Poxviral RNA-polymerase complexes

High-resolution models of poxvirus RNA polymerase complexes enable the development of targeted inhibitors to treat and prevent poxvirus diseases, overcoming the limitations of existing DNA polymerase-targeting treatments.

WO2025233438A1PCT designated stage Publication Date: 2025-11-13JULIUS-MAXIMILIANS-UNIVERSITÄT IN VERTRETUNG DES FREISTAATES BAYERN
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/062580
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-08
Filing Date
2025-05-08
Publication Date
2025-11-13

AI Technical Summary

Technical Problem

Current antiviral treatments for poxvirus-induced diseases, such as smallpox, rely on targeting the poxvirus DNA polymerase, which can cause kidney toxicity, and there is a need for new poxvirus RNA polymerase complexes and inhibitors to address this and other targets.

Method used

Purification and characterization of poxvirus RNA polymerase complexes, including a core complex and minimal complex, with high-resolution Cryo-EM structures, and development of inhibitors targeting these complexes for therapeutic applications.

Benefits of technology

Provides high-resolution models of poxvirus RNA polymerase complexes, enabling the design of specific inhibitors to treat and prevent poxvirus-induced diseases without the toxicity associated with DNA polymerase-targeting drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000012_0001
    Figure IMGF000012_0001
  • Figure IMGF000019_0001
    Figure IMGF000019_0001
  • Figure IMGF000020_0001
    Figure IMGF000020_0001
Patent Text Reader

Abstract

The present invention provides poxvirus RNA polymerase complexes for transcription of a gene under the control of a poxvirus intermediate gene promoter, minimal poxvirus RNA polymerase complexes, methods for purifying them, methods for producing in polymerase complexes, and methods for preparing pharmaceutical compositions comprising the inhibitors against the poxvirus RNA polymerase complexes. The present invention further relates to methods for the prophylaxis or treatment of poxvirus-induced diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] POXVIRAL RNA-POLYMERASE COMPLEXES

[0002] Co-filed Sequence Listing

[0003] The present specification makes reference to a sequence listing (submitted electronically on the same date as the present application). The entire contents of the Sequence Listing are incorporated herein by reference.

[0004] TECHNICAL FIELD

[0005] The present invention relates to poxvirus RNA polymerase complexes for transcription of a gene under the control of a poxvirus intermediate gene promoter, minimal poxvirus RNA polymerase complexes, methods for purifying them, methods for producing inhibitors against the poxvirus RNA polymerase complexes, and methods for preparing pharmaceutical compositions comprising the inhibitors against the poxvirus RNA polymerase complexes. The present invention further relates to methods for the prophylaxis or treatment of poxvirus-induced diseases.

[0006] BACKGROUND OF THE INVENTION

[0007] Members of the Poxviridae family are enveloped viruses that are accessible to detection with a light microscope due to their remarkable size (200-350 nm). They contain a core harboring the nonsegmented double-stranded DNA genome, which is released into the host cell cytoplasm after infection. Many members of this family are indigenous for particular animal hosts, but several are pathogenic for a larger spectrum of organisms.

[0008] The eukaryotic nucleus contains the machineries for DNA replication and gene transcription. Many viruses rely on factors of the host cell for their replication and transcription and therefore require at least a transient nuclear phase to ensure viral propagation. A remarkable exception among eukaryotic DNA viruses are the members of the Poxviridae family, whose replication and transcription are confined to the cytoplasm. These processes require virus-encoded factors for the production of mature mRNAs from the viral genome. Such cytosolic gene expression events were extensively studied for Vaccinia virus, a non-pathogenic prototype of the Poxviridae family. These studies uncovered a virus-encoded multisubunit RNA polymerase and an array of associated factors that ensure the expression of the viral genome. Upon infection, Vaccinia virus enters the cell via micropinocytosis and becomes uncoated. Whereas the viral genome is silent in these initial events, all subsequent steps of the replication cycle are dependent on viral transcription and translation processes. Poxviruses coordinate the different processes of DNA replication and virion formation through timing of expression of individual genes grouped into early, intermediate, and late classes. Accordingly, early genes encode factors involved in events that shortly follow infection, such as viral DNA replication and intermediate gene expression, whereas later processes of the infection cycle, such as virion assembly, require the expression of intermediate and late class gene products. Poxvirus-caused human diseases comprise smallpox, molluscum contagiosum and various zoonoses. Infection routes are typically direct contact, yet transmission via indirect routes is possible as poxviruses are persistent at ambient temperature. Sheeppox, swinepox, fowlpox, and myxoma virus are known to be transmitted by biting arthropods.

[0009] In July 2018, the Food and Drug Administration approved tecovirimat, the first drug approved for treatment of smallpox. Antiviral treatments have improved since the last large smallpox epidemics, and studies suggest that the antiviral drug cidofovir might be useful as a therapeutic agent. The drug must be administered intravenously, and may cause serious kidney toxicity. ACAM2000 is a smallpox vaccine developed by Acambis. It was approved for use in the United States by the U.S. FDA on August 31 , 2007. It contains live vaccinia virus, cloned from the same strain used in an earlier vaccine, Dryvax. While the Dryvax virus was cultured in the skin of calves and freeze-dried, ACAM2000s virus is cultured in kidney epithelial cells (Vero cells) from an African green monkey. Efficacy and adverse reaction incidence are similar to Dryvax. The vaccine is not routinely available to the US public; it is, however, used in the military and maintained in the Strategic National Stockpile.

[0010] In June 2021 , brincidofovir was approved for medical use in the United States for the treatment of human smallpox disease caused by variola virus. Brincidofovir targets the poxvirus DNA polymerase.

[0011] Grimm et al., Cell 179 (2019), 1537-1550 relates to the identification of the vRNAP complex with early viral transcription factors. It does not describe the present vRNAP complex with intermediate viral transcription factors.

[0012] Hillen et al. Cell 179 (2019), 1525-1536 relates to actively transcribing vRNAP complexes on a DNA- RNA scaffold comprising an early gene promoter. It does not describe the present vRNAP complex with intermediate viral transcription factors.

[0013] Thus, there remains the need for the isolation of new poxvirus RNA polymerase complexes. In addition, for the design of therapeutically relevant poxvirus RNA polymerase complex inhibitors, the characterization of the RNA polymerase complexes with high resolution is required. Further, there is the need for new poxvirus drugs directed to targets other than the poxvirus DNA polymerase.

[0014] SUMMARY OF THE INVENTION

[0015] The above technical problems are solved by the present invention.

[0016] In a first aspect a poxvirus RNA polymerase complex for transcription of a gene under the control of a poxvirus intermediate gene promoter is provided, wherein the complex comprises a core poxvirus RNA polymerase complex, a viral intermediate transcription factor 3 (VITF-3), and optionally a viral capping enzyme. In a second aspect a minimal poxvirus RNA polymerase complex suitable as a component of the poxvirus RNA polymerase complex according to the invention is provided, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7.

[0017] In a third aspect a method for purifying the poxvirus RNA polymerase according to the invention is provided.

[0018] In fourth aspect a method for screening an inhibitor of the poxvirus RNA polymerase complex is provided.

[0019] In a fifth aspect a method for identifying a candidate compound that binds to a site on the poxvirus RNA polymerase complex is provided.

[0020] In a sixth aspect a method for preparing a pharmaceutical composition comprising the inhibitor or candidate compound is provided.

[0021] In a seventh aspect a method for the prophylaxis or treatment of a poxvirus-induced disease is provided.

[0022] The present inventors have identified poxvirus DNA-dependent RNA polymerase as a target for biomedical research. To this end, the present inventors have purified the vaccine virus RNA polymerase complex for intermediate virus gene transcription. This complex has not been described in the prior art. Further, the inventors have provided a Cryo-electron microscopy (Cryo-EM) structure based model at high resolution for this RNA polymerase complex for intermediate gene transcription (PDB entries 8P0K, 8P0N, 8P0J).

[0023] In addition, the present inventors have purified the vaccinia virus complete RNA polymerase lacking the capping enzyme. The prior art does not describe a purification method for said complex. A Cryo- EM based model with high resoution has been generated for this complex (PDB entry 8C8H).

[0024] In addition, the present inventors have provided a Cryo-EM based model of the complete vRNAP at a high resolution of 2.6A (PDB entry 8RQK).

[0025] Further, the present inventors have provided a Cryo-EM structure based model of the core (minimal) poxvirus RNA polymerase complex at a high resolution of 1 .88A (PDB entry 9EXN). A high resolution is a requirement for molecular modelling of suitable inhibitors. The prior art does not describe a Cryo-EM based model with such a high resolution. Further, the present inventors have identified new poxvirus RNA polymerase complex inhibitors potentially suitable in the prophylaxis or therapy of poxvirus-induced diseases.

[0026] BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Fig. 1 shows the purification of the vaccinia virus (W) intermediate pre-initiation complex (iPIC). A: The 70 nt DNA scoffold based on the native G8R promoter, which was used for the reconstitution of the iPIC. Functional elements (green / orange) as well as the mismatch bubble ranging from position - 5 to +8 in relation to the transcription start site (TSS) are indicated. B: The elution fraction after FLAG agarose purification of RPO132-FLAG tagged complexes were further purified via 5 - 45 % sucrose gradient centrifugation and fractions were analysed on an SDS-PAGE. The molecular weight standard is shown on the left, the respective proteins on the right and DNA staining on the bottom. C: Comparison of complete vRNAP, the iPIC from B and the core vRNAP via SDS-PAGE. The molecular weight standard is shown on the left, the respective proteins on the right and DNA staining on the bottom.

