Gene editing treatment for correcting splicing defect in familial dysautonomia
CRISPR base editors with optimized deaminase domains and intein-split delivery systems correct the ELP1 T-to-C mutation in FD, addressing neuronal loss and providing a permanent therapeutic solution.
Patent Information
- Application Number
- PCT/US2025/026694
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-26
- Filing Date
- 2025-04-28
- Publication Date
- 2025-10-30
AI Technical Summary
There are no effective treatments to halt the progressive neuronal loss in familial dysautonomia (FD), a fatal autosomal recessive neuropathy caused by a T-to-C mutation in the ELP1 gene leading to premature termination codons and reduced ELP1 protein levels, resulting in severe sensory and autonomic dysfunctions.
Utilizing CRISPR base editors with optimized deaminase domains and gRNAs to precisely correct the ELP1 T-to-C mutation, combined with an engineered dual intein-split system delivered via adeno-associated virus vectors, to promote up to 70% on-target editing and restore correct exon 20 inclusion in the ELP1 transcript.
The method achieves high specificity and minimal off-target editing, effectively correcting the ELP1 splicing defect and rescuing the FD phenotype in human neurons, offering a potential permanent cure.
Smart Images

Figure US2025026694_30102025_PF_FP_ABST
Abstract
Description
[0001] GENE EDITING TREATMENT FOR CORRECTING SPLICING DEFECT IN FAMILIAL DYSAUTONOMIA
[0002] CLAIM OF PRIORITY
[0003] This application claims priority under 35 USC §119(e) to U.S. Provisional Application Serial No. 63 / 639.553, filed on April 26, 2024. The entire contents of the foregoing are incorporated herein by reference.
[0004] SEQUENCE LISTING
[0005] This application contains a Sequence Listing that has been submitted electronically as an XML file named 29539-0828WO1 SL ST26.xml. The XML file, created on April 28, 2025, is 190,002 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.
[0006] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0007] This invention was made with Government support under Grant Nos. NS134784, NS124561, NS095640, and EY037018 awarded by the National Institutes of Health. The Government has certain rights in the invention.
[0008] TECHNICAL FIELD
[0009] Provided herein are compositions and methods for treating familial dysautonomia (FD) using gene therapy to correct the ELP1 splicing mutation associated with the disease.
[0010] BACKGROUND
[0011] Familial dysautonomia (FD) is a fatal autosomal recessive neuropathy characterized by sensory and autonomic dysfunctions. Individuals with FD have a significantly reduced life expectancy, with most not surviving beyond early adulthood. FD is caused by a T-to-C mutation in intron 20 of the Elongator acetyltransferase complex subunit 1 (ELP1) gene, which causes tissue-specific skipping of exon 20, leading to a premature termination codon and a corresponding reduction in ELP1 protein levels. No effective treatments currently exist to halt the progressive neuronal loss that defines this devastating disorder. SUMMARY
[0012] Familial dysautonomia (FD) also known as HSANIII or Riley-Day syndrome, is caused by a T-to-C base transition at the 6th base of intron 20 (c.2204+6T>C) of the Elongator acetyltransferase complex subunit 1 (ELP1, previously known as IKBKAP) (see, e.g., Slaugenhaupt et al., Am. J. Hum. Genet. 68, 598-605 (2001); Gutierrez et al., Clin Neurophysiol. 2018 Feb;129(2):390-396; Rubin & Anderson, Appl Clin Genet. 2017 Dec 15:10:95-103). This mutation (henceforth ELP1 T6C) results in variable tissue-specific skipping of exon 20, leading to a premature termination codon and a corresponding reduction in ELP 1 protein (FIG. 13). The lowest levels of ELP 1 occur in the central and peripheral nervous system. All FD patients possess at least one copy of this mutation, and 99.5% of patients are homozygous. FD symptoms include decreased pain and temperature sensation, orthostatic hypotension, tachycardia, labile blood pressure, gait ataxia, and retinal degeneration. Although FD is associated with a complex neurological phenoty pe caused by the continuing depletion of sensory and autonomic neurons, the progression of visual decline and gait ataxia are the most problematic manifestations as they severely affect FD patients’ quality of life (Mendoza-Santiesteban et al., J. Neuroophthalmol. 32, 23-26 (2012); Mendoza-Santiesteban et al., J. Neuropathol. Exp. Neurol. 76, 238-244 (2017); Macefield et al., Brain 134, 3198-3208 (2011); Macefi eld et al, Alov. Disord. 28, 823-827 (2011)). Retinal degeneration in FD is progressive as evidenced by decreased visual acuity, poor color vision and central visual field loss, temporal optic nerve pallor, and delay in visual evoked potentials. As children with FD age, progressive impairment in proprioception leads to severe gait ataxia, and they eventually lose the ability to ambulate independently (Macefield et al. Brain 134, 3198-3208 (2011); Macefield et al, Mov. Disord. 28, 823-827 (2011)). Developing a permanent therapy that corrects the underlying cause of the disease and stops neuronal degeneration would transform FD patients’ lives. To date, there are no treatments available to stop the continuous neuronal loss in FD patients and no available strategies to offer a permanent cure.
[0013] Provided by the present disclosure are CRISPR base editors (BE) and methods of use thereof for precisely correcting this mutation. By leveraging Cas9 variants fused to novel deaminase domains and screening multiple gRNAs, the present disclosure provides a BE approach that can promote up to 70% on-target editing in human cells (e.g., HEK293T cells) harboring the ELP1 T-to-C mutation. As shown herein, these editing levels are sufficient to restore correct exon 20 inclusion in the ELP1 transcript. An engineered dual intein-split system is also provided herein to deliver the disclosed constructs in vivo. Constructs pf the present disclosure can be packaged in adeno-associated virus (AAV) vectors. Methods of using the disclosed constructs can effectively correct the ELP1 splicing defects in vivo in brain tissue and rescue the FD phenotype in human neurons. Methods provided herein can have minimal off-target editing, demonstrating high levels of specificity with these optimized base editors. The data provided herein establish a novel and highly precise PE- and BE-based therapeutic approach for correcting the FD mutation and associated splicing defects.
[0014] Provided herein are compositions comprising at least one base editor, or a nucleic acid encoding at least one base editor and at least one guide RNA (gRNA), wherein the gRNA comprises a spacer sequence that is complementary to a target sequence in the ELP1 gene. In some embodiments, the gRNA is complementary to a target sequence listed in Table 3 (SEQ ID NOS: 185-189). In some embodiments, the gRNA comprises a spacer sequence listed in Table 3 and / or Table 4 (SEQ ID NOS: 1- 16 and 190-194). In some embodiments, the gRNA spacer sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 16, SEQ ID NO: 13, SEQ ID NO: 10, SEQ ID NO: 9, SEQ ID NO: 190. SEQ ID NO: 191, SEQ ID NO: 192, SEQ ID NO: 193, and SEQ ID NO: 194. In some embodiments, the at least one base editor comprises at least one DNA binding domain and at least one heterologous functional domain. In some embodiments, the at least one DNA binding domain comprises a Cas9 DNA binding domain. In some embodiments, the Cas9 DNA binding domain is a DNA binding domain from a wild type Cas9 protein from S', pyogenes (SpCas9) or a variant thereof. In some embodiments, the Cas9 DNA binding domain is a DNA binding domain from SpRY. In some embodiments, the Cas9 DNA binding domain is a DNA binding domain from SpG. In some embodiments, the at least one heterologous functional domain comprises a deaminase domain, optionally wherein the deaminase domain is a cytidine deaminase domain. In some embodiments, the deaminase domain comprises at least one evolved TadA cytidine deaminase. In some embodiments, the at least one base editor comprises a linker between the DNA binding domain and the heterologous functional domain. In some embodiments, the at least one base editor comprises a cytosine base editor selected from the group consisting of A3G-BE. A3G-BE5.14, Target-AID, Target- AIDmax, Target-AID-NG, SpCas9-TadCBEa, SpCas9- TadCBEb, SpCas9-TadCBEc, SpCas9-TadCBEd, SpCas9-TadCBEe, SpCas9- TadCBEa-V106W, SpCas9-TadCBEd-V106W, SpCas9-TadCBEd-N108Q / L145T, SpRY- Cas9, SpCas9-TadCBEd-V106W / N108Q / L145T, BE4max-NG. BE4max- NRCH. AncBE4-max-NG. YE2-BE3, EE-BE3, YEE-BE3, eAID-BE4max. BE4-max, AncBE4-max, YE2-BE4-NG, EE-BE4-NG, YEE-BE4-NG, R33A+ K34A-BE4-NG, xCas9-BE, SpCas9-NRRH-BE, Td-CBEs and EQR-BE. In some embodiments, compositions disclosed herein comprise a base editor and a gRNA, wherein: (i) the base editor is TadCBEd-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: I E (ii) the base editor is TadCBE6a-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 11 ; (iii) the base editor is TadCBE6b-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 11; (iv) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 11; (v) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 16; (vi) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 13; (vii) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 10; and / or (viii) the base editor is TadCBEd-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 9. In some embodiments, the base editor comprises a split-intein base editor.
[0015] Also provided herein are compositions comprising at least one prime editor or a nucleic acid encoding the at least one prime editor, and at least one prime editing guide RNA (pegRNA), wherein the at least one pegRNA comprises a spacer sequence that is complementary to a target sequence in the ELP1 gene. In some embodiments, the at least one prime editor comprises a Cas9 DNA binding protein from S. pyogenes (SpCas9) or a variant thereof. In some embodiments, the at least one prime editor comprises a PEmax prime editing system. In some embodiments, the pegRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 33 or SEQ ID NO: 34. In some embodiments, the at least one pegRNA further comprises at least one spacer sequence for second nicking, optionally wherein the at least one spacer sequence for second nicking comprises the nucleic acid sequence SEQ ID NO: 204. In some embodiments, the at least one pegRNA comprises a primer binding site (PBS) and a reverse transcriptase (RT) template sequence, optionally wherein the PBS / RT template sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 37-45. In some embodiments, the at least one pegRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 195-203.
[0016] In some embodiments, the nucleic acid is in an adeno-associated virus (AAV) vector comprising at least one nucleic acid encoding: (i) the at least one base editor and / or the at least one guide RNA (gRNA) disclosed herein; and / or (ii) the at least one prime editor and / or the at least one pegRNA disclosed herein, or wherein the composition comprises an mRNA encoding the base editor or prime editor. In some embodiments, the AAV vector is a AAV9 vector or a AAV2 vector.
[0017] Provided herein are lipid nanoparticles comprising (i) the composition comprising at least one base editor and / or the at least one guide RNA (gRNA) as disclosed herein; or (ii) the composition compnsing at least one prime editor and / or the at least one pegRNA as disclosed herein. In some embodiments, lipid nanoparticles disclosed herein can comprise at least one ribonucleoprotein (RNP), wherein the at least one RNP comprises: (i) the composition comprising at least one base editor and / or the at least one guide RNA (gRNA) as disclosed herein; or (ii) the composition comprising at least one prime editor and / or the at least one pegRNA as disclosed herein.
[0018] Provided herein are methods of correcting a T-to-C mutation in intron 20 of the Elongator acetyltransferase complex subunit 1 (EI.P1) gene in the genome of a cell. In some embodiments, a method of correcting a T-to-C mutation in intron 20 of the ELP1 gene in the genome of a cell, comprises delivering to the cell at least one composition as disclosed herein, or at least one lipid nanoparticle as disclosed herein.
[0019] Provided herein are also methods of treating familial dysautonomia (FD) in a subject in need thereof. In some embodiments, methods of FD in a subject in need thereof can comprise delivering to a cell in the subject a therapeutically effective amount of at least one composition as disclosed herein, or at least one lipid nanoparticle as disclosed herein. In some embodiments, the subject in need thereof has a T-to-C base transition at the 6th base of intron 20 (c.2204+6T>C) of the ELP1 gene. In some embodiments, the cell is in the subject in need thereof. In some embodiments, the cell in the subject in need thereof is in the brain and / or eye of the subject. In some embodiments, a composition and / or a lipid nanoparticle as disclosed herein is administered to the subject in need thereof by local or systemic delivery. In some embodiments, at least 5% of the ELP1 gene is edited following the delivery to the cell in the subject.
[0020] Additionally, provided herein are pharmaceutical compositions. In some embodiments, a pharmaceutical composition comprises at least one of the compositions disclosed herein and / or at least one of the lipid nanoparticles as disclosed herein and at least one pharmaceutically accepted earner.
[0021] Also provided herein are kits for use in any of the methods disclosed herein, wherein the kits can comprise a base editor, a gRNA, a prime editor, a pegRNA, an AAV vector, a lipid nanoparticle, a mRNA encoding a base editor and / or a prime editor, a composition, and / or a pharmaceutical composition as disclosed herein.
[0022] As used herein, the term “about” means plus or minus 10%.
[0023] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
[0024] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
[0025] DESCRIPTION OF DRAWINGS
[0026] FIGS. 1A-1G depict the development of cytosine base editors to correct the ELP1 T6C mutation responsible for FD. FIG. 1A shows a schematic of familial dysautonomia (FD) symptoms caused by reduced ELP1 protein levels affecting the autonomic and sensory nervous system. FIG. IB shows a schematic of FD caused by reduction in ELP1 protein levels due to a T-to-C (T6C) mutation in the position 6 of intron 20. FIG. 1C shows a schematic of the genomic region surrounding the ELP1 T6C mutation, showing base editor guide RNA (gRNA) target sites; potential bystander edits are highlighted in light gray boxes. Shown are C-to-T base editing to correct ELP1 T6C in homozygous HEK293T cells using TadCBEd, which comprises deaminase domains fused to PAM-variant SpCas9 enzymes (nSpRY (FIG. ID) and nSpG (FIG. IE)). Edited alleles were assessed via targeted sequencing and analyzed using CRISPResso2. Show n are comparisons of deaminase activity for correcting the ELP1 T6C mutation in homozygous HEK293T cells using TadCBEd, CBE6a, or CBE6b deaminase domains fused to SpG paired with gRNA C6 (FIG. IF) or SpRY paired with gRNA Cl 1 (FIG. 1G). Data in FIGS. 1D-1G are from experiments in HEK 293T cells harboring the ELP1 T6C mutation; mean, s.e.m.. and individual datapoints shown for n = 3 independent biological replicates.
[0027] FIGS. 2A-2K depict the engineering of an intein-split system for in vivo delivery' via adeno- associated virus (AAV). FIG. 2A shows a schematic of plasmid transfection experiments in HEK293T-EZP7-T6C cells using ITR-containing intein- split AAV production plasmid for TadCBEd fused with SpCas9 variants SpG or SpRY with N-terminus and C-terminus. Comparison between strategies with or without guide RNA (gRNA) expression in the N-term. Shown are C-to-T base editing to correct ELP1 T6C in homozygous HEK293T cells using AAV plasmids illustrated in FIG. 2A. comprising TadCBEd-nSpG (FIG. 2B) or TadCBEd-nSpRY (FIG. 2C). Shown are ELP1 splicing assessing exon 20 inclusion (FIG. 2D) and quantification (FIG. 2E) for splicing enhancement in HEK293T ELP1 T6C cells treated with conventional base editor or intein-split plasmids. FIG. 2F shows a qPCR analysis of full-length ELP1 transcript expression following treatment with conventional and AAV plasmid systems using SpCas9 variants SpG paired with gRNA-C6 and SpRY paired with gRNA-Cl 1). FIG. 2G shows C-to-T editing efficiency using DNA titration of intein-split AAV plasmid in HEK293T ELP1 T6C cells. FIG. 2H shows a schematic comparing opposite vs. tandem gRNA cassette orientation relative to SpCas9 expression in ITR-containing intein-split AAV production plasmids. FIG. 21 shows C-to-T editing efficiency comparison between opposite and tandem gRNA orientations in intein-split AAV plasmids. Shown are ELP1 splicing assessing exon 20 inclusion (FIG. 2J) and quantification (FIG. 2K) for splicing enhancement when HEK293T ELP1 T6C cells were treated with the construct in FIG. 2H. Data in FIGS. 2B-2C, 2E-2G, 2L, and 2K are from experiments in HEK293T cells; mean, s.e.m, and individual datapoints shown for n = 2 or 3 independent biological replicates.
