Method for producing EPA with high yield through schizochytrium limacinum based on random mutation and low-temperature screening and application
By combining Agrobacterium-mediated transformation and low-temperature screening technology with fermentation optimization, the problem of weak EPA synthesis capacity of Schizochytrium was solved, achieving a high-efficiency increase in EPA yield, which is suitable for industrial production.
Patent Information
- Application Number
- CN202511150016.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-18
- Publication Date
- 2025-11-18
AI Technical Summary
In existing technologies, the eicosapentaenoic acid (EPA) synthesis capacity of Schizochytrium is weak, traditional mutagenesis screening techniques are inefficient, and there are problems such as strain physiological heterogeneity and loss of phenotype-genotype association.
The G418 resistance gene was randomly inserted into the genome of Schizochytrium using Agrobacterium-mediated transformation. Combined with low-temperature screening and fermentation optimization, the overexpression of the G418 resistance gene was driven by the P2520 promoter to construct a random insertion mutant library. Low-temperature resistant and well-growing strains were screened in a low-temperature medium containing G418. MgSO4 and MnCl2 were added during fermentation to regulate the fatty acid synthesis pathway.
It significantly increased the EPA yield of Schizochytrium, overcoming the limitations of traditional methods and providing an efficient and controllable technical solution for industrial applications. The EPA yield was 2.19 times higher than that of the wild type.
Smart Images

Figure CN120966922A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial engineering technology, and in particular to a method and application for high production of eicosapentaenoic acid (EPA) by Schizochytrium based on random mutation and low-temperature screening. Background Technology
[0002] Schizochytrium sp., an important non-model organism among marine fungi, is a core strain for the industrial production of ω-3 polyunsaturated fatty acids due to its unique metabolic capabilities. While this microorganism has achieved industrial breakthroughs in the biosynthesis of docosahexaenoic acid (DHA), significant challenges remain in the metabolic engineering research of eicosapentaenoic acid (EPA). Notably, EPA, as an ω-3 polyunsaturated fatty acid, has important applications in cardiovascular disease prevention, neurodevelopment, and anti-inflammation, with continuously growing global market demand. Current technological bottlenecks stem primarily from the relatively weak endogenous EPA synthesis capacity of Schizochytrium (<5% of total lipid content). Its carbon flux allocation is cascaded and regulated by key nodes such as acetyl-CoA carboxylase and fatty acid synthase, and the fatty acid elongation mechanism competes metabolically with DHA synthesis. Traditional mutagenesis screening techniques are limited by strain physiological heterogeneity and the lack of phenotypic-genotypic association, resulting in low genetic improvement efficiency and lengthy development cycles. Therefore, there is an urgent need to develop novel and efficient screening technologies.
[0003] To address the above problems, this invention proposes a three-pronged experimental approach: random mutation, low-temperature screening, and fermentation optimization.
[0004] G418 is an aminoglycoside antibiotic that blocks protein synthesis by inhibiting the function of the eukaryotic 80S ribosome. Its selection mechanism relies on the expression of the nptII gene, which encodes an aminoglycoside phosphotransferase that converts G418 into a non-toxic metabolite. The nptII gene, along with a randomly inserted fragment, is co-transformed into Schizochytrium protoplasts via Agrobacterium-mediated transformation or electroporation. After the exogenous gene is randomly inserted into the genome, the transformants survive in a medium containing a certain concentration of G418. This method significantly improves mutation diversity compared to homologous recombination and does not rely on specific gene loci, making it suitable for the regulation and optimization of complex metabolic networks.
[0005] EPA synthesis in Schizochytrium is regulated by a low-temperature stress-induced response. Studies have shown that 15°C treatment activates cold shock protein (CSP) and fatty acid desaturase (FAD) pathways, promoting EPA precursor accumulation. Combining low-temperature induction with G418 selection creates dual selection pressure; G418 resistance selection yields genome-stable integrated mutants, while low-temperature selection enriches strains with metabolically advantageous phenotypes, thus identifying high-EPA-producing Schizochytrium strains.
[0006] Studies have shown that Mg2+ By binding to cell membrane phospholipids, it maintains membrane fluidity and ensures the activity of fatty acid transport proteins (such as FATP); simultaneously, as a cofactor of GTPases, it participates in the activation of acetyl-CoA carboxylase (ACC), promoting the generation of malonyl-CoA (a key precursor for EPA synthesis). 2+ By competitively inhibiting the activity of Δ4-desaturase, the production of DHA (22:6Δ4,7,10,13,16,19) is reduced, thereby releasing more metabolic flux for the synthesis of EPA.
[0007] This invention enables Schizochytrium to efficiently produce EPA through the synergistic effect of random gene insertion, low-temperature induction, and fermentation optimization, thus providing a methodological reference for the development of high-value metabolites from other strains. Summary of the Invention
[0008] The purpose of this invention is to overcome the shortcomings of the prior art and provide a method and application for high EPA production by Schizochytrium based on random mutation and low-temperature screening.
[0009] The technical solution adopted by this invention to solve its technical problem is:
[0010] A method for high-yield eicosapentaenoic acid (EPA) production by Schizochytrium based on random mutation and low-temperature screening is disclosed. The method involves randomly inserting the exogenous gene G418 into the genome of Schizochytrium using Agrobacterium-mediated transformation, thereby enabling Schizochytrium to acquire the function of introducing G418. The transformed cells are then uniformly spread on a plate containing resistant G418, and the plate is placed at low temperature for screening. Larger single colonies are selected for fermentation verification, and fermentation optimization is combined to obtain a high-EPA-producing Schizochytrium strain.
[0011] Furthermore, it includes the following steps:
[0012] (a) By driving the overexpression of the G418 resistance gene through the P2520 promoter, a library of random insertion mutants was constructed, and Schizochytrium mutants with random genomic mutations were screened to obtain them.
[0013] (b) The mutant strain was spread on a medium containing G418 resistance and cultured. Strains that were resistant to low temperature and had good growth were screened at 15°C.
[0014] (c) The selected strains were inoculated into the fermentation medium. 0.1% MgSO4 was added at the beginning of fermentation and 0.05% MnCl2 was added at 72 hours of fermentation. The fermentation time was 120 hours to obtain a Schizochytrium mutant strain that produced high EPA.
[0015] Further, the overexpression of the G418 resistance gene described in step (a) is based on pZPK, with the promoter P2520 and terminator T2520 of Schizochytrium HX308 inserted, and the G418 resistance gene NeoR inserted between the promoter and terminator.
[0016] The sequence of promoter P2520 is shown in SEQ ID NO.2, the sequence of terminator T2520 is shown in SEQ ID NO.3, and the sequence of G418 resistance gene NeoR is shown in SEQ ID NO.4.