[0028] Fig. 2 shows the structure of the intermediate pre-initiation complex (iPIC). A: Three orthogonal views of the cryo EM density, enhanced with DeepEMhancer

[0040] , B: Model of the iPIC, the core vRNAP subunits are represented in grey surface depiction, the rest in cartoon style. C: Domain scheme, color code as in the rest of this figure. D: Model of the CCC, the core vRNAP subunits are represented in grey surface depiction, the rest in cartoon style. E: Model of the CCC, the core vRNAP subunits are represented in grey surface depiction, the rest in cartoon style.

[0029] Fig. 3 shows details of the iPIC structure. A:The VITF / upstream promoter unit in two orthogonal views. B: Electrostatic Poisson-Boltzmann potential mapped to the solvent-accessible surface of VITF. C: Intercalating residues of A23 around the -22 position. D: Intercalating residues of A23 around the -19 position. E: Superposition of the CE in conformation seen in the iPIC (black outline) onto the conformation seen in the CCC with bount RNA (solid colors). F: Transcription bubble region with cryo EM density (transparent blue) bound to the lobe of core vRNAP. The clamp has been removed for clarity. The insert indicates the region of this view in the complete structure as seen in Fig. 2B with a pink dot. G: Details of the leading fork point. H:Details of trailing fork point. I: Details of the interaction of the template strand with the bridge helix. J: Superposition of the RNA path observed in the CCC with the iPIC structure. K: Details of the A8 BRLE, FL and NTD bound to the CE. K: Cryo EM density of iPICcEm- Module 2 of the Ce is mobile and therefore not visible in the density. The VITF-3 ring moves towards the complex center (magenta arrow, compare to Fig. 2A, outer left).

[0030] Fig. 4 shows A: Arrangement of TBP orthologues and TFIIB paralogue / orthologues in different PICs. B Folding schemes of different TBP-fold proteins. C: Structures of TBP-fold proteins shown in (B), cartoon view.

[0031] Fig. 5 shows the vRNAP elongation complex. The active Site, cleft and the utilized binding pocket (black) inside the cleft are marked. The downstream region of the cleft is situated below the active site, the upstream region is situated above.

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although, any processes and materials similar or equivalent to those described herein can be used in practice for testing of the present invention, the preferred materials and processes are described herein. In describing and claiming the present invention, the following terminology will be used in accordance with the definitions set out below. Where the term “comprise” or “comprising” is used in the present description and claims, it does not exclude other elements or steps. For the purpose of the present invention, the term “consisting of’ is considered to be an optional embodiment of the term “comprising”. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also to be understood to disclose a group which optionally consists only of these embodiments.

[0034] Where an indefinite or a definite article is used when referring to a singular noun e.g. “a” or “an”, “the”, this includes a plural form of that noun unless specifically stated.

[0035] Vice versa, when the plural form of a noun is used it refers also to the singular form.

[0036] Furthermore, the terms first, second, third or (a), (b), (c) and the like in the description and in the claims are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein unless context clearly indicates otherwise.

[0037] In the context of the present invention any numerical value indicated is typically associated with an interval of accuracy that the person skilled in the art will understand to still ensure the technical effect of the feature in question. As used herein, the deviation from the indicated numerical value is in the range of ± 10%, and preferably of ± 5%. The aforementioned deviation from the indicated numerical interval of ± 10%, and preferably of ± 5% is also indicated by the terms “about” and “approximately” used herein with respect to a numerical value.

[0038] Poxyirus RNA polymerase complex for transcription of intermediate genes

[0039] According to a first aspect is provided a poxvirus RNA polymerase complex for transcription of a gene under the control of a poxvirus intermediate gene promoter, wherein the complex comprises a core poxvirus RNA polymerase complex, a viral intermediate transcription factor 3 (VITF-3) and optionally a capping enzyme.

[0040] “Poxvirus” comprises a species selected from the genera comprising orthopoxvirus, parapoxvirus, yatapoxvirus and molluscipoxvirus. The orthopoxvirus genus comprises smallpox virus (variola), vaccinia virus, cowpox virus, Mpox virus. The parapoxvirus genus comprises orf virus, pseudocowpox and bovine papular stomatitis virus. The genus Yatapoxvirus comprisees tanapox virus, yaba monkey tumor virus. The Molluscipoxivirus comprises molluscum contagiosum virus (MCV).

[0041] Preferably, the poxvirus is from the orthopoxvirus genus, more preferably, the poxvius is variola virus and vaccinia virus. Most preferred, the RNA polymerase complex is from vaccinia virus.

[0042] A “poxvirus intermediate gene promoter” may be selected from the promoter of an intermediate gene selected from K2L, K4L, F13L, E6R, E7R, E8R, E11 L, O2L, O3L, 11 L, I5L, I6L, I8R, G4L, G8R, L4R, J1 R, H1 L, H3L, H7R, D6R, D8L, D10R, D11 L, D13L, A1 L, A2L, A3L, A3L, A6L, A12L, A15L, A16L, A19 L , and A22R. Preferably, the gene promoter is selected from the promoter of any of A1 L, A2L and G8R, more preferably the poxvirus intermediate gene promoter is the G8R promoter.

[0043] A “viral capping enzyme” may be selected from D1 and D12, or a combination thereof. The poxviral capping enzyme (CE) is a heterodimer of the D1 and D12 subunits. D1 is a trifunctional enzyme that harbors all three enzymatic activities required for cap synthesis (Cong and Shuman, 1992; Martin and Moss, 1975; Shuman and Morham, 1990). D12 binds to the MTase domain of D1 and stimulates its activity allosterically, as shown by previous biochemical and crystallographic studies of the enzyme (Kyrieleis et al., 2014; Mao and Shuman, 1994).

[0044] “VITF-3” has been identified as a transcription factor, encoded by two vaccinia virus early genes that regulates the intermediate stage of viral gene expression (Sanz and Moss, PNAS 96 (1999), 2692- 2697). Preferably, VITF-3 is a heterodimeric complex comprising VITFs and VITFI . Preferably, the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, Rpo7, A8, and A23. Details on the individual components of the poxvirus RNA polymerase complex are given in the following table:

[0045] Table 1 : List of polypetides contained in polymerase complexes and their databank references

[0046] In a further preferred embodiment the poxvirus RNA polymerase complex comprises atoms having at least one atomic coordinate from PDB ID: 8P0K, 8P0N or 8P0J preferably at least 20, more preferably at least 50 and most preferred each of the atomic coordinates.

[0047] PDB ID refers to the accession number of the 3D structure for given polypeptides or complexes the atomic coordinates in the public protein data bank (PDB) [www.rcsb.org].

[0048] The 3D structures referred to herein have been determined by Cryogenic-electron microscopy (Cryo- EM). Cryo-EM is a cryomicroscopy technique applied on samples cooled to cryogenic temperatures. Based on the Cryo-EM analysis, models for the 3D structures of the poxvirus RNA polymerase complex have been generated. The poxvirus RNA polymerase complex has been purified from vaccinia virus as outlined in detail below.

[0049] As an alternative to Cryo-EM, X-ray crystallograpy or NMR spectroscopy may be used for macromolecular structure determination. A preferred method for Cryo-EM is described in the examples.

[0050] Minimal poxyirus RNA polymerase complex

[0051] “minimal poxvirus RNA polymerase complex” means herein the poxvirus RNA polymerase complex lacking the capping enzyme and the VITF-3 transcription factor for transcription of the poxvirus genes, in particular the intermediate genes. Preferably, the minimal poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7. In a more preferred embodiment the minimal poxvirus RNA polymerase complex comprises atoms having at at least one atomic coordinate from PDB ID: 9EXN.

[0052] Preferably, the minimal RNA polymerase complex comprises atoms having at least 20, more preferably at least 50 and most preferred each of the atomic coordinates from PDB ID: 9EXN.

[0053] Methods for purifying of the poxvirus RNA polymerase complex for transcription of genes under the control of a poxvirus intermediate promoter

[0054] In a further aspect is provided a method for purifying the poxvirus RNA polymerase complex according to the invention comprising the steps of a) infecting host cells with a recombinant vaccinia virus encoding a component of the poxvirus RNA polymerase complex of any one of claims 1 to 5 linked to an affinity tag in the presence of cytosine arabinoside; b) lysing the infected cells; c) contacting the lysate with a DNA hybrid comprising at least a portion of an intermediate gene promoter under conditions allowing the formation of a poxvirus RNA polymerase complex / DNA hybrid; d) incubating the poxvirus RNA polymerase complex / DNA hybrid with the complementary partner of the affinity tag bound to a column; e) eluting the bound poxvirus RNA polymerase complex / DNA hybrid from the column; and f) purifying the poxvirus RNA polymerase complex by subjecting the eluate to density gradient centrifugation.

[0055] The host cells may be selected from a host cells capable of being infected with a poxvirus. Preferably, the host cells are mammalian cells, more preferably human cells such as HeLa cells and CHO cells. Most preferred the host cells as HeLa S3 cells.

[0056] In a preferred embodiment the component of the poxvirus RNA polymerase complex may be Rpo132.

