanied by frequent opioid prescriptions.62

[0243] Monosodium lodoacetate OA Preclinical Model Relevance

[0244] The MIA OA model produces intra-articular loss of cartilage, joint space narrowing associated with decreased weight-bearing and chronic pain,47 50pain-depressed wheel running and mechanical hyperalgesia in rodents, providing a useful preclinical behavioral assessment of chronic pain.47"50However, while weight-bearing and automated voluntary wheel running (AVWR) may only be sensitive to nonsteroidal anti-inflammatory therapeutics during the early inflammatory period which is expected through D14, we show dose-dependent improvement after vHCA8*WT treatment through D65.63Indeed, automated VWR was impacted primarily during the first two weeks after vHCA8*WT and not at all by vHCA8*MT exposure. This neurobehavioral response confirmed the maintenance of motor function but appeared to be less useful in monitoring analgesic responses, as compared to weight-bearing (Fig. 7), and mechanically-evoked neuropathic pain in our study and studies published by others.6364Systemic diclofenac treatment of MIA-induced chronic pain in animals reduces their chronic pain and improves their function short-term. Diclofenac and celecoxib can be beneficial early in the treatment of some patients with OA. These medications represent weak Kv7 channel activators.6566The analgesia these specific medications provide could be at least partially independent of cyclooxygenase (COX) inhibition but instead may require Kv7 channel activation.65The critical importance of targeting Kv7 activation in primary sensory afferents in chronic OA pain is demonstrated by the dramatic short-term improvement in OA pain and function after localized intra-articular lidocaine administration.47’50

[0245] Advantages of the JDNI8 rdHSV For PNS Gene Delivery

[0246] Latent HSV viral genomes are present as circular episomal double-stranded DNA molecules in a non- replicative state and do not express viral proteins but rather a latency-related non-coding RNA referred to as theLAT transcript.6768During latency, HSV-infected neurons remain unharmed by the presence of the extrachromosomal, circularized, unintegrated viral genome that is shielded from immune clearance.69Wild-type HSV possesses the ability to reactivate from the latent state, wherein the virus begins to enter into its lytic virus replicative cycle, produces progeny virus particles that undergo anterograde transport back down the afferent fibers back to the region of the initial infection, where virus replication and the host immune response can lead to the formation of the characteristic herpes lesions.

[0247] Herein we exploit this novel HSV-based intracellular gene delivery system that takes advantage of the natural tropism of HSV for sensory nerves. The most advanced version of this vector system used herein is called JDNI8. JDNI8 is also deleted for the host shut-off gene (UL41), which further reduces toxicity and helps provide for long-term transgene expression. The vector is further deleted for the reiterated internal joint sequences (14kb) flanking the unique long (UL) and short (Us) genome sequences that, together with the immediate-early (IE) gene deletions, create a vector with substantial packaging capacity (40kb,) and the ability to accommodate large or multi-transgene payloads.43The infectivity of JDNI8 is enhanced by a double mutation in the fusion / entry envelop glycoprotein B (gB N / T). As a consequence, JDNI8 is a highly defective non-replicating form of HSV that is deleted for functional expression of all the viral IE genes.4345The absence of IE gene activity prevents expression of the cascade of viral genes and thus the HSV genome is silent.43This rdHSV is completely lacking in the ability to replicate, cause disease, harm neuronal cells or spread to others. When injected into the skin, the JDNI8 vector undergoes retrograde axonal transport to the nerve cell body in a manner like that seen with wild-type virus and persists in the cell nucleus in a latent-like state but is never able to reactivate, regrow or induce the reactivation of potentially resident latent wild-type virus. JDNI8 requires specialized cells engineered to express the essential IE gene products in trans-on-demand for vector production consistent with a complete lack of replication.43’70In non-complementing cells, the virus genome is silent except for the engineered transgene cassette when introduced into loci (e.g., ICP4, LAT) flanked by natural viral insulator elements to selectively maintain a localized active chromatin state within the transgene locus. This latest-generation gene therapy vector represents a major advance in the intracellular delivery of biotherapeutics like CA8*.

[0248] Clinically Relevant Intra-Articular Route of Local Administration is Comparable to Other Routes of Vector Administration

[0249] We show three routes of administration, including intra-dermal (RFP), intra-neural (SN), and intraarticular knee joint (KJ) injection, are comparable in transducing relevant DRG primary afferent neurons, providing evidence for the use of vHCA8* as a potential long-acting local analgesic. Localized administration of vHCA8*WT as a Kv7 activator using the intra-articular route provides several important advantages over parenteral routes. The intra-articular route is the customary, less invasive and a clinically favored route, while potentially reducing the risk of inadvertent exposure of tissues that will not contribute to the site of MIA-induced arthritis or may lead to off-target effects that could create safety concerns.71For example, intraneural and intradermal injections could potentially impact a much larger number of lower extremity sensory neurons unrelated to pain transmission, causing unwanted and unintended side effects. While DRG transduction by AAV is generallyknown to be inefficient when injected in a joint, we show robust DRG transduction for intra-articular injections of this rdHSV vector.

[0250] Summary

[0251] These data provide a strong preclinical proof-of-concept for this JDNI8-rdHSV-based CA8* gene therapy as a ‘chronic pain disease-modifying' long-acting local analgesic. This pathway appears to provide profound, prolonged, safe analgesia and anti-hyperalgesia in this MIA-induced chronic OA pain model using the clinically relevant minimally invasive localized intra-articular route of administration.

