Compositions and methods for treatment of neuronal injury and neurode generative disorders

Abstract

Antagonists of MRGPRX2 reduce post-stroke brain inflammation and improves motor outcomes. Methods of treating post-stroke brain inflammation neurological disorders, such as Alzheimer's Disease include administering these antagonists to patients.

Description

DOCKET NO.: 348358.18502 COMPOSITIONS AND METHODS FOR TREATMENT OF NEURONAL INJURY AND NEURODEGENERATIVE DISORDERS The present application claims the benefit of U.S. provisional application no.63 / 644,152 filed May 8, 2024, which is incorporated by reference herein in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0001] This invention was made with government support under grants NS131599 and NS054791 awarded by the National Institutes of Health. The government has certain rights in the invention. BACKGROUND

[0002] Immune surveillance is tightly regulated within the central nervous system (CNS) through brain- resident and peripheral immune cells that strategically monitor the brain and spinal cord for signs of injury. This physiologic relationship is key to maintaining homeostasis but can become pathologic following injury, such as stroke. While initial neuronal injury in ischemic stroke stems from the lack of oxygen and nutrients to the brain, subsequent inflammation following reperfusion exacerbates morbidity and mortality1. Infiltration of neutrophils and monocytes2in the brain has been correlated with greater infarct volume and long-term functional deficits months to years after stroke3,7–10. This acute inflammation has also been shown to permanently alter the brain’s immune environment, as reactive microglia can be seen years after a single pathologic event11–13. While current stroke management prioritizes reperfusion, using thrombolytic therapy and mechanical thrombectomy, little is done to prevent ensuing inflammation14. Thus, understanding specific mechanisms that mediate brain inflammation after injury is vital to provide clinically relevant targets and to prevent long term alterations to the brain-immune environment.

[0003] A growing body of evidence suggests that the meninges surrounding the CNS play a central role in immunosurveillance5,6,15. Indeed, the discovery of meningeal lymphatics that drain CNS waste questioned the idea that the brain is an immune-privileged site and has launched further studies into how the meninges play a role in brain immunity16,17. However, how meningeal immune cells respond to ischemic stroke is unclear. While several studies have reported specific cell types within the brain and meninges that contribute to post-stroke inflammation, the specific molecules that sense and mediate immune recruitment are unknown18–21. 171808680.1

[0004] One such cell that has been previously studied but often overlooked is the mast cell. Better known for their role in allergic diseases, mast cells have more recently been identified as primary immune responders in several modes of neuronal injury22,23. In these contexts, mast cells serve as sentinel immune cells responsible for probing the local environment and propagating inflammation. SUMMARY

[0005] We now provide new treatments for ischemic stroke injury and neuroinflammatory diseases which include use of one or more MRGPRX2 antagonist compounds.

[0006] In one aspect, a method of treating ischemic stroke injury in a subject is provided, comprising administering an effective amount of one or more MRGPRX2 antagonists to the subject, thereby treating the ischemic stroke injury.

[0007] In further aspects, methods are provided for treatment and / or prophylaxis of conditions and events that can result in nerve cell death resulting from e.g. stroke, hypoxia, hypoglycemia, brain or spinal cord ischemia, and brain or spinal cord trauma. These treatment methods may include treatment of effects of nerve cell death, including inflammation associated with inflammation. The methods may include administering an effective amount of one or more MRGPRX2 antagonists to a subject in need thereof, such as a subject identified as suffering from or susceptible to nerve cell death resulting from e.g. stroke, hypoxia, hypoglycemia, brain or spinal cord ischemia, and brain or spinal cord trauma.

[0008] In further aspects, methods are provided for treatment traumatic brain or spinal cord injury, including inflammation that may be associated with traumatic brain or spinal cord injury. The methods may include administering an effective amount of one or more MRGPRX2 antagonists to a subject in need thereof, such as a subject that has suffered a traumatic brain injury or a traumatic spinal cord injury.

[0009] Methods are also provided to treat and / or prevent various neurodegenerative diseases such as Parkinson's disease, Huntington's disease, Amyotrophic Lateral Sclerosis, Alzheimer's disease, Down's Syndrome and Korsakoff's disease.

[0010] In a further aspect, methods are provided to treat and / or prevent non-infectious meningitis. The methods may include administering an effective amount of one or more2 171808680.1MRGPRX2 antagonists to a subject in need thereof, such as a subject identified as suffering from or susceptible to non-infectious meningitis.

[0011] The present treatment methods in general comprise administering an effective amount of one or more MRGPRX2 antagonists to a subject in need thereof, such as a subject suffering from or susceptible to ischemic stroke injury, nerve cell death resulting from e.g. stroke, hypoxia, hypoglycemia, brain or spinal cord ischemia, brain or spinal cord trauma, or a neurodegenerative disease. These treatment methods may include treatment of effects of such conditions, diseases and disorders, including treatment of inflammation associated with to ischemic stroke injury, nerve cell death resulting from e.g. stroke, hypoxia, hypoglycemia, brain or spinal cord ischemia, brain or spinal cord trauma, or a neurodegenerative disease.

[0012] In certain embodiments, the MRGPRX2 antagonist comprises an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents, double stranded ribonucleic acid (dsRNA), small hairpin RNA or short hairpin RNA (shRNA), or antisense RNA, or any portion thereof.

[0013] In certain embodiments, the MRGPRX2 antagonist comprises a small molecule including an organic small molecule.

[0014] In certain embodiments, the MRGPRX2 antagonist comprises an antibody or antibody fragment. In certain embodiments, the MRGPRX2 antagonist is a peptide.

[0015] In certain embodiments, the MRGPRX2 antagonist comprises Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2, (1,2-Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262; MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof.3 171808680.1

[0016] In certain embodiments, the subject is identified as suffering from an injury or disorder or disorder as disclosed herein such an ischemic stroke injury and the MRGPRX2 antagonist is administered to the identified subject.

[0017] In certain embodiments, the method further comprises administering to the subject antagonists of substance P, antagonists of CCL2, antagonists of CCL3, antagonists of neutrophil elastase, antagonists of interleukin 1 beta (IL-1β), antagonists of interleukin 6 (IL-6), antagonists of interleukin 17 (IL-17), tryptase, tumor necrosis factor alpha (TNFα), anti-inflammatory agents or combinations thereof. In certain embodiments, the MRGPRX2 antagonist is administered to the subject during or post ischemic injury. In certain embodiments, the MRGPRX2 antagonist is administered orally, intra muscularly or systemically.

[0018] In another aspect, a method of treating a neuroinflammatory disease is provided comprising administering an effective amount of an MRGPRX2 antagonist to the subject in need thereof, thereby treating the neuroinflammatory disease.

[0019] In certain embodiments, the antagonist comprises an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents or any combination thereof.

[0020] In certain embodiments, the MRGPRX2 antagonist comprises a small molecule, including an organic small molecule. In certain embodiments, the antagonist comprises an antibody or antibody fragment. In certain embodiments, the antagonist is a peptide.

[0021] In certain embodiments, the MRGPRX2 antagonist comprises Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2-Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7 xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262, MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof. In certain embodiments, the subject is identified as suffering from a neuroinflammatory disease and the MRGPRX2 antagonist is administered to the identified subject.4 171808680.1

[0022] In certain embodiments, the method further comprises administering to the subject antagonists of substance P, antagonists of CCL2, antagonists of CCL3, antagonists of neutrophil elastase, antagonists of interleukin 1 beta (IL-1β), antagonists of interleukin 6 (IL-6), antagonists of interleukin-8 (IL-8), antagonists of interleukin 17 (IL-17), tryptase, tumor necrosis factor alpha (TNFα), anti-inflammatory agents or combinations thereof. In certain embodiments, wherein the MRGPRX2 antagonist is administered to the subject diagnosed with a neuroinflammatory disease, e.g. orally, intra muscularly or systemically.

[0023] In certain embodiments, a neuroinflammatory disease comprises Alzheimer's disease (AD), Parkinson's disease (PD), neuromyelitis optica (NMO), transverse myelitis, optic neuritis, acute disseminated encephalomyelitis (ADEM), primary angiitis of the central nervous system, Susac's syndrome, Acute Disseminated Encephalomyelitis, Acute Hemorrhagic Leukoencephalomyelitis, Central nervous system (CNS) vasculitis, transverse myelitis or stroke.

[0024] In another aspect, a method for screening for drug agents that modulate one or more MRGPRX2 receptors is provided comprising contacting one or more cells expressing an MRGPRX2 G protein coupled receptor with a candidate drug agent; and detecting a response of the one or more cells to thereby select the candidate drug agent.

[0025] In certain embodiments, a response of the cells is detected as activation of the G protein coupled receptor. In certain embodiments, the detected response is an increase in intracellular calcium or activation also can be assessed by inositol phosphate detection or β-arrestin recruitment assay. In certain embodiments, the cells comprise cells of the central nervous system (CNS), neuronal cells, brain cells, skull bone marrow cells, xenogeneic cells, cell lines or combinations thereof.

[0026] In another aspect, a pharmaceutical composition for the treatment of a neuroinflammatory disease is provided, the composition comprising an effective amount of an MRGPRX2 antagonist. In certain embodiments, the MRGPRX2 antagonist comprises an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents or any combination thereof. In certain embodiments, the MRGPRX2 antagonist comprises a small molecule. In certain embodiments, the MRGPRX2 antagonist comprises an antibody or antibody fragment. In certain embodiments, the MRGPRX2 the antagonist is a peptide. In certain embodiments, the MRGPRX2 antagonist comprises Osthole5 171808680.1(C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2-Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7 xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262, MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof.

[0027] In certain embodiments, the neuroinflammatory disease comprises Alzheimer's disease (AD), Parkinson's disease (PD), neuromyelitis optica (NMO), transverse myelitis, optic neuritis, acute disseminated encephalomyelitis (ADEM), primary angiitis of the central nervous system, Susac's syndrome, Acute Disseminated Encephalomyelitis, Acute Hemorrhagic Leukoencephalomyelitis, Central nervous system (CNS) vasculitis, transverse myelitis or stroke.

[0028] In some aspects, the MRGPRX2 antagonist comprises a small molecule. A small molecule is a compound that is less than 2000 Daltons in mass. The molecular mass of the small molecule is less than 1000 Daltons, less than 600 Daltons, e.g., the compound is less than 500 Daltons, less than 400 Daltons, less than 300 Daltons, less than 200 Daltons, or less than 100 Daltons.

[0029] Small molecules are organic or inorganic. Exemplary organic small molecules include, but are not limited to, aliphatic hydrocarbons, alcohols, aldehydes, ketones, organic acids, esters, mono- and disaccharides, aromatic hydrocarbons, amino acids, and lipids. Exemplary inorganic small molecules comprise trace minerals, ions, free radicals, and metabolites. Alternatively, small molecules can be synthetically engineered to consist of a fragment, or small portion, or a longer amino acid chain to fill a binding pocket of an enzyme. In certain embodiments, typically small molecules are less than one kilodalton.

[0030] In some embodiments, the MRGPRX2 antagonist comprises a nucleic acid molecule. For example, ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) inhibits the expression of MRGPRX2 polypeptide, thereby inhibiting the activity of MRGPRX2. In some cases, the nucleic acid comprises small interfering RNA (siRNA), RNA interference (RNAi), messenger RNA (mRNA), small hairpin RNA or short hairpin RNA (shRNA), double stranded6 171808680.1ribonucleic acid (dsRNA), antisense RNA or microRNA, or any portion thereof. However, the skilled artisan could readily identify additional nucleic acids that inhibit / antagonize MRGPRX2.

[0031] In certain embodiments, an MRGPRX2 antagonist can be an antibody, for example a monoclonal or polyclonal MRGPRX2 antibody. For instance, MRGPRX2 antibodies that may be employed as an antagonist include monoclonal or polyclonal antibodies, such as mouse, rabbit, primate (e.g., monkey) or humanized antibodies (e.g., commercially available Biolegend mouse monoclonal anti-MRGPRX2 antibody No. K125H4; Invitrogen’s rabbit polyclonal MRGPRX2 antibody PA5-113198; Abnova mouse polyclonal anti-MRGPRX2 antibody H00117194-B02P). Fragments of such monoclonal antibodies also can be suitable antagonists or agonists, including fragments of the noted commercially available antibodies. Suitable and preferred antibody fragments for use as an MRGPRX2 antagonist can be readily identified by the assays disclosed herein. Suitable fragments may contain a sequence that has at least 30, 40, 50, 60, 70, 80, 90 or 95 sequence identity with the corresponding antibody such as the noted commercially available antibodies. Such fragments may be the entire agent that is used an MRGPRX2 antagonist or may be covalently linked to another sequence or other molecule, for instance to form a fusion molecule containing the antibody fragment sequence or containing a sequence having a suitable sequence identify with the corresponding antibody such as the noted commercially available antibodies.

[0032] A variety of administration routes are available. For example, the antagonist or agonist is administered topically, orally, systemically, via inhalation, or via injection.

[0033] The effective amount of an MRGPRX2 antagonist is from for example 0.001 mg / kg to 250 mg / kg body weight, e.g., 0.001 mg / kg, 0.05 mg / kg 0.01 mg / kg, 0.05mg / kg, 1 mg / kg, 5 mg / kg, 10 mg / kg, 25 mg / kg, 50 mg / kg, 75 mg / kg, 100 mg / kg, 125 mg / kg, 150 mg / kg, 175 mg / kg, 200 mg / kg, 225 mg / kg, or 250 mg / kg body weight. Ultimately, the attending physician or veterinarian decides the appropriate amount and dosage regimen.

[0034] In some cases, an MRGPRX2 antagonist is administered at least once per day, at least once per week, or at least once per month. The antagonist or agonist suitably may be administered for a duration of one day, one week, one month, two months, three months, six months, 9 months, or one year. In some cases, a MRGPRX2 antagonist may be administered daily, e.g., every 24 hours. Alternatively, a MRGPRX2 antagonist is administered continuously or several times per day, e.g., every 1 hour, every 2 hours, every 3 hours, every 4 hours, every 57 171808680.1hours, every 6 hours, every 7 hours, every 8 hours, every 9 hours, every 10 hours, every 11 hours, or every 12 hours.

[0035] Activation of MRGPRX2 can be detected by identifying an increase in intracellular calcium relative to the level of intracellular calcium in the absence of the compound. In some cases, the level of intracellular calcium increases by at least 1%, e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99%. Intracellular calcium concentration is determined utilizing the methods described herein or those available to the skilled artisan.

[0036] A candidate MRGPRX2 antagonist can be screened to confirm that it counteracts or inhibits, decreases, or suppresses the biological activity of an MRGPRX2 polypeptide.

[0037] A decrease in activation of MRGPRX2 relative to the activation of MRGPRX2 in the absence of the candidate antagonist determines that the candidate compound is an antagonist. Preferably, a candidate antagonist decreases activation of MRGPRX2 by at least 1, 2, 3, 4 or 5 percent relative to a test assay in the absence of the candidate antagonist (control), more preferably a candidate antagonist decreases activation of MRGPRX2 in a test assay by at least 7, 10, 15, 20, 25, 30, 405060, 70, 80, 90 or 100 percent relative to the same test assay in the absence of the candidate antagonist (control) where activation can be assessed by calcium imaging or inositol phosphate or ^-arrestin recruitment based detection.

[0038] A compound may be considered a MRGPRX2 antagonist as referred where the compound exhibits a decrease in activation of MRGPRX2 relative to the activation of MRGPRX2 in the absence of the compound (control), e.g. where the compound decreases activation of MRGPRX2 by at least 1, 2, 3, 4 or 5 percent relative to a test assay (e.g in vitro) in the absence of the MRGPRX2 antagonist (control), more preferably a MRGPRX2 antagonist compound decreases activation of MRGPRX2 in a test assay by at least 7, 10, 15, 20, 25, 30, 405060, 70, 80, 90 or 100 percent relative to the same test assay in the absence of the antagonist compound (control) where activation can be assessed by calcium imaging or inositol phosphate or ^-arrestin recruitment based detection. A ^-arrestin recruitment assay is also disclosed in Kumar et al., J. Allergy Clin Immunol. p. 1110-1122 (April 2023) [https: / / www.jacionline.org / article / S0091- 6749(22)02551-9 / fulltext], which assay can be utilized to identify and confirm a compound as a8 171808680.1MRGPRX2 antagonist, including inhibition demonstrated at compound concentrations of 50 µM and / or 100 µM.

[0039] Also provided are methods for identifying an antagonist of MRGPRX2 comprising: contacting the isolated cell described herein (e.g. an isolated cell comprising a recombinant nucleic acid that expresses mas-related G-protein coupled receptor MRGPRX2) with a compound that induces a pseudo-allergic-type reaction, contacting the isolated cell described herein with a candidate agonist, detecting activation of MRGPRX2, wherein a decrease in activation of MRGPRX2 relative to the activation of MRGPRX2 in the absence of the candidate antagonist determines that the candidate compound is an antagonist. In certain embodiments, a selected candidate antagonist decreases activation of MRGPRX2 by at least 1, 2, 3, 4 or 5 percent relative to a test assay in the absence of the candidate antagonist (control), a selected candidate antagonist decreases activation of MRGPRX2 in a test assay by at least 7, 10, 15, 20, 25, 30, 405060, 70, 80, 90 or 100 percent relative to the same test assay in the absence of the candidate antagonist (control). Test assays for assessing a candidate antagonist are described in WO2016 / 019246 (PCT / US2015 / 043116) and may include for example by calcium imaging or inositol phosphate detection or ^-arrestin recruitment-based assay.

[0040] The compositions described herein are administered via oral administration, intravenous administration, topical administration, parenteral administration, intraperitoneal administration, intramuscular administration, intrathecal administration, intralesional administration, intracranial administration, intranasal administration, intraocular administration, intracardiac administration, intravitreal administration, intraosseous administration, intracerebral administration, intraarterial administration, intraarticular administration, intradermal administration, transdermal administration, transmucosal administration, sublingual administration, enteral administration, sublabial administration, insufflation administration, suppository administration, inhaled administration, or subcutaneous administration.

[0041] Definitions

[0042] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning9 171808680.1in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

[0043] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[0044] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value or range. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude within 5-fold, and also within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0045] The term “administering,” as used herein, refers to any mode of transferring, delivering, introducing, or transporting an MRGPRX2 antagonist, for example, to a subject in need of treatment for a disease or condition.

[0046] By “agonist” is meant a chemical that binds to a receptor and activates the receptor to produce a biological response. Whereas an agonist causes an action, an “antagonist” blocks the action of the agonist and an inverse agonist causes an action opposite to that of the agonist. As used herein, the terms “antagonist” and “inhibitor” are used interchangeably to refer to any molecule that counteracts or inhibits, decreases, or suppresses the biological activity of its target molecule. In some embodiments, an agonist is a “superagonist” when it induces or increases the biological activity of its target molecule (e.g., MRGPRX2). In some embodiments, an antagonist is a “superantagonist” when it counteracts or inhibits, decreases, or suppresses the biological activity of its target molecule (e.g., MRGPRX2). Suitable MRGPRX2 antagonists include soluble receptors, peptide inhibitors, small molecule inhibitors, ligand fusions, and antibodies, natural ligands of one or more CNS target(s), modified versions of natural ligands of one or more CNS10 171808680.1target(s), aptamers, inhibitory nucleic acids (i.e., small inhibitory RNAs (siRNA) and short hairpin RNAs (shRNA)), ribozymes, and small molecules, or active fragments of any of the foregoing.

[0047] The term “antibody” herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, variable heavy chain (VH) regions capable of specifically binding the antigen, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, tandem tri-scFv. Unless otherwise stated, the term “antibody” should be understood to encompass functional antibody fragments thereof. The term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD. The term “antibody” is inclusive of all species, including human and humanized antibodies and the antigenic target, can be from any species. Thus, an antibody, for example, which binds to an antigen “X” can be mouse anti- human X, human anti-human X; humanized anti-human X, goat anti-human X; goat anti-mouse X; rat anti-human X; mouse anti-rat X and the like. The combinations of antibody generated in a certain species against an antigen target, e.g. “X”, from another species, or in some instances the same species (for example, in autoimmune or inflammatory response) are limitless and all species are embodied in this disclosure.

[0048] As used herein, the terms “comprising,” “comprise” or “comprised,” and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements--or, as appropriate, equivalents thereof--and that other elements can be included and still fall within the scope / definition of the defined item, composition, apparatus, method, process, system, etc.11 171808680.1

[0049] “Diagnostic” or “diagnosed” means identifying the presence or nature of a pathologic condition. Diagnostic methods differ in their sensitivity and specificity. The “sensitivity” of a diagnostic assay is the percentage of diseased individuals who test positive (percent of “true positives”). Diseased individuals not detected by the assay are “false negatives.” Subjects who are not diseased and who test negative in the assay, are termed “true negatives.” The “specificity” of a diagnostic assay is 1 minus the false positive rate, where the “false positive” rate is defined as the proportion of those without the disease who test positive. While a particular diagnostic method may not provide a definitive diagnosis of a condition, it suffices if the method provides a positive indication that aids in diagnosis.

[0050] An “effective amount” as used herein, means an amount which provides a therapeutic or prophylactic benefit.

[0051] By “G protein-coupled receptors (GPCR)” is meant a protein receptor that senses molecules outside a cell and activates, inside the cell, signal transduction pathways and, ultimately, cellular responses. GPCRs are called seven-transmembrane receptors because they pass through the cell membrane seven times.

[0052] A “neurological disorder” or “neuroinflammatory disease” as used herein refers to a disease or disorder which affects the CNS and / or which has an etiology in the CNS. Exemplary CNS diseases or disorders include, but are not limited to, neuropathy, amyloidosis, inflammation, ischemia, neurodegenerative disease, and seizure. For the purposes of this application, the CNS will be understood to include the eye, which is normally sequestered from the rest of the body by the blood-retina barrier. Specific examples of neurological disorders include, but are not limited to, neurodegenerative diseases (including, but not limited to, Lewy body disease, postpoliomyelitis syndrome, Shy-Draeger syndrome, olivopontocerebellar atrophy, Parkinson's disease, multiple system atrophy, striatonigral degeneration, tauopathies (including, but not limited to, Alzheimer disease and supranuclear palsy), prion diseases (including, but not limited to, bovine spongiform encephalopathy, scrapie, Creutzfeldt-Jakob syndrome, kuru, Gerstmann-Straussler-Scheinker disease, chronic wasting disease, and fatal familial insomnia), bulbar palsy, motor neuron disease, and nervous system heterodegenerative disorders (including, but not limited to, Canavan disease, Huntington's disease, neuronal ceroid-lipofuscinosis, Alexander's disease, Tourette's syndrome, Menkes kinky hair syndrome, Cockayne syndrome, Halervorden-Spatz syndrome, lafora disease,12 171808680.1Rett syndrome, hepatolenticular degeneration, Lesch-Nyhan syndrome, and Unverricht-Lundborg syndrome), dementia (including, but not limited to, Pick's disease, and spinocerebellar ataxia).