[0057] The affinity tag may be selected from a variety of possibilities known to the skilled person including a His tag or Flag®-tag. Flag® - tag which is preferred corresponds to the oligopeptide sequence DYKDDDDK (SEQ ID NO: 3).

[0058] The recombinant vaccinia virus strain is preferably GLV-1 h439 expressing hemagglutin / Flag tag linked to the C-terminus of the Rpo132 polypeptide.

[0059] Cytosine arabinoside is preferably used in a concentration of 100 to 400 pg / ml, preferably 200 to 300 pg / ml.

[0060] Methods for preparing cell lysates are known to the skilled person.

[0061] The DNA hybrid comprises at least a portion of an intermediate gene promoter in annealed form.

[0062] Preferably, the intermediate gene promoter is the G8R promoter. The DNA hybrid may further comprise a mismatch sequence of about 10 to about 20 nucleotides thereby forming an artificial bubble.

[0063] More preferably, the DNA hybrid comprises the non-template strand of the DNA hybrid having the nucleotide sequence set forth in SEQ ID NO: 1 , and the template strand of the DNA hybrid having the nucleotide sequence set forth in SEQ ID NO: 2. The incubation of the lysate with the DNA hybrid may be carried out for 15 min to 2h.

[0064] The incubated lysate is then applied to a column having the complementary partner of the affinity tag bound to the column material. The elution may be performed by the addition of affinity tag thereby removing the bound RNA polymerase complex from the column material.

[0065] The eluate is then subjected to density gradient centrifugation for further purification of the RNA polymerase complex.

[0066] Further purification steps including one or more of size exclusion chromatography, hydrophobic and / or ion exchange chromatography may be used as well.

[0067] Methods for preparing 5’-capped RNA

[0068] In a further aspect, the present invention provides a method for preparing 5’-capped RNA comprising incubating a DNA template comprising a coding region under the control of a poxvirus intermediate gene promoter in the presence of nucleotides with (i) the poxvirus RNA polymerase complex of any one of claims 1 to 5 or with (ii) a complete poxvirus RNA polymerase complex, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7, Rap94, NPH-I, VETF-I, D1 , D12, E11 , and tRNA(GLN); and isolating the 5’-capped RNA.

[0069] For this purpose, the RNA polymerase complexes according to the invention include a capping enzyme. Thereby, the complexes are suitable in the presence of nucleotides for preparing 5’-capped RNA in vitro or in vivo. Suitable buffers are known to the skilled person. The RNA may include mRNA, rRNA or tRNA. Preferably the RNA is mRNA.

[0070] Methods for screening an inhibitor of a poxyirus RNA polymerase complex by assessing RNA polymerase activity

[0071] In a further aspect the present invention provides a method for screening an inhibitor of a poxvirus RNA polymerase complex comprising the steps of: a) incubating a test compound with the poxvirus RNA polymerase complex of any one of claims 1 to 5 or with a poxvirus RNA polymerase complex selected from:

[0072] (i) a complete poxvirus RNA polymerase complex, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7, Rap94, NPH-I, VETF-I, D1 , D12, E11 , and tRNA(GLN); and

[0073] (ii) a complete poxvirus RNA polymerase complex lacking the capping enzyme, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7, Rap94, NPH-I, VETF-I, E11 , and tRNA(GLN); and b) determining the RNA polymerase activity of the poxvirus RNA polymerase complex in a functional assay, wherein a reduction of the RNA polymerase activity of the poxvirus RNA polymerase is indicative that the test compound is an inhibitor.

[0074] An "inhibitor" refers to a compound (e.g. compounds described herein) that reduces activity when compared to a control, such as absence of the compound or a compound with known inactivity.

[0075] As defined herein, the term "inhibition", "inhibit", "inhibiting" and the like in reference to a proteininhibitor interaction means negatively affecting (e.g. decreasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the inhibitor. Preferably, the target protein is the multi-subunit RNA polymerase complex and the activity to be reduced or inhibited is the RNA polymerase activity. Suitable assays for determining the reduction or inhibition of the RNA polymerase activity are described in the examples.

[0076] In embodiments inhibition means negatively affecting (e.g. decreasing) the concentration or levels of the protein relative to the concentration or level of the protein in the absence of the inhibitor. In embodiments, inhibition refers to reduction of a disease or symptoms of disease. In embodiments, inhibition refers to a reduction in the activity of a particular protein target. Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein. In embodiments, inhibition refers to a reduction of activity of a target protein resulting from a direct interaction (e.g. an inhibitor binds to the target protein). In embodiments, inhibition refers to a reduction of activity of a target protein from an indirect interaction (e.g. an inhibitor binds to a protein that activates the target protein, thereby preventing target protein activation).

[0077] The terms "inhibitor," "repressor" or "antagonist" or "downregulator" interchangeably refer to a substance capable of detectably decreasing the expression or activity, or interaction, of a given gene or protein(s). The antagonist can decrease expression, activity, or interaction 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more in comparison to a control in the absence of the antagonist. In certain instances, expression or activity is 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or lower than the expression or activity in the absence of the antagonist.

[0078] The test compound may be a small molecule, a peptide, a nucleic acid or a chemical derivative thereof, or an aptamer.The test compound may be obtained from a combinatorial library.

[0079] Combinatorial libraries may be commercially obtained.

[0080] Suitable test compounds include antibodies directed against any polypeptide comprised in the poxvirus RNA polymerase complex.

[0081] Suitable test compounds or inhibitors for the poxvirus RNA polymerase complex include: fludarabine, adenosine, adrenor, cladribine, azacitidine, epinephrine, epivir, cytarabine, zolmitriptan, levonordefrin, cidofovir, iohexol, iopromide, isovue-M, risedronate, ioxila and risedronate. Preferably, the test compound or inhibitor includes fludarabine. Further suitable test compounds or inhibitors include: salpichrolide J, 20-hydroxytubocapsanolide and anabsinthin.

[0082] Additional suitable test compounds or inhibitors include:

[0083] The functional assay may be an enzyme assay for detecting the impact of the test compound on the RNA polymerase activity. Alternatively, the enzyme assay may be based on an in vitro transcription assay. A preferred embodiment of the in vitro transcription assay is described in detail in the examples.

[0084] In a further aspect the present invention provides a method for identifying a candidate compound that binds to a site on a poxvirus RNA polymerase complex, the method comprising: a) providing a three-dimensional structure of a poxvirus RNA polymerase complex having at least one atomic coordinate, or surrogate thereof, from PDB ID: 8P0K, 8P0N, 8P0J, 8C8H, 9EXN and 8RQK for each of the amino acid residues Tyr432, Pro430, Thr428, His429, His431 , Asp710, Lys711 , Val163, and Arg1019 of polypeptide Rpo133; and Pro382, Asp419, Asp417, Asp 415 of polypeptide Rpo147 of the poxvirus RNA polymerase complex; and b) producing a structure for a candidate compound wherein the structure defines a molecule having sufficient surface complementary to the poxvirus RNA polymerase complex to bind the site in an aqueous solution.

[0085] In one aspect, the invention provides means to carry out virtual screening of compounds using the disclosed atomic coordinates or coordinates derived therefrom. The atomic coordinates of the three- dimensional structure elucidated by the invention are input into a computer so that images of the structure and various parameters are shown on the display. The resultant data are input into a virtual compound library. Since a virtual compound library is contained in a virtual screening software, the above-described data may be input into such a software. Compounds may be searched for, using a three-dimensional structure database of virtual or non-virtual compounds, such as MDDR (Prous Science, Spain). The potential interactions of a compound may be analyzed prior to its actual synthesis and testing by the use of computer modeling techniques. If the theoretical structure of the given compound suggests insufficient interactions with the RNA polymerase complex, synthesis and testing of the compound may be obviated. However, if computer modeling indicate sufficient interactions, the molecule may then be synthesized and tested for its ability to regulate the RNA polymerase complex, using various methods described herein and / or that are known to a person skilled in the art. In one embodiment, the molecule is tested for its ability to modulate a poxvirus- induced disease such as smallpox. Animal models for smallpox are known in the art (Chapman et al., Vet Pathology 47 (2010), 852-870; Wei et al., Infectious Medicine 2 (2023), 153-166). Alternatively, the test compounds may be tested in the in vitro transcription assay described herein.

[0086] Compounds may be computationally evaluated and designed by means of a series of steps in which chemical entities or fragments are screened and selected for their ability to bind with individual binding sites or combinations thereof (e.g., PC, P+1 , P — I) or other areas of the RNA polymerase complex. One skilled in the art may use any of several methods to screen chemical entities or fragments for their ability to bind to the RNA polymerase complex and more particularly with the specific binding sites or functional sites described herein. Sequences of the RNA polymerase complex, may also be threaded onto the protein backbone of a RNA polymerase complex domain derived from the Cryo-EM structure, with side chain positions optimized using methods known in the art. The resulting structural models may then be used to discover chemical entities or fragments that regulate the RNA polymerase complex via in silico docking. The process may begin by visual inspection of, for example, the functional site on the computer screen based on the the RNA polymerase complex presented in Protein Data Bank PDB ID: 8P0K, 8P0N, 8P0J, 8C8H, 9EXN and 8RQK, in particular for each of the amino acid residues Tyr432, Pro430, Thr428, His429, His431 , Asp710, Lys711 , Val163 and Arg1019 of polypeptide Rpo133; and Pro382, Asp419, Asp417, Asp 415 of polypeptide Rpo147 of the RNA polymerase complex. Fig. 5 shows the vRNAP elongation complex. The active Site, cleft and the utilized binding pocket (black) inside the cleft are marked. The downstream region of the cleft is situated below the active site, the upstream region is situated above.

