Compositions and methods for detecting allelic variants

Abstract

Compositions and methods for allele-specific assays for HLA genotyping.

Description

[0001] COMPOSITIONS AND METHODS FOR DETECTING ALLELIC VARIANTS

[0002] SPECIFICATION

[0003] BACKGROUND

[0004] Human Leukocyte Antigen (HLA) molecules are proteins found on the surface of cells and have an important role in the immune system by presenting peptides derived from pathogens (such as viruses or bacteria) or from the body's own proteins to immune cells, particularly T cells. The genes encoding HLA molecules are among the most polymorphic genes in the human genome, and which exist in many different forms within the human population. This diversity allows the immune system to recognize a wide range of pathogens. HLA matching is essential in organ and tissue transplantation to minimize the risk of rejection. A close match between the HLA types of the donor and recipient reduces the likelihood of the recipient's immune system recognizing the transplanted organ or tissue as foreign and attacking it. Certain HLA alleles are associated with an increased risk of autoimmune diseases, such as type 1 diabetes, rheumatoid arthritis, and celiac disease. Additionally, specific HLA types are linked to susceptibility or resistance to infectious diseases. HLA typing refers to the process of determining an individual's HLA alleles. This is commonly done using molecular biology techniques such as polymerase chain reaction (PCR) followed by sequencing or hybridization-based methods.

[0005] Genotyping HLA subtypes is vital in organ and tissue transplantation. Since HLA molecules are highly polymorphic when a donor organ or tissue is transplanted into a recipient, the closer the match between the HLA types of the donor and recipient, the lower the risk of rejection. Genotyping helps identify suitable donor-recipient matches, increasing the success rates of transplants and reducing the likelihood of rejection. Certain HLA subtypes are associated with an increased risk of developing certain diseases, such as autoimmune disorders like type 1 diabetes, rheumatoid arthritis, and celiac disease. By identifying an individual's HLA subtype through genotyping, healthcare professionals can assess their predisposition to these diseases. This information can be valuable for preventive measures, early detection, and personalized treatment plans. Some HLA subtypes are linked to adverse drug reactions, particularly severe hypersensitivity reactions. HLA genotyping is used in forensic science for human identification purposes, especially in cases where traditional DNA profiling methods are insufficient. HLA typing can provide additional genetic information that aids in identifying individuals from biological samples in criminal investigations or disaster victim identification efforts. Genotyping HLA subtypes helps researchers understand population genetics and its implications for health and disease.

[0006] While genotyping HLA subtypes has proven immensely valuable in medical and research applications, several challenges persist because the HLA region is highly polymorphic, with thousands of known alleles. This diversity poses a challenge for genotyping techniques, as accurately identifying and distinguishing between these alleles can be technically demanding and prone to errors. Some rare alleles may not be well-characterized or included in genotyping panels, leading to potential inaccuracies or incomplete results. Resolving ambiguous genotyping results is a common issue, particularly when multiple alleles are detected for a single locus. This ambiguity can arise due to sequence similarities between alleles or technical limitations of genotyping assays. Resolving such ambiguities often requires additional testing or specialized techniques, adding complexity and cost to the genotyping process. High-resolution HLA genotyping can be costly, limiting its accessibility, especially in resource-constrained settings or for individuals without adequate healthcare coverage. The expense of genotyping assays, equipment, and interpretation can be prohibitive for some patients, healthcare providers, or research projects, hindering widespread adoption and utilization. Interpreting HLA genotyping data requires expertise in molecular genetics and immunology. Identifying clinically relevant alleles, assessing transplantation compatibility, or predicting disease susceptibility based on HLA profiles demands specialized knowledge and resources. Misinterpretation or misapplication of genotyping results can lead to incorrect clinical decisions or research conclusions. HLA allele frequencies vary significantly across different populations and ethnic groups. Standard genotyping panels may not adequately capture this diversity, leading to biases or inaccuracies, particularly in diverse or understudied populations. Addressing these disparities requires comprehensive and representative reference databases and tailored genotyping approaches. Current genotyping techniques, such as PCR-based methods or next-generation sequencing, have inherent limitations, including allele dropout, amplification bias, or sequencing errors. Improving the accuracy, sensitivity, and reliability of genotyping assays remains an ongoing challenge, necessitating continual advancements in technology and methodology.

[0007] Thus, there exists a need to provide allele-specific assays for HLA genotyping that amplify unique HLA alleles, which are more effective than prior art methods. This disclosure provides compositions and methods for allele- specific assays for HLA genotyping. These assays did not exist before or did not perform satisfactorily.

[0008] All references cited herein are incorporated herein by reference in their entireties.

[0009] BRIEF SUMMARY

[0010] The disclosure provides a method for designing allele- specific PCR primers and / or probes comprising: a. comparing a large number of HLA allele sequences; b. determining the consensus sequences for primary HLA allele sequences; c. generating consensus sequences for priority targets and prominent HLA allele P groups (Protein groups); d. identifying a region of each of the target HLA alleles of the aligned sequences with sufficient nucleotide variability for allele specificity; e. designing allele- specific PCR primers and allele-specific PCR probes to amplify unique sets of variants for target HLA allele sequences with sufficient nucleotide variability for allele specificity; and f. optionally, introducing mismatches to increase allele specificity. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the length of the allele- specific PCR primer is from 10 to about 40 nucleotides. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the allelespecific PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position. The disclosure provides a method for designing allele-specific PCR primers and / or probes wherein the length of the allele- specific PCR probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt. The disclosure provides a method for designing allele-specific PCR primers and / or probes wherein the length of the allele- specific PCR probe is 7 nt. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the allelespecific PCR probe comprises more than one LNA. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the allele-specific PCR probe nucleotides are all LNAs. The disclosure provides a method for designing allele-specific PCR primers and / or probes wherein the allele- specific PCR probe is complementary to an HLA allele. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the allele- specific PCR probe is complementary to an HLA allele selected from the group consisting of HLA-A*31:01; HLA-B*15:02; HLA-B*58:01; and HLA-B*57:01. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the allelespecific PCR probe is complementary to an HLA allele SNP selected from the group consisting of rsl7179220, rsl0484555, rsl44012689, rsl061235, and rsl719220. The disclosure provides a method for designing allele-specific PCR primers and / or probes wherein the allele-specific PCR probe is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsll31213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the allele- specific PCR probe is complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:0I, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01. The disclosure provides a method for designing allele- specific PCR primers and / or probes wherein the allele-specific PCR probe comprises a 5' fluorescent dye label selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. The disclosure provides a method for designing allelespecific PCR primers and / or probes wherein the allele- specific PCR probe comprises a 3' quencher group selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

[0011] The disclosure provides a composition comprising allele-specific PCR primers and / or probes made by a method comprising: a. comparing a large number of HLA allele sequences; b. determining the consensus sequences for primary HLA allele sequences; c. generating consensus sequences for priority targets and prominent HLA allele P groups; d. identifying a region of each of the target HLA alleles of the aligned sequences with sufficient nucleotide variability for allele specificity; e. designing allele- specific PCR primers and allele-specific PCR probes to amplify unique sets of variants for target HLA allele sequences with sufficient nucleotide variability for allele specificity; and f. optionally, introducing mismatches to increase allele specificity. The disclosure provides a composition comprising allele-specific PCR primers and / or probes comprising an allele-specific PCR primer wherein the length of the allele-specific PCR primer is from 10 to about 40 nucleotides. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele- specific PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the length of the allele-specific PCR probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the length of the allele- specific PCR probe is 7 nt. The disclosure provides a composition comprising allelespecific PCR primers and / or probes wherein the allele- specific PCR probe comprises one LNA. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele- specific PCR probe comprises more than one LNA. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele-specific PCR probe nucleotides are all LNAs. The disclosure provides a composition comprising allelespecific PCR primers and / or probes wherein the allele- specific PCR probe is complementary to an HLA allele. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele- specific PCR primers and / or probes are complementary to an HLA allele selected from the group consisting of HLA-A*31:01; HLA-B*15:02; HLA-B*58:01; and HLA-B *57:01. The disclosure provides a composition comprising allele-specific PCR primers and / or probes wherein the allele- specific PCR primers and / or probes are complementary to an HLA allele SNP selected from the group consisting of rs 17179220, rs 10484555, rsl44012689, rsl061235, and rsl719220. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele- specific PCR primers and / or probes are complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsl 131213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele- specific PCR primers and / or probes are complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:0L The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele-specific PCR probe comprises a 5' fluorescent dye label selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. The disclosure provides a composition comprising allele- specific PCR primers and / or probes wherein the allele-specific PCR probe comprises a 3' quencher group selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid to be characterized for the presence of an HLA allelic variant; b. providing a first polymerase chain reaction (PCR) reaction mixture comprising: i. a forward oligonucleotide PCR primer designed to be allele- specific comprising a region overlapping the target allele, optionally wherein the forward oligonucleotide PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position; ii. a reverse oligonucleotide PCR primer designed to be allele-specific comprising a region overlapping the target allele, optionally wherein the reverse oligonucleotide PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position; iii. a first test probe, wherein the first test probe comprises a sequence complementary to a sense strand with a first HLA allelic variant, wherein the first test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the first test probe comprises a first 5'- fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label, further wherein the length of the first test probe is selected from the group consisting of 6, 7, 8, and 9 nucleotides; iv. at least one additional test probe, wherein the at least one additional test probe comprises a sequence complementary to a sense strand with an additional HLA allelic variant, wherein the at least one additional test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the at least one additional test probe comprises a unique 5'- fluorescent dye label which is different that the first 5'-fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label, further wherein the length of the at least one additional test probe is selected from the group consisting of 6, 7, 8, and 9 nucleotides; v. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. Adding the target nucleic acid to the PCR reaction mixture; d. amplifying the target nucleic acid with a nucleic acid polymerase to provide amplification products, e. measuring the amplification products of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye labels, f. wherein detection of the first 5'- fluorescent dye label indicates the presence of the first SNP allelic variant, and detection of the second 5'- fluorescent dye label indicates the presence of the second SNP allelic variant in the target nucleic acid. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the length of the first test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt. The disclosure provides a method of determining HLA allelic valiants in a target nucleic acid wherein the length of the at least one additional test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the length of the first test probe is 7 nt. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the length of the at least one additional test probe is 7 nt. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the first test probe comprises more than one LNA. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the second test probe comprises more than one LNA. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the first test probe nucleotides are all LNAs. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the second test probe nucleotides are all LNAs. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele selected from the group consisting of HLA-A*31:01; HLA-B*15:02; HLA-B*58:01; and HLA-B*57:01. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rs 17179220, rs!0484555, rsl44012689, rsl061235, and rsl719220. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsl 131213, rs3190923, rsl51341205, rsl050459, rslO71816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rs 1766813040 and rs 1278753959 of HLA-B*38:02. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01. The disclosure provides a method of determining HLA allelic variants in a target nucleic acid wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. The disclosure provides a method of determining HLA allelic valiants in a target nucleic acid wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

