Methods for generating rhabdovirus-free cell line
Patent Information
- Application Number
- PCT/US2025/028176
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-08
- Filing Date
- 2025-05-07
- Publication Date
- 2026-01-22
AI Technical Summary
Existing insect cell lines, such as Sf21 and Sf9 cells, are contaminated with the adventitious rhabdovirus, necessitating the development of effective methods to produce rhabdovirus-free cell lines and detect their presence to ensure the quality of products derived from these cells.
A method involving cell culture techniques and RT-qPCR for detecting and removing rhabdovirus contamination, including dilution, clonality confirmation, and molecular weight cutoff filtration, followed by RT-qPCR for accurate detection using specific primers and probes targeting rhabdovirus genes.
Produces rhabdovirus-free insect cell lines and enables reliable detection of rhabdovirus contamination, ensuring the quality of recombinant protein production and viral vector manufacturing processes.
Smart Images

Figure US2025028176_22012026_PF_FP_ABST
Abstract
Description
METHODS FOR GENERATING RHABDOVIRUS-FREE CELL LINECROSS REFERENCE
[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 643,924, filed May 8, 2024, the entirety of which is incorporated herein by reference in its entirety.BACKGROUND
[0002] Insect cells such as cells derived from Spodoptera frugiperda (Sf) including Sf21 and Sf9 cells are used as the host for baculovirus mediated recombinant protein production. One example is the baculovirus-insect cell system (BICS) used to manufacture viral vaccines and gene therapy vectors. The BICS consists of a recombinant baculovirus vector and an inset cell host. The recombinant baculovirus vector encodes the protein of interest to be manufactured and provides the transcriptional machinery. The insect cell host, such as an Sf21 cell line or its derived cell lines, for example an Sf9 or an Sf9L5814cell line, provides the translational and processing machinery needed to produce the protein of interest. In 2014, it was reported that Sf21 cells and Sf9 cells in commercial products were contaminated with an adventitious viral agent, later classified as a novel rhabdovirus, also called Sf-rhabdovirus. Since then, Sf- rhabdovirus has been found as a common contaminant of some Sf cell lines used as hosts for baculovirus-mediated recombinant protein production including recombinant adeno-associated viral vectors. Currently, there is a demand for effective methods to produce rhabdovirus-free cell lines, such as insect cell lines free of rhabdovirus contamination, as well as for products derived from these rhabdovirus-free cell lines. Furthermore, there is a need for rhabdovirus detection methods to ensure the quality of the generated rhabdovirus-free cells and products derived from such cell line.BRIEF SUMMARY
[0003] This Summary introduces a selection of concepts that are described further below in the Detailed Description. This Summary is not intended to limit the scope of the claimed subject matter.
[0004] Provided herein are methods and compositions for producing a rhabdovirus-free Spodoptera frugiperda (Sf) cell line. In some embodiments, a method provided herein comprises: diluting Sf cells and seeding from one cell per well to about 100 cells per well in a cell culture media on a first plate; confirming clonality of a cell clone in a well of the first plate at least twice either within 30 days after the seeding or before transferring growing cells to a second plate, whichever occurs first; removing a portion of the cell culture media from the well of the first plate and adding fresh cell culture media to the well of the first plate at least twiceeither within 30 days after the seeding or before transferring the growing cells to the second plate, whichever occurs first; and at a first time point after the seeding; confirming the presence of adherent cells and transferring the adherent cells from the well of the first plate to a well of the second plate enabling suspension of cells in the well of the second plate. In some embodiments, a method provided herein may further comprise: after (d), (e) at a second time point after the seeding; transferring suspension cells from the well of the second plate to a well of a third plate enabling scaling up the suspension cells in the well of the third plate; and (f) at a third time point after the seeding; transferring suspension cells from the well of the third plate to a flask and expanding the suspension cells in the flask, thereby producing a rhabdovirus-free sf cell line. In some embodiments, in (a), the diluting is about five cells per well in the well, and wherein the cell culture media comprises 6-azuaridine. In some embodiments, 6-azuaridine is from about 1 pg / mLto about 25 pg / mL. In some embodiments, in (a), the diluting is about one cell per well in the well, and wherein the cell culture media is without an antiviral agent. In some embodiments, in (a), the diluting is about one cell per well in the well, and wherein the cell culture media is without 6-azuaridine. In some embodiments, in (a), the diluting is about one cell per well in the well, wherein the cell culture media comprises 6-azuaridine and from 9% to 75% conditioned media. In some embodiments, 6-azuaridine is from about 4 pg / mL to about 13 pg / mL. In some embodiments, a method provided herein further comprises: passing the conditioned media through a molecular weight cutoff (MWCO) filter. In some embodiments, the MWCO filter comprises a MWCO of no more than 300 kDa. In some embodiments, the MWCO filter comprises a MWCO of no more than 200 kDa. In some embodiments, the MWCO filter comprises a MWCO of no more than 150 kDa. In some embodiments, the MWCO filter comprises a MWCO of no more than 100 kDa. In some embodiments, cell density in the well of the first plate is observed and / or calculated via a microscopy. In some embodiments, 6- azuaridine or other antiviral compounds are not added in (b)-(f). In some embodiments, the confirming in (b) is done via a microscopy. In some embodiments, the confirming in (b) is at least (1) on the day of the seeding. In some embodiments, the cell culture media in (a) comprise from about 0.3% to about 30% (v / v) serum for cell growth. In some embodiments, in (c) the portion of the cell culture media removed is independently from about 10% to about 75% (v / v), and wherein in (c) the cell culture media added comprises no more than 30% (v / v) serum for cell growth. In some embodiments, in (c) the atleast twice within 30 days comprise once within 14 days after the seeding day and once on or after day 15 after the seeding day. In some embodiments, the first time point is no later than 30 days from the seeding. In some embodiments, the second time point is no later than 60 days from the seeding. In some embodiments, at the third time point confluence of the cells in the well is at least about 50% nolaterthan 120 days from the seeding. In some embodiments, after (f), the suspension cells are passaged into a suspension shake flask. In some embodiments, the suspension cells are passaged at least 20 times. In some embodiments, the suspension cells are passaged at least 60 times. In some embodiments, a method provided herein further comprises testing for the presence or absence of rhabdovirus at least in a sample removedin (f). In some embodiments, the testing is performed on samples removed from different passages.
[0005] Provided herein are methods and compositions for detecting presence or absence of rhabdovirus in a biological sample. In some embodiments, a method provided herein comprises preparing ribonucleic acid (RNA) standard dilution samples using a dilution buffer comprising yeast RNA or an RNA that is from a source other than the species from which the biological sample is derived; preparing a test sample of the biological sample and controls, if needed, diluting extracted RNA from the biological sample of the tRNA sample dilution buffer so that the range of the RNA being tested is from about 0.1 pg to about 1 pg in a reaction; adding no more than 30 pL each of (i) the RNA standard dilution samples from (a), (ii) the test sample from (b), and (iii) the controls from (b) into corresponding wells of a plurality of wells; after (c), adding a first solution comprising double-strand specific DNase (dsDNase) to each of the plurality of wells, and allowing a dsDNase digestion for about 2-30 minutes; after (d), adding a second solution comprising reagents for a one step reverse transcription quantitative polymerase chain reaction (RT-qPCR) into the corresponding wells of the plurality of wells, and sealing the plurality of wells with a cover; after (e), without adding any additional reagents, performing the RT-qPCR reaction; and determining the presence or absence of the rhabdovirus in the biological sample based on results from the RT-qPCR reaction in (f). In some embodiments, in (b), the biological sample is not from a drug substance and is not suspected to comprise rhabdovirus, and the method comprises diluting the extracted RNA from about 2-fold to about 10-fold. In some embodiments, in (b), the biological sample is not from a drug substance and is not suspected to comprise rhabdovirus, and the controls comprise a positive control which contains the rhabdovirus genome. In some embodiments, in (b), the biological sample is not from a drug substance and is not suspected to comprise rhabdovirus, and no diluting is needed. In some embodiments, after the diluting, a concentration range of the extracted RNA is from about 1 nanogram per reaction to about 1 microgram per reaction. In some embodiments, the dilution buffer further comprises (i) a PCR buffer comprising a buffer at pH 7.0-9.0 and potassium chloride, and (ii) a poly oxy ethylene-polyoxypropylene block copolymer. In some embodiments, in (d), the first solution further comprises deoxynucleotide (dNTP) solution mix and magnesium chloride. In some embodiments, in (e) the second solution further comprises (i) a primer / probe solution and (ii) an enzyme mixture comprising a reverse transcriptase, a ribonuclease (RNase)inhibitor, and a deoxyribonucleic acid (DNA) polymerase. In some embodiments, the primer / probe solution comprises a primer / probe set comprising a rhabdovirus non-coding gene forward primer, a rhabdovirus non-coding gene reverse primer, and a rhabdovirus probe. In some embodiments, a ratio of the rhabdovirus non-coding gene forward primer to the rhabdovirus non-coding gene reverse primer is about 1 :1 ; and wherein a ratio of the rhabdovirus non-coding gene forward primer to the rhabdovirus probe is from about 2:1 to about 5 :1. In some embodiments, the primer / probe solution further comprises additional primer / probe set(s) against additional gene(s) of the rhabdovirus genome. In some embodiments, the primer / probe solution comprise primer / probe sets against up to six genes of the rhabdovirus genome. In some embodiments, the primer / probe solution comprises one or more primer / probe sets selected from the group consisting of: (1) SEQ ID NOs: 2-4, (2) SEQ ID NOs: 5-7, (3) SEQ ID NOs: 8-10, (4) SEQ ID NOs: 11-13, (5) SEQ ID NOs: 14-16, (6) SEQ ID NOs: 17-19, (7) SEQ ID NOs: 20-22, (8) SEQ ID NOs: 23-25, (9) SEQ ID NOs: 26-28, (10) SEQ ID NOs: 29-31, (11) SEQ ID NOs: 32-34, (12) SEQ ID NOs: 35-37, (13) SEQ ID NOs: 38-40, (14) SEQ ID NOs: 41-43, (15) SEQ ID NOs: 44-46, (16) SEQ ID NOs: 47-49, (17) SEQ ID NOs: 50-52, (118) SEQ ID NOs: 53-55, (19) SEQ ID NOs: 56-58, (20) SEQ ID NOs: 59-61, (21) SEQ ID NOs: 62-64, (22) SEQ ID NOs: 65-67, (23) SEQ ID NOs: 68-70, 2(4) SEQ ID NOs: 71-73, (25) SEQ ID NOs: 74-76, (26) SEQ ID NOs: 77-79, (27) SEQ ID NOs: 80-82, (28) SEQ ID NOs: 83-85, (29) SEQ ID NOs: 86- 88, or (30) SEQ ID NOs: 89-91. In some embodiments, the primer / probe solution comprises up to five primer probe sets selected from the group consisting of: (1) SEQ ID NOs: 2-4, (2) SEQ ID NOs: 5-7, (3) SEQ ID NOs: 8-10, (4) SEQ ID NOs: 11-13, (5) SEQ ID NOs: 14-16, (6) SEQ ID NOs: 17-19, (7) SEQ ID NOs: 20-22, (8) SEQ ID NOs: 23-25, (9) SEQ ID NOs: 26-28, (10) SEQ ID NOs: 29-31, (11) SEQ ID NOs: 32-34, (12) SEQ ID NOs: 35-37, (13) SEQ ID NOs: 38- 40, (14) SEQ ID NOs: 41-43, (15) SEQ ID NOs: 44-46, (16) SEQ ID NOs: 47-49, (17) SEQ ID NOs: 50-52, (118) SEQ ID NOs: 53-55, (19) SEQ ID NOs: 56-58, (20) SEQ ID NOs: 59-61, (21) SEQ ID NOs: 62-64, (22) SEQ ID NOs: 65-67, (23) SEQ ID NOs: 68-70, 2(4) SEQ ID NOs: 71-73, (25) SEQ ID NOs: 74-76, (26) SEQ ID NOs: 77-79, (27) SEQ ID NOs: 80-82, (28) SEQ ID NOs: 83-85, (29) SEQ ID NOs: 86-88, or (30) SEQ ID NOs: 89-91. In some embodiments, each of the up to five primer probe sets targets a different gene of the rhabdovirus. In some embodiments, concentrations of RNA in RNA standard dilution samples prepared in (a) range from about 10 copies per reaction to about 1 *108copies per reaction. In some embodiments, the yeast RNA in (a) is a yeast tRNA.
[0006] Provided herein is a cell generated by any of the methods disclosed herein.
[0007] Provided herein the use of a cell generated by any of the methods disclosed herein in the manufacture of a drug substance. In some embodiments, the drug substance comprises a recombinant protein, an AAV virus particle, or a virus-like particle.BRIEF DESCRIPTION OF THE DRAWINGS
[0008] The features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and the disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings (also “Figure” and “FIG.” herein), of which:
[0009] FIG. 1 shows an example image of a full well with a single cell circled on seeding day.
[0010] FIG. 2 shows an example image of a partial well with a single cell circled and pointed to by an arrow on seeding day.
[0011] FIG. 3 shows an example image of a full well with cell clone on Day 14 after the seeding day.
[0012] FIG. 4 shows a sample standard curve for the new method disclosed herein. X axis is log copy number and Y axis is Cq value.
[0013] FIG. 5 shows a gel of PCR amplified nucleic acids detecting various regions of rhabdovirus genome. PC: rhabdovirus positive FRT cell line. TS: rhabdovirus-free cell line final clone.
[0014] FIG. 6 shows product quality attributes for several clones prepared in the process of generating a final rhabdovirus-free Sf clone.DETAILED DESCRIPTION
[0015] Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in this art from the following detailed description, wherein only illustrative embodiments of the present disclosure are shown and described. As will be realized, the present disclosure is capable of other and different embodiments, and its several details are capable of modifications in various obvious respects, all without departing from the disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.Overview
[0016] The present disclosure provides compositions, methods, assays, and kits for identifying contaminating agents, such as a virus, in a sample and methods to remove the identified contaminating agents from the sample. The disclosure provides methods and compositions to remove rhabdovirus found specifically in insect cell line Spodoptera frugiperda (Sf) cell linesincluding Sf+ cells, Sf9L5814cells, Sf9 cells and Sf21 cells. This particular virus is herein termed “Sf rhabdovirus” or simply referred to as “rhabdovirus,” whose sequence is provided herein as SEQ ID NO: 1.