[0087] Function of vRNAP

[0088] The vaccinia virus early RNA polymerase (vRNAP) is a multi-subunit DNA-dependent RNA polymerase. As such, it transcribes a double-stranded DNA sequence into a single stranded RNA with high fidelity.

[0089] This is facilitated by binding of the DNA into the cleft. DNA binding entails melting of the double helix which exposes the template strand and establishes the transcription bubble. In actively transcribing vRNAP, the downstream section of the cleft (Fig. 5) accommodates a double helical DNA duplex while the upstream section accommodates a DNA / RNA hybrid. At the active site, incoming nucleotide triphosphates are covalently added to the nascent RNA chain while diphosphate is released as a by-product.

[0090] Drug binding pocket

[0091] A binding pocket was defined that enables efficient and stable interaction with small molecule compounds. The pocket is situated in a position that fosters the interference of the bound compound with the transcription function of vRNAP (Fig. 1). The location of the binding pocket is in the upstream region of the cleft between the “wall” domain of vRNAP and the DNA / RNA hybrid (Fig. 5).

[0092] The relevant contact amino acid residues of the vRNAP complex are as follows:

[0093] Downstream region of the cleft

[0094] Rpo147

[0095] ASN1129

[0096] MET1128

[0097] LYS1131

[0098] GLU1126

[0099] SER971

[0100] LYS831

[0101] ARG751

[0102] ASN962

[0103] Rpo133

[0104] PRO185

[0105] LYS184

[0106] ARG181

[0107] LYS461

[0108] ARG460

[0109] ASP213

[0110] SER211

[0111] LYS226 THR225

[0112] LYS209

[0113] THR189

[0114] SER191

[0115] TYR205

[0116] HIS207

[0117] ARG181

[0118] LYS173

[0119] TYR447

[0120] Rpo30

[0121] LYS80

[0122] ILE76

[0123] ASN73

[0124] LYS67

[0125] SER70

[0126] LYS67

[0127] GLU77

[0128] GLY75

[0129] Active site region

[0130] Rpo147

[0131] ARG380

[0132] ASP417

[0133] ASP415

[0134] ASP419

[0135] Rpo133

[0136] LYS890

[0137] LYS882

[0138] Upstream Region

[0139] Rpo147

[0140] TRP422

[0141] GLN381

[0142] ARG287

[0143] GLU42

[0144] PRO382

[0145] TYR264

[0146] ASN270 TYR276

[0147] ILE260

[0148] LYS215

[0149] SER207

[0150] PHE208

[0151] Rpo133

[0152] LYS418

[0153] PRO480

[0154] THR428

[0155] LYS165

[0156] SER416

[0157] LYS160

[0158] GLN779

[0159] LYS777

[0160] LEU870

[0161] ASN711

[0162] GLN161

[0163] PRO430

[0164] GLU1043

[0165] ILE1051

[0166] THR285

[0167] THR1027

[0168] ARG 1047

[0169] LYS1046

[0170] LYS776

[0171] TYR432

[0172] TYR850

[0173] ARG 1045

[0174] ASP1024

[0175] ARG1019

[0176] LYS1025

[0177] HIS1020

[0178] ILE260

[0179] LYS215

[0180] The present invention encompasses the use of at least one of the atomic coordinates of the above amino acids in a molecular modelling software, preferably at least 10 amino acids, preferably at least 20, more preferred at least 30 amino acids, most preferred each of the above amino acids. Selected fragments or chemical entities may then be positioned in a variety of orientations, or docked, within a binding site of the RNA polymerase complex. Docking may be accomplished using software such as QUANTA™, SYBYL™, followed by energy minimization and molecular dynamics with molecular mechanics forcefields softwares, such as CHARM M™and AMBER™. It is also prefered to use MOE site finder tool or the FTMap to detect relevant binding sites.

[0181] Pharmacophore models are preferably created with the software MOE and applied with the Pharmit web tool to search the MolPort and ZINC screening libraries. The obtained molecules are followed up in dockings preferably with GOLD and molecular dynamics simulations preferably with the Amber ff14SB force field and subsequent AG calculations using the MM / GBSA approach. Molecular modelling includes molecular docking, molecular dynamics or ADMET modelling.

[0182] Specialized computer programs may also assist in the process of selecting fragments or chemical entities. These include, but are not limited to, GRID™(Goodford, P. J., J. Med. Chem. , 28, 849-857 (1985));MCSS™(Miranker, A. and M. Karplus, "Proteins: Structure, Function and Genetics, 11 , 29- 34 (1991 ));(3) AUTODOCK™(Goodsell, D. S. and A. J. Olsen, Proteins: Structure, Function, and Genetics, 8, 195-202 (1990;DOCK™(Kuntz, I. D. et al. , J. Mol. Biol., 161 , pp. 269-288 (1982)); GLIDE™(Schrodinger Inc.); FLEXX™(Tripos Inc); (7) GOLD™ (Jones et al. , J. Mol. Biol., 245, 43- 53, 1995). Once suitable chemical entities or fragments have been selected, they may be assembled in silico or synthesized into a single compound. Chemical syntheses may be carried out by methods known in the art. In silico assembly may proceed by visual inspection of the relationship of the fragments to each other on the three-dimensional image displayed on a computer screen in relation to the structure coordinates of the poxvirus RNA polymerase complex. This may be followed by manual model building using softwares such as QUANTA™or SYBYL™. Useful programs for connecting the individual chemical entities or fragments include the following: CAVEAT™(Bartlett, P. A. et al, Royal Chem. Soc., 78, 182-196 (1989));3D Database systems such as MACCS-3D™(MDL Information Systems, San Leandro, Calif. ); and HOOK™(Molecular Simulations, Burlington, Mass. ). In addition to building a compound in a step-wise fashion as described above, compounds may be designed as a whole or "de novo" using an empty active site or optionally including some portion(s) of a known compound. Such methods include, but are not limited to, LUDI™(Bohm, H. -J., J. Com R. Aid. Molec. Design, 6, pp. 61-78 (1992)); LEGEND™(Nishibata, Y. and A. Itai, Tetrahedron, 47, p. 8985 (1991)), and LEAPFROG™(Tripos Inc. , St. Louis, Mo.).

[0183] Once a compound has been designed or selected, the efficiency with which that compound may regulate the poxvirus RNA polymerase complex may be tested and optimized by computational evaluation. For example, a compound may demonstrate a relatively small difference in energy between its bound and unbound states (i.e. , a small deformation energy of binding). A compound may interact with the poxvirus RNA polymerase complex in more than one conformation that is similar in overall binding energy. In those cases, the deformation energy of binding is taken to be the difference between the energy of the unbound compound and the average energy of the conformations observed. A compound that is designed or selected may be further computationally optimized so that in its bound state it may lack repulsive electrostatic interactions. Such interactions include repulsive charge-charge, dipole-dipole, and charge-dipole interactions. The sum of all electrostatic interactions between the compound and the poxvirus RNA polymerase complex, may make a neutral or favorable contribution to the enthalpy of binding. Software programs to evaluate compound deformation energy and electrostatic interaction include, e.g., Gaussian 92™(M. J. Frisch, Gaussian, Inc., Pittsburgh, Pa.); AMBER™(P. A. Kollman, University of California at San Francisco, Calif. ); QUANTA / CHARMM™ (Molecular Simulations, Inc., Burlington, Mass. ); and Insight ll / Discover™(Biosysm Technologies Inc. , San Diego, Calif. ). Once a compound has been optimally selected or designed, substitutions may be made in some of its atoms or side groups in order to improve or modify its binding properties. Initial substitutions may be conservative, i.e., the replacement group will have approximately the same size, shape, hydrophobicity and charge as the original group. Such substituted compounds may then be analyzed for efficiency of fit to the poxvirus RNA polymerase complex by software programs similar to those described.

[0184] In a further aspect the present invention provides a method for preparing a pharmaceutical composition comprising performing the method according to the invention thereby obtaining an inhibitor of the poxvirus RNA polymerase complex or candidate compound; and formulating the identified inhibitor or candidate compound with at least one pharmaceutically acceptable excipient.

[0185] The pharmaceutical composition can be either a therapeutic formulation or a prophylactic formulation. Typically, the composition can additionally include one or more pharmaceutically acceptable vehicles and, optionally, other therapeutic ingredients (for example further anti-smallpox drugs). Various pharmaceutically acceptable additives can also be used in the compositions.

[0186] In a further aspect the present invention provides a method for the prophylaxis or treatment of a poxvirus induced disease comprising administering an effective amount of a compound to a patient in need thereof, wherein the compound is selected from any one of

[0187] or (ii) the compound is selected from any one of fludarabine, adenosine, adrenor, cladribine, azacitidine, epinephrine, epivir, cytarabine, zolmitriptan, levonordefrin, cidofovir, iohexol, iopromide, isovue-M, risedronate, ioxila, risedronate, salpichrolide J, 20-hydroxytubocapsanolide and anabsinthin, or combinations of any of the compounds (i) and / or (ii), preferably, the compound is fludarabine.