[0252] References for Example 21. Vitaloni M, Botto-van Bemden A, Sciortino Contreras RM, et al. Global management of patients with knee osteoarthritis begins with quality of life assessment: a systematic review. BMC Musculoskelet Disord 2019;20(1):493. DOI: 10.1186 / s12891-019-2895-3.2. Cleveland RJ, Alvarez C, Schwartz TA, et al. The impact of painful knee osteoarthritis on mortality: a community-based cohort study with over 24 years of follow-up. Osteoarthritis Cartilage 2019;27(4):593- 602. DOI: 10.1016 / j.joca.2018.12.008.3. Cleveland RJ, Nelson AE, Callahan LF. Knee and hip osteoarthritis as predictors of premature death: a review of the evidence. Clin Exp Rheumatol 2019;37 Suppl 120(5):24-30.4. Relieving Pain in America: A Blueprint for Transforming Prevention, Care, Education, and Research. Washington (DC)2011.5. Busse JW, Wang L, Kamaleldin M, et al. Opioids for Chronic Noncancer Pain: A Systematic Review and Meta-analysis. JAMA 2018;320(23):2448-2460. DOI: 10.1001 / jama.2018.18472.6. McNicol ED, Midbari A, Eisenberg E. Opioids for neuropathic pain. Cochrane Database Syst Rev 2013(8):CD006146. DOI: 10.1002 / 14651858.CD006146.pub2.7. Ostling PS, Davidson KS, Anyama BO, Helander EM, Wyche MQ, Kaye AD. America's Opioid Epidemic: a Comprehensive Review and Look into the Rising Crisis. Curr Pain Headache Rep 2018;22(5):32. DOI: 10.1007 / sl 1916-018-0685-5.8. Paulozzi LJ, XI Y. Recent changes in drug poisoning mortality in the United States by urban-rural status and by drug type. Pharmacoepidemiology and drug safety 2008;17(10):997-1005. DOI: 10.1002 / pds.1626.9. Edlund MJ, Martin BO, Devries A, Fan MY, Braden JB, Sullivan MD. Trends in use of opioids for chronic noncancer pain among individuals with mental health and substance use disorders: the TROUP study. The Clinical journal of pain 2010;26(1):1-8. DOI: 10.1097 / AJP.0b013e3181b99f35.10. Edlund MJ, Martin BO, Fan MY, Braden JB, Devries A, Sullivan MD. An analysis of heavy utilizers of opioids for chronic noncancer pain in the TROUP study. Journal of pain and symptom management 2010;40(2):279-89. DOI: 10.1016 / j.jpainsymman.2010.01.012.11. Boudreau D, Von Korff M, Rutter CM, et al. Trends in long-term opioid therapy for chronic non-cancer pain. Pharmacoepidemiology and drug safety 2009;18(12): 1166-75. DOI: 10.1002 / pds.1833.12. Compton WM, Volkow ND. Major increases in opioid analgesic abuse in the United States: concerns and strategies. Drug and alcohol dependence 2006;81 (2): 103-7. DOI: 10.1016 / j.drugalcdep.2005.05.009.13. Zhuang GZ, Keeler B, Grant J, et al. Carbonic anhydrase-8 regulates inflammatory pain by inhibiting the ITPR1 -cytosolic free calcium pathway. PLoS One 2015; 10(3):e0118273. DOI: 10.1371 / journal. pone.0118273.14. Berridge MJ. Inositol trisphosphate and calcium signalling. Nature 1993;361 (6410):315-25. DOI: 10.1038 / 361315a0.15. . Zhuang GZ, Upadhyay U, Tong X, et al. Human carbonic anhydrase-8 AAV8 gene therapy inhibits nerve growth factor signaling producing prolonged analgesia and anti-hyperalgesia in mice. Gene Ther 2018;25(4):297-311. DOI: 10.1038 / s41434-018-0018-716. Upadhyay U, Zhuang GZ, Diatchenko L, et al. Profound analgesia is associated with a truncated peptide resulting from tissue specific alternative splicing of DRG CA8-204 regulated by an exon-level cis-eQTL. PLoS Genet 2019; 15(6):e1008226. DOI: 10.1371 / journal.pgen.1008226.17. Fu ES, Erasso DM, Zhuang GZ, et al. Impact of human CA8 on thermal antinociception in relation to morphine equivalence in mice. Neuroreport 2017;28(18):1215-1220. DOI: 10.1097 / WN R.0000000000000872.Upadhyay U, Zhuang GZ, Diatchenko L, et al. Reversion mutation of cDNA CA8-204 minigene construct produces a truncated functional peptide that regulates calcium release in vitro and produces profound analgesia in vivo. Mamm Genome 2020;31 (9-12):287-294. DOI: 10.1007 / s00335-020-09848-y. Levitt RC, Zhuang GY, Kang Y, et al. Car8 dorsal root ganglion expression and genetic regulation of analgesic responses are associated with a cis-eQTL in mice. Mamm Genome 2017;28(9-10):407-415. DOI: 10.1007 / S00335-017-9694-7. Selyanko AA, Brown DA. Intracellular calcium directly inhibits potassium M channels in excised membrane patches from rat sympathetic neurons. Neuron 1996;16(1):151-62. DOI: 10.1016 / s0896-6273(00)80032-x. Gamper N, Shapiro MS. Calmodulin mediates Ca2+-dependent modulation of M-type K+ channels. The Journal of general physiology 2003; 122(1 ): 17-31. DOI: 10.1085 / jgp.200208783. Delmas P, Brown DA. Pathways modulating neural KCNQ / M (Kv7) potassium channels. Nature reviews Neuroscience 2005;6(11):850-62. DOI: 10.1038 / nrn1785. Burgoyne RD. Neuronal calcium sensor proteins: generating diversity in neuronal Ca2+ signalling. Nature reviews Neuroscience 2007;8(3): 182-93. DOI: 10.1038 / nrn2093. Kosenko A, Hoshi N. A change in configuration of the calmodulin-KCNQ channel complex underlies Ca2+- dependent modulation of KCNQ channel activity. PLoS One 2013;8(12):e82290. DOI:10.1371 / journal, pone.0082290. Wu Z, Li L, Xie F, et al. Activation of KCNQ Channels Suppresses Spontaneous Activity in Dorsal Root Ganglion Neurons and Reduces Chronic Pain after Spinal Cord Injury. Journal of neurotrauma 2017;34(6):1260-1270. DOI: 10.1089 / neu.2016.4789. Lombardo J, Harrington MA. Nonreciprocal mechanisms in up- and downregulation of spinal motoneuron excitability by modulators of KCNQ / Kv7 channels. Journal of neurophysiology 2016;116(5):2114-2124. DOI: 10.1152 / jn.00446.2016. Surti TS, Huang L, Jan YN, Jan LY, Cooper EC. Identification by mass spectrometry and functional characterization of two phosphorylation sites of KCNQ2 / KCNQ3 channels. Proc Natl Acad Sci U S A 2005;102(49):17828-33. DOI: 10.1073 / pnas.0509122102. Wulff H, Castle NA, Pardo LA. Voltage-gated potassium channels as therapeutic targets. Nat Rev Drug Discov 2009;8(12):982-1001. DOI: 10.1038 / nrd2983. Passmore GM, Selyanko AA, Mistry M, et al. KCNQ / M currents in sensory neurons: significance for pain therapy. J Neurosci 2003;23(18):7227-36. DOI: 10.1523 / JNEUROSCI.23-18-07227.2003. Munro G, Dalby-Brown W. Kv7 (KCNQ) channel modulators and neuropathic pain. J Med Chem 2007;50(11):2576-82. DOI: 10.1021 / jm060989l. Blackburn-Munro G, Jensen BS. The anticonvulsant retigabine attenuates nociceptive behaviours in rat models of persistent and neuropathic pain. Eur J Pharmacol 2003;460(2-3):109-16. DOI: 10.1016 / s0014- 2999(02)02924-2. Erichsen HK, Hao JX, Xu XJ, Blackburn-Munro G. A comparison of the antinociceptive effects of voltage- activated Na+ channel blockers in two rat models of neuropathic pain. Eur J Pharmacol 2003;458(3):275- 82. DOI: 10.1016 / s0014-2999(02)02792-9. Mastronardi P, D'Onofrio M, Scanni E, et al. Analgesic activity of flupirtine maleate: a controlled doubleblind study with diclofenac sodium in orthopaedics. J Int Med Res 1988;16(5):338-48. DOI: 10.1177 / 030006058801600503. McMahon FG, Arndt WF, Jr., Newton J J, Montgomery PA, Perhach JL. Clinical experience with flupirtine in the U.S. Postgrad Med J 1987;63 Suppl 3:81-5. Perdigoto DN, Amaro P, Ferreira M, Tome L. Flupirtine drug-induced liver injury in a patient developing acute liver failure. BMJ Case Rep 2018;2018. DOI: 10.1136 / bcr-2017-223329. Konishi K, Fukami T, Ogiso T, Nakajima M. In vitro approach to elucidate the relevance of carboxylesterase 2 and N-acetyltransferase 2 to flupirtine-induced liver injury. Biochem Pharmacol 2018;155:242-251. DOI: 10.1016 / j.bcp.2018.07.019. Chakrabarti S, Pattison LA, Doleschall B, et al. Intraarticular Adeno-Associated Virus Serotype AAV- PHP.S-Mediated Chemogenetic Targeting of Knee-Innervating Dorsal Root Ganglion Neurons Alleviates Inflammatory Pain in Mice. Arthritis Rheumatol 2020;72(10): 1749-1758. DOI: 10.1002 / art.41314. Chan KY, Jang MJ, Yoo BB, et al. Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat Neurosci 2017;20(8):1172-1179. DOI: 10.1038 / nn.4593. Wu Y, Li J, Kong Y, Chen D, Liu B, Wang W. [HSV-1 based vector mediated IL-1 Ralpha gene for knee osteoarthritis in rabbits], Zhong Nan Da Xue Xue Bao Yi Xue Ban 2013;38(6):590-6. DOI: 10.3969 / j.issn.1672-7347.2013.06.007. Oligino T, Poliani PL, Marconi P, et al. In vivo transgene activation from an HSV-based gene therapy vector by GAL4:vp16. Gene Ther 1996;3(10):892-9. Lu Y, McNearney TA, Wilson SP, Yeomans DC, Westlund KN. Joint capsule treatment with enkephalin- encoding HSV-1 recombinant vector reduces inflammatory damage and behavioural sequelae in rat CFAmonoarthritis. The European journal of neuroscience 2008;27(5):1153-65. DOI: 10.1111 / j.1460- 9568.2008.06076.x. LaBranche TP, Bendele AM, Omura BC, et al. Nerve growth factor inhibition with tanezumab influences weight-bearing and subsequent cartilage damage in the rat medial meniscal tear model. Ann Rheum Dis 2017;76(1):295-302. DOI: 10.1136 / annrheumdis-2015-208913. Miyagawa Y, Marino P, Verlengia G, et al. Herpes simplex viral-vector design for efficient transduction of nonneuronal cells without cytotoxicity. Proc Natl Acad Sci U S A 2015;112(13):E1632-41. DOI: 10.1073 / pnas.1423556112. Miyagawa Y, Verlengia G, Reinhart B, et al. Deletion of the Virion Host Shut-off Gene Enhances Neuronal- Selective Transgene Expression from an HSV Vector Lacking Functional IE Genes. Mol Ther Methods Clin Dev 2017;6:79-90. DOI: 10.1016 / j.omtm.2017.06.001. Verlengia G, Miyagawa Y, Ingusci S, Cohen JB, Simonato M, Glorioso JC. Engineered HSV vector achieves safe long-term transgene expression in the central nervous system. Sci Rep 2017;7(1 ): 1507. DOI: 10.1038 / S41598-017-01635-1. Nagase H, Kumakura S, Shimada K. Establishment of a novel objective and quantitative method to assess pain-related behavior in monosodium iodoacetate-induced osteoarthritis in rat knee. J Pharmacol Toxicol Methods 2012;65(1):29-36. DOI: 10.1016 / j.vascn.2011.10.002. Okun A, Liu P, Davis P, et al. Afferent drive elicits ongoing pain in a model of advanced osteoarthritis. Pain 2012; 153(4):924-933. DOI: 10.1016 / j.pain.2012.01.022. Stevenson GW, Mercer H, Cormier J, et al. Monosodium iodoacetate-induced osteoarthritis produces pain- depressed wheel running in rats: implications for preclinical behavioral assessment of chronic pain. Pharmacology, biochemistry, and behavior 2011 ;98(1):35-42. DOI: 10.1016 / j.pbb.2010.12.009. Vonsy JL, Ghandehari J, Dickenson AH. Differential analgesic effects of morphine and gabapentin on behavioural measures of pain and disability in a model of osteoarthritis pain in rats. European journal of pain 2009; 13(8):786-93. DOI: 10.1016 / j.ejpain.2008.09.008. Chandran P, Pai M, Blomme EA, Hsieh GO, Decker MW, Honore P. Pharmacological modulation of movement-evoked pain in a rat model of osteoarthritis. European journal of pharmacology 2009;613(1- 3):39-45. DOI: 10.1016 / j.ejphar.2009.04.009. Turkmen S, Guo G, Garshasbi M, et al. CA8 mutations cause a novel syndrome characterized by ataxia and mild mental retardation with predisposition to quadrupedal gait. PLoS genetics 2009;5(5):e1000487. DOI: 10.1371 / journal.pgen.1000487. Yu T, Li L, Liu H, Li H, Liu Z, Li Z. KCNQ2 / 3 / 5 channels in dorsal root ganglion neurons can be therapeutic targets of neuropathic pain in diabetic rats. Mol Pain 2018;14:1744806918793229. DOI: 10.1177 / 1744806918793229. Teng BC, Song Y, Zhang F, et al. Activation of neuronal Kv7 / KCNQ / M-channels by the opener QO58- lysine and its anti-nociceptive effects on inflammatory pain in rodents. Acta Pharmacol Sin 2016;37(8):1054-62. DOI: 10.1038 / aps.2016.33. Sarantopoulos CD, McCallum JB, Rigaud M, Fuchs A, Kwok WM, Hogan QH. Opposing effects of spinal nerve ligation on calcium-activated potassium currents in axotomized and adjacent mammalian primary afferent neurons. Brain Res 2007;1132(1):84-99. DOI: 10.1016 / j.brainres.2006.11.055. Kawano T, Zoga V, Gemes G, et al. Suppressed Ca2+ / CaM / CaMKII-dependent K(ATP) channel activity in primary afferent neurons mediates hyperalgesia after axotomy. Proceedings of the National Academy of Sciences of the United States of America 2009;106(21):8725-30. DOI: 10.1073 / pnas.0901815106. Selyanko AA, Brown DA. Regulation of M-type potassium channels in mammalian sympathetic neurons: action of intracellular calcium on single channel currents. Neuropharmacology 1996;35(7):933-47. DOI: 10.1016 / 0028-3908(96)00135-9. Marrion NV, Zucker RS, Marsh SJ, Adams PR. Modulation of M-current by intracellular Ca2+. Neuron 1991;6(4):533-45. DOI: 10.1016 / 0896-6273(91)90056-6. Brown DA, Passmore GM. Neural KCNQ (Kv7) channels. Br J Pharmacol 2009; 156(8): 1185-95. DOI: 10.1111 / j.1476-5381.2009.00111.x. Wang JJ, Li Y. KCNQ potassium channels in sensory system and neural circuits. Acta Pharmacol Sin 2016;37(1):25-33. DOI: 10.1038 / aps.2015.131. Cisneros E, Roza C, Jackson N, Lopez-Garcia JA. A New Regulatory Mechanism for Kv7.2 Protein During Neuropathy: Enhanced Transport from the Soma to Axonal Terminals of Injured Sensory Neurons. Front Cell Neurosci 2015;9:470. DOI: 10.3389 / fncel.2015.00470. Birnbaum HG, White AG, Schiller M, Waldman T, Cleveland JM, Roland CL. Societal costs of prescription opioid abuse, dependence, and misuse in the United States. Pain medicine 2011 ; 12(4):657-67. DOI: 10.1111 / j.1526-4637.2011.01075.x. Callhoff J, Albrecht K, Redeker I, et al. Disease Burden of Patients With Osteoarthritis: Results of a Cross- Sectional Survey Linked to Claims Data. Arthritis Care Res (Hoboken) 2020;72(2): 193-200. DOI: 10.1002 / acr.24058.63. Liu P, Okun A, Ren J, et al. Ongoing pain in the MIA model of osteoarthritis. Neurosci Lett 2011 ;493(3):72- 5. DOI: 10.1016 / j.neulet.2011.01.027.64. Suokas AK, Sagar DR, Mapp PI, Chapman V, Walsh DA. Design, study quality and evidence of analgesic efficacy in studies of drugs in models of OA pain: a systematic review and a meta-analysis. Osteoarthritis Cartilage 2014;22(9):1207-23. DOI: 10.1016 / j.joca.2014.06.015.65. Peretz A, Degani-Katzav N, Talmon M, et al. A tale of switched functions: from cyclooxygenase inhibition to M-channel modulation in new diphenylamine derivatives. PloS one 2007;2(12):e1332. DOI: 10.1371 / journal. pone.0001332.66. Rivera-Arconada I, Vicente-Baz J, Lopez-Garcia JA. Targeting Kv7 channels in pain pathways. Oncotarget 2017;8(8):12554-12555. DOI: 10.18632 / oncotarget.15261.67. Stevens JG. Defining herpes simplex genes involved in neurovirulence and neuroinvasiveness. Curr Eye Res 1987;6(1):63-7. DOI: 10.3109 / 02713688709020070.68. Margolis TP, Imai Y, Yang L, Valias V, Krause PR. Herpes simplex virus type 2 (HSV-2) establishes latent infection in a different population of ganglionic neurons than HSV-1 : role of latency-associated transcripts. Journal of virology 2007;81 (4): 1872-8. DOI: 10.1128 / JVI.02110-06.69. Wilson AC, Mohr I. A cultured affair: HSV latency and reactivation in neurons. Trends Microbiol 2012;20(12):604-11. DOI: 10.1016 / j.tim.2012.08.005.70. Goins WF, Huang S, Hall B, Marzulli M, Cohen JB, Glorioso JC. Engineering HSV-1 Vectors for Gene Therapy. Methods in molecular biology 2020;2060:73-90. DOI: 10.1007 / 978-1-4939-9814-2_4.71. Watson Levings RS, Broome TA, Smith AD, et al. Gene Therapy for Osteoarthritis: Pharmacokinetics of Intra-Articular Self-Complementary Adeno-Associated Virus lnterleukin-1 Receptor Antagonist Delivery in an Equine Model. Hum Gene Ther Clin Dev 2018;29(2):90-100. DOI: 10.1089 / humc.2017.142.72. Hill R. NK1 (substance P) receptor antagonists-why are they not analgesic in humans? Trends in pharmacological sciences 2000;21(7):244-6. DOI: 10.1016 / s0165-6147(00)01502-9.73. Devulder J. Flupirtine in pain management: pharmacological properties and clinical use. CNS Drugs 2010;24(10):867-81. DOI: 10.2165 / 11536230-000000000-00000.74. Goss JR, Cascio M, Goins WF, et al. HSV delivery of a ligand-regulated endogenous ion channel gene to sensory neurons results in pain control following channel activation. Mol Ther 2011 ; 19(3):500-6. DOI: 10.1038 / mt.2010.246.75. Mazzacurati L, Marzulli M, Reinhart B, et al. Use of miRNA response sequences to block off-target replication and increase the safety of an unattenuated, glioblastoma-targeted oncolytic HSV. Mol Ther 2015;23(1):99-107. DOI: 10.1038 / mt.2014.177.76. Goins WF, Huang S, Cohen JB, Glorioso JC. Engineering HSV-1 vectors for gene therapy. Methods in molecular biology 2014;1144:63-79. DOI: 10.1007 / 978-1-4939-0428-0_5.77. Ozuer A, Wechuck JB, Russell B, et al. Evaluation of infection parameters in the production of replicationdefective HSV-1 viral vectors. Biotechnology progress 2002; 18(3):476-82. DOI: 10.1021 / bp010176k.78. Wechuck JB, Ozuer A, Goins WF, et al. Effect of temperature, medium composition, and cell passage on production of herpes-based viral vectors. Biotechnol Bioeng 2002;79(1 ): 112-9.79. Jin SX, Zhuang ZY, Woolf CJ, Ji RR. p38 mitogen-activated protein kinase is activated after a spinal nerve ligation in spinal cord microglia and dorsal root ganglion neurons and contributes to the generation of neuropathic pain. The Journal of neuroscience : the official journal of the Society for Neuroscience 2003;23(10):4017-22.80. Zhuang ZY, Wen YR, Zhang DR, et al. A peptide c-Jun N-terminal kinase (JNK) inhibitor blocks mechanical allodynia after spinal nerve ligation: respective roles of JNK activation in primary sensory neurons and spinal astrocytes for neuropathic pain development and maintenance. J Neurosci 2006;26(13):3551 -60. DOI: 10.1523 / JNEUROSCI.5290-05.2006.81. Dixon WJ. Efficient analysis of experimental observations. Annu Rev Pharmacol Toxicol 1980;20:441-62. DOI: 10.1146 / annurev.pa.20.040180.002301.82. Helyes Z, Sandor K, Borbely E, et al. Involvement of transient receptor potential vanilloid 1 receptors in protease-activated receptor-2-induced joint inflammation and nociception. Eur J Pain 2010;14(4):351-8. DOI: 10.1016 / j.ejpain.2009.07.005.Example 3 - Electrophysiologic (EP) Recordings to Characterize the Excitability of Cell Lines Treated with a Candidate Agent.