[0028] FIGS. 3A-3H depict base editing specificity in correcting the ELP1 T6C mutation. Shown are results from GUIDE-seq2 experiments including analysis of insertion or deletion (indels; FIG. 3A) and quantification of reads containing the GUIDE-seq2 dsODN tag (FIG. 3B) in ELP1 T6C HEK 293T cells when using SpCas9 variants SpG nuclease with gRNA-C6 or SpRY nuclease with gRNA-Cl 1. FIG. 3C shows the total number of GUIDE-seq2-detected off-target sites using SpG or SpRY. FIG. 3D show s the percentage of total GUIDE-seq reads attributable to the on-target site or cumulative off-target sites. FIG. 3E show s the number of putative off-target sites in the human genome with up to 3 mismatches for the spacers of gRNAs C6 and Cl 1, as annotated by CasOFFinder. FIG. 3F shows the on-target C- to-T editing levels in HEK293T-5Z 7-T6C cells, iPSC-derived FD-sympathetic neurons, and FD patient primary fibroblast cells when treated with TadCBEd-nSpG paired with gRNA-C6. FIG. 3G shows a pie chart showing a summary of off-target sites validated for gRNA C6 and SpG across all 3 cell types in FIG. 3F, based on in silica CasOFFinder and GUIDE-seq2 nominations. FIG. 3H shows a summaiy of on- and off-target base editing levels in three cell lines from FIG. 3F. Cells were untreated (naive) or treated with TadCBEd-nPSG and gRNA C6. Genomic DNA was subjected to PCR for the on-target site and 19 off-target sites (nominated by CasOFFinder and GUIDE-seq2) with data analysis via CRISPResso2 for n = 3 independent biological replicates. For FIGS. 3A-3B and 3F, mean, standard errors of the mean (s.e.m.), and individual data points are shown for n = 3 or 9 independent biological replicates.
[0029] FIGS. 4A-4K depict AAV -mediated delivery of base editors for in vivo ELP1 C6T editing. FIG. 4A shows a schematic of local retina injections of dual AAV2-BE vectors expressing intein-split TadCBEd-SpG and gRNA C6 into TgFD9 mice carry ing the human ELP1 transgene with T6C mutation. Mice retina ganglion cells were isolated and sorted based on GFP expression at 4 or 6 weeks post-injection. FIG. 4B shows a schematic of Pl-2 intravenous (IV) injections of AAV9-BE vectors expressing intein-split TadCBEd-SpG and gRNA C6 into TgFD9 neonates. Mice were sacrificed, and tissues were harvested at 12- or 22-days post-injection. Shown are on-target C-to-T editing and potential bystander editing in the retina cells (FIG. 4C. cohort 1; FIG. 4D, cohort 2) or across different tissues (FIG. 4E, cohort 3; FIG. 4F, cohort 4) in each cohort treated base editors. Shown are ELP1 splicing in liver (FIG. 4G) and brain FIG. 4H) tissues after AAV9-BE treatment. FIG. 41 shows quantification of the enhanced exon 20 inclusion in tissues as shown in FIGS. 4G and 4H. FIG. 4J shows a schematic of AAV2-BE transduction in iPSC-derived FD sympathetic neurons. Cell culture plates assessed with multielectrode arrays (MEA) were used to record the electrical activity of sympathetic neurons. FIG. 4K shows electrical activity of iPSC-derived FD sympathetic neurons recorded at 5-, 7-, and 10- days post-transduction. Measurements were taken from both untreated and AAV2- BE-treated neurons. The mean firing rate was used to quantify overall neuronal firing activity. For FIG. 4K, mean, standard errors of the mean (s.e.m.), and individual data points are shown for n = 3-6 independent biological replicates.
[0030] FIGS. 5A and 5B depict the generation of a HEK 293T cell line harboring the ELP1 T6C mutation via adenine base editing (ABE). FIG. 5A shows precise intended A-to-G editing to introduce the ELP1 T6C mutation using different deaminases fused to the Cas9 variant nSpRY paired with various gRNAs targeting the intended site. Base editing efficiencies assessed by targeted sequencing and analyzed using CRISPResso2; mean, standard errors of the mean (s.e.m.), and individual datapoints shown for n = 3 independent biological replicates. FIG. 5B shows a schematic of experimental approach to sort and expand clonal HEK 293T cells harboring the ELP1 T6C mutation when using ABE8.20-nSPRY and gRNA-A6 from FIG. 5A.
[0031] FIGS. 6A-6C depict base editing via BE4max or prime editing to correct the ELP1 T6C mutation. Shown are C-to-T base editing to correct ELP1 T6C in homozygous HEK293T cells using BE4max, which comprised deaminase domains fused to PAM-variant enzymes SpRY (FIG. 6A) and SpG (FIG. 6B) with gRNA target sites within the editing window. Edited alleles were assessed via targeted sequencing and analyzed using CRISPResso2. FIG. 6C shows C-to-T prime editing to precisely correct ELP1 T6C in homozygous HEK293T cells using PEmax fused with wild-type (WT) SpCas9 and PAM-variant enzy mes SpG and SpRY with various combinations of RTT-PBS lengths and a second nicking gRNA targeting the nontargeted strand. Data in FIGS. 6A-6C are from experiments in HEK293T cells; mean, s.e.m., and individual datapoints shown for n = 3 independent biological replicates.
[0032] FIGS. 7A and 7B depict off-target site nomination using the nuclease-based GUIDE-seq2 assay. Shown are rank-ordered visualization of genomic on- and off- target sites identified by GUIDE-seq2 experiments performed in ELP1 T6C HEK 293T cells transfected with the SpCas9 variant SpG nuclease and gRNA-C6 (FIG. 7 A), or SpRY nuclease and gRNA-Cl 1 (FIG. 7B). Mismatched positions in the spacers of the off-target sites are highlighted; GUIDE-seq2 read counts from consolidated unique molecular events for each variant are show n to the right of the sequence plots. Datasets represent a single sequencing result from a pool of 3 independent biological replicates prior to sequencing.
[0033] FIGS. 8A-8C depict in silica annotation of putative off-target sites. Shown are putative off-target sites were identified computationally using CasOFFinder for gRNA C6 with NGN PAM and gRNA Cl 1 with NNN PAM. Off-target sites were nominated when considering up to 3 mismatches (FIG. 8A), 3 mismatches with a 1 nt DNA bulge (FIG. 8B), or 3 mismatches with a 1 nt RNA bulge (FIG. 8C).
[0034] FIG. 9 depicts the validation of on- and off-target base editing with TadCBEd-nSpG and gRNA C6 in HEK293T-ELP1-TC6 cells. The on-target site and 20 off-target sites were sequenced using PCR and genomic DNA extracted from independent replicates of untreated homozygous HEK293T-ELP1-T6C cells or cells transfected with TadCBEd-SpG and gRNA-C6. Data were analyzed using CRISPResso2, and base editing efficiencies were plotted for all cytosines and adenines (to assess potential bystander A-to-G editing by TadCBEd) across a wide editing window (defined as bases 1-10 within the target site spacer, counting from the P AM-distal end of the spacer). Off-target sites were selected based on all sites nominated by GUIDE-seq2 and those with up to three mismatches identified by CasOFFinder. The genomic regions for off-target sites 5 and 12 failed to amplify or sequence.
[0035] FIGS. 10A and 10B depict the validation of on- and off-target base editing with AAV2-EBE in iPSC-derived FD sympathetic neurons. FIG. 10A shows a bright- field image of untreated iPSC-derived FD sympathetic neurons and GFP fluorescence image of neurons transduced with AAV2-CBE. FIG. 10B shows on-target site and 20 off-target sites were sequenced using PCR and genomic DNA extracted from independent replicates of untreated samples or samples transduced with AAV2-BE comprised TadCBEd and gRNA-C6. Data were analyzed using CRISPResso2. The base editing efficiencies were plotted for all cytosines and adenines (to assess potential bystander A-to-G editing by CBE) across a wide editing window, defined as bases 1-10 within the target site spacer, counting from the PAM-distal end of the spacer. Off-target sites were selected based on all sites nominated by GUIDE-seq2 and those with up to three mismatches identified by CasOFFinder. The genomic regions for off-target sites 5 and 12 failed to amplify or sequence.
[0036] FIG. 11 depicts the validation of on- and off-target base editing with TadCBEd-nSpG and gRNA-C6 in FD-fibroblasts. The on-target site and 20 off-target sites were sequenced using PCR and genomic DNA extracted from independent replicates of untreated homozygous human primary fibroblast or transfected with TadCBEd-SpG and gRNA-C6. Data were analyzed using CRISPResso2, and base editing efficiencies were plotted for all cytosines and adenines (to assess potential bystander A-to-G editing by CBE) across a wide editing window (defined as bases 1- 10 within the target site spacer, counting from the PAM-distal end of the spacer). Off- target sites were selected based on all sites nominated by GUIDE-seq2 and those with up to three mismatches identified by CasOFFinder. The genomic regions for off-target sites 5 and 12 failed to amplify or sequence.
[0037] FIG. 12 depicts representative images of iPSC-derived FD sympathetic neurons plated and assessed with multielectrode arrays. Shown are representative bright field images of iPSC-derived FD sympathetic neurons untreated or AAV2-BE transduced at day 5 and day 10 post transduction. Scale bar represents 200 gm.
[0038] FIG. 13 depicts a schematic of the T-to-C base transition at the 6th base of intron 20 (c.2204+6T>C) of ELP1 (i.e., the ELP1 T6C mutation), which is the underlying cause of FD.
[0039] DETAILED DESCRIPTION
[0040] Familial dysautonomia (FD), also known as hereditary sensory and autonomic neuropathy type III (HS ANIII) or Riley -Day syndrome, is a rare, fatal, inherited congenital disorder that affects the development and survival of specific unmyelinated sensory and autonomic neurons. FD is caused by a T-to-C base transition at the 6th base of intron 20 (c.2204+6T>C) of the Elongator acetyltransferase complex subunit 1 (ELP1, previously known as IKBKAP) (1, 2). This mutation (henceforth ELP1 T6C) results in variable tissue-specific skipping of ELP1 exon 20, leading to a premature termination codon and a corresponding reduction in ELP1 protein (1, 3). The lowest levels of ELP1 occur in the central and peripheral nervous system (3). All FD patients possess at least one copy of this mutation, and 99.5% of patients are homozygousA. 4). FD symptoms include decreased pain and temperature sensation, orthostatic hypotension, tachycardia, labile blood pressure, gait ataxia, and retinal degeneration^- -10) (FIG. 1A). Neurogenic dysphagia causes frequent aspiration, leading to chronic pulmonary disease. Characteristic hyperadrenergic "autonomic crises" consisting of brisk episodes of severe hypertension, tachycardia, skin blotching, retching, and vomiting occur in all patients. Unexplained sudden death, aspiration pneumonia, and respiratory insufficiency remain the leading causes of death (5, 11). To date, there are no treatments available to stop the continuous neuronal loss in FD patients.
[0041] Previous efforts to develop therapeutic approaches for FD include splicing modulator compounds (SMCs), antisense oligonucleotides (ASOs). modified exonspecific U1 small nuclear RNAs (ExSpe snRNAs), and gene replacement therapy (12- 18). However, none of these potential strategies offer a permanent cure or have been FDA-approved. A drawback of some of these potential therapies such as SMCs lies in their frequent lack of specificity and transient nature. Similarly, ASOs, ExSpe snRNAs and gene replacement therapies have limitations including transient effects, unknown longevity of expression, utilization of ubiquitous exogenous promoters, uncontrolled gene expression, and potential neurotoxicity. Genome editing technologies capable of permanently correcting the FD splicing mutation to adequately maintain endogenous expression of ELP1 would overcome many of these challenges.
[0042] Base editors (BEs) and prime editors (PEs) are genome editing technologies capable of installing point mutations(79 . Recently, we reported pre-clinical efforts to optimize novel BE technologies to treat spinal muscular atrophy (SMA), a severe pediatric neuromuscular disease(20 SMA is caused by mutations in SMN1. SMN2 is a paralogous gene with a base transition in exon 7, which causes this exon to be skipped in most SMN2 transcripts. Thus, the present disclosure provides a BE approach to restore SMN expression by correcting the SMN2 coding sequence. Provided herein are engineered enzymes and guide RNAs (gRNAs) capable of editing SMN2. One optimized combination resulted in up to 99% intended editing in SMA patient-cells, highlighting the great therapeutic potential of customized BEs to introduce corrective genetic edits efficiently and safely. Provided herein are compositions and methods for the genetic treatment for FD which can correct the ELP1 TC6 using cytosine base editing (see. e.g., FIG. IB). Disclosed herein are a series of engineering strategies for optimization of base editors along with a comprehensive evaluation of on-target and off-target editing via unbiased methods. Minimum off-target editing was observed showing high levels of specificity with these optimized base editors. Base editors disclosed herein have proven in vivo effectiveness in a humanized FD mouse model harboring the human ELP1 gene carrying the T-to-C mutation as well as FD induced pluripotent stem cells (iPSCs) derived human neurons (Hirns et al., (2007). Genomics 90, 389-396). Also disclosed herein are compositions and methods for the genetic treatment for FD which can correct the ELP1 TC6 using prime editing. The compositions and methods of the present disclosure are capable of permanently correcting the ELP1 splicing mutation while preserving endogenous expression levels, thus proving a significant advance in therapy for FD.
[0043] Base Editors
[0044] The present methods and compositions use a base editor, e.g., a cytosine base editor (CBE). Cytosine base editors mediate a change from cytosine (C) to thymine (T) via the deamination of deoxycytidine to deoxyuridine, which has binding properties similar to deoxythymidine. Deoxyuridine is recognized as DNA lesions by the cell and repaired by cellular DNA repair mechanisms, resulting in the formation of a T: A base pair subsequent to editing by a CBE. Within first generation cytosine base editors (BE1) usually a catalytically impaired dCas9 protein is linked to a deaminase. The first generation of base editors encountered low base editing efficiency. As CBEs mediate the deamination of cytosines, generating an uracil (U) base, recognized as thymine by the cell’s DNA polymerases. However, uracil can be recognized and eliminated by the enzyme uracil DNAN-glycosylase (UNG) during the initiation of BER, resulting in less C to T edits and increased C to A or C to G edits. Second generation cytosine base editors (BE2) additionally comprise an uracil glycosylase inhibitor (UGI) fused to the base editor. UGI inhibits the action of UNG, thus conserving the uracil base and achieving higher editing efficiency and purity. In third generation base editors (BE3) instead of a cataly tically dead Cas 9 (dCas9) protein the nickase Cas9n is used, introducing a nick on the non-modified DNA strand. This nick serves to bias the cellular repair mechanisms to preferentially replace this strand and use the mutagenic intermediate as a template for repair, thus increasing editing efficiency. Fourth generation cytosine base editors (BE4) comprise an additional copy of UGL thus further reducing C-to G or C to A conversions due to UNG.
[0045] A base editor of the present disclosure (e.g., a CBE) can comprise at least one DNA binding domain and at least one heterologous functional domain. In some embodiments, the heterologous functional domain comprises a deaminase domain e.g., a cytidine deaminase domain, e.g., from the apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like (APOBEC) family of deaminases, including APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D / E, APOBEC3F, APOBEC3G, APOBEC3H, or APOBEC4; activation- induced cytidine deaminase (AID), e.g., activation induced cytidine deaminase (AICDA); cytosine deaminase 1 (CDA1) or CDA2; or cytosine deaminase acting on tRNA (CD AT). In some embodiments, the heterologous functional domain disclosed herein can comprise an engineered cytosine deaminase domain (e.g., BE4max, evoAPOBECl- BE4max, Anc BE4max, FERNY-BE4max, evoFERNY-BE4max. CDAl-BE4max. evoCDAl-BE4max). In some embodiments, the heterologous functional domain disclosed herein can comprise a cytosine deamianse domain from an engineered a bacterial tRNA-specific adenosine deaminase (TadA). In some embodiments, a cytosine deaminase domain from an engineered TadA-based CBE suitable for use herein can be, TadCBEs or TadDEs (Neugebauer et al., Nature Biotecnology. 2023), CBETs or CABE-Ts (Lam et al., Nature Biotechnology, 2023), Td-CBEs or Td- CGBEs (Chen et al., Nature Biotechnology, 2023), CBE6 enzymes (Zhang et al., Nature Communications, 2024), Sddl, Sdd3, Sdd7 -based CBEs and others (Huang, Lin, Fei, & He et al., Cell, 2023), or any combination thereof.