[0012] The disclosure provides a method of determining allelic SNP variants in a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid, wherein the target nucleic acid has an allelic variant SNP to be characterized; b. providing a polymerase chain reaction (PCR) reaction mixture comprising: i. an oligonucleotide primer designed to specifically amplify the wild- type allele, wherein the primer contains a nucleotide at the 3' end to prevent PCR amplification, further wherein the oligonucleotide primer designed to specifically amplify the wild-type allele comprises a fluorescent label at the 5' end; ii. an oligonucleotide primer designed to specifically amplify the mutant allele further wherein the oligonucleotide primer designed to specifically amplify the mutant allele, further wherein the oligonucleotide primer designed to specifically amplify the mutant allele comprises a fluorescent label at the 5' end which is different than the fluorescent label on the wild-type allele oligonucleotide primer; iii. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. Adding the target nucleic acid to the PCR reaction mixture; d. performing a PCR amplification in the PCR reaction mixture to amplify the target nucleic acid in the sample, thereby generating an amplification product, e. detecting the amplification product, wherein due to the nucleotide mismatches at the 3' end of the wild type primer, only the primer complementary to the target mutant allele will efficiently bind during the annealing step, leading to selective amplification of the target mutant allele, wherein the presence or absence of the amplification product indicates the genotype of the sample at the specific locus being interrogated. The disclosure provides a method of determining allelic SNP variants in a target nucleic acid wherein the oligonucleotide primer is complementary to an HLA allele. The disclosure provides a method of determining allelic SNP variants in a target nucleic acid wherein the oligonucleotide primer is complementary to an HLA allele selected from the group consisting of HLA- A*31:01; HLA-B* 15:02; HLA-B *58:01; and HLA-B *57:01. The disclosure provides a method of determining allelic SNP valiants in a target nucleic acid wherein the oligonucleotide primer is complementary to an HLA allele SNP selected from the group consisting of rsl7179220, rsl0484555, rsl44012689, rsl061235, and rsl719220. The disclosure provides a method of determining allelic SNP variants in a target nucleic acid wherein the oligonucleotide primer is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsl 131213, rs3190923, rs!51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02. The disclosure provides a method of determining allelic SNP variants in a target nucleic acid wherein the oligonucleotide primer is complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01. The disclosure provides a method of determining allelic SNP variants in a target nucleic acid wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar- 670, CY3, CY5, CY5.5, Quasar- 705, and Yakima Yellow.

[0013] The disclosure provides a method of determining allelic variants in a target nucleic acid, the method comprising: a. providing a sample comprising a tar-get nucleic acid, wherein the target nucleic acid has an allelic variant to be characterized; b. providing a polymerase chain reaction (PCR) reaction mixture comprising: i. a pair of unlabclcd allele specific oligonucleotide PCR primers; ii. a test probe, wherein the probe comprises a sequence complementary to a sense strand with a SNP, wherein the probe comprises at least one Locked Nucleic Acid (LNA) further wherein the probe comprises a 5'- fluorescent dye label and a 3'-quencher; iii. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. Adding the target nucleic acid to the PCR reaction mixture; d. performing a PCR amplification in the PCR reaction mixture to amplify the target nucleic acid in the sample, thereby generating an amplicon, e. measuring amplification of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye label, wherein amplification of the target nucleic acid indicates the presence of the SNP. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the length of the first test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the length of the at least one additional test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the length of the first test probe is 7 nt. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the length of the at least one additional test probe is 7 nt. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the first test probe comprises more than one LNA. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the second test probe comprises more than one LNA. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the first test probe nucleotides are all LNAs. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the second test probe nucleotides are all LNAs. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele selected from the group consisting of HLA-A*31:01; HLA- B*15:02; HLA-B*58:01; and HLA-B*57:01. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rsl7179220, rsl0484555, rsl44012689, rsl061235, and rs 1719220. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsl 131213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the test probe is complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow. The disclosure provides a method of determining allelic variants in a target nucleic acid wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

[0014] The disclosure provides for the use of the compositions of the disclosure for the production of a composition for detecting and / or preventing and / or treating the indications as set forth herein.

[0015] BRIEF DESCRIPTION OF SEVERAL VIEWS OF THE DRAWINGS

[0016] The invention will be described in conjunction with the following drawings in which like reference numerals designate like elements and wherein: Figure 1 is a diagram showing HLA-B 15:02 consensus alignments.

[0017] Figure 2 is a diagram showing HLA-B 15:02 Primer Design.

[0018] Figure 3 is a diagram showing HLA-B 15:02 Probe Design.

[0019] Figure 4 is a diagram showing HLA-31:01 rsl061235.

[0020] Figure 5 is a diagram showing HLA-31:01 rsl719220.

[0021] Figure 6 is a chart showing the results of an HLA-A*31:01 assay.

[0022] Figure 7 is a chart showing the results of an HLA-B* 15:02 Assay.

[0023] Figure 8 is a chart showing the results of an HLA-B*58:O1 H1 / H3 Assay.

[0024] Figure 9 is a chart showing the results of an HLA-B*57:01 H9 / H11 Assay.

[0025] Figure 10 is a chart showing the results of an HLA-B*58:01 vs *57:01 assay.

[0026] DETAILED DESCRIPTION

[0027] As used herein the term “active pharmaceutical ingredient” (“API”) or “pharmaceutically active agent” is a drag or agent which can be employed as disclosed herein and is intended to be used in the human or animal body in order to heal, to alleviate, to prevent or to diagnose diseases, ailments, physical damage or pathological symptoms; allow the state, the condition or the functions of the body or mental states to be identified; to replace active substances produced by the human or animal body, or body fluids; to defend against, to eliminate or to render innocuous pathogens, parasites or exogenous substances or to influence the state, the condition or the functions of the body or mental states. Drags in use can be found in reference works such as, for example, the Rote Liste or the Merck Index. Examples which may be mentioned include, for example, tretinoin.

[0028] As used herein, “pharmaceutically acceptable salts” refer to derivatives of the disclosed compounds wherein the therapeutic compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of the active agent. The pharmaceutically acceptable salts include the conventional nontoxic salts, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfonic, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as amino acids, acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2- acetoxy benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, and other known to those of ordinary skill in the pharmaceutical sciences. Lists of suitable salts are found in texts such as Remington's Pharmaceutical Sciences, 18th Ed. (Alfonso R. Gennaro, ed.; Mack Publishing Company, Easton, Pa., 1990); Remington: the Science and Practice of Pharmacy 19thEd. (Lippincott, Williams & Wilkins, 1995); Handbook of Pharmaceutical Excipients, 3rdEd. (Arthur H. Kibbe, ed.; Amer. Pharmaceutical Assoc., 1999); the Pharmaceutical Codex: Principles and Practice of Pharmaceutics 12thEd. (Walter Lund ed.; Pharmaceutical Press, London, 1994); The United States Pharmacopeia: The National Formulary (United States Pharmacopeial Convention); and Goodman and Gilman's: the Pharmacological Basis of Therapeutics (Louis S. Goodman and Lee E. Limbird, eds.; McGraw Hill, 1992), the disclosures of which are hereby incorporated by reference.

[0029] An amount is "effective" as used herein, when the amount provides an effect in the subject. As used herein, the term "effective amount" means an amount of a compound or composition sufficient to significantly induce a positive benefit, including independently or in combinations the benefits disclosed herein, but low enough to avoid serious side effects, i.c., to provide a reasonable benefit to risk ratio, within the scope of sound judgment of the skilled artisan. For those skilled in the art, the effective amount, as well as dosage and frequency of administration, may be determined according to their knowledge and standard methodology of merely routine experimentation based on the present disclosure.

[0030] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, the term "patient" refers to an animal, preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey and human), and most preferably a human. In some embodiments, the subject is a non-human animal such as a farm animal (e.g., a horse, pig, or cow) or a pet (e.g., a dog or cat). In a specific embodiment, the subject is an elderly human. In another embodiment, the subject is a human adult. In another embodiment, the subject is a human child. In yet another embodiment, the subject is a human infant. The patient or subject to be medicated according to the compositions and methods as disclosed herein may be any animal or human. In certain embodiments, animals may include vertebrates. The terms vertebrate or animals in this context is understood to comprise, for example fish, amphibians, reptiles, birds, and mammals including humans. One preferred group of vertebrates or animals according to the invention comprises warm-blooded animals including farm animals, such as cattle, horses, pigs, sheep and goats, poultry such as chickens, turkeys, guinea fowls and geese, fur-bearing animals such as mink, foxes, chinchillas, rabbits and the like, as well as companion animals such as ferrets, guinea pigs, rats, hamster, cats and dogs. A further group of preferred vertebrates or animals according to the disclosure comprises fish including salmonids, for example salmon, trout or whitefish. The subject is preferably mammalian. In some embodiments the subject is a human. In other embodiments the subject is an animal, more preferably a non-human mammal. The nonhuman mammal may be a domestic pet, or animal kept for commercial purposes, e.g., a racehorse, or farming livestock or animals such as pigs, sheep or cattle. As such the disclosure may have veterinary applications. Non-human mammals include rabbits, guinea pigs, rats, mice or other rodents (including any animal in the order Rodentia), cats, dogs, pigs, sheep, goats, cattle (including cows or any animal in the order Bos), horse (including any animal in the order Equidae), donkey, and non-human primates. The subject may be male or female. The subject may be an adult or a child. The subject may be a patient.

[0031] As used herein, the phrase "pharmaceutically acceptable" means approved by a regulatory agency of the federal or a state government, or listed in the U.S. Pharmacopeia, European Pharmacopeia, or other generally recognized pharmacopeia for use in animals, and more particularly, in humans.

[0032] As used herein, the terms "prevent," "preventing" and "prevention" in the context of the administration of a therapy to a subject refer to the prevention or inhibition of the recurrence, onset, and / or development of a disease or condition, or a combination of therapies (e.g., a combination of prophylactic or therapeutic agents).

[0033] As used herein, the terms "therapies" and "therapy" can refer to any method(s), composition(s), and / or agent(s) that can be used in the prevention, treatment and / or management of a disease or condition, or one or more symptoms thereof.

