Mapping spatial locations of lipid particles using nucleic acid barcodes

Abstract

Disclosed herein are methods of evaluating the spatial distribution of lipid nanoparticles containing various concentrations of chemical components in tissues or cells using nucleic acid barcodes. In certain embodiments, the methods entail administering a group of lipid nanoparticles that contain nucleic acids that encode a cell surface antigen and barcodes that are correlated to the chemical components of the lipid nanoparticles. The lipid nanoparticles in the tissues of a subject are evaluated for the content of the nucleic acid barcodes at various fixed locations and recorded on a computer readable medium.

Description

[0001] MAPPING SPATIAL LOCATIONS OF LIPID PARTICLES USING NUCLEIC ACID BARCODES

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 63 / 641,107 filed May 1, 2024. The entirety of this application is hereby incorporated by reference for all purposes.

[0004] INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED AS AN XML FILE VIA THE OFFICE ELECTRONIC FILING SYSTEM

[0005] The Sequence Listing associated with this application is provided in XML format and is hereby incorporated by reference into the specification. The name of the XML file containing the Sequence Listing is 24019PCT.xml. The XML file is 44,672 bytes, was created on April 30, 2025, and is being submitted electronically via the USPTO Patent Center.

[0006] BACKGROUND

[0007] Recombinant viral vectors are sometimes used to deliver peptide and oligonucleotide- based therapeutics. Depending on the therapeutic context, undesirable immunogenicity and determining effective dosing amounts are hurdles. As a delivery alternative, on can use formulations of lipid nanoparticles (LNPs). Because LNPs formulations often have high liver tropism, initial clinical applications have been limited to therapies targeting hepatocytes. However, expanding the application of LNP formulations to other tissues is desirable. Thus, there is a need to identify improved methods of directing and evaluating the effectiveness of using LNP formulations to target other specialized tissues.

[0008] Dalman et al. report barcoded nanoparticles for high throughput in vivo discovery of targeted therapeutics. PNAS, 2017, 114(8):2060-2065.

[0009] Wang et al. report an in-situ RNA analysis platform for formalin-fixed, paraffin embedded tissues. J Mol Diagn, 2012, 14(1 ):22-9.

[0010] Sago et al. report high-throughput in vivo screen of functional mRNA delivery identifies nanoparticles for endothelial cell gene editing. PNAS, 2018, 115(42):E9944-E9952.

[0011] Hou et al. report using lipid nanoparticles for mRNA delivery. Nature Reviews Materials, 2021, 6: 1078-1094. Choi et al. report a multiplexed, quantitative, in situ hybridization chain reaction method. Development, 2018, 145, devl65753.

[0012] Sountoulidis et al report spatial mapping of cell states in tissue sections with single-cell resolution. PLoS Biol, 2020, 18(11): e3000675.

[0013] Zhuang reports spatially resolved single-cell genomics and transcriptomics by imaging. Nat Methods, 2021, 18(l): 18-22.

[0014] Debrowolski e al. report nanoparticle single-cell multiomic readouts reveal that cell heterogeneity influences lipid nanoparticle-mediated messenger RNA delivery. Nat Nanotechnol, 2022, 17(8):871-879.

[0015] See also US Pat. Nos. 7,709,198, 8,658,361, 11,034,995 and WO2017 / 066211.

[0016] References cited herein are not an admission of prior art.

[0017] SUMMARY

[0018] Disclosed herein are methods of evaluating the spatial distribution of lipid particles containing various concentrations of chemical components in tissues or cells using nucleic acid barcodes. In certain embodiments, the methods entail administering a group of lipid nanoparticles that contain nucleic acids that encode a cell surface antigen and barcodes that identify and are correlated to the chemical components of the lipid nanoparticles. The lipid nanoparticles in the tissues of a subject are evaluated sequentially for the content of the nucleic acid barcodes at various fixed locations and recorded on a computer readable medium.

[0019] In certain embodiments, this disclosure relates to methods of determining the selective spatial distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter nucleic acid, e.g., mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, wherein the cell surface antigen and barcode segments are associated with chemical components and amounts of chemical components contained in the lipid nanoparticles.

[0020] In certain embodiments, one administers a chemically diverse groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute in a tissue of the subject, and one evaluates various spatial locations in the tissue that contain the barcodes and cell surface antigens to determine the components in the chemically defined lipid nanoparticles that were absorbed by the tissue or cells in the various spatial locations.

[0021] In certain embodiments, this disclosure relates to methods of determining the selective distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter nucleic acid, e.g., mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, wherein the cell surface antigen and barcode segments are associated with specific chemical components and amounts of chemical components contained in the lipid nanoparticles; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject; isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area; contacting the fixed area with a labeling reagent that specifically binds cell surface antigen providing space define zones that absorbed the lipid nanoparticles; detecting the labeling reagent associated with the cell surface antigen; and recording the labeling reagent associated with the cell surface antigen and associated unique location of the space defined zones on a non-transitory computer readable medium.

[0022] In certain embodiments, the methods further comprise contacting the space defined zones with split probes of oligonucleotides that hybridized the barcode segments providing first split probe hybridized labels in the space defined zones; contacting the first split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the first split probe hybridized labels providing first barcode labeled segments; contacting the first barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a first detectable label; detecting first detectable label in each of the space defined zones; recording the first detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; contacting the first detectable label in each of the space defined zones with a dehybridization reagent providing first denatured space defined zones; contacting the denature space defined zones with second split probe oligonucleotides that hybridized the barcode segments providing second split probe hybridized labels in the space defined zones; contacting the second split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the second split probe hybridized labels providing a second barcode labeled segment; contacting the second barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a second detectable label; detecting second detectable label in each of the space defined zones; recording the second detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

[0023] In certain embodiments, methods further comprise the steps of contacting the second detectable label in each of the space defined zones with a dehybridization reagent providing second denatured space defined zones; and contacting the second denature space defined zones with third split probes of oligonucleotides that hybridized the barcode segments providing third split probe hybridized labels in the space defined zones; contacting the third split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the third split probe hybridized labels providing a third barcode labeled segment; contacting the third barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a third detectable label; detecting third detectable label in each of the space defined zones; recording the third detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, the second detectable label and third detectable label in the space defined zones.

[0024] In certain embodiments, the chemical components and amounts of chemical components contained in the lipid nanoparticles include concentrations of an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid. In certain embodiments, the signal amplification reagents contain an amplifier oligonucleotide that hybridizes with the landing segment, wherein the split probe of oligonucleotides have segments that hybridized to the barcode segment, and segments of the landing sequence oligonucleotide hybridize with segments of the split probe oligonucleotides, and fluorescent labels are linked to amplifier oligonucleotide sequences that hybridize to the segments of the landing segment.

[0025] In certain embodiments, the barcode segment is amplified comprising the steps of providing a preamplification probe oligonucleotide comprising a barcode binding segment and second segments providing a preamplification complex, contacting the preamplification complex with amplifier probes that contain multiple landing sites and bind second segments to the preamplification probe providing an amplification complex with landing sites; contacting the amplification complex with landing sites with split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the split probe hybridized labels providing a barcode labeled signal.

[0026] In certain embodiments, this disclosure contemplates methods wherein detecting the barcode segments entails amplification using rolling circle amplification.

[0027] In certain embodiments, this disclosure contemplates methods of determining the selective distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter oligonucleotide, e g., mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, having a first barcode sequence and a second barcode sequence, wherein the cell surface antigen and barcode segments are associated with chemical components and amounts of chemical components contained in the lipid nanoparticles; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject; isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area; contacting the fixed area with a labeling reagent that specifically binds cell surface antigen providing space define zones that absorbed the lipid nanoparticles. contacting the space defined zones with padlock probe oligonucleotides comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the barcode providing a circular nucleic acid complex, contacting the circular nucleic acid complex with a ligation enzyme connecting the first and second barcode binding segment together providing a circular oligonucleotide having a first barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having a first barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the first barcode sequence; and contacting the amplified oligonucleotides having the first barcode sequences with split probe oligonucleotides that hybridized the barcode segments providing an amplified oligonucleotide having split probe hybridized first barcode labels, or contacting the amplified oligonucleotides having the first barcode sequences with labeled probes; contacting the amplified oligonucleotide having split probe hybridized first barcode labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotides hybridizes the amplified oligonucleotide having split probe hybridized first barcode labels providing first barcode labeled segments that contain an amplification segment; contacting the first barcode labeled segment that contain an amplification segment with signal amplification reagents that hybridize to the amplification segment and contain a first detectable label; detecting first detectable label in each of the space defined zones; recording the first detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; contacting the space defined zones with padlock probe oligonucleotides comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the second barcode providing a circular nucleic acid complex, contacting the circular nuclei acid complex with a ligation enzyme connecting the first and second barcode binding segment together providing a circular oligonucleotide having a second barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having a second barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the second barcode sequence; and contacting the amplified oligonucleotides having the second barcode sequences with split probe oligonucleotides that hybridized the second barcode segments providing an amplified oligonucleotide having split probe hybridized second barcode labels, or contacting the amplified oligonucleotides having the second barcode sequences with labeled probes; contacting the amplified oligonucleotide having split probe hybridized second barcode labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the amplified oligonucleotide having split probe hybridized second barcode labels providing second barcode labeled segments that contain an amplification segment; contacting the second barcode labeled segment that contain an amplification segment with signal amplification reagents that hybridize to the amplification segment and contain a second detectable label; detecting second detectable label in each of the space defined zones; recording the second detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

[0028] In certain embodiments, the method further comprises detecting the labeling reagent associated with the cell surface antigen wherein one generates an oligo-conjugated antibody that allows for simultaneous oligo-barcode and protein detection, wherein the oligo-conjugated antibody oligo-barcode is exposed to a padlock probe oligonucleotide comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the oligo-conjugated antibody oligo-barcode providing a circular nucleic acid complex and having a primer landing site sequence; contacting the oligo-conjugated antibody oligo-barcode circular nucleic acid complex having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the oligo-barcode sequence label; and detecting oligo-barcode sequence label in each of the space defined zones; recording the labeling reagent associated with the cell surface antigen and oligo-barcode sequence label and associated unique location of the space defined zones on a non-transitory computer readable medium.

[0029] In certain embodiments, an antibody that binds the cell surface antigen is conjugated to an oligonucleotide barcode providing an antibody bound cell surface antigen barcode, and methods comprises the steps of contacting the antibody bound cell surface antigen barcode with a padlock probe oligonucleotide comprising a first antibody bound cell surface antigen barcode binding segment and second antibody bound cell surface antigen barcode binding segment with a primer landing site sequence between the first and second antibody bound cell surface antigen barcode binding segments, wherein the first and second antibody bound cell surface antigen barcode binding segments hybridize with the antibody bound cell surface antigen barcode providing a circular nucleic acid complex, contacting the circular nuclei acid complex with a ligation enzyme connecting the first and second antibody bound cell surface antigen barcode binding segment together providing a circular oligonucleotide having an antibody bound cell surface antigen barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having an antibody bound cell surface antigen barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the antibody bound cell surface antigen barcode sequence; and contacting the amplified oligonucleotides having the antibody bound cell surface antigen barcode sequences with split probe oligonucleotides that hybridized the barcode segments providing an amplified oligonucleotide having split probe hybridized antibody bound cell surface antigen barcode label, detecting antibody bound cell surface antigen barcode label in each of the space defined zones; recording the antibody bound cell surface antigen barcode label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds antibody bound cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

[0030] In certain embodiments, the chemical components and amounts of chemical components contained in the lipid nanoparticles include concentrations of an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid.

