Genetically engineered t cells expressing a CD19 chimeric antigen receptor (CAR) and uses thereof for allogeneic cell therapy
Patent Information
- Application Number
- PCT/US2025/028570
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-14
- Filing Date
- 2025-05-09
- Publication Date
- 2026-08-27
Smart Images

Figure IMGF000205_0001 
Figure IMGF000295_0001 
Figure IMGF000328_0001
Abstract
Description
GENETICALLY ENGINEERED T CELLS EXPRESSING A CD19 CHIMERIC ANTIGEN RECEPTOR (CAR) AND USES THEREOF FOR ALLOGENEIC CELL THERAPYCross-Reference To Related Applications
[0001] This application claims the benefit of US Provisional Application No. 63 / 645,442, filed May 10, 2024, and US Provisional Application No. 63 / 758,598, filed February’ 14, 2025, which are incorporated by reference herein in their entirety’ for any’ purpose.Sequence Listing
[0002] The present application contains a Sequence Listing, which has been submitted electronically in XML format. Said XML file was created on May 1, 2025, is named “14682-WO-PCT_ST26.xmr‘, and is 201,270 bytes in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.Field
[0003] The present disclosure relates in some aspects to genetically engineered cells such as T cells containing chimeric antigen receptors (CARs), and related methods and uses thereof in allogeneic cell therapy. In some embodiments, the T cells are genetically engineered with a CAR and are further genetically engineered by one or more strategies to reduce host immune recognition of the engineered T cells, such as by heterologous expression of one or more additional transgenes and by genetic disruption to reduce or eliminate expression or one or more endogenous protein. Also disclosed are cell compositions containing the engineered T cells, and related methods, kits and systems for producing the engineered T cells. Also provided are methods of making and using the engineered T cells for cell therapy, including in connection with cancer immunotherapy comprising adoptive transfer of the engineered T cells.Background
[0004] Various cell therapy methods are available for treating diseases and conditions. Among cell therapy methods are methods involving immune cells, such as T cells, genetically engineered with a recombinant receptor, such as a chimeric antigen receptor (CAR). However, in some cases, current methods for generating CAR T cells are not ideal because they require patient-specific manufacturing for autologous delivery. Further, even for allogenic cell therapies, there is in many cases a problem with the persistence of the cell therapy in the subject so that there can be a high rate of relapse. Also, in some cases, incidences of relapse following CAR-T cell therapy may be high because of insufficient targetingof disease cells by the CAR due to antigen escape of the antigen being targeted by tire CAR and / or heterogeneity in the character of tumor cells so that targeting a single antigen may be insufficient.Improved CAR T cell therapies are needed, including in connection with allogenic administration.Summary
[0005] Provided herein is a genetically engineered T cell comprising: (a) a first genetic disruption in the endogenous TRAC gene; (b) a second genetic disruption in the endogenous B-2 microglobulin (B2M) gene; (c) a nucleotide sequence comprising a transgene encoding a single chain HLA-E fusion protein; and (d) a nucleotide sequence encoding a chimeric antigen receptor (CAR).
[0006] Also provided herein is a genetically engineered T cell comprising: (a) a first genetic disruption in the endogenous TRAC gene; (b) a second genetic disruption in the endogenous B-2 microglobulin (B2M) gene; (c) a nucleotide sequence encoding a single chain HLA-E fusion protein; and (d) a nucleotide sequence encoding a chimeric antigen receptor directed against CD 19.
[0007] In some embodiments, the gene editing technique is or comprises a CRISPR-Cas system. In some embodiments, the Cas is a Cas9. In some embodiments, the Cas is a S. pyogenes Cas9 (spCas9). In some embodiments, the Cas is a Casl2a. In some embodiments, the Casl2 as is Francisella novicida Casl2a (FnCasl2a), Lachnospiraceae bacterium Casl2a (LbCasl2a), Acidaminococcus sp. Cas12a (AsCas12a).
[0008] In some of any embodiments, the first genetic disruption is by a CRISPR-Cas system that comprises a Cas protein and a guide RNA (gRNA) targeting the endogenous TRAC gene that comprises a spacer sequence that is complementary to a target site sequence in the endogenous TRAC gene, optionally wherein the Cas protein is a Cas9. In some of any embodiments, the first genetic disruption in the endogenous TRAC gene is in a target site sequence in exon 1 of the TRAC gene.
[0009] In some embodiments, the target site sequence in exon 1 of the endogenous TRAC gene is located within a TRAC genome region at contiguous positions within the hg38 genomic region chr14:22,547,506-22,547,778. In some of any embodiments, the target site sequence in exon 1 of the endogenous TRAC gene is located at hg38 genomic coordinates chr14:22,547,576-22,547,595. In some of any embodiments, the target site sequence in exon 1 of the endogenous TRAC gene has the sequence set forth in SEQ ID NO: 84, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary’ sequence of the foregoing. In some of any embodiments, the target site sequence in exon 1 of the endogenous TRAC gene has the sequence set forth in SEQ ID NO: 84.
[0010] In some of any embodiments, the first genetic disruption is by a CRISPR-Cas system that comprises a Cas9 protein and a guide RNA (gRNA) comprising a spacer sequence comprising thenucleic acid sequence of SEQ ID NO: 87, or a contiguous portion thereof of at least 14 nt. In some of any embodiments, the CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas9 protein and the gRNA.
[0011] In some of any embodiments, the first genetic disruption disrupts one or more alleles of the endogenous TRAC gene. In some of any embodiments, the first genetic disruption disrupts all alleles of the endogenous TRAC gene. In some of any embodiments, the first genetic disruption reduces protein expression of TCR alpha chain encoded from the endogenous TRAC gene, optionally protein expression of the TCR alpha chain on the surface of the T cell, more optionally wherein there is no detectable expression of TCR alpha chain in the T cell.
[0012] In some of any embodiments, the genetically engineered cell has reduced expression of CD3 on the cell surface, optionally wherein the genetically engineered cell does not express detectable CD3 on the cell surface.
[0013] In some of any embodiments, the second genetic disruption is by a CRISPR-Cas system that comprises a Cas protein and a guide RNA (gRNA) targeting the endogenous B2M gene that comprises a spacer sequence that is complementary to a target site sequence in the endogenous B2M gene, optionally wherein the Cas protein is a Cas 12a. In some of any embodiments, the second genetic disruption in the endogenous B2M gene is in a target site sequence in exon 2 of the B2M gene.
[0014] In some embodiments, the target site sequence in exon 2 of the endogenous B2M gene is located within a B2M genome region at contiguous positions within hg38 the genomic region 44,715,423-44,715,701. In some of any embodiments, the target site sequence in exon 2 of the endogenous B2M gene is located at hg38 genomic coordinates chr15:44,715,614-44,715,634. In some of any embodiments, the target site sequence in exon 2 of the endogenous B2M gene has the sequence set forth in SEQ ID NO: 85, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of the foregoing. In some of any embodiments, the target site sequence has the sequence set forth in SEQ ID NO: 85.
[0015] In some of any embodiments, the second genetic disruption is by a CRISPR-Cas system that comprises a Casl2a protein and a guide RNA (gRNA) comprising a spacer sequence comprising the nucleic acid sequence SEQ ID NO: 105. or a contiguous portion thereof of at least 14 nt. In some of any embodiments, the CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas12a protein and the gRNA.
[0016] In some of any embodiments, the second genetic disruption disrupts one or more alleles of the endogenous B2M gene. In some of any embodiments, the second genetic disruption disrupts allalleles of the endogenous B2M gene. In some of any embodiments, the second genetic disruption reduces protein expression of B2M encoded from the endogenous B2M gene, optionally wherein there is no detectable expression of endogenous B2M in the T cell.
[0017] In some of any embodiments, the genetically engineered cell has reduced expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface, optionally wherein the genetically engineered cell has no detectable expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface. In some of any embodiments, the genetically engineered cell has no detectable expression of HLA-A class I. HLA-B class I and HLA-C class I on the cell surface.
[0018] In some of any embodiments, each gRNA independently comprises a spacer sequence between 14 nt and 24 nt, or between 16 nt and 22 nt in length. In some of any embodiments, the gRNA independently comprises a spacer sequence that is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length. In some of any embodiments, each gRNA further comprises a scaffold sequence for binding the respective Cas protein. In some of any embodiments, the gRNA is modified by one or more modified nucleotides, wherein the one or more modified nucleotides are for increased stability of the gRNA.
[0019] In some of any embodiments, the gRNA targeting the endogenous TRAC gene comprises the sequence set forth in SEQ ID NO:82. In some of any embodiments, the gRNA targeting the endogenous B2M gene comprises the sequence set forth in SEQ ID NO:83.