[0017] Further, in step (b), the concentrations of G418 in the solid culture medium containing G418 resistance are 400 ug / ml, 600 ug / ml, and 800 ug / ml, respectively.
[0018] Furthermore, the initial pH of the fermentation medium in step (c) is 6.0-7.0, the culture temperature is 28°C, and the rotation speed is 200-300 rpm.
[0019] Furthermore, in the fermentation process described in step (c), MgSO4 is added at the beginning of fermentation, and MnCl2 is added after 72 hours of fermentation.
[0020] Furthermore, the specific steps are as follows:
[0021] (1) Construction and transformation of recombinant plasmid pZPK-P2520-G418-T2520:
[0022] Using pZPK as a backbone, the promoter P2520 and terminator T2520 of Schizochytrium HX308 were inserted, and the G418 resistance gene NeoR was inserted between the promoter and terminator to obtain the recombinant plasmid pZPK-P2520-NeoR-T2520; the complete sequence of the G418 resistance gene expression cassette is shown in SEQ ID NO.1; transformation was performed using Agrobacterium-mediated transformation to induce random mutations in the Schizochytrium genome;
[0023] (2) Low-temperature screening of Schizochytrium mutant strains:
[0024] After Agrobacterium transforms Schizochytrium, 1) transformants growing on solid medium containing 400 μg / mL G418 were selected with sterile toothpicks and transferred to solid medium containing 600 μg / mL G418. The culture temperature was 28℃ and the culture time was 48h; 2) transformants on solid medium containing 600 μg / mL G418 were selected again and transferred to solid medium containing 800 μg / mL G418.
[0025] First, the solid culture medium in step 2) was placed at 28°C and cultured for 24 hours; then, it was transferred to 15°C and cultured for 48 hours to induce the metabolic pathway to EPA synthesis; finally, it was transferred to 28°C and continued to grow for 24 hours, and the single colony with the best growth in the solid culture medium was screened for fermentation verification.
[0026] (3) Fermentation optimization of Schizochytrium mutant strain
[0027] 1) Use a sterile pipette tip to pick up a single colony with good growth in the solid culture medium, inoculate it into the seed culture medium at an inoculation rate of 4%, and incubate it in a shaker at 28℃ and 200rpm for 48h to obtain the first generation seed.
[0028] 2) After microscopic examination and finding no contamination, the first-generation seeds obtained in step 1) were inoculated into the seed culture medium at an inoculation rate of 4% and cultured at 28℃ and 200rpm for 24h to obtain second-generation seeds.
[0029] 3) After microscopic examination and finding no bacterial contamination, the second-generation seeds obtained in step 2) were inoculated into the seed culture medium at an inoculation rate of 4% and cultured at 28°C and 200 rpm for 24 hours to obtain third-generation seeds.
[0030] 4) After microscopic examination of the third-generation seeds from step 3) showed no contamination, they were transferred to a fermentation medium for fermentation culture to produce EPA.
[0031] In step 4), MgSO4 with a final mass concentration of 0.1% was added to the third-generation seeds at the beginning of fermentation, and MnCl2 with a final mass concentration of 0.05% was added after 72 hours of fermentation.
[0032] Furthermore, the solid culture medium is formulated as follows: 7 g / L peptone, 7 g / L yeast extract, 60 g / L glucose, 15 g / L sea salt, 3% agar powder, 5% glycerol, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages.
[0033] The seed culture medium is formulated as follows: 50 g / L glucose, 15 g / L sodium chloride, 4 g / L yeast powder, 3 g / L potassium sulfate, 0.5 g / L potassium chloride, 15 g / L monosodium glutamate, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages.
[0034] The fermentation medium is formulated as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast powder 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, 0.3 g / L choline chloride, 10 μM abscisic acid, 20 g / L glycerol, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages.
[0035] Furthermore, the EPA content of the high-EPA-producing Schizochytrium mutant strain is at least 1.04 g / L.
[0036] Application of the Schizochytrium mutant strain obtained by the method described above in EPA industrial production.
[0037] The advantages and positive effects of this invention are as follows:
[0038] 1. This invention involves randomly inserting the G418 resistance gene carried by a plasmid into the genome of Schizochytrium, combined with low-temperature induction screening, to overcome the target limitations of traditional homologous recombination and enrich stable strains with multiple mutations.
[0039] 2. This invention precisely regulates the fatty acid synthesis pathway by adding magnesium and manganese ions in stages, thereby achieving synergistic growth in EPA yield and biomass.
[0040] 3. The low-temperature induction screening method in this invention does not require long-term use of antibiotics, avoids the risk of drug resistance gene spread, and reduces the cost of production waste liquid treatment. Therefore, the method provided by this invention has extremely high application potential.
[0041] 4. This invention relates to a method and application for high EPA (eicosapentaenoic acid) production from Schizochytrium based on a three-pronged approach of "random mutation-low temperature screening-fermentation optimization". This method involves overexpressing the G418 resistance gene driven by the P2520 promoter to construct a random integration mutant library. Strains with randomly mutated genomes are obtained through G418 resistance plate screening. Subsequently, mutant strains that are tolerant to low temperatures and exhibit good growth are screened at 15℃. Finally, through fermentation process optimization, 0.1% MgSO4 is added at the initial stage of fermentation, and 0.05% MnCl2 is added after 72 hours of fermentation. This results in a 2.19-fold increase in EPA yield compared to the wild type (0.49 g / L) after batch feeding fermentation in a 5L fermenter, significantly improving the EPA accumulation efficiency of Schizochytrium.
[0042] 5. This invention overcomes the limitations of traditional single mutagenesis methods through a multi-stage synergistic regulation strategy, providing an efficient and controllable technical solution for the industrial application of high EPA production by Schizochytrium, and offering a new method and effective approach for the efficient production of EPA by Schizochytrium. Attached Figure Description
[0043] Figure 1 This is a structural diagram of the recombinant plasmid pZPK-P2520-G418-T2520 in this invention; wherein, P2845 is the promoter, T2845 is the terminator, and NeoR represents the resistance gene of G418;
[0044] Figure 2 The image shows the fermentation results of adding different concentrations of MgSO4 at 0 h of fermentation in this invention.
[0045] Figure 3 The image shows the fermentation results of adding different concentrations of MnCl2 after 72 hours of fermentation in this invention.
[0046] Figure 4 This is a comparison chart of the oil content and biomass between the control group and the experimental group in this invention;
[0047] Figure 5 This is a comparison chart of EPA content between the control group and the experimental group in this invention. Detailed Implementation
[0048] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.
[0049] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.