[0017] sfRV cDNA sequence (NCBI accession KF947078, 13,534 bp, SEQ ID NO: 1): TGAAAATTATACGATAAATGATCCTAACTCTTATAGATGACAACGACTACTTCACGGATATCGGCTTCTTAGATCTTATCATGACACAGGGAACCATGAAGCCAGTATGGGAA GAATTGGGGACAGGAGAAACAGAGTTCCAAGGGACCGTGGACATTCCAGGGAGAT CTCTCAAGCCAGAAAAAACAGATTGGAGTGTTGATACATGTCGGGAGATCAGTTTA AATCTGAAGTTACCTGGTGAAATATGGCAACTGGCCCATCAAGAAACCATCTTCAA CAGATTTCTTACATTTTACGCTACTGGGTATGTTCCAAATACACACACAGCCACAGA AATTGTACTCTCCATGGCATCACTAATCTTCAAGGACAAGGCCAAAGCACCTATTGA TTTGATTTGGGATGACTCATTTCAAGCTAGTCCCTCTGAGGAGTGTGGGTTCTCCGT TGTTGGAGAAACTCCATTGGTTATCGGACAACACCCGGATGATGATGACTACACAT TGAGAGAAGATGAAGAATCAGCCGCTATGAATGAGGAAGAAAAAATACAAGCAGC TCTAAAAACTTTGGGAATTCAAGATACTCCAGTAGACCTGAAGGATGCATCTGGAA TTGTCTTTGAGACAAAGGAGGACAGAGAACAAAGGATCAAGAATGAGAAAGCTCT ACATGTAGAGGATGATATCAACGCTCTAACTCAGATTACAAAACAATTCTTGTTTGA GTATTCCACAGGCTCCCTACAGAAATTTGTTGCAAAGGCTACTACTATTTTCATAGA TAATAATGCTACTAACGGCTTCACCCGTTTGCATCTCCATGCCATCAGAGTCATGAA CTTCATTGCTCTAACAATGCTTAGAAAGGTAACCAAGTCAAATGCCCAGATGATCA ATGCCTTTCTGAAGGAGCAATACAAGAGAAATATTGCCTCCCTAATCCCCGGCGCC CTCTCCTCTGATTTTGCTCCTCCCAGTAAGAGCTGCATTGATAAACTGACAGCTATTT CTAAGAATGACCCGGCAGTCAGTTCATTCTTTGCAAAGGTTGTGATGCTCAACATGG AGGAGGAACGGAGAAACCCTTCTCTGGTTGCTTGTCTTGGGGCTTCCCTTCTCACCC ACACCACTTGGAATGGAATGGGGATTTTACATGTTATTTTTGAAGTTTGTCTATTCC ATCAGATTAGCTGGAAGAGGTTGGTCACAGAGTCCCTGACCTCACTAACAAAGATG TCATGGGGTGAAGTCAGTCAATTCCTCATCAAGTATCAAGCAAAGGGAAATCCTGA CCCAACGGTTGCCTGGGCCAGAATCATTGATGATTCTTACTTTATGAGATTAACCAT AGTAAATCATCCCACACTTGCTGCATTATTAGTGGAATCCCTCATAAGATCTCAGAA AGATGATGGAATCCTGAATGCCAACTGGGCCATCCAACACAGGGACACCATCAATT ATTATAGGGACGCTGCCAAGCTTCTCACTGATAAGCTCACAGGACAGACTGCTACA GTCCAAGCCCTTACCAATGAAGCCGCTGATCTAGTTAGAACAATGAATGCAGGACC CTCTAGATACCACCCAAGGCCTAGTACCCTTATCCCCATGGTAGATCTAAACCCGGA AGACTTATAAGACTTACCTATTATCCCAAGACTAATTTCCATAATAATCCCCAAAAA GACAATTACTGTTATTTTCTATTAAAAAACCAATGAAAATTATGCAGAGAATATTGAGACATATAGTATCCTTCTTCTCAAAGTCCTGGTGCCAATCCTCCGATCCCGCTCTAGTGTGCGACTGTGAGTATCCTCCTCTCAAGAGAAACTATCAACTGATTTACTCTATAATGGCTTCCCACTCTCTTGACACCATTGATCTATCTGAAATTGGATTGACAAGGGAGGTTCTGACTGGGGTTGGCGATTACATGACTGGACAAAGACCGGTTCCAGCCTTCAATCCTCCAGAGGTCGGTCACTCCCCCTCTGATGAAGTGGCAAAACGATTGGGAGAACTGAAGAATTACTGGACTCAGTTAGAGGATCCTCTTGATGAGAGAATTCTCAATACCTTGAAAGCGATCAGCATCCTGAGCGGAGACACCAGAGGAGATCTGAGTGGAAAATATAAACATCTAGTCCGCATTAGCGGAGATGACATGCCCCAATTATTGGACGAACTTATAGACATCTGTCTTCTGGGGCCTAAGACTCTAATTGCTACCTTACGAATGGCGATAACCGCCTATACCGCTGCATTAGCCAGAAATGCCAAGTCCACCATCTCAGATATTACTACCGCATCAGCAGATTTGATGGTCATCACTCAGATGATACAGTCCCAGCAGGAATCTTTCCAATCATCATTAGAGCATCTCTCTCATGCTTGGAATAACGTCGCCAGTGGTATGACTGCTTATACAGCGGAACTGGATAAGAGAACCCTCAAGTTGACACAGCTTACACCGCCAGTCAAGCCTGACCATCACCGGGCCCCCTCTACAGCCTCCAGTCATACCCCTGATGCTTCAGTGGGGCTTCATATAAACATAACCCCCGGTTGTGCATATAAGTCCCAATTTGGGGTATTGACTTGCTGTCCCAATGGGAACATTGGTTTTCTTGCAAATAACTCCGATGGCACTGTGATAGCCAAACTTGTGGAAGTAATTAGGAAGCCACGCCCTCTCACGACGGCCCTCAATAAGAACCTGTCTGAGCTGATCAATTATGTCAAGGCAAATCCGAAGATCCTTGCTACTTACTCTACCTCTTCTCCTCAGGATAAGCTTAATATCCTGAATGAGATCCACTTCTGCATCCCAGATCTTACCAATCAATGGGTCAAGGCCTGATAACATTCCCTTCCCTCACAAACTCTAAAGATATCTCCATCCTTGATGACATTTTTATTAATTATATTTAAGTACGATTTAAGATCTACATACCAAAACCAACCATTTTGATGATTAACATGTTATTATAAAAAACCAATGAAACTTATACGTTAATTGAGATAAGTTTGATTTCATTGTTCCTTGTGTCATCACCGAACTTTTTGAGCTCGAACAATGAGTGCTCTTGAACGGATTGCACGGAGCCTATCATTGAAGAAGTTGAACCCTAGGAGAACTCCAAAGACTCAGCCTATTCCTGAAAAGGCTACTGTCTATCATCCTTTCATGCTCTCTTATGATCTCAATTTAGCTATTGAGGGTAAAATCCACATCTCCGCTATCACCATTATAGTGAATGCCCTTTCCTTAGCTTGGGCAATAGAACTCTTTCACTCTGACTCATCGTGGTCAGGGTGTCTTGAGTACTTTTGGAAATCCATCAAGGATAACATATTGGCATCCATAAACCCTCGAGTTGATCCAAATGGAACTTGTCATATGATGACATCAATCATAACTTTCCTCGGATTCTCAGATGGATCCTGCATCAACTCAGAAGCAGAGCCAAGACAGCTCACAGGATCTAGATCCTGGGAGATCATGTCTCCTAATCAGAATCTCATTGTGATAACCCTAGGATTCAAAATAACCTTGAAAACCTTCGCACAGCACCAGAGATACAGCTTGCGTGACCATGGATTCCACAAATTGGAGATGCTCAACGAGAAAGAGAAGAAAATGTTGAACTATATGGGGGTCAAACAATTAAAACCCCAGTATACACATGAAAAGACATTCGAGAAACTCATTCTCAAGAACAAAGGTCCAAAGGGGTCTCGTGTCAGGGCAATTCTTCACTCTCAAAGTCGTGACATGTGGTCTCCAACCGCTCCTTCTCCTCCACCCACATATGAAGATGGATCCTCAGATGAATGGGATCAGCAACAACTGCACAGCCTCAACCACCTGCATACACCTTCTGTCCCCCTGAGGGCCCCCAGGACATCCCCACCCCAACAACTCTCCCCAAAACCGACATCCACAACCCAACCCCTCCCACAACTCACACAACCAAACAAGCCCCAAGAACTCTCCAAGTAGACACTTGACAGCCCCCACCAATTACTTTTAGATCATAAAAAACCAACAGGCAGAATATAAGACCTATCAATTAGAGATATTAAAAAATACTAATTAAACAATTATACATCAAGCATTGGCTCATTATGGTTTTCTTAAGTTTATCAACGATCATATTTATCCTAAGCCTCCGGGCTGTAACCTGCTCCAATCCTCTCTCCTATCCTAATGGCATTTTGACTAACAACTCTACTCACAATCATCCCCTATCGGACTTTTATATTTTTTATGAGAACAGTTCCCTTACCTATACTCAATTCCCTGTGGCCCCAGACTGCTCTAGTATTCTAGATACTAGAGATGAGCAGTATCCCACCACTGTTACTTTGTGGAAGGTTGATCAAGAATCTCAAGCTGAGTGGGGACTCCTTTTATGGCAAGAGAGAATTGACACCACTTGCTCCTGGAACTTCTGGGGCAATTACAAAGGATCCATTGTATCTAAATCCTCAGTACCTCTAAAGGATATCCCATCGGGTAGTGCCCGGAATGGATATTGGGCTTTGAGCAATGATGAAGTTCAAGAGATTGATCATGTCCCTTACAACTTGAGATATTATTGTTACTGGTGCAGAAATGAATATCCTGGGAGCTTTTATATGAGATATGTAAAGAAAGTTCGGATCATAAGAAATCCTGATGGGTCTATAAAGACTCCTAGAGGATCCTGGGTTCATGAGTTGGACAACTTGTGGGGAGATCAGATGAGGTATCTAGTTATTCGAAGATTTGGGGGAGAATCTAGCTGCCCTCTTAAGATATATGATGTGAGAGCAGGGGTTCTGTCAAAATCTCGGTCAAACTTCATCTTAGTGTCCCTTCCCTCCTTGAATTTGCAGTTCTCTGTATCACTTGAATCCACTGAGACGAAATGCTCATTTGGAGATAAGACATATGATATTGTGCAGAGCATGGGAGGCTATCTCCTCTCCATCGACATAGGTAATGCGAACTGGCGAGGCCCTTGGGATCCTACCCCTCAGCATCCGGGTCGTGAAAGAAGATCAATTATGGAGTTTCCGGATCAAACATCTTTCAGATATAACCAATTTATAAATTATCACTCATCCCCAAGACACAAGAGACATGATCAAGAATTTGAGTTCCCTCTCAGTCTAAAATCCAGTTATGATTATGCTCAATTTAGATATGAGCAGAATTTCATCATCCGACAGATCAATAAGAATTTTGGATTATTACAGAAGAGCATTTGTGATATTCAGTTTTCTAAGTGGCAGAATCTCAGTCCACCCAATCTTGCTATGAAAATTGCCCATTATGTCACCGGCTCTATCCACTCTATAGGTGGTGTTCATCATGGATCTTATTCAATTCAAAGAACGGAAAAATCCATTACTAAGGTCAATCTGGTGTTTCCCATTGTTATTGTTCATGGAATGTATAAGTGCCAAAGGGAACCATCCAAGGAGGTGGTTTGGGCAGAACCCGTCACAGGGATCTTATTCAAGTCTCCTATTCCGACTCATTTCTCACTAAGTTCCTCTTGGCTACCTGGGGTAAATGGTTCTTCTATTGTCCCTCTGACAGGTCAAATTCTTCTCCCTGAAATCACAATGGATCACTTGGAGGTTGTACAACAGGTTGAAGCAAAGATGGTCAAAAGTATGTACACGAATGTAGAGTTGTTTGGATCAACAGAGGAATTTCAAAGATACCAAACTCAGGGAATTACCTCTGATGAACAATCAAATACAGTAAATCCTTGGATTGGGCTTTTGATACATGGTGGAGTGTCCATAGCTACTGGAATATTAGTAGCACTTTTGATCCCCTCAATCTTAAAATTGTTCAGACATATAATTGAGAAAGGGGAGGCATCGTTAGAGGAGAGGTTGCATCTGAGGGAAACCTCAAGAAAAGAATTTGTCAAGGTTAGGGGGAAACCATGGGGTGTCTAAGCTACCACAGCTTCCACAAGAGATTGGACTCCAGGTGGCTCTCTCCATCAAGCGATCATGACTCACAAAGTCCCTTCAGGCCCTAACAGATCAGTACAGCCATCATTCATTTGGGCTCCATCTGGCCCCAACCGACTCCTCTTATAAAAAACCAATGAAACTTATACAGATCGTCCTTGACTGCCAAAATGGATCTCACTTTAGACACTATGAGGCATATTGAAACTCTGATCAATTCACATCTAGAGCTTGAAGACCTTAAATCTTTGATTACAGACACTTGTTTGATTCACTCAAGGGATCTATACAATCCCTTCTTATACATTATCTGTTTTGTCAAACCTACCATCACAGCCAGTGCTGAAAACTTTATGATTGGGAAATTAAAGAAGATCATAATTCCATTCTGGGATGTGGTTGATGTCACAAGATGCAAAAGAATCATTTGTACTGAATTTGCTCCAGATGATGTGATATTAATGAAACTGACCCCTGTGATCTCTTATCACTCTGCATAATAACCAGATCTCTAAATATATTTTAAAGGGATAGAAAAATCCTTCCCTAGTTATTAGTTTATACCAGTGTCTTTATTTATATTTAATCTAAGATTTCTTTATAGTGATTCCAATTAGAGAAGGGATGAACTTTAGACTTATTGGTTGTGATATAGTAATGAAATAGACAGTTATTTATTCTTAGTTAATCTTTAAACATTTTCCTTCTTCTATTTTTCGGTTAAGTCACCAAACTACCTATCAAACCAATACATGAGAACAGTGTATTATTCCTGCTATTAAAAAAGATCATACCTTTTCCATCTCAGCTCCTCAGTCAAATCTTAGTTTCATTAAATCACCATGGATGAATTACAAAGTGATAATGTCCGTAAAAAACGTCCCCCTTTATCAACTCATTGTGACACCCCTCTCACCCTCAACAATGCCAGAAAAGCCTTATTAGTACCTGCACCCGGTCAATTCATACATCCCAATAACCCCATTCGACGAGAGTACTTGGAGATGCAGAGACAACTTCAGATAACACCCCCCAATCTATTTGATCTATCAAAAGTTCAGGGTTTTTTCCTAAATGTGTTTAATGTACCAGTCTCTAGCCTTCCTTTATTAGAATTTAGACAAGCATTGCACTTGGCTTCTCAACTATACCAAGTAGAAGTTGAAGGGGTTCTCAAAGAGCTAGGGGCATCAGCTACTAAAATTGATATATCTCCTCTGATGAAAAATAAGGACTTAATTAATCTTTATCTGAGAAAATGTTTCTGGGAGGAAGCAGTTGTCATGAGTGGAAATGATAACTCTAGTCAGGGATCCTGGTGGTCAAGAGCAGATAAAGGGCTTATTCTCTTTAGACGACCTGGGCTTGATATCATAATTGGGGAGAATTTAATGTCAATCCAGACATCTCAGAACTCCATATTGGTCTCCCGAGATCACCTAACCATATTGTCAGATCTCGCTGCTGAGCGGTTTAGTATAATTCTCCAATCCTTCTTAGCTGATCAAACCCATAATACAGATATGCCCACCCCTTCCGAATTAAGTTTATTTCTTAAGGAAGGAGATGAAATGCTAACTTTAGCAGGAAATCAAGGATATGATCTAATTTATACTTTAGAATCTTCCTGTACTTCCCGATTAGTAGGGAACTATGAAGGAGGCTCGTGGAAAGATTCTAAATTCCGGCATGAAATTGTTAAAGATTTAGAGAAAAAAGCCTCAGATCTAAATTTACATCCTCAACTTAGAGTTAGAGAACAACTGTTAGATTCAGTTTTTGAACGAAATCTAAACGCCTTCACCCAACTGTATGGGCTATATCGCATATGGGGTCACCCAACTCTGGATCCATTACTTGGGACAATAGCCCTCAAAGAATTGGGAACAACACCAAGATTGTACCTATCACACCAAGCTCAGGAGATTAACAACAAGTTTAAGGAAGAGTTCATAAAAAGATATTTAAATAGACATAAGGAGTGGCCGGAATTAGATGTATCGAAATTACCAAGACATAACATCATTCGAGTCCATTATGAGAAGAAATTACAATTTCCTTCTAAATCCAGACAATATAGGAGATCTCATCTCTCCTTGGTAGAATTCAAAGAGGTATTCCCTGTTGATCCTAAATTTGATCTTATTGAATTTATTGATGATAAATCCATCTCCTTAGGTTTCCCAGATCTCCTTAACGAGATCTATAGAAACAAGAGTATCGGGAATTCACTAGCAAGATCCTTATTGCTTAATTTCCTCTCCTCTGACATTTCAGACCCCCAAGAATTTCTGAAGAATATAGATACCTCAGGGTTTCCTCCTGAAGAGATTTGTGTTGGGGTACACGAAAAAGAGAGAGAAGGAAAGCTAAAGGCAAGGCTGTTTGGATTACTGACCTTAGTGAAACGATCATATGTAGTTATCACAGAAAAACTCTTGGCTGAGCATCTATTTCCGTATTTCCCTGAAATAACCATGACGGATGACGAGTTAGTTTTGGAGAAAAAGAGGCATGCATTCAATACAGAACGAAAAAACAAATTTATGGTGAGTTTGGATTTTTCCAAGTGGAACACCAATATGAGAGCCCCAGACACACAGCCATTTTACCACACTATAGATACGATGTTTGGTTTGGAAAATTGTTTTACCAGGACACATGAAATGTTCTACAATTCCTTTTTGTACCTTATAGACGGTTCTTATCTCCCAACAATAGTTGATGATGGGTTCAAAACAGATATTGGATGTTGGCGACATCATCTTGGGGGAATCGAAGGTCTCAGACAAAAAGGATGGACTCTGTGGACAGTTATGTTGATCAGGCTAGTTGCGGAAAAATATATTTTCAATATGTCTATCATGGGACAGGGGGACAATCAAATGCTACTTCTAACTTTCGATTCTAATACCCCGGAAGAATATGCCCTCTCTCAAGTTAATGATTTCCTTCAGTCATTAAAGGATAAACTGTCACTAATAGGTCCTCCTCTCAAGTTGGAGGAAACTTGGATTTCCAAAGACTTTTATTTATATGGAAAGTATCCTATCAAAGGAGGTGTTTCTCTCACCACATCGTGGAAAAAATCATGCAGAATGTTCCGATGTTGCAACGAGGACTATCCCACCATAGAGTCCAGTTTGTCCTCCTTAGCTGCAAACCTGTACTCTGCAGTGGCTGCTGATAACTTTACACAGACTCTGTTTTTTGTTTACTTATTTGAATTAGTAGGTCTATTCCAATGCAATATTAGAAGACCCTATCTCCAAAAGAACTCATTTTATCAATCGTTAGATCGAAATAGAACCTTCACAGTTGCTTCTGCAAAAGACCAAAAGAAGAAACTTCATGTCCCTCTTGTTCTATCACCCCCAAATCAGCTACAGCCTACCGAGGTTTTGTTAGGACTATGTTTGACTCCGAGGACTTTGGGAGGATATCCAGTTGTTCTGTACCCATCGGTCTTGATAAAGGGAGCCCCAGACCAATTATCATTTGATCTTGCGTCCTTAAAATTATTTTCAAAGTCAGCAGATGCAACTGTTAATAGGATAATAACCCGTGTATCCAGTCCATTCCTCTCCGAGTATAAGAATTATTCTCTACTTTTTATGAACCCTGAGGCAATTATCCTGGAGTCTACACCCACTCCTGCAGAGGCAAGGAGAACTACGATGTTAGAATTTCTTTCCAACAGTGATCGTGTTAACCAGCCTTACATAAAAGAATTCCTAAACATCATTCATGAGAATGCAAATCAATCTATGGAAGATTTTTTAACCTCAAATCCTGTACTTCATCCACGTGTAATCTCTCTTCTACTTCAGGCAACTCCACAATACAGAGCTCAACAAGTAATTGGAAGGCTCCAAAAGACCCCAACAATGGCTAGAGTCTACTTAAGAGAGGGAGATAGAGATCTTTATGCACTGTTAGAGATGTCTGAGTTGAATCATTTTAAGTCAGTATTACGACAAGTCTTTGCTGAGGTAGGCAGGTATTCATTGCCTCACTTCAACTCTTTGGTTGAACATTCCACCTTTTTAAGGAACATGGGTTGGGGTAAAATAATTGAAGGTGTAGATAGTGCCCCTCCTCATGAGGTCTTCCATCTAGAGGTCATGACATCTATTACAGAATGCCAGGATTCTCCACATGCAGACCTGGGGTTCATATCAGTTAGACTGAACACCCCTAAAGATGTTGCAGGAAATTCTCTTGCAATTGGAACCACAAGACCTTATAGAGGATCTATCACTAAAAATAAAGTCAACTCCTTATCAACAAAAATCCAAGCCAGAACCCCTTCTCTGTTACAAAGAGCTCTCATGGTTGCAGGACTGGAATCCTGGGCATTCACTAAGGATTCTTCACTTGCTCAGTTATCAAGGGGGTTAGTTTGGAGTGTTACAGACTTACCGTATGAACTGTTGACTCCACAGGTAGATCAGGTTTCGGGATCATATCAACATCGCTTACGAAATGATAGACTAGACAATGGGGGAATCAGTCCTGTTTTACCGAATCAAGGTACCAAATTACAATTCAACACTGTCCCTCTTGTATGTTTGAATAAAGGAAGTAAAAATAAGAATGTCATGTTCCAAGGGCCTTTAGTGATGTTTGGAAGTGTAATTGGCGAGGGACTGCTTACAGAAGGTATCAATTATCCAGAGACAAAACTATTTCACATCCATATTAGGAATCCCTCTTCCATACAGGATCTTGATGAAAATCCAATCACCTATCCCCCTATTCAACAGCCTATCAGATTGTTACGAAACCCCCAATCTCCTTTCTTATTTTTCCCATCTGACAAAATCATGCCTTATATAAAAAGAATTCTAAAATATCCTATCTGTTCACGGGAAGATCTCAATGTGATTTCTACAGAATCTCGCTTCAATACTTTATTGGCCTACGAGTGCATAAACTTGCTTGATCCATGGTCATGGGTCTCTGGATCTGACTCGAGATTGGTAACTAACGGAATAACCATCAACTGGGCTCTCTCTTGTAATATTGTAGAGCTATGTCTTGTGATCAGCCTCTTACTTCTAGCTATTTTCTTCACCCCAACTAAAATCATTGATCCGGAATGGCATATCAATAGAGTGATAAATGTTGTCAAAGCTTCCCCTCTCTCCTCATGGGAGAATTTAACAAATCTCTGTTTCTGCAATGTCTTCCCAACCCCTCTATTACATTTTCTTAGAGCTATGAGCCCACAAACCTCTGAGGGTTTAACAAATTCAAATGTTGCACTTATACTAAAGACTTCCATTACATTGATCCTTCAGAATATCCTTTACGATAGGAATTTCATAAAAGGAAAAGTACCTCACCTGATTGCACCCCCGGCTGTGTCTTTTAACCTGCACCCTTACAGGGTCATAGAAATCCTAGGGTGGTTATATAAGGAACATGAAGTTCATAAATCCCATCTTTCGTACCTCTCTAAGGACATGCTAGATTTGAAACTTAGGAGTTTGGAAGGTCCCTATGTTCACCAATTAGACTTTTGGGGGAGCCCTACCCGAATATCTGGAATCAGCTCTGAGTCTCTGGATTATCTTTGTAAATTGGAAGACGTAATTAAATCTAGATCCATAGAGGTACTCACAGTTGCTACAATATTTGATCCAAATCCACTCCCAATGCCTCTAGTTACTGGCCCCATTGTTAAGTCGGGTGTTGTGAACACAAGGCTGCAAGTATCTTTTTATTCAGAGGGGGACGTACTGCATCCGGAATTAGGACATAGAGATTATAGAACTTTCTTTTTCCGACCAGCTCCATTGCCCACATCAGGGGCTTATAAGCTATCAAGTGTTTTGCCCTTACTAGGAAGCTGTGCCTTGACAAAATGCCTCTGTTTAGCTGATGGAACAGGTGGATTCACCAGAACACTCGCTCTTAGAGATGATTCGAAAACAATTGTATTCAATACATTAGTAACTGATCAAGATTATGTAACACAAATGGACCCAATTCAAAATATCCCAGACATTGCAGATCTTCCAATTTCTTGTCAGAAGAAAGTTGTGGGCCTAAGGGAGGTCAATGATTATCCAACAGATATAACAAGCCCGGATTTCGGACATCAAATTCTGGACAGATTTGGAGGTGATTTCATCTTGGTTACAGGAGATGCGGAAGACCCCTCTCTGCACCATAGTGGGAATGTTTTAGCTTTGTTCAAAGCCTATATGGATATTAGCCTAATTGTGAATTCCGTTCATGGTATCTTTAAGATTCATACTCACAGAAGGTCTGTCCTACATCAGGCTCTGGTTATATTGTTGACTTATTATGACTCTGTAGTTGTAGTAAGAAGTCAATTCTCTCTCCGATCCAACAATGAATTTTATCTTGTTGGTGCAAGAAACAAGTTAGCTCCTAAAATCCTTCCATTAAATATTATTACTCTGGCAGATGGTAATCCGACCCTAAATGTTGGTCTAAGCAGAGATGCTGAACTGATGCTGAATAAAAGTCTCAACAACTTAAATAGACAACAAGGTCAACTGCAAGAGCTACAAAAATCTACCTACATACAGATTACATCCAACTTAATGCCTCACCTCCATTACCAAGATCTAATCTTTCACCTAGTTGGTCAGTATCCATGGTTGAAACAGGAATACTTTGATATCGGGGAATCCAAGGATGGGGATCTCAGACCTATCTACTCATCTTGTATCCATAAGTTTGTAACCTCTATACACAAGGCAAATACCAAATATGAGGAGAAAGATGTAGCAAGATTTGTGGTAAAGCAATTTACTCTAAGAGAGCTGTCAGATATATTATCCTCCTATCTCTTTCTGATACTGTCTGTTCTTCCCCTAGCCAGATGGAATTCTTGGATACCTCACTTCTTGAAAGAAGGATGCTTGTTATGGATACAATGTGAGAATGGGTTGTGGTTCTTTTCTCCCTATCTGGGGGTTGTCCCACCTGCGAGATCAACCTATCATTTTAGACTGTATAGGACACAAGATTTATTAAATCATGTTGCGATCCAGAGGATTTGCAGATCTGTTGGTTTAGCTCACATGTTACACTTCAGGGAACCTGACGATAAACATCTTAAAGAAGAGTCCATCTTTACTAGACCATCAAGGAAATTCACATTCTATGATCCTAAACTCAAGGGACTAAAAGACAAGATTAAATGTCAGAGTTGGCAATGGCTCAGTCAATCTCCTGGTTATCAACTGGATCAGTTTGCTCGAATTTCCCAAAATCCCAAGAAATAAGGAGCATCTATCAAATCCCCCGACCAATGATTGTCTCTTTGTCCTCCATCAAACTATATATAAATCAATCAATCGTCTTAAAGTTCTCTTGATTTTTGTTGTATAGATTATAAAAAACCAATTATTTTAATTACTTCTCTCATTTACAGTTAGTGTCCCTTAAGAATATCTGGCTTCATGTCATCAAGGGTGGACCCTCTATTTTATCTTCATTTTCTCTCAGCAACCCACTGCATCAATCATTTCTTCCCCTGCTTGCCCCCCCTCCCCCACGATCTA (SEQ ID NO: 1)