[0020] In some of any embodiments, the nucleotide sequence encoding the single chain HLA-E fusion protein is present in the disrupted B2M gene in the T cell under the operable control of a promoter.
[0021] In some embodiments, the promoter is the endogenous promoter of the B2M gene. In some embodiments, the promoter is a heterologous promoter of the B2M gene.
[0022] In some of any embodiments, the nucleotide sequence has been integrated in the disrupted B2M gene by homology directed repair (HDR).
[0023] In some of any embodiments, the single chain HLA-E fusion protein comprises at least a portion of the B2M protein linked to at least a portion of an HLA-E class I chain. In some of any embodiments, the at least a portion of the B2M protein is linked to at least a portion of an HLA-E class I chain by a peptide linker. In some of any embodiments, the single chain HLA-E fusion protein further comprises a peptide linked to the fusion protein comprising at least a portion of the B2M and at least a portion of an HLA-E.
[0024] In some embodiments, the peptide is a peptide epitope that is presented by the single chain HLA-E fusion protein when expressed on the cell surface, optionally wherein presentation of the peptide on the cell surface ensures proper folding of the single chain fusion on the cell surface. In some of any embodiments, the peptide is a portion of a signal sequence from an MHC class I molecule. In some of any embodiments, the peptide is VMAPRTLVL (SEQ ID NO: 107), VMAPRTLLL (SEQ ID NO: 108), VMAPRTVLL (SEQ ID NO: 109), VMAPRTLFL (SEQ ID NO: 110), or VMAPRTLIL (SEQ ID NO:111). In some of any embodiments, the peptide is VMAPRTLVL (SEQ ID NO:107).
[0025] In some of any embodiments, the peptide is linked to the fusion protein comprising at least a portion of the B2M protein and at least a portion of an HLA-E class I chain by a peptide linker. In some of any embodiments, the peptide linker is a GS linker, optionally wherein the GS linker is 4 to 25 amino acids in length, optionally wherein the GS linker is 12 to 20 amino acids in length, more optionally at or about 15 amino acids in length. In some embodiments, the GS linker is a (G4S)x3 linker is a GGGGSGGGGSGGGGS (SEQ ID NO: 112).
[0026] In some of any embodiments, the single chain HLA-E fusion protein comprises the sequence of amino acids set forth in SEQ ID NO:81 or a sequence of amino acids that has at least about 85%, 86%.87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:81. In some of any embodiments, the single chain HLA-E fusion protein comprises the sequence of amino acids set forth in SEQ ID NO:81. In some of any embodiments, the single chain fusion HLA-E fusion protein is capable of engaging inhibitory receptors on the surface of NK cells.
[0027] In some of any embodiments, the nucleotide sequence encoding the CAR is present in the disrupted TRAC gene in the T cell under the operable control of a promoter. In some embodiments, the promoter is a heterologous promoter of the TRAC gene. In some of any embodiments, the heterologous promoter is or comprises a human elongation factor 1 alpha (EF1α) promoter or a variant thereof. In some embodiments, the promoter is the endogenous promoter of the TRAC gene.
[0028] In some of any embodiments, the nucleotide sequence has been integrated in the disrupted TRAC gene by homology directed repair (HDR).
[0029] In some of any embodiments, (i) the VH region of the CD19-binding domain comprises the sequences set forth in, or a sequence that is at least 90%. 91%, 92%, 93%, 94%. 95%, 96%, 97%, 98% or 99% identical to, SEQ ID NO: 1 and (ii) the VL region of the CD19-binding domain comprises the sequences set forth in, or a sequence that is at least 90%. 91%. 92%, 93%, 94%. 95%. 96%, 97%, 98% or 99% identical to, SEQ ID NO: 2. In some of any embodiments, wherein the VH region of the CD19-binding domain comprises the sequences set forth in SEQ ID NO: 1; and the VL region of the CD19-binding domain comprises the sequences set forth in SEQ ID NO: 2.
[0030] In some of any embodiments, the VH region of the CD 19- binding domain is joined to the VL region of the CD 19- binding domain via a linker. In some embodiments, the linker is a flexible linker. In some of any embodiments, the linker is 5 to 25 amino acids in length, optionally wherein the linker is 12 to 18 amino acids in length. In some of any embodiments, the linker comprises the sequence set forth in SEQ ID NO: 18 or the sequence set forth in SEQ ID NO: 19.
[0031] In some of any embodiments, the length of the linker is between 5 and 25 amino acids, inclusive, optionally wherein the length of the linker is between 5 and 15 amino acids, inclusive. In some of any embodiments, the linker is a G4S linker (SEQ ID NO: 20), a G4S2 linker (SEQ ID NO: 21) or a (G4S)4 linker (SEQ ID NO: 22).
[0032] In some of any embodiments, the spacer comprises a hinge region sequence, optionally wherein the hinge region sequence is a hinge region of an immunoglobulin or a variant thereof. In some embodiments, the hinge region of an immunoglobulin is an IgG4 hinge region, optionally a human IgG4 hinge region, or a variant thereof. In some of any embodiments, the spacer comprises a variant IgG4 hinge region comprising substitution of amino acids CPSC to CPPC compared to the wild-type IgG4 hinge region. In some of any embodiments, the spacer is between 12 and 15 amino acids in length. In some of any embodiments, the spacer comprises an amino acid sequence having at least at or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 12, optionally wherein the spacer has the sequence set forth in SEQ ID NO: 12. In some of any embodiments, the spacer is between 200 and 250 amino acids in length, or between 220 and 240 amino acids in length.
[0033] In some of any embodiments, the spacer comprises a hinge region of an immunoglobulin, a CH2 region of an immunoglobulin or a chimeric CH2 region of two different immunoglobulins, and a CH3 region of an immunoglobulin. In some of any embodiments, the spacer comprises an IgG4 hinge region or a variant thereof, a chimeric CH2 region comprising a portion of an IgG4 CH2 and a portion of an IgG2 CH2 (IgG2 / 4 CH2 region), and an IgG4 CH3 region. In some of any embodiments, the spacer comprises an amino acid sequence having at least at or about 85%, 86%, 87%. 88%, 89%, 90%, 91%. 92%, 93%, 94%. 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 13, optionally wherein the spacer has the sequence set forth in SEQ ID NO: 13.
[0034] In some of any embodiments, the transmembrane domain comprises a transmembrane domain from CD28, optionally a human CD28. In some of any embodiments, the transmembrane domain is or comprises SEQ ID NO: 15 or an amino acid sequence having at least at or about 90%, 91%. 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 15.
[0035] In some of any embodiments, the intracellular signaling domain is a cytoplasmic signaling domain of a CD3-zeta (CD3ζ) chain, optionally a human CD3C chain. In some of any embodiments, the intracellular signaling domain comprises the sequence set forth in SEQ ID NO: 17, or an amino acid sequence having at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 17.
[0036] In some of any embodiments, the intracellular signaling region further comprises a costimulatory signaling region. In some embodiments, the costimulatory signaling region comprises an intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof. In some of any embodiments, wherein the costimulatory signaling region comprises an intracellular signaling domain of 4-1BB, optionally a human 4-1BB. In some of any embodiments, the costimulatory signaling region comprises the sequence set forth in SEQ ID NO: 16 or an amino acid sequence having at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 16.
[0037] In some of any embodiments, the CAR comprises the amino acid sequence set forth in SEQ ID NO: 78 or SEQ ID NO: 138, or an amino acid sequence that is at least at or about 85%, at or about 86%, at or about 87%, at or about 88%, at or about 89%, at or about 90%, at or about 91%, at or about 92%, at or about 93%, at or about 94%, at or about 95%, at or about 96%, at or about 97%, at or about 98% or at or about 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 78 or SEQ ID NO: 138.
[0038] In some of any embodiments, the genetically engineered T cell comprises one or more further genetic disruptions to reduce cell surface expression of one or more HLA class II molecules. In some embodiments, the one or more further genetic disruptions is a genetic disruption in the CIITA gene.
[0039] In some of any embodiments, the T cell is a primary T cell. In some embodiments, the primary T cell is from a human donor. In some embodiments, the human donor is a healthy donor.
[0040] Also provided herein is a method of producing a genetically engineered T cell, the method comprising: (a) introducing, into a T cell, a first agent for inducing a first genetic disruption at a target site sequence in an endogenous endogenous B-2 microglobulin (B2M) gene; (b) introducing into the T cell a second agent for inducing a second genetic disruption at a target site sequence in a endogenous T cell receptor alpha constant (TRAC) gene; (c) introducing into the T cell a polynucleotide comprising a transgene encoding a single chain HLA-E fusion protein; and (d) introducing into the T cell a polynucleotide comprising a transgene encoding a chimeric antigen receptor (CAR).