[0053] As used in this specification and the appended claims, the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise.

[0054] “Parenteral” administration of an MRGPRX2 antagonist composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques.

[0055] The terms “patient” or “individual” or “subject” are used interchangeably herein, and refers to a mammalian subject to be treated, with human patients being preferred. In some embodiments, the methods of the disclosure find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters, and primates.

[0056] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0057] The term “pharmaceutical composition” is meant any composition, which contains at least one therapeutically or biologically active agent and is suitable for administration to the patient. Any of these formulations can be prepared by well-known and accepted methods of the art. See, for example, Remington: The Science and Practice of Pharmacy, 20th edition, (ed. A. R. Gennaro), Mack Publishing Co., Easton, Pa., 2000.13 171808680.1

[0058] The term “promoter” as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.

[0059] As used herein, the term “promoter / regulatory sequence” means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter / regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter / regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.

[0060] Ranges provided herein are understood to be shorthand for all of the values within the range. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, as well as all intervening decimal values between the aforementioned integers such as, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With respect to sub-ranges, “nested sub-ranges” that extend from either end point of the range are specifically contemplated. For example, a nested sub-range of an exemplary range of 1 to 50 may comprise 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to 30, 50 to 20, and 50 to 10 in the other direction.

[0061] By “reduces” is meant a negative alteration of at least 10%, 25%, 50%, 75%, or 100%.

[0062] By “reference” is meant a standard or control condition.

[0063] The terms “sample,” “patient sample,” “biological sample,” and the like, encompass a variety of sample types obtained from a patient, individual, or subject and can be used in a diagnostic, prognostic and / or monitoring assay. The patient sample may be obtained from a healthy subject, a diseased patient, or a patient with lung cancer. In certain embodiments, a sample that is “provided” can be obtained by the person (or machine) conducting the assay, or it can have been obtained by another, and transferred to the person (or machine) carrying out the assay. Moreover, a sample obtained from a patient can be divided and only a portion may be used14 171808680.1for diagnosis. Further, the sample, or a portion thereof, can be stored under conditions to maintain sample for later analysis. The definition specifically encompasses blood and other liquid samples of biological origin (including, but not limited to, peripheral blood, serum, plasma, cord blood, amniotic fluid, cerebrospinal fluid, urine, saliva, stool and synovial fluid), solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. In certain embodiment, a sample comprises cerebrospinal fluid. In a specific embodiment, a sample comprises a blood sample. In another embodiment, a sample comprises a plasma sample. In yet another embodiment, a serum sample is used. The definition of “sample” also includes samples that have been manipulated in any way after their procurement, such as by centrifugation, filtration, precipitation, dialysis, chromatography, treatment with reagents, washed, or enriched for certain cell populations. The terms further encompass a clinical sample, and also include cells in culture, cell supernatants, tissue samples, organs, and the like. Samples may also comprise fresh-frozen and / or formalin-fixed, paraffin-embedded tissue blocks, such as blocks prepared from clinical or pathological biopsies, prepared for pathological analysis or study by immunohistochemistry.

[0064] As defined herein, a “therapeutically effective” amount of a compound or agent (i.e., an effective dosage) means an amount sufficient to produce a therapeutically (e.g., clinically) desirable result. The compositions can be administered from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the compounds of the disclosure can include a single treatment or a series of treatments.

[0065] The terms “treating” and “treatment” as used herein refer to the administration of an agent or formulation to a clinically symptomatic individual afflicted with an adverse condition, disorder, or disease, so as to effect a reduction in severity and / or frequency of symptoms, eliminate the symptoms and / or their underlying cause, and / or facilitate improvement or remediation of damage.

[0066] Any compositions or methods provided herein can be combined with one or more of any of the other compositions and methods provided herein.15 171808680.1

[0067] Other aspects are disclosed infra. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0069] FIGS.1A-1I demonstrate that Mrgprb2- / -mice are protected from ischemic stroke injury. FIG.1A: Schematic of mouse transient middle cerebral artery occlusion (tMCAO) model. Black and green dotted line indicates filament and white vessel indicates MCA that is occluded. FIG. 1B: Representative 2,3,5-triphenyltetrazolium (TTC) staining of WT and Mrgprb2- / -mice brains. Each column represents one brain from anterior to posterior. Infarct is denoted by region of brain with no red dye uptake. FIG. 1C: Quantification of WT and Mrgprb2- / -brain stroke volumes using TTC stain 48 hours after tMCAO (WT n = 33, Mrgprb2- / -n = 27). FIG. 1D: Representative T2- weighted MR images of brains of WT and Mrgprb2- / -mice 48 hours after tMCAO. Each column represents one brain from anterior to posterior. Infarct is denoted by brighter (white) signal on images in the right hemisphere. Signal intensity (in arbitrary units) is denoted by color bar. FIG. 1E: Quantification of stroke volume in WT and Mrgprb2- / -mice 48 hours after tMCAO (WT n = 11, Mrgprb2- / -n = 7). FIG.1F: WT and Mrgprb2- / -mice neurological scores before tMCAO (0 hours), and 24- and 48-hours after tMCAO. Higher score indicates better overall sensorimotor function (WT n = 16, Mrgprb2- / -n = 12). FIG.1G: Latency to fall on rotarod for WT and Mrgprb2- / -mice before tMCAO (0 hours), and 24- and 48-hours after tMCAO. Higher latency to fall indicates better motor function (WT n = 6, Mrgprb2- / -n = 10). FIG.1H: left, Left front paw and right, left hind paw toe spread before tMCAO (0 hours), and 24- and 48-hours after tMCAO. (WT n = 4, Mrgprb2- / -n = 4). FIG.1I: Mortality rate of WT and Mrgprb2- / -mice at 48 hours after tMCAO. Each point represents the mortality rate in an independent cohort of mice. Each cohort contains 4 to 5 mice. (WT n = 9 cohorts, Mrgprb2- / -n = 8 cohorts). BioRender was used to create the diagram in FIG. 1A. Statistical analysis was performed using two- sided Student’s t-test (FIGS.1C, 1E, 1I) and two-way ANOVA with Sidak’s multiple comparisons test (FIGS.1F-1H). *P < 0.05, **P < 0.01, ***P < 0.001.

[0070] FIGS.2A-2G demonstrate that Mrgprb2 is expressed in meningeal mast cells and is activated after stroke. FIG.2A: Whole mount dura from Mrgprb2-Cre;tdT mice. left, tdT signal16 171808680.1correlates to Mrgprb2 expression. middle, CD31 counterstain identifies vasculature. right, tdT and CD31 co-stain with DAPI to identify nuclei. Scale bar = 500 ^m. FIG. 2B: Zoom in of whole mount dura. Same colors as in FIG.2A. Scale bar = 25 ^m. FIG.2C: Flow cytometry of Mrgprb2- Cre;tdT peritoneal fluid, dura, and whole brain. left, Live CD45-positive cells gated for mast cells using CD117 and FcER1^. Number is frequency of CD45-positive cells that are mast cells. right, Mast cells gated for tdT fluorescence represented as count of cells versus intensity. Number is percentage of mast cells that are tdT-positive. FIG. 2D: Representative immunofluorescence images of WT and Mrgprb2- / -right hemispheric dura 6 hours after tMCAO. Avidin denotes mast cell stain and DAPI identifies nuclei. Granules seen outside of cell body denote degranulation. Scale bar = 25 ^m. FIG.2E: Percent of degranulated mast cells in WT and Mrgprb2- / -meninges (WT n = 3 mice, Mrgprb2- / -n = 3 mice). FIG.2F: Relative mRNA expression of various genes in WT and Mrgprb2- / -dura 48 hours after tMCAO, normalized to WT gene expression (WT n = 3, Mrgprb2- / -n = 4). FIG.2G: Quantification of neutrophil count per frame in WT and Mrgprb2- / -dura left, 16 hours, middle, 24 hours, and right, 48 hours after tMCAO. (left, WT n = 4, Mrgprb2- / -n = 5, middle, WT n = 3, Mrgprb2- / -n = 4, left, WT n = 3, Mrgprb2- / -n = 3). Statistical analysis was performed using two-sided Student’s t-test (FIGS.2E-2F) and two-way ANOVA with Sidak’s multiple comparisons test (FIG.2G). *P < 0.05, **P < 0.01.

[0071] FIGS. 3A-3K demonstrate Mrgprb2- / - mice exhibit reduced brain parenchymal inflammation after tMCAO which is rescued by meningeal mast cell engraftment. FIG. 3A: Representative flow cytometry gating of WT and Mrgprb2- / - mouse brains 48 hours after tMCAO. left, Live cells are gated using CD45 as an immune cell marker and CD11b as a myeloid cell marker. right, Myeloid cells are then gated using Ly6G and Ly6C to delineate CD45-high neutrophils and monocytes / macrophages, and CD45-low microglia. FIG.3B: Quantification of absolute count of neutrophils, FIG.3C: monocytes / macrophages, and FIG.3D: activated microglia in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - mice (WT n = 18, Mrgprb2- / - n = 16). FIG. 3E: Representative immunofluorescence images of WT (top) and Mrgprb2- / - (bottom) right brain hemispheres 48 hours after tMCAO. left column, CD45 denotes immune cells. middle column, GFAP counterstain delineates activated astrocytes. Dotted white line separates infarcted tissue with no GFAP stain, and live but injured brain tissue with GFAP stain. right column, CD45 and GFAP co-stain with DAPI to identify nuclei. Scale bar = 50 μm. FIG.3F: left, CCL2 and right, CCL3 protein expression measured by ELISA in contralateral and stroke brain17 171808680.1hemispheres of WT and Mrgprb2- / - mice (CCL2: WT n = 6, Mrgprb2- / - n = 6, CCL3: WT n = 5, Mrgprb2- / - n = 5). FIG.3G: IL-6 and FIG.3H: neutrophil elastase protein expression measured by ELISA in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - mice (FIG. 3G, WT n = 5, Mrgprb2- / - n= 5, FIG. 3H, WT n = 7, Mrgprb2- / - n = 7). FIG. 3I: Representative immunofluorescence image of Mrgprb2- / - mouse meninges engrafted with Mrgprb2-tdT mast cells. left column, tdT denoted engrafted cells. middle column, Avidin denotes all mast cells. right column, tdT and avidin co-stain with DAPI to identify nuclei. Scale bar = 50 μm. j, Mast cell count in meninges of Mrgprb2- / - mice engrafted with sham (saline), WT, or Mrgprb2- / mast cells, determined by avidin positive cells in the dura. Count is per frame using a 0.408mm2 viewing frame (WT sham n = 4, WT engraftment n = 5, Mrgprb2- / - sham n = 4, Mrgprb2- / - engraftment n = 4). FIG. 3K: Quantification of absolute count of left, neutrophils and right, monocytes / macrophages in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - mast cell engrafted mice (WT n = 10, Mrgprb2- / - n =11).

[0072] FIGS.4A-4J demonstrateMrgprb2 is vital for neutrophil recruitment from the skull bone marrow and periphery. FIG. 4A: Outline of UBC-GFP skull transplant experiment: UBC- GFP skull explants are transplanted on WT and Mrgprb2- / - skulls on day 0 and tMCAO is performed 10 days later. FIG.4B: Quantification of absolute count of GFP-positive neutrophils in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - brains (WT n= 5, Mrgprb2- / - n = 6). FIG. 4C: Quantification of percentage of total neutrophils that are GFP-positive in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - brains (WT n = 5, Mrgprb2- / - n = 6). FIG. 4D: Quantification of left, absolute count of GFP-positive neutrophils and right, percentage of total neutrophils that are GFP-positive in dura of WT and Mrgprb2- / - mice 48 hours after tMCAO (WT n = 4, Mrgprb2- / - n = 4). FIG. 4E: Quantification of percentage of total neutrophils that are GFP-positive in skull bone marrow of WT and Mrgprb2- / - mice 48 hours after tMCAO (WT n = 3, Mrgprb2- / - n = 3). FIG. 4F: Protein levels of semaphorin 3a in WT and Mrgprb2- / - leptomeninges after sham surgery and tMCAO measured by ELISA (WT 0h n = 7, Mrgprb2- / - 0h n = 4, WT 48h n = 10, Mrgprb2- / - 48h n = 9). FIG.4G: Recombinant SEMA3A- Fc was incubated with dermal fibroblast lysate, WT mast cell lysate, or a known protease that cleaves semaphorin, ADAMTS1, as a positive control. The reaction was then run on a gel and blotted for semaphorin. The smaller band indicates SEMA65, the inactive form of SEMA3A after cleavage. FIG. 4H: Representative immunofluorescence image of WT recipient right brain18 171808680.1hemisphere 48 hours after tMCAO. left, Ly6G denotes neutrophils and middle, GFP denotes cells recruited from skull bone marrow. right, Ly6G and GFP co-stain, along with DAPI to identify nuclei, delineates those neutrophils that came from the skull bone marrow. White arrows indicate cells with dual Ly6G and GFP stain. Scale bar = 20 μm. FIG.4I: Outline of parabiosis experiment: UBC-GFP mice were parabiotically joined to either WT or Mrgprb2- / - mice and housed for three weeks. tMCAO was then performed on the non-GFP mouse. FIG.4J: Quantification of absolute count of GFP-positive neutrophils in contralateral and stroke brain hemispheres of WT and Mrgprb2- / -parabionts (WT n = 9, Mrgprb2- / - n = 7). BioRender was used to create the diagram in FIGS.4A and 4I.

[0073] FIGS.5A-5J show MRGPRX2 mast cells are activated in human stroke dura and this activation is due in part to substance P. FIG. 5A: Immunofluorescence images of human control patient dura. left, Tryptase and middle, avidin both co-stain mast cells. right, Avidin and tryptase co-stain, along with DAPI nuclear stain. Scale bar = 10 μm. FIG. 5B: Immunofluorescence image of human dura. left, MRGPRX2 stain along with middle, avidin co- stain for mast cells. right, MRGPRX2 and avidin co-stain, along with DAPI nuclear stain. Scale bar = 10 μm. FIG.5C: CT-angiogram of patient #1 presenting with right MCA occlusion. Arrow pointing at site of occlusion. FIG. 5D: top, Axial and coronal CT images of patient at time of presentation and bottom, axial and coronal CT images of patient after decompressive hemicraniectomy. Dotted lines denote infarcted region. FIG. 5E: Representative immunofluorescence images of control (top) and stroke (bottom) patient human dural mast cells stained with Avidin and DAPI for nuclear stain. Granules seen outside of the cell body indicate mast cell degranulation. Scale bar = 10 μm. Each image denotes a distinct patient. FIG. 5F: Quantification of number of mast cells per frame and FIG.5G: percentage of degranulated mast cells in control and stroke patient dura. Each point represents one patient (control n = 3, stroke n = 3). FIG. 5H: Quantification of substance P neuropeptide measured by ELISA in control and stroke human patient serum (control n = 11, stroke n =17). FIG.5I: WT and MRGPRX2- / - LAD2 human mast cell beta hexosaminidase release using control and stroke human patient serum. Ratio of WT to MRGPRX2- / - LAD2 cells is quantified as amount of degranulation of WT cells divided by amount of degranulation of MRGPRX2- / - cells (control n = 8, stroke n = 8). FIG.5J: Ratio of beta hexosaminidase release from WT and MRGPRX2- / - LAD2 human mast cells incubated with substance P-depleted control and stroke patient serum (control n = 3, stroke n = 4).19 171808680.1

[0074] FIGS. 6A-6H show Mrgprb2 inhibition by osthole attenuates post-stroke inflammation and neurologic deficits in mice. FIG.6A: Mast cell activity of WT and Mrgprb2- / - peritoneal mast cells pre-treated with osthole. Data is normalized to vehicle of corresponding genotype (n = 3). FIG. 6B: Quantification of absolute count of neutrophils in contralateral and stroke brain hemispheres of vehicle and osthole treated WT and FIG. 6C: vehicle and osthole treated Mrgprb2- / - mice (FIG.6B, vehicle n = 11, osthole n = 13, c, vehicle n = 6, osthole n =5). FIG. 6D: Representative T2-weighted MR images of brains of vehicle (left) and osthole (right) treated WT mice 48 hours after tMCAO. Each column represents one brain from anterior to posterior. Infarct isdenoted by brighter (white) signal on images in the right hemisphere. Signal intensity (in arbitrary units) is denoted by color bar. FIG.6E: Quantification of stroke volume in vehicle and osthole treated WT mice 48 hours after tMCAO (vehicle n = 7, osthole n = 7). FIG. 6F: Vehicle and osthole treated WT mice neurological scores before tMCAO (0 hours), and 24- and 48-hours after tMCAO assessed using the 28-point neuroscore. All scores are normalized to vehicle treated mice in each cohort (vehicle n = 13, osthole n = 12). FIG. 6G: Kaplan-Meier survival curve of WT vehicle- and osthole-treated mice after tMCAO (vehicle n = 13, osthole n = 11cohorts). FIG.6H: Working model of the role of Mrgprb2 in stroke inflammation. At baseline, meningeal mast cells are inactive, and semaphorins at ACE points inhibit migration of immune cells into the brain. After stroke, SP released from injured neurons activates Mrgprb2. Mast cell activity causes neutrophil recruitment from the periphery and skull bone marrow. Additional cleavage of semaphorin 3a by mast cell proteases allows neutrophils to traffic from the meninges, through ACE points, and into the brain. BioRender was used to create the diagram in FIG. 6H. Statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparisons test (FIG.6A), two-way ANOVA with Sidak’s multiple comparisons test (FIGS.6A, 6B and 6F), and two-sided Student’s t-test (FIG.6E).

[0075] FIGS. 7A-7D show Mrgprb2- / - mice exhibit equivalent blood flow reduction during tMCAO but have improved neurological outcomes. FIG.7A: Blood flow reduction during 40-minute occlusion time measured by laser doppler. Baseline blood flow measured before surgery is 100% (WT n = 23, Mrgprb2- / - n = 22). FIG.7B: Brain midline shift determined by MR imaging 48 hours after stroke. Negative shift indicates midline of the brain shifted away from the right (stroke) hemisphere into the left hemisphere. Whiskers indicate minimum and maximum values, and bold line depicts the mean (WT n = 8, Mrgprb2- / - n = 11). FIG.7C: left, Right front paw and20 171808680.1right, right hind paw toe spread measured by Catwalk for WT and Mrgprb2- / - mice before tMCAO (0 hours), and 24- and 48-hours after tMCAO (WT n = 4, Mrgprb2- / - n = 4). FIG.7D: Mortality rate of WT and Mrgprb2- / - mice at 48 hours after tMCAO. Each point represents the mortality rate in an independent cohort of mice. Each cohort contains 4 to 5 mice. (WT n = 10 cohorts, Mrgprb2- / - n = 8 cohorts).

[0076] FIGS.8A-8G demonstrate that Mrgprb2 shows 100% penetrance in mast cells of the meninges, but these mast cells do not migrate after stroke. FIG.8A: Whole mount dura from Mrgprb2-Cre;tdT mice. left, Avidin signal identifies mast cells. middle, tdT signal correlates to Mrgprb2 expression. right, Avidin and tdT co- localize in every mast cell. DAPI is used to identify nuclei. Scale bar = 500 ^m. FIG. 8B: Zoom of whole mount dura. Same colors as in FIG. 8A. Scale bar = 25 ^m. FIG.8C, Peritoneal fluid, FIG.8D, dural meninges, and FIG.8E, whole brain from Cre- and Cre+mice. Cre- mice do not express tdT and are used as negative control to properly gate each tissue for positive tdT signal. left, All CD45-positive immune cells from each tissue are plotted. Gray histogram is Cre- tissue, red histogram is Cre+tissue. Number indicates frequency of Cre+immune cells that are tdT positive. right, tdT positive cells gated for mast cells using CD117 and FcER1^. Number is frequency of tdT cells that are mast cells. FIG. 8F: Mast cell count in WT and Mrgprb2- / -mice in sham and tMCAO mice 48 hours after surgery, determined by avidin positive cells in the dura (WT sham n = 3, Mrgprb2- / -sham n = 3, WT tMCAO n = 3, Mrgprb2- / -tMCAO n = 5). FIG 8G: Relative mRNA expression of various genes in baseline WT and Mrgprb2- / -dura, normalized to WT gene expression. (WT n = 4, Mrgprb2- / -n = 4). Statistical analysis was performed using two-way ANOVA with Sidak’s multiple comparisons test (FIG.8C) and two-sided Student’s t-test (FIG.8D). ns, not significant.

[0077] FIGS.9A-9C demonstrate that mouse Mrgprb2-expressing meningeal, peritoneal, and skin mast cell RNA sequencing. FIG.9A: Log normalized counts of genes in connective tissue mast cell transcriptional signature35in meningeal, peritoneal, and skin mast cells. All counts are normalized to transcript length. Each column is an average of three samples from three different mice. FIG.9B: Volcano plot of differentially expressed genes between meningeal and peritoneal mast cells. FIG.9C: Volcano plot of differentially expressed genes between meningeal and skin mast cells. None of the significant differentially expressed genes in FIG.9A or FIG.9B overlap with genes in the mast cell transcriptional signature.21 171808680.1

[0078] FIGS.10-10C show Mrgprb2 is not expressed in the brain before or after stroke. FIG.10A: Flow cytometry of Mrgprb2-Cre;tdT peritoneal fluid, and whole brain 48 hours after tMCAO. Each whole brain panel denotes a distinct mouse. Live cells gated for CD45 and tdT. Number in each quadrant indicates frequency of that population in all live cells. FIG. 10B: Representative sections from anterior to posterior of one Mrgprb2-Cre;tdT mouse brain 48 hours after stroke. top, tdT fluorescence indicates Mrgprb2-expressing cells. No tdT positive cells are seen. bottom, GFAP indicates activated astrocytes that surround infarcted brain tissue. Scale bar = 1000 μm. FIG.10C: Average expression of mRNA using single cell analysis of the whole brain using the Brain Cell Data Viewer (https: / / www.braincelldata.org / singlecell)36. No Mrgprb2 expression is seen in any cell of the brain.