[0034] As used herein, the terms "treat," "treatment," and "treating" in the context of the administration of a therapy to a subject refer to the reduction or inhibition of the progression and / or duration of a disease or condition, the reduction or amelioration of the severity of a disease or condition, and / or the amelioration of one or more symptoms thereof resulting from the administration of one or more therapies.

[0035] "Polymerase Chain Reaction (PCR) assays" refer to a technique used in molecular biology and genetics to amplify a specific segment of DNA or RNA targets in a reaction. "Multiplex polymerase ehain reaction (PCR) assays" refer to a technique used in molecular biology and genetics to amplify multiple DNA or RNA targets simultaneously in a single reaction.

[0036] The term “nucleic acid” encompasses multi- stranded, as well as single- stranded molecules. In double- or triple-stranded nucleic acids, the nucleic acid strands need not be coextensive (i.e., a double- stranded nucleic acid need not be double-stranded along the entire length of both strands). Nucleic acid templates described herein may be any size depending on the sample (from small cell-free DNA fragments to entire genomes), including but not limited to 50-300 bases, 100-2000 bases, 100-750 bases, 170-500 bases, 100-5000 bases, 50-10,000 bases, or 50-2000 bases in length. In some instances, templates are at least 50, 100, 200, 500, 1000, 2000, 5000, 10,000, 20,00050,000, 100,000, 200,000, 500,000, 1,000,000 or more than 1,000,000 bases in length. Methods described herein provide for the amplification of nucleic acid acids, such as nucleic acid templates. Methods described herein additionally provide for the generation of isolated and at least partially purified nucleic acids and libraries of nucleic acids. Nucleic acids include but are not limited to those comprising DNA, RNA, circular RNA, cfDNA (cell free DNA), cfRNA (cell free RNA), siRNA (small interfering RNA), cffDNA (cell free fetal DNA), mRNA, tRNA, rRNA, miRNA (microRNA), synthetic polynucleotides, polynucleotide analogues, any other nucleic acid consistent with the specification, or any combinations thereof. The length of polynucleotides, when provided, are described as the number of bases and abbreviated, such as nt (nucleotides), bp (bases), kb (kilobases), or Gb (gigabases).

[0037] The phrase “fragment library” refers to a collection of nucleic acid fragments, wherein one or more fragments are used as a sequencing template. A fragment library can be generated in numerous ways that are known in the art. As an example, a fragment library can be generated by cutting, shearing, restricting, or otherwise subdividing a larger nucleic acid into smaller fragments. Fragment libraries can be generated from naturally occurring nucleic acids, such as, for example, from bacteria, cancer cells, normal cells, or solid tissue. Libraries comprising synthetic nucleic acid sequences can also be generated to create a synthetic fragment library.

[0038] The phrase “synthetic nucleic acid sequence” and variations thereof refers to a designed and synthesized sequence of nucleic acid. For example, a synthetic nucleic acid sequence can be designed to follow rules or guidelines. The term “template” and variations thereof refer to a nucleic acid sequence that is a target of nucleic acid sequencing reactions. A template sequence can comprise a naturally-occurring or synthetic nucleic acid sequence. A template sequence also can include a known or unknown nucleic acid sequence from a sample of interest. In various exemplary embodiments herein, a template sequence can be attached to a solid support, such as, for example, a bead, microparticle, flow cell, or any other surface or object.

[0039] As used herein, the term "about" when used in conjunction with a stated numerical value or range has the meaning reasonably ascribed to it by a person skilled in the art, i.e., denoting somewhat more or somewhat less than the stated value or range.

[0040] When a group of substituents is disclosed herein, it is understood that all individual members of those groups and all subgroups and classes that can be formed using the substituents are disclosed separately. When a Markush group or other grouping is used herein, all individual members of the group and all combinations and subcombinations possible of the group are intended to be individually included in the disclosure. As used herein, “and / or” means that one, all, or any combination of items in a list separated by “and / or” are included in the list; for example, “1, 2 and / or 3” is equivalent to “1, 2, 3, 1 and 2, 1 and 3, 2 and 3, or 1, 2, and 3”.

[0041] Every formulation or combination of components described or exemplified can be used to practice the disclosure, unless otherwise stated. Specific names of materials are intended to be exemplary, as it is known that one of ordinary skill in the art can name the same material differently. It will be appreciated that methods, device elements, starting materials, and synthetic methods other than those specifically exemplified can be employed in the practice as disclosed herein without resort to undue experimentation. All art-known functional equivalents, of any such methods, device elements, starting materials, and synthetic methods are intended to be included in this disclosure. Whenever a range is given in the specification, for example, a temperature range, a time range, or a composition range, all intermediate ranges and subranges, as well as all individual values included in the ranges given are intended to be included in the disclosure. It is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither, or both limits are included in the smaller ranges is also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included.

[0042] As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim element. As used herein, “consisting essentially of’ does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term “comprising”, particularly in a description of components of a composition, in a description of a method, or in a description of elements of a device, is understood to encompass those compositions, methods, or devices consisting essentially of and consisting of the recited components or elements, optionally in addition to other components or elements. The disclosure as illustratively described herein suitably may be practiced in the absence of any element, elements, limitation, or limitations which is not specifically disclosed herein.

[0043] As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a method” includes a plurality of such methods and reference to “the nanoparticle” includes reference to one or more nanoparticles and equivalents thereof known to those skilled in the art, and so forth. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope as disclosed herein claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.

[0044] As used herein, an “isolated” biological component, such as a nucleic acid, protein or cell that has been substantially separated or purified away from other biological components in the environment (such as a cell) in which the component naturally occurs, i.e., chromosomal and extra-chromosomal DNA and RNA, proteins and other cells. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids and proteins. Similarly, an “isolated” cell has been substantially separated, produced apart from, or purified away from other cells of the organism in which the cell naturally occurs. Isolated cells can be, for example, at least 99%, at least 98%, at least 97%, at least 96%, 95%, at least 94%, at least 93%, at least 92%, or at least 90% pure.

[0045] As used herein, the term Marker or Label is an agent capable of detection, for example by ELISA, spectrophotometry, flow cytometry, immunohistochemistry, immunofluorescence, microscopy, Northern analysis or Southern analysis. For example, a marker can be attached to a nucleic acid molecule or protein, thereby permitting detection of the nucleic acid molecule or protein. Examples of markers include, but are not limited to, radioactive isotopes, nitroimidazoles, enzyme substrates, co-factors, ligands, chemiluminescent agents, fluorophores, haptens, enzymes, and combinations thereof. Methods for labeling and guidance in the choice of markers appropriate for various purposes are discussed for example in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).

[0046] As used herein, the terms purified or isolated, a term that may not require absolute purity; rather, it is intended as a relative term. Thus, a purified population is greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 100% pure, or, most preferably, essentially free of other constituents.

[0047] All references throughout this application, for example patent documents, including issued or granted patents or equivalents and patent application publications, and non-patent literature documents or other source material are hereby incorporated by reference herein in their entireties, as though individually incorporated by reference. None is admitted to being prior art.

[0048] HLA Alleles

[0049] HLA (Human Leukocyte Antigen) alleles are a group of genes that encode for proteins called the major histocompatibility complex (MHC) in humans. These proteins play a crucial role in the immune system by presenting antigens (foreign substances) to T cells, which are a type of white blood cell. HLA alleles are highly polymorphic, and this diversity is important because it allows individuals to have unique immune responses to various pathogens. There are three main classes of HLA genes: Class I, Class II, and Class III. Class I HLA alleles: These genes encode proteins found on the surface of almost all nucleated cells in the body. They present antigens from inside the cell (such as viral or intracellular bacterial antigens) to cytotoxic T cells. Class I HLA alleles include HLA- A, HLA-B, and HLA-C. Class II HLA alleles: These genes encode proteins found on the surface of antigen-presenting cells, such as macrophages, B cells, and dendritic cells. They present antigens from outside the cell (such as those derived from extracellular bacteria) to helper T cells. Class II HLA alleles include HLA-DP, HLA-DQ, and HLA-DR. Class III HLA alleles: These genes encode proteins that are involved in the immune response but are not directly involved in antigen presentation. They include genes such as those encoding complement components and cytokines.

[0050] The diversity of HLA alleles is important for the success of organ and tissue transplantation, as well as for the susceptibility to autoimmune diseases and infectious diseases. Mismatches between the HLA types of donor and recipient in transplantation can lead to rejection of the transplant. Additionally, certain HLA alleles have been associated with an increased risk of developing specific autoimmune diseases, such as type 1 diabetes or rheumatoid arthritis.

[0051] HLA alleles are highly heterogeneous making assay design challenging. Disclosed herein are methods for designing HLA assays that amplify unique HLA alleles, and the primers and probes to amplify and identify unique HLA alleles. Large numbers of HLA allele sequences were downloaded from IPD-IMGT / HLA Database (ebi.ac.uk). Primary HLA targets were grouped, and consensus sequence was generated for HLA design. Primers and probes were then designed to cover the unique set of variants for a given allele. Sequence was then tested for specificity. Consensus sequences for the priority targets and prominent HLA allele P groups were generated using a Levinsky consensus type with 99% threshold. HLA (Human Leukocyte Antigen) allele P groups refer to specific sets of HLA alleles that are classified based on their molecular structure and function. The P group classification system is used to categorize HLA alleles into distinct groups based on similarities in their peptide-binding specificities and structural features. Each P group consists of alleles that share common characteristics in terms of peptide-binding motifs and other structural features. The allele P group consensus sequences were aligned using Kaiignalgorithm. For each of the target HLA alleles, a region of the aligned sequences was identified with sufficient nucleotide variability for allele specificity. Manual primer design was performed using an allele specific methodology for both primers and probe. Where significant nucleotide variability was not present, deliberate mismatches were introduced to increase allele specificity.