[0041] Also provided herein is a method of producing a genetically engineered T cell, the method comprising: (a) introducing, into a T cell, a first agent for inducing a first genetic disruption at a target site sequence in an endogenous endogenous B-2 microglobulin (B2M) gene; (b) introducing into the T cell a second agent for inducing a second genetic disruption at a target site sequence in a endogenous T cell receptor alpha constant (TRAC) gene; (c) introducing into the T cell a polynucleotide comprising a transgene encoding a single chain HLA-E fusion protein; and (d) introducing into the T cell a polynucleotide comprising a transgene encoding a chimeric antigen receptor (CAR) directed against CD19.
[0042] In some of any embodiments, each genetic disruption is by a gene editing technique. In some embodiments, each introduced agent mediates the gene editing technique and is or comprises a CRISPR-Cas system comprising a guide RNA (gRNA) comprising a spacer sequence that binds to the target site and a Cas protein. In some embodiments, each CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas protein and the gRNA. In some of any embodiments, the first agent is a first CRISPR-Cas system comprising a guide RNA (gRNA) targeting the endogenous TRAC gene comprising a spacer sequence that is complementary to the target site in the endogenous TRAC gene, and a Cas9 protein. In some embodiments, the CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas9 protein and the gRNA. In some of any embodiments, the Cas is a S. pyogenes Cas9 (spCas9).
[0043] In some of any embodiments, the target site sequence in the endogenous T cell receptor alpha constant (TRAC) gene is in exon 1 of the TRAC gene. In some of any embodiments, the target site sequence in the endogenous TRAC gene is located within a TRAC genome region at contiguous positions within the hg38 genomic region chr14:22,547,506-22,547,778. In some of any embodiments, the target site sequence in the endogenous TRAC gene is located at hg38 genomic coordinates chr14:22,547,576-22,547,595. In some of any embodiments, the target site sequence in the endogenous TRAC gene has the sequence set forth in SEQ ID NO: 84, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of the foregoing. In some of any embodiments, the target site sequence in the endogenous TRAC gene has the sequence set forth in SEQ ID NO: 84.
[0044] In some of any embodiments, the gRNA comprises a spacer sequence comprising the nucleic acid sequence of SEQ ID NO: 87. or a contiguous portion thereof of at least 14 nt.
[0045] In some of any embodiments, the first genetic disruption disrupts one or more alleles of the endogenous TRAC gene. In some of any embodiments, the first genetic disruption disrupts all alleles of the endogenous TRAC gene.
[0046] In some of any embodiments, introducing the first agent into the T cell reduces protein expression of TCR alpha chain encoded from the endogenous TRAC gene, optionally protein expression of the TCR alpha chain on the surface of the T cell, more optionally wherein there is no detectable expression of TCR alpha chain in the T cell. In some of any embodiments, introducing the first agent into the T cell reduces expression of CD3 on the cell surface, optionally where there is no detectable CD3 on the cell surface.
[0047] In some of any embodiments, the second agent is a second CRISPR-Cas system comprising a guide RNA (gRNA) targeting the endogenous B2M gene comprising a spacer sequence that is complementary to the target site in the endogenous B2M gene, and a Casl2a protein. In some embodiments, the CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas12a protein and the gRNA. In some of any embodiments, wherein the Cas is a Casl2a is Francisella novicida Casl2a (FnCasl2a), Lachnospiraceae bacterium Casl2a (LbCasl2a), Acidaminococcus sp. Casl2a (AsCasl2a).
[0048] In some of any embodiments, the target site sequence in the endogenous B2M gene is in exon 2 of the B2M gene. In some of any embodiments, the target site sequence in the endogenous B2M gene is located within a B2M genome region at contiguous positions within hg38 the genomic region 44,715,423-44,715,701. In some of any embodiments, the target site sequence in the endogenous B2M gene is located at hg38 genomic coordinates chr15:44,715,614-44,715,634. In some of any embodiments, the target site sequence in tire endogenous B2M gene has the sequence set forth in SEQ ID NO: 85, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of the foregoing. In some of any embodiments, the target site sequence in the endogenous B2M gene has the sequence set forth in SEQ ID NO: 85.
[0049] In some of any embodiments, the gRNA comprises a spacer sequence comprising the nucleic acid sequence of SEQ ID NO: 105, or a contiguous portion thereof of at least 14 nt.
[0050] In some of any embodiments, wherein the second genetic disruption disrupts one or more alleles of the endogenous B2M gene. In some of any embodiments, the second genetic disruption disrupts all alleles of the endogenous B2M gene.
[0051] In some of any embodiments, introducing the second agent into the T cell reduces protein expression of B2M encoded from the endogenous B2M gene, optionally wherein there is no detectable expression of B2M in the T cell.
[0052] In some of any embodiments, introducing the second agent into the T cell reduces expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on thecell surface, optionally wherein there is no detectable expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface. In some of any embodiments, introducing the second agent into the T cell results in no detectable expression of HLA-A class I, HLA-B class I and HLA-C class I on the cell surface.
[0053] In some of any embodiments, wherein each gRNA independently comprises a spacer sequence between 14 nt and 24 nt, or between 16 nt and 22 nt in length. In some of any embodiments, wherein each gRNA independently comprises a spacer sequence that is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length. In some of any embodiments, each gRNA further comprises a scaffold sequence for binding the respective Cas protein. In some of any embodiments, the gRNA is modified by one or more modified nucleotides, wherein the one or more modified nucleotides are for increased stability of the gRNA.
[0054] In some of any embodiments, the gRNA targeting the endogenous TRAC gene comprises the sequence set forth in SEQ ID NO: 82 or SEQ ID NO: 92. In some of any embodiments, the gRNA targeting the endogenous B2M gene comprises the sequence set forth in SEQ ID NO: 83. In some of any embodiments, the gRNA targeting the endogenous TRAC gene and / or the gRNA targeting the endogenous B2M gene induces a double strand break.
[0055] In some of any embodiments, the transgene encoding a single chain HLA-E fusion protein is integrated via homology directed repair (HDR) at the target site in the B2M gene.
[0056] In some of any embodiments, the polynucleotide encoding the single chain HLA-E fusion protein further comprises one or more homology ann(s) linked to the transgene, wherein the one or more homolog}’ arm(s) comprise a sequence homologous to nucleic acid sequences surrounding the target site sequence in the endogenous B2M gene. In some embodiments, the polynucleotide encoding the single chain HLA-E fusion protein comprises the structure [5’ homology ann]-[transgene]-[3’ homology arm], wherein the 5’ homology arm and 3’ homology arm comprises nucleic acid sequences homologous to the nucleic acid sequences surrounding the target site sequence in the endogenous B2M gene.
[0057] In some of any embodiments, the 5 ‘ homology arm and 3 ’ homology ann independently are at or about 200, 300. 400, 500, 600. 700 or 800 nucleotides in length, or any value between any of the foregoing. In some of any embodiments, the 5’ homology arm comprises SEQ ID NO: 79 or a sequence that has at least at or about 90%, 91%, 92%. 93%, 94%, 95%, 96%, 97%. 98% or 99% sequence identity to SEQ ID NO: 79 or a partial sequence thereof, and / or the 3’ homology arm comprises SEQ ID NO: 80. a sequence that has at least at or about 90%. 91%. 92%, 93%, 94%. 95%. 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 80 or a partial sequence thereof. In some of any embodiments, the 5’ homology arm comprises SEQ ID NO: 79 and the 3’ homology arm comprises SEQ ID NO: 80.
[0058] In some of any embodiments, the single chain HLA-E fusion protein comprises at least a portion of the B2M protein linked to at least a portion of an HLA-E class I chain, optionally via a peptide linker. In some embodiments, the single chain HLA-E fusion comprises a peptide sequence, wherein the peptide is a peptide epitope that is presented by the single chain HLA-E fusion protein when expressed on the cell surface. In some embodiments, the peptide is VMAPRTLVL (SEQ ID NO: 107), VMAPRTLLL (SEQ ID NO: 108), VMAPRTVLL (SEQ ID NO: 109), VMAPRTLFL (SEQ ID NO: 110), or VMAPRTLIL (SEQ ID NO: 111), optionally wherein the peptide is VMAPRTLVL (SEQ ID NO: 107).
[0059] In some of any embodiments, the single chain HLA-E fusion protein comprises the sequence of amino acids set forth in SEQ ID NO: 81 or a sequence of amino acids that has at least about 85%, 86%, 87%, 88%, 89%. 90%, 91%, 92%, 93%. 94%. 95%, 96%, 97%. 98%. or 99% sequence identity to SEQ ID NO: 81.
[0060] In some of any embodiments, the transgene encoding the CAR is integrated via homology directed repair (HDR) at the target site in the TRAC gene.