[0046] In some embodiments, the DNA binding domain comprises a Cas9 DNA binding domain. In some embodiments, a Cas9 DNA binding domain can be from a wild type Cas9 or an engineered form of other Cas9 orthologs or ancestrals including, but not limited to, ISCB, SaCas9, SaCas9-KKH, CjCas9, and Nme2Cas9. Nonlimiting examples of Cas9 proteins include Cas9 proteins from S'. pyogenes (GI: 15675041); Listeria innocua Clip 11262 (GI: 16801805); Streptococcus mutans UA159 (GL24379809); Streptococcus thermophilus LMD-9 (S. thermophilus A, GL 11662823; S. thermophilus B, GI: 116627542); Lactobacillus buchneri NRRL B-30929 (GL331702228); Treponema denticola ATCC 35405 (GI:42525843); Francisella novicida U112 (GI: 118497352); Campylobacter jejuni subsp. Jejuni NCTC 11168 (GL218563121); Pasteurella multocida subsp. multocida str. Pm70 (GL218767588); Neisseria meningitidis Zs491 (GI: 15602992) and Actinomyces naeslundii (GL489880078).
[0047] A Cas9 DNA binding domain for use in the base editors disclosed herein (e.g., a CBE) can be a DNA binding domain from a Cas9 protein from S. pyogenes (SpCas9). In some embodiments, a Cas9 DNA binding domain for use in the base editors disclosed herein can be a DNA binding domain from a SpCas9 wild type or variant. SpCas9 variants for use herein can comprise an altered PAM specificity. For example, two SpCas9 variants, SpG and SpRY, have relaxed of PAM recognition. SpG recognizes an NG PAM, whereas SpRY recognizes both NRN and NYN PAMs (R for A / G and Y for C / T), with a preference for NRN. SpRY Cas9 comprises eleven specific amino acid mutations in the Cas9 amino acid sequence (A61R, LI 111R, D1135L, S 1136W, G1218K, E1219Q, N1317R, A1322R, R1333P, R1335Q, and T1337R). SpG Cas9 comprises six specific amino acid mutations (D1135L, S1136W, G1218K, E1219Q, R1335Q. and T1337R). In some embodiments, a Cas9 DNA binding domain for use in the base editors disclosed herein can be a DNA binding domain from SpRY. In some embodiments, a Cas9 DNA binding domain for use in the base editors disclosed herein can be a DNA binding domain from SpG.
[0048] A base editor of the present disclosure (e.g., a CBE) can comprise a Cas9 DNA binding domain and a heterologous functional domain (e.g., a deaminase domain) fused at the N or C terminus or inlaid internally, and also at least one uracil DNA glycosylase (UGI) as a fused component (see, e.g., Komor et al., Nature. 2016 May 19;533(7603):420-4; Nishida et al.. Science. 2016 Sep 16;353(6305); Kim et al., Nat Biotechnol. 2017 Apr;35(4):371-376; Komor et al., Sci Adv. 2017 Aug 30;3(8):eaao4774; Gaudelh et al., Nature. 2017 Nov 23;551(7681):464-471; and Jeong et al., Mol Then 2020 Sep 2; 28(9): 1938-1952).
[0049] A base editor of the present disclosure (e.g., a CBE) can comprise a linker between the Cas9 DNA binding domain and the heterologous functional domain (e.g., deaminase domain). Linkers that suitable for use in the CBEs herein can include any sequence that does not interfere with the function of the CBE. In some embodiments, a linker for use in the CBEs disclosed herein can be short, e.g., 2-20 amino acids. In some embodiments, a linker for use in the CBEs disclosed herein can be flexible (e.g., comprising amino acids with a high degree of freedom such as glycine, alanine, and serine). In some embodiments, a linker for use in the CBEs disclosed herein comprises one or more units consisting of GGGS (SEQ ID NO: 182) or GGGGS (SEQ ID NO: 183). Cytosine base editors are known in the art (see, e.g., WO2021151073A2;
[0050] W02021042047AI; WO2021151085A2) and are suitable for use herein. Nonlimiting examples of cytosine base editors include A3G-BE, A3G-BE5.14, Target- AID, Target- AIDmax, Target- AID-NG, SpCas9-TadCBEa, SpCas9-TadCBEb, SpCas9-TadCBEc, SpCas9-TadCBEd, SpCas9-TadCBEe, SpCas9-TadCBEa- V106W, SpCas9-TadCBEd-V106W, SpCas9-TadCBEd-N108Q / L145T, SpRY-Cas9,
[0051] SpCas9-TadCBEd-VI06W / N108Q / L145T, BE4max-NG. BE4max-NRCH, AncBE4- max-NG, YE2-BE3, EE-BE3, YEE-BE3, eAID-BE4max, BE4-max, AncBE4-max, YE2-BE4-NG, EE-BE4-NG, YEE-BE4-NG, R33A+ K34A-BE4-NG, xCas9-BE, SpCas9-NRRH-BE, Td-CBEs and EQR-BE. Examples of cytosine base editors are also provided in Table 1.
[0052] TABLE 1: Cytosine Base Editors
[0053] In some embodiments, a CBE suitable for use herein comprises at least one evolved TadA cytidine deaminase. In some embodiments, a CBE suitable for use herein comprises at least one DNA binding domain from Cas9 variant SpG. In some embodiments, a CBE suitable for use herein comprises at least one DNA binding domain from Cas9 variant SpRY. In some embodiments, a CBE suitable for use herein comprises at least one uracil DNA glycosylase (UGI). In some embodiments, a CBE suitable for use herein comprises at least two UGIs. In some embodiments, a CBE suitable for use herein is provided in Table 2. TABLE 2: Base Editors Guide RNAs
[0054] The present disclosure provides guide RNAs (gRNAs) for use in the compositions and methods disclosed herein. In general, a gRNA may include a direct repeat sequence and a guide sequence, or consists essentially of or consists of a direct repeat sequence and a guide sequence (also referred to as a spacer sequence). In some embodiments, a gRNA disclosed herein can include crRNA and tracrRNA or can contain only crRNA. according to the Cas9 protein as used in the base editors as described herein. The tracrRNA and / or crRNA can be artificially modified and fused to form a single guide RNA (sgRNA).
[0055] Methods of the present disclosure can include the delivery of a base editor (e.g., a CBE) and guide RNA (gRNA) (optionally, e.g., in a ribonucleoprotein complex, or as a nucleic acid encoding the base editor and / or one or more gRNAs) bearing various spacer sequences that target the base editor to a target sequence in the ELP1 gene. As used herein, “target sequence” refers to the nucleotide sequence in the nucleic acid of interest that is complementary to or at least partially complementary’ to the gRNA. The target site (e.g., target sequence) of the gRNAs disclosed herein can comprise the about 10-20 nucleotides (nts) on either side of location where the T-to-C mutation in the human ELP1 gene is known to occur (see, Gene ID: 8518 at ncbi.nlm.nih.gov / gene / 8518, accessed on Apr. 23, 2025). In some embodiments, the target sequence of the gRNAs disclosed herein can be complementary’ to:
[0056] GTAAGTGCCATTGTACTGTT (SEQ ID NO: 184) (see also FIG. 5B), which corresponds to a nucleic acid sequence from the wild type (i.e., not mutated) human ELP1 gene, where the bolded “T” represents the known location of the T-to-C mutation that results in FD. In some embodiments, a gRNA disclosed herein can comprise a spacer sequence complementary to a target sequence (SEQ ID NO: 184) of the ELP1 gene. In some embodiments, a gRNA disclosed herein can comprise a spacer sequence at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to a target sequence (SEQ ID NO: 184) of the ELP1 gene. In some embodiments, a gRNA disclosed herein can comprise a spacer sequence complementary' to a target sequence as disclosed in Table 3 (e.g.. SEQ ID NOS: 185-189). In some embodiments, a gRNA disclosed herein can comprise a spacer sequence at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to a target sequence as disclosed in Table 3 (e.g., SEQ ID NOS: 185-189).
[0057] In some embodiments, a gRNA disclosed herein can comprise a spacer sequence as disclosed in Tables 3 and 4. For the gRNA spacer sequences in Tables 3 and 4, exemplary spacer sequences are shown; the 5 ’ end of the spacer may be extended or substituted to include alternate nucleotide compositions to modify transcription from polIII promoters. The spacer sequence can be, e.g.. 20 nucleotides (nt) with a matched 5’ guanine (G), 20 nt with a mismatched 5’G, 20 nt with matched or mismatched alternate nts, 21 nt with an extended matched or mismatched 5’G or other nts, or 22 nt with extended matched or mismatched nts optionally including a 5’G.
[0058] In Table 3, the gRNAs have exemplary 20 nt spacer sequences; the spacer sequences can be truncated to 19, 18, or 17 nt (by removing 1 , 2, or 3 bases from the 3’ PAM distal end of the spacer). TABLE 3: gRNAs Bystander Editing
[0059] Bystander editing that occurs with use of base editors (e.g., CBEs) refers to unintended changes to DNA sequences at locations near the intended target site. Although base editors are generally designed to specifically modify a single base, base editors can sometimes affect nearby cytosine bases. It is generally accepted in the art that bystander editing leads to undesired mutations and should be avoided in base editing methods (see, e.g., Lee et al., Set Adv. 2020 Jul 15;6(29):eabal773; Kaukonen et al., Genes (Basel). 2022 Jul 26;13(8): 1327).
[0060] Herein, the base editors of the present disclosure demonstrate that (1) specific editing at the target nucleotide (e.g., the C mutation to be corrected to T); and (2) specific editing at the target nucleotide in addition to at least one bystander editing mutation can correct the ELP1 T6C mutation in human cells. As presented herein, one of the most efficient combinations of base editors and gRNAs resulted in bystander editing at two other cytosine sites (see, FIG. IE). Without wishing to be bound by any particular theory, on-target base correction along with intronic bystander editing increased exon 20 inclusion and full-length ELP1 transcript levels to superior levels than observed with conditions causing on-target base correction not accompanied by additional bystander editing. In some embodiments, use of a base editor and a gRNA as disclosed herein can result in bystander editing at at least one nucleotide (e.g., an unintended cytosine site) and have no negative impact on exon 20 inclusion or ELP1 splicing. In some embodiments, use of a base editor and a gRNA as disclosed herein can result in bystander editing at about 1 to 4, 1 to 3, or 1-2 nucleotides and have no negative impact on exon 20 inclusion or ELP1 splicing. In some embodiments, use of a base editor and a gRNA as disclosed herein can result in bystander editing at at least one nucleotide (e.g., 1, 2, 3, 4 nucleotides) within an intronic region and have no negative impact on exon 20 inclusion or ELP1 splicing.
[0061] Base Editor and gRNA Combinations
[0062] Any of the base editors (e.g., CBE) disclosed herein can be combined with any of the gRNAs disclosed herein for editing of the ELP1 gene. Methods of delivering at least one base editor disclosed herein and at least one gRNA disclosed herein to a target cell are further described below. In some embodiments, at least one base editor disclosed herein and at least one gRNA disclosed in Table 4 are delivered to a target cell for editing of the ELP1 gene. In some embodiments, at least one base editor disclosed in Table 2 and at least one gRNA disclosed in Table 3 are delivered to a target cell for editing of the ELP1 gene. In some embodiments, the base editor is TadCBEd-SpG and the gRNA is human-ELPl-C6 (SEQ ID NO: 11). In some embodiments, the base editor is TadCBE6a-SpG and the gRNA is human-ELPl-C6 (SEQ ID NO: 11). In some embodiments, the base editor is TadCBE6b-SpG and the gRNA is human-ELPl-C6 (SEQ ID NO: 11). In some embodiments, the base editor is TadCBEd-SpRY and the gRNA is human-ELPl-C6 (SEQ ID NO: 11). In some embodiments, the base editor is TadCBEd-SpRY and the gRNA is human-ELP 1 -C 1 1 (SEQ ID NO: 16). In some embodiments, the base editor is TadCBEd-SpRY and the gRNA is human-ELPl-C8 (SEQ ID NO: 13). In some embodiments, the base editor is TadCBEd-SpRY and the gRNA is human-ELPl-C5 (SEQ ID NO: 10). In some embodiments, the base editor is TadCBEd-SpG and the gRNA is human-ELP 1-C4 (SEQ ID NO: 9).
[0063] Prime Editing
[0064] Disclosed herein are compositions and methods for the genetic treatment for FD which can correct the ELP1 TC6 using prime editing. Prime editing (PE) comprises a genome editing technology7that can perform all 12 possible base-to-base conversions, insertions, and deletions with greater targeting flexibility, no bystander products, and a broader editing range than base editors (see. e.g., Lu et al., IntJMol Sci. 2022 Aug 30;23(l 7):9862). A prime editor is composed of two parts: (1 ) a reverse transcriptase (RT) that incorporates a Cas9 nickase (H840A mutation), which can only produce single-strand breaks; and (2) a 3'-extended sgRNA containing a primer binding site (PBS) and a RT template — referred to as pegRNA (see, e.g., Anzalone et al.. Nature. 2019 Dec;576(7785): 149-157; Lu et al., IntJMol Sci. 2022 Aug 30;23(17):9862).
[0065] In some embodiments, a Cas9 nickase for use in the prime editors of the present disclosure can comprise a SpCas9 nickase. In some embodiments, a prime editing system for use herein can be a PE2, PE3, PE4, or PE5 prime editing system (see, Chen et al. Cell. 2021 Oct 28;184(22):5635-5652.e29). In some embodiments, a prime editing system for use herein can be a PEmax prime editing system (see, Chen et al. Cell. 2021 Oct 28;184(22):5635-5652.e29). Mammalian expression of a SpCas9 PEmax prime editor can be accomplished by use of a pCMV -PEmax vector (i.e., pCMV-Pemax-SpCas9) according to the methods disclosed herein. In some embodiments, the target sequence of a pegRNA disclosed herein can be complementary to: GTAAGTGCCATTGTACTGTT (SEQ ID NO: 184) which corresponds to a nucleic acid sequence from the wild type human ELP1 gene, where the bolded “T” represents the known location of the T-to-C mutation that results in FD. In some embodiments, a pegRNA disclosed herein can comprise a spacer sequence complementary to a target sequence (SEQ ID NO: 184) of the ELP1 gene. In some embodiments, a pegRNA disclosed herein can comprise a spacer sequence at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary to a target sequence (SEQ ID NO: 184) of the ELP1 gene. In some embodiments, a pegRNA disclosed herein can comprise a spacer sequence as disclosed in Table 5 (e.g., SEQ ID NOS: 33-34). In some embodiments, a pegRNA disclosed herein can comprise a spacer sequence for second nicking. In some embodiments, a spacer for second nicking can comprise a nucleic acid sequence consisting of SEQ ID NO: 204. (Table 6). In some embodiments, a pegRNA disclosed herein can comprise a PBS / RT template sequence disclosed in Table 5 (e.g., SEQ ID NOS: 37-45). In some embodiments, a pegRNA disclosed herein can comprise a nucleic acid sequence as disclosed in Table 6 (SEQ ID NOS: 195-203).