[0079] FIGS. 11A-11J show WT and Mrgprb2- / - mice demonstrate similar ischemic injury after stroke and show no baseline differences in brain immune populations. FIG. 11A: Quantification of stroke volume in WT and Mrgprb2- / - mice 6 hours after tMCAO (WT n = 6, Mrgprb2- / - n = 5). FIG. 11B: Western blot and quantification of GFAP (main band at 49 kDa) and FIG.11C: 4-hydroxynonenal in WT and Mrgprb2- / - brains 6 hours after tMCAO (WT n = 3 mice, Mrgprb2- / - n = 3 mice). FIG.11D: Representative flow cytometry gating of a WT mouse brain 48 hours after tMCAO. left, CD45+ Ly6G- cells are gated using CD11b and Ly6C. right, Further gating of CD11b+ Ly6C+ monocytes using F4 / 80 and Ly6C reveals a heterogenous population of monocytes and macrophages. FIG. 11E: Flow cytometry of baseline WT and Mrgprb2- / - whole brains without tMCAO surgery. Cell counts of neutrophils, monocytes / macrophages, and microglia are denoted (WT n = 3 mice, Mrgprb2- / - n = 3 mice). FIG.11F: Quantification of absolute count of left, neutrophils, and right, monocytes / macrophages in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - mice after excluding intravascular cells labeled by IV-CD45 PE (WT n = 8, Mrgprb2- / - n = 10). FIG. 11G: Quantification of absolute count of left, neutrophils, middle, monocytes / macrophages, and right, microglia in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - littermate mice (WT n = 8, Mrgprb2- / - n = 5). FIG. 11H: Representative immunofluorescence images of left, WT, and right, Mrgprb2- / - contralateral brain hemispheres 48 hours after tMCAO. CD45 denotes immune cells, GFAP counterstain delineates activated astrocytes, and DAPI identify nuclei. Scale bar = 50 μm. FIG. 11I: Quantification of absolute count of neutrophils at 48 hours in left, WT and right, Mrgprb2- / - mice injected with vehicle or anti-CXCL2 antibody at 6h and 24h post-22 171808680.1MCAO in the cisterna magna (WT vehicle n = 5, WT anti-CXCL2 n = 6, Mrgprb2- / - vehicle n = 3, Mrgprb2- / - anti-CXCL2 n = 6). FIG. 11J: Quantification of absolute count of monocytes / macrophages at 48 hours in left, WT and right, Mrgprb2- / - mice injected with vehicle or anti- CXCL2 antibody at 6h and 24h post-MCAO in the cisterna magna (WT vehicle n = 5, WT anti-CXCL2 n = 6, Mrgprb2- / - vehicle n = 3, Mrgprb2- / - anti-CXCL2 n = 6).

[0080] FIGS. 12A-12G show Neutrophils exit WT meninges 48 hours after stroke but accumulate in Mrgprb2- / - meninges. FIG.12A: left, Peritoneal fluid, and right, brain of Mrgprb2- / - mice engrafted with Mrgprb2-Cre tdT mast cells. Gray histogram indicates cells with no tdT expression (same gating as in FIG. 8). Horizontal bar gates cells that are positive for tdT expression. FIG.12B: Percentage of immune cells in each tissue compartment of Mrgprb2- / - mice engrafted with Mrgprb2-Cre tdT mast cells. Red bar indicates positive control of percentage of immune cells in Mrgprb2-Cre+ tdT peritoneums that express tdT. All other bars refer to tissues in the engrafted mouse, 48 hours tMCAO (tdT Control n = 3, Mrgprb2- / - engrafted mice n = 4). FIG.12C: Representative immunofluorescence images of WT meninges 48 hours after tMCAO, and after IV-CD45 PE antibody injection to label intravascular neutrophils. left, Image in dura away from sinus and right, at sinus. top, Ly6G denotes neutrophils, middle, IV-CD45 denotes cells from circulation at time of sacrifice of the animal, and bottom, Ly6G and IV-CD45 overlap indicate neutrophils that are likely in the blood vessels within the meninges. Scale bar = 50 μm. below, Percentage of IV-CD45+ neutrophils in meninges of WT and Mrgprb2- / - mice 48 hours after tMCAO. Each point denotes a new field of view in meninges (WT n = 9 images across 3 mice, Mrgprb2- / - n = 14 images across 3 mice). FIG.12D: Representative immunofluorescence images of WT and Mrgprb2- / - right hemispheric dura top, 16 hours, middle, 24 hours, and bottom, 48 hours after tMCAO. Ly6G denotes neutrophils and DAPI identifies nuclei. Scale bar = 50 μm. FIG.12E: Neutrophil counts in WT and Mrgprb2- / - right hemispheric dura at different timepoints up until 48 hours. These data are replotted from FIG. 2G to show a clearer time-course of neutrophil recruitment. Significance stars represent statistical analyses from FIG.2G. FIG.12F: Quantification of absolute count of neutrophils in contralateral and stroke brain hemispheres of WT and Mrgprb2- / - mice 72 hours after tMCAO (WT n = 6, Mrgprb2- / - n = 9). FIG. 12G: Quantification of neutrophil count per frame in WT and Mrgprb2- / - dura 72 hours after tMCAO. (WT n = 5, Mrgprb2- / - n = 6).23 171808680.1

[0081] FIGS. 13A-13L show GFP-positive cells predominate in the skull bone marrow after skull transplantation, and in the blood after parabiosis. FIG. 13A: Percent of neutrophils among all immune cells in the skull bone marrow at baseline and 48 hours after tMCAO in WT and Mrgprb2- / - mice (WT baseline n = 3, Mrgprb2- / - baseline n = 3, WT tMCAO n = 8, Mrgprb2- / - tMCAO n = 7). FIG. 13B: Percent of Mrgprb2-tdT mast cells in all immune cells among peritoneal fluid, meninges, and skull bone marrow (SBM) (n = 3 mice per tissue). FIG.13C: Mast cell count in WT and Mrgprb2- / - mice at baseline and 10 days after skull bone marrow transplant determined by avidin positive cells in the dura. Count is per frame using a 0.408mm2 viewing frame (WT baseline / transplant n = 3, Mrgprb2- / - baseline / transplant n = 3). FIG. 13D: left, Percent of GFP-positive immune cells and right, GFP-positive neutrophils in the blood and SBM 12 days after skull transplant in WT and Mrgprb2- / - mice (WT n = 6, Mrgprb2- / - n = 7). FIG. 13E: Quantification of left, absolute count of GFP52 positive neutrophils in contralateral and ipsilateral brain hemispheres and right, percentage of GFP positive neutrophil of WT and Mrgprb2- / - meninges 12 days after skull transplant (left, WT n = 6, Mrgprb2- / - n = 7, right, WT n = 4, Mrgprb2- / - n = 4). FIG.13F: Representative immunofluorescence images of WT recipient right brain hemisphere 48 hours after tMCAO. left, GFP denotes cells recruited from skull bone marrow. Arrows indicate GFP-positive cells. middle, CD45 denotes all immune cells. Arrows point to all GFPpositive cells from previous image. right, CD45 and GFP co-stain, along with DAPI to identify nuclei, indicates that all GFP-positive cells co-stain with CD45, indicating they are immune cells. Scale bar = 25 μm. FIG. 13G: Quantification of percentage of total immune cells that are GFP-positive in skull bone marrow of WT and Mrgprb2- / - mice 48 hours after tMCAO (WT n = 3, Mrgprb2- / - n = 3). FIG. 13H: Protein levels of semaphorin 3d in WT and Mrgprb2- / - sham and tMCAO leptomeninges 48 hours after tMCAO measured by ELISA (WT sham n = 3, Mrgprb2- / - sham n = 3, WT tMCAO n = 9, Mrgprb2- / - tMCAO n = 8). FIG.13I: Percent of neutrophils among all immune cells in the blood at baseline and 48 hours after tMCAO in WT and Mrgprb2- / - mice (WT baseline n = 3, Mrgprb2- / - baseline n = 3, WT tMCAO n = 8, Mrgprb2- / - tMCAO n = 7). FIG.13J: left, Percent of GFP-positive immune cells and right, GFP- positive neutrophils in the blood and SBM 3 weeks after parabiosis in WT and Mrgprb2- / - parabionts (WT n = 3, Mrgprb2- / - n = 3). FIG. 13K: Quantification of absolute count of GFP- positive neutrophils in contralateral and ipsilateral brain hemispheres of WT and Mrgprb2- / - parabionts 3 weeks after parabiosis (WT n = 3, Mrgprb2- / - n = 3). FIG.13L: Percentage of GFP-24 171808680.1positive immune cells in the blood of WT and Mrgprb2- / - parabionts 48 hours after tMCAO (WT n = 9, Mrgprb2- / - n = 7).

[0082] FIGS. 14A-14C shows human stroke brain tissue does not express MRGPRX2. FIG.14A: Relative mRNA expression of MRPRX2 (left), tryptase (middle), and GFAP (right), in control and stroke patient brain tissue, normalized to actin beta expression. LAD2 WT and LAD2 KO cells serve as positive and negative control for MRGPRX2 expression (MRGPRX2 and Tpsb2: control n = 3, stroke n = 6, GFAP control n = 2, stroke n = 4). FIG.14B: top, CT-angiogram of patient #2 presenting with left ICA termination occlusion. Arrow pointing at site of occlusion. middle, Axial and coronal CT images of patient at time of presentation and bottom, axial and coronal CT images of patient after decompressive hemicraniectomy. Dotted lines denote infarcted region. FIG. 14C: top, CT-angiogram of patient #3 presenting with left supraclinoid ICA occlusion. Arrow pointing at site of occlusion. middle, Axial and coronal CT images of patient at time of presentation and bottom, axial and coronal CT images of patient after decompressive hemicraniectomy. Dotted lines denote infarcted region.

[0083] FIGS. 15A-15D show Substance P is increased in the stroke mouse brain and worsens WT but not Mrgprb2- / - stroke inflammation. FIG. 15A: Quantification of substance P neuropeptide measured by ELISA in WT and Mrgprb2- / - contralateral and stroke brain hemispheres 48 hours after tMCAO (WT n = 6, Mrgprb2- / - n = 6). FIG.15B: Quantification of absolute count of neutrophils at 48 hours in WT (left) and Mrgprb2- / - (right) injected with vehicle or SP at 6h and 24h post-MCAO in the cisterna magna (WT vehicle n = 6, WT SP n = 6, Mrgprb2- / - vehicle n = 6, Mrgprb2- / - SP n = 6). FIG.16C: Quantification of absolute count of neutrophils in the brain of WT, Mrgprb2- / - and NK1-R- / - mice, 48 hours after tMCAO. (WT n = 11, Mrgprb2- / - n = 11, NK1-R- / - n = 6). FIG.15D: Substance P measured in serum of control and stroke patients after incubation with anti-IgG or anti-SP antibodies (control n = 5, stroke n = 6).

[0084] FIGS. 16A-16G show Osthole reduces inflammation and injury in WT but not Mrgprb2- / - mice. FIG.16A: Quantification of absolute count of left, monocytes / macrophages and right, activated microglia in contralateral and stroke brain hemispheres of WT vehicle and osthole treated mice 48 hours tMCAO (vehicle n = 11, osthole n = 13). FIG. 16B: Quantification of absolute count of left, monocytes / macrophages and right, activated microglia in contralateral and stroke brain hemispheres of Mrgprb2- / - vehicle and osthole treated mice 48 hours after tMCAO25 171808680.1(vehicle n = 4, osthole n = 3). FIG.16C: Representative immunofluorescence images of WT left, vehicle and right, osthole treated right hemispheric dura 48 hours after tMCAO. Ly6G denotes neutrophils and DAPI identifies nuclei. Scale bar = 50 μm. FIG. 16D: Quantification of neutrophils in vehicle and osthole treated WT and FIG. 16E: Mrgprb2- / - dura 48 hours after tMCAO (WT / Mrgprb2- / - n = 3, WT / Mrgprb2- / - osthole n = 3). FIG. 16F: Quantification of absolute count of neutrophils in contralateral and stroke brain hemispheres of vehicle and osthole treated intra cisterna magna in WT mice (vehicle n = 4, osthole n = 7). FIG.16G: Brain midline shift determined by MR imaging 48 hours after stroke. Negative shift indicates midline of the brain shifted away from the right (stroke) hemisphere into the left hemisphere. Whiskers indicate minimum and maximum values, and bold line depicts the mean (vehicle n = 7, osthole n = 7). DETAILED DESCRIPTION

[0085] The immune environment surrounding the central nervous system plays a fundamental role in monitoring the brain for signs of injury and infection. However, traumatic injury such as ischemic stroke, can disrupt this balance and cause an exaggerated inflammatory response that further exacerbates injury and prevents long-term recovery1–3. The underlying mechanism that drives this hyperactive immune cell recruitment after injury remains unclear. Here, we show that Mrgprb2, a mast cell-specific receptor4, regulates post-stroke brain inflammation via the meninges, a connective tissue that surrounds the brain and harbors a diverse immune cell population5,6. This receptor is activated in meningeal mast cells after stroke, causing mast cell degranulation and release of cytokines and chemokines that attract immune cells. Meningeal mast cells via Mrgprb2 specifically regulate recruitment of skull bone marrow neutrophils into the brain, identifying a cell and receptor that allow the meninges to regulate recruitment from this source. It is demonstrated herein that the human ortholog of this receptor, MRGPRX2, is expressed in human meningeal mast cells. These cells are activated in stroke patients, due in part to upregulation of the neuropeptide substance P, a known ligand of MRGPRX2. Further, pharmacologic inhibition of Mrgprb2 reduces post-stroke brain inflammation and improves motor outcomes. Collectively, our study identifies the mast cell as a sentinel cell of the meninges that mediates brain inflammation after acute injury, deciphering an important regulatory component of the brain-immune interface. This meningeal mast cell receptor provides a specific and druggable target to attenuate post-stroke inflammation and holds untapped promise for meaningfully altering the clinical course for patients following a stroke.26 171808680.1

[0086] MAST CELLS

[0087] Mast cells (MCs) act as primary effectors in inflammatory and allergic reactions by releasing intracellularly-stored inflammatory mediators in diseases. The two major pathways for MC activation are known to be immunoglobulin E (IgE)-dependent and -independent. Although IgE-dependent signaling is the main pathway to MC activation, IgE-independent pathways have also been found to serve pivotal roles in the pathophysiology of various inflammatory conditions. Recent studies have shown that human and mouse MCs express several regulatory receptors such as toll-like receptors (TLRs), CD48, C300a, and GPCRs, including mas-related GPCR-X2 (MRGPRX2). MRGPRX2 has been reported as a novel GPCR that is expressed in MCs activated by basic secretagogues, neurokinin peptides, host defense antimicrobial peptides, and small molecule compounds (e.g., neuromuscular blocking agents) and leads to MC degranulation and eicosanoids release under in vitro experimental condition. Functional analyses of MRGPRX2 and Mrgprb2 (mouse ortholog) indicate that MRGPRX2 is involved in MC hypersensitivity reactions causing neuroinflammation such as postoperative pain, type 2 inflammation, non-histaminergic itch, and drug-induced anaphylactic-like reactions (Ogasawara H, Noguchi M. Therapeutic Potential of MRGPRX2 Inhibitors on Mast Cells. Cells. 2021 Oct 27;10(11):2906. doi: 10.3390 / cells10112906. PMID: 34831128; PMCID: PMC8616451).

[0088] MCs store dense secretory granules containing mediators such as histamine, tumor necrosis factor α (TNF-α), serotonin, and also a wide range of MC-specific serine proteases bound to a proteoglycan core containing heparin and glycosaminoglycans, and are responsible for host resistance to bacteria, multicellular parasites, and xenobiotic toxins (Dwyer D.F., et al. Nat. Immunol. 2016;17:878–887. doi: 10.1038 / ni.3445). Upon MC activation, they rapidly release granules and produce de novo synthesized inflammatory mediators (cytokines and lipid mediators such as interleukin (IL)-4, -5, and -13), which are also involved in the continuation of allergic inflammation (Metcalfe D.D., et al. Physiol. Rev. 1997;77:1033–1079. doi: 10.1152 / physrev.1997.77.4.1033). Thus, MCs have the ability to detect various danger signals transmitted by pathogens, tissues, and other immune cells and are responsible for modulating immune responses according to the characteristics of the stimuli received.

[0089] Although IgE / FcεRI signaling is the main pathway for MC activation , the ability of mast cells to alter their responses to so many internal and external signals suggests that the27 171808680.1various regulatory receptors such as toll-like receptors (TLRs), CD48, CD300a, lectin receptors, and GPCRs also act as regulators of these responses ( Varricchi G., et al. Int. J. Mol. Sci. 2019;20:4397. doi: 10.3390 / ijms20184397). It is known that MCs are activated by basic secretagogues such as substance P (SP) and compound 48 / 80 (C48 / 80) (Ferry X., et al. Peptides. 2002;23:1507–1515. doi: 10.1016 / S0196-9781(02)00090-6), as well as through suppression of tumorigenicity-2 as an IL-1 family receptor for IL-33 and a receptor for thymic stromal lymphopoietin (Yoshimoto T., et al. Allergol. Int. 2014;1:3–11. doi: 10.2332 / allergolint.13-RA- 0657; Bjerkan L., et al. Pharmaceuticals.2016;9:41. doi: 10.3390 / ph9030041). MC activation by basic secretagogues is mediated by the pertussis toxin (PTX)-sensitive G-proteins Gi2 and Gi3, which are known to be involved in phagocytosis. The MC activation by basic secretagogues has been reported to be mediated by Gi2 and Gi3, PTX-sensitive G-proteins, and then to activate phospholipase Cβ leading to exocytosis and mitogen-activated protein kinases (MAPKs), which induces synthesis and release of arachidonic acid metabolites. It was first reported that basic secretagogues activate connective tissue mast cells (CTMCs) via mas-related GPCR-X2 (MRGPRX2) (Tatemoto K., et al. Biochem. Biophys. Res. Commun. 2006;349:1322–1328. doi: 10.1016 / j.bbrc.2006.08.177). MRGPRX2 was primarily presumed to be a GPCR expressed in the sensory neuron, but it is highly expressed in human skin-derived and human cord blood-derived cultured MCs (Fujisawa D., et al. J. Allergy Clin. Immunol. 2014;134:622–633. doi: 10.1016 / j.jaci.2014.05.004), and MRGPRX family members except MRGPRX2 were expressed in the neuron using transcriptome analysis (Ray P., et al. Pain. 2018;159:1325–1345. doi: 10.1097 / j.pain.0000000000001217).

[0090] MRGPRX2 ANTAGONISTS

[0091] MRGPRs were cloned as a GPCR family with 35% homology to the proto- oncogene MAS1 gene and were reported to be sensory neuron-specific GPCR (Lembo P.M.C., et al. Nat. Neurosci. 2002;5:201–209. doi: 10.1038 / nn815). In humans, there are four MRGPRX families (MRGPRX1-X4) and MrgprD-H (Dong X., et al. Cell. 2001;106:619–632. doi: 10.1016 / S0092-8674(01)00483-4; Han S.K., et al. Proc. Natl. Acad. Sci. USA. 2002;99:14740– 14745. doi: 10.1073 / pnas.192565799), but there are 22 MrgprA genes, 11 MrgprB genes, and 13 MrgprC genes in mice. Within the MRGPR family, proenkephalin A gene products such as bovine adrenal medulla peptide were first identified as ligands for MRGPRX1, followed by the identification of corstatin-14 (CST-14) as a ligand for MRGPRX2 (Robas N., et al. J. Biol. Chem.28 171808680.12003;278:44400–44404. doi: 10.1074 / jbc.M302456200). PAMP-12, somatostatin, neuropeptide FF, oxytocin and SP are also ligands for MRGPRX2 (Kamohara M., et al. Biochem. Biophys. Res. Commun. 2005;330:1146–1152. doi: 10.1016 / j.bbrc.2005.03.088). The affinities of CST-14 and SP for canonical receptors (somatostatin receptor and neurokinin-1 receptor (NK-1)) are on the order of nM, whereas MRGPRX2 reacts with ligands on the order of μM. MRGPRX2 is highly expressed in CTMCs and induces degranulation of human CTMCs by recognizing basic peptides such as mastoparan, somatostatin, SP, C48 / 80, VIP, and pituitary adenylate cyclase-activating polypeptide (PACAP), which are known as basic secretagogues (Arifuzzaman M., et al. Sci. Adv. 2019;5:eaav0216. doi: 10.1126 / sciadv.aav0216). Furthermore, human β-defensin (hBD)2 and hBD3, as well as cathelicidin LL-37, were reported to induce MC degranulation via MRGPRX2 (Subramanian H., et al. J. Biol. Chem.2011;286:44739–44749. doi: 10.1074 / jbc.M111.277152).

[0092] MRGPRX2 inhibitors can be divided into three categories: (1) direct inhibition of MRGPRX2, (2) inhibition of MRGPRX2 downstream signaling, and (3) other mechanisms.

[0093] Direct Inhibition of MRGPRX2: QWF is a tripeptide antagonist of NK-1, a canonical receptor for SP which is a representative neuropeptide of the MRGPRX2 ligands. QWF has also been reported to act as an MRGPRX2 antagonist. QWF competitively inhibits SP binding not only to human MRGPRX2 but also to Mrgpra1 and b2 (Azimi E., et al. JCI Insight. 2016;1:e89362. doi: 10.1172 / jci.insight.89362). QWF inhibits SP-induced MC activation and ameliorates SP-induced pain that is not suppressed in NK-1-deficient mice.

[0094] Compounds 1 and 2, small molecule MRGPRX2 antagonists obtained by screening a small molecule compound library, inhibit MRGPRX2 activation by several MRGPRX2 ligands including SP and icatibant but show no inhibitory effect on NK-1 or other GPCRs. Compounds 1 and 2 inhibited the MC activation by MRGPRX2 ligand, and the intervention of both compounds revealed the involvement of MAPKs in the downstream signaling of MRGPRX2.

[0095] The alkaloid compound piperine, reported as a small molecule MRGPRX2 antagonist, has a cross-inhibitory effect with mice and ameliorates mouse anaphylactic reactions (Qiao C., et al. Phytother. Res.2020;34:1409–1420. doi: 10.1002 / ptr.6615). In addition, naturally occurring compounds such as isoliquiritigenin (a component of licorice), shikonin (a component of Lithospermum erythrorhizon), imperatorin (an active furocumarin in Angelica Dahurica radix), and roxithromysin (a derivative of erythromycin) were shown to bind to MRGPRX2 in molecular29 171808680.1docking studies and surface plasmon resonance (SPR) and inhibit C48 / 80 or SP-induced passive cutaneous anaphylaxis (PCA) in mice (Wang N., et al. Biochem. Pharmacol. 2021;184:114401. doi: 10.1016 / j.bcp.2020.114401; Wang J., et al. Phytomedicine. 2020;68:153149. doi: 10.1016 / j.phymed.2019.153149; Zhang Y., et al. Cell. Immunol. 2020;358:104239. doi: 10.1016 / j.cellimm.2020.104239). Paeoniflorin (a component of Paeonia Lactiflora), quercetin (a plant flavonoid), and genistein (a non-steroidal polyphenol), which were found to bind MRGPRX2, also suppressed C48 / 80-induced PCA in mice (Wang J., et al. Phytother. Res. 2020;34:401–408. doi: 10.1002 / ptr.6531; Ding Y., et al. Int. Immunopharmacol. 2019;66:185– 197. doi: 10.1016 / j.intimp.2018.11.025; Kumar M., et al. Molecules. 2020;25:1028. doi: 10.3390 / molecules25051028). These compounds are low-affinity antagonists with inhibitory concentrations on the order of μM.