[0052] By analyzing how genetic variations influence a person's response to medications, pharmacogenomics aims to personalize medicine by optimizing drug therapy for individual patients. HLA (Human Leukocyte Antigen) allelic variants play a significant role in pharmacogenomics due to their involvement in the body's immune response. These variants can influence how individuals respond to certain drugs, particularly those that are metabolized by the immune system. One well-known example is the association between certain HLA alleles and adverse drug reactions (ADRs), such as hypersensitivity reactions. Some drugs undergo metabolism by enzymes that are regulated by genes within the HLA region. Variants in these genes can affect the rate at which drugs are metabolized, leading to variations in drug efficacy and toxicity. HLA molecules play a crucial role in presenting foreign substances (antigens) to the immune system. Variants in HLA genes can influence the immune system's recognition and response to drugs, leading to adverse reactions in some individuals. Certain HLA alleles have been linked to an increased risk of specific adverse drug reactions, such as Stevens- Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN), which are severe skin reactions. For example, the HLA-B* 15:02 allele is associated with an increased risk of Severe cutaneous adverse reactions (SCAR) due to Carbamazepine (CBZ) Stevens-Johnson syndrome (SJS) / Toxic Epidermal Necrolysis (TEN) in certain populations; HLA-A*31:01 allele is associated with an increased risk of severe cutaneous adverse reactions (SCAR) due to Carbamazepine (CBZ) and Stevens-Johnson syndrome (SJS) / Toxic Epidermal Necrolysis (TEN); the HLA-B*58:01 allele is associated with Severe cutaneous adverse reactions (SCAR) due to allopurinol drug used to treat Gout; and HLA-B*57:01 is associated with Severe adverse reactions (SAR) due to anti-HIV drug Abacavir (ABC). Knowledge of a patient's HLA genotype can inform drug selection and dosage adjustments to minimize the risk of adverse reactions and optimize therapeutic outcomes. For instance, screening for HLA-B *57:01 before prescribing abacavir, a drug used to treat HIV, helps identify individuals at risk of hypersensitivity reactions.

[0053] Polymerase Chain Reaction

[0054] Polymerase Chain Reaction (PCR) is a molecular biology technique used to amplify a specific segment of DNA. PCR with probes and primers involves the use of specialized nucleic acid sequences to target and amplify specific regions of DNA. Primers are short, single-stranded DNA sequences (usually around 18-25 nucleotides long) that are complementary to the sequences flanking the target region of interest. In PCR, two primers are designed, one complementary to each of the DNA strands at the 3' end of the target region. These primers serve as starting points for DNA synthesis by the DNA polymerase enzyme. Probes are single- stranded nucleic acid molecules, typically DNA or RNA, labeled with a detectable marker such as a fluorescent dye or a radioactive tag. Probes are designed to hybridize specifically to the target DNA sequence during PCR. They can be used for various purposes, such as monitoring the amplification process or detecting specific mutations or variations in the target DNA sequence.

[0055] PCR generally involves heating the nucleic acid template containing the target region is to a high temperature (typically around 94-98°C), causing the DNA strands to separate, or denature, into single strands; the reaction mixture is cooled to a temperature typically ranging from 50-65°C. During this step, the primers anneal, or bind, to their complementary sequences on the single- stranded DNA template flanking the target region; the reaction temperature is raised to the optimal temperature for the DNA polymerase enzyme (usually around 72°C). The DNA polymerase synthesizes a new DNA strand complementary to each single- stranded template by adding nucleotides to the 3' end of the primers (i.e., elongation). This step extends the primers along the DNA template, resulting in the synthesis of new DNA strands; in some PCR assays, probes are added to the reaction mixture during the annealing step. These probes hybridize specifically to the target DNA sequence between the primers. If the probe contains a fluorescent dye, the fluorescence emitted by the bound probe can be detected and measured, providing realtime monitoring of the amplification process; the denaturation, annealing, and extension steps are repeated for a certain number of cycles (typically 20-40 cycles) to exponentially amplify the target DNA sequence. Each cycle doubles the amount of target nucleic acid, resulting in a significant amplification of the target region.

[0056] Multiplex Polymerase Chain Reaction (PCR)

[0057] In multiplex PCR, multiple primer pairs are used in the same reaction, allowing for the simultaneous amplification of multiple target sequences from a single sample. The key components of a multiplex PCR assay include: Primers: Short DNA sequences that are designed to anneal to specific regions of the target DNA or RNA sequences. In multiplex PCR, there are multiple pairs of primers, each designed to amplify a different target; DNA / RNA template: The sample containing the DNA or RNA sequences to be amplified. It can be a purified DNA / RNA sample or a complex biological sample like blood, tissue, or other bodily fluids; DNA polymerase: An enzyme that synthesizes new DNA strands by adding nucleotides to the primers and extending the DNA sequences during the amplification process; Nucleotides: Building blocks of DNA, A (adenine), T (thymine), G (guanine), and C (cytosine), which are required for the DNA synthesis during PCR; Buffer solution: A reaction buffer that provides optimal conditions for the PCR process, including the required pH and salt concentration; Thermocycler: A specialized instrument used to automate the temperature cycling required for PCR, which includes denaturation, annealing, and extension steps.

[0058] The multiplex PCR process involves setting up the reaction with multiple primer pairs, each specific to a different target sequence. During the temperature cycling, the reaction goes through repeated cycles of denaturation (heating to separate the DNA strands), annealing (cooling to allow primers to bind to their complementary target sequences), and extension (heating to allow DNA polymerase to extend the primers and create new DNA strands). As a result, the target DNA sequences arc exponentially amplified.

[0059] Primers

[0060] PCR Primers are designed using primer design parameters for the proposed applications to target DNA / RNA segments within, for example, a targeted HLA allele.

[0061] In one embodiment of any of the compositions, systems, and methods as disclosed herein, amplification primers are, for example, between 4 and 70 nucleotides long. In one embodiment of any of the systems and methods as disclosed herein, the amplification products are between about 50 and about 2000 nucleotides in length. In one embodiment of any of the systems and methods as disclosed herein, the target nucleic acid is DNA (e.g., cDNA, or genomic DNA). In one embodiment of any of the systems and methods as disclosed herein, the target nucleic acid is RNA, such as messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), small nuclear RNA (snRNA), microRNA (miRNA), small nucleolar RNA (snoRNA), long non-coding RNA (IncRNA), or catalytic RNA (ribozymes). In one embodiment of any of the systems and methods as disclosed herein, the amplification primers are random primers.

[0062] Target Nucleic Acids

[0063] The disclosure provides compositions, systems and methods to detect, characterize, and / or quantify nucleic acid targets in a sample. In certain embodiments as disclosed herein, the nucleic acid targets may be, for example, an HLA allele. In some embodiments, the target nucleic acid sample can be isolated from any source, or sample, such as solid tissue, tissue, cells, yeast, bacteria, or similar sources of nucleic acid samples. Methods for isolating nucleic acids from these sources are well known in the art. For example, the solid tissue or tissue can be weighed, cut, mashed, homogenized, and the nucleic acid can be isolated from the homogenized samples. In some embodiments, the target nucleic acid sample can be fragmented to prepare target nucleic acid fragments, using any procedure known in the art, including cleaving with an enzyme or a chemical, or by shearing. Enzyme cleavage includes any type of restriction endonuclease, endonuclease, or transposase-mediated cleavage. In some embodiments, the biomolecules can be fragmented using well known methods, including enzymatic or chemical cleavage, or shearing forces.

[0064] Further provided herein are methods wherein the sample is selected from tissue(s) samples, cells, biological fluid samples, bone marrow samples, semen samples, biopsy samples, cancer samples, tumor samples, cell lysate samples, forensic samples, archaeological samples, paleontological samples, infection samples, production samples, whole plants, plant parts, microbiota samples, viral preparations, soil samples, marine samples, freshwater samples, household or industrial samples, and combinations and isolates thereof. Further provided herein are methods wherein the biological fluids are selected from blood, urine, saliva, lymphatic fluid, cerebrospinal fluid (CSF), amniotic fluid, pleural fluid, pericardial fluid, ascites, and aqueous humor.

[0065] Single Nucleotide Polymorphism

[0066] A Single Nucleotide Polymorphism (SNP) is a common type of genetic variation that occurs when a single nucleotide (A, T, C, or G) at a specific position in the genome differs among individuals within a population or species. In simpler terms, it refers to a single- letter difference in the DNA sequence at a particular location in the genome. SNPs are the most abundant type of genetic variation in the human genome, with millions of SNPs identified across the genome. SNPs can be inherited from one generation to the next. They can arise as a result of mutations during DNA replication or through recombination events during meiosis. While many SNPs may not have any discernible effect on an individual’ s traits or health, some SNPs can influence traits such as susceptibility to diseases, response to medications, or physical characteristics. These SNPs are often located within or near genes and can affect gene expression, protein structure, or function. SNPs are widely used in genetic association studies to identify genetic variants associated with diseases, traits, or responses to treatments. Genome-wide association studies (GWAS) compare the frequency of SNPs between individuals with a particular trait or disease and those without it, Allowing researchers to identify SNPs that may be linked to the trait or disease of interest. SNPs are typically genotyped using molecular biology techniques such as PCR followed by sequencing, microarrays, or targeted genotyping assays. These methods allow researchers to determine which nucleotide variant (allele) an individual carries at a specific SNP locus. qPCR

[0067] Quantitative Polymerase Chain Reaction (qPCR), also known as real-time PCR, is a molecular biology technique used to quantify the amount of a specific DNA sequence in a sample. It is highly sensitive and allows for the precise measurement of DNA concentration, making it valuable in various applications such as gene expression analysis, detection of pathogens, and quantification of viral load. Like traditional PCR, qPCR requires specific primers that flank the target DNA sequence. In addition to primers, qPCR often uses a fluorescent probe that binds to the amplified DNA during the reaction. This probe typically contains a fluorescent dye and a quencher molecule. As the probe is cleaved during amplification, the fluorescent signal is released, allowing for real-time monitoring of DNA amplification. The qPCR reaction is set up with the DNA sample containing the target sequence, along with the primers, probe, DNA polymerase, dNTPs, buffer, and fluorescent dye. The reaction is thermally cycled through repeated rounds of denaturation, annealing, and extension, similar to traditional PCR. However, in qPCR, fluorescence is measured at each cycle to monitor the amplification process in real-time. The fluorescence signals generated during amplification are recorded and analyzed using specialized qPCR instruments and software. By comparing the fluorescence signals to a standard curve generated from known concentrations of DNA, the initial amount of target DNA in the sample can be determined quantitatively. qPCR provides precise quantification of DNA concentration, allowing for accurate determination of gene expression levels, viral load, or pathogen abundance. qPCR can detect even low levels of target DNA, making it suitable for applications requiring high sensitivity. The ability to monitor amplification in real-time enables rapid and efficient data collection, reducing the time required for analysis. qPCR can be multiplexed to simultaneously detect and quantify multiple target sequences in a single reaction, increasing throughput and efficiency. In quantitative polymerase chain reaction (qPCR), a probe is a key component used to detect and quantify the amplified DNA during the reaction. The probe used in qPCR is typically a short single- stranded DNA molecule that is complementary to a specific region within the target DNA sequence. This probe is designed to bind to the target DNA sequence during the reaction. The probe contains a reporter dye at one end and a quencher dye at the other end.

[0068] During the qPCR reaction, the probe is designed to hybridize to the target DNA sequence specifically. The reporter dye emits fluorescence when excited by a specific wavelength of light, but the quencher dye suppresses this fluorescence when it is in close proximity to the reporter dye. When the probe binds to the target DNA sequence, it is in an intact state, and the reporter dye emits fluorescence, which is detected by the qPCR instrument.