[0066] Delivery and Expression Systems
[0067] Provided herein are methods of introducing (1) a base editor (e.g.. a CBE) and / or gRNA; or (2) a primer editor (PE) and / or a pegRNA in a nucleic acid that encodes them into a cell (e.g., a target cell). In some embodiments, the nucleic acid encoding the base editor (e.g., a CBE) / PE can be delivered as rnRNA or can be cloned into an intermediate vector for transformation into prokaryotic or eukaryotic cells for replication and / or expression. Intermediate vectors are typically prokaryote vectors, e.g., plasmids, or shuttle vectors, or insect vectors, for storage or manipulation of the nucleic acid encoding the base editor (e.g., a CBE) / PE for production of the base editor / PE. The nucleic acid encoding the base editor (e.g.. a CBE) / PE can also be cloned into an expression vector, for administration to an animal cell, preferably a mammalian cell or a human cell, or to a fungal cell, bacterial cell, or protozoan cell. In order to express a base editor (e.g., a CBE) or a PE disclosed herein, a sequence encoding the base editor / PE can be subcloned into an expression vector that contains a promoter to direct transcription. Suitable bacterial and eukaryotic promoters are well known in the art and described, e.g., in Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL (3d ed. 2001); Kriegler, GENE TRANSFER AND EXPRESSION: A LABORATORY MANUAL (1990); and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel el al., eds., 2010). Bacterial expression systems for expressing the engineered protein are available in, e.g., E. coli, Bacillus sp., and Salmonella (see, e.g., Palva et al., 1983, Gene 22:229-235). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
[0068] The promoter used to direct expression of a nucleic acid depends on the particular application. For example, a strong constitutive promoter is typically used for expression and purification of proteins. In contrast, when the base editor (e.g., a CBE) or PE is to be administered in vivo for gene regulation, either a constitutive or an inducible promoter can be used, depending on the particular use of the base editor / PE. A promoter for administration of the base editor (e.g., a CBE) / PE can be a weak promoter, such as HSV TK or a promoter having similar activity. In some embodiments, a promoter can also include one or more elements that are responsive to transactivation, e.g., hypoxia response elements. Gal4 response elements, lac repressor response element, and small molecule control systems such as tetracycline- regulated systems (see, e.g., Gossen & Bujard, 1992, Proc. Natl. Acad. Sci. USA, 89:5547; Oligino et al., 1998, Gene Ther., 5:491- 496; Wang et al., 1997, Gene Ther., 4:432-441; Neering et al., 1996, Blood, 88: 1147- 55; and Rendahl et al., 1998, Nat. Biotechnol., 16:757-761).
[0069] An expression vector for use herein can also contain a transcription unit or expression cassette that contains all the additional elements required for the expression of the nucleic acid in host cells, either prokaryotic or eukaryotic. A typical expression cassette thus contains a promoter operably linked, e.g., to the nucleic acid sequence encoding the base editor (e.g., a CBE) or PE, and any signals required, e.g., for efficient polyadenylation of the transcript, transcriptional termination, ribosome binding sites, or translation tennination. Additional elements of the cassette may include, e.g., enhancers, and heterologous spliced intronic signals. The particular expression vector used to transport the genetic information into the cell can be selected with regard to the intended use of the base editor / PE, e.g., expression in plants, animals, bacteria, fungus, protozoa, etc. Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and commercially available tag-fusion expression systems such as GST and LacZ.
[0070] Expression vectors containing regulator}- elements from eukaryotic viruses can be used in eukaryotic expression vectors, e.g., lentiviral vectors, adenoviral vectors, SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr vims. Other exemplary eukaryotic vectors include pMSG, pAV009 / A+, pMTO10 / A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary' tumor virus promoter, Rous sarcoma vims promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
[0071] Vectors for expressing the base editor (e.g., a CBE) and / or gRNAs (or PE and / or pegRNAs) can include RNA Pol III promoters, e.g., the Hl, U6 or 7SK promoters. These human promoters allow for expression of base editor (e.g., a CBE) and / or gRNAs (or PE and / or pegRNAs) in mammalian cells following plasmid transfection.
[0072] Some expression systems suitable for use herein can have markers for selection of stably transfected cell lines such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase. High yield expression systems are also suitable, such as using a baculovirus vector in insect cells, with the gRNA or pegRNA encoding sequence under the direction of the polyhedrin promoter or other strong baculovirus promoters.
[0073] Standard transfection methods can be used herein to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of protein, which are then purified using standard techniques (see, e.g., Colley et al., 1989, J. Biol. Chem., 264: 17619-22; GUIDE TO PROTEIN PURIFICATION, IN METHODS IN ENZYMOLOGY, vol. 182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, 1977. Bacteriol. 132:349-351; Clark-Curtiss & Curtiss. Methods in Enzymology 101 :347-362 (Wu et al., eds, 1983).
[0074] Any of the known procedures for introducing foreign nucleotide sequences into host cells can be used in the present disclosure. Examples include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation. nucleofection, liposomes, microinjection, naked DNA, plasmid vectors, viral vectors, both episomal and integrative, and any of the other well-known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell (see, e.g., Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL (3d ed. 2001); Kriegler, GENE TRANSFER AND EXPRESSION: A LABORATORY MANUAL (1990)).
[0075] All of the base editors (e.g., a CBEs) and / or gRNAs (or PE and / or pegRNAs) described herein can be rapidly incorporated into existing and widely used vectors, e.g., by simple site-directed mutagenesis.
[0076] Viral Gene Delivery Vectors
[0077] Viral vectors for use in the present methods and compositions include recombinant retroviruses, adenovirus, adeno-associated virus, alphavirus, and lentivirus, comprising the targeting peptides described herein and optionally a transgene for expression in a target tissue / target cell.
[0078] A preferred approach for in vivo introduction of nucleic acid into a cell is byuse of a viral vector containing nucleic acid, e.g., a cDNA. Infection of cells with a viral vector has the advantage that a large proportion of the targeted cells can receive the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells that have taken up viral vector nucleic acid. Viral vectors for use in the present methods and compositions include recombinant retroviruses, adenovirus, adeno-associated virus, alphavirus, and lentivirus, comprising the base editors (e.g., a CBEs) and / or gRNAs (or PE and / or pegRNAs) described herein and optionally a transgene for expression in a target tissue / target cell.
[0079] A preferred viral vector system useful for delivery of nucleic acids in the present methods is the adeno-associated virus (AAV). AAV is a tiny non-enveloped virus having a 25 nm capsid. No disease is know n or has been shown to be associated with the wild-ty pe virus. AAV has a single-stranded DNA (ssDNA) genome. AAV has been shown to exhibit long-term episomal transgene expression. Space for exogenous DNA in AAV is generally limited to an amount of nucleic acid that can physically fit inside the particle. For example, AAV types 1-5 can package up to 6 kb DNA, and in some reports AAV5 has been shown to package up to 8.9 kb DNA. An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al.. Proc. Natl. Acad. Sci. USA 81 :6466-6470 (1984); Tratschin et al., Afo / . Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51 :611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993). There are numerous alternative AAV variants (over 100 have been cloned), and AAV variants have been identified based on desirable characteristics. The present disclosure contemplates uses of peptides that can be incorporated into an AAV capsid — thus providing capsid modified AAVs, e.g., AAVPR — for selectively transfecting endothelium, pericytes and SMC after delivery to a subject. Such AAV’s can also be used for delivery of a nucleic acid sequence comprising a base editor (e.g., a CBEs) and / or a gRNAs (or PE and / or pegRNAs) as described herein. In some embodiments, an AAV suitable for use with a nucleic acid sequence of the disclosure is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AV6.2, AAV7, AAV8, rh.8, AAV9, rh.10, rh.39, rh.43 or CSp3; for CNS use, in some embodiments the AAV is AAV1, AAV2. AAV4. AAV5. AAV6, AAV8, or AAV9.
[0080] In cases where an AAV vector is used, the gene therapy construct can also include components such as inverted terminal repeats (ITRs) and Rep. cl.
[0081] The vectors for expressing the base editors (e.g., a CBEs) or PEs can include RNA Pol III promoters to drive expression of the guide RNAs, e.g.. the Hl, U6 or 7SK promoters. These human promoters allow for expression of Cas9 variants in mammalian cells following plasmid transfection.
[0082] The selected vector may be delivered to an AAV packaging cell by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. Stable packaging cells can also be made. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., MOLECULAR CLONING: A LABORATORY MANUAL, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (2012).
[0083] Delivery of mRNA or AAV or other viral vectors can also be used; see, e.g., Davis et al., Nature Biomedical Engineering 6: 1272-1283 (2022). In some embodiments, the BE is split into two parts to facilitate delivery in an AAV, e.g.. Koblan et al. Nature 589, 608-614 (2021); Villiger et al., Nat. Med. 24, 1519-1525 (2018); Lim et al., ALo / . Ther. 28, 1177-1189 (2020); She et al., Sig Transduct Target Ther 8, 57 (2023).
[0084] The AAV genomes can be packaged into AAV capsids, which capsids can be included in compositions (such as pharmaceutical compositions) and / or administered to subjects. An exemplary pharmaceutical composition comprising an AAV capsid according to this disclosure can include a pharmaceutically acceptable carrier such as balanced saline solution (BSS) and one or more surfactants (e.g. Tween 20) and / or a thermosensitive or reverse-thermosensitive polymer (e.g, pluronic). Other pharmaceutical formulation elements known in the art may also be suitable for use in the compositions described here.
[0085] An AAV vector as described herein can be a pseudotyped vector. Pseudotyping provides a mechanism for modulating a vector’s target cell population. For instance, pseudotyped AAV vectors can be utilized in various methods described herein. Pseudotyped vectors are those that contain the genome of one vector, e.g., the genome of one AAV serotype, in the capsid of a second vector, e.g., a second AAV serotype. Methods of pseudotyping are well known in the art. For instance, a vector may be pseudotyped with envelope glycoproteins derived from Rhabdovirus vesicular stomatitis virus (VSV) serotypes (e.g., Indiana and Chandipura strains), rabies virus (e.g., various Evelyn-Rokitnicki-Abelseth ERA strains and challenge virus standard (CVS)), Lyssavirus Mokola virus, a rabies-related virus, vesicular stomatitis virus (VSV), Mokola virus (MV), lymphocytic choriomeningitis virus (LCMV), rabies virus glycoprotein (RV-G), glycoprotein B type (FuG-B), a variant of FuG-B (FuG- B2) or Moloney murine leukemia virus (MuLV). A virus may be pseudotyped for transduction of one or more neurons or groups of cells. Non-limiting examples of pseudotyped vectors include recombinant AAV2 / 1, AAV2 / 2, AAV2 / 5, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV9, AAVrhlO, AAV11, and AAV12 serotype vectors. It is known in the art that such vectors may be engineered to include a transgene encoding a human protein or other protein. See VIRA VECTORS FOR GENE THERAPY: METHODS AND PROTOCOLS, ed. Machida, Humana Press, 2003. In some embodiments, the present disclosures can include a pseudotyped AAV9 or AAV2 viral vector including a nucleic acid as disclosed herein. In addition, the capsid can be altered to include one or more peptides that increase expression in the nervous system, e.g., in the CNS (see, e.g., Yao et al., Nat Biomed Eng. 2022 Oct 10. doi: 10.1038 / s41551-022-00938-7; Chatteqee et al., Gene Ther. 2022 Jun;29(6):390-397; Meng et al., Mol Ther Methods Clin Dev. 2021 Feb 27;21:28-41; Zhang et al.. Biomaterials. 2022 Feb;281 : 121340; Gray, Cell Gene Ther. Insights 5, 1361-1368 (2019); Nonnenmacher et al., Mol. Ther. Methods Clin. Dev. 20, 366-378 (2021)) or in the peripheral nervous system (see e.g., AAV -PHP. S. Chan et al., Nat Neurosci. 2017 Aug;20(8): 1172-1179; AAV- MaCPNSl and AAV- MaCPNS2, Chen et al., Neuron. 2022 Jul 20;l 10(14):2242- 2257. e6; AAV-PHP, AAV-PHP.A, AAV-PHP.B, AAV-PHP.B2, AAV-PHP.B3, AAV -PHP. eB, AAV- PHP.S, Challis et al., Nat Protoc. 2019 Feb;14(2):379-414)). In some embodiments, the AAV vector is encapsulated by one of the following capsids: AAV1, AAV5. AAV6. AAV7, AAV8, AAV9, AAV-F, AAV-PHP, AAV-PHP.A, AAV-PHP.B, AAV-PHP. B2, AAV-PHP. B3, AAV-PHP.eB, MaCPNSl / MaCPNS2 or AAV-PHP. S.
[0086] Ribonucleoprotein
[0087] Alternatively, the methods provided herein can include delivering either (1) the base editor (e.g., a CBE) and gRNA together or (2) the PE and pegRNA together. For example, the base editor (or PE) can be overexpressed in a host cell and purified, then complexed with the gRNA (or pegRNA)(e.g., in a test tube) to form a ribonucleoprotein (RNP) and delivered to a target cell. In some embodiments, the base editor (or PE) can be expressed in and purified from bacteria through the use of bacterial base editor expression plasmids. For example, His-tagged variant base editor proteins (or PE proteins) can be expressed in bacterial cells and then purified using nickel affinity' chromatography. The use of RNPs circumvents the necessity' of delivering plasmid DNAs encoding the nuclease or the guide or encoding the nuclease as an mRNA. RNP delivery may also improve specificity, presumably because the half-life of the RNP is shorter and there is no persistent expression of the nuclease and guide (as one of skill in the art would expect from a plasmid). The RNPs can be delivered to the cells in vivo or in vitro, e.g., using lipid-mediated transfection or electroporation. See. e.g., Liang et al.. Journal of Biotechnology 208 (2015): 44-53; Zuris et al., Nature biotechnology 33.1 (2015): 73-80; Kim et al., Genome research 24.6 (2014): 1012-1019. In some embodiments, RNPs can be delivered to a target cell via lipid nanoparticles (LNPs) encapsulating said RNPs (see. e.g., Holubowicz et al.. Nat Biomed Eng. 2025 Jan;9(l):.57-78). Compositions and Methods of Administration
[0088] The present disclosure provides compositions comprising either (1) a gRNA and / or a base editor (e.g., a CBE), or (2) a PE and / or a pegRNA that can be administered to a subject in need thereof. The compositions disclosed herein can include, e.g., a viral delivery' vector, e.g., preferably an adeno-associated virus (AAV) vector that comprises sequences encoding a gRNA and / or a base editor (e.g., a CBE) or encoding a pegRNA and / or a PE. In some embodiments, a base editor (e.g.. a CBE) disclosed herein can be split, and encoded across two AAVs. Alternatively, the compositions disclosed herein can comprise a RNP comprising the base editor (e.g., a CBE) with the guide RNA, or a RNP comprising the PE with the pegRNA. In some embodiments, compositions of the present disclosure can also be referred to as a ■‘gene therapy agent” wherein the ‘‘agent” comprises either (1) a base editor and / or gRNA, or (2) a PE and / or pegRNA as disclosed herein. In some embodiments, a gene therapy agent can be delivered in a viral vector, e.g., an AAV as described herein. Alternatively the gene therapy agent can be delivered as mRNA, e.g., mRNA encoding the BE or PE, in combination with the gRNA or pegRNA. Preferably, the mRNA is capped and polyadenylated.
[0089] Preferably the BE or PE mRNA has at least one nuclear localization signal (NLS) at the N or C terminal, optionally with NLS at both the N and C terminal. Exemplary NLSs include SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 205)); PKKKRKV (SEQ ID NO: 206); KRTADGSEFESPKKKRKV (SEQ ID NO: 207)); or nucleoplasmin NLS KRPAATKKAGQAKKKK (SEQ ID NO: 208)).
[0090] Preferably, the mRNA includes 5’UTR and 3’UTR, is capped, and is polyadenylated. The cap can be, e.g., a Cap-1 structure, modified with 5- methoxyuridine, e.g., produced by co-transcnptional capping technology, mCap, or anti-reverse cap analog (ARCA). In some embodiments the mRNA is synthesized, e.g., using a method as described in US Pat. Nos. 10494399, 10519189, 10913768C1, 11414453, 11878991, 11578095, and 12103944 to TriLink, relating to compositions and methods for synthesizing 5’-capped RNAs. In some embodiments, uridine is substituted with modified nucleotides such as m5U and . Other modifications can be included. See, e.g., Shi et al., Sig Transduct Target Ther 9, 322 (2024); Qin et al., Sig Transduct Target Ther 7, 166 (2022); Ying et al., CURRENT OPINION IN SYSTEMS BIOLOGY, Volume 37, 2024, 100503; Wang et al.. Nanomicro Lett. 2025 Feb 21;17: 155; Wang et al., J Biomed Sci 30, 84 (2023); Lin & Kuang, Nat Rev Gastroenterol Hepatol. 2024 Apr;21(4): 267-281; Pan et al.. Trends Immunol. 2024 Jan;45(l):20-31, and references cited therein.
[0091] Also disclosed herein are pharmaceutical compositions comprising a viral delivety vector, e.g., preferably an adeno-associated virus (AAV) vector that comprises sequences encoding the gene therapy agent disclosed herein. Pharmaceutical compositions typically include a pharmaceutically acceptable carrier. As used herein the language '‘pharmaceutically acceptable carrier’ includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions. A listing of active compounds and specific drugs suitable for use herein as supplementary active compounds can be found in The Merck Index Online; Royal Society' of Chemistry, 2025; rsc.org / merck-index (accessed March 12, 2025), and the United States Pharmacopeia-47 / National Formulary-47, published by the United States Pharmacopeial Convention. Inc., Rockville Md., 2024. In some embodiments, a suppl ementary active compound can be one known in the art to treat and / or alleviate a symptom associated FD. In some embodiments, a pharmaceutically acceptable carrier for use herein can cross the blood brain barrier.