[0188] The docking scores of compounds (i) are shown in the examples. The docking scores of compounds (ii) have also been found to be suitable as inhibitors for the poxvirus RNA polymerase complex.

[0189] As used herein, the term "administering" means oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini- osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g, intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc. In embodiments, the administering does not include administration of any active agent other than the recited active agent. In a further aspect the present invention provides a compound selected from or (ii) the compound is selected from any one of fludarabine, adenosine, adrenor, cladribine, azacitidine, epinephrine, epivir, cytarabine, zolmitriptan, levonordefrin, cidofovir, iohexol, iopromide, isovue-M, risedronate, ioxila, risedronate, salpichrolide J, 20-hydroxytubocapsanolide and anabsinthin, or combinations of any of the compounds (i) and / or (ii), preferably, the compound is fludarabine for use in the prophylaxis or treatment of a poxvirus-induced disease.

[0190] The poxvirus-induced disease may be selected from smallpox, molluscum contagiosum, and zoonoses selected from sheeppox, swinepox, fowlpox and monkeypox. Preferably, the poxvirus- induced disease is smallpox.

[0191] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are tobe included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes. Examples Methods

[0192] In vitro transcription assay

[0193] In vitro transcription was carried out in 25 pl reactions containing 40 mM Tris pH 8.0, 6 mM MgCI2, 10 mM DTT, 2 mM spermidine, 80 pM S-adenosyl methionine, 20 U RNase Inhibitor, 2.5 mM ATP / GTP / CTP, 0.5 mM UTP and 33.3 nM [a-32P]-UTP. As DNA scaffold, the native promoter of G8R ranging from -178 to +501 in respect to the TSS, was PCR amplified and ligated into the vector pUC19. The vector was linearized at position +748 in respect to the TSS and 500 ng were added per reaction. Last, 0.5 pg intermediate vRNAP and 0.5 pg recombinant VITF-3 were added, and the sample was incubated at 30°C for 45 min. To stop the reaction, 25 pl water, 200 pl TRIzol reagent and 50 pl chloroform were added to the sample. The sample was centrifuged at 12 000 g at 4°C for 15 min, before the aqueous phase was transferred into a fresh tube containing 200 pl 2-propanol and 1 pl glycol blue. After mixing, the RNA was precipitated at -20°C for at least 10 h. The sample was centrifuged at 12 000 g at 4°C for 15 min and the supernatant was discarded, before the RNA pellet was washed once with 180 pl of 70 % ethanol. The RNA pellet was dried at 37°C for 5 min and resuspended in 20 pl 1x RNA loading dye (47.5 % formamide, 0.025 % bromophenol blue, 0.025 % xylene cyanol). After heating up the sample to 95°C for 5 min, 10 pl of the sample were loaded on a 4 % polyacrylamide gel containing 8 M urea. Electrophoresis was carried out at 20 mA in 1x TBE running buffer. After 120 min, electrophoresis was stopped, and the gel was transferred onto Whatman paper and exposed to a high performance chemiluminescence film (Cytiva) at -80°C.

[0194] 5’-labelling of DNA

[0195] DNA oligonucleotides containing the G8R promoter or a randomized sequence from -35 to +35 in respect to the TSS, were ordered by Sigma-Aldrich and dissolved in 1x Annealing buffer (20 mM HEPES pH 7.5, 100 mM NaCI, 3 mM MgCI2) to a concentration of 100 pM. To add a radioactive 5’- label to the single stranded template DNA oligonucleotide, a 10 pl reaction containing 1x reaction buffer A, 10 pM DNA, 10 U T4-Polynukleotid-Kinase (Thermo Scientific) and 0.17 pM [a-32P]-ATP was incubated at 37°C for 60 min. The sample was filled to 20 pl with water, before it was purified via MicroSpin G-25 Column (Amersham) according to the vendor’s protocol. A small portion of the eluate was taken off, serving as ssDNA sample and the remaining template DNA was combined with equal amounts of the respective non-labelled, non-template DNA oligonucleotide. For annealing, the sample was heated to 95°C for 15 min, before the heating device was switched off. After at least 5 h, the annealed DNA was diluted to 500 fmol / pl and used for electrophoretic mobility shift assay (EMSA).

[0196] Electrophoretic mobility shift assay

[0197] Electrophoretic mobility shift assays were carried out in 10 pl reactions containing 10 mM Tris pH 8.5, 5 mM MgCI2, 1 mM DTT, 1 mM ATP / GTP / UTP / CTP, 117 ng VITF-3 and 810 ng intermediate vRNAP. Last, 500 fmol of 5’-labelled DNA were added and the sample was incubated at 30°C for 30 min. If indicated, heparin or antibodies targeted against VITF-3 or HA were added, and the sample was incubated for further 15 min at room temperature. Respective amounts of 5x native dye (50 % glycerol, 2,5x TBE, 0.05 % bromophenol blue) were added to generate a concentration of 1x and the sample was applied on a 4 % polyacrylamide gel with an acrylamide to bis-acrylamide ratio of 19:1. Electrophoresis was carried out at 120 V in 0.25x TBE running buffer. After 4 h, electrophoresis was stopped, and the gel was transferred onto Whatman paper and exposed to a high performance chemiluminescence film (Cytiva) at -80°C.

[0198] Infection of HeLa S3 cells in presence of Cytosine Arabinoside

[0199] Hela S3 cells were grown to about 80 % confluency on 15 cm plates at 37°C with 5 % CO2in DMEM supplied with 10 % FBS and 1 % Pen / Strep. The medium was changed to 10 ml DMEM supplied with 10 % FBS, 1 % Pen / Strep and 250 pg / ml Cytosine arabinoside per plate and cells were incubated for 1 h at 37°C with 5 % CO2. The medium was changed to 10 ml DMEM supplied with 2 % FBS, 1 % Pen / Strep and 250 pg / ml Cytosine arabinoside per plate. The cells were infected with genetically generated GLV-1 h439 virus expressing FLAG / HA-RPO132 (second largest subunit of the vRNAP; Genelax protocol) with an MOI of 10. After 1 - 3 h of incubation at 37°C with 5 % CO2, 10 ml DMEM supplied with 18 % FBS, 1 % Pen / Strep and 250 pg / ml Cytosine arabinoside were added per plate and cells were further incubated at 37°C with 5 % CO2. About 24 h after infection, the cells were detached from the plate by pipetting and centrifuged at 1 800 g and 4°C for 10 min. The cell pellet was flash-frozen in liquid nitrogen and stored at -80°C. For the FLAG purification of intermediate-stage vRNAP see STAR protocol.

[0200] Purification of the vaccinia virus intermediate-stage pre-initiation complex RNAP from infected cells

[0201] HeLa S3 cells infected with W GLV1 h439 in presence of Cytosine arabinoside, were thawed on ice. The cell pellet was resuspended in 1 ml lysis buffer (150 mM NaCI, 50 mM HEPES pH 7.5, 1.5 mM MgCI2, 0.5 % NP-40, 1 mM DTT, Protease inhibitors) per 60x106cells and incubated at 4°C for 20 min. The lysate was cleared by centrifugation at 48 254 g and 4°C for 40 min. The supernatant was supplied with ATP at a final concentration of 4 mM and 10 nmol of annealed G8R promoter DNA, which contained an artificial bubble from position -5 to +8 in respect to the TSS (Template strand: 5’-CCCCCTTTATGGATTTTTATAGGGATGGAGTAAAATATAATTTGTAAATTAT TTAAAGTTAAATGGCTGC-3’ [SEQ ID NO:2]), Non-template strand: 5’-GCAGCCATTTAACTTTAAATAATTTACAAAAATTTAAAATGAGCATCCCT ATAAAAATCCATAAAGGGGG-3’ [SEQ ID NO: 1]). The sample was incubated at 20°C for 30 min under rotation, before the protein-DNA complex was purified via FLAG-IP and a 5 - 45 % sucrose density gradient as described in STAR protocol (Bartuli et al., STAR Protocols 3, 101116 (2022). The fractions containing intermediate-stage vRNAP and endogenous VITF-3 were pooled and concentrated in a centrifuge tube filter (100 kDa MWCO) by centrifugation at 8 000 g and 4°C to a concentration of 1 .5 pg / pl. The sample was centrifuged at 15 000 g and 4°C for 5 min, before 3 pl were applied on a Quantifoil R1 .2 / 1 .3 Au 300 grid at 4°C and 100 % humidity using a Vitrobot Mark IV instrument (FEI). For grid preparation, 0 s wait time, 5 s blotting time and a blot force of 20 were used. Grids were stored in liquid nitrogen till data collection.