[0018] Rhabdoviruses belong to the family Rhabdoviridiae (order: Mononegavirales) comprising a diverse family of negative (-) sense ribonucleic acid (RNA) viruses. This familyincludes at least 6 genera: Lyssavirus (e.g., rabies virus), vesiculovirus (e.g., vesicular stromatitis virus (VSV)), ephemerovirus(e.g., bovine ephemeral fever virus), cytorhabdovirus (e.g., plant viruses such as lettuce necrotic yellows virus), nucleorhabdovirus (e.g., plant viruses such as potato yellow dwarf virus), and norvirhabdovirus.
[0019] Insect cells, such as cells from Spodoptera frugiperda and other Lepidopteran insect species, may be used in the production of recombinant proteins via the infection and replication of baculoviruses or other viruses. Such production may include production of therapeutic products including vaccines and gene therapy vectors. Some, if not all, of the Sf cell lines (including but not limited to S+ cell line, Sf9L5814cell line, Sf9 cell line or Sf21 cell line) can be a clonal isolate of Sf21 cells. An Sf21 cell line may be obtained from S. frugiperda ovarian cells. An Sf9 cell line may comprise but is not limited to ATCC CRL-1711. Other sources of insect cell lines include, but are not limited to, Spodoptera exigua, Heliothis virescens, Helicoverpa zea, Heliothis subflexa, Anticarsia gemmalalis. and others.Recombinant AAV Vector
[0020] Adeno-associated virus (AAV) belong to the parvovirus family. An AAV may comprise a single strand DNA (ssDNA) virus. The full-length genome of the AAV contains approximately 4.7 kilobases (kb), comprising inverted terminal repeats (ITR) DNA sequences at both ends of the virus encompassing two open reading frames (ORF) called rep and cap.
[0021] The “AAV inverted terminal repeat (ITR)” sequence is a sequence of about 145 nucleotides that exists at both ends of the natural single-stranded AAV genome. ITR is required for the efficient replication of the genome nucleic acid sequences of the symmetrical AAV particles, which can be used as a viral DNA synthesis origin of replication and are necessary structural components for the recombinant AAV vector.
[0022] As used herein, the term “packaging” generally refers to a series of intracellular events that result in the assembly and encapsidation of an AAV particle.
[0023] AAV “rep” and “cap” genes refer to polynucleotide sequences encoding replication and encapsidation proteins of adeno-associated virus. The “rep” gene contains polynucleotide sequences encoding four rep proteins rep78, rep68, rep52, and rep40 required for the life cycle of AAV. The “cap” gene contains polynucleotide sequences encoding the AAV capsid proteins VP1, VP2, and VP3 proteins. The AAV capsid proteins VP1, VP2 and VP3 are capable of forming a 60-subunit symmetrical AAV capsid through interaction between them. AAV rep and cap are referred to herein as AAV “packaging genes.”
[0024] AAV can effectively infect dividing and non-dividing human cells, and its genome can persist extra chromosomally in an episomal form or integrate into the cellular genome. AAVmay have low immunogenicity. Based on its high safety, low immunogenicity, broad host range, ability to mediate stable long-term expression of exogenous genes in vivo, AAV may be used as a vector system in gene therapy.
[0025] To date, more than 13 natural AAV serotypes have been identified according to the tissues or different cell types they infect. Capsid engineering has the capability to generate millions or billions of rAAV variants with different tropism. Further, as shown in Table 1 below, different AAVs have been developed as advantageous vector systems for transfection of specific cell types.
[0026] Table 1: Examples of AAV Serotypes and the Target Tissues Used in Gene Therapy
[0027] The methods described herein are suited to any rAAV serotype, including but not limited to: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15 and AAV-16, AAV.rh8, AAV.rhlO, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, and AAV.HSC16, and derivatives, modifications, or pseudotypes thereof.
[0028] As used herein, the term “rAAV” generally refers to a recombinant adeno-associated virus. The term “recombinant,” as applied to a polynucleotide, generally refers to that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that collectively result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinantpolynucleotide. This term respectively includes replicates of the original polynucleotide construct and progeny of the original virus construct.
[0029] The term “recombinant AAV vector (rAAV vector)” as used herein refers to a polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not derived from AAV) flanked by two AAV ITR sequences. When present in host cells expressing AAV rep and cap proteins, the rAAV vector can replicate and be packaged into AAV virus particles. The rAAV vector includes an rAAV polynucleotide (e.g., a single stranded polynucleotide encoding rAAV (ss-rAAV); a double stranded polynucleotide encoding rAAV (ds-rAAV), such as, for example, plasmids encoding rAAV; and the like). If an AAV virion includes a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome, such as, for example, a transgene to be delivered to a target cell, etc.), it is generally referred to as a “recombinant AAV (rAAV) virion” or an “rAAV viral particle.”
[0030] The term “recombinant AAV (rAAV) virus” or “rAAV viral particle” as used herein refers to rAAV vector encapsidated by at least one AAV capsid protein into AAV viral particles. Other than insect cells, some host cells for rAAV viral particle production is derived from mammalian cell types, such as human embryonic kidney 293 (HEK293) cells, 293T cells, human fibrosarcoma (HT-1080) cells, differentiated hepatocyte-derived carcinoma (Huh-7) cells, PER.C6 cells, COS cells, murine myeloma (NS0) cells, HeLa cells, Baby Hamster Kidney (BHK) cells, KB cells, and other mammalian cell lines.
[0031] The rAAV virus particles can be produced in the mammalian cell culture system by providing the rAAV plasmid to the mammalian cell. However, the productivity of the virus of most of the above mammalian cell culture systems is insufficient in meeting the requirements of clinical trials and commercial scale production. To this end, an rAAV virus particle production system using insect cells such as Sf cells, including Sf+ cells, Sf9L5814cells, Sf9 cells and Sf21 cells, has been developed. However, to produce AAV in insect cells, some modifications must be made to obtain the correct stoichiometric ratio of the AAV capsid protein.
[0032] As used herein, the term “empty capsid” or “empty particle” generally refers to a virion that comprises at least one AAV capsid but may lack in whole or in part of the polynucleotide (artificial genome, e.g., an rAAV vector). Empty capsids do not include an intact rAAV vector comprising a heterologous polynucleotide (e.g., a transgene).
[0033] Baculovirus is a double-stranded circular DNA virus, belonging to Baculoviridae virus family, and has a genome size of 90 kb-230 kb. Baculoviruses are parasites exclusive to arthropods and known to infect more than 600 species of insects. A baculovirus system may be comprised in a eukaryotic cell expression system.
[0034] In some embodiments, the rAAV vector used to carry the gene of interest in the rAAV virus particle may also include one or more “expression control elements”. The term “expression control element” or “expression regulatory element” as used herein refers to a nucleic acid sequence that affects the expression of an operably linked polynucleotide, including polynucleotide sequences that promote the transcription and translation of heterologous polynucleotides. The expression control elements that can be used in the present disclosure include, but are not limited to, promoters, enhancers, intron splicing signals, poly A sequences, or inverted terminal repeats (ITR).
[0035] A “promoter” is a DNA sequence located adjacent to a heterologous polynucleotide sequence encoding a target product, which is usually operably linked to an adjacent sequence, such as a heterologous polynucleotide. Compared to the amount expressed in the absence of a promoter, a promoter generally increases the amount of heterologous polynucleotide expression.
[0036] Examples of promoter include, but are not limited to, the phosphoglycerate kinase (PKG) promoter, CAG (composite of the CMV enhancer the chicken beta actin promoter (CBA) and the rabbit beta globin intron.), NSE (neuronal specific enolase), synapsin or NeuN promoters, the SV40 early promoter, mouse mammary tumor virus LTR promoter; adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), SFFV promoter, rous sarcoma virus (RSV) promoter, synthetic promoters, hybrid promoters, and the like. Other promoters can be of human origin or from other species, including from mice. Common promoters include, e.g., the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, [beta]-actin, rat insulin promoter, the phosphoglycerate kinase promoter, the human alpha-1 antitrypsin (A AT or hAAT) promoter, the transthyretin (TTR) promoter, the TBG promoter and other (hybrid) liver-specific promoters, the desmin promoter and similar muscle-specific promoters, the EFl -alpha promoter, the CAG promoter and other constitutive promoters, hybrid promoters with multi-tissue specificity, promoters specific for neurons like synapsin and glyceraldehyde-3 -phosphate dehydrogenase promoter, all of which are promoters well known and readily available to those of skill in the art, can be used to obtain high-level expression of the coding sequence of interest. In addition, sequences derived from non-viral genes, such as the murine metallothionein gene, also find use herein.
[0037] Another regulatory element in the rAAV vector is a polyadenylation (poly A) sequence. In some embodiments, the polyadenylation sequence is selected from the group consisting of a modified SV40 late poly-A (SV40pAmL), SV40 early poly -A (SV40pAE), SV40 late poly-A (SV40pAL), rabbit beta-globin poly-A (rbGlobpA), modified synthetic poly-A (mspA), humangrowth hormone poly -A (hGHpA), and bovine growth hormone poly-A (bGHpA). In some embodiments, the polyadenylation sequence comprises a sequence having at least 90% identity to a modified SV40 late poly-A (SV40pAmL), SV40 early poly-A (SV40pAE), SV40 late poly- A (SV40pAL), rabbit beta-globin poly-A (rbGlobpA), modified synthetic poly-A (mspA), human growth hormone poly-A (hGHpA), and bovine growth hormone poly-A (bGHpA).
[0038] An “enhancer” is a sequence that enhances the activity of a promoter. Different from the promoter, an enhancer does not have the promoter activity, and may generally depend on its location relative to the promoter (i.e., upstream or downstream of the promoter). Non-limiting examples of enhancer elements (or portions thereof) that can be used in the present disclosure include baculovirus enhancers and enhancer elements found in insect cells. Enhancer elements found in insect cells include but are not limited to baculovirus immediate early 1 (IE1) enhancer, hr5 enhancer, OpIE2 enhancer, plO enhancer, and viral homologous regions (hrs).
[0039] A “stuff er sequence” refers to a nucleotide sequence of a larger nucleic acid molecule (such as, but not limited, to a vector), and is usually to create a desired gap or separation between two nucleic acid features (such as, but not limited, between two coding gene sequences) or to extend the nucleic acid molecule a desired length. The stuffer sequence does not contain protein coding information and may have unknown or synthetic origin, not related to other nucleic acid sequences within the larger nucleic acid molecule, or any combination thereof.
[0040] As used herein, the term “intron” generally refers to a DNA molecule that may be isolated or identified from a gene and may be defined generally as a region spliced out during messenger RNA (mRNA) processing prior to translation. Alternately, an intron may be a synthetically produced or manipulated DNA element. An intron may contain enhancer elements that effect the transcription of operably linked genes. An intron may be used as a regulatory element for modulating expression of an operably linked transcribable DNA molecule. A construct may comprise an intron, and the intron may or may not be heterologous with respect to the transcribable DNA molecule.Compositions of rAAV
[0041] In some embodiments, the rAAV is a self-complementary adeno-associated virus (sc AAV) vector or a single-stranded AAV (ssAAV) vector. In some embodiments, the rAAV protein is an adeno-associated virus (AAV) capsid protein. In some embodiments, the AAV capsid protein is an AAV3 capsid, an AAV5 capsid, an AAV6 capsid, an AAV8 capsid, an AAV9 capsid, an AAV-DJ capsid, a KPI capsid, an LK03 capsid, anNP59 capsid, or fragments or variants thereof.