[0092] The present pharmaceutical compositions provided herein can be formulated for administration by a variety of routes and in a variety of dosage forms including those for oral, rectal, parenteral (such as subcutaneous, intramuscular, and intravenous), epidural, intrathecal, intra-articular, topical (e.g., ocular) and buccal administration.
[0093] Pharmaceutical compositions provided herein can be formulated for systemic administration. In some embodiments, pharmaceutical compositions formulated for systemic administration can comprise an AAV which targets CNS, specific cells within the CNS, targets PNS, and / or specific cells within the PNS. Suitable AAVs are generally known in the art (see. e.g., Zhou et al.. Front Mol Neurosci. 2022 Oct 26; 15: 988914), and can include, e.g, AAV9 (U.S. Pat. No. 7,906,111; US 2011- 0236353-Al), rhlO (WO 2003 / 042397) and / or hu37 (see, e.g., U.S. Pat. No. 7,906,111; US 2011-0236353A1). In some embodiments, pharmaceutical compositions comprising a brain-targeting AAV (e.g., AAV9 and / or engineered AAV 9) disclosed herein can be formulated for intravenous (i.v.) injection.
[0094] Pharmaceutical compositions provided herein can also be formulated for administration into the brain. In some embodiments, routes of administration into the brain can include intranasal, intraventricular, and / or intraparenchymal injection. Direct routes of administration can include intracerebral, intracerebroventricular (ICV), intrathecal and / or intraosseous. In some embodiments, pharmaceutical compositions provided herein can be formulated for use in an intrathecal pump.
[0095] Pharmaceutical compositions provided herein can be formulated for administration to the eye (i.e., ocular delivery). Pharmaceutically acceptable carriers and excipients for use in a formulation for ocular delivery of gene therapy agents are generally known in the art (see, e.g., Banou et al., Yale J Biol Med. 2024 Dec 19;97(4):491 -503) and are suitable for use herein. In some embodiments, pharmaceutical compositions provided herein can be formulated for topical application to the eye. In some embodiments, pharmaceutical compositions provided herein can be formulated for intravitreal, subretinal, and / or suprachoroidal injection. In some embodiments, pharmaceutical compositions formulated for ocular delivery can comprise an AAV with tropism for retinal tissue. Such AAVs are generally known in the art (see. e.g., Rodrigues et al., Pharm Res. 2018 Dec 27;36(2):29) and can include AAV2 and / or engineered AAV2 which are suitable for use herein.
[0096] Methods of formulating suitable pharmaceutical compositions are known in the art, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005; and the books in the series Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY). For example, solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0097] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). Tn all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The earner can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0098] Pharmaceutical compositions herein can include one or more agents / deli very earners to enhance delivery of the gene therapy agents disclosed herein across the blood-brain barrier (BBB). Strategies to enhance uptake of the pharmaceutical compositions disclosed herein into the brain can include use of a hyperosmolar solution to disrupt the BBB, drug lipidization, protein cationization, fusion to a targeting peptide, use of a nanocarrier, or any of the methods known in the art (see, e.g., Pardridge. Neuron. 2002 Nov 14;36(4): 555-8; Bhunia et al., Pharmaceutics. 2023 Nov 23;15(12):2658).
[0099] The pharmaceutical compositions of the present disclosure can be included in a container, pack, or dispenser together with instructions for administration. A kit comprising at least one gRNA, at least one base editor (e.g., a CBE), and / or at least one viral delivery' vector (e.g., a AAV vector), as disclosed for use in the methods of the present disclosure is contemplated herein. A kit comprising at least one pegRNA. at least one PE, and / or at least one viral delivery vector (e.g., a AAV vector), as disclosed for use in the methods of the present disclosure is also contemplated herein.
[0100] Methods of Treatment
[0101] Provided herein are methods of treating familial dysautonomia (FD) in a subject by delivering a therapeutically effective amount of a gene therapy agent. Subjects who have FD and can be treated using the present methods can be identified by a skilled health care provider, e g., using methods known in the art (see, Bar- Aluma. '“Familial Dysautonomia” 2003 Jan 21 [Updated 2021 Nov 4], In: Adam MP. Feldman J, Mirzaa GM, et al., editors. GENEREVIEWS® [Internet], Seattle (WA): University of Washington, Seattle; 1993-2025 (available from: ncbi.nlm.nih.gov / books / NBKl 180 / ; accessed Apr. 23, 2025)). The disclosure demonstrates effective delivery’ of a therapy comprising a base editor for correcting a mutation known to cause FD. The gene therapy agent can be delivered in a viral vector, e.g., an AAV as described herein. The vector can be delivered by any suitable route, e.g., locally (e.g., by intraocular, intravesical, or intrathecal delivery ) or systemically (e.g., by intravenous delivery). The gene therapy agent can be delivered in lipid-nanoparticle formulations as disclosed herein.
[0102] Compositions of the present disclosure and methods of use thereof can be used to correct a T-to-C mutation at the 6th base of intron 20 (c.2204+6T>C) of the ELP1 gene via base editing. In some embodiments, methods of administering a composition of the present disclosure can result in at least about 5% editing (e.g., correction of the T-to-C mutation) of the ELP1 gene. In some embodiments, methods of administering a composition of the present disclosure can result in about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, or about 5% to about 10% editing of the ELP1 gene. In some embodiments, methods of administering a composition of the present disclosure can result in at least about or about 5%, 10%, 20%, 305, 40%, 50%, 60%, 70%, 80%, 90%, or about 100% editing of the ELP1 gene.
[0103] As shown herein, base editing according to the methods disclosed herein can result in a phenotypic improvement over baseline when at least 5% editing occurs in a target cell (e.g., a cell of the central nervous system (CNS) and / or the peripheral nervous system (PNS)). As used herein, “baseline” refers to the stage of the disease (e.g., FD) and / or severity of disease symptoms in a subject immediately before a gene therapy agent (e.g., a base editor and / or gRNA) is administered to the subject.
[0104] Methods of administering a gene therapy agent disclosed herein can treat, attenuate, or prevent further instance of at least one symptom of FD. Non-limiting examples of FD symptoms include decreased pain and temperature sensation, orthostatic hypotension, tachycardia, labile blood pressure, gait ataxia, and retinal degeneration (see FIG. 1A). In some embodiments, methods of administering a gene therapy agent disclosed herein can treat, attenuate, or prevent progressive impairment of proprioception in a subject. In some embodiments, methods of administering a gene therapy agent disclosed herein can prevent neuronal loss in a subject. In some embodiments, methods of administering a gene therapy agent disclosed herein can prevent retinal degeneration in a subject. In some embodiments, methods of administering a gene therapy agent disclosed herein can improve gait ataxia in a subject as compared to the subject’s baseline. In some embodiments, methods of administering a gene therapy agent disclosed herein can increase ELP1 protein levels in a subject as compared to the subject’s baseline.
[0105] Cellular Models of Familial Dysautonomia
[0106] Provided herein is a cell line, HEK 293T-E F -TC6 cell-line, for evaluation of corrective genome editing strategies for correcting the mutation that causes familial dysautonomia (FD). In some embodiments, the HEK 293T- / .7.7N-TC6 cell-line disclosed herein harbors a homozygous ELP1 T6C mutation and no other bystander edits. In some embodiments, the HEK 293T-A7. / N-TC6 cell-line disclosed herein can be used to optimize delivery of nucleic acids disclosed herein (e.g., base editors and / or gRNAs; PEs and / or pegRNAs) mimicking the needed pharmacologic delivery strategy in patients.
[0107] EXEMPLARY SEQUENCES AND CONSTRUCTS
[0108] In some embodiments, the sequence of a protein or nucleic acid used in a composition or method described herein is at least 80%. 85%. 90%. 95%. 97%. 98%. or 99% identical to an exemplary' or reference sequence set forth herein. To determine the percent identity7of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0109] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity7betw een two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453 ) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at gcg.com), using the default parameters, e.g., a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty7of 5. EXAMPLES
[0110] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0111] Materials and Methods The following materials and methods were used in the Examples below.
[0112] Plasmids and oligonucleotides
[0113] Target site sequences for gRNAs are available in Table 4 and sequences for pegRNAs for prime editors are available in Table 5 and Table 6. Plasmids used in these studies are described in Table 7. Oligonucleotide sequences are available in Table 8.
[0114] TABLE 4: gRNA Sequences
[0115] TABLE 5: Expression of pegRNAs for Prime Editors
[0116] TABLE 6: pegRNAs for Prime Editors
[0117] TABLE 7: Plasmids
[0118] TABLE 8: Oligonucleotides and Probes
[0119] Briefly, base editor plasmids were generated by subcloning different TadA deaminase sequences into the Notl and Bglll sites of pCMV-T7-ABEmax(7.10)- VRQR-P2A-EGFP (RTW5025; Addgene plasmid 140003) via isothermal assembly (29). Additional mutations were cloned into BE plasmids using isothermal assembly the Q5 Site-Directed Mutagenesis Kit (E0554; New England Biolabs; NEB). Expression plasmids for human U6 promoter-driven gRNAs were generated by annealing and ligating duplexed oligonucleotides corresponding to spacer sequences into BsmBI-digested pUC19-U6-BsmBI_cassette-SpCas9_gRNA (BPK1520; Addgene plasmid 65777). Npu intein-split ABE constructs were cloned into N- and C-terminal AAV plasmids (Addgene plasmids 137177 and 137178, respectively). The N-terminal vector was modified to include the deaminase domain and gRNA cassette. The C-terminal vector was modified to encode the spacers for ELP1-16C.
[0120] HEK293T and fibroblast culture
[0121] Human HEK 293T cells (American Type Culture Collection; ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% heat-inactivated FBS (HI-FBS) and 1% penicillin-streptomycin. Transfections were performed 20 hours following seeding of 2xl04HEK 293T cells per well in 96-well plates. Base editor transfections contained 70 ng of ABE expression plasmid and 30 ng gRNA expression plasmid (exception for specific experiments testing lower doses, which included a supplemented weight of a stuffer plasmid BPK1098 to reach 100 ng total DNA) mixed with 0.72 pL of TransIT-X2 (Mirus) in a total volume of 15 pL Opti-MEM (Thermo Fisher Scientific). Transfection mixtures were incubated for 15 minutes at room temperature and distributed across the seeded HEK 293T cells. Experiments were halted after 72 hours and genomic DNA (gDNA) was collected by discarding the media, resuspending the cells in 100 pL of quick lysis buffer (20 mM Hepes pH 7.5, 100 mM KC1, 5 mM MgCh, 5% glycerol, 25 mM DTT, 0.1% Triton X-100, and 60 ng / pL Proteinase K (NEB)), heating the lysate for 6 minutes at 65 °C, heating at 98 °C for 2 minutes, and then storing at -20 °C. For experiments to generate clonal cell lines, serial dilutions were performed to sort for single clones. Samples of supernatant media from cell culture experiments were analyzed monthly for the presence of mycoplasma using My coAlert PLUS (Lonza).
[0122] For fibroblast cell culture, GMO2343 patient fibroblasts were thawed and incubated in Dulbecco's Modified Eagle Medium (DMEM-10%) fetal bovine (FBS) for 72 hours. Fibroblasts were cultured in DMEM supplemented with 10% HI-FBS and 1% penicillin / streptomycin. For experiments involving fluorescence-activated cell sorting, the media was modified to contain 20% HI-FBS for recovery after sorting. Fibroblasts were transfected with Lipofectamine LTX (ThermoFisher) to deliver separate plasmids encoding base editors. Approximately 48 hours after transfection, GFP+ fibroblasts were sorted (MGH Pathology: Flow and Mass Cytometry Core (CNY) and DNA was extracted.
[0123] Human pluripotent stem cell (hPSC) lines hPSC experiments were carried out in vitro with two hPSC lines: H9, a healthy control embryonic stem cell line, and S2, an FD patient derived iPSC line. H9 embryonic stem cells were purchased from WiCell, H9=WA-09 (female, NIH registry # 0062). S2 iPSCs were reprogrammed and characterized previously (27) from FD patient fibroblasts purchased from Cori ell S2=GM 04899 (female, 12 years old). The fibroblasts were previously reprogrammed, characterized^ 7) and resulting iPSCs have been employed to study FD in vitro (27, 28, 30, 31). Detailed stem cell maintenance has been previously describedAA 30). hPSCs were maintained in Essential 8 medium (Gibco, A15170-01) on Vitronectin (Thermo Fisher / Life Technologies, Al 4700, 5 ug / ml) coated cell culture plates and passaged regularly with EDTA (Sigma, ED2SS).
[0124] In vitro differentiation of hPSCs into sympathetic neurons
[0125] In vitro differentiation into sympathetic neurons was done as previously described(2S, 30). On day 0, hPSCs were dissociated in EDTA for 20 min at 37°C, washed with IX PBS, and plated on Geltrex (Invitrogen, A1413202) coated plates at 1.25*105cells / cm2On day 0-1 cells were maintained in Essential 6 medium (Gibco. A15165-01) supplemented with 0.4 ng / ml BMP4 (PeproTech, 314-BP), 10 pM SB431542 (R&D Systems, 1614), and 300 nM CHIR99021 (R&D Systems, 4423). From day 2 to day 10, cells were fed with Essential 6 medium containing 10 pM SB431542 and 0.75 pM CHIR99021. On day 10, neural crest cells were rinsed with lx PBS twice, then dissociated with Accutase (Coming, AT104500) for 20 min at 37°C. Dissociated neural crest cells were again rinsed with IX PBS and replated onto ultra low-attachment 24 well cell culture dishes (Coming, 07 200 602) at 0.5* 106cells / well. Sympathetic neuron progenitors were maintained in 3D spheroid cultures from day 10 to day 14 in Neurobasal media (Gibco, 21103-049) containing 1% N2 supplement (Gibco, 17502-048), 2% B27 supplement (Gibco, 17502-048), 1% L- glutamine (Thermo Fisher / Gibco, 25030-081), 3 pM CHIR99021, and 10 ng / ml FGF2 (R&D Systems, 233-FB / CF). On day 14, sympathetic neuron progenitors were dissociated in Accutase for 20 min at 37°C, washed in IX PBS, and replated on PO (Sigma, P3655) / LM (R&D Systems, 3400-010-01) / FN (VWR / Coming, 47743-654) coated cell culture dishes at 1.0*105cells / cm2Sympathetic neuron growth and maturation was supported by maintaining cells in Neurobasal medium containing 1% N2 supplement, 2% B27 supplement, 1% L-glutamine, 25 ng / ml GDNF (PeproTech, 450), 25 ng / ml BDNF (R&D Systems, 248-BD), 200 pM Ascorbic Acid (Sigma, A8960), 25 ng / ml NGF (PeproTech, 450-01), and 200 pM dbcAMP (Sigma, D0627) with 0. 125 pM RA (Sigma, R2625). RA was added fresh at each feeding from day 14 onwards. Number of independent experiments (biological replicates, n) w ere defined as independent differentiations started at least 3 days apart or from a freshly thawed vial of hPSCs.