[0050] A method for high-yield eicosapentaenoic acid (EPA) production by Schizochytrium based on random mutation and low-temperature screening is disclosed. The method involves randomly inserting the exogenous gene G418 into the genome of Schizochytrium using Agrobacterium-mediated transformation, thereby enabling Schizochytrium to acquire the function of introducing G418. The transformed cells are then uniformly spread on a plate containing resistant G418, and the plate is placed at low temperature for screening. Larger single colonies are selected for fermentation verification, and fermentation optimization is combined to obtain a high-EPA-producing Schizochytrium strain.
[0051] Preferably, the steps include:
[0052] (a) By driving the overexpression of the G418 resistance gene through the P2520 promoter, a library of random insertion mutants was constructed, and Schizochytrium mutants with random genomic mutations were screened to obtain them.
[0053] (b) The mutant strain was spread on a medium containing G418 resistance and cultured. Strains that were resistant to low temperature and had good growth were screened at 15°C.
[0054] (c) The selected strains were inoculated into the fermentation medium. 0.1% MgSO4 was added at the beginning of fermentation and 0.05% MnCl2 was added at 72 hours of fermentation. The fermentation time was 120 hours to obtain a Schizochytrium mutant strain that produced high EPA.
[0055] Preferably, the overexpression of the G418 resistance gene in step (a) is based on pZPK, with the promoter P2520 and terminator T2520 of Schizochytrium HX308 inserted into the backbone, and the G418 resistance gene NeoR inserted between the promoter and terminator.
[0056] The sequence of promoter P2520 is shown in SEQ ID NO.2, the sequence of terminator T2520 is shown in SEQ ID NO.3, and the sequence of G418 resistance gene NeoR is shown in SEQ ID NO.4.
[0057] Preferably, the concentration of G418 in the solid culture medium containing G418 resistance in step (b) is 400 ug / ml, 600 ug / ml, and 800 ug / ml, respectively.
[0058] Preferably, the initial pH of the fermentation medium in step (c) is 6.0-7.0, the culture temperature is 28°C, and the rotation speed is 200-300 rpm.
[0059] Preferably, in the fermentation process described in step (c), MgSO4 is added at the beginning of fermentation, and MnCl2 is added after 72 hours of fermentation.
[0060] Preferably, the specific steps are as follows:
[0061] (1) Construction and transformation of recombinant plasmid pZPK-P2520-G418-T2520:
[0062] Using pZPK as a backbone, the promoter P2520 and terminator T2520 of Schizochytrium HX308 were inserted, and the G418 resistance gene NeoR was inserted between the promoter and terminator to obtain the recombinant plasmid pZPK-P2520-NeoR-T2520; the complete sequence of the G418 resistance gene expression cassette is shown in SEQ ID NO.1; transformation was performed using Agrobacterium-mediated transformation to induce random mutations in the Schizochytrium genome;
[0063] (2) Low-temperature screening of Schizochytrium mutant strains:
[0064] After Agrobacterium transforms Schizochytrium, 1) transformants growing on solid medium containing 400 μg / mL G418 were selected with sterile toothpicks and transferred to solid medium containing 600 μg / mL G418. The culture temperature was 28℃ and the culture time was 48h; 2) transformants on solid medium containing 600 μg / mL G418 were selected again and transferred to solid medium containing 800 μg / mL G418.
[0065] First, the solid culture medium in step 2) was placed at 28°C and cultured for 24 hours; then, it was transferred to 15°C and cultured for 48 hours to induce the metabolic pathway to EPA synthesis; finally, it was transferred to 28°C and continued to grow for 24 hours, and the single colony with the best growth in the solid culture medium was screened for fermentation verification.
[0066] (3) Fermentation optimization of Schizochytrium mutant strain
[0067] 1) Use a sterile pipette tip to pick up a single colony with good growth in the solid culture medium, inoculate it into the seed culture medium at an inoculation rate of 4%, and incubate it in a shaker at 28℃ and 200rpm for 48h to obtain the first generation seed.
[0068] 2) After microscopic examination and finding no contamination, the first-generation seeds obtained in step 1) were inoculated into the seed culture medium at an inoculation rate of 4% and cultured at 28℃ and 200rpm for 24h to obtain second-generation seeds.
[0069] 3) After microscopic examination and finding no bacterial contamination, the second-generation seeds obtained in step 2) were inoculated into the seed culture medium at an inoculation rate of 4% and cultured at 28°C and 200 rpm for 24 hours to obtain third-generation seeds.
[0070] 4) After microscopic examination of the third-generation seeds from step 3) showed no contamination, they were transferred to a fermentation medium for fermentation culture to produce EPA.
[0071] In step 4), MgSO4 with a final mass concentration of 0.1% was added to the third-generation seeds at the beginning of fermentation, and MnCl2 with a final mass concentration of 0.05% was added after 72 hours of fermentation.
[0072] Preferably, the solid culture medium is formulated as follows: 7 g / L peptone, 7 g / L yeast extract, 60 g / L glucose, 15 g / L sea salt, 3% agar powder, 5% glycerol, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages.
[0073] The seed culture medium is formulated as follows: 50 g / L glucose, 15 g / L sodium chloride, 4 g / L yeast powder, 3 g / L potassium sulfate, 0.5 g / L potassium chloride, 15 g / L monosodium glutamate, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages.
[0074] The fermentation medium is formulated as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast powder 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, 0.3 g / L choline chloride, 10 μM abscisic acid, 20 g / L glycerol, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages.
[0075] Preferably, the EPA content of the high-EPA-producing Schizochytrium mutant strain is at least 1.04 g / L.
[0076] Application of the Schizochytrium mutant strain obtained by the method described above in EPA industrial production.
[0077] The culture media used in the following examples are as follows:
[0078] The solid culture medium consists of: 7 g / L peptone, 7 g / L yeast extract, 60 g / L glucose, 15 g / L sea salt, 3% agar powder, 5% glycerol, and the remainder is pure water, adjusted to pH 6.0-7.0; all percentages are by mass.
[0079] The seed culture medium consists of: 50 g / L glucose, 15 g / L sodium chloride, 4 g / L yeast powder, 3 g / L potassium sulfate, 0.5 g / L potassium chloride, 15 g / L monosodium glutamate, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, with the remainder being pure water, adjusted to pH 6.0-7.0; all percentages mentioned above are mass percentages.
[0080] The fermentation medium consists of: 100 g / L glucose, 20 g / L sodium chloride, 8 g / L yeast extract, 1 g / L magnesium sulfate heptahydrate, 3 g / L potassium sulfate, 0.5 g / L potassium chloride, 0.5 g / L calcium chloride, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, 0.3 g / L choline chloride, 10 μM abscisic acid, 20 g / L glycerol, with the remainder being pure water, adjusted to pH 6.0-7.0; all percentages are by mass.