[0031] BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0032] Figure 1 illustrates tissues for analysis using the HiDeN-seq method. A pooled LNP library is injected into the blood stream or locally at directed tissues and tissues of interest are collected for analysis. Tissues of interest are fixed and preserved instantly, reducing bias and increasing viability of sensitive tissues and cell types e.g., pancreas, brain. The tissue can be extracted, and embedded and preserved on a microscope slide wherein multiple rounds of spatial nucleic acid barcode sequencing is performed and parameters are recorded on a computer for storage and analysis (multi-omics).

[0033] Figure 2 illustrates spatial multi-omics to screen for LNP delivery in preserved tissue sections using multiple rounds of fluorescent in situ hybridization, each of which produces a fluorescent dot within an image of a tissue slice. The sequence of colored dots in a given position are decoded to give the unique barcode in that position. This enables precise LNP delivery profiles with subcellular spatial resolution.

[0034] Figure 3 illustrates using nucleic acid barcodes. Reporter mRNAs are incorporated into an LNP, whereby each unique lipid nanoparticle (LNP) formulation has a unique DNA barcode. The pooled LNP library is injected into the blood stream or locally at directed tissues and tissues of interest are collected for analysis. Spatial multi-omics an LNP1 has a tropism for cell type 1 whilst LNP N has a tropism for multiple second cell types.

[0035] Figure 4 illustrates using the HCR™-FISH method, e.g., reported in Choe et al., Development, 2018, 145(12):devl65753, for amplifying target signals. Figure 5 illustrates the desirable outcome when a barcode is derived from two split probe landing sites that are physically far apart on the same mRNA transcript, reducing likelihood of false positive signal even if hybridization occurs. A similar outcome is achieved when the pair of split probes are derived from different genes and or species.

[0036] Figure 6A illustrates barcodes repeated 3 times with short spacers with a fluorescent dye, providing an inherent pre-amplification.

[0037] Figure 6B illustrates a method using Rolling Circle Amplification (RCA). The barcode is a single repeat of the hybridization chain reaction (HCR) landing site. To pre-amplify the barcode, the padlock probe, hybridizes to the barcode and is then ligated to form a closed circular DNA structure. A primer then anneals to a universal primer site which allows Phi polymerase to produce complementary sequence copies of the padlock probe, which creates many landing sites for HCR split probes and greater signal strength. Included are the barcode sequence and its complementary sequence on the padlock probe, accessory sequences, and a universal primer site.

[0038] Figure 6C illustrates a barcode design which places the HCR-landing sites in a secondary branched DNA amplifier, which anneals to a primary amplifier, which in turn anneals to a unique sequence on a DNA oligonucleotide that is incorporated into the LNP. This amplifies a simple oligo sequence into multiple HCR landing sites on the secondary amplifier producing a signal. This in turn allows the user to define the color sequence of multiple imaging rounds that corresponds to a given LNP.

[0039] Figure 7 illustrates an oligo-conjugated antibody that allows for simultaneous DNA barcode and aVHH detection. The cell surface antigen, aVHH, can be detected by exposing the tissue or cells with an antibody that binds aVHH that is produced and displayed on cells that absorb the LNPs. The antibody can be conjugated to one or two oligonucleotide sequences for binding with a padlock probe which is ligated, subject to rolling circle amplification to produce multiple HCR landing sites to be directly detected by using a labeled probe or through the use of a secondary amplifier producing a signal.

[0040] DETAILED DISCUSSION

[0041] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims. "Embodiments" refer to an example, and it is contemplated that the embodiments are not necessarily limited to the example.

[0042] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.

[0043] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited.

[0044] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0045] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of medicine, organic chemistry, biochemistry, molecular biology, pharmacology, and the like, which are within the skill of the art. Such techniques are explained fully in the literature.

[0046] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, a nucleic acid molecule refers to one or more nucleic acid molecules.

[0047] Also, the term "or" is used in its inclusive sense (and not in its exclusive sense) so that when used, for example, to connect a list of elements, the term "or" means one, some, or all of the elements in the list.

[0048] As used herein, the term "about" is synonymous with the term "approximately." Illustratively, the use of the term "about" indicates that a value includes values slightly outside the cited values. Variation may be due to conditions such as experimental error, manufacturing tolerances, variations in equilibrium conditions, and the like. In some embodiments, the term "about" includes the cited value plus or minus 10%. In all cases, where the term "about" has been used to describe a value, it should be appreciated that this disclosure also supports the exact value.

[0049] As used in this disclosure and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") have the meaning ascribed to them in U.S. Patent law in that they are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0050] "Consisting essentially of' or "consists of' or the like, when applied to methods and compositions encompassed by the present disclosure refers to compositions like those disclosed herein that exclude certain prior art elements to provide an inventive feature of a claim, but which may contain additional composition components or method steps, etc., that do not materially affect the basic and novel characteristic(s) of the compositions or methods, compared to those of the corresponding compositions or methods disclosed herein.

[0051] "Subject" refers to any animal, preferably a human patient, livestock, rodent, monkey, or domestic pet.

[0052] A "nucleic acid," or "oligonucleotide," refers to a polymer of nucleotides. As used herein, a "nucleotide" is given its ordinary meaning as used in the art, i.e., a molecule comprising a sugar moiety, a phosphate group, and a base (usually nitrogenous). Typically, the nucleotide comprises one or more bases connected to a sugar-phosphate backbone (a base connected only to a sugar moiety, without the phosphate group, is a "nucleoside"). The sugars within the nucleotide can be, for example, ribose sugars (a "ribonucleic acid," or "RNA"), or deoxyribose sugars (a "deoxyribonucleic acid," or "DNA"). In some cases, the polymer can comprise both ribose and deoxyribose sugars or functioning natural or synthetic derivatives. Examples of bases include, but not limited to, the naturally occurring bases (e.g., adenosine or "A," thymidine or "T," guanosine or "G," cytidine or "C," or uridine or "U"). The terms are used to designate a single molecule, or a collection of molecules. Nucleic acids may be single stranded or double stranded and may include coding regions and regions of various control elements.

[0053] The term "encoding" refers to the inherent property of nucleic acids, i.e., specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, or combinations thereof, to serve as templates or provide additional features important to synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene, cDNA, or RNA, encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence (with T replaced by U) and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0054] As used herein, an “RNA” refers to a polymer of ribonucleic acid that may be naturally or non-naturally occurring. For example, an RNA may include modified and / or non-naturally occurring components such as one or more nucleobases, nucleosides, nucleotides, or linkers. An RNA may include a cap structure, a chain terminating nucleoside, a stem loop, a polyA sequence, and / or a poly adenylation signal. An RNA may have a nucleotide sequence encoding a polypeptide of interest. For example, an RNA may be a messenger RNA (mRNA). Translation of an mRNA encoding a particular polypeptide, for example, in vivo translation of an mRNA inside a mammalian cell, may produce the encoded polypeptide. RNAs may be selected from the nonlimiting group consisting of small interfering RNA (siRNA), microRNA (miRNA), Dicersubstrate RNA (dsRNA), small hairpin RNA (shRNA), mRNA, and mixtures thereof.

[0055] The term "polymerase chain reaction" ("PCR") refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,965,188, that describe a method for increasing the concentration of a segment of a target sequence in a mixture. This process for amplifying the target sequence consists of introducing a large excess of two polynucleotide primers to the nucleic acid mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured, and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one "cycle"; there can be numerous "cycles") to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the "polymerase chain reaction" (hereinafter "PCR"). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "PCR amplified."

[0056] With PCR, it is possible to amplify a single copy of a specific target sequence in genomic DNA to a level detectable by several different methodologies (e.g., hybridization with a labeled probe; incorporation of biotinylated primers followed by avi din-enzyme conjugate detection; incorporation of32P -labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified segment). In addition to genomic DNA, any polynucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are, themselves, efficient templates for subsequent PCR amplifications.

[0057] The terms "PCR product," "PCR fragment," and "amplification product" refer to the resultant mixture of compounds after two or more cycles of the PCR steps of denaturation, annealing and extension are complete. These terms encompass the case where there has been amplification of one or more segments of one or more target sequences.

[0058] Rolling circle amplification (RCA) is an isothermal nucleic acid amplification technique where the polymerase continuously adds single nucleotides to a primer annealed to a circular template which results in a long concatemer single stranded oligonucleotide, e g., DNA that contains tandem repeats (complementary to the circular template). Components for performing RCA include a polymerase a suitable buffer that is compatible with the polymerase, a primer, a circular template, and nucleotide triphosphates (NTPs). Polymerases used in RCA include Phi29, Bst, and Vent exo-DNA polymerase for DNA amplification, and T7 RNA polymerase for RNA amplification. Circular template ligation, which can be conducted via template mediated enzymatic ligation (e.g., T4 DNA ligase) or template-free ligation using special ligases. In primer-induced single-strand elongation, a primer or multiple primers hybridize with the same circle. As a result, multiple amplification events can be initiated, producing multiple RCA products ("Multiprimed RCA"). Amplification products can be detected using fluorophore-conjugated oligonucleotides, fluorophore-tethered complementary oligonucleotides or fluorescently labeled molecular beacons e g., in combination with gel electrophoresis. RCA produces a linear amplification of an oligonucleotide, as each circular template grows at a given speed for a certain amount of time. Hyperbranched rolling circle amplification (HRCA) includes added primers that anneal to the original RCA products. Other amplification techniques include circle to circle amplification (C2CA) wherein the initial RCA products are digested with a restriction enzyme and ligated to create second circular template that is subject to another round of RCA.

[0059] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p- acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art.

[0060] A "heterologous" nucleic acid sequence or peptide sequence refers to a nucleic acid sequence or a peptide sequence that does not naturally occur, e.g., because the whole sequence contains a segment from other plants, bacteria, viruses, other organisms, or joinder of two sequences that occur in the same organism but are joined together in a manner that does not naturally occur in the same organism or any natural state.

[0061] The term "recombinant" when made in reference to a nucleic acid molecule refers to a nucleic acid molecule which is comprised of segments of nucleic acid joined together by means of molecular biological techniques provided that the entire nucleic acid sequence does not occur in nature, i.e., there is at least one mutation in the overall sequence such that the entire sequence is not naturally occurring even though separately segments may occur in nature. The segments may be joined in an altered arrangement such that the entire nucleic acid sequence from start to finish does not naturally occur. The term "recombinant" when made in reference to a protein or a peptide refers to a protein molecule that is expressed using a recombinant nucleic acid molecule.