[0096] DNA aptamer has been reported as a method to obtain high-affinity MRGPRX2 inhibitors (Suzuki Y., et al. Eur. J. Pharmacol. 2020;878:173104. doi: 10.1016 / j.ejphar.2020.173104). Nucleic acid aptamer is a shape complement that binds to proteins by creating a three-dimensional structure that fits the shape of the protein. Suzuki et al. screened for single strand DNA (ssDNA) that binds MRGPRX2 using a proteoliposome that incorporates MRGPRX2 into a liposome to obtain a high-affinity MRGPRX2 antagonist, aptamer-X35 (5′- atgaccatgaccctccacactgtaggcaccacgggtccctggcagttaaaagtacgtttgtcagactgtggcagggaaaca-3'; SEQ ID NO: 1).

[0097] Inhibition of MRGPRX2 Downstream Signaling: Resveratrol, a polyphenol found in grapes, red wine, and peanuts, increases the expression of nuclear factor erythroid-derived 2- related factor (Nrf2) and induces heme-oxygenase 1 (HO-1), which has antioxidant effects. Since the Nrf2 / HO-1 pathway is known to suppress NF-κB signaling downstream of MRGPRX2 (Huang Y., et al. J. Cell. Physiol. 2019;234:6023–6032. doi: 10.1002 / jcp.27187), it may indirectly suppress MRGPRX2 activation. Licochalcone A, a chalcone isolated from Glycyrrhiza uralensis Fisch, also suppresses MRGPRX2-mediated MC activation by inhibiting NF-κB signaling (Xue Z., et al. Phytother Res.2021 doi: 10.1002 / ptr.7272). Licochalcone A has been reported to activate Nrf2, so that licochalcone A may also suppress MRGPRX2 signaling via a similar mechanism to resveratrol.30 171808680.1

[0098] Osthole, a coumarin derivative extracted from the medicinal herbs of the Cnidium monnieri (L.) Cusson plant, does not interact with MRGPRX2 but inhibits MRGPRX2 ligand- stimulated increases in intracellular Ca2+concentration and suppresses MC activation. It also suppresses MRGPRX2 expression on the plasma membrane, and thus, MRGPRX2 is inhibited through a complex mechanism (Callahan B.N., et al. Front. Immunol. 2020;11:703. doi: 10.3389 / fimmu.2020.00703). In addition, Osthole has also been reported to bind to IgE receptors, which may indicate an anti-inflammatory effect of dual action on MCs (Han S., et al. Electrophoresis.2018;39:1181–1189. doi: 10.1002 / elps.201700457). In addition, dexamethasone, a well-known anti-inflammatory drug, inhibits MC activation through downregulating Gαi and MRGPRX2 downstream signals induced by basic secretagogues (Yamada K., et al. Cells. 2019;8:112. doi: 10.3390 / cells8020112). Lactic acid inhibits MRGPRX2 ligand-induced MC activation by suppressing MRGPRX2 downstream signals, such as elevation of intracellular Ca2+concentration and activation of MAP kinase. However, it may also inhibit MRGPRX2 activation and MC activation by interacting with the basicity of MRGPRX2 ligands (Syed M., et al. Cell. Immunol.2021;368:104422. doi: 10.1016 / j.cellimm.2021.104422). Therefore, the development of therapeutic agents targeting MRGPRX2 downstream signaling may also be effective on animal disease models.

[0099] Other Mechanisms: CD300f (leukocyte mono-immunoglobulin-like receptor 3), a known inhibitory regulator of IgE- and LPS-stimulated MC activation, suppresses MRGPRX2- mediated MC activation (Takamori A., et al. J. Allergy Clin. Immunol.2019;143:1231–1235. doi: 10.1016 / j.jaci.2018.10.034). CD300f inhibits the activation of FcεR and TLR by binding to ceramide and sphingomyelin (Izawa K., et al. J. Allergy Clin. Immunol.2014;133:270–273. doi: 10.1016 / j.jaci.2013.08.008). Although the mechanism by which CD300f regulates MRGPRX2 suppression is unknown, these results suggest that CD300f activators may be effective in suppressing anaphylactic reactions involving the MRGPRX2 pathway. Dondalska et al. reported that immunomodulatory single strand DNA (ssDNA) suppresses MRGPRX2-mediated MC activation using basic secretagogues. The ssDNA suppresses C48 / 80- and LL-37-induced murine dermatitis models (Dondalska A., et al. Front. Immunol. 2020;11:559589. doi: 10.3389 / fimmu.2020.559589). In addition, sugammadex, a cyclodextrin derivative encapsulating the MRGPRX2 ligand rocuronium, inhibits MRGPRX2 activation and MC activation by not only31 171808680.1rocuronium but also SP and other MRGPRX2 ligand stimuli (Fernandopulle N.A., et al. Clin. Exp. Allergy.2021;51:685–695. doi: 10.1111 / cea.13801)

[0159] .

[0100] Examples of other inhibitors, such as small molecules GE0118, GE1109, GE1109, and GE1111 demonstrated significant inhibition of MC degranulation and MRGPRX2 activation with IC50 of 5 to 21 μM. (Mukesh Kumar, et al. Translational and Clinical Immunology. Volume 151, issue 4, P1110-1122, April 2023) However, compared to the lead molecule, only GE1111 showed more potent inhibitory activity, with IC50below 10 μM, indicating the necessity of further efforts to increase the potency of these small molecules. Consistent with previous findings on slow decay of intracellular Ca2+signal in the MRGPRX2-mediated MC degranulation, a sustained Ca2+flux signal on activation by C48 / 80.29,49 MCs treated with the novel small molecules demonstrated a significant decrease in the Ca2+flux signal, which indicated that these small molecules can inhibit the early phase of MC activation (Mukesh Kumar, et al. 2023).

[0101] Another antagonist, EP262 (Escient Pharmaceuticals, Inc), is a potent, highly-selective antagonist that blocks the activation of MRGPRX2 by various neuropeptides and other agonists.

[0102] Another antagonist, MrgprX2 antagonist-1 is an MrgprX2 antagonist extracted from PCT application publication No.: WO2021092264A1, example E23.

[0103] Other examples of MrgprX2 antagonists can be found in PCT application publication No.: WO2021092240A1 and PCT application publication No.: WO2021092264A1.

[0104] Additional examples of MrgprX2 antagonists that can be used in the present methods and compositions include the following with structures depicted immediately below: MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist- 3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and ZINC49534341, some of which are disclosed in WO2021092264A1 and all of which commercially available from MedChem Express (www.medchemexpress.com):32 171808680.1MrgprX2 antagonist-2MrgprX2 antagonist-333 171808680.1(R)- MrgprX2 antagonist-3 (compound E118)34 171808680.1MrgprX2 antagonist-735 171808680.1ZINC49534341

[0105] References herein to MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and ZINC49534341 are to the respective compound of the above-depicted structure.36 171808680.1

[0106] Gene Editing Agents: Compositions of the disclosure include at least one gene editing agent. The gene editing agents can be targeted to the MRGPRX2 genes, fragments of MRGPRX2 genes, transcriptional regulators, etc, so as to render the MRGPRX2 non-functional, e.g. downregulation of the MRGPRX2, mutating or deletion of binding site, etc. Gene editing agents comprise CRISPR-associated nucleases such as Cas9 and Cas12a gRNAs, Argonaute family of endonucleases, clustered regularly interspaced short palindromic repeat (CRISPR) nucleases, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, other endo- or exo-nucleases, or combinations thereof.

[0107] In recent years, several systems for targeting endogenous genes have been developed including homing endonucleases (HE) or meganucleases, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN) and most recently clustered regularly interspaced short palindromic repeats (CRISPR)-associated system 9 (Cas9) proteins which utilize site-specific double-strand DNA break (DSB)-mediated DNA repair mechanisms. These enzymes induce a precise and efficient genome cutting through DSB-mediated DNS repair mechanisms. These DSB-mediated genome editing techniques enable target gene deletion, insertion, or modification.

[0108] In the past years, ZFNs and TALENs have revolutionized genome editing. The major drawbacks for ZFNs and TALENs are the uncontrollable off-target effects and the tedious and expensive engineering of custom DNA-binding fusion protein for each target site, which limit the universal application and clinical safety.

[0109] The RNA-guided Cas9 biotechnology induces genome editing without detectable off-target effects. This technique takes advantage of the genome defense mechanisms in bacteria that CRISPR / Cas loci encode RNA-guided adaptive immune systems against mobile genetic elements (viruses, transposable elements and conjugative plasmids). Three types (I-III) of CRISPR systems have been identified. CRISPR clusters contain spacers, the sequences complementary to antecedent mobile elements. CRISPR clusters are transcribed and processed into mature CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA (crRNA). Cas9 belongs to the type II CRISPR / Cas system and has strong endonuclease activity to cut target DNA.37 171808680.1

[0110] CRISPR methodologies employ a nuclease, CRISPR-associated (Cas), that complexes with small RNAs as guides (gRNAs) to cleave DNA in a sequence-specific manner upstream of the protospacer adjacent motif (PAM) in any genomic location. CRISPR may use separate guide RNAs known as the crRNA and tracrRNA. These two separate RNAs have been combined into a single RNA to enable site-specific mammalian genome cutting through the design of a short guide RNA. Cas and guide RNA (gRNA) may be synthesized by known methods. Cas / guide-RNA (gRNA) uses a non-specific DNA cleavage protein Cas, and an RNA oligonucleotide to hybridize to target and recruit the Cas / gRNA complex. See Chang et al., 2013, Cell Res.23:465-472; Hwang et al., 2013, Nat. Biotechnol.31:227-229; Xiao et al., 2013, Nucl. Acids Res.1-11.

[0111] In general, the CRISPR / Cas proteins comprise at least one RNA recognition and / or RNA binding domain. RNA recognition and / or RNA binding domains interact with guide RNAs. CRISPR / Cas proteins can also comprise nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, RNase domains, protein-protein interaction domains, dimerization domains, as well as other domains. The mechanism through which CRISPR / Cas9- induced mutations inactivate the MRGPRX2 can vary. For example, the mutation can affect MRGPRX2 gene expression. The mutation can comprise one or more deletions. The size of the deletion can vary from a single nucleotide base pair to about 10,000 base pairs. In some embodiments, the deletion can include all or substantially all of the MRGPRX2 sequence. The mutation can also comprise one or more insertions, that is, the addition of one or more nucleotide base pairs to the MRGPRX2 sequence. The size of the inserted sequence also may vary, for example from about one base pair to about 300 nucleotide base pairs. The mutation can comprise one or more point mutations, that is, the replacement of a single nucleotide with another nucleotide. Useful point mutations are those that have functional consequences, for example, mutations that result in the conversion of an amino acid codon into a termination codon, or that result in the production of a nonfunctional protein.

[0112] In certain embodiments, the CRISPR / Cas-like protein can be a wild type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein can be modified to increase nucleic acid binding affinity and / or specificity, alter an enzymatic activity, and / or change another property of the protein. For example, nuclease (i.e., DNase, RNase) domains of the CRISPR / Cas-like protein38 171808680.1can be modified, deleted, or inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the fusion protein. The CRISPR / Cas-like protein can also be truncated or modified to optimize the activity of the effector domain of the fusion protein.

[0113] In some embodiments, the CRISPR / Cas-like protein can be derived from a wild type Cas9 protein or fragment thereof. In other embodiments, the CRISPR / Cas-like protein can be derived from modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to alter one or more properties (e.g., nuclease activity, affinity, stability, etc.) of the protein. Alternatively, domains of the Cas9 protein not involved in RNA-guided cleavage can be eliminated from the protein such that the modified Cas9 protein is smaller than the wild type Cas9 protein.

[0114] Cas9 is guided by a mature crRNA that contains about 20 base pairs (bp) of unique target sequence (called spacer) and a trans-activated small RNA (tracrRNA) that serves as a guide for ribonuclease III-aided processing of pre-crRNA. The crRNA:tracrRNA duplex directs Cas9 to target DNA via complementary base pairing between the spacer on the crRNA and the complementary sequence (called the protospacer) on the target DNA (tDNA). Cas9 recognizes a trinucleotide (NGG) protospacer adjacent motif (PAM) to specify the cut site (the 3rd nucleotide from PAM). The crRNA and tracrRNA can be expressed separately or engineered into an artificial fusion small guide RNA (gRNA) via a synthetic stem loop (AGAAAU) to mimic the natural crRNA / tracrRNA duplex. Such gRNA, like shRNA, can be synthesized or in vitro transcribed for direct RNA transfection or expressed from a RNA expression vector (e.g., U6 or H1 promoter- driven vectors). Therefore, the Cas9 gRNA technology requires the expression of the Cas9 protein and gRNA, which then form a gene editing complex at the specific target DNA binding site within the target genome and inflict cleavage / mutation of the target DNA, e.g., MRGPRX2 nucleic acid sequences, promoters, enhancers etc., that regulated MRGPRX2 expression or function.

[0115] METHODS OF TREATMENT

[0116] In certain embodiments, a method of treating ischemic stroke in a subject, comprises administering an effective amount of an MRGPRX2 antagonist to the subject, thereby treating the ischemic stroke. In certain embodiments, the MRGPRX2 antagonist comprises an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents,39 171808680.1siRNA reagents, gene editing agents or any combination thereof. In certain embodiments, the MRGPRX2 antagonist comprises a small molecule. In certain embodiments, the MRGPRX2 antagonist comprises an antibody or antibody fragment. In certain embodiments, the MRGPRX2 antagonist is a peptide. In certain embodiments, the MRGPRX2 antagonist comprises Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2-Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7 xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3) or combinations thereof. In certain embodiments, the subject is identified as suffering from an ischemic stroke and the MRGPRX2 antagonist is administered to the identified subject.

[0117] In another aspect, a method of treating a neuroinflammatory disease comprises administering an effective amount of an MRGPRX2 antagonist to the subject, thereby treating the neuroinflammatory disease. In certain embodiments, the antagonist comprises an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents or any combination thereof. In certain embodiments, the MRGPRX2 antagonist comprises a small molecule. In certain embodiments, the MRGPRX2 antagonist comprises an antibody or antibody fragment. In certain embodiments, the antagonist is a peptide.

[0118] In certain embodiments, the MRGPRX2 antagonist comprises Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2-Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7 xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262, MrgprX2 antagonist-1 (C15H15F5N4O2S); MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof.

[0119] Suitable and preferred MrgprX2 antagonists for use in the present methods and compositions are also disclosed in H. Ogasawara et al., Cells, 10(11): 2906 (Nov. 2021);40 171808680.1International Patent Application WO2023 / 192901; US Patent 11919864; International Patent Application WO2022 / 087083; and U.S. Patent Application 2022 / 0177434; and WO2021092264A1.

[0120] As discussed, methods are provided for treatment of a subject suffering or susceptible to stroke and consequences thereof, including ischemic stroke injury.

[0121] In certain aspects, the subject may be identified as having suffered or is suffering from a stroke, including an ischemic stroke or a hemorrhagic stroke.

[0122] As discussed, methods are also provided for treatment of brain injury (including traumatic brain injury) or spinal cord injury (including traumatic spinal cord injury). Traumatic brain injury may occur e.g. with skull fracture or penetration injury. Traumatic brain injury may be a closed injury such as Shaken Baby Syndrome, blast injury, blunt trauma, concussion, concussion syndrome or stroke. Subject suffering from such conditions may be identified and treated by administration of one or more MrgprX2 antagonists as disclosed herein.

[0123] In certain aspects, the subject may be identified as at risk for undergoing a stroke and / or suffering from a stroke. For instance, a subject may be treated by the present methods where the patient is undergoing surgery such as heart surgery where brain ischemia and / or ischemic stroke injury is a potential complication. In such methods, the subject may be administered one or more MRGPRX2 antagonists in advance of (e.g. up to or about 48, 24, 12, 6, 3, 2, 1 or 05 hours in advance of surgery) and / or during the course and / or following the surgery.

[0124] In certain aspects, the subject may be identified as at risk for undergoing a stroke and / or suffering from nerve cell death resulting from e.g. stroke, hypoxia, hypoglycemia, brain or spinal cord ischemia, brain or spinal cord trauma. In such methods, the subject may be administered one or more MRGPRX2 antagonists e.g. within 0.25, 0.5, 1, 2, 3, 4, 6, 12, 24 or 48 hours or more following an injury or event such as stroke, hypoxia, hypoglycemia, brain or spinal cord ischemia, brain or spinal cord trauma.

[0125] In further aspects, methods are provided for treatment and / or prophylaxis of a neurodegenerative disease such as Parkinson's disease, Huntington's disease, Amyotrophic Lateral Sclerosis, Alzheimer's disease, Down's Syndrome and Korsakoff's disease In such41 171808680.1methods, the subject may be administered one or more MRGPRX2 antagonists to thereby treat the subject for the neurodegenerative disease or symptoms thereof.

[0126] In further aspects, methods are provided for treatment and / or prophylaxis of non-infectious meningitis. Non-infectious meningitis has ben described as inflammation of layers of tissue that cover the brain and spinal cord (meninges) and of the fluid-filled space between the meninges (subarachnoid space) when it is caused by disorders that are not infections or by drugs or vaccines.

[0127] In certain aspects, the subject or patient has not previously been treated for ischemic stroke injury.

[0128] In certain aspects, the subject is not suffering from and / or has not been identified as suffering from or susceptible to itch, including a chronic itch condition such as pruritus.

[0129] In certain aspects, the subject is not suffering from and / or has not been identified as suffering from or susceptible to an inflammatory condition, including an inflammatory condition relating to a subject’s skin e.g. an itch condition.

[0130] In certain aspects, the subject is not suffering from and / or has not been identified as suffering from cancer, including melanoma.

[0131] In certain aspects, the subject is not suffering from and / or has not been identified as suffering or needing treatment for relief from pain, including chronic pain.

[0132] In certain aspects, the subject is not suffering from and / or has not been identified as suffering from an allergic condition, including a pseudo-allergic condition.

[0133] In certain aspects, the subject is not suffering from and / or has not been identified as suffering from an inflammatory or autoimmune disorder or disease.

[0134] In certain aspects, a subject being treated by the present methods is not suffering from and / or has not been identified as suffering from or susceptible to itch, including a chronic itch condition such as pruritus; and / or the subject being treated by the present methods is not suffering from and / or has not been identified as suffering from or susceptible to an inflammatory condition, including an inflammatory condition relating to a subject’s skin; and / or the subject is not suffering from and / or has not been identified as suffering from cancer, including42 171808680.1melanoma; and / or the subject is not suffering from and / or has not been identified as suffering or needing treatment for relief from pain, including chronic pain; and / or the subject is not suffering from and / or has not been identified as suffering from an allergic condition, including a pseudo- allergic condition; and / or the subject is not suffering from and / or has not been identified as suffering from an inflammatory or autoimmune disorder or disease.

[0135] In certain aspects, a subject being treated by the present methods is not suffering from and / or has not been identified as suffering from or susceptible to an autoimmune disease, pseudo-allergic drug reaction, pain, itch, and inflammatory disorders including in particular inflammatory bowel disease, urticaria, sinusitis, asthma, rosacea, and / or endometriosis.

[0136] In certain aspects, , a subject being treated by the present methods is not suffering from and / or has not been identified as suffering from or susceptible to pseudo-allergic reactions including pseudo-allergic drug reactions, chronic itch (e.g., pruritus), inflammation disorders, pain disorders, skin disorders, wound healing, cardiovascular disease, and / or lung inflammation / COPD.

[0137] In certain aspects, the patient or subject is a male. In certain aspects, the patient or subject is a female. In certain aspects, the patient or subject is less than 65 years of age. In certain aspects, the patient or subject is at least 65 years old (including at least about 70, 75 or 80 years old).

[0138] In certain aspects, a composition comprising one or more MRGPRX2 antagonist compounds as disclosed herein is used as monotherapy to treat a condition or disease as disclosed herein.

[0139] As defined herein, a therapeutically effective amount of an MRGPRX2 antagonist (i.e., an effective dosage) depends on the agent selected. For instance, single dose amounts of an MRGPRX2 antagonist in the range of approximately 1 pg to 1000 mg per day may be administered; in some embodiments, 10, 30, 100, or 1000 pg, or 10, 30, 100, or 1000 ng, or 10, 30, 100, or 1000 µg, or 10, 30, 100, or 1000 mg per day may be administered.

[0140] A therapeutically effective amount of the compound of the present disclosure can be determined by methods known in the art. In addition to depending on the agent and selected / pharmaceutical formulation used, the therapeutically effective quantities of a43 171808680.1pharmaceutical composition of the disclosure will depend on the age and on the general physiological condition of the patient and the route of administration. In certain embodiments, the therapeutic doses will generally be between about 10 and 2000 mg / day and preferably between about 30 and 1500 mg / day. Other ranges may be used, including, for example, 50-500 mg / day, 50-300 mg / day, 100-200 mg / day.

[0141] Administration may be once a day, twice a day, or more often, and may be decreased during a maintenance phase of the disease or disorder, e.g. once every second or third day instead of every day or twice a day. The dose and the administration frequency will depend on the clinical signs, which confirm maintenance of the remission phase, with the reduction or absence of at least one or more preferably more than one clinical signs of the acute phase known to the person skilled in the art. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of an agent can include a single treatment or, optionally, can include a series of treatments.

[0142] It can be appreciated that the method of introducing an agent into the environment of a cell will depend on the type of cell and the makeup of its environment. Suitable amounts of an agent must be introduced and these amounts can be empirically determined using standard methods. Exemplary effective concentrations of an individual agent in the environment of a cell can be 500 millimolar or less, 50 millimolar or less, 10 millimolar or less, 1 millimolar or less, 500 nanomolar or less, 50 nanomolar or less, 10 nanomolar or less, or even compositions in which concentrations of 1 nanomolar or less can be used.

[0143] Combination Therapies

[0144] In certain embodiments, the compositions embodied herein are administered to a patient in combination with one or more other agents or therapeutics. The term “combination therapy”, as used herein, refers to those situations in which two or more different pharmaceutical agents are administered in overlapping regimens so that the subject is simultaneously exposed to both agents. When used in combination therapy, two or more different agents may be administered simultaneously or separately. This administration in combination can include simultaneous administration of the two or more agents in the same dosage form,44 171808680.1simultaneous administration in separate dosage forms, and separate administration. That is, two or more agents can be formulated together in the same dosage form and administered simultaneously. Alternatively, two or more agents can be simultaneously administered, wherein the agents are present in separate formulations. In another alternative, a first agent can be administered just followed by one or more additional agents. In the separate administration protocol, two or more agents may be administered a few minutes apart, or a few hours apart, or a few days apart.

[0145] In certain embodiments, the method further comprises administering to the subject antagonists of substance P, antagonists of CCL2, antagonists of CCL3, antagonists of neutrophil elastase, antagonists of interleukin 1 beta (IL-1β), antagonists of interleukin 6 (IL-6), antagonists of interleukin-8 (IL-8), antagonists of interleukin 17 (IL-17), tryptase, tumor necrosis factor alpha (TNFα), anti-inflammatory agents or combinations thereof.