[0253] EP recordings in small diameter primary dispersed DRG neurons with whole-cell patch clamping is shown. Small diameter DRG neuronal somata are selected for patch clamping by size < 30 m using a fluorescence microscope with a recording micropipette to measure the relevant electrophysiological parametersincluding the action potential (AP) and afterhyperpolarization (AHP). Measurements are obtained using Clampfit or similar software. vHCA8* prolong the AHP of infected DRG neurons.Example 4. EP Recordings With Kv7-Specific Inhibitors to Characterize the Excitability of Cell Lines Treated with DS and DP.

[0254] EP recordings show that Kv7 specific inhibitor XE-991 (10 piM administration by perfusion in external bath solution) shortens the duration of AHP at the level corresponding to the resting membrane potential (P=0.006). XE-991 also shortens the duration of AHP at the level corresponding to 50% peak AHP amplitude height. (P=0.03).Example 5. Differences in Kv7 currents between vHCA8WT DRG neuronal somata versus controls can also be used to assess DS and DP potency using EP studies.

[0255] Current responses from -20 mV holding potentials to -50 mV hyperpolarizing voltage command steps of 1-sec duration were recorded before and after administration of 10 piM XE-991 in vHCA8WT-infected and control neurons. The selective Kv7 inhibitor XE-991 had an inhibitory effect only in vHCA8WT-infected cells, indicating the presence of significant Kv7 currents only in vHCA8WT-infected cells. It will be obvious to one skilled in the art that IPSC-SNs (IPSCs directed differentiation toward sensory-like neurons SN), could be used as cells to test candidate agents using EP studies.Example 6. Producing Vectors Incorporating Wildtype KCNQ Coding Sequence, KCNQ Coding Sequence with Gain-of-Function (Constitutively Active) or Loss-of-Function (Inactive) Mutation(s) in Kv7 Channels.

[0256] This example describes the creation of Lentivirus vectors incorporating KCNQ coding inserts comprising wildtype, gain-of-function, or loss-of-function mutations to create novel modified cell lines to produce Product-Specific Potency Assays.

[0257] Wildtype Kv7 voltage-gated potassium channels along with positive and negative controls are critical for the successful creation and running of Product-Specific Assays. These Modified Cell Lines may be especially helpful for Product-Specific Potency Assays. Lentivirus vectors or similar transfection reagents can be helpful in the creation of these Modified Cell Lines. The invention describes vectors incorporating KCNQ coding sequence for the creation of Modified Cell Lines useful in Product-Specific Assay Development. Herein, we describe for the first time in detail knowledge that vHCA8*WT but not vHCA8*MT (S100P mutation with unstable rapidly degraded peptide)(negative control identical in every way except for the inactivating point mutation) function to activate Kv7 (eg, Kv7.2, Kv7.3, Kv7.5, etc.) channels to decrease neuronal excitability by producing "M-currents” and hyperpolarization of neurons in culture, and reduced neuronal excitability in vivo and their use in developing novel product-specific assay reagents to characterize CA8* therapeutics. We further describe that dephosphorylation of Thr-217 in Kv7.2 and Thr246 of Kv7.3 are associated with activation of these Kv7 voltagegated potassium channels to produce decreased neuronal excitability with vHCA8*WT, but not vHCA8*MT treatment. Additionally, we show prolonged, profound analgesia is associated with Kv7.2, Kv7.3, and Kv7.5 activation that is reversed in vivo by Kv7 channel-specific inhibitor XE-991.

[0258] Creation of Product-Specific Assays Using Modified Cell Lines Expressing KCNQ2 and KCNQ3 Including Gain-of-Function and Loss-of-Function Mutations: This invention describes the creation of Product- Specific Assays by incorporating KCNQ2, KCNQ3, KCNQ4, and / or KCNQ5 coding sequences within Lentivirus expression vectors, or a similar transfection vehicle to specifically enable the creation of Modified Cell Lines (using transient transfection or stable cell line selection) as useful reagents for the development of Product- Specific Assays.

[0259] Positive Controls:

[0260] Producing Vectors With Gain-of-Function (Activating) Mutation in KCNQ3 (2263C>T) and Kv7.3 (D755N)(Produce Pain Resilience in Humans).

[0261] The Kv7.3-D755N missense variant (c.2263C>T, p. D755N) in KCNQ3 (Kv7.3)(activating mutation in humans) is introduced into the Kv7.3WT construct using QuickChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA).18 Human Embryonic Kidney Cells 293 (HEK293) cells, grown under standard culture conditions (5% CO2, 37°C) in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, are transiently transfected with the Kv7.2, Kv7.3, Kv7.4, Kv7.5 or multiple alpha subunits using LipoJet (SignaGen laboratories, Frederick, MD). The transfected cells are resuspended and plated onto coverslips the next day for patch-clamp recordings to be performed over the next two days. Additional experiments designed to identify stable cell lines incorporating Lenti-mediated genomic inserts into the target cells after transfected.

[0262] Producing Vectors With Gain-of-Function (Activating) Mutation in KCNQ2 and Kv7.3 (T730A)(Producing Pain Resilience in Human).

[0263] The Kv7.2 T730A missense variant in KCNQ2 (Kv7.2)(activating mutation in humans) is introduced into the Kv7.2WT construct using QuickChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA).19 Human Embryonic Kidney Cells 293 (HEK293) cells, grown under standard culture conditions (5% CO2, 37°C) in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, are transfected with the Lentivirus vectors or similar plasmid incorporating coding sequence for Kv7.2, Kv7.3, Kv7.4, Kv7.5 or multiple or both alpha subunits with selectable markers and may include reporter genes for ease of screening for stable single cells after limiting dilutions. Additional validation of the modified cell line may include resuspending the selected transfected cells onto coverslips for whole-cell patch-clamp recordings to be performed. Transfected cells are used for additional experiments designed to identify stable unique Modified Cell Lines incorporating one or both Lentivirus vector-mediated genomic inserts.

[0264] Figures 27-29 show examples of VectorBui Ider description of Lentivirus plasmid containing human KCNQ vector maps, coding sequences, and restriction digests that are described in Figures 31-33. It should be appreciated by one skilled in the art that these are not limiting examples, and additional reagents capable of transfecting target cells to create unique Modified Cell Lines incorporating KCNQ2, KCNQ3, KCNQ4, or KCNQ5, and other KCNQ coding sequences. These may include wildtype and KCNQ variants, including channelactivating mutations (causing gain-of-function and decreased excitability) and channel-inactivating mutations(causing loss-of-function and increased excitability), useful as positive and negative controls, respectively,18 19) for the creation of unique Modified Cell Lines, useful as Product Specific Assays.

[0265] Negative Controls:

[0266] Producing Vectors With Loss-of-Function (Inactivating) Mutation in KCNQ2 (N258K) and (G279D)(Produce Pain Epilepsy in Humans).

[0267] The KCNQ2 mutations N258K or G279D incorporated into the KCNQ2 sequence within Lentivirus by in vitro mutagenesis specifically enables the development of Modified Cell Lines using transient transfection or stable cell line selection that are useful as negative controls in our Product-Specific Assays. Two variants incorporated by reference, p.(N258K) and p.(G279D), in the pore loop domain of Kv7.2 are described that demonstrate loss-of-function and dominant-negative effects useful as negative controls.20

[0268] Both mutations causing epilepsy are in the pore-domain of KCNQ2 (see Figure). The N258K variant was found in a neurodevelopment disorder, suggesting it was the cause of abnormal brain development as well as seizures due to the lack of Kv7.2 voltage-gated potassium channel activity as homo-tetramers or heterotetramers in down-regulating neuronal excitability. N258K incorporated into KCNQ2 sequence within Lent! virus vector by in vitro mutagenesis enables the creation of stable Modified Cell Lines or Modified Cell Lines useful for transient transfection, both of which are useful as negative controls in our Product Specific Assays.

[0269] Methods

[0270] Plasmid construction, protein expression and localization in HEK293 cells. pcDNA3.1 + / KV7.2-DYK (#NM_004518.6) and pcDNA3.1 + / KV7.3-DYK (# NM_004519.4) are synthesized by Genescript (Piscataway, New Jersey, USA). cDNAKv7.2 is subcloned into the pcDNA3.1 / CT-GFP-TOPO Vector (Invitrogen, Waltham, Massachusetts, USA), resulting in a C-terminal GFP, useful to identify transfected cells. Two loss of function mutations c.774C>G p.(N258K) and C.836G > A p.(G279D), are introduced using QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, California, USA). All plasmids are verified using Sangar sequencing.

[0271] Transient Transfections: HEK293 cells are transiently transfected with about 2.5 pg of either wild-type, p.(N258K), or p.(G279D) Kv7.2 for homotetrameric experiments using Lipofectamine 3000 (Invitrogen). For heterotetrameric experiments, different types of Kv7.2 are co-transfected with wild-type Kv7.3 (wild-type Kv7.2 / Kv7.3, p.(N258K) Kv7.2 / Kv7.3, p.(G279D) Kv7.2 / Kv7.3, wild-type Kv7.2 / p.(N258K) Kv7.2 / Kv7.3, wild-type Kv7.2 / p.(G279D) Kv7.2 / Kv7.3) at a 1 : 1 ratio [eg, (1.25mg: 1.25mg) or 1 : 1 :2 ratio (0.625mg: 0.625 mg: 1.25 mg)] and assayed 48- or 72- hours post-transfection. In other heterotetrameric experiments, different types of Kv7.4 are co-transfected with wild-type Kv7.4. In still other experiments, wild-type Kv7.2 / Kv7.5; or wild-type Kv7.3 / Kv7.5 at a 1 : 1 ratio [eg, (1.25mg: 1.25mg) or 1 : 1 :2 ratio (0.625mg: 0.625 mg: 1.25 mg)] and assayed 48- or 72- hours post-transfection.