[0062] In certain contexts, an “antibody” refers to a protein-based molecule that is naturally produced by animals in response to the presence of a protein or other molecule or that is not recognized by the animal’s immune system to be a “self’ molecule, i.e., recognized by the animal to be a foreign molecule, i.e., an antigen to the antibody. The immune system of the animal will create an antibody to specifically bind the antigen (or any cell or organism attached to the antigen) and thereby targeting the antigen for degradation or elimination. It is well recognized by skilled artisans that the molecular structure of a natural antibody can be synthesized and altered by laboratory techniques. Recombinant engineering can be used to generate fully synthetic antibodies or fragments thereof providing control over variations of the amino acid sequences of the antibody. Thus, the term “antibody” is intended to include natural antibodies, monoclonal antibody, or non- naturally produced synthetic antibodies, such as specific binding single chain antibodies, bispecific antibodies, or fragments thereof. These antibodies may have chemical modifications. The term "monoclonal antibodies" refers to a collection of antibodies encoded by the same nucleic acid molecule that are optionally produced by a single hybridoma (or clone thereof) or other cell line, or by a transgenic mammal such that each monoclonal antibody will typically recognize the same antigen. The term "monoclonal" is not limited to any particular method for making the antibody, nor is the term limited to antibodies produced in a particular species, e g., mouse, rat, etc.

[0063] In humans, from a structural standpoint, an antibody is a combination of proteins: two heavy chain proteins and two light chain proteins. Alternatively, other animals produce antibodies from nucleic acids that encode a single protein. In humans, the heavy chains are longer than the light chains. The two heavy chains typically have the same amino acid sequence. Similarly, the two light chains typically have the same amino acid sequence. Each of the heavy and light chains contain a variable segment that contains amino acid sequences which participate in binding to the antigen. The variable segments of the heavy chain do not have the same amino acid sequences as the light chains. The variable segments are often referred to as the antigen binding domains. The antigen and the variable regions of the antibody may physically interact with each other at specific smaller segments of an antigen often referred to as the "epitope." Epitopes usually consist of surface groupings of molecules, for example, amino acids or carbohydrates. The terms “variable region,” "antigen binding domain," and "antigen binding region" refer to that portion of the antibody molecule which contains the amino acid residues that interact with an antigen and confer on the antibody its specificity and affinity for the antigen. Small binding regions within the antigenbinding domain that typically interact with the epitope are also commonly alternatively referred to as the "complementarity-determining regions, or CDRs."

[0064] A "chimeric antibody" is a molecule in which different portions of the antibody are derived from different immunoglobulin molecules such that the entire molecule is not naturally occurring. Examples of chimeric antibodies include those having available region derived from anon-human antibody and a human immunoglobulin constant region. The term is also intended to include antibodies having a variable region derived from one human antibody grafted to an immunoglobulin constant region of a predetermined sequences or the constant region from another human for which there are allotypic differences residing in the constant regions of any naturally occurring antibody having the variable regions, e.g., CDRs 1, 2, and 3 of the light and heavy chain. Human heavy chain genes exhibit structural polymorphism (allotypes) that are inherited as a haplotype. The serologically defined allotypes differ within and between population groups. See Jefferis et al. mAb, 1 (2009), pp. 332-338.

[0065] "Single chain antibodies" refer to a single peptide containing naturally or non-naturally occurring sequences, including synthetically modified peptide sequences, derived from an antibody variable region that specifically binds an antigen of interest. Single chain antibodies are sometimes fragments or variants of naturally occurring mammalian antibodies. Such antibodies are sometimes referred to as single-domain antibodies (sdAbsor or VHHs), or camelid singledomain antibodies, e.g., when derived from an animal of Camelidae family, e.g., lamas, camels.

[0066] Lipid Nanoparticles

[0067] In certain embodiments, lipid nanoparticles disclosed herein include ionizable lipids, PEG lipids, phospholipids, and sterols. In certain embodiments, lipid nanoparticles disclosed herein comprise a nucleic acid that encodes a barcode, antibody, and / or protein, an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid.

[0068] In certain embodiments, the disclosed lipid nanoparticles include an ionizable lipid. Ionizable lipids have a positive or partial positive charge at physiological pH. Exemplary alternative ionizable lipids include but are not limited to l-linoleoyl-2-linoleyloxy-3- dimethylaminopropane, l,2-dilinoleylcarbanioyloxy-3-dimethylaniinopropane, l,2-dilmoleoyl-3- dimethylammopropane, 1 ,2-dilinoleyloxy-N,N-dimethylaminopropane, 2,2-dilinoleyl-4-dimethy laminomethyl-[l,3]-dioxolane, l,2-dioieoyl-3 -dimethylammonium propane, N,N-dimethyl-(2,3- dioleyloxy)propylamine, spermine cholesterylcarbamate, bis-guanidinium-spermidine- cholesterol, .V-Zc / 7-butyl-.V-tetradecyl-3-(tetradecylamino)propanimidamide, dimethyldioctadecylaminium bromide, N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N- hydroxyethylaminium bromide, aminopropyl-dimethyl-bis(dodecyloxy)-propanaminium bromide, l,2-dioleoyl-sn-3-phosphoethanolamine (“DOPE”), or combinations thereof. In certain embodiments, the disclosed lipid nanoparticles include a polyethylene glycol phospholipid or alternative. Such polyethylene glycol phospholipid may be alternately referred to as PEGylated lipids. Inclusion of a PEGylating lipid can be used to enhance lipid nanoparticle colloidal stability in vitro and circulation time in vivo. In some embodiments, the PEGylation is reversible in that the PEG moiety is gradually released in blood circulation. Exemplary PEG-lipids include but are not limited to PEG conjugated to saturated or unsaturated alkyl chains having a length of C3-C22. PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides (PEG-CER), PEG-modified dialkylamines, PEG-modified di acylglycerols (PEG-DAG), PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC or a PEG- DSPE lipid. In certain embodiments, the molecular weight of the PEG lipid can be about 1 KDa, 2 KDa, or 3 KDa.

[0069] In certain embodiments, the disclosed lipid nanoparticles include an alternative phospholipid moiety that may be selected from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety may be selected from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Nonnatural species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid may be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group may undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions may be useful in functionalizing a lipid bilayer to provide a nanoparticle composition with a targeting or imaging moiety (e.g., a dye).

[0070] In certain embodiments, the disclosed lipid nanoparticles include alternative phospholipids such as l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), l,2-dilinoleoyl-sn-glycero-3 -phosphocholine (DLPC), 1,2- dimyristoyl-sn-glycero-phosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3 -phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero- phosphocholine (DUPC), l-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1 ,2- dilinolenoyl-sn-glycero-3 -phosphocholine, l,2-diarachidonoyl-sn-glycero-3 -phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3 -phosphocholine, l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, l,2-diarachidonoyl-sn-glycero-3- phosphoethanolamine, l,2-didocosahexaenoyl-sn-glycero-3 -phosphoethanolamine, distearoyl- phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), 1-stearoyl- 2-oleoyl-phosphatidy ethanolamine (SOPE), l-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidyl serine, phosphatidylinositol, phosphatidic acid, or lysophosphatidylcholine.

[0071] Spatial methods of barcoding and evaluating cells or tissues that absorb lipid nanoparticles

[0072] It is contemplated that spatial information, in combination with transcriptional profile, better defines cell type, transcriptome profiles change when tissues are dissociated. Thus, a benefit of using methods disclosed herein are that the methods keep tissues intact and one is able to evaluate specialized tissues such as the brain, muscle and the heart which are problematic using other methods, e.g., single cell RNA-seq.

[0073] In certain embodiments, this disclosure relates to methods of determining the selective distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, wherein the cell surface antigen and barcode segments are associated with chemical components and amounts of chemical components contained in the lipid nanoparticles.

[0074] In certain embodiments, one administers a chemically diverse groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute in a tissue of a subject, a segment of a specialized tissue is isolated, and one evaluates various spatial locations in the tissue that contain the barcodes and cell surface antigens to determine the components in the chemically defined lipid nanoparticles that were absorbed by the tissue or cells in the various spatial locations.

[0075] In certain embodiments, this disclosure relates to methods of determining the selective distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nan oparticles, wherein the groups of lipid nanoparticles contain a reporter oligonucleotide, e g., mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, wherein the cell surface antigen and barcode segments are associated with specific chemical components and amounts of chemical components contained in the lipid nanoparticles; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject; isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area; contacting the fixed area with a labeling reagent that specifically binds cell surface antigen providing space define zones that absorbed the lipid nanoparticles; detecting the labeling reagent associated with the cell surface antigen; and recording the labeling reagent associated with the cell surface antigen and associated unique location of the space defined zones on a non-transitory computer readable medium.

[0076] In certain embodiments, the methods further comprise contacting the space defined zones with split probes of oligonucleotides that hybridized the barcode segments providing first split probe hybridized labels in the space defined zones; contacting the first split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the first split probe hybridized labels providing first barcode labeled segments; contacting the first barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a first detectable label; detecting first detectable label in each of the space defined zones; recording the first detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; contacting the first detectable label in each of the space defined zones with a dehybridization reagent providing first denatured space defined zones; contacting the denature space defined zones with second split probe oligonucleotides that hybridized the barcode segments providing second split probe hybridized labels in the space defined zones; contacting the second split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the second split probe hybridized labels providing a second barcode labeled segment; contacting the second barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a second detectable label; detecting second detectable label in each of the space defined zones; recording the second detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

[0077] In certain embodiments, methods further comprise the steps of contacting the second detectable label in each of the space defined zones with a dehybridization reagent providing second denatured space defined zones; and contacting the second denature space defined zones with third split probes of oligonucleotides that hybridized the barcode segments providing third split probe hybridized labels in the space defined zones; contacting the third split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the third split probe hybridized labels providing a third barcode labeled segment; contacting the third barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a third detectable label; detecting third detectable label in each of the space defined zones; recording the third detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, the second detectable label and third detectable label in the space defined zones.

[0078] In certain embodiments, the chemical components and amounts of chemical components contained in the lipid nanoparticles include concentrations of an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid.

[0079] In certain embodiments, the signal amplification reagents contain an amplifier oligonucleotide that hybridizes with the landing segment, wherein the split probe of oligonucleotides have segments that hybridized to the barcode segment, and segments of the landing sequence oligonucleotide hybridize with segments of the split probe oligonucleotides, and fluorescent labels are linked to amplifier oligonucleotide sequences that hybridize to the segments of the landing segment.

[0080] In certain embodiments, the barcode segment is amplified comprising the steps of providing a preamplification probe oligonucleotide comprising a barcode binding segment and second segments providing a preamplification complex, contacting the preamplification complex with amplifier probes that contain multiple landing sites and bind second segments to the preamplification probe providing an amplification complex with landing sites; contacting the amplification complex with landing sites with split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the split probe hybridized labels providing a barcode labeled signal.