[0081] The technical solution adopted by this invention to solve its technical problem is as follows: The exogenous gene G418 is randomly inserted into the genome of *Schizochytridum* using Agrobacterium-mediated transformation, enabling *Schizochytridum* to acquire the function of introducing G418. The transformed cells are uniformly spread on a plate containing a certain level of resistant G418, and the plate is placed at low temperature for screening. Larger single colonies are selected for fermentation verification, and fermentation optimization is combined to obtain a high-EPA-producing *Schizochytridum* strain.
[0082] Specifically, the *Schizochytrium* sp. HX308 has the accession number CCTCC No. M209059. This strain has been deposited at the China Center for Type Culture Collection (CCTCC) and has been published in Chinese invention patent number 201510417269.4.
[0083] As a preferred embodiment, the present invention proposes a three-pronged experimental method of "random mutation-low temperature screening-fermentation optimization," which specifically includes the following steps:
[0084] 1. Construction and transformation of recombinant plasmid pZPK-P2520-G418-T2520:
[0085] Using pZPK as a backbone, the promoter P2520 (as shown in sequence SEQ ID NO. 2) and terminator T2520 (as shown in sequence SEQ ID NO. 3) of Schizochytrium HX308 were inserted, and the G418 resistance gene NeoR (as shown in sequence SEQ ID NO. 4) was inserted between the promoter and terminator to obtain the recombinant plasmid pZPK-P2520-NeoR-T2520. The complete sequence of the G418 resistance gene expression cassette (in Example 1, the NeoR fragment was amplified by PCR, the vector pZPK was digested by enzyme digestion, and then the fragment and the vector backbone were ligated using ToloBio's 37℃ ligase to form this gene expression cassette, which was then transformed using Agrobacterium-mediated transformation to cause random mutations in the Schizochytrium genome) is shown in sequence SEQ ID NO. 1. Reference patent: CN 114426985 B. Transformation using Agrobacterium-mediated transformation to cause random mutations in the Schizochytrium genome. Figure 1 As shown.
[0086] 2. Low-temperature screening of Schizochytrium mutant strains:
[0087] After Agrobacterium transforms Schizochytrium, (1) transformants growing on solid medium containing 400 ug / mL G418 are selected with a sterile toothpick and transferred to solid medium containing 600 ug / mL G418. The culture temperature is 28℃ and the culture time is 48h; (2) transformants on solid medium containing 600 ug / mL G418 are selected and transferred to solid medium containing 800 ug / mL G418.
[0088] First, the solid culture medium in (2) was placed at 28°C and cultured for 24 hours; then, it was transferred to 15°C and cultured for 48 hours to induce the metabolic pathway to EPA synthesis; finally, it was transferred to 28°C and continued to grow for 24 hours, and the single colony with the best growth in the solid culture medium was screened for fermentation verification.
[0089] 3. Fermentation optimization of Schizochytrium mutant strain
[0090] (1) Use a sterile pipette tip to pick up a single colony with good growth in the solid culture medium, inoculate it into a test tube containing 2 mL of seed culture medium, and incubate it in a shaker at 28℃ and 200 rpm for 48 h to obtain a first generation seed.
[0091] (2) After microscopic examination of the first-generation seeds obtained in step (1) showed no bacterial contamination, the seeds were inoculated into a seed culture medium containing 50 mL of seed culture medium and cultured again to obtain second-generation seeds.
[0092] (3) After microscopic examination of the second-generation seeds obtained in step (2) showed no bacterial contamination, the seeds were inoculated into a seed culture medium containing 50 mL of seed culture medium and cultured again to obtain third-generation seeds.
[0093] (4) After the third generation seeds from step (3) were examined under a microscope and found to be free of contamination, they were transferred to a culture medium containing 100 mL of fermentation medium for fermentation to produce EPA.
[0094] Preferably, in step (1), the inoculum amount of activated bacteria is 4% (v / v), and the culture is carried out at 28°C and 200 rpm for 48 h to obtain the first generation seed;
[0095] In step (2), the inoculation amount of the first generation seeds is 4% (v / v), and the second generation seeds are obtained by culturing at 28℃ and 200rpm for 24h.
[0096] In step (3), the inoculation amount of the second-generation seeds is 4% (v / v), and the third-generation seeds are obtained by culturing at 28℃ and 200rpm for 24h.
[0097] In step (4), the third-generation seeds cultured to the exponential stage were given 0, 0.05%, 0.1%, 0.15%, and 0.2% MgSO4 at the beginning of fermentation. After 72 hours of fermentation, MnCl2 was added at the final concentrations of 0, 0.025%, 0.05%, 0.075%, and 0.1%.
[0098] 4. After fermentation, the extraction of oils and other substances shall be carried out in accordance with the following steps:
[0099] (1) Accurately measure the amount of fermentation broth, adjust the pH to 10-11 with 5 mol / L sodium hydroxide aqueous solution, mix well, and then add 0.3% of the cell wall breaking enzyme by volume of the fermentation broth. Incubate at 50℃ for 5 hours until the cells are completely digested.
[0100] (2) Add anhydrous ethanol at a ratio of 1:1 to the volume of the fermentation broth to precipitate the protein;
[0101] (3) Add hexane in a 1:1 ratio of fermentation liquid volume, shake well, let stand to separate into layers, take the upper organic phase and place it in a pre-weighed and dry round-bottom conical flask, wash with hexane about 3 times until the upper organic phase is colorless and transparent.
[0102] (4) The obtained upper liquid is rotary evaporated. Before rotary evaporation, the rotary evaporation flask is weighed and recorded. Rotary evaporation is carried out at 40°C until no more condensed water drips.
[0103] (5) After rotary steaming, place it in an oven to dry the excess moisture to a constant weight;
[0104] 5. After extracting the oil, methylate the oil according to the following steps (in preparation for gas chromatography):
[0105] (1) Add 0.6 mL of 1 M potassium hydroxide methanol solution to a 2 mL centrifuge tube, and add 20 μL of the obtained oil to it and mix well;
[0106] (2) The mixture was shaken at 1500 rpm for 7 hours at room temperature. The reaction was terminated by adding 50 μL of concentrated sulfuric acid.
[0107] (3) Add 1 mL of n-hexane for extraction, and shake at 1500 rpm for 1 h;
[0108] (4) Then centrifuge at 12000 rpm for 5 min, take the upper n-hexane phase, filter to remove impurities, and then detect by gas chromatography.