[0202] Expression and purification of recombinant VITF-3 in E. coli

[0203] The ORFs of the vaccinia virus genes A8R and A23R were PCR-amplified with respective primer pairs from vaccinia virus genomic DNA

[0204] (A8R_BamHI_fw: 5'-GGGCGGGATCCatgttcgaaccagtaccagatc-3' [SEQ ID NO:

[0205] 4], A8R_Hindlll_rev: 5'-CCGGCAAGCTTctaagtaaaatattttagtagcgtatcc-3' [SEQ ID NO:

[0206] 5], A23R_Ndel_fw: 5'-GAACTCATATGatggataatctatttacctttctac-3' [SEQ ID NO:

[0207] 6], A23R_Notll_rev: 5'-GAACTGCGGCCGCtcattttagaagcaattcttttag-3' [SEQ ID NO: 7). The PCR product containing the ORF of A8R and the vector pET28a were digested with BamHI and Hindlll. Equally, the PCR product containing the ORF of A23R and the vector pET21a were digested with Ndel and Notl. The digested DNA was purified via agarose gel followed by gel extraction according to the vendor's protocol (macherey nagel). The digested ORFs of A8R and A23R were ligated into the digested vectors pET28a and pET21 a, respectively. Chemically competent BL21 (DE3)pLysS / pRARE cells were co-transformed with 15 ng of both plasmids in an 50 pl reaction and co-transformed cells were selected via antibiotic resistance. About 100 ml SB medium supplied with chloramphenicol, ampicillin and kanamycin were inoculated with BL21 (DE3)pLysS / pRARE cells co-transformed with A8R-pET28a and A23R-pET21 a and incubated at 37°C under shaking overnight. About 2 I SB medium were inoculated with 1 % of overnight pre-culture and the bacteria were incubated at 37°C under shaking. As soon as an QD600 value of 0.5 - 0.7 was reached, protein expression was induced by adding IPTG to a final concentration of 0.5 mM. The bacteria were further incubated overnight at 16°C under shaking. The cells were collected by centrifugation at 4 000 rpm and 4°C for 20 min. About 40 ml buffer L (25 mM HEPES pH 8.0, 150 mM NaCI, 15 % glycerol, 5 mM |3-mercaptoethanol) supplied with 10 mM imidazole and 1x protease inhibitors were added. The cells were resuspended and broken by sonication (duty cycle 50 %; output control 70 %; 5x 60 s). The lysate was cleared at 48,254 g and 4°C for 40 min and the supernatant was incubated with 4 ml of equilibrated Ni-NTA beads overnight at 4°C under rotation. The beads were washed with at least 5 CV buffer L supplied with 20 mM imidazole, 10 CV buffer L supplied with 20 mM imidazole and 1 M NaCI, 5 CV buffer L supplied with 20 mM imidazole and 10 CV buffer L supplied with 50 mM imidazole. For elution, the beads were incubated with an equal volume of buffer L supplied with

[0208] 500 mM imidazole for about 30 min at 4°C under rotation. This step was repeated two times, and the elution fractions were combined and sterile filtered with a 0.2 pm filter. The Ni-NTA eluate was further purified via HiTrap Heparin HP 1 ml column equilibrated with buffer A (25 mM HEPES pH 8.0, 150 mM NaCI, 15 % glycerol, 1 mM DTT). After binding, impurities were removed by a 25 % buffer B (25 mM HEPES pH 8.0, 1 M NaCI, 15 % glycerol, 1 mM DTT) step elution. The protein of interest was eluted by a 100 % buffer B step elution. Fractions were analysed via SDS-PAGE and fractions containing VITF-3 were pooled. Pooled heparin elution fractions (about 2 ml) were dialyzed against 300 ml D1 (25 mM HEPES pH 8.0, 400 mM NaCI, 1 mM DTT) for about 3 h, followed by dialysis against D2 (25 mM HEPES pH 8.0, 250 mM NaCI, 1 mM DTT) and D3 (25 mM HEPES pH 8.0, 150 mM NaCI, 1 mM DTT) under the same conditions. Precipitated protein was removed by centrifugation at 15,000 g and 4°C for 10 min and the supernatant was concentrated in centrifuge tube filter (10 kDa MWCO). It was flash-frozen in small aliquots and stored at -80°C.

[0209] Cryo-EM structure determination and model building

[0210] The sucrose gradient purified sample was diluted 1 :50 and concentrated in a Vivaspin concentrator to a concentration of roughly 1 mg / mL to remove the sucrose, centrifuged for 2h at 21 ,000 g and diluted 1 :1 in a buffer containing 20mM HEPES, pH 7.5, 200mM (NH4)2SO4, 1 mM MgCI2 and 5mM 2-mercaptoethanol. R 1 .2 / 1 .3 holey carbon grids (Quantifoil) were glow discharged for 90 s (Plasma Cleaner model PDC-002. Harrick Plasma Ithaca, NY / USA) at medium power and 3.5 mL of C2 sample was applied inside a Vitrobot Mark IV (FEI) at 4C and 100% relative humidity. The grids were blotted for 3 s and with blot force 5 and plunged into liquid ethane. The Cryo-EM dataset was collected with a Thermo Fisher Titan Krios G3 and a Falcon III camera (Thermo-Fischer). Data was acquired with EPU at 300 keV and a primary magnification of 75,000 (calibrated pixel size 1 .0635 A°) in movie-mode with 25 fractions per movie and integrating the electron-signal. The total exposure was 50 e / A° 2 over an exposure time of 4.5 s with 2 exposures per hole.

[0211] The dataset was processed with Cryosparc. Two cycles of 2D classification and manual selection of classes based on the appearance of their class averages for cleanup resulted in a stack of 114,430 good particles. An ab initio map was created from a 50,000 particles subset and the full set subjected to a consensus 3D refinement. The set was then separated into two classes that represented complete vRNAP and vRNAP-CE. The two particle sets were finally subjected to a non- uniform refinement step and the density was docked with the complete vRNAP model (PDB 6RFL) after removal of the capping enzyme subunits D1 and D12. The model was manually refined including removal of some stretches of Rap94 that were not represented in the cryo EM density (exemplary data are shown in Table 2). The model was automatically refined with Phenix.real_space_refine including an ADP refinement step. During refinement secondary structure, mild Ramachandran and reference model restraints from the 6RFL model was imposed. A total of three cycles of manual inspection and automated refinement were performed.

[0212] Table 2: Cryo-EM data collection, single-particle reconstruction and model refinement statistics of intermediate vRNAP complexes

[0213] Results

[0214] Intermediate promoter binding by VITF-3 and vRNAP The ring structure of VITF-3 raises the question of how it is loaded on the promoter. To answer this question we performed electrophoretic mobility shift assays (EMSA) using vRNAP from infected cells in presence of araC, recombinant VITF-3 and radioactively labelled G8R promoter DNA with a length of 70 nt. Our data suggests that VITF-3 alone is not capable of promoter binding in contrast to vRNAP, which binds the promoter scaffold. If VITF-3 and vRNAP are both added the band shifts even higher, indicating that a complex of promoter, VITF-3 and vRNAP is formed. Furthermore, when VITF-3 is titrated at constant DNA and vRNAP concentrations the intensity of the shifted band linearly increases.

[0215] Purification and reconstitution of the intermediate pre-initiation complex

[0216] We infected adherent HeLa S3 cells with vaccinia GLV-1 h439, expressing a variant of Rpo132 carrying a FLAG-tag in presence of cytosine arabinoside (araC). Extracts from infected cells were incubated with a 70mer DNA duplex containing the G8R intermediate promoter sequence, as well as a mismatch bubble from position -5 till +8 in relation to the transcription start site (TSS) (Fig. 1 A). The sample was subsequently bound to anti-FLAG agaroseand vRNAP complexes were eluted with FLAG peptide. The eluate was fractionated by sucrose density gradient centrifugation and the elution profile analysed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (Fig. 1 B). Fractions of the vRNAP proteins co-eluted with the viral capping enzyme D1 / D12 and the 70mer DNA duplex in a defined peak that also contained two further proteins matching the expected size of VITF-3s and VITF-3I. DNA containing fractions were pooled, concentrated and used for cryo-EM sample preparation.

[0217] In vitro transcription on intermediate promoters

[0218] To enzymatically characterise the intermediate transcription machinery, we performed in vitro transcription assays. We used vRNAP purified from infected Hela S3 cells in presence of araC, as well as recombinant VITF-3 and native promoter scaffolds from several W genes. The latter were cloned from about 150 upstream to 100 - 500 bp downstream of the TSS into plasmids, which were linearised to generate the transcription template. We used run-off transcription since little is known about the termination requirements of intermediate transcription.

[0219] Our results demonstrate that the core vRNAP with co-purified capping enzyme and recombinant VITF-3 are sufficient for in vitro transcription from intermediate genes. We used promoter sequences of the intermediate genes G8R, A1 L, A2L, 11 L, which all showed a decent amount of transcription. Additionally, we performed our transcription reaction on the late promoter from the I2L gene, wherein we also saw transcript formation.

[0220] For in vitro transcription from intermediate promoters only the vRNAP core subunits co-purified with the heterodimeric capping enzyme and VITF-3 are required. In contrast, for the transcription of early genes several early promoter-specific transcription factors, as well as the capping enzyme, Rap94, NPH-I and glutamine tRNA from the host are needed.