[0146] PHARMACEUTICAL COMPOSITIONS

[0147] Such compositions typically include the agent and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds can also be incorporated into the compositions.

[0148] A pharmaceutical composition is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.45 171808680.1

[0149] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM(BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0150] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in a selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0151] Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition.46 171808680.1The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[0152] The compositions of the disclosure could also be formulated as nanoparticle formulations. The compounds of the disclosure can be administered for immediate-release, delayed-release, modified-release, sustained-release, pulsed-release and / or controlled-release applications. The pharmaceutical compositions of the disclosure may contain from 0.01 to 99% weight - per volume of the active material. For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer. Such methods include those described in U.S. Pat. No.6,468,798.

[0153] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art. The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0154] In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations can be prepared using standard techniques. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to mast cells47 171808680.1with monoclonal antibodies) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811.

[0155] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50(the dose lethal to 50% of the population) and the ED50(the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. Compounds which exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0156] The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For a compound used in a method of the disclosure, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0157] The pharmaceutical compositions can be included in a kit, container, pack, or dispenser together with instructions for administration.

[0158] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the disclosure, and are not intended to limit the scope of what the inventors regard as their disclosure. EXAMPLES48 171808680.1

[0159] EXAMPLE 1: A MAST CELL-SPECIFIC RECEPTOR MEDIATES POST- STROKE BRAIN INFLAMMATION VIA A DURAL-BRAIN AXIS

[0160] Murine Mrgprb2 and human MRGPRX2, members of the Mas-related family of G-protein-coupled receptors (Mrgprs), are mast cell-specific G protein-coupled receptors4. These receptors are activated by a variety of positively charged molecules, including the neuropeptides substance P and pituitary adenylate cyclase-activating polypeptide24–29. Curiously, neuropeptides released from injured peripheral nerve tissue have been shown to activate Mrgprb2 on nearby, tissue-resident mast cells25. When activated, Mrgprb2 promotes mast cell degranulation and cytokine production that then recruits a wave of innate immune cells from the periphery. Despite an extensive body of work describing the roles of Mrgprb2 / X2 in peripheral inflammation, whether these receptors contribute to neurogenic inflammation in the brain remains unclear.

[0161] Here, it is demonstrated that Mrgprb2 and MRGPRX2 are key receptors necessary for mast cell activation after ischemic stroke injury in mice and humans. Mouse meningeal mast cells in the dura sense neuronal injury from the brain after stroke and release cytokines to recruit immune cells into the brain. Mrgprb2 promotes invasion of skull bone marrow neutrophils in the acute phase of stroke inflammation, demonstrating a previously uncharacterized role of mast cells in CNS inflammation. Further, genetic deletion and pharmacological inhibition of Mrgprb2 attenuates post-stroke inflammation and infarct volume, reducing mortality and improving functional outcomes. The findings herein identify the mast cell as one of the first sentinel cells within the meninges that surveils the brain and mediates innate inflammation following stroke. Inhibiting Mrgprb2 / X2 in the early phase of brain injury may therefore be a promising therapeutic intervention to manipulate central neuroimmunity to attenuate pathologic inflammation and protect the brain from long-term detrimental damage.

[0162] Results

[0163] Mrgprb2 contributes to post ischemic stroke injury.

[0164] We first sought to investigate whether mast cells contribute to ischemic stroke pathology via Mrgprb2. To simulate ischemic stroke, we performed transient middle cerebral artery occlusion (tMCAO)29,30 in wild-type (WT) and Mrgprb2-null (Mrgprb2- / -) mice (FIG.1A). We observe no difference in blood flow reduction via laser doppler during the tMCAO49 171808680.1surgery between WT and Mrgprb2- / - mice (FIG. 7A), indicating equivalent ischemic stroke induction. After 40 minutes, the filament was removed, and the mice were placed in recovery for 48 hours before measuring the volume of infarcted brain tissue. With the chemical stain 2,3,5- triphenyltetrazolium chloride (TTC) that stains live but not infarcted tissue, we find that Mrgprb2- / - mice exhibit reduced stroke volume (FIG.1B-C). We confirmed this finding with MRI and see that Mrgprb2- / - mice show a 22% ± 5% reduction in stroke volume as compared to WT mice at 48 hours (FIG. 1D-1E). Mrgprb2- / - mice also have reduced midline shift, consistent with less edema and parenchymal injury (FIG.1B).

[0165] To delineate whether these quantifiable differences in infarct volume translate to differences in focal neurological deficits, we employed several behavior tests31. Using the 28-point neuroscore, we find that WT mice suffer from worse sensorimotor deficits as early as 24 hours after tMCAO when compared to Mrgprb2- / - mice (FIG. 1F). WT mice also perform worse in the rotarod test compared to Mrgprb2- / - mice, demonstrating severe motor deficits (FIG.1G). Consistent with an infarct of the right temporal hemisphere, WT mice also experience a diminished left front and hind paw spread (distance between the first and fourth toes) by Catwalk (FIG. 1H), which is not seen in the right paws (FIG. 7C). In addition to fewer functional neurologic deficits, Mrgprb2- / - mice show increased survival 48 hours after tMCAO (Fig.1I, FIG. 7D).

[0166] Mrgprb2-expressing meningeal mast cells are activated after stroke.

[0167] We then delineated the location of these Mrgprb2-expressing mast cells in the context of ischemic stroke. To elucidate whether Mrgprb2 mast cells are present in the meninges32 or brain, we leveraged Mrgprb2-Cre;Rosa26-tdTomato (tdT) reporter mice which express tdT only in cells expressingMrgprb24. We observe Mrgprb2 expression in dural mast cells and find that these cells are in close proximity to the vasculature, as seen by CD31 staining (FIG. 2A-2B). Using the common mast cell marker avidin, we detected tdT in all dural mast cells, thus confirming that 100% of dural mast cells express Mrgprb2 (FIG. 8A-8B). We performed RNA sequencing of meningeal mast cells, as this subtype of mast cell has not been specifically characterized before33,34. These cells were collected by sorting tdT-positive cells from Mrgprb2- Cre;tdT meninges. Expression of mast cell-specific genes in meningeal mast cells show no50 171808680.1significant differences compared to other connective tissue mast cells of the peritoneum and skin (FIG.9).

[0168] Flow cytometric analyses confirm that these tdT-positive cells are CD117- and FcER1a- positive mast cells and demonstrate that Mrgprb2-expressing mast cells are restricted to the dura and are not present in the brain parenchyma (FIG.2C, FIG.8A-8E). We additionally examined whether these mast cells migrate into the brain after stroke, but do not observe any Mrgprb2-expressing mast cells in the brain 48 hours after tMCAO (FIG.10A-10B) nor any change in the number of mast cells in the dura (FIG. 8F). These observations are corroborated by three independent studies of the single cell transcriptome of the whole mouse brain at baseline35,36 (FIG. 10C) and after ischemic stroke37, all showing no Mrgprb2 expression in the brain. These data suggest that Mrgprb2-mast cells remain in their native dural compartment and incite pathologic brain inflammation from the meninges.

[0169] To measure the activity of these dural mast cells, we monitored the release of small vesicles near mast cells as a marker of degranulation. We find that deleting Mrgprb2 significantly decreases mast cell activation after ischemic stroke, as WT dural mast cells are significantly more degranulated after tMCAO than Mrgprb2- / - cells (FIG. 2D-2E). We also see an increase in expression of the mast cell-specific serine protease tryptase beta 2 (Tpsb2), as well as other mast cell factors38 in WT over Mrgprb2- / - meninges following tMCAO (FIG.2F, FIG. 8G), consistent with greater mast cell activation and degranulation in WT meninges. Deleting Mrgprb2 thus leads to reduced mast cell degranulation and diminished cytokine production, suggesting that Mrgprb2 acts as a key receptor for meningeal mast cell activation in ischemic stroke.

[0170] Mrgprb2- / - mice exhibit attenuated post-stroke inflammation in the brain.

[0171] We next considered whether Mrgprb2-mast cells mediate the initial ischemic injury in stroke or instead incite downstream inflammation4,24. We found that there is no significant difference in stroke volume by MRI at 6 hours between WT and Mrgprb2- / - mice, suggesting that Mrgprb2-mast cells likely do not factor into the acute ischemic injury (FIG.11A). We further demonstrate that both genotypes exhibit similar neuronal injury at 6 hours using glial51 171808680.1fibrillary acidic protein (GFAP), an indirect marker of neuronal injury2,39, and 4-hydroxynonenal (4-HNE), a marker of oxidative stress after stroke40,41(FIG.11B-11C).

[0172] To assess the acute immune response after ischemic stroke, we measured immune cell populations in the stroke and contralateral brain hemispheres of WT and Mrgprb2- / - mice via flow cytometry. We analyzed recruitment of specific innate immune cell populations, first using pan-immune (CD45) and pan-myeloid cell markers (CD11b), and later using cell- specific markers (Ly6G for neutrophils, and Ly6C for monocytes / macrophages) (FIG.3A, FIG. 11D). No differences in baseline immune cell populations in the brain between WT and Mrgprb2- / - mice are detected (FIG. 11E). We show that Mrgprb2- / - mice exhibit decreased innate inflammation measured by absolute counts of neutrophils, monocytes / macrophages, and activated, CD11b-positive microglia in the stroke hemisphere 48 hours after stroke (FIG.3B-3D, FIG.11F). These differences are recapitulated in WT and Mrgprb2- / - littermates bred from Mrgprb2+ / - mice (FIG. 11G) which suggests that these distinct immune phenotypes are not artifacts of separate mouse colonies. We demonstrate further by immunofluorescence that these immune cells infiltrate in the stroke hemisphere near the injured, GFAP-positive tissue and do not accrue in the contralateral hemisphere far away from GFAP signal (FIG.3E, FIG.11H).

[0173] Commensurate with reduced immune cell recruitment in the brain, we see significantly decreased levels of the chemokines CCL2 and CCL342–44 in Mrgprb2- / - compared to WT stroke hemispheres (FIG. 3F). We additionally show a decrease in IL-6 (FIG. 3G), a cytokine associated with poor outcomes after ischemic stroke45–47, and in neutrophil elastase (NE) (FIG. 3H), a neutrophil-specific protease that increases blood brain barrier permeability48,49. Given that mast cells are known to recruit neutrophils in other inflammatory injuries, we chose to focus on neutrophil regulation in stroke. We previously showed that CXCL2, a master regulator of neutrophil recruitment released by mast cells50, was elevated in the meninges of WT mice after tMCAO (FIG.2F). Accordingly, we show that sequestering CXCL2 using a neutralizing antibody injected into the cisterna magna attenuates neutrophil-specific recruitment into the brain after stroke in WT but not Mrgprb2- / - mice (FIG.11I-11J). This decrease is not seen in vehicle-injected mice, suggesting that Mrgprb2 may chemoattract neutrophils via CXCL2.

[0174] Since Mrgprb2 is expressed in connective tissue mast cells beyond the meninges, including the peritoneum, and skin, we wanted to ensure that the effect of Mrgprb2 in52 171808680.1mediating brain inflammation is attributed specifically to meningeal mast cells. We thus injected WT or Mrgprb2- / - cultured mouse mast cells into the meninges of Mrgprb2- / - mice. First, using Mrgprb2-tdT mast cells injected into non-tdT Mrgprb2- / - mice, we show that tdT cells are expressed only in the meninges after engraftment (FIG.3I) and that these cells are not in the brain or peritoneum (FIG. 2A-12B). We additionally see an increase in meningeal mast cell counts, suggesting that the inserted cells have populated within the meninges (FIG. 3J). Engrafting Mrgprb2- / - mice with WT but not Mrgprb2- / - meningeal mast cells significantly increases brain inflammation after tMCAO as demonstrated by neutrophil and monocyte / macrophage recruitment (FIG. 3K). These data suggest that the activity of meningeal-specific Mrgprb2 mast cells is sufficient to incite poststroke neuroinflammation.

[0175] To further characterize this role of meningeal mast cells in stroke, we investigated the inflammatory environment in the meninges. We counted neutrophil populations within the meninges, excluding intravascular neutrophils in the venous sinuses (FIG. 12C). Consistent with early mast cell activity in the meninges after stroke, we see an increase in neutrophil infiltration in the meninges of WT compared to Mrgprb2- / - mice 16 hours after stroke (FIG. 2G). Curiously, the neutrophil count slowly decreases in WT meninges but rises in Mrgprb2- / - meninges (FIG.12D-12E). By 48 hours, we find significantly fewer neutrophils in the meninges of WT compared to Mrgprb2- / - mice, and this difference remains beyond 48 hours (FIG. 12F-12G). This finding suggests that neutrophils are recruited to the meninges in WT mice earlier and migrate to the brain parenchyma over time, whereas neutrophils accumulate in the meninges of Mrgprb2- / - mice but do not infiltrate into the brain. Thus, we demonstrate that Mrgprb2 signaling increases recruitment of immune cell infiltrate via the meninges, and that presence of Mrgprb2 is necessary for immune cell migration from the meninges into the brain parenchyma after stroke.

[0176] Mast cell activity regulates immune cell recruitment from the skull bone marrow.

[0177] The skull bone marrow serves as an important reservoir of immune cells for CNS neuroimmunity, providing a source of inflammatory cells specifically for the brain in times of infection and injury51–53. Recent work has identified direct anatomic connections between the skull bone marrow and dura via channels that can transfer cells between the two compartments54.53 171808680.1Sandwiched between the skull bone and the brain, dural Mrgprb2-mast cells are well positioned to recruit immune cells to the brain from the skull bone marrow. We tested whether meningeal mast cells recruit skull bone marrow immune cells and whether Mrgprb2 is necessary for this function.

[0178] To first understand how skull bone marrow neutrophil populations change with stroke, we extracted skull bone marrow from mice 48 hours after tMCAO. We see no significant changes in overall neutrophil populations in the skull bone marrow after stroke at this time point, similar to other CNS injury models51(FIG. 13A). To further investigate the role of skull bone marrow recruitment, we transplanted skull flaps from GFP reporter mice (UBC-GFP), onto WT or Mrgprb2- / - acceptor mice while keeping the dura of the acceptor mice intact (FIG. 4A). Since there are no Mrgprb2-mast cells in the skull bone marrow, there is no reintroduction of new populations of mast cells into the acceptor mice (FIGS.13B-1C). GFP signal remains mostly in the skull bone marrow with minimal leakage into the blood, allowing us to selectively track skull bone marrow cells in transplanted mice (FIG. 13D). Since skull transplantation induces a surgical inflammatory response, we confirmed that there were no significant differences in brain or meningeal GFP-positive neutrophils between genotypes 10 days after transplantation (FIG. 13E). We then proceeded with tMCAO in WT and Mrgprb2- / - acceptor mice and measured GFP signal in the brain 48 hours later. As illustrated in FIG.13F, many GFP-positive, CD45-positive immune cells infiltrate the WT brain 48 hours after stroke. However, Mrgprb2- / - mice brains contain fewer GFP-positive neutrophils after tMCAO compared to WT mice (FIG.4B). The ratio of GFP-positive neutrophils to total neutrophils is also significantly lower in Mrgprb2- / - mice, suggesting that fewer neutrophils migrate from the skull bone marrow than in their WT counterparts (FIG.4C).

[0179] Following the hypothesis that Mrgprb2 signaling in dural mast cells bolsters recruitment of skull bone marrow neutrophils through dura-skull bone channels, we find that the absolute count as well as percentage of GFP-positive neutrophils in the dura of Mrgprb2- / - mice is significantly reduced (FIG.4D). Interestingly, the pool of GFP-positive neutrophils is higher in Mrgprb2- / - skull bone marrow, indicating a depletion of GFP neutrophils from the WT skull bone marrow as they traverse through the meninges into the brain (FIG. 4E). This depletion is seen specifically in the neutrophil pool and not in the larger GFPpositive immune population as primarily neutrophils are being recruited into the brain in this acute stage(FIG. 13G). Overall,54 171808680.1these data suggest that the presence of Mrgprb2 in the dura may bolster the recruitment of neutrophils from the skull bone marrow reservoir after stroke.

[0180] Mast cell proteases cleave semaphorin, the gatekeeper of dural-brain channels.

[0181] While channels that connect the skull bone marrow to the dura have been identified, only recently has it been proposed that channels from the dura to the brain exist that connect through the arachnoid barrier55. These arachnoid cuff exit points (ACE points) are gated by semaphorins, a class of chemorepellent molecules that prevent the movement of immune cells through the channels. Decreased expression of semaphorins promotes the migration of immune cells from the dura into the brain. We thus hypothesized that perhaps a reduction of semaphorins after stroke would potentiate movement of dural neutrophils across ACE points and into the brain. Indeed, we see by ELISA of leptomeningeal lysates that semaphorin 3a (Sema3a), but not semaphorin 3d, is specifically downregulated in WT, but not Mrgprb2- / - mice after stroke (FIG. 4F, FIG.13F).

[0182] Previous studies have shown that several proteases, potentially those expressed by mast cells such as furins and matrix metalloproteinases, are able to cleave semaphorins56,57, and that the smaller 65 kilodalton form of semaphorin is inactive58. We show here that mast cell lysate, but not fibroblast lysate, can significantly cleave full-length Sema3a into its inactive form (FIG. 4G). These data suggest that Mrgprb2-mast cells facilitate movement of neutrophils from the meninges into brain by inactivating semaphorin, thus disrupting the critical checkpoint.

[0183] Mast cell activity promotes neutrophil recruitment from the peripheral blood.

[0184] It is important to note that while the skull bone marrow is a meaningful source of invading immune cells after stroke, most infiltrating neutrophils do not express GFP and thus likely originate in the periphery (FIG. 4H). To further assess whether Mrgprb2 regulates recruitment of peripheral blood neutrophils, we first monitored neutrophil populations in WT and Mrgprb2- / - mice and see that they dramatically expand after stroke (FIG. 13I). To specifically label these peripheral blood neutrophils, we employed a parabiosis model (FIG. 4I) in which UBC-GFP mice are parabiotically paired with WT or Mrgprb2- / - mice. After confirming that GFP55 171808680.1cells are expressed within the blood and do not label the brain or skull bone marrow (FIGS.13J- 13K), we performed tMCAO on the WT and Mrgprb2- / - parabionts. Two days after tMCAO, the blood of both WT and Mrgprb2- / - parabionts remain roughly 40% GFP-positive, indicating no differences in blood chimera after stroke (FIG.13l). We see that significantly more GFPpositive neutrophils infiltrate the WT brain, demonstrating that WT mice recruit more neutrophils from the blood and that the loss of Mrgprb2 attenuates blood neutrophil recruitment into the ischemic brain (FIG.4J).

[0185] Human meningeal MRGPRX2 mast cells are activated after stroke.

[0186] We next probed whether the human ortholog MRGPRX2 exerts similar pro- inflammatory activity as seen with mouse Mrgprb2. We first collected dura from non-stroke patients undergoing elective craniotomies to determine whether mast cells are present in human dura and whether they express MRGPRX2. We find that avidin and tryptase-expressing mast cells are present in human dura and discover that these cells indeed express MRGPRX2 (FIG.5-5B). We additionally collected post-mortem brain tissue from stroke and non-stroke patients to assess for presence of MRGPRX2-mast cells. While there is an increase in GFAP in stroke brains as a marker of injury, there is no MRGPRX2 or tryptase expression, suggesting a lack of MRGPRX2- mast cells in the human brain after stroke, consistent with our mouse data (FIG.14A).

[0187] After confirming that these cells are present in human dura, we then sought to determine if these cells play a role in ischemic stroke in human patients. We obtained dura from stroke patients undergoing decompressive hemicraniectomy for malignant middle cerebral artery syndromes (FIG. 5C-5D; FIG. 14B-14C) and find no differences in the number of mast cells between stroke and control patients. We show, however, that dural mast cells in ischemic stroke patients are significantly more degranulated and activated compared to control patients (FIG.11E- 11G). This is the first clear evidence that human dural mast cells are activated after ischemic stroke in patients.

[0188] Neuropeptide substance P is a ligand for Mrgprb2 and MRGPRX2 activation in stroke.

[0189] After determining that Mrgprb2 and MRGPRX2 are key mast cell receptors activated after stroke, we next asked which ligand(s) might underlie its activity. One potential candidate was substance P (SP), a neuropeptide released from neurons upon noxious stimuli and a56 171808680.1known agonist of Mrgprb2 / X24,24. SP is increased in mouse brains following tMCAO59–61, and previous studies have reported that higher serum SP in stroke patients is correlated with higher mortality62–64. We also observe that SP is elevated in the infarcted hemisphere of both WT and Mrgprb2- / - brains (FIG. 15A), indicating that SP is released from injured neuronal tissue after stroke. To determine if SP may drive inflammation via Mrgprb2, SP or vehicle was exogenously injected into the cisterna magna after tMCAO. We see that exogenous SP increases recruitment of neutrophils into the brain of WT but not Mrgprb2- / - mice, suggesting that SP acts through Mrgprb2 (FIG.15B). Since neurokinin-1 receptor (NK1R) is the canonical receptor for SP, we additionally wanted to assess whether NK1R contributes to post-stroke brain inflammation. We see however, that NK1R- / - mice exhibit similar brain neutrophil recruitment as WT mice after tMCAO (FIG. 15C), suggesting that SP acts primarily through Mrgprb2 to incite inflammation after stroke. To further assess the role of SP in human stroke, we collected serum samples and observe an increase in serum SP in ischemic stroke patients compared to controls (FIG.5H). To determine whether the increase in serum SP activates human mast cells, we exposed cultured human WT and MRGPRX2- / - LAD2 mast cells to serum from healthy and stroke patients. We find that stroke patient serum activates and degranulates more WT LAD2 mast cells than serum from healthy patients, and that fewer MRGPRX2- / - mast cells are activated by stroke serum in comparison. MRGPRX2- / - and WT mast cells show similar reactivity to serum from healthy patients, suggesting that MRGPRX2 is uniquely sensing a factor present in stroke serum (FIG. 5I). To narrow down whether MRGPRX2 is responding to SP in the sera, we immunodepleted both healthy and stroke serum of SP by pre-incubating the sera with anti-SP antibodies (FIG. 15D). Clearing SP from stroke serum significantly reduces its activation of WT but not MRGPRX2- / - LAD2 mast cells, pointing towards a specific SP-MRGPRX2 interaction (FIG. 5J). Taken together, we show that human dural mast cells are activated after stroke, and that this activation is in part dependent on SPmediated activation of MRGPRX2.

[0190] A Mrgprb2 antagonist alleviates post-stroke inflammation and attenuates stroke behavioral deficits and mortality.