[0061] In some of any embodiments, the polynucleotide encoding the CAR further comprises one or more homology arm(s) linked to the transgene, wherein the one or more homology arm(s) comprise a sequence homologous to nucleic acid sequences surrounding the target site sequence in the endogenous TRAC gene. In some embodiments, the polynucleotide encoding the CAR comprises the structure [5’ homology arm]-[transgene]-[3’ homology arm], wherein the 5’ homology arm and 3’ homology arm comprises nucleic acid sequences homologous to the nucleic acid sequences surrounding the target site sequence in the endogenous TRAC gene.
[0062] In some of any embodiments, the 5 ’ homology arm and 3 ’ homology arm independently are at or about 200, 300, 400, 500, 600, 700 or 800 nucleotides in length, or any value between any of the foregoing. In some of any embodiments, the 5’ homology arm comprises SEQ ID NO: 76 or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%, 98% or 99% sequence identity to SEQ ID NO: 76 or a partial sequence thereof, and / or the 3’ homology' arm comprises SEQ ID NO: 77, a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity' to SEQ ID NO: 77 or a partial sequence thereof. In some of any embodiments, the 5’ homology arm comprises SEQ ID NO: 76 and the 3' homology' arm comprises SEQ ID NO: 77.
[0063] In some of any embodiments, the CAR is directed against CD 19. In some of any embodiments, the CAR comprises an extracellular domain, a spacer, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the extracellular domain comprises a CD 19-binding domain that binds to CD 19 comprising a VH region and a VL region.
[0064] In some of any embodiments, (i) the VH region of the CD19-binding domain comprises the sequences set forth in, or a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, SEQ ID NO: 1; and (ii) the VL region of the CD19-binding domain comprises the sequences set forth in, or a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, SEQ ID NO: 2. In some of any embodiments, the VH region of the CD19-binding domain comprises the sequences set forth in SEQ ID NO: 1; and the VL region of the CD19-binding domain comprises the sequences set forth in SEQ ID NO: 2.
[0065] In some of any embodiments, the spacer comprises a hinge region sequence, optionally wherein the hinge region sequence is a hinge region of an immunoglobulin or a variant thereof.
[0066] In some of any embodiments, the transmembrane domain comprises a transmembrane domain from CD28, optionally a human CD28.
[0067] In some of any embodiments, the intracellular signaling domain is a cytoplasmic signaling domain of a CD3-zeta (CD3ζ) chain, optionally a human CD3C chain. In some of any embodiments, the intracellular signaling region further comprises a costimulatory signaling region comprising an intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof. In some of any embodiments, the costimulatory signaling region comprises an intracellular signaling domain of 4-1BB, optionally a human 4-1BB.
[0068] In some of any embodiments, the transgene encoding the single chain HLA-E fusion is integrated to be under the operable control of the endogenous B2M promoter, optionally wherein the transgene encoding the single chain HLA-E fusion protein comprises one or more multicistronic element(s) positioned upstream of the nucleotide sequence encoding the single chain HLA-E fusion, more optionally wherein the one or more multicistronic element is or comprises a T2A, a P2A, an E2A. or an F2A element.
[0069] In some of any embodiments, the transgene encoding the CAR is operably linked to a heterologous promoter to control expression of the CAR. In some embodiments, the heterologous promoter is or comprises a human elongation factor 1 alpha (EF1α) promoter or a variant thereof.
[0070] In some of any embodiments, the introducing of the polynucleotide comprising a transgene encoding the single chain HLA-E fusion protein is by transduction of a first viral vector comprising the polynucleotide encoding the single chain HLA-E fusion; and / or the introducing of the polynucleotide comprising a transgene encoding the CAR is by transduction of a second viral vector comprising the polynucleotide comprising a transgene encoding the CAR. In some embodiments, a mixture comprising a first viral vector and a second viral vector are introduced into the T cell. In some of any embodiments,the first viral vector and the second viral vector is an AAV vector, optionally wherein the AAV vector is an AAV6 vector.
[0071] Also provided herein is a system for engineering a T cell, comprising: (a) a first agent for inducing a first genetic disruption at a target site sequence in an endogenous endogenous B-2 microglobulin (B2M) gene; (b) a second agent for inducing a second genetic disruption at a target site sequence in a endogenous T cell receptor alpha constant (TRAC) gene; (c) a polynucleotide comprising a transgene encoding a single chain HLA-E fusion protein; and (d) a polynucleotide comprising a transgene encoding a chimeric antigen receptor (CAR).
[0072] Also provided herein is a system for engineering a T cell, comprising: (a) a first agent for inducing a first genetic disruption at a target site sequence in an endogenous endogenous B-2 microglobulin (B2M) gene; (b) a second agent for inducing a second genetic disruption at a target site sequence in a endogenous T cell receptor alpha constant (TRAC) gene; (c) a polynucleotide comprising a transgene encoding a single chain HLA-E fusion protein; and (d) a polynucleotide comprising a transgene encoding a chimeric antigen receptor (CAR) directed against CD 19.
[0073] In some of any embodiments, the first agent and / or second agent is or comprises a CRISPR-Cas system comprising a guide RNA (gRNA) comprising a spacer sequence that binds to the target site and a Cas protein. In some embodiments, each CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas protein and the gRNA. In some of any embodiments, the first agent is a ribonucleoprotein complex comprising a guide RNA (gRNA) targeting the endogenous TRAC gene comprising a spacer sequence that is complementary to the target site in the endogenous TRAC gene, and a Cas9 protein, optionally wherein the Cas is a S. pyogenes Cas9 (spCas9).
[0074] In some of any embodiments, the target site sequence in the endogenous T cell receptor alpha constant (TRAC) gene is in exon 1 of the TRAC gene. In some of any embodiments, the target site sequence in the endogenous TRAC gene has the sequence set forth in SEQ ID NO: 84, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of the foregoing.
[0075] In some of any embodiments, the gRNA comprises a spacer sequence comprising the nucleic acid sequence of SEQ ID NO: 87, or a contiguous portion thereof of at least 14 nt.
[0076] In some of any embodiments, the second agent is a ribonucleoprotein complex comprising a guide RNA (gRNA) targeting the endogenous B2M gene comprising a spacer sequence that is complementary to the target site in the endogenous B2M gene, and a Cas 12a protein.
[0077] In some of any embodiments, the target site sequence in the endogenous B2M gene is in exon 2 of the B2M gene. In some of any embodiments, the target site sequence in the endogenous B2M gene has the sequence set forth in SEQ ID NO: 85, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of the foregoing.
[0078] In some of any embodiments, the gRNA comprises a spacer sequence comprising the nucleic acid sequence of SEQ ID NO: 105, or a contiguous portion thereof of at least 14 nt.
[0079] In some of any embodiments, the gRNA targeting the endogenous TRAC gene comprises the sequence set forth in SEQ ID NO: 135. In some of any embodiments, the gRNA targeting the endogenous B2M gene comprises the sequence set forth in SEQ ID NO: 136.
[0080] In some of any embodiments, the polynucleotide encoding the single chain HLA-E fusion protein further comprises one or more homology ann(s) linked to the transgene, wherein the one or more homology arm(s) comprise a 5‘ homology arm and a 3’ homology arm comprises nucleic acid sequences homologous to the nucleic acid sequences surrounding the target site sequence in the endogenous B2M gene. In some embodiments, the 5‘ homology ann comprises SEQ ID NO: 79 or a sequence that has at least at or about 90%, 91%, 92%. 93%, 94%, 95%, 96%. 97%, 98% or 99% sequence identity to SEQ ID NO: 79 or a partial sequence thereof, and / or the 3’ homology arm comprises SEQ ID NO: 80, a sequence that has at least at or about 90%, 91%, 92%. 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 80 or a partial sequence thereof.
[0081] In some of any embodiments, the single chain HLA-E fusion protein comprises the sequence of amino acids set forth in SEQ ID NO: 81 or a sequence of amino acids that has at least about 85%, 86%, 87%, 88%. 89%, 90%, 91%, 92%. 93%, 94%, 95%, 96%. 97%, 98%, or 99% sequence identity to SEQ ID NO: 81.
[0082] In some of any embodiments, the polynucleotide encoding the CAR further comprises one or more homology arm(s) linked to the transgene, wherein the one or more homology' arm(s) comprise a 5’ homology arm and a 3’ homology' arm comprising nucleic acid sequences homologous to the nucleic acid sequences surrounding the target site sequence in the endogenous TRAC gene. In some embodiments, the 5' homology arm comprises SEQ ID NO: 76 or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%, 98% or 99% sequence identity to SEQ ID NO: 76 or a partial sequence thereof, and / or the 3’ homology arm comprises SEQ ID NO: 77, a sequence that has at least at or about 90%, 91%, 92%, 93%. 94%, 95%, 96%, 97%. 98% or 99% sequence identity to SEQ ID NO: 77 or a partial sequence thereof.