[0042] In some embodiments, the recombinant rAAV protein comprises an AAV cap protein. In some embodiments, the AAV cap protein can be any structural protein known in the art that can form a functional AAV capsid (i.e., packaging DNA and infecting target cells). In some embodiments, the cap protein includes VP1, VP2, and VP3. In some embodiments, the cap protein does not need to comprise all of VP1, VP2, and VP3, as long as it can produce a functional AAV capsid. In some embodiments, the cap protein includes VP1 and VP2. In some embodiments, the cap protein comprises VP1 and VP3. In some embodiments, the cap protein includes VP2 and VP3. In some embodiments, the case, the cap protein comprises VP1. In some embodiments, the cap protein includes VP2. In some embodiments, the cap protein includes VP3.
[0043] VP1, VP2, or VP3 may be derived from any AAV serotype. In some embodiments, the VP1 may be derived from AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV2 variants, AAV serotype 3 (AAV3, including serotypes 3A and 3B), AAV serotype 4 (AAV4), the AAV serotype 5 (AAV5), the AAV serotype 6 (AAV6), the AAV serotype 7 (AAV7), the AAV serotype 8 (AAV8), the AAV serotype 9 (AAV9), the AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), AAV serotype 12 (AAV12), AAV serotype 13 (AAV13), AAV-RhlO, AAV-Rh74, AAV-2i8 or any other known AAVs. In some embodiments, the VP1 and the wildtype VP1 derived from AAV1, AAV2, AAV3, (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, or AAV2i8 may have at least 75 %, 80 %, 85 %, 90 %, 95 %, or more sequence identity. In some embodiments case, the VP1 has one or more amino acid substitutions, deletions, additions, or any combination thereof compared to the wildtype VP1 derived from AAV1, AAV2, AAV3 (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, of AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74 or AAV-2i8.
[0044] In some embodiments, the VP2 may be derived from AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV2 variants, AAV serotype 3 (AAV3, including serotypes 3A and 3B), AAV serotype 4 (AAV4), the AAV serotype 5 (AAV5), the AAV serotype 6 (AAV6), the AAV serotype 7 (AAV7), the AAV serotype 8 (AAV8), the AAV serotype 9 (AAV9), the AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), AAV serotype 12 (AAV12), AAV serotype 13 (AAV13), AAV-RhlO, AAV-Rh74, AAV-2i8 or any other known AAVs. In some embodiments, the VP2 and the wildtype VP2 derived from AAV1, AAV2, AAV3, (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, or AAV2i8 may have at least 75 %, 80 %, 85 %, 90 %, 95 %, or more sequence identity. In some embodiments case, theVP2 has one or more amino acid substitutions, deletions, additions, or any combination thereof compared to the wildtype VP2 derived from AAV1, AAV2, AAV3 (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, of AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74 or AAV-2i8.
[0045] The VP3 may be derived from AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV2 variants, AAV serotype 3 (AAV3, including serotypes 3A and 3B), AAV serotype 4 (AAV4), the AAV serotype 5 (AAV5), the AAV serotype. 6 (AAV6), the AAV serotype 7 (AAV7), the AAV serotype 8 (AAV8), the AAV serotype 9 (AAV9), the AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), AAV serotype 12 (AAV12), AAV serotype 13 (AAV13), AAV-RhlO, AAV-Rh74, AAV-2i8, AAV-DJ, AAVHSC, LK03, KPI, NP59 or any other known AAVs. In some embodiments, the VP3 and the wildtype VP3 derived from AAV1, AAV2, AAV2 variants, AAV3, (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV- Rh74, AAV2i8, AAV-DJ, AAVHSC, LK03, KPI, or NP59 may have at least 75 %, 80 %, 85 %, 90 %, 95 %, or more sequence identity. In some embodiments case, the VP3 has one or more amino acid substitutions, deletions, additions, or any combination thereof compared to the wildtype VP3 derived from AAV1, AAV2, AAV2 variants, AAV3 (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, of AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, AAV-2i8, AAV-DJ, AAVHSC, LK03, KPI or NP59.
[0046] In some embodiments, the cap protein comprises VP1, VP2, VP3, or any combinations thereof derived from AAV of the same serotype; for example, the cap protein may comprise VP1, VP2, VP3, or any combinations thereof derived from AAV2, AAV2 variants, AAV5, or AAV8. In some embodiments, the cap comprises VP1, VP2, VP3, or any combinations thereof derived from different serotypes of AAV; for example, the cap protein may comprise any one or more of VP1, VP2, VP3, or any combination thereof of AAV1, AAV2, AAV2 variants, AAV3, (including AAV3 A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, AAV-2i8, AAV-DJ, AAVHSC, LK03, KPI, or NP59.
[0047] In some embodiments, the cap protein may be cloned into pUC57, pFastBacl, modified pUC57, or modified pFastBacl. In some embodiments, the cap protein may be cloned into pUC57. In some embodiments, the cap protein may be cloned into pFastBacl. In some embodiments, the cap protein may be cloned into modified pUC57. In some embodiments, the cap protein may be cloned into modified pFastBacl .
[0048] In some embodiments, the polynucleotide sequence encoding the cap protein is operably linked to a first promoter. The first promoter may be any suitable promoter known in the art that can drive the expression of the cap protein. In some embodiments, the first promoter may be a tissue-specific promoter, a constitutive promoter, or a regulatable promoter. In some embodiments, the first promoter can be selected from different sources, for example, the first promoter can be a viral promoter, a plant promoter, or a mammalian promoter.
[0049] The first promoter can include, but are not limited to, a human cytomegalovirus (CMV) immediate-early enhancer or promoter, a SV40 early enhancer or promoter, a JC polyomavirus promoter, a myelin basic Protein (MBP) or a glial fibrillary acidic protein (GFAP) promoter, a herpes simplex virus (HSV-1) latency-related promoter (LAP), a Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, a neuron specific promoter (NSE), a platelet-derived growth factor (PDGF) promoter, hSYN, a melanin aggregation hormone (MCH) promoter, CBA, a matrix metal protein promoter (MMP), a chicken P-actin promoter, CAG, MNDU3, PGK and an EFla promoter.
[0050] In some embodiments, the first promoter is a promoter suitable for expression in insect cells. In some embodiments, the promoter suitable for expression in insect cells include, but are not limited to a polh promoter, a p 10 promoter, a basic promoter, an inducible promoter, an El promoter, or a AE1 promoter. In some embodiments, the first promoter is a polh promoter. In some embodiments, the first promoter is a p 10 promoter.
[0051] In some embodiments, the 3’ end of a DNA sequence, such as, for example, the cap protein sequence, further comprises a polyadenylation sequence or “poly A sequence”. In some embodiments, the polyadenylation sequences or “poly A sequences” may range from about 1 to about 500 base pairs (bp). In some embodiments, the polyadenylation sequence or “poly A sequence” maybe, but is not limited to, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 50, 100, 200, or 500 nucleotides.
[0052] In some embodiments, the rep protein can be a replication protein necessary for any rAAV vector to replicate and be packaged into rAAV viral particles. In some embodiments, the rep protein comprises rep78, rep68, rep52 or rep40. In some embodiments, the rep protein may not comprise all of rep78, rep68, rep52, or rep40, as long as it can allow the rAAV vector to replicate or be packaged into rAAV virus particles. In some embodiment, the rep protein comprises any three of rep78, rep 68, rep52 or rep 40. In some embodiment, the rep protein comprises any two of rep78, rep 68, rep52 or rep 40. In some embodiment, the rep protein comprises any one of rep78, rep 68, rep52 or rep 40. In some embodiment, the rep protein comprises rep78 or rep52. In some embodiment, the rep protein comprises rep78 or rep 40. Insome embodiment, the rep protein comprises rep68 or rep52. In some embodiment, the rep protein comprises rep68 or rep40.
[0053] rep78, rep68, rep52, or rep40 may be derived from any AAV serotype. In some embodiments, the rep78 may be derived from AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3, including serotypes 3A and 3B), AAV serotype 4 (AAV4), the AAV serotype 5 (AAV5), the AAV serotype 6 (AAV6), the AAV serotype 7 (AAV7), the AAV serotype 8 (AAV8), the AAV serotype 9 (AAV9), the AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), AAV serotype 12 (AAV12), AAV serotype 13 (AAV13), AAV-RhlO, AAV-Rh74, AAV-2i8 or any other known AAVs. In some embodiments, the rep78 and the wildtype rep78 derived from AAV1, AAV2, AAV3, (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, or AAV2i8 may have at least 75 %, 80 %, 85 %, 90 %, 95 %, or more sequence identity. In some embodiments case, the rep78 has one or more amino acid substitutions, deletions, additions, or any combination thereof compared to the wildtype rep78 derived from AAV1, AAV2, AAV3 (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74 or AAV-2i8.
[0054] In some embodiments, the rep68 may be derived from AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3, including serotypes 3 A and 3B), AAV serotype 4 (AAV4), the AAV serotype 5 (AAV5), the AAV serotype 6 (AAV6), the AAV serotype 7 (AAV7), the AAV serotype 8 (AAV8), the AAV serotype 9 (AAV9), the AAV serotype 10 (AAV10), AAV serotype 11 (AAV11), AAV serotype 12 (AAV12), AAV serotype 13 (AAV13), AAV-RhlO, AAV-Rh74, AAV-2i8 or any other known AAVs. In some embodiments, the rep68 and the wildtype rep68 derived from AAV1, AAV2, AAV3, (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, or AAV2i8 may have at least 75 %, 80 %, 85 %, 90 %, 95 %, or more sequence identity. In some embodiments case, the rep68 has one or more amino acid substitutions, deletions, additions, or any combination thereof compared to the wildtype rep68 derived from AAV1, AAV2, AAV3 (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74 or AAV-2i8.
[0055] In some embodiments, the rep52 may be derived from AAV serotype 1 (AAV1), AAV serotype 2 (AAV2), AAV serotype 3 (AAV3, including serotypes 3A and 3B), AAV serotype 4 (AAV4), the AAV serotype 5 (AAV5), the AAV serotype 6 (AAV6), the AAV serotype 7 (AAV7), the AAV serotype 8 (AAV8), the AAV serotype 9 (AAV9), the AAVserotype 10 (AAV10), AAV serotype 11 (AAV11), AAV serotype 12 (AAV12), AAV serotype 13 (AAV13), AAV-RhlO, AAV-Rh74, AAV-2i8, or any other known AAVs. In some embodiments, the rep52 and the wildtype rep52 derived from AAV1, AAV2, AAV3, (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, or AAV2i8 may have at least 75 %, 80 %, 85 %, 90 %, 95 %, or more sequence identity. In some embodiments case, the rep52 has one or more amino acid substitutions, deletions, additions, or any combination thereof compared to the wildtype rep52 derived from AAV1, AAV2, AAV3 (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74 or AAV-2i8.
[0056] In some embodiments, the rep protein comprises rep78, rep68, rep52, or rep40, or any combinations thereof derived from AAV of the same serotype; for example, the rep protein may comprise rep78, rep68, rep52, rep40, or any combinations thereof derived from AAV2. In some embodiments, the rep protein comprises rep78, rep68, rep 52, rep40, or any combinations thereof derived from different serotypes of AAVs; for example, the rep protein may comprise any one or more of rep78, rep68, rep52, rep40, or any combination thereof of AAV1, AAV2, AAV3, (including AAV3 A and 3 B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, or AAV-2i8.
[0057] In some embodiments, the sequence encoding the rep protein is operably linked to a second promoter. The second promoter may be any suitable promoter known in the art that can drive the expression of the rep protein. In some embodiments, the second promoter may be a tissue-specific promoter, a constitutive promoter, or a regulatable promoter. In some embodiments, the second promoter can be selected from different sources, for example, the second promoter can be a viral promoter, a plant promoter, or a mammalian promoter.
[0058] In some embodiments, the rep protein may be cloned into pUC57, pFastBacl, modified pUC57, or modified pFastBacl . In some embodiments, the rep protein may be cloned into pUC57. In some embodiments, the rep protein may be cloned into pFastBacl . In some embodiments, the rep protein maybe cloned into modified pUC57. In some embodiments, the rep protein may be cloned into modified pFastBacl .
[0059] The second promoter can include, but are not limited to, a human cytomegalovirus (CMV) immediate-early enhancer or promoter, a SV40 early enhancer or promoter, a JC polyomavirus promoter, a myelin basic protein (MBP) or a glial fibrillary acidic protein (GFAP) promoter, a herpes simplex virus (HSV-1) latency -related promoter (LAP), a Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter, a neuron specific promoter (NSE), a platelet- derived growth factor (PDGF) promoter, hSYN, a melanin aggregation hormone (MCH)promoter, CBA, a matrix metal protein promoter (MPP), a chicken P-actin promoter, CAG, MNDU3, PGK and an EFla promoter.
[0060] In some embodiments, the second promoter is a promoter suitable for expression in insect cells. In some embodiments, the promoter suitable for expression in insect cells include, but are not limited to a polh promoter, a p 10 promoter, a basic promoter, an inducible promoter, an El promoter, or a AE1 promoter. In some embodiments, the second promoter is a polh promoter. In some embodiments, the second promoter is a plO promoter.
[0061] In some embodiments, the cap protein and rep protein are derived from AAV of the same serotype; for example, the cap protein and rep protein may be derived from AAV1, AAV2, AAV2 variants, AAV3 (including AAV3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, AAV-2i8, or any other known A A Vs.
[0062] In some embodiments, the cap protein and the rep protein are derived from different serotypes of AAV; for example, the cap protein and the rep protein may be derived from AAV1, AAV2, AAV3, (including AAV3 A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-RhlO, AAV-Rh74, AAV-2i8, or any other known AAVs. For example, in some embodiments, the cap protein may be derived from AAV5, and the rep protein is derived from the AAV2. In some embodiments, the cap protein may be derived from AAV8 variants, and the rep protein is derived from the AAV2. In some embodiments, the cap protein may be derived from AAV3 variants, and the rep protein is derived from the AAV2.
[0063] In some embodiments, the first promoter and the second promoter may be the same promoter. For example, the first promoter and the second promoter may be selected from the group consisting of a polh promoter, a plO promoter, a basic promoter, an inducible promoter, an El promoters, and a AE1 promoter. For example, in some embodiments, the first promoter and the second promoter are both polh promoters. In some embodiments, the first promoter and the second promoter are both plO promoters.
[0064] In some embodiments, the first promoter and the second promoter may comprise different promoters. For example, the first promoter and the second promoter may be from the group consisting of a polh promoter, a plO promoter, a basic promoter, an inducible promoter, an El promoters, and a AE1 promoter. For example, in some embodiments, the first promoter is the polh promoter and the second promoter is the p 10 promoter. In some embodiments, the first promoter is the plO promoter and the second promoter is the polh promoter.
[0065] In some embodiments, the first or second promoter may be cloned into pUC57, pFastBacl, modified pUC57, or modified pFastBacl. In some embodiments, the first or secondpromoter may be cloned into pUC57. In some embodiments, the first or second promoter may be cloned into pFastBacl . In some embodiments, the first or second promoter may be cloned into modified pUC57. In some embodiments, the first or second promoter may be cloned into modified pFastBacl .
[0066] In some embodiments, the cap protein, rep protein, first promoter, and second promoter may be cloned into pUC57, pFastBacl, modified pUC57, or modified pFastBacl . In some embodiments, the cap protein, rep protein, first promoter, and second promoter may be cloned into pUC57. In some embodiments, the cap protein, rep protein, first promoter, and second promoter may be cloned into pFastBacl. In some embodiments, the cap protein, rep protein, first promoter, and second promoter may be cloned into modified pUC57. In some embodiments, the cap protein, rep protein, first promoter, and second promoter may be cloned into modified pFastBacl .
[0067] In some embodiments, the polynucleotide sequence further comprises a sequence encoding a linker, such as, for example a cleavable linker. In some embodiments, the cleavable linker is a sequence comprising a 2A peptide. In some embodiments, the 2A peptide may be selected from the 2A peptides derived from Aphthorvirus or Cardiovirus, such as foot-and- mouth disease virus (FMDV), Equine rhinitis A virus (ERAV), Thosea asigna virus (TaV) or porcine teschovirus (PTV-1). In some embodiments, the sequence encoding the linker further comprises a promoter sequence. In some embodiments, the promoter is an FMDV promoter. Recombinant AAV virus particles
[0068] In another aspect, the present disclosure provides a recombinant adeno-associated virus (rAAV) particle prepared by introducing or transfecting the composition of the present disclosure into a host cell. In some embodiments, the host cell is an insect cell, a human cell or an animal cell. In some embodiments, the insect cells are Drosophila S2 cells, Sf9 cells, Sf21 cells, Sf+ cells, or Sf9L5814cells. In some embodiments, the animal cells are fibroblasts, Chinese hamster ovary (CHO) cells, COS cells, murine myeloma (NS0) cells, or Baby Hamster Kidney (BHK) cells. In some embodiments, the human cells are human embryonic kidney 293 (HEK293) cells, human fibrosarcoma (HT-1080) cells, differentiated hepatocyte-derived carcinoma (Huh-7) cells, HeLa cells, or PER.C6 cells. In some embodiments, the host cell is a mammalian cell. In some embodiments, the mammalian cell is HEK293 cell or a derivative such as 293T cells.
[0069] In some embodiments, the preparation includes, but is not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection. In some embodiments, the composition is transfected into the 293 T cells with a helper plasmid. In some embodiments, the 293 T cells are used to produce the rAAV virus particles.
[0070] In some embodiments, the composition of the present disclosure may be delivered into the insect cell by any method known in the art. In some embodiments, the method includes, but is not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, and / or infection. In some embodiments, the composition is infected into the insect cell. In some embodiments, the composition is stably transfected into the insect cell.
[0071] If necessary, in some cases, the rAAV virus particles can be isolated and purified from the insect cells according to conventional methods known to those skilled in the art. For example, the rAAV can be purified using centrifugation, HPLC, hydrophobic interaction chromatography (HIC), anion exchange chromatography, cation exchange chromatography, size exclusion chromatography, ultrafiltration, gel electrophoresis, affinity chromatography, other purification techniques, or any combinations thereof.
[0072] AAV vectors may be produced in adherent or suspension cell culture of various cell lines using transient transfection or virus co-infection methods. Viral particles produced may include full, partial and empty species, which are secreted out of cells into the culture medium or contained inside cells.