[0272] Western Blot Analysis'. Westerns are used to determine Kv7.2 wildtype and mutant expression in transfected cells. In this example, we are using HEK293 cells. Cells are scraped, centrifuged and resuspended. Membrane protein and cytoplasmic protein are extracted using the Mem-PER Plus Membrane Protein Extraction Kit (ThermoFisher). The membrane protein and cytoplasmic protein are separated based on their hydrophobicity using two different buffers, a permeabilization buffer and a solubilization buffer. Then, 20 mg of denatured proteins are separated on 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Invitrogen). Transferred membranes are blocked for 1 h at RT in 5% nonfat dry milk and incubated overnight at 4 °C with monoclonal anti-Kv7.2 Rabbit mAb (1 :500) (Cell Signaling Danvers, Massachusetts, USA) in 5% Bovine serum albumin (BSA) and then with monoclonal anti-GAPDH Rabbit (1 :500) (Cell Signaling) in 5% BSA is used as a loading control. The membranes are then incubated for 2 h at RT with Anti-rabbit IgG, horseradish peroxidase (HRP)-linked antibody (1 :1000) (Cell Signaling) in 5% BSA. Specific bands are visualized using an ImageQuant Las4000 chemi-image (GE Healthcare).

[0273] ncubated for 2 h at RT with Anti-rabbit IgG, horseradish peroxidase (HRP)-linked antibody (1 :1000) (Cell Signaling) in 5% BSA. Specific bands are visualized using an ImageQuant Las4000 chemi-image (GE Healthcare).

[0274] Creation of Product Specific Modified Cell Lines to Detect Changes in pKv7 Expression Due to vHCA8*

[0275] Lentivirus vectors incorporating KCNQ sequences of Kv7 channel subunits can be used to create Modified Cell Lines after transfection overexpressing wildtype, incorporating gain-of-function mutation(s) (Positive Controls),1819or loss-of-function mutation(s) (Negative Controls). Examples of Lentivirus vector maps, sequences, and restriction digests are provided in Figures 31-33 as a non-limiting example of these useful for generating the modified cell lines. These Modified Cell Lines are used in methods disclosed in Figures 21-25 and Figure 30 and to develop product-specific ELISA assays. They are also used specifically as Product-Specific Assays to detect and quantify changes in Kv7 channel activation, including alterations in pKv7 after vHCA8* infection, to test for Product-Specific biological function as a Potency Assay.Example 7 - Verification of Kv7 mutation using whole-cell voltage-clamp recordings

[0276] Verification of the activating mutation function is performed on isolated HEK293 cells showing mRuby and mCitrine fluorescence at room temperature (~21°C). Electrodes are pulled from 1.65 mm O.D. borosilicate glass micropipettes (World Precision Instruments, Sarasota, FL) and had a resistance of 1-2 MX when filled with pipette solution, which is contained (in mM): 126 K-Gluconate, 4 KCI, 10 HEPES, 0.3 EGTA, 10 phosphocreatine disodium salt, 4 ATP Mg-salt and 0.3 GTP Na-salt (pH 7.3 with KOH, adjusted to 320 mOsm with dextrose). The extracellular solution contained (in mM): 140 NaCI, 3 KCI, 1 MgCh, 1 CaCl2, 10 HEPES (pH 7.3 with NaOH, is adjusted to 320 mOsm with dextrose). Currents of Kv7 voltage-gated potassium channels are measured on an EPC-10 USB amplifier (HEKA Electronics) and acquired using PatchMaster software (HEKA Electronics) at anacquisition rate of 20 kHz with a low pass Bessel filter setting of 5 kHz. When appropriate, linear leak currents and capacitance artifacts are subtracted out using the P / N method.

[0277] To evaluate the voltage-dependence of Kv7 current, the activation protocol is performed as follows: from a holding potential of -80 mV, incrementing depolarizing pulses of 500 ms duration are stepped starting at - 80 mV to |D80 mV in 10 mV increments followed by a fixed hyperpolarizing pulse to -120 mV for 50 ms and then returning to holding potential. The pulse protocol is performed with P / 4 leak subtraction, and the sweep-to-sweep cycle time is 5 s. The current-voltage (l-V) relationship is computed as the average current measured during the last 50 ms of the depolarizing pulse. The large amplitude of the currents would be expected to result in progressively larger voltage errors with large depolarizing stimuli due to incomplete series resistance compensation, and these would be expected to distort the l-V relation and complicate the transformation of the l-V into a conductance voltage (G-V) curve. Because of this, series resistance compensation is enabled and 90% compensation is commonly achieved. The G-V relationship is determined by measuring the instantaneous inward current during the repolarizing pulse to a fixed potential of -120 mV, which produces smaller currents due to the reduced driving force for potassium and results in smaller series resistance-induced voltage errors. The instantaneous inward current recorded in this way reflects the total number of channels opened by the preceding depolarizing pulse and results in a G-V curve that does not require determining the apparent reversal potential. The activation protocol was repeated multiple times after initiating whole-cell configuration to evaluate possible time-dependent changes in activation properties.

[0278] Other Methods

[0279] Generation of induced pluripotent stem cells

[0280] IPSCs are generated from the blood samples of subjects using CytoTune-IPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific) according to the manufacturer protocol. Cells are screened for pluripotent stem cell markers and tested for normal karyotype. IPSCs are cultured for at least 10 generations before the start of differentiation into sensory neurons (i.e., IPSC-SNs).

[0281] Differentiation ofiPSC into sensory neurons for Product Specific Characterization Using Whole Cell Patch Clamp Techniques.

[0282] Differentiation is initiated using a modified Chambers protocol using LSB and 3i inhibitors.34’37Differentiated neurons are maintained in Neurobasal medium supplemented with N2 / B27 GlutaMAX (Thermo Fisher Scientific) and nerve growth factors [recombinant human nerve growth factor, brain-derived neurotrophic factor, glial cell line-derived neurotrophic factor, and neurotrophin-3 (NT-3; 25 pi.g / ml; PeproTech)] for 8 weeks before characterization and use in functional assessments.

[0283] Immunocytochemistry of iPSC-Sensory Neuron Like (SNs) Cells.

[0284] IPSC-SNs are immunostained with markers for sensory neurons. Primary antibodies were incubated overnight at 4°C in PBS-T (0.1% Triton X-100, 2% BSA, 4% donkey serum in PBS; Pan Neuronal Marker-AlexaFluor 488 conjugate, 1 :100, MAB2300X - Millipore; peripherin 1 :200, SC-7604, Santa Cruz Biotechnology;BRN3A, 1 :200, AB5945, Millipore; and other antibodies against Kv7 voltage-gated potassium channels as noted above. Secondary antibodies are incubated for 2 h at room temperature in PBS-T. Images are acquired using a Nikon C1 confocal microscope or similar fluorescent microscope.

[0285] Generating Lentiviruses Incorporating Kv7 Voltage-Gated Potassium Channels (Wildtype or Mutants) for Functional Characterization of vHCA8.

[0286] Lentiviral Kv7 expression plasmid pCDH-Kv7 is constructed by replacing the complete HCMV IE promoter of plasmid pCDH-CMV-MCS-EF1-Puro (Systembio) with the Kv7 sequence (including promoter and coding region using an appropriate restriction enzyme site depending on the vector restriction digest maps) into pUC19. Lentiviral expression plasmid pCDH-Kv7MT (incorporating either gain-of-function or loss-of-function mutation) is constructed, first, by replacement of the puromycin-resistance cassette of pCDH-CMV-MCS-EF1- Puro with the blasticidin-resistance cassette of pcDNA6 / BioEase-DEST (Invitrogen) to create pCDH-CMV-MCS- SV40-blast.

[0287] Lentiviruses are produced using the ViraPower Lentiviral Packaging Mix (Invitrogen) according to the manufacturer's instructions. Briefly, 293T cells were transfected with pCDH-Kv7-puro or pCDH-Kv7MT blast in ViraPower mix. Supernatants were harvested 2 days later, clarified, filtered 5-pm filter, and concentrated by centrifugation.

[0288] These Lentivirus vectors incorporating various Kv7 voltage-gated potassium channels and their relevant mutations are used to transfect target cell lines (e.g., HEK293 cells or similar host cell lines) to create Modified Cell Lines expressing Kv7 voltage-gated potassium channels (wildtype, or with gain-of-function less excitable cells, or loss-of-function mutations - more excitable cells).

[0289] Generating Product-Specific Stable Cell Lines Expressing Kv7 voltage-gated potassium channels for Functional Characterization of vHCA8.

[0290] As an example of the creation of stable cell lines useful in the characterization of a candidate agent having the ability to activate a Kv7 voltage-gated potassium channel, HEK293 cells are infected with the purified Cre lentivirus vectors and selected for resistance to puromycin (2 pg / mL) and blasticidin (10 pg / mL). Resistant clones were isolated and screened for Cre expression by immunostaining with anti-Cre antibody 2D8 (Millipore). Alternatively, methods described elsewhere can be used to create HEK293-modified stable cell lines overexpressing Kv7 voltage-gated potassium channels useful in Product-Specific assay development.38

[0291] Modified Cell Lines are screened for differential activation by vHCA8*WT, vHCA8*MT, or similar carbonic anhydrase transgene-containing gene therapy vectors. These Modified Cell Lines are useful for characterization of DS and drug product. These Modified Cell Lines differ in their patch-clamp excitability and phosphorylation after infection with vHCA8*WT, vHCA8*MT, or similar carbonic anhydrase transgene-containing gene therapy vectors.Example 8 - CA8* Activated Kv7 Voltage-Gated Potassium Channels after XE-991 inhibition in ModifiedHEK-293 cells.