[0083] In some of any embodiments, (i) the VH region of the CD19-binding domain comprises the sequences set forth in, or a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, SEQ ID NO: 1; and (ii) the VL region of the CD19-binding domain comprises the sequences set forth in, or a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to, SEQ ID NO: 2.
[0084] In some of any embodiments, the polynucleotide comprising a transgene encoding the single chain HLA-E fusion protein is comprised in a first viral vector comprising the polynucleotide encoding the single chain HLA-E fusion: and / or the polynucleotide comprising a transgene encoding the CAR is comprised in a second viral vector comprising the polynucleotide comprising a transgene encoding the CAR.
[0085] In some embodiments, the system comprises a mixture comprising a first viral vector and a second viral vector. In some of any embodiments, wherein the first viral vector and the second viral vector is an AAV vector, optionally wherein the AAV vector is an AAV6 vector.
[0086] Also provided herein is a kit comprising any of the systems disclosed herein, and optionally instructions for using the system to genetically engineer a T cell.
[0087] Also provided herein is a method of producing a genetically engineered T cell, the method comprising introducing the first agent, the second agent, the third agent, the polynucleotide comprising a transgene encoding an HLA-E fusion protein and the polynucleotide encoding the CAR of any of the systems disclosed herein into a T cell.
[0088] Also provided herein is a method of producing a genetically engineered T cell, the method comprising introducing the first agent, the second agent, the polynucleotide comprising a transgene encoding an HLA-E fusion protein and the polynucleotide encoding the CAR of any of the systems disclosed here into a T cell.
[0089] In some of any embodiments, the first agent and the second agent are introduced into the T cell via electroporation. In some embodiments, each of the first agent and second agent are independently introduced as a ribonucleoprotein complex (RNP) and the total concentration of the RNPs introduced into the T cell is between at or about 1 pM and at or about 5 pM, between at or about 1.5 pM and at or about 2.5 pM, between at or about 1.7 pM and at or about 2.5 pM, or between at or about 2 pM and at or about 2.5 pM, optionally at or about 1.0 pM, at or about 1.5 pM, at or about 1.7 pM, at or about 2 pM, at or about 2.2 pM, or at or about 2.5 pM.
[0090] In some of any embodiments, after the electroporation, the method comprises introducing the polynucleotides by transducing the T cells with a mixture of viral vectors, wherein the mixture of viral vectors comprises a first viral vector comprising the polynucleotide encoding the single chain HLA-E fusion and a second viral vector comprising the polynucleotide comprising a transgene encoding the CAR. In some embodiments, the first viral vector and the second viral vector is an AAV vector, optionally wherein the AAV vector is an AAV6 vector. In some of any embodiments, transducing is within about 15 minutes, within about 30 minutes, within about 60 minutes, or within about 2 hours, after the introductions.
[0091] In some of any embodiments, after the transducing the method further comprises incubating the cell under static conditions in serum free media for a period of time for recovery of the cells. In some of any embodiments, the method further comprises incubating the cells with one or more recombinant cytokines under conditions for expansion of T cells, optionally one or more recombinant IL-2, IL-7 and / or IL- 15. optionally wherein expansion is carried out for 2 to 8 doublings of the T cells. In some embodiments, the incubating is carried out with perfusion.
[0092] In some of any embodiments, prior to each of the introducing, the method comprises stimulating the T cells with one or more stimulatory agent(s) under conditions to stimulate or activate the T cells, optionally wherein the one or more stimulator}' agent(s) comprises anti-CD3 and / or anti-CD28 antibodies, optionally anti-CD3 / anti-CD28 Fabs. In some of any embodiments, the T cell is a primary T cell. In some embodiments, the primary T cell is from a human donor. In some embodiments, the human donor is a healthy donor.
[0093] In some of any embodiments, the method disclosed herein is performed ex vivo. In some of any embodiments, the method is performed in vitro. In some of any embodiments, the method disclosed herein comprises harvesting T cells produced by the method.
[0094] In some embodiments, the method disclosed herein further comprises depleting CD3+ T cells from the harvested T cells. In some of any embodiments, the method disclosed herein further comprises formulating the harvested T cells with a cryoprotectant.
[0095] Also provided herein is composition comprising a population of genetically engineered T cells disclosed herein. Also provided herein is a composition comprising a population of genetically engineered T cells produced by any of the methods disclosed herein. In some of any embodiments, wherein the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient. In some of any embodiments, the composition comprises a cyroprotectant, optionally wherein the cryoprotectant is DMSO.
[0096] In some of any embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition comprise a genetic disruption in the endogenous TRAC gene. In some of any embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition comprise no detectable expression of TCR alpha chain in the T cell. In some of any embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition comprise no detectable expression of CD3 on die cell surface of the T cell. In some of any embodiments, at least at or about 95%, 96%, 97% or 98% of the engineered T cells, or of the total cells or total T cells, in the composition comprise no detectable expression of CD3 on the cell surface of the T cell.
[0097] In some of any embodiments, at least at or about 70%. 75%, 80%, 85%. 90%. or 95% of the engineered T cells, or of the total cells or total T cells, in the composition comprise a genetic disruption in the endogenous B2M gene. In some of any embodiments, at least at or about 70%. 75%. 80%, 85%, 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition comprise no detectable expression of B2M in the T cell.
[0098] In some of any embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition comprise no detectable expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface. In some of any embodiments, at least at or about 70%, 75%, 80%, 85%, 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition comprise no detectable expression of HLA-A class I, HLA-B class I and HLA-C class I on the cell surface.
[0099] In some of any embodiments, at least at or about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition express the single chain HLA-E fusion. In some of any embodiments, at least at or about 50%. 60%, 65%, 70%, 75%, 80%. 85%. 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition express the CAR. In some of any embodiments, at least at or about 50%, 60%, 65%. 70%, 75%, 80%, 85%. 90%, or 95% of the engineered T cells, or of the total cells or total T cells, in the composition express the single chain HLA-E fusion and the CAR.
[0100] In some of any embodiments, at least 90% of the total cells in the composition comprise a genetic disruption in the endogenous TRAC gene, at least 90% of the total cells in the composition comprise a genetic disruption in the endogenous B2M gene, at least 50% of the total cells in the composition express the HLA-E fusion and at least 50% of the total cells in the composition express the CAR.
[0101] In some of any embodiments, at least at or about 95%, 96%, 97% or 98% of the total cells in the composition comprise no detectable expression of CD3 on the cell surface of the T cell. In some of any embodiments, at least at or about 95%, 96%, 97% or 98% of the total cells in the composition comprise no detectable expression of HLA-A class I, HLA-B class I and HLA-C class I on the cell surface.
[0102] In some of any embodiments, at least at or about 90%, 91%, 92%, 93%. 94%, 95%, 96%, 97%, 98%, or 99% of the cells in the composition are T cells. In some of any embodiments, the composition comprises CD4+ T cells and CD8+ T cells. In some embodiments, the ratio of CD4+ T cells to CD8+ T cells is from at or about 1:5 to at or about 5:1, optionally from at or about 1:3 to at or about 3:1.
[0103] In some of any embodiments, at least at or about 80%, 85%, 90%. or 95% of the engineered T cells, or of the total cells or total T cells, in the composition are viable cells. In some of any embodiments, at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%, 98%, or 99% of the cells in the composition are engineered T cells comprising a genetic disruption of one or more endogenous genes and expression of one or more transgene.
[0104] Also provided herein is a method of treatment, the method comprising administering any of the cells disclosed herein or the composition of any one of the compositions disclosed herein to a subject having a disease or disorder. In some embodiments, the disease or disorder is associated with an antigen targeted by the CAR. In some embodiments, the antigen is CD 19.
[0105] In some of any embodiments, the disease or disorder is a cancer. In some of any embodiments, the disease or disorder is an autoimmune disease. In some embodiments, the cancer is a lymphoma or a leukemia. In some embodiments, the cancer is a lymphoma that is a large B cell lymphoma. In some of any embodiments, the lymphoma is a non-Hodgkin lymphoma.Brief Description of the Drawings
[0106] FIG. 1 depicts the percent CD4+CCR7+CD45RA+ of live CD3+ T cells (y-axis) against healthy donor age in years (x-axis) (FIG. 1A), and the percent CD8+CCR7+CD45RA+ of live CD3+ T cells (y-axis) against healthy donor age in years (x-axis) (FIG. IB).
[0107] FIG. 2 is a graph plotting die percent CD3+ T cells against healthy donor body mass index (BMI) (x-axis).
[0108] FIG. 3 depicts a schematic of the gene-edited T cell product (HD Allo CD19 CAR-T). The TRAC and B2M loci are disrupted, thus preventing endogenous TCR and HLA-I expression.respectively. An HLA-E fusion protein and CD19 CAR transgenes are delivered using rAAV6 vector for site-specific integration at the B2M and TRAC loci, respectively.