[0081] In certain embodiments, this disclosure contemplates methods wherein detecting the barcode segments entails amplification using rolling circle amplification.

[0082] In certain embodiments, this disclosure contemplates methods of determining the selective distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, having a first barcode sequence and a second barcode sequence, wherein the cell surface antigen and barcode segments are associated with chemical components and amounts of chemical components contained in the lipid nanoparticles; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject; isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area; contacting the fixed area with a labeling reagent that specifically binds cell surface antigen providing space define zones that absorbed the lipid nanoparticles. contacting the space defined zones with padlock probe oligonucleotides comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the barcode providing a circular nucleic acid complex, contacting the circular nucleic acid complex with a ligation enzyme connecting the first and second barcode binding segment together providing a circular oligonucleotide having a first barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having a first barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the first barcode sequence; and contacting the amplified oligonucleotides having the first barcode sequences with split probe oligonucleotides that hybridized the barcode segments providing an amplified oligonucleotide having split probe hybridized first barcode labels, contacting the amplified oligonucleotide having split probe hybridized first barcode labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotides hybridizes the amplified oligonucleotide having split probe hybridized first barcode labels providing first barcode labeled segments that contain an amplification segment; contacting the first barcode labeled segment that contain an amplification segment with signal amplification reagents that hybridize to the amplification segment and contain a first detectable label; detecting first detectable label in each of the space defined zones; recording the first detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; contacting the space defined zones with padlock probe oligonucleotides comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the second barcode providing a circular nucleic acid complex, contacting the circular nuclei acid complex with a ligation enzyme connecting the first and second barcode binding segment together providing a circular oligonucleotide having a second barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having a second barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the second barcode sequence; and contacting the amplified oligonucleotides having the second barcode sequences with split probe oligonucleotides that hybridized the second barcode segments providing an amplified oligonucleotide having split probe hybridized second barcode labels, contacting the amplified oligonucleotide having split probe hybridized second barcode labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the amplified oligonucleotide having split probe hybridized second barcode labels providing second barcode labeled segments that contain an amplification segment; contacting the second barcode labeled segment that contain an amplification segment with signal amplification reagents that hybridize to the amplification segment and contain a second detectable label; detecting second detectable label in each of the space defined zones; recording the second detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

[0083] In certain embodiments, the method further comprises detecting the labeling reagent associated with the cell surface antigen wherein one generates an oligo-conjugated antibody that allows for simultaneous oligo-barcode and protein detection, wherein the oligo-conjugated antibody oligo-barcode is exposed to a padlock probe oligonucleotide comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the oligo-conjugated antibody oligo-barcode providing a circular nucleic acid complex and having a primer landing site sequence; contacting the oligo-conjugated antibody oligo-barcode circular nucleic acid complex having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the oligo-barcode sequence label; and detecting oligo-barcode sequence label in each of the space defined zones; recording the labeling reagent associated with the cell surface antigen and oligo-barcode sequence label and associated unique location of the space defined zones on a non-transitory computer readable medium. In certain embodiments, an antibody that binds the cell surface antigen is conjugated to an oligonucleotide barcode providing an antibody bound cell surface antigen barcode, and methods comprises the steps of contacting the antibody bound cell surface antigen barcode with a padlock probe oligonucleotide comprising a first antibody bound cell surface antigen barcode binding segment and second antibody bound cell surface antigen barcode binding segment with a primer landing site sequence between the first and second antibody bound cell surface antigen barcode binding segments, wherein the first and second antibody bound cell surface antigen barcode binding segments hybridize with the antibody bound cell surface antigen barcode providing a circular nucleic acid complex, contacting the circular nuclei acid complex with a ligation enzyme connecting the first and second antibody bound cell surface antigen barcode binding segment together providing a circular oligonucleotide having an antibody bound cell surface antigen barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having an antibody bound cell surface antigen barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the antibody bound cell surface antigen barcode sequence; and contacting the amplified oligonucleotides having the antibody bound cell surface antigen barcode sequences with split probe oligonucleotides that hybridized the barcode segments providing an amplified oligonucleotide having split probe hybridized antibody bound cell surface antigen barcode label, detecting antibody bound cell surface antigen barcode label in each of the space defined zones; recording the antibody bound cell surface antigen barcode label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds antibody bound cell surface antigen, first detectable label, and the second detectable label in the space defined zones. In certain embodiments, the chemical components and amounts of chemical components contained in the lipid nanoparticles include concentrations of an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid.

[0084] In certain embodiments, the split probes are:

[0085] CACCCCTTCCTGCATGGATTTTATAA (SEQ ID NO: 17) and GCAGCAGTCCTGCCTAAGATTCACAC (SEQ ID NO: 18),

[0086] AGTTGTTAACCAGATCAAAACCCGTC (SEQ ID NO: 19) and AGGATTCAGGAACTGCACTGTCAGCC (SEQ ID NO: 20),

[0087] AACCAAAGCTGACCAGGAAAAAATGG (SEQ ID NO: 21) and CCCCCTGTCCCATCTGTTTAATCCCA (SEQ ID NO: 22),

[0088] TGCTTCCTTGCTGATTTTCACATTGG (SEQ ID NO: 23) and AGCACCTCCCTCCTACTTTCACTCAG (SEQ ID NO: 24),

[0089] TGACTCCTGACAACTGATCAGAGAGA (SEQ ID NO: 25) and TTCTGTCAGTGGAGAGGGTGAAGGTG (SEQ ID NO: 26),

[0090] ATGCATGAATCTTGATCCCTGCTGGA (SEQ ID NO: 27) and TGTGTTGTGGGACCTTCTAACGGGTA (SEQ ID NO: 28),

[0091] CCTCTATCCAGGCTCACTACAAGAAT (SEQ ID NO: 29) and GTTCCATGGCCAACACTTGTCACTAC (SEQ ID NO: 30),

[0092] CGTGCTGAAGTCAAGTTTGAAGGTGA (SEQ ID NO: 31) and CATTACCTGTCCACACAATCTGCCCT (SEQ ID NO: 32),

[0093] TGAAGATGGAAGCGTTCAACTAGCAG (SEQ ID NO: 33) and TGACTTTTTCAAGAGTGCCATGCCCG (SEQ ID NO: 34), GTAATCTCCATCGCAGTTGAACCGAA (SEQ ID NO: 35) and

[0094] TCTGGTATGGCTAAGCAGTATGAGCC (SEQ ID NO: 36),

[0095] AAAGGTGGTGTAATCCCTGGCGAATA (SEQ ID NO: 37) and GAATGGCACCAGAACCTGATCGAATC (SEQ ID NO: 38),

[0096] CTTGAGCCGATCATGAAGGTTGAAGT (SEQ ID NO: 39) and

[0097] CGTCAGCGCGTTCTGAACAACGAAAT (SEQ ID NO: 40),

[0098] TCTGAAAGACGTAACCACTGGTGACA (SEQ ID NO: 41) and

[0099] CGTCTGCACTTCGGTTCTTACCATGA (SEQ ID NO: 42),

[0100] CAACGTTGAAGCGAACGTAGGTAAAC (SEQ ID NO: 43) and

[0101] GTTACTGGCGTTAAGATCCACGCTGA (SEQ ID NO: 44),

[0102] AGTACCGCTGTCTGAAATGTTCGGAT (SEQ ID NO: 45) and TATCCTGGACGACGGTAAAGACACTC (SEQ ID NO: 46),

[0103] CACCAAGAAAGCTACCATGCACTTGC (SEQ ID NO: 47) and CGTTGACTCCTCTGAACTGGCGTTTA (SEQ ID NO: 48).

[0104] In certain embodiments, this disclosure relates to compositions comprising one or more of pairs of the split probes.

[0105] In certain embodiments, this disclosure relates to compositions comprising two or more of pairs of the split probes.

[0106] In certain embodiments, this disclosure relates to compositions comprising three or more of pairs of the split probes.

[0107] In certain embodiments, this disclosure relates to compositions comprising four or more of pairs of the split probes.

[0108] In certain embodiments, this disclosure relates to compositions comprising five or more of pairs of the split probes. In certain embodiments, this disclosure relates to compositions comprising six or more of pairs of the split probes.

[0109] In certain embodiments, this disclosure relates to compositions comprising seven or more of pairs of the split probes.

[0110] In certain embodiments, this disclosure relates to compositions comprising eight or more of pairs of the split probes.

[0111] In certain embodiments, this disclosure relates to compositions comprising nine or more of pairs of the split probes.

[0112] In certain embodiments, this disclosure relates to compositions comprising ten or more of pairs of the split probes.

[0113] In certain embodiments, this disclosure relates to compositions comprising eleven or more of pairs of the split probes.

[0114] In certain embodiments, this disclosure relates to compositions comprising twelve or more of pairs of the split probes.

[0115] In certain embodiments, this disclosure relates to compositions comprising thirteen or more of pairs of the split probes.

[0116] In certain embodiments, this disclosure relates to compositions comprising fourteen or more of pairs of the split probes.

[0117] In certain embodiments, this disclosure relates to compositions comprising fifteen or more of pairs of the split probes.

[0118] In certain embodiments, the split probe landing sequences are: GCAGCAGTCCTGCCTAAGATTCACACCACCCCTTCCTGCATGGATTTTATAA (SEQ ID NO: 1), HAGTTGTTAACCAGATCAAAACCCGTCAGGATTCAGGAACTGCACTGTCAGCC (SEQ ID NO: 2), AACCAAAGCTGACCAGGAAAAAATGGCCCCCTGTCCCATCTGTTTAATCCCA (SEQ ID NO: 3), TGCTTCCTTGCTGATTTTCACATTGGAGCACCTCCCTCCTACTTTCACTCAG (SEQ ID NO: 4), TGACTCCTGACAACTGATCAGAGAGATTCTGTCAGTGGAGAGGGTGAAGGTG (SEQ ID NO: 5), ATGCATGAATCTTGATCCCTGCTGGATGTGTTGTGGGACCTTCTAACGGGTA (SEQ ID

[0119] NO: 6),

[0120] CCTCTATCCAGGCTCACTACAAGAATGTTCCATGGCCAACACTTGTCACTAC (SEQ ID

[0121] NO: 7),

[0122] CGTGCTGAAGTCAAGTTTGAAGGTGACATTACCTGTCCACACAATCTGCCCT (SEQ ID

[0123] NO: 8),

[0124] TGAAGATGGAAGCGTTCAACTAGCAGTGACTTTTTCAAGAGTGCCATGCCCG (SEQ

[0125] ID NO: 9),

[0126] GTAATCTCCATCGCAGTTGAACCGAATCTGGTATGGCTAAGCAGTATGAGCC (SEQ

[0127] ID NO: 10),

[0128] AAAGGTGGTGTAATCCCTGGCGAATAGAATGGCACCAGAACCTGATCGAATC (SEQ

[0129] ID NO: 11),

[0130] CTTGAGCCGATCATGAAGGTTGAAGTCGTCAGCGCGTTCTGAACAACGAAAT (SEQ

[0131] ID NO: 12),

[0132] TCTGAAAGACGTAACCACTGGTGACACGTCTGCACTTCGGTTCTTACCATGA (SEQ ID

[0133] NO: 13),

[0134] CAACGTTGAAGCGAACGTAGGTAAACGTTACTGGCGTTAAGATCCACGCTGA (SEQ

[0135] ID NO: 14),

[0136] AGTACCGCTGTCTGAAATGTTCGGATTATCCTGGACGACGGTAAAGACACTC (SEQ

[0137] ID NO: 15)

[0138] CACCAAGAAAGCTACCATGCACTTGCCGTTGACTCCTCTGAACTGGCGTTTA (SEQ ID NO: 16).