[0191] We next wondered whether pharmacologic inhibition of Mrgprb2 could alleviate post-stroke inflammation and improve stroke outcomes. Osthole, a natural coumarin found in the fruits of Cnidium monnieri, is a known Mrgprb2 antagonist65. We confirm that pre- treatment of osthole inhibits SP-mediated degranulation in WT but not Mrgprb2- / - mouse cultured57 171808680.1mast cells (FIG.6A). After confirmation of osthole as a Mrgprb2 antagonist, we treated tMCAO mice with two intraperitoneal injections of 100mg / kg osthole65at 6 hours and 24 hours after tMCAO induction. Two days after tMCAO, we assess WT and Mrgprb2- / - brains for inflammation. We show that osthole-treated WT mice have significantly reduced inflammation by neutrophil count compared to vehicle-treated mice, and that this inflammatory reduction is not seen in Mrgprb2- / - mice (FIGS. 6B-6C). We additionally determine that other immune cells, namely monocytes / macrophages and activated microglia, are similarly diminished in the brains of WT but not Mrgprb2- / - mice after osthole treatment (FIGS. 16A-16B). These data indicate that osthole acts in a Mrgprb2-dependent manner to inhibit post-stroke inflammation. Consistent with previous differences in WT and Mrgprb2- / - meningeal inflammation at 48 hours after tMCAO, we show that osthole-treated WT mice have more neutrophils in the meninges as these cells cannot traverse into the brain (FIGS. 16C-16D). Osthole-treated Mrgprb2- / - meninges, however, show no significant differences in neutrophil counts (FIG. 16E). We further show that local osthole treatment of 1mg / kg in the cisterna magna reduces neutrophil accumulation in the brain after stroke in WT mice, suggesting that meningeal mast cell inhibition is sufficient to combat post-stroke brain inflammation (FIG.16F).

[0192] To assess whether this osthole-mediated inhibition of post-stroke inflammation is clinically relevant, we measured stroke infarct volume by MRI. Osthole-treated WT mice show significantly reduced infarct volumes and limited midline shift compared to vehicle-treated mice (FIGS. 6D-6E, FIG. 16G).Using the 28-point neuroscore, we find that osthole-treated WT mice exhibit fewer sensorimotor deficits (FIG. 6F). Lastly, we show that osthole treatment significantly increases survival in WT mice 30 days after tMCAO, indicating functional efficacy of Mrgprb2 inhibition (FIG.6G). Thus, we show here that osthole acts via a Mrgprb2-dependent manner to inhibit post-stroke inflammation and improve outcomes, providing evidence that perhaps inhibition of MRGPRX2 may be a promising therapeutic in combating post- stroke neuroinflammation in human patients.

[0193] Together, these data support a model in which Mrgprb2 is a key receptor that allows meningeal mast cells to surveil brain injury in stroke via SP. Once activated, these mast cells act as first responders in initiating recruitment of peripheral and skull bone marrow immune cells through cytokines such as CXCL2. Mrgprb2 signaling further facilitates the transfer of these immune cells into the brain parenchyma by releasing proteases that inhibit semaphorin activity58 171808680.1and promote the migration of immune cells through dural-brain channels. Through these mechanisms, Mrgprb2 signaling promotes mast cell activity in ischemic stroke, contributing towards harmful post-stroke neuroinflammation (FIG.6H).

[0194] DISCUSSION

[0195] The theory of CNS immune privilege has been slowly replaced by a more complex network of immune homeostasis. The skull bone marrow has been emphasized in recent years as an immune niche that expands over adulthood, ready to activate in times of brain injury52–54,66. Further, the meninges have been supported as an important tissue that directs this complex immune environment, with channels that connect it to the skull bone marrow and to the brain directly51,55. Despite this growing evidence of complex immune regulation of the CNS, the signals that orchestrate communication between these tissues remains unknown.

[0196] Here, we provide evidence that the mast cell, via its receptor Mrgprb2, is the first identified cell population in the meninges that directs this CNS-immune interaction. While previous studies have established the role of mucosal mast cells67–69, a distinct mast population, as well as meningeal mast cells70–73, in mediating post-stroke inflammation, none of these data provide a specific mechanism of activation of this cell population, largely limiting clinical translatability. Our finding that Mrgprb2 is a key regulator of these meningeal, connective tissue mast cells alone provides a distinct target to address several diseases and disorders of CNS neuroinflammation.

[0197] Beyond this, we introduce a new mechanism via which these meningeal mast cells contribute to brain inflammation. Our data suggest that these Mrgprb2-mast cells recruit skull bone marrow neutrophils into the brain, and that the absence of this receptor attenuates this infiltration. Further, by inhibiting the chemorepellent semaphorin 3a, Mrgprb2 disrupts the chemical barrier within dural-brain channels, allowing meningeal neutrophils to migrate into the brain. These data provide a bridge between the skull bone-dura and dura-brain pathways of immune migration, a previously unidentified gap in this important tissue structure.

[0198] In addition to describing the role of Mrgprb2 in mouse ischemic stroke, we discover that MRGPRX2, the human ortholog of this mast cell receptor, is expressed in human dural mast cells. Moreover, this is the first study demonstrating that these human mast cells are activated in response to stroke, and that this activation is in part driven by substance P, a known59 171808680.1ligand of MRGPRX2. Therefore, we propose that MRGPRX2 may be a promising drug target in the long search for a therapeutic to combat post-stroke inflammation.

[0199] As a promiscuous receptor that can be bound by many positively charged molecules, MRGPRX2 is activated by several pharmaceuticals4. Two of these agonists include leuprolide, a gonadotropin-releasing hormone agonist74,75, and levofloxacin, an antibiotic in the fluroquinolone class, both of which are known to increase risk of and exacerbate stroke. Specifically, a trial using levofloxacin to limit infections after stroke was prematurely interrupted when it was noted that the levofloxacin treatment arm had worse outcomes than the placebo arm76. Exact mechanisms of how these drugs increase and worsen risk of stroke is unclear. Via MRGPRX2, it is plausible that these drugs can activate dural mast cells and thus worsen inflammatory injury in stroke patients. While MRGPRX2 activation may be harmful in stroke patients, inhibition of MRGPRX2 instead may provide robust benefits. Further studies into age- and sex-matched analyses of stroke patients will be imperative to further support this role of MRGPRX2 in stroke.

[0200] We have identified MRGPRX2 as a specific target to address post-stroke inflammation, by directly inhibiting the significant mast cell activity that drives the skull bone- dura-brain axis of inflammation. MRGPRX2 expression and activity is confined to the meninges outside of the blood brain barrier, thus allowing ease of access for most drug delivery methods. Thus, MRGPRX2 antagonists are promising potential therapeutic candidates for significantly attenuating post-stroke inflammation. Further studies into the role of this receptor as a regulator of neuroimmunity may additionally uncover a potential role in several diseases and disorders of the central nervous system, centering mast cells as a sentinel immune cell in the meninges that regulates the brain-immune interface.

[0201] MATERIALS AND METHODS

[0202] Mice: All experiments were performed in accordance with protocols approved by the Animal Care and Use Committee at the Johns Hopkins University School of Medicine. All mice were housed in the Miller Research Building animal facility and weaned at 3 weeks of age. Mice used for this study were 8–12-week-old males and females on the C57BL / 6J background. Mrgprb2- / - and Mrgprb2-Cre animals were generated as previously described4. UBC-GFP mice used for skull transplantation and parabiosis were purchased from Jackson60 171808680.1Laboratories (C57BL / 6-Tg(UBC-GFP)30Scha / J, JAX 004353). Surgeons were blinded to mouse genotype during all surgical procedures, and mice were randomized into sham and tMCAO cohorts.

[0203] Dura Collection: Dura from patients undergoing decompressive hemicraniectomy for treatment of ischemic stroke was collected during surgery. Control dura was obtained from elective aneurysm clippings, in which a small piece of dura (5mm by 5mm) is removed. These procedures presented with no clinical symptoms and were therefore used as controls. In both our control and stroke patient procedures, patients are under general anesthesia, positioned supine, and a large craniotomy is performed. Dura is sampled at the beginning of dural opening in both procedures.

[0204] Dura was collected in normal saline and placed in 4% paraformaldehyde (PFA) overnight at 4°C. Dura samples were then transferred to 30% sucrose in PBS and incubated overnight at 4°C. They were then transferred to optimal cutting temperature and stored at -80°C until cryosectioned at 10μm sections.

[0205] Serum: Serum from patients was collected into gold serum separator tubes and centrifuged for 10 min at 1000g within 1 hour of collection. The supernatant was collected and stored at -80°C until used for experiment.

[0206] Postmortem Brain Tissue: The use of postmortem human samples was deemed exempt by the Committee for the Protection of Human Subjects at the University of Texas Health Science Center at Houston (HSC-MS-22-0982 – UTHealth Neuropathology Core). All participants provided written autopsy consent for the study and subsequent use of the stored samples. Supplementary Table 2 provides the biographical and clinical characteristics of stroke and control cohorts for postmortem brain tissue samples. Postmortem human brains were obtained and fixed in 10% neutral buffered formalin for 2–3 weeks, followed by thorough dissection. The dissected brain regions were dehydrated in a graded ethanol series with increasing concentrations, cleared in xylene, and infiltrated with melted paraffin. The paraffin-embedded brain regions were stored at 4°C until sectioning. Tissue sections were cut at a thickness of 5 μm using a rotary microtome, and a total of three sections were pooled for qPCR analysis. RNA was extracted from FFPE sections following manufacturer’s protocol (RNeasy FFPE Kit for RNA extraction, Qiagen). qPCR was then performed as described below.61 171808680.1

[0207] tMCAO Model: Initially, mice were anesthetized using 4% isoflurane and maintained at 1.5% isoflurane during surgery. A rectal probe was inserted to monitor internal body temperature and a heating pad was placed underneath the mouse to maintain the body temperature at 37°C. 70% ethanol was applied around the neck area to disinfect the skin. A midline neck incision was made, and the neck fat pads were pulled apart. The right common carotid artery (CCA) was dissected and an 8-0 silk suture was used to ligate the artery. The external carotid artery (ECA) was dissected free, ligated using two 8-0 silk sutures, and transected. Small surgical scissors were used to cut the ECA in between the 2 ligatures. An aneurysm clip was used to temporarily occlude the distal ICA. A silicone-coated filament (Doccol Corporation) was inserted into the CCA. The filament was advanced into the ICA to obstruct the origin of the middle cerebral artery, as verified by at least 80% decrease in laser doppler intensity. The mice were kept under anesthesia for a 40-minute occlusion time, after which the filament was removed, and the CCA permanently ligated. The skin was sutured using 5-0 sutures and antibacterial ointment (Vetasan Chlorhexide, Valleyvet) was applied. 1mL of normal saline was administered subcutaneously, and 0.5% lidocaine (analgesic) was injected around the incision site. Finally, the mice were placed in a heated cage for 2 hours and given a diet gel for recovery.1mL of normal saline was administered daily for the following 48 hours. Sham mice underwent the same surgery, however, the filament was inserted and removed immediately before inducing any ischemia. The individual performing tMCAO surgeries was blinded to mouse genotype.

[0208] Skull Bone Transplant: Skull transplant was carried out as previously described51. Mice were anesthetized using 4% isoflurane for induction and 1.5% for maintenance. A rectal probe was inserted to monitor internal body temperature and a heating pad was placed underneath the mouse to maintain body temperature at 37°C. The mouse head was fixed using a stereotactic machine equipped with a mouthpiece that delivers constant oxygen and isoflurane. The mouse head was carefully shaved, then 70% ethanol was applied to disinfect the skin. A midline skin incision was made to expose the skull. Using an electrical microdrill, a piece of the skull centered around the sagittal suture was drilled out. Each flap removed contained portions of the parietal and occipital bones and measured around 4mm in width and 6mm in length. While drilling out the bone the skull was constantly kept wet using a sterile Q-tip and normal saline. The skull flap was then placed in normal saline and incubated at 37°C until the recipient mouse was ready.62 171808680.1

[0209] WT and Mrgprb2- / - recipient mice underwent the same procedure as the donor mice. After the recipient skull flap was removed, making sure to keep the underlying dura intact, the donor graft bone was then placed and sealed off carefully using a tissue adhesive glue. The skin was then sutured using 5-0 sutures. 1 mL of normal saline was administered subcutaneously, and 0.5% lidocaine (analgesic) was injected around the incision site. Finally, the mice were placed in a heating cage for 2 hours and given diet gel for recovery. The mice were observed daily and given intraperitoneal injections of Baytril (2.5mg / kg) daily for 10 days.

[0210] Parabiosis: Mice were first anesthetized with ketamine (100 mg / kg) and xylazine (10 mg / kg) injected intraperitoneally. The right side of one mouse and the left side of the other mouse was shaved, starting 1 cm above the elbow to 1 cm below the knee. The shaved portions of skin were then wiped with alternating betadine and alcohol swabs. Then a longitudinal skin incision was made using surgical scissors on the shaved sides starting 1 cm above the elbow to 1 cm below the knee. Afterwards, the mice were placed adjacent such that the shaved sides were facing towards each other. Using a 5-0 resorbable suture, the mice were sutured together at the elbows (right elbow with left elbow) and the knees (right knee with left knee). Finally, skin in between the elbow and the knee was sutured together. 1 mL of normal saline was administered subcutaneously. Mice were placed in a heated cage and were given diet gel for recovery. Additionally, buprenorphine ER (0.1 mg / kg) was administered subcutaneously to each mouse in the pair every 12 hours for the first 72 hours. Each parabiotic pair was housed in its own cage and monitored daily for signs of distress. After three weeks, tMCAO was induced on the non-GFP mouse in each parabiotic pair. The tMCAO protocol was followed as above, using a split, two- way nose cone to place both of the mice under anesthesia. After surgery, 1mL of normal saline was administered subcutaneously, and 0.5% lidocaine (analgesic) was injected around the incision site. Finally, the mice were placed in a heated cage for 2 hours and given a diet gel for recovery. 1mL of normal saline was administered daily for the following 48 hours, and both mice in each pair were monitored for signs of distress.

[0211] Meningeal Mast Cell Engraftment: Mast cell engraftment into the meninges was performed as previously described20. Briefly, mice were anesthetized using 4% isoflurane for induction and 1.5% for maintenance. A rectal probe was inserted to monitor the internal body temperature. A heating pad placed underneath the mice was used to regulate the body temperature, maintained at 37°C. The mouse head was fixed using a stereotactic machine equipped63 171808680.1with a mouth piece that delivers constant oxygen and isoflurane. The mouse head was carefully shaved, then 70% ethyl alcohol was applied to disinfect the skin. A midline skin incision was made to expose the skull. Using a microdrill, a small hole that can fit a needle was drilled 1mm lateral to the sagittal suture and 1mm behind the coronal suture on the right parietal bone. A 10 μl Hamilton syringe mounted with a 34G blunt needle was filled with 10μL of 750,000 WT or Mrgprb2- / - cultured mast cells in sterile saline. The needle was attached to a microinjector set up at a 1μL / min injection rate. Using the stereotactic machine, the Hamilton needle was placed in the drilled hole at a 2mm depth from the skull surface. Once the injection is done the skin was sutured using 5-0 sutures.1 ml of normal saline was administered subcutaneously. Finally, the mice were placed in a heated cage and given diet gel for recovery.

[0212] Cisterna Magna Injections: For all cisterna magna (ICM) injections, the protocol was performed as previously described77. Briefly, mice were anesthetized using 4% isoflurane for induction and 1.5% for maintenance. The mouse neck was shaved, then wiped with three alternating wipes of betadine and alcohol each. The mouse was placed on an elevated stage, and the head of the mouse was angled downwards at a 45° angle, using the isoflurane nose cone to stabilize the head. The tail of the mouse was taped to the back of the stage. A 32G needle was filled with 10μL of the compound of interest and injected in the gap between the occipital bone and atlas vertebra, until a small pressure was noted, indicating puncture through the atlanto- occipital membrane. The needle was depressed at a rate of 10μL per minute and held within the space for an additional one minute before withdrawal. The mouse was then placed in a heated cage and monitored for signs of distress. The following doses of each substance were given at 6 hours and 24 hours post-MCAO:vehicle (10μL of saline), substance P (10μL of 1 mM stock in saline), anti-CXCL2 antibody (10μL of 0.5mg / mL in saline).

[0213] Behavioral Tests

[0214] Rotarod: For the rotarod test, each mouse was trained for 5 minutes at a constant speed of 4 rpm. This training period was repeated three times per day for three consecutive days before experiment. On experimental days, each mouse underwent three trials. Each trial started at 4 rpm and constantly accelerated to 40 rpm by 5 minutes. The trial ended when the mouse fell off and this time was recorded as the latency to fall (in seconds).64 171808680.1

[0215] Catwalk: The Catwalk system (Noldus) was used for gait analysis. Mice were trained on the Catwalk for two consecutive days before experiment. Training consisted of allowing the mouse to roam freely in the walkway for 5 minutes each day. On experimental days, each mouse was allowed to roam freely in the walkway, and recording was ended when the mouse traversed the length of the walkway three times. After recording, the toe spread of each paw for each mouse was measured using the Noldus software.

[0216] 28-Point Neuroscore: Mouse behavioral sensorimotor function was quantified using the 28-point Neuroscore test as described previously78. Subjects were acclimated to the testing environment, and behavioral deficits were assessed at baseline, 24- and 48-hours post-MCAO. Scoring was averaged between two independent scorers who were blinded to mouse genotype.11 total tests were performed on each day, with a maximum score of 28 points indicating no behavioral deficits. The lowest score for each test was 0 points, with the maximum score ranging between 1-4 depending on the test. For each test, higher scores indicated better performance. Mice that received scores below 7 (indicative of minimal movement and activity) were excluded from experiment.

[0217] The tests were performed as described below: 1) Mouse behavior was observed throughout the test cage and assessed on whether it displayed circling behavior. 2) Motility of each mouse was assessed, with increasing degrees of unsteadiness corresponding to a lower score.3) The general condition of each mouse was inspected for scoring: poor grooming, hunched posture, and weak muscle tone indicated worse condition and corresponded to lower scores.4) The mouse was lifted by the tail and held so that its body would be parallel to the edge of a table. Successful paw placement on the left and right side were assessed. 5) To test for the righting reflex, the mouse was manually positioned in the cage in a supine position on the floor and assessed for its ability to orient upright. 6) The mouse was placed with its forepaws on the wire bar cage top so that it would be allowed to hang. The mouse’s ability to grab onto the cage and raise its hindlimbs was assessed. 7) Grip strength was observed and scored based on the previous set-up in test 6.8) The mouse was positioned to face downward on top of the test cage lid, which was placed at a 45° angle. The mouse lost points if it was unable to rotate to face upward quickly (within 20 seconds).9) The mouse was held by the tail and assessed for the curling reflex, with curling indicating behavioral deficit.10) The mouse was positioned so its head would be just below the edge of the table. Mice received lower scores if they were unable to arch their back and65 171808680.1reach to place both forepaws on the tabletop. 11) The mouse was held by the tail and rotated clockwise and counterclockwise. Mice were given points if they were able to swivel contralaterally to the rotation direction. All behavioral tests were performed by the sameindividual who was blinded to genotype.

[0218] MRI: Mice were anesthetized with 2.5% isoflurane and continually placed at 2% isoflurane for the duration of imaging. Brain MR imaging was performed on a 7T / 30 MRI scanner (Bruker BioSpin, Billerica, MA, USA) using a 72mm Tx volume array and a mouse brain Rx surface coil. Axial T2-weighted TubroRARE MRI sequences covering the whole brain were taken using the following parameters: TE / TR of 27ms / 3000 ms, resolution of 0.1 × 0.1 mm, 15 sections, FOV: 20X20mm; 1mm section thickness, matrix size of 200 × 200, and four averages with rare factor 8 were performed in all mice. The total MR scan time was around 7 minutes per mouse.

[0219] TTC: For chemical stain of stroke infarct, 2% 2,3,5-triphenyltetrazolium (TTC) was dissolved in PBS (2g / 100mL). Mice were perfused and whole brains were extracted and cut into 6 sections with a 2mm thickness. Olfactory bulb and cerebellum were removed from staining. Each 2mm brain section was placed in 1mL of 2% TTC and allowed to stain for 5 minutes protected from light. Each section was then washed with 1mL of PBS and placed on a flat glass surface. The anterior and posterior sides of each section were imaged.

[0220] Stroke Infarct Quantification: For both TTC and MRI images, infarct size was quantified as previously described79. Briefly, for each section, three areas were measured using ImageJ: infarct area, ipsilateral hemisphere area (infarcted + non-infarcted region), and contralateral hemisphere area. Each area was then multiplied by the thickness of the section. For MRI, the section thickness was 1mm. For TTC, the anterior and posterior sides of each section were measured separately and thus the section thickness was also 1mm. To determine an edemaadjusted stroke infarct volume, the following formula was used: ^^^^^^^^^^^^ ^^^^^^^^^^^^ (%) = 100 ∗ ^^^^^^^^^^^^^^^^^^^^^^^^^^ − (^^^^^^^^^^^^^^^^^^^^^^ − ^^^^^^^^^^^^) ^^^^^^^^^^^^^^^^^^^^^^^^^^66 171808680.1

[0221] Midline Shift Quantification: To measure the midline shift, the T2 MRI coronal view of a section where the third ventricle is clearly visible was chosen. Using ImageJ, the width of the brain section was measured using a horizontal line from one edge of the brain to the other, passing through the third ventricle. The width of the stroke hemisphere was also measured using a horizontal line at the same dorsal / ventral position as the original line. The following formula was then used to calculate percent midline shift: ^^ℎ^^^^^^ ^^^^^^^^ ^^^^^^^^^^^^^^ (%) = −1 ∗ 100 ∗ ^^^^^^^^^^^^ ℎ^^^^^^^^^^ℎ^^^^^^ ^^^^^^^^ℎ ^^^^^^^^^^ ^^^^^^^^ℎ

[0222] Osthole Preparation and Administration: A stock solution of osthole (TCI America) was prepared at 125mg / mL in DMSO. For each mouse, a 100mg / kg dose of osthole was given intraperitoneally with the following formulation: 10% DMSO, 10% Tween-80, in normal saline. Mice were injected 6 hours after tMCAO, and 24 hours after tMCAO.

[0223] Cells

[0224] Peritoneal Mast Cell Primary Culture: Adult wild-type and Mrgprb2- / - mice were euthanized through CO2 asphyxiation. Peritoneal mast cells (PMCs) were collected after injecting 10 mL of sterile ice-cold phosphate buffered saline (PBS) into the exposed peritoneal cavity. The mouse’s abdomen was massaged gently for 30 seconds. After massaging, the PBS and peritoneal cells were aspirated out of the abdomen and then centrifuged at 300g for 5 min at room temperature. The cell pellet was resuspended in RPMI 1640 Medium (Gibco) with 10% heatinactivated fetal bovine serum (FBS, Sigma), 100 U / mL penicillin (Gibco), 100 μg / mL streptomycin (Gibco), 30 μg / mL recombinant mouse stem cell factor (Peprotech), and 10 μg / mL recombinant mouse interleukin-3(Peprotech). The cells were transferred into a culture flask to be incubated at 37°C and 5% CO2. On every 3rd day for the next 9 days, suspension cells were removed and replaced by fresh medium to promote the proliferation of PMCs. Mast cells were the remaining suspension cells by day 10 and were ready for experiment afterwards.