[0109] FIG.4 depicts in vitro characterization of HD Allo CD19 CAR-T cells from three healthy donors in a Raji Burkitt’s lymphoma 3-D spheroid tumor assay. FIG. 4A shows total integrated fluorescence intensity measured in co-cultures (effector to target cell ratio of 1:2) by monitoring NucLight Red fluorescence. FIG. 4B shows target-cell lysis for each donor by plotting total integrated intensity and the calculating the area under the curve (AUC). FIG. 4C shows measurement of proinflammatory cytokines in supernatants collected 24 hours post co-culture with HD Allo CD 19 CAR-T from three donors and 3-D spheroid tumors using an electrochemiluminescence cytokine immunoassay.
[0110] FIG.5 depicts in vitro cytotoxic activity of HD Allo CD19 CAR-T cells against B Cell Targets. B cells isolated from healthy and SLE donor material (3 HD; ISLE) were fluorescently labeled with Carboxyfluorescein Diacetate Succinimidyl Ester (CSFE) then co-cultured with HD Allo CD19 CAR-T cells in vitro at an effector to target cell ratio of 0.125: 1 (12. K effectors and 100K targets) and 2:1 (200K effectors and 100K targets) for 72 hours. Target B cell counts (FIG.5A) and fold-expansion (FIG.5B) were measured by flow cytometry and quantified using CountBright Absolute Counting Beads. Target B cell counts were gated on CSFE+ / Caspase3- cells and fold expansion of HD Allo CD19 CAR-T cells were gated on CFSE- / CAR+ cells. Fold expansion of HD Allo CD 19 CAR-T cells was calculated by dividing the HD Allo CD 19 CAR-T cell counts at 72 hours by HD Allo CD 19 CAR-T cell counts at 0 hours. HD Allo CD 19 CAR-T cell activation and degranulation (FIG.5C) were measured by quantification of CD38+CAR+ gMFI and CD107a+CAR+ gMFI, respectively.
[0111] FIG.6 depicts a strategy to mitigate the effects of GvHD by knocking out the TRAC gene in the Allo CAR-T cells, which results in the abrogation of the expression of the endogenous TCR in Allo CAR T cells. To determine GvH alloreactivity, l. Ox 106CSFE-labeled, unedited mock T cells or Allo CAR T cells derived from 3 healthy donors were incubated with HLA-mismatched host dendritic cells from 3 donors in vitro for 6 days and alloreactivity was determined by CSFE dilution. FIG. 6A is a FACS plot from one of the 9 donor pairs. FIG.6B is a graph showing combined data from the 9 donor pairs.
[0112] FIG. 7 depicts the protection of HD Allo CD 19 CAR-T cells from NK-mediated CAR-T Cell Depletion in vitro. HD Allo CD 19 CAR-T cells and allo CD 19 B2M KO / No HLA-E KI CAR T cells were generated from 3 healthy donors and were plated at an E: T ratio of 0.6:1 with primary NK cells from 2 donors for 72 hours. After co-culture for 72 hours, cells were analyzed by multicolor flow cytometry to identify the percentage of live CD5+ / CD56- / CAR+ T cells. (FlowJo software, TreeStar Inc.,Ashland, OR). Data are displayed as group means ± SEM. Data were analyzed using GraphPad Prism software (GraphPad Software, La Jolla, CA).
[0113] FIG. 8 depicts the in vivo activity of HD Allo CD19 CAR-T cells in Raji xenograft model. A single dose (1.0 ×106or 3.0 ×106) of HD Allo CD19 CAR-T cells was injected intravenously into Raji Burkitt's lymphoma xenograft mice. Tumor growth and CAR T cell expansion were assessed.Detailed Description
[0114] Provided herein are T cells engineered with a chimeric antigen receptor (CAR) that are further genetically engineered to have reduced recognition by the host immune response. In some embodiments, provided T cells are genetically engineered with a CAR and are genetically engineered by one or more strategies to mitigate graft versus host and host versus graft interaction as well as NK cell-mediated rejection, while preserving and in some cases enhancing T cell functions. In some embodiments, the provided engineered CAR T cell therapies are non-alloreactive so that they are not susceptible to, or exhibit reduced susceptibility compared to T cells without the genetic disruptions or modifications, to host immune system rejection. Also provided herein are methods for developing engineered non-alloreactive T-cells expressing the CAR for immunotherapy and more specifically for methods for increasing the persistence and / or the engraftment of allogeneic T cells.
[0115] In some embodiments, the T cell is genetically engineered by altering or modulating by genetic disruption one or more endogenous gene in the T cell. In some embodiments, the endogenous gene can be a gene sequence associated with host versus graft response or a gene sequence associated with graft versus host response. In some embodiments, the endogenous gene can be a gene sequence associated with a host versus graft response that is selected from the group consisting of B2M, CIITA, and RFX5, and combinations thereof. B2M is a common (invariant) component of MHC I complexes. CIITA and RFX5 are components of a transcription regulatory complex that is required for the expression of MHC II genes. Disrupting gene expression of these genes to eliminate their expression by gene editing can prevent host versus graft (e.g. T cell therapy) leading to increased allogeneic T cell persistence. In some embodiments, the endogenous gene can be a gene sequence associated with a graft versus host response that is selected from the group consisting of TRAC, CD3-epsilon (CD3e), and combinations thereof. TRAC and CD3e are components of the T cell receptor (TCR). Disrupting them by gene editing can take away the ability of the T cells to cause graft versus host disease.
[0116] In some cases, cells with reduced or eliminated cell-surface expression of MHC may become susceptible to NK cell-mediated cytotoxicity. In some aspects, certain MHC class I molecules, such as the non-classical MHC molecules MHC-E (HLA-E in humans and Qa-lb in mice) or MHC-G (HLA-G in humans), are ligands of and can be recognized by Natural Killer (NK) inhibitory receptors expressedon the surface of NK cells to induce an inhibitory signal to “stop” or halt an NK cell killing response. For example, MHC-E can interact with an inhibitor receptor on the surface of an NK cell that comprises CD94 and / or NKG2A, such as heterodimer of NKG2A disulfide-linked with the CD94 molecule. In some cases, an NK cell response can be triggered to kill cells that they interact with, unless those cells express the MHC molecule recognized by an NK inhibitory cell receptor on the NK cell. In cells in which MHC -I has been downregulated (e.g., as occurs in tumor or virally -infected cells), the NK cells can provide an immune surveillance by detection of “missing self,” which then results in cell killing. In the context of the provided embodiments, while reduced or disrupted expression of certain regulatory molecules (e.g. B2M) in the provided cells can reduce or eliminate expression of classical MHC class I (MHC class la) by the cell or on the cell surface, such targeting of regulatory molecules also may reduce or eliminate expression of non-classical MHC class I molecules MHC-E and MHC-G by the cell or on the cell surface, which also may render the cell susceptible to NK cell killing.
[0117] In some embodiments, to overcome or reduce risks of or associated with exposure to NK cell-mediated cytotoxicity, e.g.. due to the reduced MHC expression, the provided engineered cells include those that are reduced or prevented from being the subject of “missing self’ recognition, e.g.. by NK cells, to prevent NK cell-mediated immune surveillance that could kill a provided engineered cell lacking an MHC molecule (e.g. MHC-E or MHC-G, also known as HLA-E or HLA-G, respectively). Thus, in some embodiments, in addition to reducing or eliminating expression of an MHC molecule (e.g. MHC class I), the provided engineered cells also include a recombinant NK cell modulator that is or comprises an NK cell modulating (e.g. inhibiting) moiety on the surface of the engineered immune cell. In some embodiments, the NK cell modulating (e.g. inhibiting) moiety is capable of inducing an inhibitory signal in an NK cell. In some embodiments, the binding or modulating induces an inhibitory signal in the NK cell to reduce or prevent lack-of-sclf recognition and NK ccll-mcdiatcd rejection. In some embodiments, the inhibitory signal is transduced by a CD94 / NKG2A receptor. In some embodiments, the modulating (e.g. inhibiting) moiety is a recombinant HLA-E molecule or binding portion thereof or a recombinant HLA-G molecule or binding portion thereof, for example, one that is exogenously introduced for expression on the surface of the cell. In some embodiments, such features of the provided cells result in enhanced efficacy or longevity of adoptive cell therapy in the context of engineered immune cells susceptibility to natural killer (NK) cell-mediated cytotoxicity.