[0109] Specifically, the relevant preparation and testing methods are as follows:
[0110] Example 1: Construction and transformation of recombinant plasmid pZPK-P2520-G418-T2520
[0111] Based on the sequences obtained from genome sequencing, corresponding primers were designed. The P2520-F / R and T2520-F / R sequences are shown in Table 1. Using the Schizochytrium HX308 genome as a template, PCR amplification was performed using the above primers to obtain the corresponding promoter P2520 and terminator T2520 fragments.
[0112] The resistance gene NeoR of G418 has the sequence shown in SEQ ID NO.4. Primers NeoR-F / R were designed based on the NeoR sequence (see Table 1), and the pZPK plasmid (SunW, Yang X, Wang X, ...) was used.
[0113] Using the template of Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation[J]. Biotechnology Letters, 2017, 39(7): 1001-1007, the primer pair was used for PCR amplification to obtain the corresponding DNA fragment of the G418 resistance gene NeoR (the 2X PrimeSTAR Max Premix purchased from TaKaRa was used in this invention). After PCR, the gel was excised and the fragment was verified by electrophoresis. The amplified promoter P2520, terminator T2520 and linear fragment of the G418 resistance gene NeoR were confirmed.
[0114] Table 1 Primer sequences
[0115] P2520-F AATTAACGCCGAATTGAATTGCAACCAAAGCAACCAGAGCAAC P2520-R AATCCATCTTGTTCAATCATTGTTCCTGCTGCTGCTG T2520-F TTCTTGACGAGTTCTTCTGAAAAGTCGCACGCGAGCTTTT T2520-R TGCTGCAGGTCGACTCTAGACGATAAGGCTACCCTAGAGCAGTATGC NeoR-F CAGCAGCAGCAGCAGGAACAATGATTGAACAAGATGGATTGCAC NeoR-R AAAAGCTCGCGTGCGACTTTTCAGAAGAACTCGTCAAGAAGG
[0116] pZPK was digested with HindIII, and the linearized plasmid fragment was obtained. The linearized plasmid fragment was then co-incubated with the amplified promoter P2520, terminator T2520 and G418 resistance gene NeoR. The recombinant plasmid pZPK-P2520-NeoR-T2520 was constructed using ToloBio's 37°C ligase.
[0117] The constructed recombinant plasmid pZPK-P2520-NeoR-T2520 was transformed using the Agrobacterium transformation method according to patent CN114426985B, resulting in random mutations in the Schizochytrium genome.
[0118] Example 2: Low-temperature screening of Schizochytrium mutant strains:
[0119] After Agrobacterium transforms Schizochytrium, (1) transformants growing on solid medium containing 400 ug / mL G418 are selected with a sterile toothpick and transferred to solid medium containing 600 ug / mL G418. The culture temperature is 28℃ and the culture time is 48h; (2) transformants on solid medium containing 600 ug / mL G418 are selected and transferred to solid medium containing 800 ug / mL G418.
[0120] First, the solid culture medium in (2) was placed at 28°C and cultured for 24 hours; then, it was transferred to 15°C and cultured for 48 hours to induce the metabolic pathway to EPA synthesis; finally, it was transferred to 28°C and continued to grow for 24 hours, and 5 single colonies with good growth in the solid culture medium were screened for fermentation verification.
[0121] Example 3: Fermentation optimization of Schizochytrium mutant strain
[0122] (1) Use a sterile pipette tip to pick up a single colony with good growth in the solid culture medium, inoculate it into a test tube containing 2 mL of seed culture medium, and incubate it in a shaker at 28℃ and 200 rpm for 48 h to obtain a first generation seed.
[0123] (2) After microscopic examination of the first-generation seeds obtained in step (1) showed no bacterial contamination, the seeds were inoculated into a seed culture medium containing 50 mL of seed culture medium and cultured again to obtain second-generation seeds.
[0124] (3) After microscopic examination of the second-generation seeds obtained in step (2) showed no bacterial contamination, the seeds were inoculated into a seed culture medium containing 50 mL of seed culture medium and cultured again to obtain third-generation seeds.
[0125] (4) After the third generation seeds from step (3) were examined under a microscope and found to be free of contamination, they were transferred to a culture medium containing 100 mL of fermentation medium for fermentation to produce EPA.
[0126] In step (1), the inoculum amount of activated bacteria is 4% (v / v, volume ratio), and it is cultured at 28℃ and 200rpm for 48h to obtain first-generation seed;
[0127] In step (2), the inoculation amount of the first generation seeds is 4% (v / v, volume ratio), and the second generation seeds are obtained by culturing at 28℃ and 200rpm for 24h.
[0128] In step (3), the inoculation amount of the second-generation seeds is 4% (v / v, volume ratio), and the third-generation seeds are obtained by culturing at 28℃ and 200rpm for 24h.
[0129] In step (4), the third-generation seeds cultured to the exponential stage were given (0, 0.05%, 0.1%, 0.15%, 0.2%) MgSO4 at the beginning of fermentation. After fermentation for 72 hours, (0, 0.025%, 0.05%, 0.075%, 0.1%) MnCl2 was added and fermentation continued for 120 hours. All percentages are mass percentages (w / v).
[0130] After fermentation, the extraction of oils and other substances is carried out according to the following steps:
[0131] (1) Accurately pipette a quantitative amount of fermentation broth into a bottle with a stopper, adjust the pH to 10-11 with 5 mol / L sodium hydroxide aqueous solution, mix well, and then add 0.3% of the volume of cell-breaking enzyme in the fermentation broth. Incubate at 50℃ for 5 hours until the cells are completely digested.
[0132] (2) Add anhydrous ethanol at a ratio of 1:1 to the volume of the fermentation broth to precipitate the protein;
[0133] (3) Add hexane in a 1:1 ratio of fermentation liquid volume, shake well, let stand to separate into layers, take the upper organic phase and place it in a pre-weighed and dry round-bottom conical flask, wash with hexane about 3 times until the upper organic phase is colorless and transparent.
[0134] (4) The obtained upper liquid was extracted by rotary evaporation. Before rotary evaporation, the rotary evaporation flask was weighed and M1 was recorded. Rotary evaporation was carried out at 40°C until no more condensed water dripped.
[0135] (5) After rotary evaporation, place the product in an oven to dry excess moisture to a constant weight M2. Then the oil content is M = M2 - M1.
[0136] After oil extraction, the oil is methylated according to the following steps (in preparation for gas chromatography):
[0137] (1) Add 0.6 mL of 1 M potassium hydroxide methanol solution to a 2 mL centrifuge tube, and add 20 μL of the obtained oil to it and mix well;
[0138] (2) The mixture was shaken at 1500 rpm for 7 hours at room temperature. The reaction was terminated by adding 50 μL of concentrated sulfuric acid.