[0069] As the qPCR reaction progresses and the target DNA sequence is amplified, more probes bind to the target DNA, resulting in an increase in fluorescence intensity. The increase in fluorescence is directly proportional to the amount of amplified DNA present in the reaction. By monitoring the fluorescence in real-time during the qPCR reaction, the number of DNA copies present in the sample can be quantified. Probe-based quantitative PCR (qPCR) uses real-time fluorescence from 5'-3' exonuclease cleavage of a fluorescently-labeled, target-specific probe to measure DNA amplification at each cycle of a PCR. Because probe-based qPCR is typically more specific than dye-based qPCR, it is often the foundational technology employed in qPCR diagnostic assays. Probe designs vary but the most common type, hydrolysis (e.g., TaqMan®) probes, incorporate a 5’ reporter fluorophore and a 3’ quencher on a short oligonucleotide complementary to the target sequence. Fluorescence resonance energy transfer (FRET) prohibits emission of the fluorophore while the oligo probe is intact. During each PCR cycle, the 5’ flap endonuclease domain of Taq DNA polymerase hydrolyzes the probe as the primer is extended and the target sequence is amplified. This cleavage event separates the reporter fluorophore from the quencher and results in an amplification-dependent increase in fluorescence. Probe-based qPCR allows multiple targets to be quantified in a single reaction (multiplexing) by using a unique fluorescent dye for each amplicon-specific probe.

[0070] Some probe designs do not require the 5’ flap endonuclease activity of Taq such as molecular beacons, Scorpions® and dual-hybridization probes. Molecular beacons form a stemloop structure in the absence of the target sequence, forcing a 5’ fluorophore in close proximity to a 3’ quencher. Upon binding to the target sequence, the fluorophore and quencher become spatially separated, resulting in the fluorescence of the reporter dye. Scorpions are bifunctional molecules that link a stem-loop structure carrying a reporter fluorophore and quencher to a PCR primer. A portion of the stem-loop sequence is designed to hybridize to the newly synthesized strand, downstream of the primer binding site. Extension of the dual-labeled primer by the polymerase creates a copy of the complementary target sequence. In the subsequent PCR cycle, the stem-loop unfolds and binds intramolecularly to the recently synthesized DNA strand, separating the fluorophore from the quencher, resulting in an increase in fluorescence. A blocker between the stem-loop and primer prohibits any further extension of the target-probe complex. Dual-hybridization probes, or LightCycler® type probes, rely on FRET in order to produce, rather than to quench, a detectable fluorescence signal. Two sequence-specific probes containing compatible FRET dyes bind adjacently to the target sequence, downstream of the PCR primers. Excitation of the donor fluorophore, located on the 3’ end of the first probe, causes emission of the acceptor fluorophore, located on the 5’ end of the second probe. Monitoring the emission wavelength of the acceptor dye results in an increased fluorescence signal as the target sequence is amplified.

[0071] In certain embodiments as disclosed herein, the 5’ reporter groups include, for example, a fluorophore, such as ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, Yakima Yellow, or combinations thereof. In certain embodiments as disclosed herein, the 3’ quencher group is a molecule or group capable of absorbing / quenching the fluorescence, such as, for example, DABCYL, BHQ (e.g., BHQ-1 or BHQ-2), ECLIPSE, TAMRA, 3’ Iowa Black® FQ, or combinations thereof.

[0072] ARMS = Amplification Refractory Mutation System PCR

[0073] Primers used in PCR may be a perfectly matched to the target sequence or they can contain mismatched and or 30 modified bases. Oligonucleotide primers for Amplification Refractory Mutation System (ARMS) also known as Allele Specific PCR (ASPCR). ARMS primers promote discrimination of small genetic variations such as a single nucleotide polymorphism (SNP). This ability is based on the fact that oligonucleotides 50 with a mismatched 3’ residue will not function as efficiently as primers compared to fully matched sequences. Double mismatches between a primer and a template, with one mismatch at the 3' end of the primer, provide an increased ability of ARMS primers to effectively discriminate between alleles. ARMS primers must be well designed with the strength of the 3' mismatch balanced by the strength of the second mismatch. This is also balanced by carefully selecting the annealing temperature of the PCR which has an effect on the efficiency with which mismatched primers anneal to their target. Design of ARMS assays can be difficult and development of reaction conditions, for example temperature, where all primers discriminate effectively is tedious.

[0074] ARMS PCR relies on primers that are specifically designed to be complementary to the target DNA sequence except for a single base mismatch at their 3' end, where the polymorphism or mutation of interest resides. Generally, an ARMS PCR reaction typically requires two sets of primers designed for each allele being targeted. One set is designed to be perfectly complementary to the wild-type allele (normal sequence), while the other set is designed to be complementary to the variant allele (mutated sequence). Both sets of primers contain a fluorescent label at their 5' end. In ARMS PCR, primers arc designed to specifically amplify either the wild-type allele or the mutant allele. These primers contain a few nucleotide mismatches at the 3' end, ensuring selective amplification of the target allele. An exemplary PCR reaction mixture contains the following components: Template DNA containing the region of interest (which may contain the SNP or mutation); Forward and reverse primers specific to the wild-type allele; Forward and reverse primers specific to the variant allele; DNA polymerase enzyme; dNTPs (deoxynucleotide triphosphates); Buffer solution providing optimal conditions for DNA polymerization. The PCR cycling conditions typically involve denaturation, annealing, and extension steps. The cycling parameters are optimized to ensure specificity and efficiency of amplification. The annealing temperature is usually set slightly lower than the melting temperature (Tm) of the primers to facilitate specific binding. During the PCR cycling, the primers hybridize to their complementary sequences on the template DNA. Because of the single base mismatch at the 3' end, each primer will only anneal to its complementary allele. This selective annealing ensures allele- specific amplification. Due to the nucleotide mismatches at the 3' end of the primers, only the primer complementary to the target allele will efficiently bind during the annealing step. This leads to selective amplification of the desired allele. The presence or absence of the PCR product indicates the genotype of the sample at the specific locus being interrogated. As the PCR progresses, the DNA strands are amplified, and the fluorescently labeled primers are incorporated into newly synthesized DNA strands. The fluorescence signals from the labeled primers are detected either in real-time using a fluorescent PCR machine or after the PCR amplification is complete using gel electrophoresis or other detection methods. The fluorescent signals are analyzed to determine which allele (wild-type or variant) is present in the sample. This can be done by comparing the fluorescence signals generated by the wild-type and variant allele- specific primers. The presence or absence of specific fluorescent signals indicates the genotype of the sample at the SNP or mutation site. The results obtained from ARMS PCR with fluorescent labeling are typically validated using additional methods such as sequencing to confirm the presence of the specific SNP or mutation.

[0075] Genotyping

[0076] Genotyping (GT) refers to the process of determining the genetic makeup, specifically the variations, present in an individual's genome. It involves identifying specific genetic variants, such as single nucleotide polymorphisms (SNPs), insertions, deletions, or other structural variations, across the genome or within targeted regions. Biological samples containing DNA, such as blood, saliva, or tissue, are collected from individuals. DNA is extracted from the collected samples using various methods to isolate the genetic material. Different techniques can be employed for genotyping, depending on the scale and resolution of analysis required. Some common methods include: Microarray-based genotyping involves hybridizing DNA samples to a microarray chip containing probes specific to known genetic variants. By measuring the intensity of fluorescence signals at each probe position, the genotype of the individual can be determined; PCR-based methods can be used to amplify specific regions of DNA containing the genetic variant of interest. Following amplification, various techniques such as sequencing, restriction fragment length polymorphism (RFLP) analysis, or allele- specific PCR can be used to determine the genotype; NGS technologies allow for the high-throughput sequencing of DNA, enabling the simultaneous detection of multiple genetic variants across the genome. This approach provides comprehensive genotyping data but may be more resource-intensive and expensive than other methods.

[0077] After genotyping, the resulting data are analyzed to determine the genotype at each variant locus. This may involve comparing the observed sequences or signal intensities to reference sequences or known genotypes. Statistical methods are often employed to assess the accuracy and reliability of genotyping calls.

[0078] Locked Nucleic Acid (LNA) LNA bases (Locked nucleotides), which are nucleic acid analogues that are modified at 2'-O, 4'-C and form a bridge. This bridge results in restricted base pairing giving room to adjust the Tm as needed between the probes. Thus, +A, +T, +C or +G signify A, T, G or C bases are added on the modified backbone. LNA is a modified nucleic acid analog in which the ribose ring is constrained in the 3'-endo conformation by a methylene bridge connecting the 2'-oxygen and the 4'-carbon. This bridge "locks" the ribose ring in the ideal North conformation, resulting in increased thermal stability and enhanced hybridization properties when incorporated into oligonucleotides. LNA oligonucleotides exhibit higher melting temperatures (Tm) compared to their unmodified counterparts. This increased stability is attributed to the constrained ribose ring, which strengthens the base stacking interactions and enhances the binding affinity with complementary nucleic acid sequences. LNA oligonucleotides demonstrate improved specificity and discrimination against mismatched sequences due to their higher binding affinity. This property makes them valuable tools for various molecular biology applications requiring precise and selective hybridization, such as PCR, microarray analysis, and in situ hybridization. LNA modifications confer resistance to nuclease degradation, prolonging the half-life of LNA- containing oligonucleotides in biological environments. This feature enhances their stability and effectiveness in applications involving cellular delivery, gene silencing, and therapeutic targeting. LNA oligonucleotides are widely used in antisense technologies and RNA interference (RNAi) strategies for gene regulation and silencing. Their enhanced hybridization properties and nuclease resistance make them valuable tools for modulating gene expression, studying gene function, and developing therapeutic interventions for various diseases. LNA-based probes and inhibitors are employed in diagnostic assays, biomarker detection, and therapeutic interventions targeting nucleic acid sequences associated with diseases, including cancer, viral infections, and genetic disorders. LNA modifications improve the sensitivity, specificity, and stability of nucleic acidbased diagnostics and therapeutics, enhancing their clinical utility.

[0079] A PCR reaction using, for example, ARMS (Amplification Refractory Mutation System) primers and a sequence- specific LNA probe is a highly specific method used to amplify and detect a particular’ allele or genetic variation at specific sites within a DNA sequence. ARMS primers are designed to be allele- specific, meaning they selectively amplify the target allele while discriminating against non-target alleles. Each ARMS primer consists of two parts: a region complementary to the target allele and a 3' mismatched nucleotide at the penultimate (second to last) position. The mismatch at the penultimate position enhances the specificity of the primer by favoring annealing to the perfectly matched target allele over mismatched alleles.