[0118] In some embodiments, the engineered T cells are genetically engineered by expression of a CAR transgene, a genetic disruption that reduces or eliminates the expression or activity of a regulatory molecule that regulates expression and / or surface expression of an endogenous major histocompatibility complex (MHC) class I, a genetic disruption that reduces or eliminates the expression of TRAC, and also expression of an NK cell inhibiting moiety transgene. In some embodiments, the engineered T cells include a CAR transgene with an extracellular binding domain composed of a means for specificallybinding an antigen or antigens, a genetic disruption that reduces or eliminates the expression of B2M to reduce or eliminate surface expression of endogenous MHC class I. a genetic disruption that reduces or eliminates the expression of TRAC, and a transgene for expression of a chimeric HLA-E transgene on the surface of the engineered T cell.
[0119] In some embodiments, the provided engineering strategies can be carried out by gene editing methods, including those involving CRISPR-Cas systems. In addition to disrupting or deleting genes by nuclease-directed targeted gene editing, introduction of transgenes (such as the CAR or NK cell inhibiting moiety) can be carried out by insertion into genomic loci at the site of a double stranded break that is repaired by homology directed repair (HDR) using a delivered donor template (e.g. by AAV delivery) with homology around the target site. Gene editing using rare-cutting endonucleases, such as CRISPR-Cas systems using guide RNA / Cas, to disrupt by knock-out (KO) target genes as well as to introduce by knock-in (KI) transgenes to a defined genomic loci has the benefit to modulate gene activity while also providing precise genome modification as compared to alternative methods such as lentivirus delivery and integration.
[0120] In some embodiments, the provided engineered T cells include a genetic disruption to inactivate or delete one or more genes implicated in the self / non-self-recognition (c.g., the TRAC and / or B2M gene) by the use of specific rare-cutting endonuclease, followed by a step of knock-in (KI) of said engineered T cells with at least one non-endogenous polypeptide transgene (such as HLA-E fusion protein and / or a recombinant CAR). In some embodiments, provided herein is a genetically engineered T cell with a genetic disruption in the endogenous TRAC gene; a genetic disruption in the endogenous B-2 microglobulin (B2M) gene: a nucleotide sequence encoding a single chain HLA-E fusion protein; and a nucleotide sequence encoding a chimeric antigen receptor (CAR), in some embodiments, the genetic disruptions are by CRISPR-Cas systems using gRNAs useful for the creation of indels that result in disruption of the target gene, such as disruption of all alleles of the target gene, for example, reduction or elimination of gene expression and / or function. In some embodiments, the gRN As are useful for the creation of double strand breaks (DSBs) that faci litate insertion of a donor template into the genome by HDR. hi some embodiments, the CAR is integrated by KI into the disrupted TRAC gene by homology directed repair (HDR). In some embodiments. the single chain HLA-E fusion protein is integrated by KI into the disrupted B2M gene by homology directed repair (HDR).
[0121] Also provided herein are methods for engineering the T cells. Also provided herein are methods of administering the engineered T cells to a subject, such as for use in treating a disease or condition associated with expression of an antigen that is recognized by the recombinant receptor (e.g. CAR).
[0122] In some aspects, the provided engineered cells exhibit enhanced efficacy or longevity when used in adoptive cell therapy, for example, due to reduced or eliminated graft versus host rejection, host versus graft rejection and / or NK-cell mediated rejection. In some embodiments, the provided methods reduce or lessen or prevent an immune response in a subject administered with the genetically engineered T cells, compared to the immune response generated in the subject administered with T cells expressing the CAR in the absence of the genetic disruptions (e.g., KO of B2M and TRAC) and expression of an NK-cell inhibiting moiety transgene (e.g., HLA-E single chain fusion) in the engineered T cell. In some embodiments, the subject does not exhibit an immune response or a particular type or degree of immune response, against the genetically engineered T cells, such as following the administration of the cells to the subject. The type of immune response may be a detectable immune response, a humoral immune response, and / or a cell-mediated immune response. In some aspects, the provided genetically engineered T cells, compositions and methods result in an increased persistence and efficacy of cells used in adoptive cell therapy. In some aspects, the provided embodiments may reduce the number of T cells that need to be generated or delivered to each patient as the cells can be more efficacious and / or persist for longer. The provided embodiments may also reduce the number of sequential administrations of engineered cells required to treat a patient, or increase the amount of time needed between administrations as cells survive longer.
[0123] In some embodiments, the provided engineered cells, compositions and methods can be used regardless of the HLA type or subtype of a subject (e.g., a patient) to whom the cells may be administered, which can, in some aspects, permit “off-the-shelf’ deliver}’ to a wider variety of recipients. In some embodiments, the provided compositions and methods can be used to provide adoptive cell therapy using allogeneic cells engineered to treat a disease or disorder. In some cases, using allogeneic cells can provide certain advantages. In some embodiments, cells with known safety and efficacy profiles can be prepared for a wider variety of patients. For example, cells can be derived from a healthy donor and delivered to a subject that may be too sick to provide cells suitable for genetic engineering. In some cases, a subject may have a defect or disease in the cells or cell type typically used for a particular adoptive cell therapy regimen, such that cells from a healthy donor can be used that replace or supplement the diseased cells. In some cases, the ability to engineer or administer allogeneic cells permits the preparation of cells in advance, which can reduce the time needed before being delivered to a patient. In some cases, the engineered allogeneic cells may present lower risks of causing graft-versus-host disease or host-versus-graft disease.
[0124] Provided are T cells engineered according to the above provided strategies and engineered to express a CAR and compositions containing such cells. Also provided are approaches useful in the treatment of diseases and conditions and / or for targeting such cell types and compositions and articles of manufacture comprising the same.
[0125] Among the CAR in the provided genetically engineered T cells are chimeric antigen receptors (CARs) targeting or directed to CD19. Such CAR-engineered T cells can be used for targeting CD19-expressing cells, such as tumor cells associated with cancer. The CARs can contain antibodies (including antigen-binding antibody fragments, such as heavy chain variable (VH) regions, single domain antibody fragments and single chain fragments, including scFvs, and camelid-derived single domain antibody fragments such as VHH domains) specific for CD19. Also provided are cells, such as engineered or recombinant cells expressing such CD19-binding receptors, e.g., CARs and / or containing nucleic acids encoding such receptors, and compositions and articles of manufacture and therapeutic doses containing such cells.
[0126] Provided are cell therapy approaches utilizing CARs targeting CD 19 expressed on autologous primary T cells for use as a therapeutic agent against cancer cells. In some cases, simultaneously targeting both antigens as provided herein may improve the depth and durability of responses across patients, in addition to minimizing relapse due to antigen escape. A mechanism of resistance to CAR T-cell therapies, as evidenced by data from CAR T-cell trials in B-cell malignancies, may be the loss or downregulation (“escape”) of the target antigen. (Robbie G. Majzner and Crystal L. Mackall. Cancer Discov August 22 2018; DOI 10.1158 / 2159-8290. CD-18-0442). Such a dual targeting strategy may achieve synergistic or improved tumor responses based on targeting two antigens compared to approaches involving only single antigen targeting. A dual targeting approach may be advantageous to overcome problems due to potential for antigen loss and / or to maximize antigen targeting in cancer.
[0127] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.
[0128] The Section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.I. CAR-ENGINEERED T CELLS AND METHODS OF MAKING THE SAME
[0129] Provided herein are genetically engineered T cells that express a recombinant chimeric antigen receptor (CAR), and that also are genetically engineered to have reduced or eliminated expression an endogenous major histocompatibility complex (MHC). e.g. MHC class I or MHC class II by genetic disruption of B2M, CIITA, RFX5, and combinations thereof; reduced or eliminated expression of TRAC or CD3-epsilon; and introduction of a transgene sequence to express a NK cellinhibiting moiety, such as an HLA-E or HLA-G. In some embodiments, the HLA-E or HLA-G are single chain fusion proteins with at least a portion of B2M to promote expression on the cell surface.
[0130] In some embodiments, the provided engineered T cells comprise a genetic disruption at a target site at an endogenous T cell receptor alpha constant (TRAC) locus, for example, to knock-out (KO) or reduce or eliminate the expression of the gene product of the TRAC locus. In some embodiments, die provided engineered T cells comprise a genetic disruption at a target site at Beta-2 microglobulin (B2M) locus, for example, to knock-out (KO) or reduce or eliminate the expression of the gene product of the B2M locus.
[0131] In some embodiments, the provided engineered T cells comprise a modified T cell receptor alpha constant (TRAC) locus comprising a transgene encoding the recombinant CAR. or portion thereof. In some aspects, the transgene (e.g., sequences that are exogenous or heterologous to the T cell) encoding the recombinant CAR or a portion thereof, is integrated at the TRAC locus of the T cell, by targeted knock-in (KI), and the expression of the endogenous TRAC gene product, the TCRa constant region, is reduced or eliminated. In some embodiments, the provided engineered T cells express a single chain HLA-E fusion transgene. In some aspects, the provided engineered T cells also comprise a modified Beta-2 microglobulin (B2M) locus comprising a transgene encoding the recombinant HLA-E fusion protein, or portion thereof. In some aspects, the transgene (e.g., sequences that are exogenous or heterologous to the T cell) encoding the recombinant HLA-E fusion protein or a portion thereof, is integrated at the B2M locus of the T cell, by targeted knock-in (KI), and the expression of the endogenous B2M gene product is reduced or eliminated.