[0221] Structure of the intermediate pre-initiation complex at 2.4 A resolution We collected a cryo EM dataset from our iPIC preparation containing 9,318,600 particles that allowed for a 2.4 A reconstruction (Fig 2A) and building of an almost complete model (Fig. 2B, C, see Table 3 for data collection, reconstruction and model refinement statistics). The reconstruction displays density for core vRNAP with very high local resolution and without significant conformational changes compared to the structure of isolated core vRNAP. In the cleft, the DNA duplex is bound in a manner reminiscent of the elongation complex, but no signs of RNA synthesis whatsoever could be detected, showing that the structure is that of a pre-initation complex. In the bubble region of the DNA duplex, that is centred around the active site, both nucleic acid strands are widely separated indicating that the iPIC is in the open complex (OC) state. Remarkably, VETF forms a ring that encloses the upstream promoter in the -25 to -15 region and thereby restrains the path of the upstream DNA duplex. The ring is supported by the wall and protrusion domain of core vRNAP on one side and by the CE on another, resulting in a rugged integration of VETF into the PIC. As observed in the existing cryo EM structures containing the CE and the crystal structures of the CE, this unit is structurally divided into two modules, the first consisting of the N-terminal part of D1 , and the second consisting of the C-terminal part of D1 bound to D12. Both modules display a high conformational flexibility relative to each other, when comparing the conformation of the CE in complete vRNAP and the CCC. Adapting to the presence of VITF, the first CE module is bound in a pose similar to that observed in the CCC, but the second module is in a position that has not been observed in any other poxviral transcription complex, (Fig. 2A, B). This conformation is further stabilized by the A8 N-domain that binds at the interspace between both modules of the CE (Fig. 3A). Of note, the iPIC structure does not give any hints towards an involvement of helicase cofactors whatsoever which sets it apart from the early poxviral PIC and its closest cellular relative, the Pol II PIC.

[0222] The VITF ring encloses the DNA and induces DNA duplex bending with low sequence specificity

[0223] In contrast to genuine TBP, the A23 bilobal TBP fold does not expose stirrups, but displays dramatically extended “saddle flaps” that enable simultaneous clamping of the TFIIB orthologue A8 in a pliar-like fashion. The resulting A23 / A8 unit closes tightly around the upstream promoter (Fig. 3C), thereby bending the DNA helix axis by roughly 90°. DNA binding and ring stability is enhanced by a positive patch in the electrostatic potential distribution of VITF that is almost perfectly congruent with the contact area of the bound DNA on the ring surface (compare Fig. 3C to 3B). In the VITF- promoter complex, the saddle structure of A23 inserts into the minor groove in a fashion that is reminiscent of that observed in the TBP / TATA-box complex, but contrary to the former accompagnied by a remarkable widening of the minor groove. A further similarity is the intercalation of hydrophobic residues into the base stack that seems to drive the bending of the helix axis. However, while genuine TBP intercalates aromatic sidechans, A23 utilizes two aliphatic sidechains to disturb the base stack at promoter position -21 / -22 (Fig. 3D) and -18 / -19 (Fig 3E). Overall, the VETF-promoter contacts seem to concentrate predominantly on the phospho sugar backbone of the DNA and lack any obvious base specificity. Still, the aliphatic intercalation mechanism breaks two Watson-Crick base pairs and disturbs several others due to helix axis bending. VITF binding might therefore be more favourable in the AT-rich area of the upstream intermediate promoter compared to DNA regions with average GC content.

[0224] The functionality for promoter discrimination, template selection and TSS detection is contributed by the enzymatic core of vRNAP

[0225] The lack of base specific promoter contacts in VITF and the complete lack of DNA contacts in the CE raises the question of how the iPIC detects the promoter template and finds the TSS. Since large parts of the transcription bubble display well defined cryo EM density in the reconstruction, particularly around the two fork points, we focused on these areas to answer this question. Strikingly, at the downstream fork point, the non-template strand binds stably to the lobe domain of core vRNAP so that single bases can be clearly discerned in the density (Fig. 3F). We find that the TAAA consensus motif at position -1 to +3 of the intermediate promoter is read out by a base-specific contact. Base specificity is generated by an interaction of this strongly conserved “initiator element” (Fig. 2C, below) [24, 25] to an area of the lobe centered around His207 of the second largest core vRNAP subunit, Rpo132 (Fig. 3G). The robust binding of the non-template strand thus not only stabilizes the downstream fork point, but at the same time also positions the corresponding +1 base of the melted template strand inside the cleft next to the active site. It therefore appears obvious that intermediate promoter sequence specificity is provided by core vRNAP rather than the two TFs (CE and VITF) bound to the iPIC. This observation is so far unprecedented as for all other known multisubunit RNA polymerases, promoter seuqence specificity is almost exclusively provided by their respective associated TFs.

[0226] Loops on Rpo147 and the A23 N-terminal domain cooperate in upstream fork point stabilization

[0227] Polymerase-proximal, the upstream promoter DNA duplex exits the VITF ring and descents into the cleft. The trajectory of the DNA is fixed in this area mostly by the contact of the cyclin fold of the A8 CTD (Fig. 2A, left, Fig. 2B). Adjacent to the upstream (trailing) fork point, the insertion loop (IL) of A8 inserts into the minor groove around the -14 promoter position (Fig. 3B, left). The upstream fork point then follows at the -7 position where it is stabilized by two elements that are lowly resolved in the cryo EM density (Fig. 3H): (1) Fork loop 1 of the Rpo147 clamp domain (residues 305 -217) and (2) the A8 fork loop (FL) that links the A8 NTD to the CTD. Both loops reach out to the same spot at the fork point where they apparently cooperate in its stabilization. Still, the density is fairly disordered at this position and does not allow to discern atomic details. It is important to notice that the fork loop 1 of Pol II is situated at a comparable position

[0026] , but does not appear to be homologous to fork loop 1 of vRNAP.

[0228] Fork loop 2 of Rpo132 and the bridge helix cooperate in downstream fork point stabilization

[0229] In Pol II, a loop of the second largest subunit located on the fork domain serves in fork point stabilization, DNA strand separation, and RNAP translocation. We observe a homologous, but slightly expanded element in the iPIC structure, binding to the leading (downstream) fork point. Well discernible cryo EM density for side chains in this loop allows to elucidate its interactions with the intermediate promoter in detail. At the center of the interaction are two hydrophobic sidechains on fork loop 2 that shield the DNA bases of the non-template and the template strand that are exposed at the fork point (position +4) from the surrounding solvent. An asparagin residue in the vicinity interacts with the sugar phosphate backbone between positions +4 and +3 of the non-template strand which here makes a sharp turn towards the lobe-bound initiator element (positions -1 to +3, Fig. 3G). A similar turn in the opposite direction is observed on the non-template strand. It is stabilized by the bridge helix that inserts deeply between the bases at position +3 and +4, thereby forcing them widely apart (Fig. 3H) and presumably arresting the iPIC on the initial transcription bubble.

[0230] The A23 N-terminal domain exerts a B-reader-like function

[0231] A8 emerges as a TFIIB orthologue / paralogue whose C-terminal cyclin fold takes over similar functionalities as the two cyclin domains of TFIIB. We therefore searched for further functional communalities in the N-terminal part of A8, despite the fact that the A8 NTD lacks sequence homology to TFIIB or other cellular TFs. In TFIIB, the B-reader is the element that is situated adjacent to the N-terminal cyclin domain. During initial transcription, this domain is either displaced by the nascent RNA or, alternatevily, the B-reader displaces the abortive transcript, thus installing a decision mechanism that supports TSS scanning. To elucidate whether parts of the A8 NTD would interfere with the nascent transcript, we superposed the iPIC structure with that of the CCC [3], as this is the closest related vRNAP complex whose structure has so far been solved. The structure of the core superposes with minor coordinate differences for the Ca positions, those are mostly attributable to the “cleft” movement described previously. Also the respective positions of module 1 of the CE and the template strand in the region of the DNA-RNA hybrid overlap well between both structures. We therefore concluded that it is reasonable to evaluate the path of the nascent RNA in the superposed CCC to infer the situation in a putative initially transcribing complex derived from the iPIC (ilTC). In an ilTC, transcription would have commenced, but VITF still be bound. This would lead to a clash between the 310 helix of the A8 NTD and the nascent transcript once the latter reaches a length of roughly 12 bases (Fig. 3J), a situation closely resembling the “decision point” mechanism in the Pol II ITC. We therefore termed the 310 helix and the adjacent residues b-reader- like element (BRLE). In the ilTC, since the A8 NTD anchors module 2 of the CE (Fig.3K), promoter escape would in this way be coupled to displacement of VITF, mobilization of module 2 of the CE and capping of the transcript as the CE would be free to reconfigure to the CCC conformation.

[0232] In vitro transcription assay / inhibitor screen

[0233] Vaccinia virus early RNA polymerase (vRNAP) is purified from infected Hella S3 cells. A derivative of the pSB24 plasmid (Li J., Broyles S.S.J. Biol. Chem., 268 (1993), pp. 2773-2780) is generated that maintains the vaccinia virus early promoter, G-less cassette, but contains the early termination signal by standard genetic manipulation.

[0234] A transcription reaction is prepared in a volume of 25 pl that contains 40mM Tris-HCI, pH 7.9, 1 mM DTT, 2mM spermidine, 6mM MgCI2, 1 mM ATP, 1 mM CTP, 1 mM GTP and, 0.1 mM of UTP, 5pCi of alfa-[P32]-UTP, 80pM SAM and mouse RNAsin, 500 ng Ndel-linearized pSB24 template and 500 ng of purified vRNAP. Inhibitors are dissolved in 35% DMSO and added at a preferred final concentration of 2pM to 100pM to the mixture. The mixture is incubated at 30°C for a typical time period of 15 to 120 min. The resulting RNA transcript is extracted by phenolization, precipitated by addition of 0.1 vols 3M Sodium acetate 2.5-3 vols ice cold 100% Ethanol and incubation at -80°C for 1 h. The air dried pellet is then re-dissolved in RNA sample buffer and applied to a 4% Urea denaturing gel for electrophoresis. It is finally visualized by autoradiography. The transcript band (terminated as well as run-off transcript) is quantitized by densitometry of the developped autoradiography film.