[0292] This example illustrates the creation and utility of modified cell lines to identify, characterize, and manufacture (e.g., aid process development, demonstrate identify, purity, potency, stability, etc.) Kv7 activating therapeutics or therapeutic candidates.

[0293] Methods: HEK-293 cells (ATCC) were co-transfected with three vectors comprised of Lenti-Kv7.2-Flag (or Lenti-Kv7.2 variant 1-Flag), Lenti-Kv7.3-Myc, and AAV-V5-CA8*WT (AAV-CA8*) at a ratio of 1 :1 :1 using Lipofectamine LTX and PLUS reagent (Invitrogen). Cells were starved overnight (>10 hrs.) after 48 hrs. of incubation and the cell culture media was replaced without serum. Then 10 piM XE-991 was added to the cell cultured for 15 min. Protein samples were extracted by Ripa buffer mixed with proteinase and phosphatase inhibitors. Immunoprecipitation (IP) was performed using Dynabeads Protein G (Invitrogen) for immunoprecipitation according to the manufacturer's instructions. Anti-Flag (rabbit, ThermoFisher) and Anti-Myc (mouse, Thermofisher) antibodies were used in the IP procedure. Phospho-threonine (pThr) antibody (mouse) was used for western blotting after the IP (Millipore Sigma). Chemicals were purchased from Millipore Sigma.

[0294] Results: HEK-293 cells were modified with Lenti-Kv7.2-Flag (or Lenti-Kv7.2 variant 1 -Flag), Lenti- Kv7.3-Myc. pThr was measured after IP-western (IP-WB) without treatment (control), after Kv7 specific inhibitor XE-991, and after CA8* pretreatment + XE-991. XE-991 treatment inhibits Kv7 (increased pThr) (P<0.001) as compared with control in the modified HEK-293 cells. CA8* treatment prevents XE-991 inhibition of Kv7 (decreased pThr)(P<0.001)(Figure 31). Panel A shows WB results with pThr antibody and GAPDH as the loading control. Panel B shows relative levels of pThr by WB normalized by GAPDH. One-way ANOVA was used for statistics. Each data point was presented as the mean ± SEM. ***P<0.001 vs vehicle control, N=3 experiments. It should be appreciated by one skilled in the art that this cell line measuring Kv7 channel opening can be used in conjunction with a variety detection systems including fluorescence-based assays using fluorescent dyes, and high-throughput screening assays.

[0295] These Electrophysiological Methods Include:

[0296] Patch-clamp:

[0297] This technique allows for recording the electrical activity of individual ion channels, including potassium channels, in a controlled environment. It's a classic method for studying channel properties like conductance and gating.

[0298] Whole-cell voltage-clamp:

[0299] This technique measures the total current flowing across a cell membrane, including the current passing through potassium channels.

[0300] Fluorescence-Based Assays Include:

[0301] FluxOR assay:

[0302] This assay uses a fluorogenic dye that changes fluorescence when thallium ions flow through potassium channels, allowing for the measurement of channel activity.

[0303] Calcium-sensitive dyes:

[0304] Dyes like Fura-2 and Fluo-3 can be used to monitor changes in intracellular calcium concentration, which can be correlated with the activity of some types of potassium channels.

[0305] DNA-based sensors Include:

[0306] DNA nanodevices like pHlicKer can be used to detect both pH and K+ levels, allowing for the mapping of channel activity in specific organelles.

[0307] High-Throughput Screening Assays Include:

[0308] Rubidium flux assays:

[0309] These assays measure the efflux of Rubidium ions from cells, which is an indicator of potassium channel activity.

[0310] Thallium flux assays:

[0311] Similar to the FluxOR assay, these assays use thallium to measure the activity of potassium channels in a plate-based format.

[0312] Ligand binding assays Include:

[0313] These assays measure the binding of ligands to specific potassium channels, which can indicate channel activity.

[0314] All publications, patents and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[0315] Exemplary embodiments

[0316] 1 . A cell modified to express a potassium channel protein and a carbonic anhydrase protein.

[0317] 2. The cell of embodiment 1, wherein the carbonic anhydrase protein is a CA8 protein, a CA10 protein or a CA11 protein or a fragment thereof.

[0318] 3. The cell of embodiment 2, wherein the CA8 protein is a wildtype CA8 protein.

[0319] 4. The cell of embodiment 2, wherein the carbonic anhydrase protein is a CA8 fragment.

[0320] 5. The cell of embodiment 4, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

[0321] 6. The cell of embodiment 4, wherein the CA8 fragment is CA8-204C or CA8-204G.

[0322] 7. The cell of any of embodiments 1-6, wherein the carbonic anhydrase protein is human.

[0323] 8. The cell of any of embodiments 1-6, wherein the carbonic anhydrase protein is human.

[0324] 9. The cell of embodiment 2, wherein the carbonic anhydrase protein is murine.

[0325] 10. The cell of any one of embodiments 1-9, wherein the potassium channel protein is a KV7.2, Kv7.3 or Kv7.5 or a combination thereof.

[0326] 11. A method of producing the cell of embodiment one comprising introducing into the cell(a) a vector comprising a nucleotide sequence encoding a potassium channel protein, and(b) a vector comprising a nucleotide sequence encoding a carbonic anhydrase protein.

[0327] Additional Embodiments:

[0328] 1 A. A method of activating a Kv7 voltage-gated potassium channel in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein.

[0329] 2A. The method of embodiment 1A, wherein the carbonic anhydrase protein is CA8, CA10, CA11, or fragments thereof.

[0330] 3A. The method of embodiment 1 A or embodiment 2A, wherein the carbonic anhydrase protein is a CA8 fragment.

[0331] 4A. The method of embodiment 3A, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

[0332] 5A. The method of embodiment 3A or embodiment 4A, wherein the CA8 fragment is CA8-204C orCA8-204G.

[0333] 6A. The method of any one of embodiments 1 A-5A, wherein the Kv7 voltage-gated potassium channel is Kv7.2, Kv7.3, Kv7.4, or Kv7.5.

[0334] 7A. The method of any one of embodiments 1 A-6A, wherein the cell comprises two or more Kv7 voltage-gated potassium channels.

[0335] 8A. The method of any one of embodiments 1 A-7A, wherein the method comprises contacting the cell with a vector comprising a nucleic acid encoding the carbonic anhydrase protein.

[0336] 9A. The method of embodiment 8A, wherein the vector is a lentiviral vector.

[0337] 10A The method of embodiment 8A, wherein the vector is an AAV viral vector.

[0338] 11 A. The method of embodiment 8A, wherein the vector is a HSV viral vector.

[0339] 12A. The method of embodiment 8A, wherein the vector is an adenoviral vector.

[0340] 13A The method of embodiment 8A, wherein the vector is a replication defective viral vector.

[0341] 14A. The method of any one of embodiments 1 A-13A, wherein the nucleic acid is operably linked to a promoter.

[0342] 15A. The method of embodiment 14A, wherein the promoter is associated with a gene selected from TrkA, TrkB, TrkC, Nav1.7, Nav1.8, Nav1.9, advillin, beta-amyloid, ApoE, presenilin 1 or 2, tau, TREM2, DJ-1, GBA, LRRK2, Parkin, PINK1 , alpha-synuclein, UCHL1, VPS35, C9orf72, FUS, SOD1, SQSTM1, TDP43, VGLUT1, VGLUT2, ADORA2A, DARPP-32, GAD1, GAD2 , neuropeptide Y, Penk, ALDH1A1, FoxA2, GIRK2, Lmx1 B, tyrosine hydroxylase, FEV, SERT, TPH2, tryptophan hydroxylase, ChAT, calbindin, calretinin, 5HT3A receptor, parvalbumin, somatostatin, VIP, HB9, Islet-1, Islet-2, neurogenin-2, or Olig2.

[0343] 16A. The method of any one of embodiments 1 A-15A, wherein the neural cell is a somatosensory neuron, a neural stem cell; a neuroepithelial cell; a Schwann cell; a radial glial cell; an oligodendrocyte; an astrocyte; an immature neuron; mature neurons that are glutamatergic, GABAergic, dopaminergic, serotonergic, or cholinergic; an interneuron or a motor neuron.

[0344] 17A. A method of modulating neuronal excitability in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein.

[0345] 18A. The method of embodiment 17A, wherein the carbonic anhydrase protein is CA8, CA10, CA11, or fragments thereof.

[0346] 19A. The method of embodiment 13A or embodiment 14A, wherein the carbonic anhydrase protein is a CA8 fragment.

[0347] 20A. The method of embodiment 19A, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

[0348] 21A. The method of embodiment 19A or embodiment 20A, wherein the CA8 fragment is CA8-204C or CA8-204G.

[0349] 22A. The method of any one of embodiments 17A-21 A, wherein the method comprises contacting the cell with a vector comprising a nucleic acid encoding the carbonic anhydrase protein.