[0126] AAV2-BE transduction in iPSC derived neurons and phenotype observation FD iPSC-derived sympathetic neurons w ere transduced with AAV2-BEs. On day 21 of the sympathetic neuron differentiation, viruses were added to Neurobasal media with N2 / B27 / L-glutamine / GDNF / BDNF / Ascorbic Acid / NGF / dbcAMP / RA. Old media was removed from the sympathetic neuron containing wells, and a low- volume of media containing viruses (30 pl / 96 well or 250 pl / 24 w ell) was added to the cells and incubated at 37°C for 6 hours. After 6 hours fresh Neurobasal media with N2 / B27 / L-glutamine / GDNF / BDNF / Ascorbic Acid / NGF / dbcAMP / RA w as added to the wells to increase total media in the wells, so they did not dry out overnight (total 150 pl / 96 well or 500 pl / 24 well). 24 hours after initial transduction, media containing viruses was removed from the w ells and replaced with fresh Neurobasal media with N2 / B27 / L-glutamine / GDNF / BDNF / Ascorbic Acid / NGF / dbcAMP / RA. Brightfield images of transduced sympathetic neurons were taken regularly after transduction to monitor neuron growth and any morphological or viability related effect of the viruses. Fluorescent images were taken using the Lionheart FX Automated Microscope to assess effective transduction with AAV2:GFP. To harvest gDNA from sympathetic neurons, five days after transduction, sympathetic neurons were washed with IX PBS. Then, using a cell scraper, neurons were detached from the plate in ice cold IX PBS and collected in Eppendorf tubes. Dried cell pellets were then flash frozen and shipped on dry ice for further gDNA processing. Electrical activity of sympathetic neurons was performed as previously described^’, 30). Briefly, on day 14 of sympathetic neuron differentiations, cells were plated onto 96- well CytoView MEA plates coated with PO / LM / FN. These cells were transduced as described above. Neural activity was measured at the desired timepoints with the Axion Maestro Pro multiwell plate reader using the neural detection mode.
[0127] Next-generation sequencing and data analysis
[0128] The genome modification efficiencies of nucleases, base editors, and prime editors were determined by next-generation sequencing (NGS) using a 2-step PCR- based Illumina library construction method, similar to as previously described^?.? / Briefly, genomic loci were amplified from approximately 50 ng of gDNA using Q5 High-fidelity DNA Polymerase (NEB) and the primers (Table 8). PCR products were purified using paramagnetic beads prepared as previously described(32. 33). Approximately 20 ng of purified PCR-1 products were used as template for a second round of PCR (PCR-2) to add barcodes and Illumina adapter sequences using Q5 and primers (Table 8) and cycling conditions of 1 cycle at 98 °C for 2 min; 10 cycles at 98 °C for 10 sec, 65 °C for 30 sec, 72 °C 30 sec; and 1 cycle at 72 °C for 5 min. PCR products were purified prior to quantification via capillary electrophoresis (Qiagen QIAxcel), normalization, and pooling. Final libraries were quantified by qPCR using the KAPA Library7Quantification Kit (Complete kit; Universal) (Roche) and sequenced on a MiSeq sequencer using a 300- cycle v2 kit (Illumina). On-target genome editing activities were determined from sequencing data using CRISPResso2(34) using parameters: CRISPResso -rl READ1 -r2 READ2 — amplicon seq— amplicon name — guide seq GUIDE -w 20 -cleavage_offset -10 for nucleases and CRISPResso -rl READ1 -r2 READ2 — amplicon seq — guide seq GUIDE -w 20 — cleavage offset -10 — base editor output — conversion_nuc_from C - conversion nuc to T -min_frequency_alleles_around_cut_to_plot 0.001.
[0129] Off-target analysis via GUIDE-seq2
[0130] GUIDE-seq2 was an adapted version of the original GUIDE-seq method(2 , 25). Briefly, approximately 20,000 HEK 293T cells were seeded per well in 96-well plates ~20 hours prior to transfection, perfonned using 29 ng of nuclease expression plasmid, 12.5 ng of gRNA expression plasmid, 1 pmol of the GUIDE-seq doublestranded oligodeoxynucleotide tag (dsODN; oSQT685 / 686)(24, 25 / and 0.3 pL of TransIT-X2 (Minis). Genomic DNA w as extracted ~72 hours post transfection using the DNAdvance Kit (Beckman Coulter) according to manufacturer's instructions, and then quantified by Qubit (Thenno Fisher). On-target dsODN integration was assessed by PCR amplification, library preparation, and next-generation sequencing as described above, with data analysis via CRISPREsso2(34) run in non-pooled mode by supplying the target site spacer, the reference amplicon, and both the forw ard and reverse dsODN-containing amplicons as HDR' alleles with custom parameters: -w 25 -g GUIDE -plot window size 50. The fraction of alleles bearing an integrated dsODN was calculated as the number of reads mapped to the forward dsODN amplicon plus the number of reads mapped to the reverse dsODN amplicon divided by the sum of the total reads mapped to all three amplicons.
[0131] GUIDE-seq2 reactions were performed essentially as described with minor modifications. Briefly, the Tn5 transposase was prepared by combining 36 pL hyperactive Tn5 (1.85 mg / mL, purified as previously described), 15 pL annealed i5 adapter oligos encoding 8 nucleotide (nt) barcodes and 10-nt unique molecular indexes (UMIs) (Table 8), with 52 pL 2x Tn5 dialysis buffer (100 mM HEPES-KOH pH 7.2, 200 mM NaCl, 0.2 mM EDTA, 2 mM DTT, 0.2% Triton X-100, and 20% glycerol) for 60 minutes at 24 °C. Tagmentation reactions were performed in 40 pL reactions for 7 minutes at 55 °C, containing approximately 250 ng of genomic DNA, 8 pL of the assembled Tn5 / i5 -transposome, and 8 pL of freshly prepared 5x TAPS- DMF buffer (50 mM TAPS-NaOH, 25 mM MgCh, and 50% dimethylformamide (DMF)). Tagmentation reactions were halted using 5 pL of a 50% proteinase K (NEB) solution (mixed with H2O) with incubation at 55 °C for 15 minutes, purified using SPRI-guanidine magnetic beads, and analyzed via TapeStation with High Sensitivity D5000 tapes (Agilent). Separate PCR reactions were performed using dsODN sense- and antisense-specific primers (Table 8) using Platinum Taq (Thenrio Fisher), with a thennocycler program of 95 °C for 5 minutes, followed by 15 cycles of temperature cycling (95 °C for 30 s, 70 °C (-1 °C per cycle) for 120 s, and 72 °C for 30 s), 20 constant cycles (95 °C for 30 s, 55 °C for 60 s, and 72 °C for 30 s), an a final extension at 72 °C for 5 minutes. PCR products were purified using SPRI beads and analyzed via QIAxcel (Qiagen) prior to sample pooling to form single sense- and antisense- libraries. Libraries were purified using the Pippin Prep (Sage Science) DNA size selection system to achieve a size range of 250-500 base pairs. Sense- and antisense- libraries were quantified using Qubit (Thermo Fisher) and pooled in equal amounts to achieve a final concentration of 2 nM. The library was sequenced using NextSeql000 / 2000 P3 kit (Illumina) with cycle settings of 146. 8, 18, 146. Demultiplexed sequencing reads were down sampled to ensure equal numbers of reads for samples being compared using the same gRNA. Data analysis was performed using an updated version of the open-source GUIDE-seq2 analysis software (github.com / tsailabSJ / guideseq / tree / V2) with the max mismatches parameter set to 6.
[0132] A A V production
[0133] Plasmids encoding TadCBEd-SpG split into N-term and C-terminal fragments via an Npu intein and gRNA C6 for packaging into AAV2 and AAV9 vectors were cloned as previously described(2ft 35, 36) (see Table 7 for plasmids). AAV2 or AAV9 vectors encoding BEs and gRNAs were produced by PackGene Biotech Inc. or by our local core facility at Grousbeck Gene Therapy Center, Schepens Eye Research Institute and Massachusetts Eye and Ear Infirman \ AAVs w ere produced from endofree plasmid DNA in a triple transfection (ITR-flanked ExspeUl-eGFP, packaging, and Adeno-helper plasmids) in HEK293 cells. After 3 days, the viral vector was isolated from the combined lysate and cell media via sequential high salt, benzonase (for non-AAV protected DNA digestion) treatment, lysate clearing via high-speed centrifugation, Tangential Flow Filtration (for volume reduction and clearing), lodoxinol gradient ultracentrifugation (for purification and separation of empty vs full particles) and buffer exchange and formulation in PBS via molecular weight cutoff filtration. Preparation w as undergone titration via digital droplet PCR, and quality control for purity w as assessed via SDS-PAGE. Mice andAAV-BE treatment in vivo
[0134] The generation of the TgFD9 mice carrying the human ELP1 transgene with intron 20 6 T>C mutation was previously generated (26). Control and TgFD9 mice have a mixed background, including C57BL / 6J and C57BL / 6N. Both sexes were included in this study. The mice were housed in the animal facility at Massachusetts General Hospital (Boston, MA), provided with access to food and water ad libitum, and maintained on a 12-hour light / dark cycle. All experimental protocols were approved by the Institutional Animal Care and Use Committee of the Massachusetts General Hospital and were in accordance with NIH guidelines. For routine genotyping of progeny, genomic DNA was prepared from tail biopsies, and PCR was carried out using the following primers - forward, 5 -TGATTGACACAGACTCTGGCCA-3’ (SEQ ID NO: 170); reverse, 5'-CTTTCACTCTGAAATTACAGGAAG-3’(SEQ ID NO: 171) - to discriminate the Elpl alleles and the primers - forward 5' - GCCATTGTACTGTTTGCGACT-3’ (SEQ ID NO: 172); reverse, 5 - TGAGTGTCACGATTCTTTCTGC-3’ (SEQ ID NO: 173) - to detect the TgFD9 transgene.
[0135] For Intravitreal injection of AAV-BE vectors, TgFD9 mice were anesthetized by placing them in a mobile isofl urane induction chamber, and the vaporizer was set to an isoflurane concentration of 2% at 2 L / min O2. Pupils of the mice were dilated using 2.5% phenylephrine and 1% tropicamide. About 0.5% proparacaine was used as a topical anesthetic during the procedure for 1-2 min. Genteal gel was used to keep the eyes moist and avoid comeal dryness and opacities. The body temperature of the mouse was kept stable at 37°C throughout the procedure. Under the control of a stereo microscope (Discovery. V20. Zeiss), an incision was made into the sclera posterior of the superior limbus using a sterile, sharp 30-gauge (G) needle without touching the lens. A microliter Hamilton syringe attached to a 34G blunt needle was carefully inserted into the same incision, and 1 pl of the indicated AAV vector combination (45% N-term, 45% C-term, 10% eGFP) at a total dose of 1.5 x 109or 1 x IO10vg was injected slowly into the vitreous using manual pressure. The needle was kept inside the vitreous area for at least 1 minute after the inj ection to avoid reflux of viral suspension. After the completion of intravitreal AAV injections, triple antibiotic ointment (neomycin, bacitracin, and polymyxin B) was applied, and mice were injected subcutaneously with the analgesic buprenorphine (0. 1 mg / kg). For systemic injections, AAV-BE were combined as indicated and injected into the temporal facial vein of neonatal mice (P1-P2) according to a previously described protocol^ 7 / Briefly, neonatal mice were immobilized using cryoanesthesia by freezing on wet ice for 30-60s without direct contact. AAV9 N and C terminal vectors were combined at doses of 3 * IO10or 1.6 x 1011vector genomes (vg) / g diluted in PBS (ThermoFisher Scientific). The pups were monitored for deep anesthesia and were placed under an anatomical microscope. An insulin syringe with a 31 -gauge needle (BD, USA), containing an aliquot of the AAV vector was inserted into the temporal vein. Once the content of the syringe was injected into the facial vein, pups were then warmed with a heat pack to recover from low body temperature and returned to the dam.
[0136] Isolation of retinal cell suspension
[0137] After dissection, retinas were dissociated into single cells using 45U of papain (Worthington, Cat. LS003126) solution (Img L-Cystine, Sigma; 8 KU of DNase I, Affymetrix; in 5 mL DPBS) as previously published<29). The retina was then incubated at 37°C for 20 min, followed by the replacement of buffer with 2 mL ovomucoid solution (15 mg ovomucoid, Worthington Biochemical; 15 mg BSA Thermo Fisher Scientific; in 10 mL DPBS) and 500 pl deactivated FBS. Following the enzy matic digestion, the retinas were carefully triturated and filtered using 20 mm filter. Trituration steps were repeated with an additional 1 mL ovomucoid solution until no tissue was visible. The single cell suspension was then spun down at 300 g, 4°C for 10 mm.
[0138] Extraction of gDNA and RNA from mouse tissues
[0139] Genomic DNA was extracted from mouse tissues using the Agencourt DNAdvance protocol (Beckman Coulter). Briefly, ~10 to 20 mg frozen tissue samples were incubated at 37 °C for 30 min prior to treatment. Lysis reactions were performed using LBH lysis buffer, 1 M DTT, and proteinase K (40 mg / mL) in 200 pL reactions, incubated overnight (18 to 20 hr) at 55 °C with shaking at 100 RPM. gDNA was purified from lysate using Bind BBE solution containing magnetic beads and performing three washes with 70% ethanol. DNA was eluted in 200 pL of Elution buffer EBA, and the approximate concentrations of gDNA were quantified by Nanodrop. Brain and liver tissues were removed and snap-frozen in liquid nitrogen. Tissues were homogenized in ice-cold TRI reagent (Molecular Research Center, Inc., Cincinnati, OH, USA), using a TissueLyser (Qiagen). Total RNA was extracted using the TRI reagent procedure provided by the manufacturer. The yield, purity, and quality of the total RNA for each sample were determined using a Nanodrop ND- 1000 spectrophotometer. According to the manufacturer's protocol, reverse transcription was performed using 1 pg of total RNA. Random Primers (Promega). and Superscript III reverse transcriptase (Invitrogen)(73, 14).
[0140] RT-PCR analysis of full-length and mutant ELP1 transcripts
[0141] RT-PCR was performed using the cDNA equivalent of 100 ng of starting RNA in a 30-pl reaction, using GoTaq® green master mix (Promega) and 30 amplification cycles (94°C for 30 s, 58°C for 30 s, 72°C for 30 s). Human-specific ELP1 primers - forward. 5'- CCTGAGCAGCAATCATGTG -3 (SEQ ID NO: 174); reverse, 5 - TACATGGTCTTCGTGACATC-3’ (SEQ ID NO: 175) - were used to amplify human ELP1 isoform. PCR products were separated on 1.5% agarose gels and stained with ethidium bromide. The relative amounts of WT and mutant (A20) ELP1 spliced isoforms in a single PCR were determined using ImageJ and the integrated density value for each band as previously described^ 3, 14, 26, 38). The relative proportion of the WT isoform detected in a sample was calculated as a percentage.
[0142] RT-qPCR analysis of full-length and mutant ELP1 transcripts
[0143] Tissues were homogenized in ice-cold QIAzol Lysis Reagent (Qiagen), using Qiagen TissueLyser II (Qiagen). Similarly , human fibroblasts were collected, and RNA was extracted with QIAzol Lysis Reagent (Qiagen) following the manufacturer’s instructions. The yields of the total RNA for each sample were determined using aNanodrop ND-1000 spectrophotometer. Full-length and mutant ELP1 mRNA expression w as quantified by quantitative real-time PCR (RT-qPCR) analysis using CFX384 Touch Real-Time PCR Detection System (BioRad). Reverse transcription and qPCR were carried out using One Step RT-qPCR (BioRad) according to the manufacturer’s recommendations. The mRNA levels of full-length ELP1, mutant A20 ELP1 and GAPDH were quantified using Taqman-based RT- qPCR with a cDNA equivalent of 25 ng of starting RNA in a 20-pl reaction. To amplify the full-length ELP1 isoform, FL ELP1 primers forward, 5’- GAGCCCTGGTTTTAGCTCAG -3 (SEQ ID NO: 176); reverse, 5 - CATGCATTCAAATGCCTCTTT -3’ (SEQ ID NO: 177) and FL ELPl probe 5’- TCGGAAGTGGTTGGACAAACTTATGTTT-3' (SEQ ID NO: 178) were used. To amplify the mutant (A20) ELP1 spliced isoforms, A20 ELP1 primers forward, 5'- CACAAAGCTTGTATTACAGACT -3' (SEQ ID NO: 179); reverse, 5 - GAAGGTTTCCACATTTCCAAG -3' (SEQ ID NO: 180) and A20 ELPl probe 5’- CTCAATCTGATTTATGATCATAACCCTAAGGTG -3 (SEQ ID NO: 181) were used to amplify the mutant (A20) ELP1 spliced isoforms. The ELPl forward and reverse primers were each used at a final concentration of 0.4 pM. The ELP1 probes were used at a final concentration of 0. 15 pM. Mouse GAPDH mRNA was amplified using 20X gene expression PCR assay (Life Technologies, Inc.). RT-qPCR was earned out at the following temperatures for indicated times: Step 1: 48°C (15 min); Step 2: 95°C (15 min); Step 3: 95°C (15 sec); Step 4: 60°C (1 min); Steps 3 and 4 were repeated for 39 cycles. The Ct values for each mRNA were converted to mRNA abundance using actual PCR efficiencies. ELP1 FL and A20 mRNAs were normalized to GAPDH and vehicle controls and plotted as fold change compared to vehicle treatment. Data were analyzed using the SDS software.