[0080] A LNA probe is a short, single- stranded oligonucleotide comprising LNAs, labeled with a fluorophore at one end and a quencher at the other end. In certain embodiments as disclosed herein all the nucleotides in the LNA probe are LNAs. The probe is designed to hybridize specifically to the target sequence between the ARMS primers. During PCR amplification, the LNA probe is cleaved by the DNA polymerase, resulting in the release of the fluorophore and separation from the quencher, leading to fluorescence emission.

[0081] The PCR reaction mixture typically contains the following components: Template DNA containing the target sequence. Forward and reverse ARMS primers specific to the target allele. Sequence-specific LNA probe designed to hybridize to the target sequence. DNA polymerase (such as Taq polymerase). Deoxynucleotide triphosphates (dNTPs) for DNA synthesis. Buffer solution to maintain optimal pH and salt conditions. MgC12 or other divalent cations for enzyme activity.

[0082] The PCR reaction is subjected to thermal cycling, typically consisting of denaturation, annealing, and extension steps. During the annealing step, the ARMS primers hybridize specifically to their complementary sequences in the template DNA. The LNA probe hybridizes to the target sequence between the ARMS primers. DNA polymerase extends the primers, synthesizing new DNA strands using dNTPs. If the target allele is present, both ARMS primers and the LNA probe will bind, and the LNA probe will be cleaved during the extension step, leading to fluorescence emission. The PCR cycle is repeated multiple times, exponentially amplifying the target allele while discriminating against non-target alleles.

[0083] Fluorescence emitted by the cleaved LNA probes is detected and measured after each cycle by a real-time PCR instrument. The fluorescence signal is proportional to the amount of amplified target allele present in the reaction. Analysis of the fluorescence data allows for the determination of the presence or absence of the target allele and quantification of its abundance in the original sample.

[0084] Allele- specific PCR, such as LNA probe PCR, is a robust method used to distinguish between different alleles of a gene. Specific primers and probes are designed that are complementary to the target DNA sequence. These primers and probes are designed to specifically bind to the allele of interest, with high specificity to distinguish between different alleles. Additionally, a fluorescent probe that will hybridize to the target sequence and emit fluorescence upon amplification is also designed. An oligonucleotide, such as genomic DNA from the sample of interest, such as blood or tissue, is isolated and prepared for PCR amplification. PCR amplification is performed using the designed primers and probes. The reaction mixture typically includes the DNA template, Taq polymerase, dNTPs (deoxynucleotide triphosphates), and buffer solution. The PCR cycling conditions will include denaturation, annealing, and extension steps, during which the target DNA sequence is amplified. Allele- specific probes are labeled with different fluorophores (e.g., FAM for one allele and VIC for another allele). During the annealing step of the PCR cycle, the probes hybridize specifically to the target DNA sequence if the allele is present. If the probe binds, the polymerase cleaves the probe, releasing the fluorescent signal. The emitted fluorescence is detected and recorded by the PCR instrument. The fluorescence data obtained from the PCR instrument is analyzed. The presence or absence of fluorescence signals corresponding to specific alleles indicates the genotype of the sample. By comparing the fluorescence signals to known controls or standard curves, the genotype of the sample can be determined accurately. The presence of fluorescence corresponding to one allele indicates the presence of that allele in the sample, while the absence of fluorescence indicates the absence of that allele. The results can be validated through replication and comparison with alternative genotyping methods or known standards to ensure accuracy and reliability.

[0085] Sample

[0086] In one embodiment of the systems and methods as disclosed herein, the sample is selected from tissue(s) samples, cells, biological fluid samples (e.g., blood, urine, saliva, lymphatic fluid, cerebrospinal fluid (CSF), amniotic fluid, pleural fluid, pericardial fluid, ascites, aqueous humor), bone marrow samples, semen samples, biopsy samples, cancer samples, tumor samples, cell lysate samples, forensic samples, archaeological samples, paleontological samples, infection samples, production samples, whole plants, plant parts, microbiota samples, viral preparations, soil samples, marine samples, freshwater samples, household or industrial samples, and combinations and isolates thereof. In one embodiment of the systems and methods as disclosed herein, the sample is a cell (e.g., an animal cell [e.g., a human cell], a plant cell, a fungal cell, a bacterial cell, and a protozoal cell). In one specific embodiment, the cell is lysed prior to the replication. In one specific embodiment, cell lysis is accompanied by proteolysis. In one specific embodiment, the cell is selected from a cell from a preimplantation embryo, a stem cell, a fetal cell, a tumor cell, a suspected cancer cell, a cancer cell, a cell subjected to a gene editing procedure, a cell from a pathogenic organism, a cell obtained from a forensic sample, a cell obtained from an archeological sample, and a cell obtained from a paleontological sample. In one embodiment of any of the systems and methods as disclosed herein, the sample is a cell from a preimplantation embryo (e.g., a blastomere. In one specific embodiment, the method further comprises determining the presence of disease predisposing germline or somatic variants in the embryo cell. In one embodiment of any of the systems and methods as disclosed herein, the sample is a cell from a pathogenic organism (e.g., a bacterium, a fungus, a protozoan). In one specific embodiment, the pathogenic organism cell is obtained from fluid taken from a patient, microbiota sample (e.g., GI microbiota sample, vaginal microbiota sample, skin microbiota sample, etc.) or an indwelling medical device (e.g., an intravenous catheter, a urethral catheter, a cerebrospinal shunt, a prosthetic valve, an artificial joint, an endotracheal tube, etc.). In one specific embodiment, the method further comprises the step of determining the identity of the pathogenic organism. In one specific embodiment, the method further comprises determining the presence of genetic variants responsible for resistance of the pathogenic organism to a treatment. In one embodiment of any of the systems and methods as disclosed herein, the sample is a tumor cell, a suspected cancer cell, or a cancer cell. In one specific embodiment, the method further comprises determining the presence of one or more diagnostic or prognostic mutations. In one specific embodiment, the method further comprises determining the presence of germline or somatic variants responsible for resistance to a treatment. In one embodiment of any of the systems and methods as disclosed herein, the sample is a cell subjected to a gene editing procedure. In one specific embodiment, the method further comprises determining the presence of unplanned mutations caused by the gene editing process. In one embodiment of any of the systems and methods as disclosed herein, the method further comprises determining the history of a cell lineage. In a related aspect, the invention provides a use of any of the systems and methods as disclosed herein for identifying low frequency sequence valiants (e.g., variants which constitute >0.01% of the total sequences).

[0087] Single Nucleotide Polymorphism Scatter Plots

[0088] SNP scatter plots, or Single Nucleotide Polymorphism scatter plots, are graphical representations used in genetic studies to visualize the relationship between genetic variants across individuals or populations. Single nucleotide polymorphisms (SNPs) are variations in a single nucleotide base within the DNA sequence that occur commonly in the human genome. SNP data from multiple individuals or populations are collected, often through genotyping or sequencing technologies. For each individual, genotypes at different SNP loci are determined. Genotypes are typically represented as categorical variables, such as homozygous for the reference allele (e.g., AA), heterozygous (e.g., AG), or homozygous for the alternate allele (e.g., GG). In the scatter plot, each data point represents an individual or a population sample. The x- axis usually represents one SNP locus, and the y-axis represents another SNP locus. The genotypes of each individual at these two SNP loci determine the position of the data point on the plot. SNP scatter plots are examined for patterns and clusters. Clustering of data points may indicate linkage disequilibrium (LD), which is the non-random association of alleles at different loci. LD can provide insights into the genetic structure and history of populations. Patterns of dispersion may also indicate genetic relatedness or population stratification. SNP scatter plots can also be used in genome-wide association studies (GWAS) to identify genetic variants associated with traits or diseases. In GWAS, cases (individuals with the trait or disease) arc typically compared to controls (individuals without the trait or disease) to identify SNPs associated with the phenotype of interest. SNP scatter plots may be used to visualize the association between genotypes and phenotype. To enhance interpretation, SNP scatter plots may utilize color or size encoding to represent additional information, such as phenotype, ancestry, or allele frequency. This can help distinguish different groups or highlight specific characteristics of the data.

[0089] The invention will be illustrated in more detail with reference to the following Examples, but it should be understood that the present invention is not deemed to be limited thereto.

[0090] EXAMPLES

[0091] Example 1

[0092] Design of allele- specific assays for the HL A genotyping. HLA alleles are highly heterogeneous making assay design challenging. Large numbers of HLA allele sequences were downloaded from IPD-IMGT / HLA Database (ebi.ac.uk). Primary HLA targets were grouped and consensus sequence was generated for HLA design. Primers and probes were then designed to cover the unique set of variants for a given allele. Sequence was then tested for specificity. Consensus sequences for the priority targets and prominent HLA allele P groups were generated using a Levinsky consensus type with 99% threshold. The allele P group consensus sequences were aligned using Kaiign algorithm. For each of the target HLA alleles, a region of the aligned sequences was identified with sufficient nucleotide variability for allele specificity. Manual primer design was performed using an allele specific methodology for both primers and probe. Where significant nucleotide variability was not present, deliberate mismatches were introduced to increase allele specificity.

[0093] Example 2

[0094] HLA-B*38:02 Selection of specific SNP sites.

[0095] 1. All HLA-B allele sequences were downloaded from IPD-IMGT / HLA, which included 4240HLA-B alleles that were accurate to the full naming convention of HLA-B, including 4HLA- B*38:02 alleles: B*38:02:01:01, B*38:02:01:02, B*38:02:02:01, B*38:02:02:02 and 4236 non- HLA-B*38:02 alleles.

[0096] 2. The IPD-IMGT / HLA database also provides multiple sequence alignment functions. After analyzing the results, 13 SNP sites combinations, including rs9266178, rsl 131213, rs319O923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rs 1766813040 and rs 1278753959, could distinguish HLA-B*38:02 from other 4236 HLA-B alleles.

[0097] 3. To facilitate the primer and probe design, additional screening indicated that the combination of rs9266178, rsl 131213 and rs3190923 could distinguish HLAB* 38:02 from other 4229 HLA- B alleles, and the undifferentiated alleles included HLA-B*08:255, HLA-B* 13:97, HLA- B*38:35, HLA-B*38:72, HLA-B*38:74, HLA-B*38:79, HLA-B*38:84, HLA-B*38:85, HLA- B*38:89, HLAB*38:92 and HLA-B*38: 165N; the gene frequencies of these alleles in the existing reports were all <0.01% (www.allelefrequencies.net / default.asp). Therefore, in this study, rs9266178, rsl 131213 and rs3190923 were selected as the specific sites for HLA-B*38:02 genotyping.