[0350] 23A. The method of embodiment 22A, wherein the vector is a lentiviral vector.

[0351] 24A. The method of embodiment 22A, wherein the vector is an AAV viral vector.

[0352] 25A. The method of embodiment 22A, wherein the vector is a HSV viral vector.

[0353] 26A. The method of embodiment 22A, wherein the vector is an adenoviral vector.

[0354] 27A. The method of embodiment 22A, wherein the vector is a replication defective viral vector.

[0355] 28A. The method of any one of embodiments 17A-27A, that decreases neuronal excitability in the cell.

[0356] 29A. The method of any one of embodiments 17A-28A, wherein the nucleic acid is operably linked to a promoter.

[0357] 30A. The method of embodiment 29A, wherein the promoter is associated with a gene selected from TrkA, TrkB, TrkC, Nav1.7, Nav1.8, Nav1.9, advillin, beta-amyloid, ApoE, presenilin 1 or 2, tau, TREM2, DJ-1, GBA, LRRK2, Parkin, PINK1 , alpha-synuclein, UCHL1, VPS35, C9orf72, FUS, SOD1, SQSTM1, TDP43, VGLUT1, VGLUT2, ADORA2A, DARPP-32, GAD1, GAD2 , neuropeptide Y, Penk, ALDH1A1, FoxA2, GIRK2, Lmx1 B, tyrosine hydroxylase, FEV, SERT, TPH2, tryptophan hydroxylase, ChAT, calbindin, calretinin, 5HT3A receptor, parvalbumin, somatostatin, VIP, HB9, Islet-1, Islet-2, neurogenin-2, and Olig2.

[0358] 31 A. The method of any one of embodiments 17A-30A, wherein the neural cell is a somatosensory neuron, a neural stem cell; a neuroepithelial cell; a Schwann cell; a radial glial cell; an oligodendrocyte; an astrocyte; an immature neuron; mature neurons that are glutamatergic, GABAergic, dopaminergic, serotonergic, cholinergic; an interneuron or a motor neuron.

[0359] 32A. A method of treating a condition associated with aberrant Kv7 voltage-gated potassium channel activity in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein to the subject, wherein the condition to be treated is not pain.

[0360] 33A. A method of treating a condition associated with elevated neuronal excitability in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein to the subject, wherein the condition to be treated is not pain.

[0361] 34A. The method of embodiment 32A or embodiment 33A, wherein the carbonic anhydrase protein is CA8, CA10, CA11 , or fragments thereof.

[0362] 35A. The method of any one of embodiments 32A-34A, wherein the carbonic anhydrase protein is aCA8 fragment.

[0363] 36A. The method of embodiment 35A, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

[0364] 37A. The method of embodiment 35A or embodiment 36A, wherein the CA8 fragment is CA8-204C or CA8-204G.

[0365] 38A. The method of any one of embodiments 32A and 34A-37A, wherein the Kv7 voltage-gated potassium channel is Kv7.2, Kv7.3, Kv7.4, or Kv7.5.

[0366] 39A. The method of any one of embodiments 32A-38A, wherein the vector is a lentiviral vector.

[0367] 40A. The method of embodiment 39A, wherein the vector is a lentiviral vector.

[0368] 41 A. The method of embodiment 39A, wherein the vector is an AAV viral vector.

[0369] 42A. The method of embodiment 39A, wherein the vector is a HSV viral vector.

[0370] 43A. The method of embodiment 39A, wherein the vector is an adenoviral vector.

[0371] 44A. The method of embodiment 39A, wherein the vector is a replication defective viral vector.

[0372] 45A. The method of any one of embodiments 32A-44A, wherein the nucleic acid is operably linked to a promoter.

[0373] 46A. The method of embodiment 45A, wherein the promoter is associated with a gene selected from the group consisting of TrkA, TrkB, TrkC, Nav1.7, Nav1.8, Nav1.9, advillin, beta-amyloid, ApoE, presenilin 1 or 2, tau, TREM2, DJ-1, GBA, LRRK2, Parkin, PINK1, alpha-synuclein, UCHL1, VPS35, C9orf72, FUS, SOD1, SQSTM1, TDP43, VGLUT1, VGLUT2, ADORA2A, DARPP-32, GAD1, GAD2 , neuropeptide Y, Penk, ALDH1A1, FoxA2, GIRK2, Lmx1 B, tyrosine hydroxylase, FEV, SERT, TPH2, tryptophan hydroxylase, ChAT, calbindin, calretinin, 5HT3A receptor, parvalbumin, somatostatin, VIP, HB9, Islet-1, Islet-2, neurogenin-2, and Olig2.

[0374] 47A. The method of any one of embodiments 32A-46A, wherein the condition is amyotrophic lateral sclerosis (ALS), epilepsy, peripheral nerve hyperexcitability, age-related Alzheimer's Disease, Huntington's disease, or hearing loss.

[0375] 48A. The method of any one of embodiments 32A-46A, wherein the condition is epilepsy.

[0376] 49A. The method of any one of embodiments 32A-46A, wherein the condition is hearing loss.

[0377] 50A. A method comprising contacting a cell with a vector comprising an exogenous nucleic acid encoding a carbonic anhydrase protein, and measuring a change in Kv7 voltage-gated potassium channel activation in the cell.

[0378] 51A. The method of embodiment 50A, wherein the carbonic anhydrase protein is CA8, CA10, CA11, or fragments thereof.

[0379] 52A. The method of embodiment 51 A or embodiment 52A, wherein the carbonic anhydrase protein is a CA8 fragment.

[0380] 53A. The method of embodiment 52A, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

[0381] 54A. The method of embodiment 52A or embodiment 53A, wherein the CA8 fragment is CA8-204C or CA8-204G.

[0382] 55A. The method of any one of embodiments 50A-54A, wherein the Kv7 voltage-gated potassium channel is Kv7.2, Kv7.3, Kv7.4, or Kv7.5.

[0383] 56A. The method of any one of embodiments 50A-55A, wherein the cell comprises two or more Kv7 potassium channels.

[0384] 57A. The method of any one of embodiments 50A-56A, wherein the vector is a lentiviral vector.

[0385] 58A. A method comprising contacting a cell encoding an exogenous variant Kv7 voltage-gated potassium channel with a candidate agent, and measuring a change in Kv7 voltage-gated potassium channel activation in the cell.

[0386] 59A. The method of any one of embodiments 50A-58A, wherein the Kv7 voltage-gated potassium channel activation is measured in a patch clamp assay.

[0387] 60A. The method of any one of embodiments 50A-59A, wherein the Kv7 voltage-gated potassium channel activation is measured by potassium flux assay.

[0388] 61 A. The method of embodiment 60A, wherein potassium flux is measured by fluorescence-based methods.

[0389] 62A. The method of any one of embodiments 50A-58A, wherein the Kv7 voltage-gated potassium channel activation is measured by Rubidium flux assay.

[0390] 63A. The method of any one of embodiments 50A-58A, wherein the Kv7 voltage-gated potassium channel activation is measured by thalium flux assay.

[0391] 64A. The method of any one of embodiments 50A-58A, wherein the Kv7 voltage-gated potassium channel activation is measured by ligand binding assay.

[0392] 65A. The method of any one of embodiments 50A-58A, wherein the Kv7 voltage-gated potassium channel is measured indirectly by calcium-sensitive dyes.

[0393] 66A. A cell that has been genetically modified to express an exogenous variant Kv7 voltage-gated potassium channel.

[0394] 67A. The cell of embodiment 66A, wherein the cell expresses Kv7.3-D755N or Kv7.3-T730A.

[0395] 68A. The cell of embodiment 6A, wherein the variant Kv7 voltage-gated potassium channel is encoded by KCNQ2-N258K or KCNQ2-G269D.

[0396] 69A. The cell of any one of embodiments 66A-68A, that is a HEK293 cell.

[0397] 70A. A kit comprising the cell of any one of embodiments 66A-68A and one or more reagents.

[0398] 71 A. The kit of embodiment 70A, wherein the one or more reagents are fluorescent dyes(s), rubidium, thallium, or other potassium flux measures.

[0399] Sequence Listing table

Claims

What is claimed is:1 . A method of activating a Kv7 voltage-gated potassium channel in a neural cell comprising contacting the cell with a nucleic acid encoding a carbonic anhydrase (CA) protein.

2. The method of claim 1 , wherein the carbonic anhydrase protein is CA8, CA10, CA11 , or fragments thereof.

3. The method of claim 1 or claim 2, wherein the carbonic anhydrase protein is a CA8 fragment.

4. The method of claim 3, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

5. The method of claim 3 or claim 4, wherein the CA8 fragment is CA8-204C or CA8-204G.

6. The method of any one of claims 1-5, wherein the Kv7 voltage-gated potassium channel is Kv7.2,Kv7.3, Kv7.4, or Kv7.5.

7. The method of any one of claims 1-6, wherein the cell comprises two or more Kv7 voltage-gated potassium channels.

8. The method of any one of claims 1-7, wherein the method comprises contacting the cell with a vector comprising a nucleic acid encoding the carbonic anhydrase protein.

9. The method of claim 8, wherein the vector is a lentiviral vector.10 The method of claim 8, wherein the vector is an AAV viral vector.11 . The method of claim 8, wherein the vector is a HSV viral vector.