[0139] In certain embodiments, this disclosure contemplates composition comprising one of more of the split probe oligonucleotide sequences.

[0140] In certain embodiments, this disclosure contemplates composition comprising two or more of the split probe oligonucleotide sequences.

[0141] In certain embodiments, this disclosure contemplates composition comprising three or more of the split probe oligonucleotide sequences.

[0142] In certain embodiments, this disclosure contemplates composition comprising four or more of the split probe oligonucleotide sequences. In certain embodiments, this disclosure contemplates composition comprising five or more of the split probe oligonucleotide sequences.

[0143] In certain embodiments, this disclosure contemplates composition comprising six or more of the split probe oligonucleotide sequences.

[0144] In certain embodiments, this disclosure contemplates composition comprising seven or more of the split probe oligonucleotide sequences.

[0145] In certain embodiments, this disclosure contemplates composition comprising eight or more of the split probe oligonucleotide sequences.

[0146] In certain embodiments, this disclosure contemplates composition comprising one more of the split probe oligonucleotide sequences.

[0147] In certain embodiments, this disclosure contemplates composition comprising nine or more of the split probe oligonucleotide sequences.

[0148] In certain embodiments, this disclosure contemplates composition comprising one more of the split probe oligonucleotide sequences.

[0149] In certain embodiments, this disclosure contemplates composition comprising ten or more of the split probe oligonucleotide sequences.

[0150] In certain embodiments, this disclosure contemplates composition comprising eleven or more of the split probe oligonucleotide sequences.

[0151] In certain embodiments, this disclosure contemplates composition comprising one more of the split probe oligonucleotide sequences.

[0152] In certain embodiments, this disclosure contemplates composition comprising twelve more of the split probe oligonucleotide sequences.

[0153] In certain embodiments, this disclosure contemplates composition comprising thirteen or more of the split probe oligonucleotide sequences.

[0154] In certain embodiments, this disclosure contemplates composition comprising fourteen or more of the split probe oligonucleotide sequences.

[0155] In certain embodiments, this disclosure contemplates composition comprising fifteen or more of the split probe oligonucleotide sequences.

[0156] In certain embodiments, this disclosure relates to methods of spatially characterizing zones of a tissue comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein the oligonucleotide barcode sequences are unique target sequence associated with chemical components and amounts of chemical components contained in the lipid nanoparticles; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject; isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area providing space defined zones within the fixed area; contacting the space defined zones with oligonucleotides that hybridized the oligonucleotide barcode sequences providing hybridized labels in the space defined zones; detecting the hybridized labels in the space defined zones and recording on a non-transitory computer readable medium which hybridized labels are associated with the individual space defined zones; determining the barcode sequences associated with the individual space defined zones base on which hybridized labels are associated with the space defined zones and recording on a non-transitory computer readable medium which barcode sequence are associated with the space defined zones; contacting the space defined zones with a labeled specific binding agent that specifically binds the cell surface antigen providing labeled cell surface antigens in the space defined zones and recording on a non- transitory computer readable medium which labeled cell surface antigens are associated with which space defined zones.

[0157] In certain embodiments, the space defined zone are exposed to multiple rounds of hybridized labels and surface antigen labels and one records each of the multiple rounds of exposure on a non-transitory computer readable medium and one determines which barcode sequence are associated with the space defined zones, and wherein the lipid nanoparticle compositions are identified from the pattern of labels at the defined zones, e.g., wherein the pattens of labels are compared to a recorded known pattern associated with the specific lipid nanoparticle composition.

[0158] It is contemplated that spatial information, in combination with transcriptional profile, better defines cell type, transcriptome profiles change when tissues are dissociated, this method keeps tissues intact and one is able to evaluate specialized tissues such as the brain, muscle and the heart which are problematic using other methods, e g., single cell RNA-seq.

[0159] In certain embodiments, the oligonucleotides that hybridized the oligonucleotide barcode sequences are split probes. In certain embodiments, contacting the zones with oligonucleotides that hybridized the oligonucleotide barcode sequences providing hybridized labels in the zones is by a hybridization chain reaction (HCR) having oligonucleotides comprising a fluorescent label.

[0160] In certain embodiments, the groups of lipid nanoparticles wherein individual lipid nanoparticles contain a barcode associated with the lipid nanoparticle chemical components.

[0161] In certain embodiments, the tissue of the subject is heart tissue, skeletal muscle tissue or, central nervous system tissue.

[0162] In certain embodiments, contemplated nanoparticles comprise a reporter oligonucleotide / mRNA that encodes a cell surface antigen, a nucleic acid barcode, such as mRNA or DNA, an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid.

[0163] In certain embodiments, the labeled specific binding agent that specifically binds the cell surface antigen is an antibody or other specific binding agent comprising split probes.

[0164] In certain embodiments, the unique sequences are at a number of greater or less than 100, 1,000, or 10,000.

[0165] In certain embodiments, the subject is a mouse, rat, human patient, or non-human primate.

[0166] In certain embodiments, methods comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein the oligonucleotide barcode sequences are unique target sequence associated with chemical components and amounts of chemical components contained in the lipid nanoparticles and wherein the number of unique sequences are greater than or less than 100, 1,000, 10,000; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject; isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area providing zones within the fixed area; contacting the zones with a first set of oligonucleotides that hybridized the oligonucleotide barcode sequences providing a first set of hybridized labels in the zones; detecting the first set of hybridized labels in the zones at a first point in time and recording on a non-transitory computer readable medium which first set of hybridized labels are associated with the zones; contacting the zones with a second set of oligonucleotides that hybridized the oligonucleotide barcode sequences providing a second set of hybridized labels in the zones; detecting the second set of hybridized labels in the zones at a second point in time and recording on a non-transitory computer readable medium which second set of hybridized labels are associated with the zones; optionally contacting the zones with a third set of oligonucleotides that hybridized the oligonucleotide barcode sequences providing a third set of hybridized labels in the zones; optionally detecting the third set of hybridized labels in the zones at a third point in time and recording on a non-transitory computer readable medium which third set of hybridized labels are associated with the zones; determining the barcode sequences with the zones base on which hybridized labels are associated with the zones and recording on a non-transitory computer readable medium which barcode sequence are associated with the zones; contacting the zones with a labeled specific binding agent that specifically binds the cell surface antigen providing labeled cell surface antigens in the zones and recording on a non-transitory computer readable medium which labeled cell surface antigens are associated with which zones.

[0167] In certain embodiments, the oligonucleotides that hybridized the oligonucleotide barcode sequences are split probes.

[0168] In certain embodiments, the oligonucleotide barcode sequences are at a number of greater than 10, 15, or 20.

[0169] In certain embodiments, contacting the zones with oligonucleotides that hybridized the oligonucleotide barcode sequences providing hybridized labels in the zones is by a hybridization chain reaction (HCR) having oligonucleotides comprising a fluorescent label.

[0170] In certain embodiments, detecting the hybridized labels in the space defined zones and recording on a non-transitory computer readable medium which hybridized labels are associated with the individual space defined zones.

[0171] In certain embodiments, determining the barcode sequences associated with the individual space defined zones is base on which hybridized labels are associated with the space defined zones and recording on a non-transitory computer readable medium which barcode sequence are associated with the space defined zones; contacting the space defined zones with a labeled specific binding agent that specifically binds the cell surface antigen providing labeled cell surface antigens in the space defined zones and recording on a non-transitory computer readable medium which labeled cell surface antigens are associated with which space defined zones.

[0172] In certain embodiments, the space defined zone are exposed to multiple rounds of exposure to hybridized labels and surface antigen labels and recording the each of the multiple rounds of exposure recording on a non-transitory computer readable medium, and determining which barcode sequence are associated with the space defined zones wherein the lipid nanoparticle compositions as determined from the pattern of labels at the defined zones, e g., wherein the pattens of labels are compared to a recorded known pattern associated with the lipid nanoparticle composition.

[0173] With regard to any of the embodiments disclosed herein, the methods and composition using lipid nanoparticles can be adapted to use a lipid particle of any size. Lipid nanoparticles typically have a diameter of less than 200 nm or 100 nm, and lipid particles having a diameter of more than 200 nm or 100 nm are also contemplated. In certain embodiments, use of lipid nanoparticles with an average diameter of between 100 nm and 20 nm are contemplated. In certain embodiments, use of lipid nanoparticles with an average diameter of between 100 nm and 10 nm are contemplated. In certain embodiments, use of lipid nanoparticles with an average diameter of less than 50 nm or 25 nm are contemplated. In certain embodiments, use of lipid nanoparticles with an average diameter of more than 20 nm are contemplated.

[0174] Designing HCR™ Landing Sites

[0175] Barcodes may be to use with probes used for RNA detection methods. If it is known that a particular probe sequence binds well to a known mRNA sequence, one can use that mRNA sequences as an initial template for a barcode. One contemplated detection method utilizes hybridization chain reaction (HCR™). HCR™ includes a detection stage and an amplification stage. In the detection stage, a split probe set comprises multiple probe pairs that hybridize to different sub-sequences along the target. Initiator probe is split between a pair of probes such that only a portion of the probe pairs hybridize specifically to the target RNA. Second sections of the split probes hybridize to metastable fluorescent hairpins that unwind upon hybridization with the second probe pairs and trigger growth of a tethered fluorescent amplification polymer.

[0176] Selecting sequences from other species and discarding those with high homology

[0177] In humans, an undesirable outcome occurs when a barcode has the exact same design as a native mRNA transcript. Thus, HCR™ probe sequences were selected and further validated from genes in species other than mice or non-human primates. Sequences were screened and removed if they had high homology to native mouse or other primate transcripts. The split probes were shuffled such that even in the event that both bind to a native transcript, there is not enough proximity to generate signal. The pairs of probe sequences were shuffled such that the second pair of a split probe would be at a different location on the same mRNA molecule, if not on a different mRNA species altogether. Thus, if both pairs of a split probe annealed to their most closely matching endogenous sequences, they would not be in close enough proximity to produce any signal. (Fig. 5)

[0178] Probe sequences (i.e., one half of a pair of split probes) were listed from the G. gallus Sox 10 gene, E. coli eGFP gene and E. coli FusA gene. All probe sequences were BLASTed against the mouse and rhesus macaque transcriptome, and those with significant overlaps were removed. The remaining sequences were converted into reverse complements (to create target sequences) and listed in order of GC content.