[0073] In some embodiments, stable AAV producer cells are generated by transfection and selection of cell lines (including human-derived cell lines and insect S+ cell lines, insect Sf9L5814cell lines, insect S21 cell lines, insect Sf9 cell lines) with an rAAV transfer vector containing the ITR cassette and a packaging construct containing Rep genes and Cap genes, sometimes with the help of auxiliary viruses such as adenoviruses (AdV) that provide the helper function. Alternatively, a helper virus-free method can use a duo or triple transfection protocol employing two or three plasmids including a constructed helper plasmid. The later system is widely used in research and drug development. Furthermore, development of baculovirus expression vectors may provide another method to produce rAAV viruses in insect Sf9 cells. All the above technologies may produce rAAV viruses for use in laboratories and clinical trials.
[0074] Since some of the viral particles may reside inside the host cells, a cell lysis step may be required at harvest to release viral particles into the supernatant. For example, cell lysis reagents such as Triton X-100, Tween 20, or other detergents may be utilized.
[0075] Afterthe cell lysis step, the released AAVs may need to be purified. Some purification step may include clarification, concentration, and diafiltration, filtration, chromatography purification by using affinity chromatography and ion exchange chromatography. Other steps may include ultracentrifugation and gradient ultracentrifugation. In some processes, concentration and diafiltration into suitable excipient buffer composition and sterile filtration may complete the purification processes.Cells
[0076] Provided herein are methods and compositions for generating cells. In some embodiments, cells may comprise cell lines. The cells may be produced by any method disclosed herein. The cells may be tested by any method disclosed herein. In some embodiments, the cells may be free of rhabdovirus. In some embodiments, the level of rhabdovirus is undetectable by PCR. In some embodiments, the level of rhabdovirus is below the limit of detection (LOD). In some embodiments, the LOD may be 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, or 350 copies ofRNA per mL of purified RNA. In some embodiments, the LOD may be 800, 825, 850, 857, 900, 925, 950, 975, 1000, 1025, 1050, 1075, or 1100 copies of RNA per mL of starting material. In some embodiments, starting material may comprise cell culture or viral preparations. In some embodiments, the RNA detected by PCR may correspond to one or more non-coding rhabdovirus RNA genes. Non-coding rhabdovirus RNA genes may comprise a G, H, L, M, N, or P gene, or combinations thereof. Each non-coding rhabdovirus RNA genes may be detected using one or more forward primers, one or more reverse primers, or combinations thereof. In some embodiments, a cell that is considered free of rhabdovirus may comprise no rhabdovirus particles. In some embodiments, a cell free of rhabdovirus may comprise no rhabdovirus nucleic acids. In some embodiments, a cell free of rhabdovirus may comprise no rhabdovirus RNA. In some embodiments, a cell free of rhabdovirus may comprise no detectable rhabdovirus RNA. In some embodiments, detectable rhabdovirus RNA may be present in a sample of one or more cells above a LOD as described herein. In some embodiments, a cell free of rhabdovirus may comprise rhabdovirus nucleic acids below a LOD.
[0077] Provided herein in some embodiments is a population of cells of the present disclosure. In some embodiments, the population of cells may be free of rhabdovirus. In some embodiments, the population of cells may be free of rhabdovirus without downstream purification. In some embodiments, a cell line provided herein may comprise an in-house rhabdovirus-free clonal Sf9 cell line. In some embodiments, a cell line provided herein may demonstrate superior yield and product quality compared to a conventional Sf9 cell line in regard to production of baculovirus and / or AAV. In some embodiments, cells may be frozen following generation of a cell line. In some embodiments, cells may demonstrate a viable cell density of lxlOA7 cells / vial. In some embodiments, cells may demonstrate a viability of greater than or equal to 90% at 3 days post thaw. In some embodiments, cells may demonstrate sterility; bacteriostasis; fungistasis; mycoplasmastasis; and / or undetectable levels of spiroplasmas, mycobacteria, in vitro adventitious agents (including but not limited to those found in MRC-5, Vero 76, BHK-21, and / or Sf9), in vitro adventitious virus detection of inapparent viruses,rhabdovirus, bovine adventitious viruses, porcine adventitious viruses, retroviruses, bovine polyomavirus (BPy V), porcine circoviruses type 1 and 2, and / or nodavirus TNCL.Preparing Non-Contaminated Cell Lines
[0078] Spodopterafrugiperda9 (Sf9) cells (or other Sf cells such as S+ cells, Sf9L5814cell, and S21 cells) using baculovirus as helper virus may be used as a host to produce AAV vectors. Sf cell lines include but are limited to SF+ cell lines, Sf21 cell lines, Sf9 cell lines, and Sf9L5814cell lines.
[0079] However, the commercially available Sf9 cell lines have potential problems. For example, ThermoFisher Sf9 cell line is contaminated with rhabdovirus, which appears to infect insect cells specifically but not human cells. Nonetheless, FDA has started to set strict regulations to require that final drug products be rhabdovirus-free. Therefore, there is a need to generate rhabdovirus-free cell lines for AAV packaging. This problem is applicable to any Sf cells or insect cells used the AAV production.
[0080] Based on such needs, rhabdovirus-free Sf cell lines are generated. Starting from commercially available Sf9 cell lines (e.g., SF+ cell lines, Sf21 cell lines, Sf9 cell lines, and gf9L58i4cep iines)anc] their derivatives, rhabdovirus was removed from the new Sf cell lines either via antiviral treatment and / or sub cloning to single cell colonies as outlined in Example 1. The selected rhabdovirus free clones thus generated and selected were then screened for rAAV production and product quality. In addition, these clones were subjected to continuous passaging, with detection of rhabdovirus conducted at different passage of cells to ensure that they are rhabdovirus-free. Example 2 discloses the selected clone screening for their AAV production and product quality as well as the cell growth during passaging.
[0081] Cell lines may be grown for one or more passages before cloning. In some embodiments, cell lines are grown for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 passages. Cell number may be counted prior to cloning. The percentage of viable cells in each culture may be calculated. The percentage of viable cells may be 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%. Cells may be treated with an antiviral drug. The antiviral drug may comprise but is not limited to one or more of ribavirin, 6-azauridine, or vidarabine, or a combination thereof.Generating Single clonal Sf cells
[0082] In one aspect, single clonal Sf cells are generated with shortened adaptation time by following procedures shown below. In some embodiments, starting with single cell seeding in 96-well plate, the cells are cultured with or without antiviral agent for weeks before switching to 24-well plate, or 125 mL shake flasks, and, in some cases from 24 well plate to 6 well plate and then to T25 untreated-flasks or 125 mL shake flasks. Other switching orders are possible.
[0083] The Sf cells can be non-limiting, any type of Sf cells, including but not limiting to, ATCC Sf9 cell line or derivatives thereof (e.g., ATCC CRL-1711 a derivative thereof) or Sf21 cells (e.g., available from Sigma or ThermoFisher), or other available Sf cell lines (e.g., SF+ cell lines, Sf21 cell lines, Sf9 cell lines, and Sf9L5814cell lines). The Sf cells may be first adapted to adherent growth in a culture media (any commercial culture media in which the specific Sf cells can grow, in particular, any cell culture media that can support cell growth at low cell seeding density, for example, insect cell culture media), optionally supplemented with serum (any serum, either commercially available or tailor made, depending on the Sf cell lines used and the media chosen, e.g., fetal calf serum or fetal bovine serum). For example, some non-limiting examples of the insect cell culture media include: Grace’s insect media, Sf900 II or Sf900 III, EX-CELL insect media, Therapeak media, or TNM-fh insect media. In some embodiments, the insect cell culture media is Grace’s insect media. In some embodiments, the insect cell culture media is Sf900 II media. In some embodiments, the insect cell culture media is Sf900 III media. In some embodiments, the insect cell culture media is EX-CELL insect media. In some embodiments, the insect cell culture media is Therapeak media. In some embodiments, the insect cell culture media is TNM-fh insect media. Other insect cell culture media may work as well.
[0084] The Sf cells may be then diluted down to a pre-determined starting concentration, such as about from about 10 cells to about 100 cells per well, about 100 cells per well, about 80 cells per well, about 60 cells per well, about 40 cells per well, about 20 cells per well, about 15 cells per well, about 10 cells per well, about 8 cells per well, about 5 cells per well, about 3 cells per well, and about 1 cell per well for clonal expansion of Sf cells. The number of cells per well can be evaluated by all kinds of methods, including but not limited to, using a microscope to count the cells. Several different experimental conditions may be used to generate single clonal Sf cells. For each of these conditions: a fixed number of plates (e.g., 15 plates, 13 plates, 10 plates or 8 plates) of 96-well plates may be seeded with a fixed amount of cell suspension (e.g., about 200 pL, about 180 pL, about 160 pL, about 140 pL, about 120 pL, about 100 pL, about 80 pL, about 60 pL, or about 40 pL of cell suspension). Below are some examples of the conditions.
[0085] In condition A, cells may be diluted to about 12 cells per well, 10 cells per well, or about 8 cells per well, about 5 cells per well, about 3 cells per well (using about 140 pL, about 120 pL, 100 pL, about 80 pL, or about 60 pL of cell suspension seeded into each well) with a single antiviral reagent or a combination of antiviral reagents, such as, for example, 6-azuaridine. The concentration of the antiviral reagent is about 1 pg / mL, about 4 pg / mL, about 7 pg / mL, about 10 pg / mL, about 13 pg / mL, about 15 pg / mL, about 18 pg / mL, about 20 pg / mL, about 22 pg / mL,or about 25 pg / mL of a single antiviral reagent, or a combination of antiviral reagents, such as, for example, 6-azuaridine, In Condition B, the cells may be diluted to about 100 cells per well, about 80 cells per well, about 60 cells per well, about 40 cells per well, about 20 cells per well, about 10 cells per well, about 8 cells per well, about 5 cells per well, about 3 cells per well, or about 1 cell per well without the antiviral reagent. In Condition C, the cells may be diluted to about 5 cells per well, about 3 cells per well, or about 1 cell per well with about 1 pg / mL, about 4 pg / mL, about ? pg / mL, about 10 pg / mL, about 13 pg / mL, about 15 pg / mL, about 18 pg / mL, about 20 pg / mL, about 22 pg / mL, or about 25 pg / mL of a single antiviral reagent, or a combination of antiviral reagents, such as, for example, 6-azuaridine, and an insect cell culture media described above, optionally with added serum. In some embodiment, the serum is added at a concentration from about 0.3% to about 30% (v / v) serum for cell growth. In some embodiments, the serum is added at a concentration of about 0.3%, about 1%, about 3%, about 6%, about 9%, about 12%, about 15%, about 18%, about 21%, about 24%, about 27%, or about 30%. In some embodiments, conditioned media is used to grow the cells in the presence or absence of the antiviral reagent. In some embodiments, the conditioned media may be purified by passing through a size exclusion filter (or molecular weight cut-off (MWCO) filter) to remove contaminants, such as a known adventitious agent. In some embodiments, the size of the filter pore is no more than 100 kDa. In some embodiments, the size of the filter pore is no more than 200 kDa. In some embodiments, the size of the filter pore is no more than 300 kDa. In some embodiments, the size of the filter pore from about 100 kDa to about 200 kDa. In some embodiments, the size of the filter pore from about 200 kDa to about 300 kDa. In some embodiments, the MWCO filter comprises a MWCO. In some embodiments, the MWCO is no more than 100 kDa. In some embodiments, the MWCO is no more than 150 kDa. In some embodiments, the MWCO is no more than 200 kDa. In some embodiments, the MWCO is no more than 300 kDa. In some embodiments, the MWCO from about 100 kDa to about 200 kDa. In some embodiments, the MWCO from about 200 kDa to about 300 kDa. In some embodiments, the conditional media is used to grow cells in the presence of the antiviral reagent.
[0086] For all these conditions A-C, in order to dilute to about 100 cells per well, about 80 cells per well, about 60 cells per well, about 40 cells per well, about 20 cells per well, about 10 cells per well, about 8 cells per well, about 5 cells per well, about 3 cells per well, or about single cell concentration, the cells can be first harvested, counted, and diluted to about from about 5 to about 10 cells per 100 pL, from about 10 to 20 cells per 100 pL, from about20 to about 50 cells per 100 pL, from about 50to about 100 cells per 100 pL, from about 100 to about 200 cells per 100 pL, from about200 to about 500 cells per 100 pL, from about 500 to about 750 cells per 100 pL, from about 750 to about 1000 cells per 100 pL, and the cell density of the dilutedculture can be confirmed by various detection methods. After confirming the cell density of the cell culture concentrate, the same cell culture concentrate may be diluted to about 100 cells per well, about 80 cells per well, about 60 cells per well, about 40 cells per well, about 20 cells per well, about 10 cells per well, about 8 cells per well, about 5 cells per well, about 3 cells per well, or about 1 cell per well accordingly and seeded into a 96 well plate. The final cell density after the dilution can be no more than 100 cells per well, no more than 90 cells per well, no more than 80 cells per well, no more than 70 cells per well, no more than 60 cells per well, no more than 50 cells per well, no more than 40 cells per well, no more than 30 cells per well, no more than 20 cells per well, no more than 15 cells per well, no more than 10 cells per well, or no more than 8 cells per well, or no more than 5 cells per well, or no more than 3 cells per well, or 1 cell per well. The cell number in each well can be determined after the seeding. For example, an image of each well can be taken after seeding the cells in the plates, and again at a later time (e.g., 1 day, 2 days, 5 days, 1 week or 2 weeks later). Sf cells can be challenging to clone. Using the procedures described above, multiple single clonal Sf cells, including but not limited to S+ cells, Sf9L5814cells, Sf9 cells, and Sf21 cells, on plates can be obtained.
[0087] The clonality of a cell clone can be determined in different ways and on different days or schedules. For example, microscopic determination can be conducted on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or up to 15 days after seed. Microscopic determination can be done one or two or multiple times after seeding. The determination can be done using methods other than the microscopic determination. The clonality of a cell clone may be confirmed by microscopy at the day of seeding the cells, then at a later time, such as, for example, about 5 days later, or about 1 week later, or about 2 weeks after cell seeding and culture. For each condition, on the second time to confirm the cell numbers in wells, for example, on Day 6, all plates may be checked via microscopy before changing media. On that second time, for example, on Day 6, no significant expansion is observed for the cells for all Conditions A-C. Then on additional time points, such as, for example, on Day 7 and Day 15, portion of the insect cell culture media is removed, such as for example, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, or about 75% of the culture media can be removed and replaced with fresh insect cell culture media for all conditions. However, no additional antiviral agent or conditioned media (e.g., insect cell culture media that is harvested from cultured cells) are added to Conditions A and C, respectively. In other words, in all Conditions A-C, on the additional time points, such as, for example, on Day 7 and Day 15, about 9%, about 12%, about 15%, about 18%, about 20%, about 25%, about 30%, about 35%, about 40%, about45%, about 50% , about 55%, about 60%, about 65%, about 70%, or about 75% of the culture media can be removed and replaced with the same fresh insect cell culture mediawithout serum. After additional time, for example, after 15 days, cells are observed daily to monitor the cell growth in the wells. When a plurality cell clusters are observed to form colonies, they are transferred to 24 well plates. At this point, confluency of the well can be observed under the microscopy and the results can be from about 40% to about 90% confluency. After confirming colonies are formed, transfer the cell cultures from the 96-well plates to 24- well plates, the cells are adapted directly to suspension. In some embodiments, the day of transferring from 96-well plates to 24-well plates is no later than 30 days from the seeding. The above procedures of all Conditions A-C may shorten the adaptation time when compared with previously known Sf cell line generation procedure, including Sf9 cell line generation procedures. About 1-2 months after initial cell seeding, the clones that grow well in the 24 well plates can be scaled up to 6-well plates for the following expansion into T25 flasks or 125mL shake flasks. The date to transfer the clones to T25 flasks or 125mL shake flasks is no later than 60 days from the seeding. Rhabdovirus free status of the clones may be confirmed at the 24 well plate stage or 6 well plate stage for quality control purposes. In some embodiments, at least one type of tissue culture 24-well plate, tissue culture 6-well plate, tissue culture T25 flask, and tissue culture 125 mL shake flask is non-tissue culture treated. In some embodiments, at least tissue culture 24-well plate is non-tissue culture treated. In some embodiments, at least tissue culture 6-well plate is non-tissue culture treated. In some embodiments, at least tissue culture T25 flask is non-tissue culture treated. In some embodiments, at least tissue culture 125 mL shake flask is non-tissue culture treated. In some embodiments, at least two types of tissue culture 24-well plate, tissue culture 6-well plate, tissue culture T25 flask, and tissue culture 125 mL shake flask are non-tissue culture treated. In some embodiments, all of tissue culture 24-well plate, tissue culture 6-well plate, tissue culture T25 flask, and tissue culture 125 mL shake flask are non-tissue culture treated.
[0088] When the clones are transferred into either T25 or 125ml shake flasks, they can be defined as Passage 0 (P0). At Passage 1 (Pl) and all subsequent passages, the cells are cultured in suspension shake flasks of various sizes. Clones can be adapted in insect cell culture media. Cells may be banked at various passages (e.g., P0, Pl, P2, P4, P6, and / or P10). Cells that are banked can be revived and further passaged up to, for example, passage 40, passage 50, or passage 60. Cells can be adapted into different culture media, banked and then revived in the same insect cell culture media the cells were cultured before, or use a different insect cell culture media. Cells may stay rhabdovirus-free to at least 60 passages. Rhabdovirus free status of the clones is confirmed for quality control purposes. The testing protocol can be found in another section of this disclosure. RT-qPCR using up to 6 primer sets targeting any or all 6 different genes (G, H, L, M, N, and P) may be conducted at different stages of the clone development. Forexample, RT-qPCR on samples may be tested at the 24 well stage, Passage 0, Passage 1, Passage 2, and / or Passage 8-10 for confirmation of samples’ rhabdovirus free status. Those passages contaminated with rhabdovirus may be discarded.
[0089] The final rhabdovirus-free Sf clone selected according to AAV productivity and quality generated by the above conditions can be used in AAV production for different serotypes, including, for example, AAV2, AAV2m, AAV5, AAV8 and AAV9. Final clone selected showed better yield and final product quality comparing to original rhabdovirus containing cell production under the same process procedures.