[0139] (3) Add 1 mL of n-hexane for extraction, and shake at 1500 rpm for 1 h;
[0140] (4) Then centrifuge at 12000 rpm for 5 min, take the upper n-hexane phase, filter it through an organic filter membrane to remove impurities, add it to a gas chromatograph, and then perform gas chromatography detection. Gas chromatography test method: Gas chromatography analysis conditions: Use DB-23 (60m*0.25mm*0.25μm) column; select FID detector; use high-purity nitrogen as carrier gas; split ratio of 30 / 1; set the injection port temperature to 250℃; set the detector temperature to 280℃; injection volume of 1μL; temperature program: at the beginning of the program, the gas chromatography column temperature is set to 100℃, and the program first increases to 196℃ at a rate of 25℃ / min. Then, the program increases to 220℃ at a rate of 2℃ / min and holds at 220℃ for 12 min. The gas column flow rate is set to 3.0 mL / min; the tail purge flow rate is set to 30 mL / min; the hydrogen flow rate is 40 mL / min and the air flow rate is set to 400 mL / min.
[0141] Biomass determination: Take 2 mL of fermentation broth fermented for 120 h, centrifuge at 4000 rpm for 5 min, discard the supernatant, wash once with 2 mL of 1 mol / L sorbitol solution, dry at 110 °C to constant weight, and finally weigh and calculate.
[0142] EPA standard samples were prepared to obtain the standard curve equation, and the EPA yield was calculated based on the gas chromatogram analysis results.
[0143] Fermentation time was 120 h. After fermentation, the EPA content of mutant strains with different concentrations of MgSO4 and MnCl2 was measured, and the results are as follows: Figure 2 and Figure 3 As shown, the EPA content of the five selected mutant strains was higher than that of the wild-type strain. The mutant strain with the highest EPA yield showed that when 0.1% MgSO4 was added at the start of fermentation, the EPA content reached 1.17 g / L, which was 2.54 times that of the control group (0.46 g / L). When 0.05% MnCl2 was added after 72 hours of fermentation, the EPA content of the mutant strain reached 1.04 g / L, which was 2.26 times that of the control group (0.46 g / L). Therefore, this technique can provide a new approach for the efficient production of EPA from Schizochytrium.
[0144] The mutagenic strain was treated with (0, 0.05%, 0.1%, 0.15%, 0.2%) MgSO4 at the initial stage of fermentation. Figure 2 It was found that 0.1% MgSO4 could achieve a high EPA yield; the mutagenized strain could achieve a high EPA yield by adding 0.05% MnCl2 at a final mass concentration after 72 hours of fermentation. Therefore, the correctness of the addition amount and timing of MgSO4 and MnCl2 was demonstrated. In Example 4, the two were combined for fed-batch fermentation culture in a 5L fermenter.
[0145] Example 4: Feed-in batch fermentation culture of Schizochytrium mutant strain in a 5L fermenter
[0146] The seed culture of the mutant strain of Schizochytrium (prepared in the same way as the preparation of the third-generation seeds obtained in step (3) of Example 3) was inoculated into a 5L fermenter at an inoculation rate of 10% (v / v, volume percentage). The fermenter was filled with fermentation medium. At the beginning of fermentation, 0.1% MgSO4 was added. After 72 hours of fermentation, 0.05% MnCl2 was added. Fermentation was continued for 120 hours at 28°C and 300 rpm. The results were as follows. Figure 4 , Figure 5As shown in the figure. The results showed that adding 0.1% MgSO4 at the start of fermentation and 0.05% MnCl2 at 72 h of fermentation resulted in a biomass of 138 g / L, an oil content of 64.6 g / L, and an EPA yield of 1.22 g / L for the mutant strain in a 5 L fermenter. These values were significantly higher than those of the original strain, being 1.13 times, 1.18 times, and 2.46 times higher, respectively.
[0147] In patent CN118755584A, EPA is produced by culturing Schizochytrium at 20°C, which is close to the optimal growth temperature range for Schizochytrium. Patent CN116203166A uses temperature control (28°C to 34°C) combined with an exogenous inhibitor, iodoacetamide, to identify the specific synthetic pathway for EPA production by Schizochytrium.
[0148] In patent CN114164122A, the invention screened a fissuriycidae that produces high levels of EPA by ion beam implantation and ultraviolet-lithium chloride combined mutagenesis.
[0149] In patent CN106947706A, strains were screened under conditions of 18-25℃ and 180-250rpm to achieve the co-production of EPA and DHA.
[0150] In this patent, Schizochytrium is cultured at 15°C, which is a low-temperature stress environment. This environment can act as a signal to activate regulatory pathways in Schizochytrium related to stress adaptation and the synthesis of specific substances, thereby prompting more resources to be directed toward EPA synthesis in response to environmental changes.
[0151] The sequences used in this invention are as follows:
[0152] SEQ ID NO.1 (Complete sequence of G418 resistance gene expression cassette):
[0153] GCAACCAAAGCAACCAGAGCAACAAACAAACAAACACACAACAAACAAACAAACA
[0154] AACAAACAAACAAAGAACGCAACGCAGCTGCAGACGCGGCGGGCAGCGCTTGCGTCA
[0155] GAGCGTACGCGCGGGAGCGGTACCGTACGTAGGCGGCCGCGGCGAAGATCTCGGGTGC