[0179] To create an initial set of 16 barcodes, 32 probes sequences were selected based on their proximity to the median GC value i.e., 16 sequences above the median and the 16 sequences below the median. This resulted in a list of probe sequences that had a GC content between 42% and 54%. This list of 32 probe sequences were paired up, such that the sequence with the highest in GC content was matched to the sequence with the lowest GC content, the sequence with the second highest GC content was matched to the sequence with the second lowest GC content etc. The pairing for these initial 16 barcodes is shown in the table below.

[0180] Table 1 split probe sequences

[0181]

[0182] In some cases, the rearranged pairs are still from the same mRNA, but do not have the same HCR number, indicating that if both sequences of the probes in the pair were to hybridize to native mRNA transcripts, they would not be in close enough proximity that is required for signal generation, and therefore would be very unlikely to lead to false positives. In cases where the delta G for hairpin formation in the 3’ region of a sequence was above -6 kcal / mol, the sequences were altered slightly. The list of 16 barcodes is given in Table 2. Table 2 Sequences for the split probe landing sequences for generating barcode signal. Preamplification Methods

[0183] With the HCR landing sequences, one can generate a barcode signal in various ways. A typical mRNA is long enough for many HCR split-probe landing sites; thus, fluorescent signal generated from a single mRNA molecule is sufficient (“option 1”). Barcodes that are shorter limits the number of landing sites. Pre-amplification is the process of increasing the number of landing sites for HCR split probes, before the hybridization chain reaction itself is initiated. Different preamplification methods were evaluated.

[0184] One option is to perform pre-amplification with Rolling Circle Amplification (RCA)(“option 2”). A single repeat of the barcode is recognized first by a padlock probe. The padlock probe comprises the following sections (in a 5’ to 3’ direction): the second half of the reverse complement of the barcode (HCR landing site, 26 nt), a randomly generated 38 nt stable accessory sequence, a 20 nt universal primer landing site, another 11 nt stable accessory sequence and the first half of the reverse complement of the barcode (HCR landing site, 26 nt). The portion of the padlock probe that does not hybridize to the barcode was designed to be longer (32.6%) than the portion that does to allow the full probe to bend round to facilitate full hybridization. The 5’ end of the padlock probe was phosphorylated to encourage ligation. Accessory sequences were iteratively modified until the AG for hairpin formation of the full padlock probe was above -6 kcal / mol. Upon successful hybridization of the padlock probe to the barcode, it is ligated and amplified through RCA using Phi polymerase. This creates a ball of DNA, consisting of repeated units of the barcode, which contain HCR landing sites. This greatly amplifies the number of landing sites.

[0185] Another option adapts the branched DNA amplification whereby the barcode incorporated into the LNP contains multiple, 20 nucleotide (nt) sequences (Fig. 6C, “option 3”). Each 20 nt sequence can be one of 16 sequences. Whenever a known sequence on a barcode is detected, its number is used to assign the value of 1 to the corresponding position in a 16 bit binary code e g. the barcode in Figure 6C, which has the numbers 3, 4, 5 and 6 would have a 1 assigned at the 3rd, 4th, 5th and 6th positions of the binary code: 0011110000000000.

[0186] Each unique sequence may be detected by annealing a corresponding primary amplifier with a complementary region, which in turn anneals to a secondary amplifier designed to contain 2 HCR-landing sites. These landing sites e.g., for HCR1, HCR2 or HCR3 (from Table 2) and would be used to produce a red, green or far-red fluorescent signal respectively. In this sense, the HCR sites provide an additional aspect for detecting any of the unique 16 20 nt sequences in a given imaging round. For example, in imaging round 1, sequence 1 would be detected as red, sequence 2 would be green and sequence 3 would be far-red. All amplifiers would be stripped and in round 2, sequence 4 would be detected as red, sequence 5 would be green and sequence 6 would be far-red etc. This decoding system is shown in figure 6C as an example of a 6 bit code, detected over 2 imaging rounds. The presence of a 1 at any digit in the binary code is reflected in a TRUE value for a given imaging round and fluorophore.

[0187] Calibration of in vitro transfection

[0188] Experiments were performed to determine the optimal transfection concentration. Too high, and the LNP administration could be toxic, too low and the LNPs might not be detected at all. To test this, “Kauffman” LNPs we formulated containing a 1 : 1 ratio of aVHH mRNA and barcode, and mouse NIH3T3 cells were transfected with them. The LNPs formulated well and showed acceptable encapsulation.

[0189] Cells (in triplicate) were transfected at 500 ng of nucleic acid per well (of a 96-well plate) and at 2-fold serial dilutions until we reached 3.9 ng per well. After transfection (24 hours), cells were dissociated and FACS sorted with live / dead and aVHH staining. Live / dead staining gave a readout of cell viability and aVHH staining gave a readout of functional mRNA delivery i.e., production of protein product from LNP cargo. Treatment with LNPs containing a SENT-seq or a nucleic acid barcode and aVHH mRNA show that as dose increased, aVHH signal increases, whilst viability decreases. This pattern was similar for other barcodes. This indicates barcode designs are feasible and a suitable range to test their ability to generate signals (in situ barcoding between 25 ng and 100 ng per well). The upper range is 100 ng. By FACS sorting, the viability goes down to about 25%; however, when the cells are fixed in the dish, as is the case for HiDeN-seq, the viability is a significantly higher.

[0190] Detection sensitivity of the barcode design and stripping efficiency

[0191] One of the steps in the barcoding method includes performing several rounds of imaging, whereby a fluorescent signal is stripped following image acquisition, i.e., to facilitate the ability of the barcodes to be reimaged in the next round, e.g., as either the same or different color. Generating a color sequence that corresponds to a known barcode provides information on the chemical components of the unique LNP that was delivered to the cell location. One stripping method when detecting RNA molecules involves the use of DNase which degrades DNA but not RNA, thus removing the fluorescent signal probes and the split probes. However, since the barcodes are DNA alternative approaches were evaluated.

[0192] Formamide is an organic solvent that lowers the melting temperature between two annealed nucleic acid sequences, thus promoting dehybridization of the HCR split probes with the barcode. Various concentrations of formamide (50%, 60% and 80%) were evaluated at 2 different temperatures (37°C and 60°C) between two imaging rounds. The calibration for stripping efficiency was tested. As one performs several rounds of imaging, fluorescent signals are stripped following image acquisition, so that the barcodes can be reimaged in the next round which can be the same or a different color.

[0193] If the stripping method used in the detection of barcode designs 1 or 2 does not fully remove the split probes, the signal may be absent or weakened, but access to the HCR-landing sites for the split probes of the second imaging round for the same barcode will be blocked. To distinguish this from a fully stripped barcode i.e., where split-probes from the first round are removed, the red fluorescent hairpins of round 1 were included (in addition to the split probes and green fluorescent hairpins for round 2) which would cause the barcodes to be detected as red again in round 2, instead of green, indicating insufficient stripping.

[0194] In barcode option 3, the HCR sites are not the barcodes, but rather a mechanism for fluorescently detecting a unique 20 nt sequence on the barcode. Therefore, in every imaging round, split probes and fluorescent hairpins for all relevant fluorophores are used, and if the stripping fails to remove branched DNA beyond the second amplifier (which contains HCR-landing sites), the barcode will be detected in two colors in the subsequent round, leading to errors in decoding. Barcode design options 1 and 3 did not produce a particularly strong signal under the conditions tested. However, option 2 (RCA preamplification) produced a robust signal that was reliably stripped under all conditions tested.

[0195] Detecting functional delivery of LNP Cargo

[0196] The detection of DNA barcodes inside a cell is useful in determining the tropism of an LNP, however, many endocytosed LNPs are degraded by lysosomes before delivering their contents into the cytoplasm. For this reason, existing screening platforms were developed for functional delivery by detecting the protein product of an encapsulated cargo mRNA, aVHH. To detect aVHH protein alongside the DNA barcodes, HCR sequences (one of the 16) were conjugated to a monoclonal anti-aVHH antibody. This was done in a site-specific manner utilizing an oYoLink® by chemically conjugating the oligonucleotides to the anti-aVHH antibody heavy chains under UV-light. A 17 nt spacer was used to provide separation between the antibody and the HCR landing site. The oligonucleotide contains the HCR landing site barcode and a phosphorothioate linked cap: oYoLink® -

[0197] CCTTGGCACCCGAGAATCCTCTATCCAGGCTCACTACAAGAATGTTCCATGGC CAACACTTGTCACTAC*T*A*G (SEQ ID NO: 49, underlined HCR landing site SEQ ID NO: 7). This sequence is not incorporated into any LNPs, so it acts as a specific read out for aVHH protein. Following treatment of cells with an LNP containing aVHH mRNA, the protein product is detected.

[0198] Experiments were performed to test the ability of the antibody to be detected via the conjugated DNA barcode. Cells were treated with LNPs containing a mixture of barcodes and aVHH mRNA. Experiments were performed across a range of concentrations of nucleic acid per well as well as antibody concentration. The aVHH protein could be detected across a wide range of test conditions, including as low as 1 pg per well at 0.15 ug / ml antibody concentration.

[0199] Detection of endogenous mRNA using HCR split probes was validates and probes can be commercially designed for any target of interest, allowing for the detection of many different cell types within a tissue. HCR split probes can be modified to also detect short (less than 100 nt) DNA barcodes, as well as the protein product of mRNAs delivered by LNPs.

[0200] In certain embodiments, this disclosure relates to compositions of nucleic acid comprising an oligonucleotide barcode conjugated to an antibody heavy chain. In certain embodiments, the oligonucleotide barcode is

[0201] CCTCTATCCAGGCTCACTACAAGAATGTTCCATGGCCAACACTTGTCACTAC (SEQ ID NO: 7).

[0202] In certain embodiments, the nucleic acid comprises a spacer between the oligonucleotide barcode and the antibody heavy chain. In certain embodiments, the nucleic acid has nucleic acid sequence of CCTTGGCACCCGAGAATCCTCTATCCAGGCTCACTACAAGAATGTTCCATGGC CAACACTTGTCACTACTAG (SEQ ID NO: 49). In certain embodiments, the oligonucleotide barcode and the antibody heavy chain hybridize with a circular nucleic acid.

[0203] In certain embodiments, this disclosure relates to methods of detecting a protein in a sample comprising providing a composition as above, and contacting the composition with a sample comprising the protein, providing a composition wherein the antibody heavy chain is a portion of an antibody that binds the protein, providing a protein antibody complex comprising the circular nucleic acid; and performing rolling circle amplification providing amplified oligonucleotides having the barcode sequence; detecting and recording the barcode sequence or that the protein is in the sample on a non-transitory computer readable medium.