[0098] 1. Download all HLA-B allele sequences from the IPD-IMGT / HLA (www.ebi.ac.uk / ipd / imgt / hla / ) database. The database also provides a sequence alignment tool.

[0099] 2. Select HLA-B*38:02:01:01 was used as the reference gene for alignment, and the alignment rule was selected as an exact matched full-length genome alignment. The alignment results for each HLA-B allele were presented in rows, and each base position information was presented in columns.

[0100] 3. The gene alignment results were presented in .txt format, which was then converted into the CSV format data files and imported into Microsoft Excel 2016 for alignment data processing.

[0101] 4. Mismatched bases, missing bases and non-sequenced bases were replaced with the number 0, and the bases that matched each other were replaced with the number 1 ; single or multiple column vectors were summed to obtain a single base or the specificity of a combination of several bases for the HLA-B*38:02 allele.

[0102] 5. Pair of ARMS primers and a sequence- specific TaqMan probe were designed for the determined specific sites.

[0103] 6. Primers and probes were designed with the Primer Premier 5.0 software (Premier Biosoft International, CA, USA). Specificity analysis of the primers and probes was performed with the primer blast in NCBI

[0104] Example 3

[0105] Assays designed for the following 4 HLA, representative SNPs listed below.

[0106] Table 1

[0107] Table 2 Reference Sequences

[0108] Example 4

[0109] HLA-B 15:02 rsl44012689 (See Figure 1)

[0110] FP - AGAGCTCAGGTAGGGAAGGG

[0111] RP - CAACACCACAACCATCAAGGC

[0112] Probe -

[0113] Example 5

[0114] HLA-B 15:02 Primer Design (See Figure 2)

[0115] Example 6

[0116] HLA- A*31:01 (See Figure 6) rs 1061235

[0117] FP - CTTTGCAGAAACAAAGTCAGGGTt

[0118] RP - AGTGTGAGACAGCTGCCTTG

[0119] Normal Probe (Primer Quest) - TTGCCTCTCAGTCCCACACAAGG

[0120] - LN A Probe Recommended

[0121] HLA-3L01 rsl719220

[0122] FP - GAAACAGGAACTCAAATGTGGAGC

[0123] RP - TGAGACCCCTCAGCCTGAG Normal Probe (Primer Quest) - CAAGTGCAAAGGGTGGGCAGAG

[0124] LN A Probe Recommended

[0125] Table 3 Example 7

[0126] HLA-B*15:02 - Assay H19 (See Figure 7)

[0127] Table 4

[0128]

[0129] Example 8

[0130] HLA-B*58:01 H1 / H3 - Assay (See Figure 8)

[0131] Table 5

[0132] Example 9

[0133] HLA-B*57:01 H9 / H11 - Assay (See Figure 9) Table 6

[0134] The present invention also include the following aspects and embodiments. The following aspects and embodiments are listed with numerical references for convenience in exposition and reference, such numerical listing and reference is not meant to be construed in a limiting sense. Embodiment 1, a method for designing allele- specific PCR primers and / or probes comprising: a. comparing a large number of HLA allele sequences; b. determining the consensus sequences for primary HLA allele sequences; c. generating consensus sequences for priority targets and prominent HLA allele P groups (Protein groups); d. identifying a region of each of the target HLA alleles of the aligned sequences with sufficient nucleotide variability for allele specificity; e. designing allele-specific PCR primers and allele- specific PCR probes to amplify unique sets of variants for target HLA allele sequences with sufficient nucleotide variability for allele specificity; and f. optionally, introducing mismatches to increase allele specificity.

[0135] Embodiment 2, the method of embodiment 1, wherein the length of the allele- specific PCR primer is from 10 to about 40 nucleotides.

[0136] Embodiment 3, the method of any one of embodiments 1 to 2 wherein the allele- specific PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position.

[0137] Embodiment 4, the method of any one of embodiments 1 to 3 wherein the length of the allelespecific PCR probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt.

[0138] Embodiment 5, the method of any one of embodiments 1 to 4 wherein the length of the allelespecific PCR probe is 7 nt.

[0139] Embodiment 6, the method of any one of embodiments 1 to 5 wherein the allele- specific PCR probe comprises more than one LNA.

[0140] Embodiment 7, the method of any one of embodiments 1 to 6 wherein the allele- specific PCR probe nucleotides are all LNAs. Embodiment 8, the method of any one of embodiments 1 to 7 wherein the allele- specific PCR probe is complementary to an HLA allele.

[0141] Embodiment 9, the method of any one of embodiments 1 to 8 wherein the allele- specific PCR probe is complementary to an HLA allele selected from the group consisting of HLA-A*31 :01; HLA-B*15:02; HLA-B*58:01; and HLA-B*57:01.

[0142] Embodiment 10, the method of any one of embodiments 1 to 9 wherein the allele- specific PCR probe is complementary to an HLA allele SNP selected from the group consisting of rsl7179220, rsl0484555, rsl44012689, rsl061235, and rsl719220.

[0143] Embodiment 11, the method of any one of embodiments 1 to 10 wherein the allele- specific PCR probe is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rs 1131213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02.

[0144] Embodiment 12, the method of any one of embodiments 1 to 11 wherein the allele- specific PCR probe is complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA- B*57:01, rs2395029; HLA-B*38:02:01:0L

[0145] Embodiment 13, the method of any one of embodiments 1 to 12 wherein the allele- specific PCR probe comprises a 5' fluorescent dye label selected from the group consisting of ALEX- 350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow.

[0146] Embodiment 14, the method of any one of embodiments 1 to 13 wherein the allele- specific PCR probe comprises a 3' quencher group selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ. Embodiment 15, a composition comprising allele- specific PCR primers and / or probes made by a method comprising: a. comparing a large number of HLA allele sequences; b. determining the consensus sequences for primary HLA allele sequences; c. generating consensus sequences for priority targets and prominent HLA allele P groups; d. identifying a region of each of the target HLA alleles of the aligned sequences with sufficient nucleotide variability for allele specificity; e. designing allele-specific PCR primers and allele- specific PCR probes to amplify unique sets of variants for target HLA allele sequences with sufficient nucleotide variability for allele specificity; and f. optionally, introducing mismatches to increase allele specificity.

[0147] Embodiment 16, the composition of embodiment 15, comprising an allele-specific PCR primer wherein the length of the allele- specific PCR primer is from 10 to about 40 nucleotides.

[0148] Embodiment 17, the composition of any one of embodiments 15 to 16 wherein the allelespecific PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position.

[0149] Embodiment 18, the composition of any one of embodiments 15 to 17 wherein the length of the allele-specific PCR probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt.

[0150] Embodiment 19, the composition of any one of embodiments 15 to 18 wherein the length of the allele-specific PCR probe is 7 nt.

[0151] Embodiment 20, the composition of any one of embodiments 15 to 19 wherein the allelespecific PCR probe comprises one LNA. Embodiment 21, the composition of any one of embodiments 15 to 20 wherein the allelespecific PCR probe comprises more than one LNA.

[0152] Embodiment 22, the composition of any one of embodiments 15 to 21 wherein the allelespecific PCR probe nucleotides are all LNAs.

[0153] Embodiment 23, the composition of any one of embodiments 15 to 22 wherein the allelespecific PCR probe is complementary to an HLA allele.

[0154] Embodiment 24, the composition of any one of embodiments 15 to 23 wherein the allelespecific PCR primers and / or probes are complementary to an HLA allele selected from the group consisting of HLA-A*31 :01; HLA-B*15:02; HLA-B*58:01; and HLA-B*57:01.

[0155] Embodiment 25, the composition of any one of embodiments 15 to 24 wherein the allelespecific PCR primers and / or probes are complementary to an HLA allele SNP selected from the group consisting of rsl7179220, rsl0484555, rsl44012689, rsl061235, and rsl719220.

[0156] Embodiment 26, the composition of any one of embodiments 15 to 25 wherein the allelespecific PCR primers and / or probes are complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsll31213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02.

[0157] Embodiment 27, the composition of any one of embodiments 15 to 26 wherein the allelespecific PCR primers and / or probes are complementary to an HLA allele and SNP selected from the group consisting of HLA- A*31 :01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01.

[0158] Embodiment 28, the composition of any one of embodiments 15 to 27 wherein the allelespecific PCR probe comprises a 5' fluorescent dye label selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, C Y3 , CY 5 , CY 5.5 , Quasar 705 , and Yakima Yellow.

[0159] Embodiment 29, the composition of any one of embodiments 15 to 28 wherein the allelespecific PCR probe comprises a 3' quencher group selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

[0160] Embodiment 30, a method of determining HLA allelic variants in a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid to be characterized for the presence of an HLA allelic variant; b. providing a first polymerase chain reaction (PCR) reaction mixture comprising: i. a forward oligonucleotide PCR primer designed to be allele-specific comprising a region overlapping the target allele, optionally wherein the forward oligonucleotide PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position; ii. a reverse oligonucleotide PCR primer designed to be allele- specific comprising a region overlapping the target allele, optionally wherein the reverse oligonucleotide PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position; iii. a first test probe, wherein the first test probe comprises a sequence complementary to a sense strand with a first HLA allelic variant, wherein the first test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the first test probe comprises a first 5'- fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label, further wherein the length of the first test probe is selected from the group consisting of 6, 7, 8, and 9 nucleotides; iv. at least one additional test probe, wherein the at least one additional test probe comprises a sequence complementary to a sense strand with an additional HLA allelic variant, wherein the at least one additional test probe comprises at least one Locked Nucleic Acid (LNA), further wherein the at least one additional test probe comprises a unique 5'- fluorescent dye label which is different that the first 5 '-fluorescent dye label, as well as a 3'-quencher capable of quenching the fluorescence of the 5' fluorescent label, further wherein the length of the at least one additional test probe is selected from the group consisting of 6, 7, 8, and 9 nucleotides; v. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. Adding the target nucleic acid to the PCR reaction mixture; d. amplifying the target nucleic acid with a nucleic acid polymerase to provide amplification products, e. measuring the amplification products of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye labels, f. wherein detection of the first 5'- fluorescent dye label indicates the presence of the first SNP allelic variant, and detection of the second 5'- fluorescent dye label indicates the presence of the second SNP allelic variant in the target nucleic acid.

[0161] Embodiment 31, the method of embodiment 30, wherein the length of the first test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt.

[0162] Embodiment 32, the method of any one of embodiments 30 to 31 wherein the length of the at least one additional test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt.

[0163] Embodiment 33, the method of any one of embodiments 30 to 32 wherein the length of the first test probe is 7 nt.