[0144] Example 1: Development of HEK 293T cell lines harboring ELP1 T6C mutation
[0145] We first established a homozygous HEK 293T cell line harboring the ELP1 T6C mutation via adenosine base editing (ABE). We sought to generate this cell line to rapidly screen and prioritize combinations of editors and guide RNAs (gRNAs) that maximize editing efficiencies. We tested various combinations of gRNAs and ABEs (FIG. 5A). Transfections in HEK 293T cells were performed to investigate the efficacy of these combinations, with some combinations achieving >50% precise introduction of the mutation with the presence or not of bystander editing (FIG. 5A). To create a clonal cell line, we further selected the most optimal ABE paired gRNA- A6 and transfected into fresh HEK 293T cells followed by a serial dilution for single cell sorting (FIG. 5B). Targeted sequencing of the ELPl locus in genomic DNA extracted from clonal cell lines confirmed that some harbored homozygous ELPl T6C mutation. To enhance sensitivity for detecting correction, we selected a homozygous HEK 293T cell line harboring ELPl T6C and no other bystander edits (hereafter named HEK 293T-EL 7-TC6). This cell line was used throughout the study to systematically screen and optimize base editor strategies for correcting the FD mutation.
[0146] Example 2: Development of cytosine base editors to correct the ELP1 T6C mutation
[0147] Using the newly developed HEK 293T -ELP 7-TC6 homozygous cell line, we explored the potential of various cytosine base editors (CBEs) to correct the ELP1 T6C mutation since CBEs can catalyze C»G to T»A edits(27 We recognize that this approach has several challenges. For example, CBEs can only act in a narrow “edit window’' within the gRNA-Cas target site at a fixed distance from a PAM motif, but there are no NGG PAMs typically recognized by wild-type (WT) CRISPR-Cas9 enzymes for this specific ELP1 site (FIG. 1C). Thus, this site was not accessible for WT CRISPR-Cas9 enzymes. Another complicating factor was that the target cytosine has two additional adjacent cytosines, which may lead to bystander edits (FIG. 1C). To overcome these challenges and identify an efficient and precise CBE strategy, we utilized previously engineered SpCas9 variants that have relaxed tolerance for NNN PAMs (named SpRY) or preference for an NGN PAM motif (named SpG) 22). In addition, we designed eight different gRNAs to tile target sites across the ELP1 T6C editable window for CBEs by placing the target cytosine at positions C4 to Cl 1 (FIG. 1C). We tested various Cas enzymes linked with different deaminases and found that recently developed CBEs comprised of the TadCBEd deaminase(27 were more efficient than other conventional options such as BE4max(23) as well as prime editing strategies to edit the ELP1 FD mutation (FIGS. ID, IE, and 6A-6C). Therefore, we cloned TadCBEd deaminase into our SpRY and SpG Cas9 variants. TadCBEd-SpRY enabled C-to-T editing across nearly all gRNAs within this editing window, with the most promising result observ ed using gRNA Cl 1 (NTG PAM), which achieved efficient target base correction without any bystander editing mutation (FIG. ID). TadCBEd-SpG also resulted in C-to-T editing using all gRNAs with NGN PAMs (FIG. ID). The most efficient combination identified across all CBE conditions was TadCBEd-SpG paired with gRNA-C6 (NGC PAM). While this condition resulted in bystander editing at two other cytosine sites (FIG. IE), it is important to emphasize that these edits occurred in the intronic region and have no negative impact on exon 20 inclusion or ELP 1 splicing. Moreover, TadCBEd deaminase domain activity was superior to CBE6a and 6b (FIGS. IF and 1G). Taken together, these data demonstrated that optimized CBEs can correct the ELP1 T6C mutation in human cells.
[0148] Example 3: Optimization of an AAV-delivered base editing strategy to correct the ELP1 T6C mutation
[0149] We selected two conditions for further investigation: (1) TadCBEd-SpRY paired with gRNA-Cl 1, which resulted in reasonable on-target editing with no bystander editing and (2) TadCBEd-SpG paired with gRNA-C6, which resulted in the highest on-target editing. To prepare for in vivo applications, we applied a series of engineering strategies to produce an intein-split system to facilitate the packaging of these constructs into AAV vectors for in vivo delivery (20 / First, we cloned novel variants of intein-split systems expressing gRNAs in both C-terminal and N-terminal, which achieved efficient on-target editing in cells (FIGS. 2A-2C). Most importantly, we observed that TadCBEd-SpG and gRNA-C6 combination delivered via this intein- split system resulted in a significant increase in ELP1 exon 20 inclusion, which was not observed with the TadCBEd-SpRY and gRNA-Cl 1 combination (FIGS. 2D-2F). To better simulate in vivo conditions where BE expression from AAV vectors may be less robust compared to plasmid-based expression, we performed titration experiments in R179H HEK 293T cells. This experiment allowed us to establish a dynamic range of activity across different constructs, reflecting more physiologically relevant expression levels. We observed that TadCBEd-SpG with gRNA C6 resulted in the highest levels of on-target ELP1 TC6 correction (FIG. 2G). Lastly, we evaluated the impact of gRNA orientations relative to the base editor within these constructs, testing whether this architectural variation could impact the editing efficiency (FIG. 2H). Our findings revealed that tandem-facing gRNAs yielded slightly higher editing efficiency compared to the opposite-facing orientation. More importantly, this configuration resulted in a greater rescue of ELP1 exon 20 inclusion (FIGS. 2I-2K). Collectively, these optimizations led to the development of a refined construct that can be suitable for in vivo use.
[0150] Example 4: Assessment of CBE-mediated ELP1 T6C correction specificity
[0151] Given that base editors can introduce unwanted genome-wide off-target edits, we performed an unbiased cell-based assay (GUIDE-seq2) and in silico prediction (Cas-OFFinder) to nominate putative off-target sites. GUIDE-seq2 as used was an updated version of GUIDE-seq(24. 25). We performed GUIDE-seq2 in HEK293T- ELP1-IC6 using nucleases SpG paired with gRNA C6 and and SpRY paired with CH. Sequencing data from GUIDE-seq2 experiments revealed on-target editing (FIG. 3A) and integration of the GUIDE-seq dsODN tag (FIG. 3B). Off-target analysis revealed 5 and 6 off-target sites detected for SpG and SpRY, respectively (FIGS. 3C, 7A, and 7B). With SpG and gRNA-C6, about 70% of reads were attributable to on-target editing, while only about 55% for on-target reads for SpRY and gRNA-C 1 1 (FIG. 3D), suggesting an increased on-target precision for the intended to edit ELP1 site targeting with SpG and gRNA-C 6 when compared to SpRY and gRNA-Cl l. Analysis of putative off-target sites with 3 or fewer mismatches using Cas-OFFinder for SpG with gRNA-C6 or SpRY with gRNA-C 11 revealed 17 and 84 sites, respectively (FIGS. 3E and 8A-8C). Importantly, among the 17 targets identified for SpG with gRNA-C 6, two were also previously identified by GUIDE-seq2.
[0152] We next validated the list of a total of 20 nominated off-target sites from GUIDE-seq2 combined with CasOFFinder for SpG paired with gRNA-C6. For this validation step, we used three different cells that demonstrated precise on-target editing: HEK293T-EC 7-TC6 (FIGS. 3F and 9), FD iPSC-derived sympathetic neurons (FIGS. 3F, 10A, and 10B), and FD patient fibroblasts (FIGS. 3F and 11).
[0153] Off-target base editing was detected at 9 sites in HEK293T-ELP1-TC6 cells, 8 sites in FD iPSC-derived sympathetic neurons, and only a single site in FD patient primary fibroblasts (FIG. 3G). Notably, all significant off-target base editing was lower than 0.2% in absolute values when compared to untreated paired cells (FIG. 3H). In summary, these results demonstrated that our developed TadCBEd-nSpG base editor paired with gRNA-C6 can effectively correct ELP1 T6C with minimal off- target editing in different human cell types.
[0154] Example 5: In vivo testing of ELP1 base editing efficiency in a humanized FD mouse model and phenotypic recovery in human sympathetic neurons
[0155] To assess the translatability of our base editing approach, we used two different AAV seroty pes, AAV2 and AAV9, to deliver our N- and C-terminal TadCBEd-nSpG and gRNA-C6 strategy in the humanized TgFD9 mouse model, which carried the full ELP1 human gene with the FD mutation(26). This model was phenotypically normal, as it expressed normal levels of mouse endogenous Elpl, but it faithfully recapitulated the ELP1 splicing defect observed in FD patients (see, Hirns et al.. (2007) Genomics 90. 389-396), making it an ideal model for testing the effects of our base editing approach on rescuing ELP1 splicing in vivo. We delivered AAV2- BE via intravitreal injections into TgFD9 mice (FIG. 4A) and AAV9-BE systemically in TgFD9 neonates (FIG. 4B). Analysis was conducted using two distinct cohorts for each delivery method, with varying doses and time courses (FIGS. 4A and 4B). These two delivery approaches were highly translatable: AAV2 delivery via intravitreal injection provided a localized treatment that had the potential to rescue retinal degeneration, while AAV9 systemic delivery' had the potential to address the systemic manifestations of the disease. AAV2-BE intravitreal delivery promoted up to 9% on-target editing in retina cells, with average values close to 3% (FIGS. 4C and 4D). In parallel, we observed a range of editing efficiency across different tissues with the systemic injections (FIGS. 4E and 4F). Notably, liver was the most edited tissue w ith about 30% editing on average, and brain tissues reached up to 5% editing levels (FIGS. 4E and 4F). To determine whether these editing levels could rescue ELP1 exon 20 inclusion in vivo, we extracted RNA and calculated the percentage exon 20 inclusion levels in both liver and brain tissues using RT-PCR. Remarkably, in TgFD9 mice injected with AAV9-BE, the percentage of ELP1 exon 20 inclusion in the brain nearly doubled compared to untreated mice. In the liver, although the base editing efficiency was higher than in the brain, we observed only a 20% increase in ELP1 exon 20 inclusion in treated TgFD9 mice compared to untreated controls (FIGS. 4G-4I). One possible explanation for this was the tissue-specific variability7in the splicing of the mutant ELP1 transcript. In the liver, the mutant transcript already- spliced relatively well, reaching an average of 66% exon 20 inclusion, even in untreated TgFD9 mice, whereas in the brain, splicing was much less efficient, with only an average of 18% exon 20 inclusion. The difference in baseline splicing efficiency could explain the more pronounced improvement in splicing following base editing in the brain. These striking findings demonstrated for the first time that these optimized base editors can significantly rescue the ELP1 splicing in mouse brain.
[0156] To assess the therapeutic potential of our approach in rescuing the neuronal phenotype, we used FD iPSC-derived sympathetic neurons, as they accurately recapitulated many of the neuronal features characteristic of FD (27, 28). After treatment with AAV2-BE, we observed approximately 10% editing efficiency in the FD iPSC-derived sympathetic neurons. We recorded the electrical activity of these neurons at 5-, 7-, and 10-days post-transduction, comparing treated and untreated groups (FIGS. 4J and 12). FD sympathetic neurons exhibited hyperactivity when compared to neurons derived from healthy control hiPSCs (FIG. 4K). Notably, in FD sympathetic neurons treated with AAV2-BE, we observed a full recovery' of activity' to normal levels, demonstrating that even a 10% editing efficiency is sufficient to produce a significant improvement in critical FD-related phenotypes. In summary, the development and validation of a gene editing technology targeting the FD splicing mutation provided a groundbreaking approach to treating this devastating disorder. The significance of this work presented herein was underscored by the rapid advancements in gene editing and the severity of FD, a disease that currently lacks effective therapeutic options beyond supportive care. These studies represented a pioneering effort to assess the therapeutic potential and safety7of base editors in correcting the ELP1 splicing defect, both in a mouse model and a human neuronal model of FD. thereby paving the way for future therapeutic interventions in FD.
[0157] References
[0158] 1. S. A. Slaugenhaupt, A. Blumenfeld, S. P. Gill, M. Leyne, J. Mull, M. P. Cuajungco, C. B. Liebert, B. Chadwick, M. Idelson, L. Reznik, C. Robbins, 1. Makalowska, M. Brownstein, D. Krappmann, C. Scheidereit, C. Maayan, F. B. Axelrod, J. F. Gusella, Tissue-specific expression of a splicing mutation in the IKBKAP gene causes familial dysautonomia. Am. J. Hum. Genet. 68, 598-605 (2001).
[0159] 2. S. A. Slaugenhaupt, Genetics of familial dysautonomia. Clin. Auton. Res. 12, 115— 119 (2002).
[0160] 3. M. P. Cuajungco, M. Leyne, J. Mull, S. P. Gill, W. Lu, D. Zagzag, F. B. Axelrod, C. Maayan, J. F. Gusella, S. A. Slaugenhaupt, Tissue-specific reduction in splicing efficiency of IKBKAP due to the major mutation associated with familial dysautonomia. Am. J. Hum. Genet. 72, 749-758 (2003).
[0161] 4. M. Leyne, J. Mull. S. P. Gill, M. P. Cuajungco, C. Oddoux, A. Blumenfeld, C. Maayan, J. F. Gusella, F. B. Axelrod, S. A. Slaugenhaupt, Identification of the first non-Jewish mutation in familial Dysautonomia. Am. J. Med. Genet. A. 118A, 305-308 (2003).
[0162] 5. L. Norcliffe-Kaufmann, S. A. Slaugenhaupt, H. Kaufmann. Familial dysautonomia: History, genoty pe, phenotype and translational research. Prog. Neurobiol. 152, 131— 148 (2017).
[0163] 6. L. Norcliffe-Kaufmann, H. Kaufmann, Familial dysautonomia (Riley-Day syndrome): when baroreceptor feedback fails. Auton. Neurosci. Basic Clin. 172, 26- 30 (2012).
[0164] 7. F. B. Axelrod, J. J. Abularrage, Familial dysautonomia: a prospective study of survival. J. Pediatr. 101, 234-236 (1982).
[0165] 8. F. B. Axelrod, J. Pearson, Congenital sensory neuropathies. Diagnostic distinction from familial dysautonomia. Am. J. Dis. Child. 1960 138, 947-954 (1984). 9. Familial dysautonomia - Axelrod - 2004 - Muscle & Nerve - Wiley Online Library (available at https: / / onlinelibrary.wiley.com / doi / abs / 10. 1002 / mus.10499).
[0166] 10. L. Norcliffe-Kaufmann, F. Axelrod, H. Kaufmann, Afferent baroreflex failure in familial dysautonomia. Neurology 75, 1904-1911 (2010).
[0167] 11. F. B. Axelrod, Familial dysautonomia. Muscle Nerve 29, 352-363 (2004).
[0168] 12. I. Donadon, M. Pinotti. K. Rajkowska, G. Pianigiani, E. Barbon, E. Morini, H. Motaln, B. Rogelj, F. Mingozzi, S. A. Slaugenhaupt, F. Pagani, Exon-specific U1 snRNAs improve ELP1 exon 20 definition and rescue ELP1 protein expression in a familial dysautonomia mouse model. Hum. Mol. Genet. 27, 2466-2476 (2018).
[0169] 13. E. Morini, A. Chekuri, E. M. Logan. J. M. Bolduc, E. G. Kirchner, M. Salani, A. J. Krauson, J. Narasimhan, V. Gabbeta, S. Grover, A. Dakka, A. Mollin, S. P. Jung, X. Zhao, N. Zhang, S. Zhang, M. Arnold, M. G. Well, N. A. Naryshkin, M. Weetali, S. A. Slaugenhaupt, Development of an oral treatment that rescues gait ataxia and retinal degeneration in a phenotypic mouse model of familial dysautonomia. Am. J. Hum. Genet. 110, 531-547 (2023).
[0170] 14. E. Morini, D. Gao, C. M. Montgomery, M. Salani, C. Mazzasette. T. A. Krussig, B. Swain, P. Dietrich, J. Narasimhan, V. Gabbeta, A. Dakka, J. Hedrick, X. Zhao, M. Weetail, N. A. Naryshkin, G. G. Wojtkiewicz. C.-P. Ko, M. E. Talkowski, I.