[0204] In certain embodiments, this disclosure relates to methods of detecting a protein in a sample comprising providing a nucleic acid comprising an oligonucleotide barcode conjugated to an antibody heavy chain wherein the nucleic acid comprises a spacer between the oligonucleotide barcode and the antibody heavy chain, and contacting the composition with a sample comprising the protein, providing a composition wherein the antibody heavy chain is a portion of an antibody that binds the protein, providing a protein antibody complex, and contacting the protein antibody complex with a circular nucleic acid that hybridizes with the barcode, optionally purifying the protein antibody complex with a circular nucleic acid that hybridizes with the barcode; and performing PCR to rolling circle replication / amplification providing amplified oligonucleotides having the barcode sequence; detecting and recording the barcode sequence or that the protein is in the sample on a non-transitory computer readable medium.

[0205] Rolling circle amplification (RCA) / replication can amplify a molecular binding event for detecting targets with low abundance. Reactions can be performed in solution environments or on a solid surface like glass, micro- or nano-bead, microwell plates, microfluidic devices or paper strips. Nucleotide amplification using antibodies is suitable for detecting, quantifying and visualizing low abundance markers. By attaching a ssDNA oligonucleotide on the end of the heavy chains, the Fab (Fragment, antigen binding) section on the detection antibody can still bind to specific antigens and the oligonucleotide can serve as a primer of the RCA reaction. A detection antibody recognizes a specific target. This antibody is also attached to an oligonucleotide primer. When circular DNA is present, it is annealed, and the primer matches to the circular DNA complementary sequence. The complementary sequence of the circular DNA template is copied multiple of times and remains attached to the antibody, the PCR output (elongated ssDNA) is detected, e.g., with fluorescent probes using a fluorescent microscope or a microplate reader.

[0206] In certain embodiments, it is contemplated that the antibody can be replaced with an aptamer. In certain embodiments, the primer can be conjugated to the 3' end of a DNA aptamer. In certain embodiments, the primer tail can be amplified through rolling circle amplification. In certain embodiments, quantification is by detecting a label, e.g., fluorescent reporter. In certain embodiments, on-chip signal amplification method is contemplated.

Claims

CLAIMS1. A method of determining the selective distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, wherein the cell surface antigen and barcode segments are associated with chemical components and amounts of chemical components contained in the lipid nanoparticles; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject; isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area; contacting the fixed area with a labeling reagent that specifically binds cell surface antigen providing space define zones that absorbed the lipid nanoparticles; detecting the labeling reagent associated with the cell surface antigen; recording the labeling reagent associated with the cell surface antigen and associated unique location of the space defined zones on a non-transitory computer readable medium; contacting the space defined zones with split probe oligonucleotides that hybridized the barcode segments providing first split probe hybridized labels in the space defined zones; contacting the first split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the first split probe hybridized labels providing first barcode labeled segments; contacting the first barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a first detectable label; detecting first detectable label in each of the space defined zones; recording the first detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium;contacting the first detectable label in each of the space defined zones with a dehybridization reagent providing first denatured space defined zones; contacting the denature space defined zones with second split probe oligonucleotides that hybridized the barcode segments providing second split probe hybridized labels in the space defined zones; contacting the second split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the second split probe hybridized labels providing a second barcode labeled segment; contacting the second barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a second detectable label; detecting second detectable label in each of the space defined zones; recording the second detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

2. The method of claim 1, further comprising the steps of contacting the second detectable label in each of the space defined zones with a dehybridization reagent providing second denatured space defined zones; and contacting the second denature space defined zones with third split probes of oligonucleotides that hybridized the barcode segments providing third split probe hybridized labels in the space defined zones; contacting the third split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the third split probe hybridized labels providing a third barcode labeled segment; contacting the third barcode labeled segment with signal amplification reagents that hybridize to the amplification segment and contain a third detectable label;detecting third detectable label in each of the space defined zones; recording the third detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, the second detectable label and third detectable label in the space defined zones.

3. The method of claim 1, wherein the chemical components and amounts of chemical components contained in the lipid nanoparticles include concentrations of an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid.

4. The method of claim 1 wherein the signal amplification reagents contain an amplifier oligonucleotide that hybridizes with the landing segment, wherein the split probe of oligonucleotides having segments that hybridized to the barcode segment, and segments of the landing sequence oligonucleotide hybridize with segments of the split probe oligonucleotides, and fluorescent labels are linked to amplifier oligonucleotide sequences that hybridize to the segments of the landing segment.

5. The method of claim 1 wherein the barcode segments are amplified comprising the steps of providing a preamplification probe oligonucleotide comprising a barcode binding segment and second segments providing a preamplification complex, contacting the preamplification complex with amplifier probes that contain multiple landing sites and bind second segments to the preamplification probe providing an amplification complex with landing sites; contacting the amplification complex with landing sites with split probe hybridized labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the split probe hybridized labels providing a barcode labeled signal.

6. The method of any of claims 1-5 wherein the split probe oligonucleotides comprise:CACCCCTTCCTGCATGGATTTTATAA (SEQ ID NO: 17) andGCAGCAGTCCTGCCTAAGATTCACAC (SEQ ID NO: 18),AGTTGTTAACCAGATCAAAACCCGTC (SEQ ID NO: 19) andAGGATTCAGGAACTGCACTGTCAGCC (SEQ ID NO: 20),AACCAAAGCTGACCAGGAAAAAATGG (SEQ ID NO: 21) andCCCCCTGTCCCATCTGTTTAATCCCA (SEQ ID NO: 22),TGCTTCCTTGCTGATTTTCACATTGG (SEQ ID NO: 23) andAGCACCTCCCTCCTACTTTCACTCAG (SEQ ID NO: 24),TGACTCCTGACAACTGATCAGAGAGA (SEQ ID NO: 25) andTTCTGTCAGTGGAGAGGGTGAAGGTG (SEQ ID NO: 26),ATGCATGAATCTTGATCCCTGCTGGA (SEQ ID NO: 27) andTGTGTTGTGGGACCTTCTAACGGGTA (SEQ ID NO: 28),CCTCTATCCAGGCTCACTACAAGAAT (SEQ ID NO: 29) andGTTCCATGGCCAACACTTGTCACTAC (SEQ ID NO: 30),CGTGCTGAAGTCAAGTTTGAAGGTGA (SEQ ID NO: 31) andCATTACCTGTCCACACAATCTGCCCT (SEQ ID NO: 32),TGAAGATGGAAGCGTTCAACTAGCAG (SEQ ID NO: 33) andTGACTTTTTCAAGAGTGCCATGCCCG (SEQ ID NO: 34),GTAATCTCCATCGCAGTTGAACCGAA (SEQ ID NO: 35) andTCTGGTATGGCTAAGCAGTATGAGCC (SEQ ID NO: 36),AAAGGTGGTGTAATCCCTGGCGAATA (SEQ ID NO: 37) andGAATGGCACCAGAACCTGATCGAATC (SEQ ID NO: 38),CTTGAGCCGATCATGAAGGTTGAAGT (SEQ ID NO: 39) andCGTCAGCGCGTTCTGAACAACGAAAT (SEQ ID NO: 40),TCTGAAAGACGTAACCACTGGTGACA (SEQ ID NO: 41) andCGTCTGCACTTCGGTTCTTACCATGA (SEQ ID NO: 42),CAACGTTGAAGCGAACGTAGGTAAAC (SEQ ID NO: 43) andGTTACTGGCGTTAAGATCCACGCTGA (SEQ ID NO: 44),AGTACCGCTGTCTGAAATGTTCGGAT (SEQ ID NO: 45) andTATCCTGGACGACGGTAAAGACACTC (SEQ ID NO: 46),CACCAAGAAAGCTACCATGCACTTGC (SEQ ID NO: 47) and CGTTGACTCCTCTGAACTGGCGTTTA (SEQ ID NO: 48).

7. The method of claim 1, wherein the split probe landing sequence oligonucleotides are GCAGCAGTCCTGCCTAAGATTCACACCACCCCTTCCTGCATGGATTTTATAA (SEQ ID NO: 1),HAGTTGTTAACCAGATCAAAACCCGTCAGGATTCAGGAACTGCACTGTCAGCC (SEQ ID NO: 2),AACCAAAGCTGACCAGGAAAAAATGGCCCCCTGTCCCATCTGTTTAATCCCA (SEQ ID NO: 3),TGCTTCCTTGCTGATTTTCACATTGGAGCACCTCCCTCCTACTTTCACTCAG (SEQ ID NO: 4),TGACTCCTGACAACTGATCAGAGAGATTCTGTCAGTGGAGAGGGTGAAGGTG (SEQ ID NO: 5),ATGCATGAATCTTGATCCCTGCTGGATGTGTTGTGGGACCTTCTAACGGGTA (SEQ ID NO: 6),CCTCTATCCAGGCTCACTACAAGAATGTTCCATGGCCAACACTTGTCACTAC (SEQ ID NO: 7), CGTGCTGAAGTCAAGTTTGAAGGTGACATTACCTGTCCACACAATCTGCCCT (SEQ ID NO: 8), TGAAGATGGAAGCGTTCAACTAGCAGTGACTTTTTCAAGAGTGCCATGCCCG (SEQ ID NO: 9), GTAATCTCCATCGCAGTTGAACCGAATCTGGTATGGCTAAGCAGTATGAGCC (SEQ ID NO: 10), AAAGGTGGTGTAATCCCTGGCGAATAGAATGGCACCAGAACCTGATCGAATC (SEQ ID NO: 11), CTTGAGCCGATCATGAAGGTTGAAGTCGTCAGCGCGTTCTGAACAACGAAAT (SEQ ID NO: 12), TCTGAAAGACGTAACCACTGGTGACACGTCTGCACTTCGGTTCTTACCATGA (SEQ ID NO: 13), CAACGTTGAAGCGAACGTAGGTAAACGTTACTGGCGTTAAGATCCACGCTGA (SEQ ID NO: 14), AGTACCGCTGTCTGAAATGTTCGGATTATCCTGGACGACGGTAAAGACACTC (SEQ ID NO: 15)CACCAAGAAAGCTACCATGCACTTGCCGTTGACTCCTCTGAACTGGCGTTTA (SEQ ID NO: 16).