[0164] Embodiment 34, the method of any one of embodiments 30 to 33 wherein the length of the at least one additional test probe is 7 nt.

[0165] Embodiment 35, the method of any one of embodiments 30 to 34 wherein the first test probe comprises more than one LNA. Embodiment 36, the method of any one of embodiments 30 to 35 wherein the second test probe comprises more than one LNA.

[0166] Embodiment 37, the method of any one of embodiments 30 to 36 wherein the first test probe nucleotides are all LNAs.

[0167] Embodiment 38, the method of any one of embodiments 30 to 37 wherein the second test probe nucleotides are all LNAs.

[0168] Embodiment 39, the method of any one of embodiments 30 to 38 wherein the test probe is complementary to an HL A allele.

[0169] Embodiment 40, the method of any one of embodiments 30 to 39 wherein the test probe is complementary to an HLA allele selected from the group consisting of HLA- A*31:01; HLA- B*15:02; HLA-B*58:01; and HLA-B*57:01.

[0170] Embodiment 41, the method of any one of embodiments 30 to 40 wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rs 17179220, rsl0484555, rsl44012689, rsl061235, and rsl719220.

[0171] Embodiment 42, the method of any one of embodiments 30 to 41 wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rslL31213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02.

[0172] Embodiment 43, the method of any one of embodiments 31 to 42 wherein the test probe is complementary to an HLA allele and SNP selected from the group consisting of HLA- A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01. Embodiment 44, the method of any one of embodiments 30 to 43 wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow.

[0173] Embodiment 45, the method of any one of embodiments 30 to 44 wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

[0174] Embodiment 46, a method of determining allelic SNP variants in a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid, wherein the target nucleic acid has an allelic variant SNP to be characterized; b. providing a polymerase chain reaction (PCR) reaction mixture comprising: i. an oligonucleotide primer designed to specifically amplify the wild-type allele, wherein the primer contains a nucleotide at the 3' end to prevent PCR amplification, further wherein the oligonucleotide primer designed to specifically amplify the wild-type allele comprises a fluorescent label at the 5' end; ii. an oligonucleotide primer designed to specifically amplify the mutant allele further wherein the oligonucleotide primer designed to specifically amplify the mutant allele, further wherein the oligonucleotide primer designed to specifically amplify the mutant allele comprises a fluorescent label at the 5' end which is different than the fluorescent label on the wild-type allele oligonucleotide primer; iii. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. Adding the target nucleic acid to the PCR reaction mixture; d. performing a PCR amplification in the PCR reaction mixture to amplify the target nucleic acid in the sample, thereby generating an amplification product, e. detecting the amplification product, wherein due to the nucleotide mismatches at the 3' end of the wild type primer, only the primer complementary to the target mutant allele will efficiently bind during the annealing step, leading to selective amplification of the target mutant allele, wherein the presence or absence of the amplification product indicates the genotype of the sample at the specific locus being interrogated.

[0175] Embodiment 47, the method of embodiment 46, wherein the oligonucleotide primer is complementary to an HL A allele.

[0176] Embodiment 48, the method of any one of embodiments 46 to 47 wherein the oligonucleotide primer is complementary to an HLA allele selected from the group consisting of HLA- A* 31 :01;

[0177] HLA-B*15:02; HLA-B*58:01; and HLA-B*57:01.

[0178] Embodiment 49, the method of any one of embodiments 46 to 48 wherein the oligonucleotide primer is complementary to an HLA allele SNP selected from the group consisting of rsl7179220, rsl0484555, rsl44012689, rsl061235, and rsl719220.

[0179] Embodiment 50, the method of any one of embodiments 46 to 49 wherein the oligonucleotide primer is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rs 1131213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02.

[0180] Embodiment 51, the method of any one of embodiments 46 to 50 wherein the oligonucleotide primer is complementary to an HLA allele and SNP selected from the group consisting of HLA- A*31 :01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA- B*57:01, rs2395029; HLA-B*38:02:01:01.

[0181] Embodiment 52, the method of any one of embodiments 46 to 51 wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow.

[0182] Embodiment 53, a method of determining allelic variants in a target nucleic acid, the method comprising: a. providing a sample comprising a target nucleic acid, wherein the target nucleic acid has an allelic variant to be characterized; b. providing a polymerase chain reaction (PCR) reaction mixture comprising: i. a pair of unlabeled allele specific oligonucleotide PCR primers; ii. a test probe, wherein the probe comprises a sequence complementary to a sense strand with a SNP, wherein the probe comprises at least one Locked Nucleic Acid (LN A) further wherein the probe comprises a 5'- fluorescent dye label and a 3'-quencher; iii. an amplification buffer, at least one nucleic acid polymerase, and a mixture of nucleotides; c. Adding the target nucleic acid to the PCR reaction mixture; d. performing a PCR amplification in the PCR reaction mixture to amplify the target nucleic acid in the sample, thereby generating an amplicon, e. measuring amplification of the target nucleic acid by monitoring the fluorescence of the 5'- fluorescent dye label, wherein amplification of the target nucleic acid indicates the presence of the SNP.

[0183] Embodiment 54, the method of embodiment 53, wherein the length of the first test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt.

[0184] Embodiment 55, the method of any one of embodiments 53 to 54 wherein the length of the at least one additional test probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt.

[0185] Embodiment 56, the method of any one of embodiments 53 to 55 wherein the length of the first test probe is 7 nt. Embodiment 57, the method of any one of embodiments 53 to 56 wherein the length of the at least one additional test probe is 7 nt.

[0186] Embodiment 58, the method of any one of embodiments 53 to 57 wherein the first test probe comprises more than one LNA.

[0187] Embodiment 59, the method of any one of embodiments 53 to 58 wherein the second test probe comprises more than one LNA.

[0188] Embodiment 60, the method of any one of embodiments 53 to 59 wherein the first test probe nucleotides are all LNAs.

[0189] Embodiment 61, the method of any one of embodiments 53 to 60 wherein the second test probe nucleotides are all LNAs.

[0190] Embodiment 62, the method of any one of embodiments 53 to 61 wherein the test probe is complementary to an HL A allele.

[0191] Embodiment 63, the method of any one of embodiments 53 to 62 wherein the test probe is complementary to an HLA allele selected from the group consisting of HLA-A*31:01; HLA- B*15:02; HLA-B*58:01; and HLA-B*57:01.

[0192] Embodiment 64, the method of any one of embodiments 53 to 63 wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rs 17179220, rsl0484555, rsl44012689, rsl061235, and rsl719220.

[0193] Embodiment 65, the method of any one of embodiments 53 to 64 wherein the test probe is complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsll31213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02. Embodiment 66, the method of any one of embodiments 54 to 65 wherein the test probe is complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01.

[0194] Embodiment 67, the method of any one of embodiments 53 to 66 wherein the 5' fluorescent dye label is selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow.

[0195] Embodiment 68, the method of any one of embodiments 53 to 67 wherein the 3' quencher group is selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

[0196] While the invention has been described in detail and with reference to specific examples thereof, it will be apparent to one skilled in the ail that various changes and modifications can be made therein without departing from the spirit and scope thereof.

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A composition comprising allele- specific PCR primers and / or probes made by a method comprising: a. comparing a large number of HLA allele sequences; b. determining the consensus sequences for primary HLA allele sequences; c. generating consensus sequences for priority targets and prominent HLA allele P groups; d. identifying a region of each of the target HLA alleles of the aligned sequences with sufficient nucleotide variability for allele specificity; e. designing allele- specific PCR primers and allele- specific PCR probes to amplify unique sets of variants for target HLA allele sequences with sufficient nucleotide variability for allele specificity; and f. optionally, introducing mismatches to increase allele specificity.

2. The composition of claim 1, comprising an allele-specific PCR primer wherein the length of the allele- specific PCR primer is from 10 to about 40 nucleotides.

3. The composition of any one of claims 1 to 2 wherein the allele- specific PCR primer comprises a 3' mismatched nucleotide at the penultimate (second to last) position.

4. The composition of any one of claims 1 to 3 wherein the length of the allele- specific PCR probe is selected from the group consisting of 6 nt, 7 nt, 8 nt, and 9 nt.

5. The composition of any one of claims 1 to 4 wherein the length of the allele- specific PCR probe is 7 nt.

6. The composition of any one of claims 1 to 5 wherein the allele-specific PCR probe comprises one LNA.

7. The composition of any one of claims 1 to 6 wherein the allele-specific PCR probe comprises more than one LNA.

8. The composition of any one of claims 1 to 7 wherein the allele-specific PCR probe nucleotides are all LNAs.

9. The composition of any one of claims 1 to 8 wherein the allele- specific PCR probe is complementary to an HL A allele.

10. The composition of any one of claims 1 to 9 wherein the allele- specific PCR primers and / or probes are complementary to an HLA allele selected from the group consisting of HLA-A*31:01; HLA-B*15:02; HLA-B*58:01; and HLA-B*57:01.

11. The composition of any one of claims 1 to 10 wherein the allele- specific PCR primers and / or probes are complementary to an HLA allele SNP selected from the group consisting of rsl7179220, rsl0484555, rsl44012689, rsl061235, and rsl719220.

12. The composition of any one of claims 1 to 11 wherein the allele- specific PCR primers and / or probes are complementary to an HLA allele SNP selected from the group consisting of rs9266178, rsl l31213, rs3190923, rsl51341205, rsl050459, rsl071816, rs41559314, rsl51341283, rsl766844490, rs41555918, rs778808034, rsl766813040 and rsl278753959 of HLA-B*38:02.

13. The composition of any one of claims 1 to 12 wherein the allele-specific PCR primers and / or probes are complementary to an HLA allele and SNP selected from the group consisting of HLA-A*31:01, rsl7179220; HLA-B*15:02, rsl0484555, rsl44012689; HLA-B*58:01; HLA-B*57:01, rs2395029; HLA-B*38:02:01:01.

14. The composition of any one of claims 1 to 13 wherein the allele- specific PCR probe comprises a 5' fluorescent dye label selected from the group consisting of ALEX-350, FAM, VIC, TET, CAL Fluor Gold 540, JOE, HEX, CAL Fluor Orange 560, TAMRA, CAL Fluor Red 590, ROX, CAL Fluor Red 610, TEXAS RED, CAL Fluor Red 635, Quasar 670, CY3, CY5, CY5.5, Quasar 705, and Yakima Yellow.

15. The composition of any one of claims 1 to 14 wherein the allele- specific PCR probe comprises a 3' quencher group selected from the group consisting of DABCYL, BHQ, BHQ-1, BHQ-2, ECLIPSE, TAMRA, and Iowa Black® FQ.

Images