[0090] FIG. 6 shows product quality attributes for several clones prepared in the process of generating a final rhabdovirus-free Sf clone.Rhabdovirus Detection Methods
[0091] As part of the discovery for the generation of rhabdovirus-free Sf cell lines, including but not limited to, S+ cell lines, Sf9L5814cell lines, Sf9 cell lines and Sf21 cell lines, a new rhabdovirus detection method is also developed. This new method uses a new sample dilution buffer recipe and new primer probes for the hybridization assay, thereby achieving one-step detection for the presence of rhabdovirus with high sensitivity.
[0092] RT-qPCR based commercial rhabdovirus detection kit may suffer from low sensitivity, lot to lot variation of quantitation, and linearity issues. In addition, standard curve preparations or sample dilutions usually cannot be saved for repeat testing. A new sample dilution buffer was developed which is able to increase the quantitation range of the qPCR assay and stabilize the diluted standards or samples. Therefore, samples or standards can be saved for at least a week, at least a dozen days, or at least two weeks.
[0093] For example, commercially available reverse transcription polymerase chain reaction (RT-qPCR) to detect rhabdovirus (e.g., ViralSEQ™ Quantitative Sf-Rhabdovirus Kits, Catalog number: A50496, ThermoFisher) is a two-step RT-PCR assay for the detection of Sf- rhabdovirus, and suffers from sensitivity and linearity issue when used to detect rhabdovirus in recombinant products manufactured in insect cell lines using baculovirus expression systems. RT-qPCR is a laboratory technique combining step 1 : reverse transcription of RNA into DNA (also known as complementary DNA (“cDNA”)) and step 2: amplification of specific DNA targets from cDNA using quantitative polymerase chain reaction (qPCR). This two-step RT- qPCR assay is used to measure the amount of a specific RNA by monitoring the amplification reaction using fluorescence, a technique called real-time PCR or quantitative PCR (qPCR).Table 2 summarizes the performance of the new method disclosed here when a primer / probe set for one of the rhabdovirus genes is used.
[0094] Table 2. Summary of Performance for an Example RT-qPCR of the New MethodLLQQ: lower limit of quantitationULOQ: upper limit of quantificationLOD: limit of detectionLOB: limit of blankCV: coefficient of variationANOVA: analysis of varianceRV+ PC: rhabdovirus positive control
[0095] In addition, standard curve preparations or sample dilutions used in two-step RT-qPCR assay usually cannot be saved or used repeatedly due to stability reasons. To solve the above problems, the inventors developed a new sample dilution buffer which can increase the quantitation range of the qPCR assay and stabilize the diluted standards or samples at the same time. Consequently, samples or standards can be saved for at least a week, at least a dozen days, or at least two weeks. FIG. 4 shows a sample standard curve for the new method disclosed herein. In FIG. 4 X axis is log copy number and Y axis is Cq value.
[0096] The detection method disclosed herein is also a true one-step method, which does not require any addition of reagents after settingup the reaction. Additionally, a deoxyribonuclease (DNase) treatment step is added in the new method to decrease the possibility of DNA contamination, such as genomic DNA (gDNA) contamination. Furthermore, for extended characterization, primer probe sets were designed against all five canonical genes of the rhabdovirus genome. Rhabdovirus genomes are diverse and often complex because the five canonical genes may be overprinted, overlapped or interspersed with a range of novel accessory genes. For example, the rhabdovirus genome may encode the following five canonical rhabdovirus structural proteins: nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and large protein (L, a polymerase).
[0097] Briefly, RNA samples from the Sf (e.g., Sf9, Sf21, Sf9L5814, or Sf+) cell cultures are prepared using commercial kits. This step can adopt a variety of methods depending on the needs. For example, RNA can be extracted from media / cell mix using ThermoFisher’s magmax total RNA isolation kit (catalogue no. AMI 830, ThermoFisher). Other commercial kits or research kits for RNA extraction can be used. Then the amount and purity of the extracted RNA is measured by NanoDrop Spectrophotometers (NDS). After the nanodrop, up to 10 pL of RNA is used for the one-step RT-qPCR method. A dsDNase digestion step is set up first. Then the reverse transcription (RT) enzyme mix is added and mixed well before reaction is set up. For example, the commercially available Vazyme’s HiScriptlll one step RT-qPCR kit can be used. In some embodiments, some reagents in the commercial kits can be replaced with reagents from other vendors. In some embodiments, some enzymes in the commercial kits can be replaced enzymes from other commercial kits. In some embodiments, that gDNA cleanup is done by a dsDNase on the market. The efficiency and the impact on the sensitivity of the assay can be assessed when replacing some reagents in the commercial kits with other commercially available reagents. The running protocol is the same as the vendor (Vazyme) suggested. Other protocols can be used. In some embodiments, one or more synthesized RNA fragments (i.e., one or moreN, G, L, M, or P gene) with or without capping, without uridine modification and with added polyA tail is used as the standard. In some embodiments, other synthesized RNA fragments (e.g., H gene) with or without capping, without uridine modification and with added polyA tail is used as the standard. Dilution of RNA standards is carried out using the sample dilution buffer. In certain cases, dilution of the RNA sample is also needed. In those cases, the same sample dilution buffer is used to dilute the RNA sample.Definitions
[0098] As used in the specification and claims, the singular forms “a”, “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “rAAV particle” includes one or more rAAV particles.
[0099] The term “about” or “approximately” refers to a particular value within the acceptable error range determined by a person of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, according to the practice in the art, “about” can mean within 1 or more than 1 standard deviation. Alternatively, “about” can mean a range of up to 20 %, up to 10 %, up to 5 %, or up to 1 % of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, up to 5-fold, or up to 2-fold, of a value. Where particular values can be described in the application and claims, unless otherwise stated the term “about” meaning up to an acceptable error range for the particular value should be assumed.
[0100] As used herein, the terms “Sf9 rhabdovirus” or “rhabdovirus” generally refer to rhabdovirus whose nucleic acid sequence is provided herein as SEQ ID NO: 1. As used herein, the term “replication competent” or “replication capable”, when used to describe a Sf9 rhabdovirus or Sf9 rhabdovirus ribonucleic acid (RNA) molecule, means a virus or an RNA molecule which is self-replicating and provides for transcription in a host cell.
[0101] As used herein, in the case of a polynucleotide, the term “sequence” generally refers to the sequence of nucleotides in the polynucleotide in the direction from the 5’ end to the 3’ end, wherein the nucleotides adjacent to each other in the sequence are in the polynucleotide. It is continuous in the primary structure. The sequence can also be a linear sequence of a part of a polynucleotide known to contain additional nucleotides in one or two directions.
[0102] As used herein, the term “insect cell culture media” generally refers to culture media in which the specific Sf cells (e.g., Sf+ cells, Sf9L5814cells, Sf9 cells or Sf 21 cells) can grow, in particular, any cell culture media that can support cell growth at low cell seeding density. Non-limiting examples of insect cell culture media include: Grace insect media, Sf900 II or Sf900 III, Excell insect media, Therapeak media, or TNM-fh insect media, etc.
[0103] As used herein, the terms “antiviral drug” or “antiviral reagent” or “antiviral agent” generally refer to a chemical reagent that kills viruses. Non-limiting examples include nucleoside analogs, interferon, and viral-specific antibodies, for example but not limited to neutralizing monoclonal or polyclonal antibodies. Non-limiting examples of nucleoside analogs include ribavirin, 6-azauridine, vidarabine, acyclovir, 9- / 3-D-Arabinofuranosyladenine (Ara-A), cytosine arabinose, adenine arabinoside, and Guanine 7-N-oxide (G-7-Ox). More preferably, the antiviral drug comprises at least one of ribavirin, 6-azauridine, and vidarabine. In some embodiment, the antiviral drug is 6-azauridine.
[0104] As used herein, the terms “identity,” “homology,” or “sequence identity” generally refer to the similarity or interchangeability between two or more polynucleotide sequences or between two or more polypeptide sequences. When using program such as Emboss Needle or BestFit to determine the sequence identity, homology, or similarity between two different amino acid sequences, the default settings may be used, or an appropriate scoring matrix may be selected, such as blosum45 or BLOSUM80, to optimize the identity, similarity, or homology score. Preferably, homologous polynucleotides are those that hybridize under stringent conditions as defined herein and have at least 70 %, preferably at least 80 %, more preferably at least 90 %, more preferably at least 95 %, more preferably at least 97 %, more preferably at least 98 %, and even more preferably at least 99 % sequence identity. When a sequence of comparable length is optimally aligned, homologous polypeptide preferably has at least 80 %, at least 90 %, at least 95 %, at least 97 %, at least 98 % sequence identity, or at least 99 % sequence identity.
[0105] With regard to the polypeptide or polynucleotide herein, the “percent sequence identity (%)” is defined as the percentage of amino acid residues or nucleotides in the query sequence that are identical to the amino acid residues or nucleotides of the second, reference polypeptide / polynucleotide sequence or part thereof calculated after aligning the sequences and introducing gaps if necessary to obtain the maximum sequence identity percentage, and not removing any conservative substitutions that are regarded as part of sequence. The alignment aimed at determining the percentage of amino acid sequence identity can be achieved in various ways within the skill of the art, such as using publicly available computer software, such as the BLAST, BLAST-2, ALIGN, NEEDLE, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including the full length of the sequences being compared is eligible for any algorithms needed to obtain maximal alignment. The percent identity can be measured over the length of the entire defined polypeptide / polynucleotide sequence, or can be measured over a shorter length, for example, thelength of a fragment taken from a larger, defined polypeptide / polynucleotide sequence, such as A fragment of at least 5, at least 10, at least 15, at least 20, at least 50, at least 100, or at least 200 consecutive residues / nucleotides. These lengths are exemplary only, and it should be understood that the forms herein shown in the drawings, or the sequence supported in the Sequence Listing can be used to describe any fragment length thereon may be measured with a percentage of the length.
[0106] The proteins described herein may have one or more modifications relative to the reference sequence. The modification may be deletion, insertion or addition, or substitution or substitution of amino acid residues. “Deletion” refers to a change in amino acid sequence due to the lack of one or more amino acid residues. “Insertion” or “addition” refers to an amino acid sequence change that results in the addition of one or more amino acid residues compared to a reference sequence. “Substitution” or “substitution” refers to the replacement of one or more amino acids with different amino acids. In the present disclosure, the mutation of the polypeptide relative to the reference sequence can be determined by comparing the polypeptide with the reference sequence. The optimal alignment of sequences for comparison can be performed according to any known method in the art.
[0107] As used herein, the term “primer” generally refers to a series of nucleotide residues that has a sufficient number of bases to be used in a PCR reaction. A primer may be used to amplify, confirm, or reveal the presence of an identical, similar, or complementary deoxyribonucleic acid (DNA) or RNA in a sample. As used herein, the term “probe” refers to a nucleic acid sequence used in the detection of identical, similar, or complementary nucleic acid sequences
[0108] As used herein, the term “extracted” refers to the isolation and / or separation of cellular or other components that are associated with, in nature, polynucleotides, peptides, polypeptides, proteins, antibodies or fragments thereof under normal circumstances. Those skilled in the art should understand that non-naturally occurring polynucleotides, peptides, polypeptides, proteins, antibodies, or fragments thereof do not need to be “isolated” to be distinguished from their naturally occurring counterparts. In addition, “concentrated”, “isolated” or “diluted” polynucleotides, peptides, polypeptides, proteins, antibodies, or fragments thereof are distinguishable from their naturally occurring counterparts because of their concentration or number of molecules per unit volume is greater than (“concentrated”) or less than its naturally occurring counterpart (“isolated”). Enrichment can be measured based on absolute amounts, such as the weight of solution per unit volume, or it can be measured relative to the second, potentially reference species present in the source mixture.
[0109] The terms “polynucleotide”, “nucleic acid”, “nucleotide” and “oligonucleotide” are used interchangeably. They refer to polymeric forms of nucleotides of any length (whether they aedeoxy ribonucleotides or ribonucleotides) or their analogs. A polynucleotide can have any three- dimensional structure and can perform any known or unknown function. The following are nonlimiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, loci determined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, isolated plasmids, vectors, any DNA isolated sequence, any RNA sequence, nucleic acid probes, primers, or a synthetic oligonucleotide DNA. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after polymer assembly. The sequence of nucleotides can be interrupted by non-nucleotide components. The polynucleotide can be further modified after polymerization, for example, by conjugation with a labeling component. When referring to a DNA / RNA, A can mean adenine, C can mean cytosine, G can mean guanine, T can mean thymine, U can mean uracil. U and T can be used interchangeably when referring to a DNA or an RNA.
[0110] When applied to polynucleotides, “recombinant” means that the polynucleotide is the product of cloning, restriction digestion, ligation, other procedures that produce constructs different from those found in nature, or any combinations thereof. When applied to polypeptides, “recombinant” means that the polypeptide is the expressed / translated product of a recombinant polynucleotide.[OHl] The terms “gene” or “gene fragment” are used interchangeably herein. They refer to a polynucleotide containing at least one open reading frame, the open reading frame capable of encoding a particular protein after transcription and translation. Gene or gene fragment may be a gene group, the cDNA, or synthetic, as long as the polynuclear nucleotide comprises a sequence having at least one open reading frame, the open reading frame may cover the entire coding region or a section thereof.
[0112] The term “variant” as used herein generally refers to a polynucleotide or polypeptide having a sequence substantially similar to a reference polynucleotide or polypeptide. Procedures for the introduction of nucleotide and amino acid changes in a polynucleotide, protein or polypeptide (see, e.g., Sambrook et al. (1989)). In the case of a polynucleotide, a variant can have deletions, substitutions, additions of one or more nucleotides at the 5' end, 3' end, and / or one or more internal sites in comparison to the reference polynucleotide. Similarities and / or differences in sequences between a variant and the reference polynucleotide can be detected using conventional techniques known in the art, for example polymerase chain reaction (PCR) and hybridization techniques. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis.Generally, a variant of a polynucleotide, including, but not limited to, a DNA, can have at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the reference polynucleotide as determined by sequence alignment programs. In the case of a polypeptide, a variant can have deletions, substitutions, additions of one or more amino acids in comparison to the reference polypeptide. Similarities and / or differences in sequences between a variant and the reference polypeptide can be detected using conventional techniques known in the art, for example Western blot.Generally, a variant of a polypeptide, can have at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the reference polypeptide as determined by sequence alignment programs.
[0113] As used herein, “expression” refers to the process by which polynucleotides are transcribed into mRNAs, and / or the process by which transcribed mRNAs (also referred to as “transcripts”) is subsequently translated into peptides, polypeptides, or proteins. The transcripts and the encoded polypeptides are collectively referred to as gene products. If the polynucleotide is derived from genomic DNA, expression may include splicing of mRNA in eukaryotic cells.
[0114] As used herein, the term “vector” refers to a nucleic acid delivery vehicle into which polynucleotides can be inserted. When the vector can express the protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into the host cell through transformation, transduction, infection, or transfection, so that the genetic material it carries can be expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to: plasmids; phagemids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or artificial chromosomes (PAC) derived from Pl; bacteriophages such as lambda phage or Ml 3 phage body and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillae Polyoma vacuole virus (such as SV40). A vector can contain a variety of elements that control expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may also contain an origin of replication site.
[0115] As used herein, the term “AAV virion” or “AAV viral particle” generally refers to a viral particle composed of at least one AAV capsid protein and an encapsulated AAV polynucleotide.
[0116] As used herein, the term “host cell” refers to a cell that can be used to be introduced with a vector, which includes, but is not limited to, prokaryotic cells such as Escherichia coh or Bacillus sublilis, or yeast or fungal cells such as Aspergillus, or insect cells such as Drosophila S2 cells, Sf cells, Sf+ cells, Sf9L5814cells, Sf21 cells, or Sf9 cells, or animal cells such as fibroblasts, CHO cells, COS cells, NSO cells, BHK cells, HEK293 cells, HEK293 derivatives 293 T cells, HeLa cells, or human cells.
[0117] As used herein, the terminology that a cell line, sample, protein, peptide, drug substance, biological product, vaccine antigen, VLP preparation, and the like is “substantially free” of a virus means that the cell, sample, protein, peptide, drug substance, biological product, vaccine antigen, VLP preparation and the like does not comprise a detectable level of the virus as measured by a PCR or RT-qPCR assay or the like.
[0118] While various embodiments of the disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed.
[0119] Some embodiments of the present disclosure are further illustrated by the following examples, which should not be construed as limiting. Those skilled in the art will understand that the techniques disclosed in the following examples represent techniques that the inventors have found to work well in the implementation of the embodiments of the present disclosure described herein and can therefore be considered to constitute a useful tool for implementing these embodiments. However, based on the present disclosure, those skilled in the art will understand that without departing from the spirit and scope of the present disclosure, many changes can be made in the specific embodiments disclosed herein, and the same or similar results can still be obtained.EXAMPLES
[0120] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.
[0121] Example 1: Rhabdovirus Free Sf9 Cell Line Development
[0122] The purpose of Example 1 is to generate a Rhabdovirus free Sf9 cell line to produce AAV viral particles. This Example describes cell cloning, expansion, banking, and production experiments for the selection of clones. Other Sf cell lines (e.g., Sf+ cell lines, Sf9L5814cell lines, and Sf21 cell lines) can be similarly developed. Example equipment for growing cells includes but is not limited to the following: microscope, pipets, shaking incubators, real-time PCRsystem, water jacketed incubators, etc. Any commercially available equipment that can fulfill the task can be used. Example materials used for growing cells includes but is not limited to the following: total RNA isolation kits, insect cell culture media, antiviral reagents, tissue culture treated 96 well plates, tissue culture 24 well plates, tissue culture 6 well plates, cell culture flask (125 mL, or 250 mL, or 500 mL, or 1 L), and liquid handler.