8. A method of determining the selective distribution of chemically defined lipid nanoparticles in tissue locations comprising, providing groups of lipid nanoparticles, wherein the groups of lipid nanoparticles contain a reporter mRNA that encodes a cell surface antigen and oligonucleotide barcode sequences, wherein individual oligonucleotide barcodes contain barcode segments, having a first barcode sequence and a second barcode sequence, wherein the cell surface antigen and barcode segments are associated with chemical components and amounts of chemical components contained in the lipid nanoparticles; administering the groups of lipid nanoparticles to a subject such that the lipid nanoparticles distribute to a tissue of the subject;isolating a sample tissue of the subject; immobilizing the sample tissue to a fixed area; contacting the fixed area with a labeling reagent that specifically binds cell surface antigen providing space define zones that absorbed the lipid nanoparticles; contacting the space defined zones with padlock probe oligonucleotides comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the barcode providing a circular nucleic acid complex, contacting the circular nucleic acid complex with a ligation enzyme connecting the first and second barcode binding segment together providing a circular oligonucleotide having a first barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having a first barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the first barcode sequence; and contacting the amplified oligonucleotides having the first barcode sequences with split probe oligonucleotides that hybridized the barcode segments providing an amplified oligonucleotide having split probe hybridized first barcode labels, contacting the amplified oligonucleotide having split probe hybridized first barcode labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotides hybridizes the amplified oligonucleotide having split probe hybridized first barcode labels providing first barcode labeled segments that contain an amplification segment; contacting the first barcode labeled segment that contain an amplification segment with signal amplification reagents that hybridize to the amplification segment and contain a first detectable label; detecting first detectable label in each of the space defined zones; recording the first detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; contacting the space defined zones with padlock probe oligonucleotides comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequencebetween the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the second barcode providing a circular nucleic acid complex, contacting the circular nuclei acid complex with a ligation enzyme connecting the first and second barcode binding segment together providing a circular oligonucleotide having a second barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having a second barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the second barcode sequence; and contacting the amplified oligonucleotides having the second barcode sequences with split probe oligonucleotides that hybridized the second barcode segments providing an amplified oligonucleotide having split probe hybridized second barcode labels, contacting the amplified oligonucleotide having split probe hybridized second barcode labels with split probe landing sequence oligonucleotides that contain an amplification segment, wherein the split probe landing sequence oligonucleotide hybridizes the amplified oligonucleotide having split probe hybridized second barcode labels providing second barcode labeled segments that contain an amplification segment; contacting the second barcode labeled segment that contain an amplification segment with signal amplification reagents that hybridize to the amplification segment and contain a second detectable label; detecting second detectable label in each of the space defined zones; recording the second detectable label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

9. The method of claim 8, wherein the cell surface antigen is conjugated to an oligonucleotide barcode providing a cell surface antigen barcode, contacting the cell surface antigen barcode with a padlock probe oligonucleotide comprising a first cell surface antigen barcode binding segment and second cell surface antigenbarcode binding segment with a primer landing site sequence between the first and second cell surface antigen barcode binding segments, wherein the first and second cell surface antigen barcode binding segments hybridize with the cell surface antigen barcode providing a circular nucleic acid complex, contacting the circular nuclei acid complex with a ligation enzyme connecting the first and second cell surface antigen barcode binding segment together providing a circular oligonucleotide having a cell surface antigen barcode sequence and having a primer landing site sequence, contacting the circular oligonucleotide having a cell surface antigen barcode sequence and having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the cell surface antigen barcode sequence; and contacting the amplified oligonucleotides having the cell surface antigen barcode sequences with split probe oligonucleotides that hybridized the barcode segments providing an amplified oligonucleotide having split probe hybridized cell surface antigen barcode label, detecting cell surface antigen barcode label in each of the space defined zones; recording the cell surface antigen barcode label and associated unique location of the space defined zones on a non-transitory computer readable medium; determining the chemical components and amounts of chemical components contained in the lipid nanoparticles in the space defined zones based on presence of the labeling reagent that specifically binds cell surface antigen, first detectable label, and the second detectable label in the space defined zones.

10. The method of claim 8, wherein the method further comprises detecting the labeling reagent associated with the cell surface antigen wherein one generates an oligo-conjugated antibody that allows for simultaneous oligo-barcode and protein detection, wherein the oligoconjugated antibody oligo-barcode is exposed to a padlock probe oligonucleotide comprising a first barcode binding segment and second barcode binding segment with a primer landing site sequence between the first and second barcode binding segments, wherein the first and second barcode binding segments hybridize with the oligo-conjugated antibody oligo-barcode providing a circular nucleic acid complex and having a primer landing site sequence.contacting the oligo-conjugated antibody oligo-barcode circular nucleic acid complex having a primer landing site sequence with a primer and reagents for performing rolling circle amplification providing amplified oligonucleotides having the oligo-barcode sequence label; and detecting oligo-barcode sequence label in each of the space defined zones; recording the labeling reagent associated with the cell surface antigen and oligo-barcode sequence label and associated unique location of the space defined zones on a non-transitory computer readable medium.

11. The method of claim 8, wherein the chemical components and amounts of chemical components contained in the lipid nanoparticles include concentrations of an ionizable lipid, a phospholipid, a sterol, and a polyethylene glycol phospholipid.

12. The method of any of claims 8-11 wherein the split probe oligonucleotides are:CACCCCTTCCTGCATGGATTTTATAA (SEQ ID NO: 17) andGCAGCAGTCCTGCCTAAGATTCACAC (SEQ ID NO: 18),AGTTGTTAACCAGATCAAAACCCGTC (SEQ ID NO: 19) andAGGATTCAGGAACTGCACTGTCAGCC (SEQ ID NO: 20),AACCAAAGCTGACCAGGAAAAAATGG (SEQ ID NO: 21) andCCCCCTGTCCCATCTGTTTAATCCCA (SEQ ID NO: 22),TGCTTCCTTGCTGATTTTCACATTGG (SEQ ID NO: 23) andAGCACCTCCCTCCTACTTTCACTCAG (SEQ ID NO: 24),TGACTCCTGACAACTGATCAGAGAGA (SEQ ID NO: 25) andTTCTGTCAGTGGAGAGGGTGAAGGTG (SEQ ID NO: 26),ATGCATGAATCTTGATCCCTGCTGGA (SEQ ID NO: 27) andTGTGTTGTGGGACCTTCTAACGGGTA (SEQ ID NO: 28),CCTCTATCCAGGCTCACTACAAGAAT (SEQ ID NO: 29) andGTTCCATGGCCAACACTTGTCACTAC (SEQ ID NO: 30),CGTGCTGAAGTCAAGTTTGAAGGTGA (SEQ ID NO: 31) and CATTACCTGTCCACACAATCTGCCCT (SEQ ID NO: 32),TGAAGATGGAAGCGTTCAACTAGCAG (SEQ ID NO: 33) andTGACTTTTTCAAGAGTGCCATGCCCG (SEQ ID NO: 34),GTAATCTCCATCGCAGTTGAACCGAA (SEQ ID NO: 35) andTCTGGTATGGCTAAGCAGTATGAGCC (SEQ ID NO: 36),AAAGGTGGTGTAATCCCTGGCGAATA (SEQ ID NO: 37) andGAATGGCACCAGAACCTGATCGAATC (SEQ ID NO: 38),CTTGAGCCGATCATGAAGGTTGAAGT (SEQ ID NO: 39) andCGTCAGCGCGTTCTGAACAACGAAAT (SEQ ID NO: 40),TCTGAAAGACGTAACCACTGGTGACA (SEQ ID NO: 41) andCGTCTGCACTTCGGTTCTTACCATGA (SEQ ID NO: 42),CAACGTTGAAGCGAACGTAGGTAAAC (SEQ ID NO: 43) andGTTACTGGCGTTAAGATCCACGCTGA (SEQ ID NO: 44),AGTACCGCTGTCTGAAATGTTCGGAT (SEQ ID NO: 45) andTATCCTGGACGACGGTAAAGACACTC (SEQ ID NO: 46),CACCAAGAAAGCTACCATGCACTTGC (SEQ ID NO: 47) and CGTTGACTCCTCTGAACTGGCGTTTA (SEQ ID NO: 48).

13. The method of claim 8, wherein the split probe landing sequence oligonucleotides are GCAGCAGTCCTGCCTAAGATTCACACCACCCCTTCCTGCATGGATTTTATAA (SEQ ID NO: 1), HAGTTGTTAACCAGATCAAAACCCGTCAGGATTCAGGAACTGCACTGTCAGCC (SEQ ID NO: 2), AACCAAAGCTGACCAGGAAAAAATGGCCCCCTGTCCCATCTGTTTAATCCCA (SEQ ID NO: 3), TGCTTCCTTGCTGATTTTCACATTGGAGCACCTCCCTCCTACTTTCACTCAG (SEQ ID NO: 4), TGACTCCTGACAACTGATCAGAGAGATTCTGTCAGTGGAGAGGGTGAAGGTG (SEQ ID NO: 5), ATGCATGAATCTTGATCCCTGCTGGATGTGTTGTGGGACCTTCTAACGGGTA (SEQ ID NO: 6), CCTCTATCCAGGCTCACTACAAGAATGTTCCATGGCCAACACTTGTCACTAC (SEQ ID NO: 7), CGTGCTGAAGTCAAGTTTGAAGGTGACATTACCTGTCCACACAATCTGCCCT (SEQ ID NO: 8), TGAAGATGGAAGCGTTCAACTAGCAGTGACTTTTTCAAGAGTGCCATGCCCG (SEQ ID NO: 9), GTAATCTCCATCGCAGTTGAACCGAATCTGGTATGGCTAAGCAGTATGAGCC (SEQ ID NO: 10), AAAGGTGGTGTAATCCCTGGCGAATAGAATGGCACCAGAACCTGATCGAATC (SEQ ID NO: 11), CTTGAGCCGATCATGAAGGTTGAAGTCGTCAGCGCGTTCTGAACAACGAAAT (SEQ ID NO: 12), TCTGAAAGACGTAACCACTGGTGACACGTCTGCACTTCGGTTCTTACCATGA (SEQ ID NO: 13), CAACGTTGAAGCGAACGTAGGTAAACGTTACTGGCGTTAAGATCCACGCTGA (SEQ ID NO: 14), AGTACCGCTGTCTGAAATGTTCGGATTATCCTGGACGACGGTAAAGACACTC (SEQ ID NO: 15)CACCAAGAAAGCTACCATGCACTTGCCGTTGACTCCTCTGAACTGGCGTTTA (SEQ ID NO: 16).

14. A composition nucleic acid comprising an oligonucleotide barcode conjugated to an antibody heavy chain.

15. The composition of claim 14, wherein the oligonucleotide barcode is CCTCTATCCAGGCTCACTACAAGAATGTTCCATGGCCAACACTTGTCACTAC (SEQ ID NO: 7)16. The composition of claim 14, wherein the nucleic acid comprises a spacer between the oligonucleotide barcode and the antibody heavy chain.

17. The composition of claim 16, wherein the nucleic acid has nucleic acid sequence of CCTTGGCACCCGAGAATCCTCTATCCAGGCTCACTACAAGAATGTTCCATGGCCAAC ACTTGTCACTACTAG (SEQ ID NO: 49).

18. The composition of claim 16, wherein the oligonucleotide barcode and the antibody heavy chain hybridize with a circular nucleic acid encoding.

19. A method of detecting a protein in a sample comprising providing a composition as in claim 18, and contacting the composition with a sample comprising the protein, providing a composition wherein the antibody heavy chain is a portion of an antibody that binds the protein, providing a protein antibody complex comprising the circular nucleic acid; and performing rolling circle replication providing amplified oligonucleotides having the barcode sequence; detecting and recording the barcode sequence or that the protein is in the sample on a non- transitory computer readable medium.

Images