[0225] Human LAD2 Mast Cell Culture: LAD2 (Laboratory of Allergic Diseases 2) WT and MRGPRX2- / - male human mast cells were obtained and generated as described previously80. Cells were cultured in StemPro-34 SFM medium (Life Technologies)67 171808680.1supplemented with 2mM L-glutamine, 100 U / mL penicillin (Gibco), 50μg / mL of streptomycin (Gibco), and 100 ng / mL recombinant human stem cell factor (Peprotech). The cell suspensions were seeded at a density of 1 million cells / mL and maintained at 37°C and 5% CO2. Cells are hemi-depleted weekly by removing half of the volume of cells and replenishing with half of fresh media.

[0226] Beta hexosaminidase degranulation assay

[0227] Human LAD2 Cells: 50μL of 5 x 105 cells / mL of WT and MRGPRX2- / - cells were seeded per well in a 96-well round bottom plate.50μL of 2X treatment was then added to the cells, to obtain a final 1X concentration in the well. Substance P was treated using a 100nM final concentration. All serum samples were first cleared by centrifugation and added directly to each well, for a final 1:2 dilution in the well. Cells were treated for 30 minutes then spun down at 300g for 5 min.50μL of supernatant was removed and added to a 96-well assay plate.50μL of cell lysis buffer (0.1% Triton-X in PBS) was then added to the remaining cell and supernatant wells and mixed thoroughly. Once mixed, 50μL of this solution was added to the other half of the 96- well assay plate. 50μL of p-nitrophenyl N-acetyl-β-D-glucosaminide (Sigma-Aldrich) in 0.1 M sodium citrate buffer (pH 4.5) was added to each well for 90 minutes and incubated at 37°C. After incubation, the reaction was stopped by adding 50μL of 0.4M pH 10.7 glycine buffer to each well. The plate was immediately read at absorbance 405nm with 570nm as reference. The percent of beta hexosaminidase released was calculated by the following formula: ^^^^^^^^ ^^^^^^ ^^^^^^^^^^^^^^ (%) = 100 ∗ supernatant absorbance 0.5 ∗ supernatant absorbance + cell absorbance

[0228] Mouse Peritoneal Mast Cells: 50μL of 2 x 106 cells / mL of WT and Mrgprb2- / - cells were seeded per well in a 96-well round bottom plate. For pretreatment with osthole, cells were treated with 25μL of 3X osthole (final concentration in well: 100μM in 0.01% DMSO) for 1 hour at 37°C. Cells were then treated with 25μL of 4X substance P (final concentration of 50μM) for 30 minutes at 37°C. Beta hexosaminidase protocol was followed exactly as above after treatment.68 171808680.1

[0229] Substance P Depletion: To deplete human serum of substance P, anti-rat IgG2a (ThermoFisher Scientific) and rat anti-SP (Millipore Sigma) antibodies were first separately incubated with Protein A / G beads (50μg of antibody in 100μL of Protein A / G slurry) for 2 hours at room temperature on a shaker. Excess antibody was then washed away from the beads with 3, 5-minute washes in 1mL of PBS on the shaker, followed by centrifugation at 3000g for 3 minutes. 50μL of human serum was then incubated with 10μL of IgG-conjugated beads or anti- SPconjugated beads overnight at 4°C on a shaker. The following day, beads were spun down at 3000g for 3 minutes and the supernatant was separated from the bead pellet. This supernatant was then used for degranulation assays with LAD2 mast cells as described above.

[0230] Semaphorin 3a Cleavage Assay: WT LAD2 mast cells and human dermal fibroblasts were lysed with 0.1% Triton-X (without protease inhibitors). Protein was estimated and normalized between both samples. 40μL of each sample was added to 0.75μg of recombinant human semaphorin-Fc in 1.5mL tubes (Sino Biological). A negative control of semaphorin on its own was placed in 40μL of 0.1% Triton-X. For positive control, 0.75μg of recombinant ADAMTS1 (R&D Systems) was placed with 0.75μg of semaphorin in 40μL of 50mM Tris pH 7.4, 10mM CaCl2, 80mM NaCl. All reactions were placed at 37°C overnight. After incubation, 10μL of SDS-loading buffer was added to each sample and boiled at 100°C for 5 minutes before loading for western blot analysis.

[0231] Flow Cytometry

[0232] Brain: Adult mice were anesthetized with 200μL of 20% urethane in saline and perfused with 20 mL of phosphate buffered saline (PBS) (pH 7.4, 4°C). For mice used in IV anti-CD45 intravascular stain experiments, 10uL of anti-CD45 PE was injected retro-orbitally 2 minutes before urethane injection. After perfusion, the brain was dissected, and the right and left hemispheres were divided. Tissues were dounce homogenized in 1 mL of brain digestion buffer (HBSS containing 10% fetal bovine serum, 5mg / mL Collagenase IV, and 30μg / mL DNase I) and brought up to a volume of 4mL with digestion buffer. Samples were digested for 20 min at 37°C in a rotisserie incubator. Following incubation, samples were passed through a 70 μM mesh cell strainer and 5 mL of PBS was added to the suspension and centrifuged at 450g for 5 min at 4°C. The supernatant was discarded, and the pellet was resuspended in 30% Percoll (Sigma-Aldrich) in PBS and spun down at 900g for 35 min at 4°C. The upper layer was gently aspirated and the pellet69 171808680.1was given a final wash in 5 mL of PBS and spun down at 450g for 5 min at 4°C before moving to flow staining.

[0233] Dura: The dura was peeled from the skull and processed by mincing in 1mL of digestion buffer (DMEM containing 2% fetal bovine serum, 1mg / mL Collagenase VIII, and 30μg / mL DNase I). They were then incubated for 20 min at 37°C in a rotisserie incubator and passed through a 70 μM cell strainer. The samples were spun down (300g, 5 min, 4°C) and washed in 1mL of PBS before flow staining.

[0234] Skull Bone Marrow: The skull was minced into small pieces, dounce homogenized with a pestle in 1mL of PBS, and filtered through a 70 μM cell strainer. The cells were centrifuged at 300g for 5 min at 4°C and 1mL of ACK was added to each sample to dissolve red blood cells. After incubation for 5 min at room temperature, the cells were centrifuged (300g, 5 min, 4°C) and resuspended in 5mL of PBS. Cells were centrifuged and resuspended in FACs buffer for flow staining.

[0235] Peritoneal Fluid: The peritoneal fluid was processed by injecting 10 mL of PBS into the exposed peritoneal cavity and aspirating the fluid. The peritoneal fluid was spun down at 300g for 5 min at 4°C and washed in 5mL of PBS before moved to flow staining. Once digested, each sample was resuspended in 1mL of Live / Dead Fixable Aqua Dead Cell Stain Kit (1:1000, Invitrogen). Cells were centrifuged (300g, 5 min, 4°C) and resuspended in Fc Block (1:100; BioLegend) in FACs buffer and incubated at room temperature for 5 minutes. Cells were then stained with the following antibodies for 25 minutes at 4°C protected from light: anti-CD45 APC-Cy7 (1:200, BioLegend), anti-CD117 Brilliant Violet 605 (1:50, BioLegend), anti-FcεRIα Pe / Cy7 (1:50, BioLegend), anti-CD11b Pe / Dazzle594 (1:200; BioLegend), anti-Ly6G Brilliant Violent 421 (1:100, BioLegend), anti-Ly6C APC (1:100, BioLegend). After staining, cells were washed with 1mL of FACs buffer and resuspended in 300μL FACs buffer (containing 50μL of CountBright Absolute Counting beads) before running on the BD FACSCelesta Flow Cytometer. Cell counts were normalized using the absolute bead count collected on the machine and analyzed using FlowJo (TreeStar).

[0236] Protein Quantification by ELISA: Brain tissue was dissected after perfusion, and a midsagittal transection was performed to separate the stroke and contralateral hemispheres. The samples were snap-frozen in liquid nitrogen and homogenized in 500μL of RIPA70 171808680.1lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 0.5% Sodium deoxycholate, and 1% Triton X-100) containing a 1:100 concentration of protease inhibitors (Sigma-Aldrich). The samples were centrifuged at maximum speed for 15 minutes at 4°C, and supernatants were harvested. Total protein concentration was measured using the Pierce BCA Protein Assay (ThermoFisher Scientific). 50μg of lysate was used for each ELISA analysis. Substance P, IL-6, ELA2, CCL2 (MCP-1), and CCL3 (MIP-1a) levels were measured using ELISA DuoSets (R&D Systems) according to the manufacturer’s instruction. For human serum substance P quantification, human serum was diluted 1:2 and assayed using the SP Parameter Assay ELISA Kit (R&D Systems).

[0237] Semaphorin ELISA: Leptomeningeal semaphorin ELISAs were performed as previously described55. Briefly, the mouse brain was dissected and placed in a dish containing ice-cold PBS. The leptomeninges were then extracted from the dorsal hemispheres of the brain using Dumont #5 forceps. Once extracted, the leptomeninges were placed in 50μL of PBS containing protease inhibitors (1:100), then freeze-thawed three times in liquid nitrogen. The suspension was then centrifuged at 14,000g for 10 minutes, and the supernatant was collected for assay. Protein concentration was determined by BCA assay and 10μg of each sample was loaded into the ELISA plate. The ELISA was carried out by manufacturer’s instructions.

[0238] Western Blot: For western blot analysis, tissues were dounce homogenized with RIPA lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 0.5% Sodium deoxycholate, and 1% Triton X-100) containing a 1:100 concentration of protease inhibitors (Sigma-Aldrich). Lysates were then allowed to shake at 4°C for 20 min, then pulse-sonicated and centrifuged at 16,000g for 15 min at 4°C. Protein concentration was measured using the BCA assay (ThermoFisher Scientific). Western samples were made using 15 μg of lysate, 6.25 μl 4x LDS sample buffer (Invitrogen), 1 μl Dithiothreitol (DTT), and Phosphate-buffered saline (PBS) to a total volume of 25uL. Samples were then heated at 100°C for 5 min, then centrifuged briefly. Western samples were run on a 4-12% polyacrylamide Bis-Tris gradient gel in 1x running buffer (Invitrogen) and then transferred to a PVDF membrane. Membranes were blocked with 5% milk in TBS-T (pH 7.6 solution of 16 mM Tris-HCl, 140 mM NaCl, 0.1% Tween-20) and incubated with primary antibodies in 3% bovine serum albumin (BSA) in TBST overnight at 4°C. Following incubation in primary antibody, membranes were washed with TBS-T, then incubated with secondary antibodies (1:10,000) in 3% BSA in TBS-T for 2 h at room temperature. The following primary71 171808680.1antibodies were used: anti-GFAP (1:1,000; Abcam), anti-ACTB HRP conjugated (1:10,000; Santa Cruz Biotechnology), and anti-4HNE (1:1,000; Abcam).

[0239] RNA isolation and quantification: Meningeal tissue was carefully harvested from WT and Mrgprb2- / - adult mice. Total RNA for the meningeal samples was extracted using the RNeasyR Plus Micro Kit (Qiagen), according to the manufacturer’s instructions. Tissue lysate was sonicated with 3, 10-second pulses right after addition of RNA extraction buffer. RNA was quantified using NanoDrop. Reverse transcription was performed using the iScript cDNA synthesis kit and following the manufacturer’s suggestions. Finally, qPCR was performed using TaqMan™ Fast Advanced Master Mix (Applied Biosystems) and run in triplicate on a StepOnePlus Real-Time PCR System (Applied Biosciences) and analyzed by StepOne Software v2.2.2. Gene expression was normalized using a Mrgprb2 probe that recognizes both WT and mutant Mrgprb2 and calculated with 2-Δnormalized Ct. Actin could not be used as a loading control since there are differences in total cell count due to inflammation, however since mast cell counts do not change, Mrgprb2 was used as a normalization control. It is important to note that the Mrgprb2 mRNA probe binds in a region distant from the Mrgprb2 mutation that causes lack of translation of Mrgprb2 in the Mrgprb2- / - mice. Thus, this probe can determine general transcription of Mrgprb2, even though it is not translated in the Mrgprb2- / - mice.

[0240] Immunofluorescence

[0241] Mouse Brain: Adult mice were anesthetized with 200μL of 20% urethane in saline and perfused with 20 mL of phosphate buffered saline (PBS), followed by 20mL of 4% paraformaldehyde (PFA). After perfusion, the brain was dissected and post-fixed in 4% paraformaldehyde (PFA) at 4°C overnight, followed by overnight incubation in 30% sucrose at 4°C. After removal of sucrose the brain was then stored in optimal cutting temperature compound (OCT) at -80°C until sectioned with a cryostat at 20uM sections onto slides. Sections were washed with PBS to remove any remaining OCT, then placed in blocking solution (10% normal goat serum in PBS, 0.2% Triton-X) for 1 h at room temperature. Sections were then incubated in antibody overnight in blocking solution at 4°C as follows: anti-GFAP (1:1000; Abcam), anti-CD45 (1:100; BioLegend), anti-Ly6G (1:200; BioLegend), anti-GFP (1:100; Aves Labs). Sections were then washed with PBS (3 washes, 5 min each) and incubated in secondary antibody in blocking solution at room temperature for 2h. All secondary antibodies (Life Technologies) were diluted 1:500,72 171808680.1except for anti-chicken 488 which was diluted at 1:1000. Slides were then washed with PBS (5 washes, 5 min each), mounted with Fluoromount-G with DAPI (Invitrogen), and imaged using the Zeiss LSM700 Confocal microscope.

[0242] Mouse Whole Mount Dura: Adult mice were anesthetized with 200μL of 20% urethane in saline and perfused with 20 mL of phosphate buffered saline (PBS) (pH 7.4, 4°C). After perfusion, the skull cap with dura mater is dissected and postfixed in 4% paraformaldehyde (PFA) at 4°C. After 1 hour, the dura was then carefully peeled back from the skull cap in a PBS solution and transferred gently to a slide, ready for staining. Whole mounts were washed with PBS, then permeabilized with 0.5% Triton-X in PBS for 45 min at room temperature. Tissue was then blocked in blocking solution (10% normal goat serum in PBS, 0.2% Triton-X) for 1 h at room temperature, before primary antibody incubation in blocking solution overnight at 4°C as follows: anti-Ly6G (BioLegend; 1:200), anti-CD31 (1:100; BD Pharmingen). Tissues are then washed with PBS (3 washes, 5 min each) and incubated in secondary antibody in blocking solution at room temperature for 2 h. All secondary antibodies are diluted 1:500. Avidin stain is also performed during secondary antibody incubation in blocking buffer for 2 h at room temperature (Avidin- FITC, Invitrogen / Avidin-Sulforhodamine, Abcam ; 1:500). Slides were then washed with PBS (5 washes, 5 min each), mounted with Fluoromount-G with DAPI (Invitrogen),and imaged using the Zeiss LSM700 Confocal microscope.

[0243] Human Dura: Human dura was obtained and placed in 4% PFA overnight at 4°C. Dura was then transferred to 30% sucrose for overnight incubation at 4°C. After removal from sucrose, dura was stored in optimal cutting temperature compound (OCT) at -80°C until sectioned with a cryostat at 10μM sections onto slides. Slides were washed with PBS to remove excess OCT and then placed in blocking solution (10% normal goat serum, 0.3% Triton-X) for 1h at room temperature. If slides were also receiving Avidin stain, they were first placed in Avidin (1:500) in blocking solution for 2h at room temperature. Slides were then washed with PBS (3 washes, 5 min each), before incubation in primary antibody in blocking solution overnight at 4°C as follows: anti-MRGPRX2 (1:200; BioLegend), anti-tryptase (1:500; Santa Cruz Biotechnology). Slides were then washed with PBS (3 washes, 5 min each), before incubation in secondary antibody solution as described above for 2h at room temperature. Slides were then washed (5 washed, 5 min each), mounted with Fluoromount-G with DAPI (Invitrogen), and imaged using the73 171808680.1Zeiss LSM700 Confocal microscope. MRGPRX2 antibody validated on human WT and MRGPRX2- / - cultured mast cells.

[0244] Mouse Meningeal Neutrophil Quantification: Neutrophil count in the meninges is calculated by dividing the meninges from anterior to posterior into three equally portioned sections, excluding the cerebellar meninges. Within each hemisphere (right and left), one image is taken per section, and the neutrophils in each image are manually counted. The representative neutrophil count per hemisphere is determined by summing the three sections. These counts were done by two individuals blinded to genotype and counts are reported as an average of the two measurements.

[0245] Mouse Meningeal Mast Cell Degranulation Quantification: Several confocal images (between 3-7) are taken across each whole mount dura sample per mouse. The total number of mast cells across all images is counted and the number of mast cells that are degranulated across all images is counted. These numbers are then summed across all images of one sample and the percent of total mast cells that are degranulated is determined. These counts were done by two individuals blinded to genotype and counts are reported as an average of the two measurements.

[0246] Fluorescence-activated cell sorting (FACS) of tdT Mast Cells: Mrgprb2- Cre;tdT mice were used for mast cell sorting experiments. Single-cell suspensions from meninges and peritoneal fluid were isolated as described above. Skin samples were digested using 3mL RPMI containing 100 μg / mL DNase I and 1.67 Wunsch units / mL Liberase TL (Roche) for one hour at 37°C in a rotisserie incubator. Skin samples were then passed through a 70 μm cell strainer and washed with 5mL of PBS to obtain a single-cell suspension. ACK Lysing Buffer (Quality Biological) was added to all samples (meninges, peritoneal fluid, and skin) to lyse all red blood cells and washed in PBS afterward to remove the ACK. Samples were then centrifuged (300g, 5 min, 4°C) and resuspended in Fc Block (1:100; BioLegend) in FACs buffer and incubated at room temperature for 5 minutes. Cells were then stained with the following antibodies for 25 minutes at 4°C protected from light: anti-CD45 APC-Cy7 (1:200, BioLegend), anti-CD117 Brilliant Violet 605 (1:50, BioLegend), and anti-FcεRIα Pe / Cy7 (1:50, BioLegend). After staining, cells were washed with 1mL of FACs buffer and resuspended in 300μL FACs buffer. Dead cells were stained with Sytox Blue (1:1000) immediately before sorting. Sorting was performed on the SONY74 171808680.1MA900 cell sorter (Sony Biotechnology) with a 100μm chip. Mrgprb2 mast cells were gated as CD45+tdT+CD117+FcεRI+ cells. Cells were sorted into RNA lysis buffer from the SMARTSeq v4 Ultra Low Input RNA kit (Takara Bio).

[0247] RNA Sequencing and Bioinformatics Analysis: RNA from sorted mast cells was extracted after cells were lysed in lysis buffer. cDNA was synthesized and libraries were prepared using the Takara V4 SMART-Seq Plus Kit and sequenced on NovaSeq 6000 using the SP100 flow cell for 2X50 paired end reads. Transcriptomic data collected by RNA sequencing was analyzed to determine the genes that are present in each sample and condition, their expression levels, and the differences between expression levels among different tissues. Following quality checking with the software Fastqc, reads were mapped to the mouse genome version GRCm39 with the spliced alignment tool STAR v.2.7.8a81, which allows for large ‘gaps’ in the alignment, representing introns. The aligned reads were assembled with PsiCLASS82 using the GENCODE v.M28 reference annotations for gene assignment, to create a unified set of gene annotations for differential analyses. Lastly, DESeq283 was used to quantify gene expression levels and determine differentially expressed genes.

[0248] Statistical Analysis: Statistical analyses were performed using GraphPad Prism v.10.0.2. Statistical comparisons were conducted by two-tailed, unpaired Student’s t-test, or two-way ANOVA with Sidak’s multiple comparison test or Tukey’s multiple comparison test, unless otherwise noted. For all bar charts, bars depict the mean. For all violin plots, bold lines depict the mean. All error bars represent SEM and n represents the number of mice analyzed.