[0123] An Sf9 cell line was passed in insect cell culture media in suspension for two passages. Then cells were adapted to adherent growth using insect cell culture media supplemented with serum (e.g., from about 5% to about 10% serum). After anotherthree, four, five, or six passages, cells obtained were subjected to cloning in tissue culture treated 96 well plates. On the day of cloning, cell culture was counted and the cell counting information was as follows: about1 *10A6 total cells, about0.9*10A6 viable cells (about 90% viable). The cell culture was diluted to about 30 to about 100 cells per 100 pL as a diluted cell culture concentrate. The cell density of the diluted cell culture was checked by plating 100 pL of the diluted cell culture in a well of a 96 well plate. After confirming that the cell density of the diluted cell culture was about 30-100 cells in the well, the diluted cell culture was further diluted to about 100 cells per well, about 8 cells per well, about 5 cells per well, about3 cells per well, and 1 cell per well. The cell density of the further diluted cell culture in the wells was further confirmed with microscopy data.
[0124] Imaging was used to confirm cell density. Cells were seeded using a liquid handler to 96 well plates and then imaged the first well of each plate. Images were taken for wells seeded with cell culture on the 96 well plates. Cell density was confirmed for wells seeded with cell culture by images. An example image of Day 1 a full well with a single cell circled is depicted in FIG. 1. An enlarged image of Day 1 a partial well showing the single cell circled and pointed to by an arrow is depicted in FIG. 2. About 30% of wells were confirmed single clonal for Condition B on the seeding day.
[0125] Three different conditions were tested as follows: Condition A: about 5 cells per well + antiviral drug in insect cell culture media, on 10 plates; Condition B: 1 cell per well + no antiviral drug in insect cell culture media, on 10 plates; Condition C: 1 cell per well + antiviral+ conditioned supplement medium (from insect cell culture and pretreated enzymatically to be used as a supplement, then, optionally, filtered with Amicon® size exclusion filter(s)); 20% of supplement media was used in each well that contains antiviral drug, on 10 plates. The antiviral drug used was ribavirin, 6-azauridine, or vidarabine, or a combination thereof.
[0126] After about 1 week, about half of the media was replaced by fresh complete insect cell culture media, and cells were cultured for an additional week or more before imaging to examine clonal growth. An example image at Day 14 of a full well with a cell clone is shown in FIG. 3.
[0127] When the cells became confluent, cells were passed into either multiwell tissue culture plates or shake flasks of gradually increased culture capacity and cells were adapted to suspension during the process of clone selection and expansion.
[0128] Regarding exchanging media on the 96 well plates, it can be conducted once, twice, three times or more. In an embodiment, on day 7 and day 15 after seeding, from about 20% to about 80% of the media was changed to fresh insect cell culture media supplemented with serum or without serum.
[0129] All clones were analyzed. A particular clone was selected for further characterization based on growth, rhabdovirus-free status, clonality, and AAV productivity. The selection is described in Example 2. Briefly, the selected clone tested negative for rhabdovirus genome RNA at all stages for testing including passage testing.
[0130] About 1 mL of cell culture was sampled during the whole cell line development process starting at the 24 well stage. RNA from the samples was then extracted using a total RNA isolation kit (one of the commercially available RNA isolation kit, e.g., PrepSEQ or ThermoFisher MagMax). Different amounts of extracted RNA can be used in the reverse transcription reaction depending on the samples tested and the commercial RNA isolation kit used. For example, about 10 pL of extracted RNA was used for each reverse transcription (RT) reaction using a commercially available RT-qPCR kit (e.g., SuperScript IV VILO ThermoFisher Cat No. 11756050, PrimeTime One-Step RT-qPCR Master Mix IDT Cat No. 10007065, or ViralSEQ Quantitative Sf-Rhabdovirus Kit ThermoFisher Cat No. A50484). After that cDNA was diluted about 5 fold, about 10 fold, about 15 fold, or about 20 fold depending on the sample and the commercial RNA isolation kit used. Then about 10 pL of the diluted cDNA (or other amount of the diluted cDNA sample, e.g., 8pL or 9 pL) was used for each PCR reaction using from 1 to 5 different qPCR primer sets targeting 1 major protein or all 5 major proteins of the rhabdovirus. The testing was according to the procedure disclosed in Example 2. The testing procedure may also be adapted to use a one step RT-qPCR kit from Vazyme (for example, after passage 50) or other one step RT-qPCR kits. The one step RT-qPCR method used about 10 pL of the extracted and 10x serially diluted RNA standards estimated to be from about 0.1 pg to about 1 pg of RNA in the starting material for the RT-qPCR per reaction. This volume or amount RNA may vary. For example, RNA was diluted according to sample types. For example, samples may or may not be diluted to fall in the range of 1 x dilution to about 250 x dilution, or any number in-between. In some examples, DS / DP sample were not diluted. RV+ Sf9 RNA sample was diluted about 125 x. Other samples, if they fell out of the range, were diluted 5x. RNA standards were diluted 10x per dilution to obtain concentrations from 1 x!0A10 copies / mL to 1000 copies / mL.
[0131] Example 2: Quantification and Detection of Rhabdovirus Viral Genome in Purified RNA Samples by One-Step RT-qPCR
[0132] The purpose of Example 2 is to quantify and identify the presence or absence of rhabdovirus viral genome in purified RNA samples. Specifically, RT-qPCR technique was used to amplify rhabdovirus RNA genome for the detection of its existence in samples with low levels of rhabdovirus and to quantify the amount of rhabdovirus RNA present in samples with high levels of rhabdovirus. The sample type was RNA purified from different types of starting materials (drug substance, drug product, crude biological material, or cell culture). Both negative and positive strand RNA were detected since random primers were used in the reverse transcription reaction mix.
[0133] Example equipment used includes but is not limited to: qPCR instrument, vortex machine (vortexer), microcentrifuge or centrifuge, and microplate centrifuge. Example materials used include but are not limited to: buffers at the appropriate pH for the test or treatment, distilled water that is DNase and RNase Free, concentrated PCR buffers , tRNA (commercially available tRNA for RT-qPCR reactions), block co-polymers used in suspension culture (e.g., polyoxyethylene-polyoxypropylene block copolymer), dsDNase, commercially available one step qRT-PCR probe kit, 384-well PCR plate, optical adhesive film, positive control (samples confirmed to contain rhabdovirus), and rhabdovirus-negative (non-coding) RNA (supplied by TriLink Biotechnologies or GenScript or other commercial suppliers).
[0134] For each of the rhabdovirus non-coding RNA genes (G, H, L, M, N and P), at least one set of forward primer / reverse primer / probe was designed based on the sequences of the target non-coding RNA gene. See Table 3.
[0135] Table 3 Primers and probes (“Primer / Probe set”) for rhabdovirus non-coding RNA genes
[0136] Centrifuge tubes were spun containing the powder of Primer / Probes assay set ordered at 2:2:1 ratio for Forward Primer / Reverse Primer / Probe. In some embodiments, other ratios for Forward Primer / Reverse Primer / Probe are possible. In some embodiments, the ratio for Forward Primer / Reverse Primeris about5:l, about4:l, about3:l, about2:l; about 1:1, about 1:2, about 1 :3; about 1 :4, or about 1 :5. In some embodiments, the ratio for Forward Primer / Probe is about 5:1, about4:l, about3:l, about2:l; about 1:1, about 1:2, about 1:3; about 1:4, or about 1:5 when the ratio for Forward Primer / Reverse Primer is independently about 5:1, about4:l, about 3:1, about 2:1; about 1:1, about 1:2, about 1:3; about 1:4, or about 1:5.
[0137] Primer / Probe assay was dissolved with a buffer (pH at about 7-8, e.g., a Tris-EDTA buffer) to make a Primer / Probe 10x Stock Solution. The concentration of reconstituted primers was about 100 pMand the probe was about 50 pMin the stock solution if the ratio for ForwardPrimer / Reverse Primer / Probe was 2:2:1. Other ratios can be used. This Primer / Probe 10x Stock Solution may be stored at -20 °C for up to one year after date of preparation.
[0138] Distilled water (about 900 pL) was mixed with Primer / Probe 10x Stock Solution (about 100 pL) prepared above to make the Primer / Probe Working Solution. This amount (about 1 mL) of the Primer / Probe Working Solution was sufficient for multiple assays. This can be kept frozen at -20 °C for up to one year after date of preparation. The final concentration was about 10 pM for the primers and 5 pM for the probe if the ratio for Forward Primer / Reverse Primer / Probe was 2:2:1. Other ratios can be used.
[0139] Distilled water was mixed with Tris-HCl based buffer that is suitable for one step RT and PCR reactions at about pH 7-9 (about 0.1 to about 0.5 parts), tRNA 0.01-0.5 parts, and block co- polymer (about 0.1 -0.5 parts) to afford tSDB. This amount of tSDB was sufficient for multiple assays. This tSDB can be kept frozen at -20 °C for about 3 months after the date of preparation.
[0140] A working stock standard can be prepared as follows: serially dilute by adding about 10 pL of RhabdovirusRNA Stock into about 990 pL of tSDB. Dilute further 10-fold (final dilution is 1000-fold) by adding about 100 pL of the first dilution into about 900 pL tSDB.
[0141] Rhabdovirus RNA Working Stock Standard was made by making a 1000-fold dilution of a rhabdovirus RNA stock, to provide a final concentration about l xlOA12 copies / mL.Rhabdovirus RNA Working Stock Standard was aliquoted into single-use 8 pL aliquots, and these aliquots can be store at <-65°C for 6 months after date of preparation. The final concentration of this rhabdovirus RNA Working Stock Standard was about 1 xlOA12 copies / mL, which is equivalent to l xl0A10 copies / reaction in the assay described herein.
[0142] A double stranded DNase (dsDNase, 1 part, commercially available) was 5x diluted in distilled water (4 parts) to afford the dsDNase Working Solution. This dsDNase working solution was kept in -20°C mini cooler or on ice before use.
[0143] One-Step Mastermix was prepared by mixing one step mix (6 parts, commercially available) with the dsDNase Working Solution (1 part) made above in distilled water (1 part) to afford the One-Step Mastermix. It was used on the day of preparation.
[0144] The RT Enzyme Mix was prepared by mixing one step enzyme mix (15 parts, commercially available), the Primer / Probe Working solution prepared above (6 parts), and distilled water (99 parts) to afford the RT Enzyme Mix. It was used on the day of preparation.
[0145] The No-RT Control (NRT) Mix was prepared by mixing the Primer / Probe Working solution prepared above (6 parts), and distilled water (114 parts) to afford the NRT Mix. Reverse transcriptase in the RT Enzyme Mix was replaced with an equivalent volume of water to prepare this control.
[0146] Samples and controls were thawed on ice. After thawing, the extraction plate was moved to a 96-well magnetic stand. The plate was left on the magnetic stand from about 1 minute to about 15 minutes before pipetting. The plate can be kept on the magnetic stand or the plate can stand alone while pipetting the eluates. In some cases, there is no need to run this step. After thawing, the eluates were pipetted directly from the 96-well plate.
[0147] In tubes, serial dilution of the rhabdovirus RNA standard in tRNA sample dilution buffer (tSDB) was performed followed by vortexing. Note: volumes may be scaled up or down, but concentrations must remain the same. Vortex thoroughly after performing each dilution.
[0148] For the Sf9 rhabdovirus positive control (if applicable) and any test samples derived from crude material that is rhabdovirus positive, extracted RNA sample was tested neat or serially diluted from about 5 fold to about 125 fold in tSDB.
[0149] For test samples (TS) derived from rhabdovirus negative crude material, the extracted RNA was diluted in tSDB so that the total RNA was in the range from about 0.1 pg to about 1 pg per reaction (0.01 pgto 100 ngper pL). Note: if it is necessary to dilute, it is recommended to dilute to be in this range. For drug substance or drug product test samples, no dilution of the extracted RNA is required.
[0150] In triplicate, 10 pL of the standard curve, controls, and test samples were pipetted into a qPCR plate. See the example half plate layout in Table 4. Test samples were prepared as technical replicates (N=9 per test sample). For no template control, 10 pL of tSDB was pipetted in triplicate. For negative extraction control, 10 pL of negative extraction control (NEC) was pipetted in triplicate (extraction performed in duplicate for NEC). For positive control (PC), 10 pL of PC was pipetted in triplicate (extraction performed in duplicate for PC). For No-RT control, 10 pL of STD 1 of the Rhabdovirus RNA Standard Curve was pipetted in triplicate.
[0151] Table 4. Example Half Plate Layout.
[0152] One Step RT-qPCR Procedure: experimental procedure before the RT-qPCR (other vendor-specific procedure can be used instead):• Pipetted 8 pL of One Step Mastermix into the qPCR plate.• Let the plate sit for 5-30 minutes at room temperature for DNase digestion.• Pipetted 12 pL of RT Enzyme mix into the qPCR plate, except for the wells containing the No-RT control.• To the wells containing the No-RT control, added 12 pL of the NRT Mix.• Set the pipette to 25 pL and pipette mixed all wells at least 10 times.• Sealed the plate with Optical Adhesive Film.• Spun the plate at lOOOxg for 2 minutes.
[0153] The plate was placed on a qPCR instrument and the following protocol was run for RT- qPCR reactions: a) reverse transcription step at 45-65 °C 10-30 min; b) an initial denaturation step at95 °C for 15-45 sec; c) a qPCR step with step 1 : at95 °C denature temperature 10-15sec, step 2: at 60 °C annealing temperature 30-45 seconds, and repeat step 1 and step 2 for multiple times (e.g., 30 times or 40 times).
[0154] Data was analyzed using vendor software (e.g., BioRad mastrosuite software).Regression analysis was conducted. As shown in FIG. 5, a final generated cell line was free of any rhabdovirus genome sequence.
[0155] Example 3: Extraction of Residual Rhabdovirus RNA in Cell Culture and Crude Recombinant Baculovirus (rBV) Materials
[0156] The purpose of Example 3 is to extract rhabdovirus RNA in cell suspension and cell pellet samples. The extracted total RNA can be samples for further RT-qPCR analysis to detect the presence or absence of rhabdovirus genome.
[0157] RNA was extracted according to manufacturer kit instructions. Rhabdovirus positive control (RV+ PC) was prepared by diluting the RV+ PC to a concentration no more than 1.0><10A7 cells / mL. Cells were thawed and diluted as needed. Cells were plated on 96 well plates. RV+ Sf PC was added to the 96-deep well plate in triplicate. RNA was extracted once but elute twice. Eluates were combined. A total of two RNA extractions in triplicate could be performed for the PC, if required. The protocol is summarized below.
[0158] Example equipmentused includesbutis notlimited to: microplate shaker, thermomixer, thermocycler, qPCR instrument, vortexer, and microplate centrifuge. Example materials used include but are not limited to: total RNA isolation kit (commercially available kits such as Qiagen RNeasy Plus RNA isolation kit, Magmax Total RNA). Some of the chosen kits may be supplied with proteinase K, and protease K buffer, some may provide RNA carriers such as glycogen (a multibranched polysaccharide of glucose) and tRNA. In some cases, a universal nuclease (“Nuclease”) that digests mainly all formats of DNA, sodium chloride solution (e.g., 5 M), deep well plates and isopropanol (100% molecular grade) may be used. All the kits need ethanol (200 proof absolute) and 2-mercaptoethanol, cell culture media including insect cell culture media (“Culture Media”) may be used to dilute the starting material. All these materials are commercially available.
[0159] Prepared reagents:
[0160] 1) Wash Solution 1
[0161] Wash Solution 1 was either provided or prepared by adding isopropanol up to 60-80% final concentration
[0162] 2) Wash Solution 2
[0163] Wash Solution 2 was prepared by mixing wash solution 2 concentrate (supplied by the vendor in the total RNA isolation kit) in ethanol (final concentration 60-80%) to afford Wash Solution 2 in a bottle.
[0164] 3) Proteinase K Mix
[0165] Proteinase K Mix was prepared by mixing proteinase K (1 part, supplied by the vendor) in PK digestion buffer (9 parts, supplied by the vendor). Used on the day of preparation.
[0166] 4) DNase Mix
[0167] DNase Mix was prepared by mixing DNase (1 part, supplied by the vendor in the total RNA isolation kit) in DNase buffer (24 parts, supplied by the vendor). Used on the day of preparation.
[0168] 5) Lysis Binding Mix
[0169] Lysis Binding Mix was prepared by mixing 2-mercaptoethanol (1 part, supplied by the vendor in the total RNA isolation kit) in lysis buffer (99 parts, supplied by the vendor in the total RNA isolation kit). Used on the day of preparation
[0170] 6) Rhabdovirus Positive Control (RV+ PC)
[0171] RV+ PC was prepared by diluting the RV+PC to a concentration no more than 1 ,0><10A7 cells / mL.
[0172] Sample Pre-treatment: Thawed samples and controls. If the sample was cell pellet material, resuspended the pellet in the appropriate media so that the final cells / mL concentration did not exceed 1.0><10A7 cells / mL. Re-froze at -80°C and thaw before proceeding. If the sample was cell suspension, confirmed the concentration did not exceed 1.0x10A7 cells / mL. If it was higher, diluted the test sample in the appropriate medium until it was < 1.0x10A7 cells / mL.
[0173] If samples had never been thawed previously, the samples were thawed and the freezethaw cycle was repeated 1-3 times.
[0174] Procedure: Each sample was pipetted in triplicate into a 96-deep well plate. The total cell number to be extracted was no more than 1.0xl0A6. If recombinant baculovirus (rBV) samples were tested, 1 or 2 pL of tRNA stock solution was added per 100 pL of sample before testing. Culture Media was pipetted into the 96-deep well plate as the Negative Extraction Control (NEC). About 2 or 4 pL of glycogen and about 5 M NaCl were added to each sample and control. About 1 or 2 pL of Nuclease were added to each sample and control. Nuclease was kept on ice or in a -20 °C mini cooler while being used. If done in a plate, the plate was mixed on a plate shaker at about 1000 RPM for about 2 to 4 minutes. The plate was incubated at about 37°C for about 1 to 1.5 hours. After 1 or 1.5 hours, 50 to 70 pL of Proteinase K Mix were added to each well. The plate was shaken for about 5 minutes at about 1000 RPM. The plate was incubated at about 65°C for about 30 to 45 minutes. About 80 to 100 pL of Lysis Binding Mix were added to each sample and control, and the mixture was pipetted up and down about 10 times. Samples containing Lysis Binding Mix could be frozen at < -65 °C for up to 6 months.