[0171] Dragatsis, S. A. Slaugenhaupt, ELP1 Splicing Correction Reverses Proprioceptive Sensor\’ Loss in Familial Dysautonomia. Am. J. Hum. Genet. 104, 638-650 (2019).
[0172] 15. G. Romano, F. Riccardi, E. Bussani, S. Vodret, D. Licastro, I. Ragone, G. Ronzitti, E. Morini, S. A. Slaugenhaupt, F. Pagani, Rescue of a familial dysautonomia mouse model by AAV9-Exon-specific U1 snRNA. Am. J. Hum. Genet. 109, 1534- 1548 (2022).
[0173] 16. M. Salani, F. Urbina, A. Brenner, E. Morini, R. Shetty, C. S. Gallagher, E. A. Law, S. Sunshine, D. J. Finneran, G. Johnson, L. Minor, S. A. Slaugenhaupt, Development of a Screening Platform to Identify Small Molecules That Modify ELP1 Pre-mRNA Splicing in Familial Dysautonomia. SLAS Discov. 24, 57-67 (2019).
[0174] 17. A. Schultz, S.-Y. Cheng, E. Kirchner, S. Costello, H. Miettinen, M. Chaverra, C. King, L. George, X. Zhao, J. Narasimhan, M. Weetail, S. Slaugenhaupt, E. Morini, C. Punzo, F. Lefcort, Reduction of retinal ganglion cell death in mouse models of familial dysautonomia using AAV -mediated gene therapy and splicing modulators. Sei. Rep. 13, 18600 (2023).
[0175] 18. R. Sinha, Y. J. Kim, T. Nomakuchi, K. Sahashi, Y. Hua, F. Rigo, C. F. Bennett, A. R. Krainer, Antisense oligonucleotides correct the familial dysautonomia splicing defect in IKBKAP transgenic mice. Nucleic Acids Res. 46, 4833-4844 (2018).
[0176] 19. A. V. Anzalone, L. W. Koblan, D. R. Liu, Genome editing with CRISPR-Cas nucleases, base editors, transposases and prime editors. Nat. Biotechnol. 38, 824-844 (2020).
[0177] 20. C. R. R. Alves, L. L. Ha, R. Yaworski, E. R. Sutton, C. R. Lazzarotto, K. A. Christie, A. Reilly. A. Beauvais. R. M. Doll, D. de la Cruz, C. A. Maguire, K. J. Swoboda, S. Q. Tsai, R. Kothary. B. P. Kleinstiver, Optimization of base editors for the functional correction of SMN2 as a treatment for spinal muscular atrophy. Nat. Biomed. Eng. 8, 118-131 (2024).
[0178] 21. M. E. Neugebauer, A. Hsu, M. Arbab, N. A. Krasnow, A. N. McElroy, S. Pandey, J. L. Doman, T. P. Huang, A. Raguram, S. Banskota, G. A. Newby, J. Tolar, M. J. Osbom, D. R. Liu, Evolution of an adenine base editor into a small, efficient cytosine base editor with low off-target activity7. Nat. Biotechnol. 41, 673-685 (2023). 22. R. T. Walton, K. A. Christie, M. N. Whittaker, B. P. Kleinstiver, Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science 368, 290-296 (2020).
[0179] 23. L. W. Koblan, J. L. Doman, C. Wilson, J. M. Levy, T. Tay, G. A. Newby, J. P. Maianti, A. Raguram, D. R. Liu, Improving cytidine and adenine base editors by expression optimization and ancestral reconstruction. Nat. Biotechnol. 36, 843-846 (2018).
[0180] 24. S. Q. Tsai, Z. Zheng, N. T. Nguyen, M. Liebers, V. V. Topkar, V. Thapar, N. Wyvekens, C. Khayter, A. J. lafrate, L. P. Le, M. J. Aryee, J. K. Joung, GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases. Nat Biotechnol 33, 187-197 (2015).
[0181] 25. N. L. Malinin, G. Lee, C. R. Lazzarotto, Y. Li, Z. Zheng, N. T. Nguyen, M. Liebers, V. V. Topkar, A. J. lafrate, L. P. Le, M. J. Aryee, J. K. Joung, S. Q. Tsai, Defining genome-wide CRISPR-Cas genome-editing nuclease activity with GUIDE- seq. Nat. Protoc. 16, 5592-5615 (2021).
[0182] 26. M. M. Hirns, R. S. Shetty, J. Pickel, J. Mull. M. Leyne, L. Liu, J. F. Gusella, S. A. Slaugenhaupt, A humanized IKBKAP transgenic mouse models a tissue-specific human splicing defect. Genomics 90, 389-396 (2007).
[0183] 27. N. Zeltner, F. Fattahi, N. C. Dubois, N. Saurat, F. Lafaille, L. Shang, B. Zimmer, J. Tchieu, M. A. Soliman, G. Lee, J.-L. Casanova. L. Studer, Capturing the biology of disease severity in a PSC-based model of familial dysautonomia. Nat. Med. 22, 1421— 1427 (2016).
[0184] 28. H.-F. Wu, W. Yu, K. Saito-Diaz, C.-W. Huang, J. Carey, F. Lefcort, G. W. Hart, H.-X. Liu, N. Zeltner, Norepinephrine transporter defects lead to sympathetic hyperactivity in Familial Dysautonomia models. Nat. Commun. 13, 7032 (2022).
[0185] 29. S. Siegert, E. Cabuy, B. G. Scherf, H. Kohler, S. Panda, Y.-Z. Le, H. J. Fehling, D. Gaidatzis, M. B. Stadler, B. Roska, Transcriptional code and disease map for adult retinal cell types. Nat. Neurosci. 15, 487-495 (2012).
[0186] 30. H.-F. Wu, K. Saito-Diaz, C.-W. Huang, J. L. McAlpine, D. E. Seo, D. S.
[0187] Magruder, M. Ishan, H. C. Bergeron, W. H. Delaney, F. R. Santori, S. Krishnaswamy, G. W. Hart, Y.-W. Chen, R. J. Hogan, H.-X. Liu, N. B. Ivanova, N. Zeltner, Parasympathetic neurons derived from human pluripotent stem cells model human diseases and development. Cell Stem Cell 31, 734-753. e8 (2024).
[0188] 31. K. Saito-Diaz, P. Dietrich, T. Saini, M. M. Rashid, H.-F. Wu, M. Ishan, X. Sun, S. Bedillion, A. J. Patel, A. R. Prudden, C. G. Wzientek, T. N. Knight, Y.-W. Chen, G- J. Boons, S. Chen, L. Studer, M. Tiemeyer, B. Xu, I. Dragatsis, H.-X. Liu, N. Zeltner, Genipin rescues developmental and degenerative defects in familial dysautonomia models and accelerates axon regeneration. Sci. Transl. Med. 16, eadq2418 (2024).
[0189] 32. N. Rohland, D. Reich, Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, 939-946 (2012).
[0190] 33. B. P. Kleinstiver. A. A. Sousa. R. T. Walton, Y. E. Tak. J. Y. Hsu, K. Clement. M. M. Welch, J. E. Homg, J. Malagon-Lopez, I. Scarfd, M. V. Maus, L. Pinello, M. J. Aryee, J. K. Joung. Engineered CRISPR-Cas 12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nat. Biotechnol. 37 , 276-282 (2019).
[0191] 34. K. Clement, H. Rees, M. C. Canver, J. M. Gehrke, R. Farouni, J. Y. Hsu, M. A. Cole, D. R. Liu, J. K. Joung, D. E. Bauer, L. Pinello, CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat. Biotechnol. 37, 224-226 (2019).
[0192] 35. S. H. Ramirez, J. F. Hale, S. McCarthy, C. L. Cardenas, K. N. U. G. Dona, K. S. Hanlon, E. Hudry, D. D. L. Cruz, C. Ng, S. Das, D. M. Nguyen, J. Nammour, R. E. Bennet, A. M. Andrews. P. L. Musolino, C. A. Maguire, An Engineered Adeno- Associated Virus Capsid Mediates Efficient Transduction of Pericytes and Smooth Muscle Cells of the Brain Vasculature. Hum. Gene Ther. 34, 682-696 (2023).
[0193] 36. K. S. Hanlon, J. C. Meltzer, T. Buzhdygan, M. J. Cheng, M. Sena-Esteves, R. E. Bennet, T. P. Sullivan, R. Razmpour, Y. Gong, C. Ng, J. Nammour, D. Maiz, S. Dujardin, S. H. Ramirez, E. Hudry, C. A. Maguire, Selection of an Efficient AAV Vector for Robust CNS Transgene Expression. Mol. Ther. Methods Clin. Dev. 15, 320-332 (2019).
[0194] 37. S. E. Gombash Lampe, B. K. Kaspar, K. D. Foust, Intravenous Injections in Neonatal Mice. J. Vis. Exp. JoVE . 52037 (2014).
[0195] 38. R. S. Shetty, C. S. Gallagher, Y.-T. Chen, M. M. Hirns, J. Mull, M. Leyne, J. Pickel, D. Kwok. S. A. Slaugenhaupt, Specific correction of a splice defect in brain by nutritional supplementation. Hum. Mol. Genet. 20, 4093-4101 (2011).
[0196] OTHER EMBODIMENTS
[0197] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
WHAT IS CLAIMED IS:1 . A composition comprising at least one base editor, or a nucleic acid encoding at least one base editor and at least one guide RNA (gRNA), wherein the gRNA comprises a spacer sequence that is complementary to a target sequence in the ELP1 gene.
2. The composition of claim 1, wherein the gRNA is complementary to a target sequence listed in Table 3 (SEQ ID NOS: 185-189).
3. The composition of claim 1 or 2. wherein the gRNA comprises a spacer sequence listed in Table 3 and / or Table 4 (SEQ ID NOS: 1-16 and 190-194).
4. The composition of claim 2, wherein the gRNA spacer sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 16, SEQ ID NO: 13, SEQ ID NO: 10, SEQ ID NO: 9, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ID NO: 192, SEQ ID NO: 193, and SEQ ID NO: 194.
5. The composition of any one of claims 1-4, wherein the at least one base editor comprises at least one DNA binding domain and at least one heterologous functional domain.
6. The composition of claim 5, wherein the at least one DNA binding domain comprises a Cas9 DNA binding domain.
7. The composition of claim 6, wherein the Cas9 DNA binding domain is a DNA binding domain from a wild type Cas9 protein from S. pyogenes (SpCas9) or a variant thereof.
8. The composition of claim 7, wherein the Cas9 DNA binding domain is a DNA binding domain from SpRY.
9. The composition of claim 7, wherein the Cas9 DNA binding domain is a DNA binding domain from SpG.
10. The composition of claim 5, wherein the at least one heterologous functional domain comprises a deaminase domain, optionally wherein the deaminase domain is a cytidine deaminase domain.
11. The composition of claim 10, wherein the deaminase domain comprises at least one evolved TadA cytidine deaminase.
12. The composition of any one of claims 5-11, wherein the at least one base editor comprises a linker between the DNA binding domain and the heterologous functional domain.
13. The composition of any one of claims 1-12, wherein the at least one base editor comprises a cytosine base editor selected from the group consisting of A3G- BE. A3G-BE5.14, Target- AID, Target- AIDmax, Target- AID-NG, SpCas9-TadCBEa, SpCas9-TadCBEb, SpCas9-TadCBEc. SpCas9-TadCBEd, SpCas9-TadCBEe, SpCas9-TadCBEa-V106W, SpCas9-TadCBEd-V106W, SpCas9-TadCBEd- N108Q / L145T, SpRY- Cas9, SpCas9-TadCBEd-V106W / N108Q / L145T, BE4max- NG, BE4max-NRCH, AncBE4-max-NG, YE2-BE3, EE-BE3, YEE-BE3. eAID- BE4max. BE4-max, AncBE4-max, YE2-BE4-NG, EE-BE4-NG, YEE-BE4-NG, R33A+ K34A-BE4-NG, xCas9-BE, SpCas9-NRRH-BE, Td-CBEs and EQR-BE.
14. The composition of any one of claims 1-13, wherein:(i) the base editor is TadCBEd-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 11;(ii) the base editor is TadCBE6a-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 11 ;(iii) the base editor is TadCBE6b-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 11;(iv) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 11 ;(v) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 16;(vi) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 13;(vii) the base editor is TadCBEd-SpRY and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 10; and / or(viii) the base editor is TadCBEd-SpG and the gRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 9.
15. The composition of any one of claims 1-14, wherein the base editor comprises a split-intein base editor.
16. A composition comprising at least one prime editor or a nucleic acid encoding the at least one prime editor, and at least one prime editing guide RNA (pegRNA), wherein the at least one pegRNA comprises a spacer sequence that is complementary' to a target sequence in the ELP1 gene.
17. The composition of claim 16, wherein the at least one prime editor comprises a Cas9 DNA binding protein from pyogenes (SpCas9) or a variant thereof.
18. The composition of claim 16 or 17, wherein the at least one prime editor comprises a PEmax prime editing system.
19. The composition of any one of claims 16-18, wherein the pegRNA spacer sequence comprises the nucleic acid sequence SEQ ID NO: 33 or SEQ ID NO: 34.
20. The composition of any one of claims 16-19, wherein the at least one pegRNA further comprises at least one spacer sequence for second nicking, optionally wherein the at least one spacer sequence for second nicking comprises the nucleic acid sequence SEQ ID NO: 204.
21. The composition of any one of claims 16-20, wherein the at least one pegRNA comprises a primer binding site (PBS) and a reverse transcriptase (RT) template sequence, optionally wherein the PBS / RT template sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 37-45.
22. The composition of any one of claims 16-21, wherein the at least one pegRNA comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOS: 195-203.
23. The composition of any one of claims 1-22, wherein the nucleic acid is in an adeno-associated virus (AAV) vector comprising at least one nucleic acid encoding:(i) the at least one base editor and / or the at least one guide RNA (gRNA) of any one of claims 1-15; and / or(ii) the at least one prime editor and / or the at least one pegRNA of any one of claims 16-22, or wherein the composition comprises an mRNA encoding the base editor or prime editor.
24. The composition vector of claim 23, wherein the AAV vector is a AAV9 vector or a AAV2 vector.
25. A lipid nanoparticle comprising:(i) the composition comprising at least one base editor and / or the at least one guide RNA (gRNA) of any one of claims 1-15; or(ii) the composition comprising at least one prime editor and / or the at least one pegRNA of any one of claims 16-22.
26. The lipid nanoparticle of claim 25 comprising at least one ribonucleoprotein (RNP), wherein the at least one RNP comprises:(i) the composition comprising at least one base editor and / or the at least one guide RNA (gRNA) of any one of claims 1-15; or(ii) the composition comprising at least one prime editor and / or the at least one pegRNA of any one of claims 16-22.
27. A method of correcting a T-to-C mutation in intron 20 of the Elongator acetyltransferase complex subunit 1 (ELP1) gene in the genome of a cell, the methodcomprising delivering to the cell the composition of any one of claims 1-24, or the lipid nanoparticle of claim 25 or 26.
28. The method of claim 27, wherein the cell is in a subject in need thereof, preferably a subject having familial dysautonomia (FD).
29. A method of treating familial dysautonomia (FD) in a subject in need thereof, the method comprising delivering to a cell in the subject a therapeutically effective amount of the composition of any one of claims 1-24, or the lipid nanoparticle of claim 25 or 26.
30. The method of any one of claims 27-29, wherein the subject in need thereof has a T-to-C base transition at the 6th base of intron 20 (c.2204+6T>C) of the ELP1 gene.
31. The method of any one of claims 27-30, wherein the cell in the subject in need thereof is in the brain and / or eye of the subject.
32. The method of any one of claims 27-31, wherein the composition of any one of claims 1-24. or the lipid nanoparticle of claim 25 or 26 is administered to the subject in need thereof by local or systemic delivery.
33. The method of any one of claims 27-32, wherein at least 5% of the ELP1 gene is edited following the delivery’ to the cell in the subject.
Citation Information
Patent Citations
Methods and compositions for determining whether a subject carries a disease associated gene mutation common in jewish populations
US20100304985A1
C-to-G Transversion DNA Base Editors
US20220411777A1
Compounds for improving mRNA splicing
WO2016115434A1