[0235] In silico drug screening

[0236] Materials / Methods

[0237] Pharmacophore models are preferably created with the software MOE and applied with the Pharmit web tool to search the MolPort and ZINC screening libraries. The obtained molecules are followed up in dockings preferably with GOLD and molecular dynamics simulations preferably with the Amber ff14SB force field and subsequent AG calculations using the MM / GBSA approach. Molecular modelling includes molecular docking, molecular dynamics or ADMET modelling. Rescoring for selection of most suitable candidate compounds is carried out with the scoring function DSX (Neudert et al., J. Chem. Inf. Model. 2011 , 51 , 2731).

[0238] Results

[0239] Compounds obtained by structure-based virtual screening to the Vaccinia virus RNA polymerase

[0240] B01 BOZ BO3

[0241] Schematic binding mode of the hit compounds, with directed interactions to binding-site residues of Rpo132 illustrated in brown, to DNA in blue and to RNA in red.

[0242] Table 3. Docking scores of the hit compounds obtained with the scoring function DSX (Neudert et al., J. Chem. Inf. Model. 2011 , 51 , 2731 ), given as total scores (second column) and per-atom- scores (PAS, i.e., total score divided by the number of non-hydrogen-atoms; third column).

Claims

CLAIMS1 . A poxvirus RNA polymerase complex for transcription of a gene under the control of a poxvirus intermediate gene promoter, wherein the complex comprises a core poxvirus RNA polymerase complex, a viral intermediate transcription factor s (VITF-3), and optionally a viral capping enzyme.

2. The poxvirus RNA polymerase complex of claim 1 , wherein the viral capping enzyme comprises D1 and D12.

3. The poxvirus RNA polymerase complex of any one of claims 1 or 2, wherein VITF-3 is a heterodimeric complex comprising VITFs and VITFI .

4. The poxvirus RNA polymerase complex of any one of claims 1 to 3, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30,Rpo22, Rpo19, Rpo18, Rpo7, VITFI, and VITFs.

5. The poxvirus RNA polymerase complex of any one of claims 1 to 4, wherein the poxvirus RNA polymerase complex comprises atoms having at least one atomic coordinate from PDB ID: 8P0K, 8P0N or 8P0J preferably at least 20, more preferably at least 50 and most preferred each of the atomic coordinates. .

6. A minimal poxvirus RNA polymerase complex suitable as a component of the poxivirus RNA polymerase complex of claim 1 , wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7.

7. The minimal poxvirus RNA polymerase complex of claim 6 comprising atoms having at least one atomic coordinate from PDB ID: 9EXN.

8. The poxvirus RNA polymerase complex or any one of claims 1 to 5 or the minimal poxvirus RNA polymerase of claim 6 or 7, wherein the poxvirus is a variola virus or a vaccinia virus.

9. The poxvirus RNA polymerase complex or any one of claims 1 to 5 or the core poxvirus RNA polymerase of any one of claims 6 to 8, wherein the intermediate gene promoter is selected from the promoter of an intermediate gene selected from the group consisting of K2L, K4L, F13L, E6R, E7R, E8R, E11 L, O2L, O3L, 11 L, I5L, I6L, I8R, G4L, G8R, L4R, J1 R, H1 ,L H3L, H7R, D6R, D8L, D10R, D11 L, D13L, A1 L, A2L, A3L, A3L, A6L, A12L, A15L, A16L, A19L, and A22R.

10. A method for purifying the poxvirus RNA polymerase complex of any one of claims 1 to 5 comprising the steps ofa) infecting host cells with a recombinant vaccinia virus encoding a component of the poxvirus RNA polymerase complex of any one of claims 1 to 5 linked to an affinity tag in the presence of cytosine arabinoside; b) lysing the infected cells; c) contacting the lysate with a DNA hybrid comprising at least a portion of an intermediate gene promoter under conditions allowing the formation of a poxvirus RNA polymerase complex / DNA hybrid; d) incubating the poxvirus RNA polymerase complex / DNA hybrid with the complementary partner of the affinity tag bound to a column; e) eluting the bound poxvirus RNA polymerase complex / DNA hybrid; f) purifying the poxvirus RNA polymerase complex by subjecting the eluate to density gradient centrifugation.11 . The method of claim 10, wherein the host cells are selected from HeLa cells.

12. The method of claim 10 or 11 , wherein the recombinant vaccinia virus encodes hemagglutinin / FLAG tag linked to the C-terminus of Rpo132.

13. The method of any one of claims 10 to 12, wherein the affinity tag is selected from histidine tag and FLAG.

14. The method of any one of claims 10 to 13, wherein the non-template strand of the DNA hybrid has the nucleotide sequence set forth in SEQ ID NO: 1 , and the template strand of the DNA hybrid has the nucleotide sequence set forth in SEQ ID NO: 2.

15. A method for preparing 5’-capped RNA comprising incubating a DNA template comprising a coding region under the control of a poxvirus intermediate gene promoter in the presence of nucleotides with (i) the poxvirus RNA polymerase complex of any one of claims 1 to 5 or with (ii) a complete poxvirus RNA polymerase complex, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7, Rap94, NPH-I, VETF-I, D1 , D12, E11 , and tRNA(GLN); and isolating the 5’-capped RNA.

16. A method for screening an inhibitor of a poxvirus RNA polymerase complex comprising the steps of: a) incubating a test compound with the poxvirus RNA polymerase complex of any one of claims 1 to 5 or with a poxvirus RNA polymerase complex selected from:(i) a complete poxvirus RNA polymerase complex, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7, Rap94, NPH-I, VETF-I, D1 , D12, E11 , and tRNA(GLN); and(ii) a complete poxvirus RNA polymerase complex lacking the capping enzyme, wherein the poxvirus RNA polymerase complex consists of Rpo147, Rpo132, Rpo35, Rpo30, Rpo22, Rpo19, Rpo18, and Rpo7, Rap94, NPH-I, VETF-I, E11 , and tRNA(GLN); and b) determining the RNA polymerase activity of the poxvirus RNA polymerase complex in a functional assay, wherein a reduction of the RNA polymerase activity of the poxvirus RNA polymerase is indicative that the test compound is an inhibitor.

17. The method of claim 16, wherein the test compound is a small molecule, a peptide, a nucleic acid or a chemical derivative thereof, or an aptamer.

18. The method of claim 16 or 17, wherein the functional assay is an enzyme assay, preferably an ELISA assay.

19. The method of any one of claims 16 to 18, wherein the assay is an in vitro transcription assay.

20. A method for identifying a candidate compound that binds to a site on a poxvirus RNA polymerase complex, the method comprising: a) providing a three-dimensional structure of a poxvirus RNA polymerase complex having at least one atomic coordinate, or surrogate thereof, from PDB ID: 8P0K, 8P0N, 8P0J, 8C8H, 9EXN and 8RQK for each of the amino acid residues Tyr432, Pro430, Thr428, His429, His431 , Asp710, Lys711 , Val163 and Arg1019 of polypeptide Rpo133; and Pro382, Asp419, Asp417, Asp415 of polypeptide Rpo147 of the RNA polymerase complex; and b) producing a structure for a candidate compound wherein the structure defines a molecule having sufficient surface complementary to the poxvirus RNA polymerase complex to bind the site in an aqueous solution.

21. The method according to claim 20, wheren the method is based on molecular modelling and the software algorithm is installed on a computer.

22. A method for preparing a pharmaceutical composition comprising performing the method of any of claims 16 to 21 thereby obtaining an inhibitor of the poxvirus RNA polymerase complex or candidate compound; and formulating the identified inhibitor or candidate compound with at least one pharmaceutically acceptable excipient.

23. A method for the prophylaxis or treatment of a poxvirus induced disease comprising administering an effective amount of a compound to a patient in need thereof, wherein the compound is selected from any one of (i)or (ii) the compound is selected from any one of fludarabine, adenosine, adrenor, cladribine, azacitidine, epinephrine, epivir, cytarabine, zolmitriptan, levonordefrin, cidofovir, iohexol, iopromide, isovue-M, risedronate, ioxila, risedronate, salpichrolide J, 20-hydroxytubocapsanolide and anabsinthin, or combinations of any of the compounds (i) and / or (ii), preferably, the compound is fludarabine.

24. A compound selected from (i)or (ii) fludarabine, adenosine, adrenor, cladribine, azacitidine, epinephrine, epivir, cytarabine, zolmitriptan, levonordefrin, cidofovir, iohexol, iopromide, isovue-M, risedronate, ioxila, risedronate, salpichrolide J, 20-hydroxytubocapsanolide and anabsinthin, or combinations of any of the compounds (i) and / or (ii) for use in the prophylaxis or treatment of a poxvirus-induced disease.

25. The method of claim 23 or the compound for use of claim 24, wherein the poxvirus-induced disease is selected from smallpox, molluscum contagiosum, and zoonoses selected from sheeppox, swinepox, fowlpox and monkeypox, preferably the poxvirus-induced disease is smallpox.

Citation Information

Patent Citations

  • Vaccinia viral polymerase-mediated viral replication

    WO2021119500A1

  • Chimeric poxviruses

    WO2024038175A1