[0156] CGTCGTCGGCGGTGTCGGATTCCAGGCTCCATCCAGCCAGCCAGGCACCTGCACCTACC
[0157] TATCTCGCCCGGACTCGCGGCCGCGAGCGCAGGACGGACGCCCGCCCCGCCGGAGGGA
[0158] GAGGCAAGGAGGGAGGGAGGGAGGGAGGGAGGGAGGAACGCGAGCGGAGGGAGCG
[0159] ACGGCGCCGCGCTGACGAGACGCGGAGGCTGCCCCTGGCGTAGTGTATCTATCTCTCTA
[0160] TCGGTCGGTCATCGATCCCAAGCGCATCCTCGCGTTTCATTTTCCATTCTTTCATTTGTCG
[0161] ATTCATCGCCCACCGGGGGCGACACGGCACCTACGCACCCCTCGCGGAGATTGCATCGC
[0162] AGCGCATCATACATACCGCCCCGCCTCGCATCACATCGCATCGCATCGCATCGCGGCGTG
[0163] GCGTGGCGTGGCGTGGCGCAAGAGGTGTGACCCAGGCAGGCAAGGCAGGCAAGCAAG
[0164] CAAGCAAAAGCAGGGCCCACACTAAGCCCACCAGGGGCTGACGGAGGAAGAAGGGAG
[0165] GGGAAGAAAGGCGGGCTGAGAGCAGCCGCCAGCGCAGACCAAACCCCCAATCGGAAC
[0166] ATCCGCTGCCACGGACGCACGCGGACTACGCAGGCAGCCAGACAGGAAGGCAGGCAG
[0167] GCCGGCCGAGCGAGCGAGCGAACCCCCAAGCGCAGCAAACCTGCAGCCGTCTCCGGC
[0168] AGCAGCAGCACAGCAACAACAACAACAACAACAACAACAACAACAAGAGCGGCAGC
[0169] ACAAGCCTTGTGCACCGCGTACAGCACAAGCAGCAGCAAAGAGCAGCAGCAGCAAGA
[0170] GCAGCAGCAGCAGCAGCAGCAGCAGGAACAATGATTGAACAAGATGGATTGCACGCAG
[0171] GTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATC
[0172] GGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGT
[0173] CAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCG
[0174] TGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGG
[0175] GAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTT
[0176] GCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGAT
[0177] CCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCG
[0178] GATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGC
[0179] CAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGT
[0180] GACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATT
[0181] CATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCC
[0182] GTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTA
[0183] TCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAA
[0184] AAGTCGCACGCGAGCTTTTTACTTTTCCTATTATTATTTTTTTTCTTCCTCCGATCCCTCTT
[0185] GTTGCACCAGAAAACAACGCAGAAACACGGGAGCTTGACAGCGTGACCACAGGAAAG
[0186] ATACTATGGATGAGAACGGAACGCCAGGTGGAATACAGAAGTCGAGGGCATATCTTTGC
[0187] GAGCAACACATGTTCGAGCCGCGGAATCGACCCCGGACGCCATGGCTGGCTGGCTGAC
[0188] TGGCTGACTGATCCATGCTCATGAAAGCATGGCAACTCTTGCTGGCGCCGGGGCCTCTG
[0189] TCGCTCTTGCCGCTTCCGTGCCACGTTTTGCCTGGACTTGCTCCCTTTGTTTGTTTCTCGC
[0190] TTCCAGGTCCTTCTCGCGTTCTGCCTCTTCCTCTTCCCTTTCCCAGTCCTCTTCTTCAATA
[0191] TCCATGTCGTCGTCTTCGAATGCAAAGTCACGCGAATCAGAGCCAAATTGTGCTGCAAA
[0192] TTCAGCATACTGCTCTAGGGTAGCCTTATCG
[0193] SEQ ID NO.2(Promoter P2520):
[0194] GCAACCAAAGCAACCAGAGCAACAAACAAACAAACACACAAACAAACAAACAAACA
[0195] AACAAACAAACAAAGAACGCAACGCAGCTGCAGACGCGGCGGGCAGCGCTTGCGTCA
[0196] GAGCGTACGCGCGGGAGCGGTACCGTACGTAGGCGGCCGCGGCGAAGATCTCGGGTGC
[0197] CGTCGTCGGCGGTGTCGGATTCCAGGCTCCATCCAGCCAGCCAGGCACCTGCACCTACC
[0198] TATCTCGCCCGGACTCGCGGCCGCGAGCGCAGGACGGACGCCCGCCCCGCCGGAGGGA
[0199] GAGGCAAGGAGGGAGGGAGGGAGGGAGGGAGGGAGGAACGCGAGCGGAGGGAGCG
[0200] ACGGCGCCGCGCTGACGAGACGCGGAGGCTGCCCCTGGCGTAGTGTATCTATCTCTCTA
[0201] TCGGTCGGTCATCGATCCCAAGCGCATCCTCGCGTTTCATTTTCCATTCTTTCATTTGTCG
[0202] ATTCATCGCCCACCGGGGGCGACACGGCACCTACGCACCCCTCGCGGAGATTGCATCGC
[0203] AGCGCATCATACATACCGCCCCGCCTCGCATCACATCGCATCGCATCGCATCGCGGCGTG
[0204] GCGTGGCGTGGCGTGGCGCAAGAGGTGTGACCCAGGCAGGCAAGGCAGGCAAGCAAG
[0205] CAAGCAAAAGCAGGGCCCACACTAAGCCCACCAGGGGCTGACGGAGGAAGAAGGGAG
[0206] GGGAAGAAAGGCGGGCTGAGAGCAGCCGCCAGCGCAGACCAAACCCCCAATCGGAAC
[0207] ATCCGCTGCCACGGACGCACGCGGACTACGCAGGCAGCCAGACAGGAAGGCAGGCAG
[0208] GCCGGCCGAGCGAGCGAGCGAACCCCCAAGCGCAGCAAACCTGCAGCCGTCTCCGGC
[0209] AGCAGCAGCACAGCAACAACAACAACAACAACAACAACAACAACAAGAGCGGCAGC
[0210] ACAAGCCTTGTGCACCGCGTACAGCACAAGCAGCAGCAAAGAGCAGCAGCAGCAAGA
[0211] GCAGCAGCAGCAGCAGCAGCAGCAGGAACA
[0212] SEQ ID NO.3 (Terminator T2520):
[0213] AAAGTCGCACGCGAGCTTTTTACTTTTCCTATTATTATTTTTTTTCTTCCTCCGATCCCTCT
[0214] TGTTGCACCAGAAAACAACGCAGAAACACGGGAGCTTGACAGCGTGACCACAGGAAA
[0215] GATACTATGGATGAGAACGGAACGCCAGGTGGAATACAGAAGTCGAGGGCATATCTTTG
[0216] CGAGCAACACATGTTCGAGCCGCGGAATCGACCCCGGACGCCATGGCTGGCTGGCTGA
[0217] CTGGCTGACTGATCCATGCTCATGAAAGCATGGCAACTCTTGCTGGCGCCGGGGCCTCT
[0218] GTCGCTCTTGCCGCTTCCGTGCCACGTTTTGCCTGGACTTGCTCCCTTTGTTTGTTTCTC
[0219] GCTTCCAGGTCCTTCTCGCGTTCTGCCTCTTCCTCTTCCCTTTCCCAGTCCTCTTCTTCAA
[0220] TATCCATGTCGTCGTCTTCGAATGCAAAGTCACGCGAATCAGAGCCAAATTGTGCTGCA
[0221] AATTCAGCATACTGCTCTAGGGTAGCCTTATCG
[0222] SEQ ID NO.4 (NeoR, the resistance gene to G418):
[0223] ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATT
[0224] CGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGT
[0225] CAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA
[0226] CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAG
[0227] CTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCC GGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGA
[0229] TGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGA
[0230] AACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGAT
[0231] CTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGC
[0232] GCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCA
[0233] TGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGAC
[0234] CGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATG
[0235] GGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTT
[0236] CTATCGCCTTCTTGACGAGTTCTTCTGA
[0237] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.