12. The method of claim 8, wherein the vector is an adenoviral vector.13 The method of claim 8, wherein the vector is a replication defective viral vector.

14. The method of any one of claims 1-13, wherein the nucleic acid is operably linked to a promoter.

15. The method of claim 14, wherein the promoter is associated with a gene selected from TrkA, TrkB, TrkC, Nav1.7, Nav1.8, Nav1.9, advillin, beta-amyloid, ApoE, presenilin 1 or 2, tau, TREM2, DJ-1, GBA, LRRK2, Parkin, PINK1, alpha-synuclein, UCHL1, VPS35, C9orf72, FUS, SOD1, SQSTM1, TDP43, VGLUT1, VGLUT2, ADORA2A, DARPP-32, GAD1, GAD2 , neuropeptide Y, Penk, ALDH1A1, FoxA2, GIRK2, Lmx1 B, tyrosine hydroxylase, FEV, SERT, TPH2, tryptophan hydroxylase, ChAT, calbindin, calretinin, 5HT3A receptor, parvalbumin, somatostatin, VIP, HB9, Islet-1, Islet-2, neurogenin-2, and Olig2.

16. The method of any one of claims 1-15, wherein the neural cell is a somatosensory neuron, a neural stem cell; a neuroepithelial cell; a Schwann cell; a radial glial cell; an oligodendrocyte; an astrocyte; an immature neuron; mature neurons that are glutamatergic, GABAergic, dopaminergic, serotonergic, or cholinergic; an interneuron or a motor neuron.

17. A method of modulating neuronal excitability in a neural cell comprising contacting the cell with an exogenous nucleic acid encoding a carbonic anhydrase (CA) protein.

18. The method of claim 17, wherein the carbonic anhydrase protein is CA8, CA10, CA11, or fragments thereof.

19. The method of claim 13 or claim 14, wherein the carbonic anhydrase protein is a CA8 fragment.

20. The method of claim 95, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.21 . The method of claim 19 or claim 20, wherein the CA8 fragment is CA8-204C or CA8-204G.

22. The method of any one of claims 17-21 , wherein the method comprises contacting the cell with a vector comprising a nucleic acid encoding the carbonic anhydrase protein.

23. The method of claim 22, wherein the vector is a lentiviral vector.

24. The method of claim 22, wherein the vector is an AAV viral vector.

25. The method of claim 22, wherein the vector is a HSV viral vector.

26. The method of claim 22, wherein the vector is an adenoviral vector.

27. The method of claim 22, wherein the vector is a replication defective viral vector.

28. The method of any one of 17-27, that decreases neuronal excitability in the cell.

29. The method of any one of claims 17-28, wherein the nucleic acid is operably linked to a promoter.

30. The method of claim 29, wherein the promoter is associated with a gene selected from TrkA, TrkB,TrkC, Nav1.7, Nav1.8, Nav1.9, advillin, beta-amyloid, ApoE, presenilin 1 or 2, tau, TREM2, DJ-1, GBA, LRRK2, Parkin, PINK1, alpha-synuclein, UCHL1, VPS35, C9orf72, FUS, SOD1, SQSTM1, TDP43, VGLUT1, VGLUT2, ADORA2A, DARPP-32, GAD1, GAD2 , neuropeptide Y, Penk, ALDH1A1, FoxA2, GIRK2, Lmx1 B, tyrosine hydroxylase, FEV, SERT, TPH2, tryptophan hydroxylase, ChAT, calbindin, calretinin, 5HT3A receptor, parvalbumin, somatostatin, VIP, HB9, Islet-1, Islet-2, neurogenin-2, or Olig2.31 . The method of any one of claims 17-30, wherein the neural cell is a somatosensory neuron, a neural stem cell; a neuroepithelial cell; a Schwann cell; a radial glial cell; an oligodendrocyte; an astrocyte; an immature neuron; mature neurons that are glutamatergic, GABAergic, dopaminergic, serotonergic, cholinergic; an interneuron or a motor neuron.

32. A method of treating a condition associated with aberrant Kv7 voltage-gated potassium channel activity in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein to the subject, wherein the condition to be treated is not pain.

33. A method of treating a condition associated with elevated neuronal excitability in a subject in need thereof, comprising administering a vector comprising a nucleic acid encoding a carbonic anhydrase (CA) protein to the subject, wherein the condition to be treated is not pain.

34. The method of claim 32 or claim 33, wherein the carbonic anhydrase protein is CA8, CA10, CA11, or fragments thereof.

35. The method of any one of claims 32-34, wherein the carbonic anhydrase protein is a CA8 fragment.

36. The method of claim 35, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

37. The method of claim 35 or claim 36, wherein the CA8 fragment is CA8-204C or CA8-204G.

38. The method of any one of claims 32 and 34-37, wherein the Kv7 voltage-gated potassium channel isKv7.2, Kv7.3, Kv7.4, or Kv7.5.

39. The method of any one of claims 32-38, wherein the vector is a lentiviral vector.

40. The method of claim 39, wherein the vector is a lentiviral vector.41 . The method of claim 39, wherein the vector is an AAV viral vector.

42. The method of claim 39, wherein the vector is a HSV viral vector.

43. The method of claim 39, wherein the vector is an adenoviral vector.

44. The method of claim 39, wherein the vector is a replication defective viral vector.

45. The method of any one of claims 32-44, wherein the nucleic acid is operably linked to a promoter.

46. The method of claim 45, wherein the promoter is associated with a gene selected from the group consisting of TrkA, TrkB, TrkC, Nav1.7, Nav1.8, Nav1.9, advillin, beta-amyloid, ApoE, presenilin 1 or 2, tau, TREM2, DJ-1, GBA, LRRK2, Parkin, PINK1, alpha-synuclein, UCHL1, VPS35, C9orf72, FUS, SOD1, SQSTM1, TDP43, VGLUT1, VGLUT2, ADORA2A, DARPP-32, GAD1, GAD2 , neuropeptide Y, Penk, ALDH1A1, FoxA2, GIRK2, Lmx1 B, tyrosine hydroxylase, FEV, SERT, TPH2, tryptophan hydroxylase, ChAT, calbindin, calretinin, 5HT3A receptor, parvalbumin, somatostatin, VIP, HB9, Islet-1, Islet-2, neurogenin-2, and Olig2.

47. The method of any one of claims 32-46, wherein the condition is amyotrophic lateral sclerosis (ALS), epilepsy, peripheral nerve hyperexcitability, age-related Alzheimer's Disease, Huntington's disease, or hearing loss.

48. The method of any one of claims 32-46, wherein the condition is epilepsy.

49. The method of any one of claims 32-46, wherein the condition is hearing loss.

50. A method comprising the contacting a cell with a vector comprising a nucleic acid encoding a carbonic anhydrase protein, and measuring a change in Kv7 voltage-gated potassium channel activation in the cell.51 . The method of claim 50, wherein the carbonic anhydrase protein is CA8, CA10, CA11 , or fragments thereof.

52. The method of claim 51 or claim 52, wherein the carbonic anhydrase protein is a CA8 fragment.

53. The method of claim 52, wherein the CA8 fragment is CA8-202, CA8-203, or CA8-204.

54. The method of claim 52 or claim 53, wherein the CA8 fragment is CA8-204C or CA8-204G.

55. The method of any one of claims 50-54, wherein the Kv7 voltage-gated potassium channel is Kv7.2, Kv7.3, Kv7.4, or Kv7.5.

56. The method of any one of claims 50-55, wherein the cell comprises two or more Kv7 potassium channels.

57. The method of any one of claims 50-56, wherein the vector is a lentiviral vector.

58. A method comprising contacting a cell encoding a mutated Kv7 voltage-gated potassium channel with a candidate agent, and measuring a change in Kv7 voltage-gated potassium channel activation in the cell.

59. The method of any one of claims 50-58, wherein the Kv7 voltage-gated potassium channel activation is measured in a patch clamp assay.

60. The method of any one of claims 50-58, wherein the Kv7 voltage-gated potassium channel activation potential is measured by potassium flux assay.61 . The method of claim 60, wherein potassium flux is measured by fluorescence-based methods.

62. The method of any one of claims 50-58, wherein the Kv7 voltage-gated potassium channel activation is measured by Rubidium flux assay.

63. The method of any one of claims 50-58, wherein the Kv7 voltage-gated potassium channel activation is measured by thalium flux assay.

64. The method of any one of claims 50-58, wherein the Kv7 voltage-gated potassium channel activation is measured by ligand binding assay.

65. The method of any one of claims 50-58, wherein the Kv7 voltage-gated potassium channel activation is measured indirectly by calcium-sensitive dyes.

66. A cell that has been genetically modified to express an exogenous variant Kv7 voltage-gated potassium channel.

67. The cell of claim 66, wherein the cell expresses Kv7.3-D755N or Kv7.3-T730A.

68. The cell of claim 66, wherein the variant Kv7 voltage-gated potassium channel is encoded by KCNQ2- N258K or KCNQ2-G269D.

69. The cell of any one of claims 66-68, that is a HEK293 cell.

70. A kit comprising the cell of any one of claims 66-68 and one or more reagents.

71. The kit of claim 70, wherein the one or more reagents are fluorescent dyes(s), rubidium, thallium, or other potassium flux measures.

Images