[0175] Plating the PC and Binding the Nucleic Acids: The RV+ Sf PC was thawed and vortexed to mix. If samples had been frozen, the samples were thawed and vortexed to mix. RV+ Sf PC was added to the 96-deep well plate in triplicate, twice if required. A total of two extractions in triplicate could be performed for the PC if needed. The magnetic beads were vortexed thoroughly for about 1-2 minutes. If the beads were not fully resuspended, they were heated at about 37 °C and vortexed again for about 1-2 minutes. It was preferred that this mixture was homogeneous.
[0176] The kit manual was followed after sample preparation, and DNase treatment was added either on the membrane or on the beads before washes and elution. The RNA was washed. Thebeads or columns were washed with Wash Solution 1, prepared above, to each sample and control. The plate was shaken at about 1000 RPM for about 5 minutes at room temperature. The wash was repeated multiple times to eliminate the buffer in the system. The plate was placed on the magnetic stand and left to stand until the solution was clear. The plate or columns were left uncovered at room temperature for about 5 minutes.
[0177] Elution: While the beads or columns were drying, the elution buffer was preheated to about 65 °C. Elution buffer was added to each well used in the 96-deep well plate. The plate was incubated for 5-7 minutes. If done in a plate, some shaking of the plate at less than 1000 RPM was helpful. RNA was eluted twice. The extracted RNA was nanodropped, using the same elution buffer to blank the nanodrop.
[0178] Extracts could be stored at <-65°C for up to 2 weeks.
[0179] Example 4: Extraction of Residual Rhabdovirus RNA in Drug Substance and Drug Product Materials
[0180] The purpose of Example 4 is to extract rhabdovirus RNA in drug substance and drug product samples. This Example used a silica coated magnetic beads-based nucleic acid extraction method to purify total RNA from crude material sample types such drug substance and drug product. The extracted total RNA was used as samples for further RT-qPCR analysis to detect the presence or absence of rhabdovirus genome.
[0181] In summary, residual rhabdovirus RNA was extracted from drug substance and drug product materials. The protocol that was used is summarized below.
[0182] Example equipment used: microplate shaker, thermomixer, thermocycler, qPCR instrument.
[0183] Example materials used: Viral RNA or nucleic acid sample preparation kit (commercially available kits, examples include but not limited to QIAamp Circulating Nucleic Acid Kit, Prepseq Nucleic Acid Preparation kit, Zymoresearch quick RNA viral Kit.
[0184] Prepared reagents:
[0185] 1) Binding Solution
[0186] It was provided by the commercial kit, and the kit procedure was followed to add chaotic reagents, such as isopropanol, before use, if required, as indicated in the kit.
[0187] 2) Proteinase K Mix
[0188] Proteinase K Mix was prepared by mixing Proteinase K (1 part, supplied by the vendor in the DNA sample preparation kit) in PK buffer (6 parts, supplied by the vendor in the RNA sample preparation kit). It was used on the day of preparation.
[0189] 3) Lysis Binding Mix
[0190] Lysis Binding Mix was prepared by mixing a carrier, such as glycogen (1 part, commercially available or supplied by the sample preparation kit), in lysis buffer (about 40 parts, supplied by the vendor in the RNA sample preparation kit). It was used on the day of preparation.
[0191] 4) Wash Buffer
[0192] About 80 mL of 95% ethanol was added to the provided bottle.
[0193] 5) Yeast tRNA Sample Dilution Buffer (tSDB)
[0194] tSDB was prepared as described above.
[0195] 6) Formulation Buffer
[0196] Formulation was prepared for each individual sample or drug substance.
[0197] Sample Preparation and Digestion: Samples and controls were allowed to thaw and vortex thoroughly. Extraction was done mainly following the commercial kit-provided manual, which was briefly described as follows:
[0198] Each sample was pipetted from about 100 to about 130 pL in triplicate into wells on a 96-deep well plate.
[0199] In triplicates, about 90 to about 120 pL of Formulation Buffer was pipetted into the 96- deep well plate as the Negative Extraction Control (NEC).
[0200] About 80 to about 105 pL of Formulation Buffer was pipetted in triplicate, twice into the 96-deep well plate as the Sample Spike Positive Control (Sample Spike PC). A total of two Sample Spike PCs in triplicate could be performed.
[0201] About 10-20% volume of 5MNaCl and about 60 pLto about 70 pL of Proteinase K mix were added to each well in a thermomixer at about 60 °C for about 1 hour.
[0202] During digestion, serial dilutions of rhabdovirus RNA Working Stock Standard were prepared for the Sample Spike Positive Control with concentrations ranging from about 1.00*10A4 copies / mL to about 1.00><10A10 copies / mL of rhabdovirus RNA.
[0203] After the digestion, samples were allowed to cool to room temperature, and then about 10 pL of rhabdovirus RNA Working Stock Standard was pipetted into the wells containing the Sample Spike PC.
[0204] About 350 pL of Lysis Buffer was added.
[0205] Binding the Nucleic Acids: The proper amount of binding buffer was added, as indicated in the kit. In general, 1-3 times the starting material volume was used.
[0206] Wash the RNA: The RNA was washed with kit-provided wash buffer supplemented with ethanol at a final concentration of 60-80% ethanol, at least twice. The columns or beads were dried for 5 minutes after the last wash.
[0207] Elute the RNA: While the columns or beads were drying, the elution buffer was preheated to about 70 °C.
[0208] About 40 to about 70 pL of elution buffer was added to each well used in the 96-deep well plate.
[0209] RNA was eluted twice with the proper elution buffer or, in some cases, tSDB. Extracts could be stored at <-65°C for about 2 weeks.
[0210] Example 5: Generation of Drug Substance Using Rhabdovirus-free Sf Cell Line
[0211] Provided herein is a method of generating a drug substance using the rhabdovirus-free Sf9 cell line of Example 1. The rhabdovirus-free Sf9 cell line of Example 1 is used to generate, for example, recombinant proteins, AAV virus particles, and / or virus-like particles. In some embodiments, the cell line is used to generate AAV viral particles for use in AAV-based therapies for genetic disorders. In some embodiments, the cell line is used to generate proteins for use in vaccines and / or therapeutics such as for example influenza VLP-based vaccines. In some embodiments, the cell line is used in combination with a baculovirus expression vector system (BEVS) for high-yield expression of recombinant proteins such as for example malaria antigens, CO VID-19 spike protein VLPs, and / or HPV LI proteins. In some embodiments, the cell line is used to produce complex proteins such as G protein coupled receptors. The products produced by these cells are not contaminated with rhabdoviral particles.
[0212] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. It is not intended that the disclosure be limited by the specific examples provided within the specification. While the disclosure hasbeen described with reference to the aforementioned specification, the descriptions and illustrations of the embodiments herein are notmeantto be construed in a limiting sense. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. Furthermore, it shall be understood that all aspects of the disclosure are not limited to the specific depictions, configurations or relative proportions set forth herein which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is therefore contemplated that the disclosure shall also cover any such alternatives, modifications, variations or equivalents. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.
Claims
CLAIMSWHAT IS CLAIMED IS:
1. A method of producing a rhabdovirus-free Spodoptera frugiperda (Sf) cell line, comprising:(a) diluting Sf cells and seeding from one cell per well to about 100 cells per well in a cell culture media on a first plate;(b) confirming clonality of a cell clone in a well of the first plate at least twice either within 30 days after the seeding or before transferring growing cells to a second plate, whichever occurs first;(c) removing a portion of the cell culture media from the well of the first plate and adding fresh cell culture media to the well of the first plate at least twice either within 30 days after the seeding or before transferring the growing cells to the second plate, whichever occurs first; and(d) at a first time point after the seeding; confirming the presence of adherent cells and transferring the adherent cells from the well of the first plate to a well of the second plate enabling suspension of cells in the well of the second plate.2 The method of claim 1, further comprising: after (d),(e) at a second time point after the seeding; transferring suspension cells from the well of the second plate to a well of a third plate enabling scaling up the suspension cells in the well of the third plate; and(f) ata third time point after the seeding; transferring suspension cells from the well of the third plate to a flask and expanding the suspension cells in the flask, thereby producing a rhabdovirus-free sf cell line.3 The method of claim 1 or claim 2, wherein, in (a), the diluting is about five cells per well in the well, and wherein the cell culture media comprises 6-azuaridine.4 The method of claim 3, wherein 6-azuaridine is from about 1 pg / mL to about 25 pg / mL.5 The method of claim 1 or claim 2, wherein, in (a), the diluting is about one cell per well in the well, and wherein the cell culture media is without an antiviral agent.6 The method of claim 1 or claim 2, wherein, in (a), the diluting is about one cell per well in the well, and wherein the cell culture media is without 6-azuaridine.7 The method of claim 1 or claim 2, wherein, in (a), the diluting is about one cell per well in the well, wherein the cell culture media comprises 6-azuaridine and from 9% to 75% conditioned media.8 The method of claim 7, wherein 6-azuaridine is from about 4 pg / mL to about 13 pg / mL.9 The method of claim 7 or claim 8, further comprising: passing the conditioned media through a molecular weight cutoff (MWCO) filter.
10. The method of claim 9, wherein the MWCO filter comprises aMWCO of no more than 300 kDa.
11. The method of claim 9, wherein the MWCO filter comprises a MWCO of no more than 200 kDa.
12. The method of claim 9, wherein the MWCO filter comprises aMWCO of no more than 150 kDa.
13. The method of claim 9, wherein the MWCO filter comprises a MWCO of no more than 100 kDa.
14. The method of any one of claims 1-13, wherein cell density in the well of the first plate is observed and / or calculated via a microscopy.
15. The method of any one of claims 1-14, wherein 6-azuaridine or other antiviral compounds are not added in (b)-(f).
16. The method of any one of claims 1-15, wherein the confirming in (b) is done via a microscopy.
17. The method of claim 16, wherein the confirming in (b) is at least (1) on the day of the seeding.
18. The method of any one of claims 1-17, wherein the cell culture media in (a) comprise from about 0.3% to about 30% (v / v) serum for cell growth.
19. The method of any one of claims 1-18, wherein in (c) the portion of the cell culture media removed is independently from about 10% to about 75% (v / v), and wherein in (c) the cell culture media added comprises no more than 30% (v / v) serum for cell growth.
20. The method of any one of claims 1-19, wherein in (c) the at least twice within 30 days comprise once within 14 days after the seeding day and once on or after day 15 after the seeding day.
21. The method of any one of claims 1-20, wherein the first time point is no later than 30 days from the seeding.
22. The method of any one of claims 1-21, wherein the second time point is no later than 60 days from the seeding.
23. The method of any one of claims 1-22, wherein at the third time point confluence of the cells in the well is at least about 50% no later than 120 days from the seeding.
24. The method of any one of claims 1-23, wherein, after (f), the suspension cells are passaged into a suspension shake flask.
25. The method of claim 24, wherein the suspension cells are passaged at least 20 times.
26. The method of claim 24, wherein the suspension cells are passaged at least 60 times.
27. The method of any one of claims 2-26, further comprising, testing for the presence or absence of rhabdovirus at least in a sample removed in (f).
28. The method of claim 27, wherein the testing is performed on samples removed from different passages.
29. A method of detecting a presence or absence of rhabdovirus in a biological sample, comprising:(a) preparing ribonucleic acid (RNA) standard dilution samples using a dilution buffer comprising yeast RNA or an RNA that is from a source other than the species from which the biological sample is derived;(b) preparing a test sample of the biological sample and controls, if needed, diluting extracted RNA from the biological sample of the tRNA sample dilution buffer so that the range of the RNA being tested is from about 0.1 pg to about 1 pg in a reaction;(c) adding no more than 30 pL each of (i) the RNA standard dilution samples from (a), (ii) the test sample from (b), and (iii) the controls from (b) into corresponding wells of a plurality of wells;(d) after (c), adding a first solution comprising double-strand specific DNase (dsDNase) to each of the plurality of wells, and allowing a dsDNase digestion for about 2-30 minutes;(e) after (d), adding a second solution comprising reagents for a one step reverse transcription quantitative polymerase chain reaction (RT-qPCR) into the corresponding wells of the plurality of wells, and sealing the plurality of wells with a cover;(f) after (e), without adding any additional reagents, performing the RT-qPCR reaction; and(g) determining the presence or absence of the rhabdovirus in the biological sample based on results from the RT-qPCR reaction in (f).
30. The method of claim 29, wherein, in (b), the biological sample is notfrom a drug substance and is not suspected to comprise rhabdovirus, and the method comprises diluting the extracted RNA from about 2-fold to about 10-fold.
31. The method of claim 29, wherein, in (b), the biological sample is not from a drug substance and is not suspected to comprise rhabdovirus, and the controls comprise a positive control which contains the rhabdovirus genome.
32. The method of claim 29, wherein, in (b), the biological sample is notfrom a drug substance and is not suspected to comprise rhabdovirus, and no diluting is needed.
33. The method of any one of claims 29-32, wherein, after the diluting, a concentration range of the extracted RNA is from about 1 nanogram per reaction to about 1 microgram per reaction.
34. The method of any one of claims 29-32, wherein the dilution buffer further comprises (i) a PCR buff er comprising a buffer at pH 7.0-9.0 and potassium chloride, and (ii) a polyoxyethylenepolyoxypropylene block copolymer.
35. The method of any one of claims 29-34, wherein, in (d), the first solution further comprises deoxy nucleotide (dNTP) solution mix and magnesium chloride.
36. The method of any one of claims 29-35, wherein, in (e) the second solution further comprises (i) a primer / probe solution and (ii) an enzyme mixture comprising a reverse transcriptase, a ribonuclease (RNase) inhibitor, and a deoxyribonucleic acid (DNA) polymerase.
37. The method of claim 36, wherein the primer / probe solution comprises a primer / probe set comprising a rhabdovirus non-coding gene forward primer, a rhabdovirus non-coding gene reverse primer, and a rhabdovirus probe.
38. The method of claim 37, wherein a ratio of the rhabdovirus non-coding gene forward primer to the rhabdovirus non-coding gene reverse primer is about 1 :1; and wherein a ratio of the rhabdovirus non-coding gene forward primer to the rhabdovirus probe is from about 2:1 to about 5:1.
39. The method of claim 37 or claim 38, wherein the primer / probe solution further comprises additional primer / probe set(s) against additional gene(s) of the rhabdovirus genome.
40. The method of claim 37 or claim 38, wherein the primer / probe solution comprise primer / probe sets against up to six genes of the rhabdovirus genome.
41. The method of any one of claims 36-40, wherein the primer / probe solution comprises one or more primer / probe sets selected from the group consisting of: (1) SEQ ID NOs: 2-4, (2) SEQ ID NOs: 5-7, (3) SEQ ID NOs: 8-10, (4) SEQ ID NOs: 11-13, (5) SEQ ID NOs: 14-16, (6) SEQ ID NOs: 17-19, (7) SEQ ID NOs: 20-22, (8) SEQ ID NOs: 23-25, (9) SEQ ID NOs: 26-28, (10) SEQ ID NOs: 29-31, (11) SEQ ID NOs: 32-34, (12) SEQ ID NOs: 35-37, (13) SEQ ID NOs: 38-40, (14) SEQ ID NOs: 41-43, (15) SEQ ID NOs: 44-46, (16) SEQ ID NOs: 47-49, (17) SEQ ID NOs: SO- 52, (118) SEQ ID NOs: 53-55, (19) SEQ ID NOs: 56-58, (20) SEQ ID NOs: 59-61, (21) SEQ ID NOs: 62-64, (22) SEQ ID NOs: 65-67, (23) SEQ ID NOs: 68-70, 2(4) SEQ ID NOs: 71-73, (25) SEQ ID NOs: 74-76, (26) SEQ ID NOs: 77-79, (27) SEQ ID NOs: 80-82, (28) SEQ ID NOs: 83- 85, (29) SEQ ID NOs: 86-88, or (30) SEQ ID NOs: 89-91.
42. The method of any one of claims 36-40, wherein the primer / probe solution comprises up to five primer probe sets selected from the group consisting of: (1) SEQ ID NOs: 2-4, (2) SEQ ID NOs: 5-7, (3) SEQ ID NOs: 8-10, (4) SEQ ID NOs: 11-13, (5) SEQ ID NOs: 14-16, (6) SEQ ID NOs: 17-19, (7) SEQ ID NOs: 20-22, (8) SEQ ID NOs: 23-25, (9) SEQ ID NOs: 26-28, (10) SEQ ID NOs: 29-31, (11) SEQ ID NOs: 32-34, (12) SEQ ID NOs: 35-37, (13) SEQ ID NOs: 38-40, (14)SEQ ID NOs: 41-43, (15) SEQ ID NOs: 44-46, (16) SEQ ID NOs: 47-49, (17) SEQ ID NOs: SO- 52, (118) SEQ ID NOs: 53-55, (19) SEQ ID NOs: 56-58, (20) SEQ ID NOs: 59-61, (21) SEQ ID NOs: 62-64, (22) SEQ ID NOs: 65-67, (23) SEQ ID NOs: 68-70, 2(4) SEQ ID NOs: 71-73, (25) SEQ ID NOs: 74-76, (26) SEQ ID NOs: 77-79, (27) SEQ ID NOs: 80-82, (28) SEQ ID NOs: 83- 85, (29) SEQ ID NOs: 86-88, or (30) SEQ ID NOs: 89-91.
43. The method of claim 42, wherein each of the up to five primer probe sets targets a different gene of the rhabdovirus.
44. The method of any one of claims 29-43, wherein concentrations of RNA in RNA standard dilution samples prepared in (a) range from about 10 copies per reaction to about 1 *108copies per reaction.
45. The method of any one of claims 29-44, wherein the yeast RNA in (a) is a yeast tRNA.
46. A cell generated by the method of any one of claims 1-28.
47. Use of a cell generated by the method of any one of claims 1-28 in the manufacture of a drug substance.
48. Use of the cell of claim 47, wherein the drug substance comprises a recombinant protein, an AAV virus particle, or a virus-like particle.
Citation Information
Patent Citations
Virus-free cell lines and methods for obtaining same
US20230059552A1
Virus-free cell cultures
US20230075854A1