Claims
1. A method for high-yield eicosapentaenoic acid (EPA) production by Schizochytrium based on random mutation and low-temperature screening, characterized in that: The method involves randomly inserting the exogenous gene G418 into the genome of Schizochytrium using Agrobacterium-mediated transformation, thereby enabling Schizochytrium to acquire the function of introducing G418. The transformed cells are then uniformly spread on a plate containing resistant G418, and the plate is placed at low temperature for screening. Larger single colonies are selected for fermentation verification, and fermentation optimization is combined to obtain a high-EPA-producing Schizochytrium strain.
2. The method according to claim 1, characterized in that: Includes the following steps: (a) By driving the overexpression of the G418 resistance gene through the P2520 promoter, a library of random insertion mutants was constructed, and Schizochytrium mutants with random genomic mutations were screened to obtain them. (b) The mutant strain was spread on a medium containing G418 resistance and cultured. Strains that were resistant to low temperature and had good growth were screened at 15°C. (c) The selected strains were inoculated into the fermentation medium. 0.1% MgSO4 was added at the beginning of fermentation and 0.05% MnCl2 was added at 72 hours of fermentation. The fermentation time was 120 hours to obtain a Schizochytrium mutant strain that produced high EPA.
3. The method according to claim 2, characterized in that: The overexpression of the G418 resistance gene described in step (a) is based on pZPK, with the promoter P2520 and terminator T2520 of Schizochytrium HX308 inserted into the backbone, and the G418 resistance gene NeoR inserted between the promoter and terminator. The sequence of promoter P2520 is shown in SEQ ID NO.2, the sequence of terminator T2520 is shown in SEQ ID NO.3, and the sequence of G418 resistance gene NeoR is shown in SEQ ID NO.
4.
4. The method according to claim 2, characterized in that: The concentrations of G418 in the solid culture medium containing G418 resistance described in step (b) are 400 ug / ml, 600 ug / ml, and 800 ug / ml, respectively.
5. The method according to claim 2, characterized in that: The initial pH of the fermentation medium in step (c) is 6.0-7.0, the culture temperature is 28℃, and the rotation speed is 200rpm-300rpm.
6. The method according to claim 2, characterized in that: In the fermentation process described in step (c), MgSO4 is added at the beginning of fermentation, and MnCl2 is added after 72 hours of fermentation.
7. The method according to claim 2, characterized in that: The specific steps are as follows: (1) Construction and transformation of recombinant plasmid pZPK-P2520-G418-T2520: Using pZPK as a backbone, the promoter P2520 and terminator T2520 of Schizochytrium HX308 were inserted, and the G418 resistance gene NeoR was inserted between the promoter and terminator to obtain the recombinant plasmid pZPK-P2520-NeoR-T2520; the complete sequence of the G418 resistance gene expression cassette is shown in SEQ ID NO.1; transformation was performed using Agrobacterium-mediated transformation to induce random mutations in the Schizochytrium genome; (2) Low-temperature screening of Schizochytrium mutant strains: After Agrobacterium transforms Schizochytrium, 1) transformants growing on solid medium containing 400 μg / mL G418 were selected with sterile toothpicks and transferred to solid medium containing 600 μg / mL G418. The culture temperature was 28℃ and the culture time was 48h; 2) transformants on solid medium containing 600 μg / mL G418 were selected again and transferred to solid medium containing 800 μg / mL G418. First, the solid culture medium in step 2) was placed at 28°C and cultured for 24 hours; then, it was transferred to 15°C and cultured for 48 hours to induce the metabolic pathway to EPA synthesis; finally, it was transferred to 28°C and continued to grow for 24 hours, and the single colony with the best growth in the solid culture medium was screened for fermentation verification. (3) Fermentation optimization of Schizochytrium mutant strain 1) Use a sterile pipette tip to pick up a single colony with good growth in the solid culture medium, inoculate it into the seed culture medium at an inoculation rate of 4%, and incubate it in a shaker at 28℃ and 200rpm for 48h to obtain the first generation seed. 2) After microscopic examination and finding no contamination, the first-generation seeds obtained in step 1) were inoculated into the seed culture medium at an inoculation rate of 4% and cultured at 28℃ and 200rpm for 24h to obtain second-generation seeds. 3) After microscopic examination and finding no bacterial contamination, the second-generation seeds obtained in step 2) were inoculated into the seed culture medium at an inoculation rate of 4% and cultured at 28°C and 200 rpm for 24 hours to obtain third-generation seeds. 4) After microscopic examination of the third-generation seeds from step 3) showed no contamination, they were transferred to a fermentation medium for fermentation culture to produce EPA. In step 4), MgSO4 with a final mass concentration of 0.1% was added to the third-generation seeds at the beginning of fermentation, and MnCl2 with a final mass concentration of 0.05% was added after 72 hours of fermentation.
8. The method according to claim 7, characterized in that: The solid culture medium is formulated as follows: 7 g / L peptone, 7 g / L yeast extract, 60 g / L glucose, 15 g / L sea salt, 3% agar powder, 5% glycerol, and the balance being pure water, adjusted to pH 6.0-7.0; all percentages mentioned above are mass percentages. The seed culture medium is formulated as follows: 50 g / L glucose, 15 g / L sodium chloride, 4 g / L yeast powder, 3 g / L potassium sulfate, 0.5 g / L potassium chloride, 15 g / L monosodium glutamate, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages. The fermentation medium is formulated as follows: glucose 100 g / L, sodium chloride 20 g / L, yeast powder 8 g / L, magnesium sulfate heptahydrate 1 g / L, potassium sulfate 3 g / L, potassium chloride 0.5 g / L, calcium chloride 0.5 g / L, 0.15% vitamin B1, 0.15% vitamin B6, 0.15% vitamin B12, 0.3 g / L choline chloride, 10 μM abscisic acid, 20 g / L glycerol, with the remainder being pure water, and the pH adjusted to 6.0-7.0; all percentages mentioned above are mass percentages.
9. The method according to any one of claims 1 to 8, characterized in that: The high-EPA-producing Schizochytrium mutant strain has an EPA content of at least 1.04 g / L.
10. The application of the Schizochytrium mutant strain obtained by the method of any one of claims 1 to 9 in the industrial production of EPA.
Citation Information
Patent Citations
DHA (docosahexaenoic acid)-producing Schizochytrium limacinum gene engineering strain, and construction method and application thereof
CN104974944A
Schizochytrium limacinum strain as well as building method and application thereof
CN106947706A
A method and application of Agrobacterium transforming Schizochytrium
CN114426985B
Method for identifying synthetic route of schizochytrium limacinum for producing EPA
CN116203166A
Cited By
A mitochondrial localization signal peptide, a high-squalene schizochytrium engineering bacteria, a method and an application
CN122608730A