[0249] REFERENCES 1. Tsao, C. W. et al. Heart Disease and Stroke Statistics—2023 Update: A Report From the American Heart Association. Circulation 147, e93–e621 (2023). 2. Buscemi, L., Price, M., Bezzi, P. & Hirt, L. Spatio-temporal overview of neuroinflammation in an experimental mouse stroke model. Sci Rep-uk 9, 507 (2019). 3. Akopov, S. E., Simonian, N. A. & Grigorian, G. S. Dynamics of Polymorphonuclear Leukocyte Accumulation in Acute Cerebral Infarction and Their Correlation With Brain Tissue Damage. Stroke 27, 1739–1743 (1996). 4. McNeil, B. D. et al. Identification of a mast-cell-specific receptor crucial for pseudo-allergic drug reactions. Nature 519, 237–241 (2015).75 171808680.15. Rustenhoven, J. et al. Functional characterization of the dural sinuses as a neuroimmune interface. Cell 184,1000-1016.e27 (2021). 6. Lima, K. A. de, Rustenhoven, J. & Kipnis, J. Meningeal Immunity and Its Function in Maintenance of the Central Nervous System in Health and Disease. Annu. Rev. Immunol.38, 597–620 (2020). 7. Buck, B. H. et al. Early Neutrophilia Is Associated With Volume of Ischemic Tissue in Acute Stroke. Stroke 39, 355–360 (2008). 8. Su, J.-A., Chou, S.-Y., Tsai, C.-S. & Hung, T.-H. Cytokine changes in the pathophysiology of poststroke depression. Gen. Hosp. Psychiatry 34, 35–39 (2012). 9. Kim, J. et al. Different prognostic value of white blood cell subtypes in patients with acute cerebral infarction. Atherosclerosis 222, 464–467 (2012). 10. Kumar, A. D. et al. Leukocytosis in Patients with Neurologic Deterioration after Acute Ischemic Stroke is Associated with Poor Outcomes. J. Stroke Cerebrovasc. Dis.22, e111–e117 (2013). 11. Dong, R., Huang, R., Wang, J., Liu, H. & Xu, Z. Effects of Microglial Activation and Polarization on Brain Injury After Stroke. Front. Neurol.12, 620948 (2021). 12. Yu, C. et al. A longitudinal diffusion tensor imaging study on Wallerian degeneration of corticospinal tract after motor pathway stroke. NeuroImage 47, 451–458 (2009). 13. Johnson, V. E. et al. Inflammation and white matter degeneration persist for years after a single traumatic brain injury. Brain 136, 28–42 (2013). 14. Ousman, S. S. & Kubes, P. Immune surveillance in the central nervous system. Nat. Neurosci.15, 1096–1101 (2012). 15. Louveau, A. et al. Structural and functional features of central nervous system lymphatic vessels. Nature 523, 337–341 (2015). 16. Louveau, A. et al. CNS lymphatic drainage and neuroinflammation are regulated by meningeal lymphatic vasculature. Nat Neurosci 21, 1380–1391 (2018). 17. Beuker, C. et al. Stroke induces disease-specific myeloid cells in the brain parenchyma and pia. Nat. Commun.13, 945 (2022). 18. Mattila, O. S. et al. Cerebral Mast Cells Mediate Blood-Brain Barrier Disruption in Acute Experimental Ischemic Stroke Through Perivascular Gelatinase Activation. Stroke 42, 3600– 3605 (2011).76 171808680.119. Jin, Y., Silverman, A. J. & Vannucci, S. J. Mast Cells Are Early Responders After Hypoxia- Ischemia in Immature Rat Brain. Stroke 40, 3107–3112 (2009). 20. Arac, A. et al. Evidence that Meningeal Mast Cells Can Worsen Stroke Pathology in Mice. Am J Pathology 184, 2493–2504 (2014). 21. Amin, K. The role of mast cells in allergic inflammation. Resp Med 106, 9–14 (2012). 22. Kempuraj, D. et al. Mast Cell Activation in Brain Injury, Stress, and Post-traumatic Stress Disorder and Alzheimer’s Disease Pathogenesis. Front. Neurosci.11, 703 (2017). 23. Meixiong, J. et al. Activation of Mast-Cell-Expressed Mas-Related G-Protein-Coupled Receptors Drives Nonhistaminergic Itch. Immunity 50, 1163-1171.e5 (2019). 24. Green, D. P., Limjunyawong, N., Gour, N., Pundir, P. & Dong, X. A Mast-Cell-Specific Receptor Mediates Neurogenic Inflammation and Pain. Neuron 101, 412-420.e3 (2019). 25. Pundir, P. et al. A Connective Tissue Mast-Cell-Specific Receptor Detects Bacterial Quorum-Sensing Molecules and Mediates Antibacterial Immunity. Cell Host Microbe 26, 114- 122.e8 (2019). 26. Kamohara, M. et al. Identification of MrgX2 as a human G-protein-coupled receptor for proadrenomedullin Nterminal peptides. Biochem. Biophys. Res. Commun.330, 1146–1152 (2005). 27. Kothari, R. & Dong, X. Scratching the surface of itch receptors. Trends Pharmacol. Sci.43, 168–170 (2022). 28. Roy, S., Ayudhya, C. C. N., Thapaliya, M., Deepak, V. & Ali, H. Multifaceted MRGPRX2: New insight into the role of mast cells in health and disease. J. Allergy Clin. Immunol.148, 293– 308 (2021). 29. Fluri, F., Schuhmann, M. K. & Kleinschnitz, C. Animal models of ischemic stroke and their application in clinical research. Drug Des., Dev. Ther.9, 3445–3454 (2015). 30. Chiang, T., Messing, R. O. & Chou, W.-H. Mouse Model of Middle Cerebral Artery Occlusion. J Vis Exp Jove 2761 (2011) doi:10.3791 / 2761. 31. Encarnacion, A. et al. Long-term behavioral assessment of function in an experimental model for ischemic stroke. J. Neurosci. Methods 196, 247–257 (2011). 32. Sbei, S., Moncrief, T., Limjunyawong, N., Zeng, Y. & Green, D. P. PACAP activates MRGPRX2 on meningeal mast cells to drive migraine-like pain. Sci. Rep.13, 12302 (2023).77 171808680.133. Tauber, M. et al. Landscape of mast cell populations across organs in mice and humans. J. Exp. Med.220, e20230570 (2023). 34. Dwyer, D. F. et al. Expression profiling of constitutive mast cells reveals a unique identity within the immune system. Nat Immunol 17, 878–887 (2016). 35. Yao, Z. et al. A high-resolution transcriptomic and spatial atlas of cell types in the whole mouse brain. bioRxiv 2023.03.06.531121 (2023) doi:10.1101 / 2023.03.06.531121. 36. Langlieb, J. et al. The cell type composition of the adult mouse brain revealed by single cell and spatial genomics. bioRxiv 2023.03.06.531307 (2023) doi:10.1101 / 2023.03.06.531307. 37. Garcia-Bonilla, L. et al. Analysis of brain and blood single-cell transcriptomics in acute and subacute phases after experimental stroke. Nat. Immunol.25, 357–370 (2024). 38. Mukai, K., Tsai, M., Saito, H. & Galli, S. J. Mast cells as sources of cytokines, chemokines, and growth factors. Immunol Rev 282, 121–150 (2018). 39. Brouns, R. et al. Neurobiochemical Markers of Brain Damage in Cerebrospinal Fluid of Acute Ischemic Stroke Patients. Clin. Chem.56, 451–458 (2010). 40. McCracken, E. et al. The Lipid Peroxidation By-product 4-Hydroxynonenal Is Toxic to Axons and Oligodendrocytes. J. Cereb. Blood Flow Metab.20, 1529–1536 (2000). 41. Matsuda, S., Umeda, M., Uchida, H., Kato, H. & Araki, T. Alterations of oxidative stress markers and apoptosis markers in the striatum after transient focal cerebral ischemia in rats. J. Neural Transm.116, 395–404 (2009). 42. Tian, D.-S. et al. Chemokine CCL2–CCR2 Signaling Induces Neuronal Cell Death via STAT3 Activation and IL-1β Production after Status Epilepticus. J. Neurosci.37, 7878–7892 (2017). 43. Geng, H., Chen, L., Tang, J., Chen, Y. & Wang, L. The Role of CCL2 / CCR2 Axis in Cerebral Ischemia-Reperfusion Injury and Treatment: From Animal Experiments to Clinical Trials. Int. J. Mol. Sci.23, 3485 (2022). 44. Wolinski, P. & Glabinski, A. Chemokines and Neurodegeneration in the Early Stage of Experimental Ischemic Stroke. Mediat. Inflamm.2013, 727189 (2013). 45. Zhu, H. et al. Interleukins and Ischemic Stroke. Front. Immunol.13, 828447 (2022). 46. Shaafi, S. et al. Interleukin-6, a reliable prognostic factor for ischemic stroke. Iran. J. Neurol. 13, 70–6 (2013).78 171808680.147. Aref, H. M. A. et al. Role of interleukin-6 in ischemic stroke outcome. Egypt. J. Neurol., Psychiatry Neurosurg.56, 12 (2020). 48. Jickling, G. C. et al. Targeting Neutrophils in Ischemic Stroke: Translational Insights from Experimental Studies. J. Cereb. Blood Flow Metab.35, 888–901 (2015). 49. Ikegame, Y. et al. Neutrophil elastase inhibitor prevents ischemic brain damage via reduction of vasogenic edema. Hypertens. Res.33, 703–707 (2010). 50. Filippo, K. D. et al. Mast cell and macrophage chemokines CXCL1 / CXCL2 control the early stage of neutrophil recruitment during tissue inflammation. Blood 121, 4930–4937 (2013). 51. Cugurra, A. et al. Skull and vertebral bone marrow are myeloid cell reservoirs for the meninges and CNS parenchyma. Science 373, (2021). 52. Herisson, F. et al. Direct vascular channels connect skull bone marrow and the brain surface enabling myeloid cell migration. Nat. Neurosci.21, 1209–1217 (2018). 53. Kolabas, Z. I. et al. Distinct molecular profiles of skull bone marrow in health and neurological disorders. Cell 186, 3706-3725.e29 (2023). 54. Mazzitelli, J. A. et al. Cerebrospinal fluid regulates skull bone marrow niches via direct access through dural channels. Nat. Neurosci.25, 555–560 (2022). 55. Smyth, L. C. D. et al. Identification of direct connections between the dura and the brain. Nature 1–9 (2024) doi:10.1038 / s41586-023-06993-7. 56. Esselens, C. et al. The Cleavage of Semaphorin 3C Induced by ADAMTS1 Promotes Cell Migration*. J. Biol. Chem.285, 2463–2473 (2010). 57. Tellman, T. V., Cruz, L. A., Grindel, B. J. & Farach-Carson, M. C. Cleavage of the Perlecan- Semaphorin 3APlexin A1-Neuropilin-1 (PSPN) Complex by Matrix Metalloproteinase 7 / Matrilysin Triggers Prostate Cancer Cell Dyscohesion and Migration. Int. J. Mol. Sci.22, 3218 (2021). 58. Adams, R. H., Lohrum, M., Klostermann, A., Betz, H. & Puschel, A. W. The chemorepulsive activity of secreted semaphorins is regulated by furin‐dependent proteolytic processing. EMBO J.16, 6077–6086 (1997). 59. Turner, R. J., Helps, S. C., Thornton, E. & Vink, R. A substance P antagonist improves outcome when administered 4 h after onset of ischaemic stroke. Brain Res 1393, 84–90 (2011). 60. Turner, R. J. & Vink, R. The Role of Substance P in Ischaemic Brain Injury. Brain Sci 3, 123–142 (2013).79 171808680.161. Vink, R., Gabrielian, L. & Thornton, E. The Role of Substance P in Secondary Pathophysiology after Traumatic Brain Injury. Front. Neurol.8, 304 (2017). 62. Lorente, L. et al. Serum Levels of Substance P and Mortality in Patients with a Severe Acute Ischemic Stroke. Int J Mol Sci 17, 991 (2016). 63. Lorente, L. et al. High serum substance P levels and mortality after malignant middle cerebral artery infarction.J. Crit. Care 57, 1–4 (2020). 64. Lorente, L. et al. Serum substance P levels are associated with severity and mortality in patients with severe traumatic brain injury. Crit. Care 19, 192 (2015). 65. Callahan, B. N. et al. Osthole, a Natural Plant Derivative Inhibits MRGPRX2 Induced Mast Cell Responses. Front. Immunol.11, 703 (2020). 66. Koh, B. I. et al. Adult skull bone marrow is an expanding and resilient haematopoietic reservoir. Nature 1–10 (2024) doi:10.1038 / s41586-024-08163-9. 67. Conesa, M. P. B. et al. Stabilizing histamine release in gut mast cells mitigates peripheral and central inflammation after stroke. J. Neuroinflammation 20, 230 (2023). 68. Strbian, D., Karjalainen-Lindsberg, M.-L., Kovanen, P. T., Tatlisumak, T. & Lindsberg, P. J. Mast Cell Stabilization Reduces Hemorrhage Formation and Mortality After Administration of Thrombolytics in Experimental Ischemic Stroke. Circulation 116, 411–418 (2007). 69. Furukawa, H. et al. Mast Cell Promotes the Development of Intracranial Aneurysm Rupture. Stroke 51, 3332–3339 (2020). 70. Biran, V. et al. Stroke Induces Histamine Accumulation and Mast Cell Degranulation in the Neonatal Rat Brain: Stroke Induces Histamine Accumulation and Mast Cell Degranulation. Brain Pathol 18, 1–9 (2007). 71. Blasco, M. P. et al. Age-dependent involvement of gut mast cells and histamine in post- stroke inflammation. J Neuroinflamm 17, 160 (2020). 72. Rehni, A. K., Bhateja, P., Singh, N. & Jaggi, A. S. Implication of mast cell degranulation in ischemic preconditioning‐induced prevention of cerebral injury. Fundam. Clin. Pharmacol.22, 179–188 (2008). 73. Strbian, D., Karjalainen-Lindsberg, M.-L., Tatlisumak, T. & Lindsberg, P. J. Cerebral Mast Cells Regulate Early Ischemic Brain Swelling and Neutrophil Accumulation. J Cereb Blood Flow Metabolism 26, 605–612 (2005).80 171808680.174. Tadeo, C. S., Incorvaia, B., Russo, R. & Lauretis, L. D. Adjuvant Effect of Leuprolide on Stroke: A Case report. Eur. J. Case Rep. Intern. Med.1, (2014). 75. Meng, F. et al. Stroke related to androgen deprivation therapy for prostate cancer: a meta- analysis and systematic review. BMC Cancer 16, 180 (2016). 76. Chamorro, A. et al. The Early Systemic Prophylaxis of Infection After Stroke Study. Stroke 36, 1495–1500 (2005). 77. Erlebach, E. et al. Measurement of cerebral oxygen pressure in living mice by two-photon phosphorescence lifetime microscopy. STAR Protoc.3, 101370 (2022). 78. Lenzlinger, P. M. et al. Inhibition of vascular endothelial growth factor receptor (VEGFR) signaling by BSF476921 attenuates regional cerebral edema following traumatic brain injury in rats. Restor. Neurol. Neurosci.22, 73–9 (2004). 79. Gerriets, T. et al. Noninvasive Quantification of Brain Edema and the Space-Occupying Effect in Rat Stroke Models Using Magnetic Resonance Imaging. Stroke: J. Am. Hear. Assoc. 35, 566–571 (2004). 80. Shtessel, M. et al. MRGPRX2 Activation Causes Increased Skin Reactivity in Patients with Chronic Spontaneous Urticaria. J. Investig. Dermatol.141, 678-681.e2 (2021). 81. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013). 82. Song, L., Sabunciyan, S., Yang, G. & Florea, L. A multi-sample approach increases the accuracy of transcript assembly. Nat. Commun.10, 5000 (2019). 83. Anders, S. & Huber, W. Differential expression analysis for sequence count data. Genome Biol.11, R106 (2010).81 171808680.1OTHER EMBODIMENTS From the foregoing description, it will be apparent that variations and modifications may be made to the disclosure described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims. All citations to sequences, patents and publications in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference. By their citation of various references in this document, Applicants do not admit any particular reference is “prior art” to their disclosure.82 171808680.1

Claims

What is claimed:

1. A method of treating ischemic stroke injury in a subject in need thereof, the method comprising: administering an effective amount of one or more MRGPRX2 antagonists to the subject, thereby treating the ischemic stroke injury.

2. The method of claim 1, wherein the MRGPRX2 antagonist comprises an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents or any combination thereof.

3. The method of claim 1 or 2, wherein the MRGPRX2 antagonist comprises a small molecule.

4. The method of any one of claims 1 to 3, wherein the MRGPRX2 antagonist comprises an antibody or antibody fragment.

5. The method of any one of claims 1 to 4, wherein the MRGPRX2 antagonist is a peptide.

6. The method of any one of claims 1 to 5, wherein the MRGPRX2 antagonist comprises Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2- Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7 xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262, MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof.

7. The method of any one of claims 1 through 6, wherein the subject is identified as suffering from an ischemic stroke injury and the MRGPRX2 antagonist is administered to the identified subject.

8. The method of any one of claims 1 through 7, further comprising administering to the subject antagonists of substance P, antagonists of CCL2, antagonists of CCL3, antagonists of83 171808680.1neutrophil elastase, antagonists of interleukin 1 beta (IL-1β), antagonists of interleukin 6 (IL-6), antagonists of interleukin 17 (IL-17), tryptase, tumor necrosis factor alpha (TNFα), anti- inflammatory agents or combinations thereof.

9. The method of any one of claims 1 through 8, wherein the MRGPRX2 antagonist is administered to the subject during or post ischemic injury.

10. The method of any one of claims 1 through 9, wherein the MRGPRX2 antagonist is administered orally, intra muscularly or systemically.

11. A method of treating a neuroinflammatory disease in a subject in need thereof, comprising: administering an effective amount of one or more MRGPRX2 antagonists to the subject, thereby treating the neuroinflammatory disease.

12. The method of claim 11, wherein the one or more MRGPRX2 antagonists comprise an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents or any combination thereof.

13. The method of claim 11 or 12, wherein the one or more MRGPRX2 antagonists comprise a small molecule.

14. The method of any one of claims 11 to 13, wherein the one or more MRGPRX2 antagonists comprise an antibody or antibody fragment.

15. The method of claim 11 or 12, wherein the one or more MRGPRX2 antagonists is a peptide.

16. The method of any one of claims 11 to 15, wherein the one or more MRGPRX2 antagonists comprise Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2- Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262, MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof.84 171808680.

117. The method of any one of claims 11 to 16, wherein the subject is identified as suffering from a neuroinflammatory disease and the one or more MRGPRX2 antagonists is administered to the identified subject.

18. The method of any one of claims 11 through 17, further comprising administering to the subject antagonists of substance P, antagonists of CCL2, antagonists of CCL3, antagonists of neutrophil elastase, antagonists of interleukin 1 beta (IL-1β), antagonists of interleukin 6 (IL-6), antagonists of interleukin-8 (IL-8), antagonists of interleukin 17 (IL-17), tryptase, tumor necrosis factor alpha (TNFα), anti-inflammatory agents or combinations thereof.

19. The method of any one of claims 11 through 18, wherein one or more MRGPRX2 antagonists are administered to the subject diagnosed with a neuroinflammatory disease, orally, intra muscularly or systemically.

20. The method of any one of claims 11 to 19, wherein a neuroinflammatory disease comprises Alzheimer's disease (AD), Parkinson's disease (PD), neuromyelitis optica (NMO), transverse myelitis, optic neuritis, acute disseminated encephalomyelitis (ADEM), primary angiitis of the central nervous system, Susac's syndrome, Acute Disseminated Encephalomyelitis, Acute Hemorrhagic Leukoencephalomyelitis, Central nervous system (CNS) vasculitis, transverse myelitis or stroke.

21. A method for treating a subject suffering from or susceptible to nerve cell death, comprising: administering an effective amount of one or more MRGPRX2 antagonists to the subject, thereby treating consequences of nerve cell death.

22. A method for treating a subject suffering from or susceptible to a neurodegenerative disease, comprising: administering an effective amount of one or more MRGPRX2 antagonists to the subject, thereby treating the neurodegenerative disease thereof.

23. The method of claim 22 wherein the neurodegenerative disease is Parkinson's disease, Huntington's disease, Amyotrophic Lateral Sclerosis, Alzheimer's disease, Down's Syndrome or Korsakoff's disease.85 171808680.

124. Parkinson's disease, Huntington's disease, Amyotrophic Lateral Sclerosis, Alzheimer's disease, Down's Syndrome and Korsakoff's disease.

25. The method of any one of claims 21 to 24, wherein the one or more MRGPRX2 antagonists comprise an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents or any combination thereof.

26. The method of any one of claims 21 to 25, wherein the one or more MRGPRX2 antagonists comprise a small molecule.

27. The method of any one of claims 21 to 26, wherein the one or more MRGPRX2 antagonists comprise an antibody or antibody fragment.

28. The method of any one of claims 21 to 27, wherein the one or more MRGPRX2 antagonists comprise a peptide.

29. The method of any one of claims 21 to 29 wherein the one or more MRGPRX2 antagonists comprise Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2- Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262, MrgprX2 antagonist-1; MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof.

30. A method for screening for drug agents that modulate one or more MRGPRX2 receptors comprising: contacting one or more cells expressing an MRGPRX2 G protein coupled receptor with a candidate drug agent; and detecting a response of the one or more cells to thereby select the candidate drug agent.

31. The method of claim 29, wherein a response of the cells is detected as activation of the G protein coupled receptor.86 171808680.

132. The method of any one of claims 30 or 31, wherein the detected response is an increase in intracellular calcium or activation also can be assessed by inositol phosphate detection.

33. The method of any one of claims 30 through 32, wherein the cells comprise cells of the central nervous system (CNS), neuronal cells, brain cells, skull bone marrow cells, xenogeneic cells, cell lines or combinations thereof.

34. A pharmaceutical composition for the treatment of a neuroinflammatory disease, the composition comprising an effective amount of an MRGPRX2 antagonist.

35. The pharmaceutical composition of claim 34, wherein the MRGPRX2 antagonist comprises an antibody or fragment thereof, a binding protein, a polypeptide, a nucleic acid, antisense reagents, siRNA reagents, gene editing agents or any combination thereof.

36. The pharmaceutical composition of claim 34, wherein the MRGPRX2 antagonist comprises a small molecule.

37. The pharmaceutical composition of claim 34, wherein the MRGPRX2 antagonist comprises an antibody or antibody fragment.

38. The pharmaceutical composition of claim 34, wherein the MRGPRX2 the antagonist is a peptide.

39. The pharmaceutical composition of claim 34, wherein the MRGPRX2 antagonist comprises Osthole (C15H16O3), licochalcone A (C21H22O4), dexamethasone, lactic acid, ceramide, sphingomyelin, Sugammadex (C72H104Na8O48S8), QWF (C38H43N5O8), Compound 1, 2 (1,2- Butadiene), Piperine (C17H19NO3), Isoliquiritigenin (C15H12O4), Shikonin (C16H16O5), Imperatorin (C16H14O4), Paeoniflorin (C23H28O11), Quercetin (C15H10O7 xH2O), Genistein (C15H10O5), aptamer-X35, Resveratrol (C14H12O3), EP262, MrgprX2 antagonist-1 (C15H15F5N4O2S); MrgprX2 antagonist-2; MrgprX2 antagonist-3; (R)- MrgprX2 antagonist-3 (compound E118); MrgprX2 antagonist-4; MrgprX2 antagonist-5, MrgprX2 antagonist-6, and MrgprX2 antagonist-7, MrgprX2 antagonist-7 and / or ZINC4953434, or combinations thereof.

40. The pharmaceutical composition of claim 34, wherein the neuroinflammatory disease comprises Alzheimer's disease (AD), Parkinson's disease (PD), multiple sclerosis, neuromyelitis87 171808680.1optica (NMO), transverse myelitis, optic neuritis, acute disseminated encephalomyelitis (ADEM), primary angiitis of the central nervous system, Susac's syndrome, Acute Disseminated Encephalomyelitis, Acute Hemorrhagic Leukoencephalomyelitis, Central nervous system (CNS) vasculitis, transverse myelitis or stroke.

41. The method of any one of clams 1 to 29 wherein the subject: i) is not suffering from and / or has not been identified as suffering from or susceptible to itch; ii) is not suffering from and / or has not been identified as suffering from or susceptible to an inflammatory condition, including an inflammatory condition relating to a subject’s skin; iii) the subject is not suffering from and / or has not been identified as suffering from cancer; iv) the subject is not suffering from and / or has not been identified as suffering or needing treatment for relief from pain; v) the subject is not suffering from and / or has not been identified as suffering from an allergic condition; vi) the subject is not suffering from and / or has not been identified as suffering from a pseudo-allergic condition; vii) the subject is not suffering from and / or has not been identified as suffering from an inflammatory disorder or disease; and / or viii) the subject is not suffering from and / or has not been identified as suffering from an autoimmune disorder or disease.

42. The method of any one of clams 1 to 29 wherein the subject: i) is not suffering from and / or has not been identified as suffering from or susceptible to an autoimmune disease, pseudo-allergic drug reaction, pain, itch, and inflammatory disorders including in particular inflammatory bowel disease, urticaria, sinusitis, asthma, rosacea, and / or endometriosis.

43. The method of any one of clams 1 to 29 wherein the subject: i) is not suffering from and / or has not been identified as suffering from or susceptible to pseudo-allergic reactions including pseudo-allergic drug reactions, chronic itch (e.g., pruritus), inflammation disorders, pain disorders, skin disorders, wound healing, cardiovascular disease, and / or lung inflammation / COPD.88 171808680.1

Images