[0132] In some aspects, the provided cells are engineered by CRISPR / Cas mediated gene editing to introduce a genetic disruption at a target site, and / or targeted integration (targeted knock-in, KI) of transgene sequences, for example encoding the recombinant CAR or HLA-E fusion protein, at or near one of the target sites with the genetic disruption. In some aspects, a genetic disruption is introduced at a target site at a TRAC or B2M locus, and in the presence of a polynucleotide comprising transgene sequences encoding a recombinant CAR or HLA-E fusion protein, respectively, or a portion thereof, the transgene sequences is integrated into a location at or near the target site with the genetic disruption, for example, by homology -directed repair (HDR). Exemplary methods for carrying out genetic disruptions at the endogenous loci and / or for carrying out HDR for targeted integration of the transgenes are described in this disclosure. Further, the engineered T cells can be generated using other methods, for example, as described in WO2015 / 161276, WO2015 / 070083, WO2019 / 070541. WO2019 / 195491. WO2019 / 195492, WO2019 / 089884, and WO2020 / 223535, the contents of which are incorporated by reference.A. Source T cells
[0133] Any source of T cells can be used for genetically engineering T cells in accord with the provided embodiments. In some embodiments, the T cells are eukaryotic cells, such as mammalian cells, and typically are human cells. In some embodiments, the cells are derived from the blood, bone marrow, lymph, or lymphoid organs. In some embodiments, the T cells are derived such as differentiated from stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). The cells typically are primary cells, such as those isolated directly from a subject and / or isolated from a subject and frozen. In some embodiments, the T cells are from a healthy donor. In some embodiments, the healthy donor is age 18 to 35 years old. In some embodiments, a healthy donor has a body mass index (BMI) less than 30 kg / m2. In some embodiments, a healthy donor is age 18 to 35 years old and has a body mass index (BMI) less than 30 kg / m2.
[0134] In some embodiments, the cells include one or more subsets of T cells or other cell types, such as whole T cell populations, CD4+cells, CD8+cells, and subpopulations thereof, such as those defined by function, activation state, maturity, potential for differentiation, expansion, recirculation, localization, and / or persistence capacities, antigen-specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and / or degree of differentiation. In some embodiments, provided herein is a T cell comprising a provided bispecific CAR. In some embodiments the T cell is a CD4+ T cell. In some embodiments, the T cell is a CD8+ T cell.
[0135] Among the sub-types and subpopulations of T cells and / or of CD4+and / or of CD8+T cells are naive T (TN) cells, effector T cells (TEFF), memory T cells and sub-ty pes thereof, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH 17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha / beta T cells, and delta / gamma T cells.
[0136] With reference to the subject to be treated, the cells may be allogeneic and / or autologous. Typically, the cells are allogeneic to the subject being treated. Among the methods include off-the-shelf methods.
[0137] In some embodiments, the methods include isolating cells from the subject, preparing, processing, culturing, and / or engineering them, as described herein, and re-introducing them into the same patient, before or after cryopreservation.
[0138] In some embodiments, the cells include one or more polynucleotides introduced via genetic engineering, and thereby express recombinant or genetically engineered products of such polynucleotides. In some embodiments, the polynucleotides are heterologous, i.e., normally not presentin a cell or sample obtained from the cell, such as one obtained from another organism or cell, which for example, is not ordinarily found in the cell being engineered and / or an organism from which such cell is derived. In some embodiments, the polynucleotides are not naturally occurring, such as a polynucleotide not found in nature, including one comprising chimeric combinations of polynucleotides encoding various domains from multiple different cell types. In some embodiments, the cells (e.g., engineered cells) comprise a vector (e.g., a viral vector, expression vector, etc.) as described herein such as a vector comprising a nucleic acid comprising a nucleic acid encoding a recombinant receptor described herein.
[0139] In some embodiments, T cells are isolated, selected, or enriched cells from a biological sample. In some embodiments, the biological sample is a sample from a donor subject (e.g. donor samples). In some embodiments, the donor subject is a subject that does not have a particular disease or condition or is not in need of a cell therapy or to which cell therapy will be administered. In some embodiments, the donor subject is a healthy subject or is believed to be a healthy subject (i.e. has not been diagnosed with a disease or condition).
[0140] In some embodiments, the T cells are primary T cells, such as primary human T cells. In some embodiments, the donor sample is a sample from an individual donor. In some embodiments, samples from a plurality of different individual donors are combined into a donor sample. In some aspects, the donor sample is from samples from a plurality of different individual donors. In some aspects, the donor sample is from a plurality of different donors. In some aspects, the individual donor is a human. In some aspects, each of the plurality of different donors is a human. In some aspects, the plurality of different donors are human donors. In some embodiments, the sample (e.g. donor sample) comprises primary human T cells from an individual donor. In some embodiments, each of the samples (e.g. donor samples) from a plurality of different individual donors are combined. In some embodiments, the sample (e.g. donor sample) comprises primary human T cells from a plurality of different donors. In some embodiments, the human donor is a healthy human donor.
[0141] In some embodiments, the samples include tissue, fluid, and other samples taken directly from the donor. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to. body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.
[0142] In some aspects, the sample is blood or a blood-derived sample, or is or is derived from an apheresis or leukapheresis product. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen,other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and / or cells derived therefrom. Samples include, in the context of cell therapy, e.g., adoptive cell therapy, samples from autologous and allogeneic sources. In some embodiments, the samples are from allogeneic sources (e.g. allogenic donors). In some embodiments, the samples are from autologous sources (e.g. autologous donors). In some embodiments, die sample is or comprises a whole blood sample, a buffy coat sample, a peripheral blood mononuclear cells (PBMC) sample, an unfractionated T cell sample, a lymphocyte sample, a white blood cell sample, an apheresis product, or a leukapheresis product.
[0143] In some examples, cells from the circulating blood of a donor are obtained, e.g.. by apheresis or leukapheresis. The samples, in some aspects, contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and / or platelets, and in some aspects contains cells other than red blood cells and platelets.
[0144] In some embodiments, the blood cells collected from the donor are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In some embodiments, the sample containing cells (e.g., a donor sample, such as an apheresis product or a leukapheresis product) is washed in order to remove one or more anti-coagulants, such as heparin, added during apheresis or leukapheresis. In some embodiments, the cells are washed with phosphate buffered saline (PBS).
[0145] In some embodiments, the sample containing cells (e.g., donor sample, such as an apheresis product or a leukapheresis product) is cryopreserved and / or cryoprotected (e.g.. frozen) and then thawed and optionally washed prior to any steps for isolating or selecting T cells or genetically engineering the cells.
[0146] In certain embodiments, subsets of T cells, e.g., CD3+, CD4+ or CD8+ T cells, are selected, isolated, or enriched from the donor sample or pooled donor samples. In some embodiments, CD4+ and CD8+ T cells are selected, isolated, or enriched the donor sample or pooled donor samples. In particular embodiments, CD3+ T cells are selected, isolated, or enriched the donor sample or pooled donor samples. In some embodiments, CD4+ and CD8+ are selected from a donor by adding CD4 and CD8 selection beads to a leukapheresis product from the donor. In some embodiments, CD8+ cells are selected first by adding CD8 selection beads to a leukapheresis product and keeping the CD8 selected fraction separate from the remaining leukapheresis product, then adding CD4 selection beads to the remaining leukapheresis product to yield a CD4 selected fraction. In some embodiments, the separate CD4+ and CD8+ fractions are mixed in a 1: 1 ratio.
[0147] In some embodiments, selection, isolation, or enrichment includes one or more preparation and / or non-affinity based cell separation steps. In some examples, cells are washed, centrifuged, and / or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents. In some examples, cells are separated based on one or more property, such as density, adherent properties, size, sensitivity’ and / or resistance to particular components. In some embodiments, the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by ly sing the red blood cells and centrifugation through a Percoll or Ficoll gradient. In certain embodiments, methods, techniques, and reagents for selection, isolation, and enrichment are described, for example, in PCT Application Nos. WO2013124474 and WO2015164675, which are hereby incorporated by reference in their entirety.
[0148] In some embodiments, selection, isolation, or enrichment includes one or more selection steps. The selection can be a negative selection to deplete or remove unwanted cells or can be a positive selection of desired cells. In some embodiments, at least a portion of the selection step includes incubation of cells with a selection reagent. The incubation with a selection reagent or reagents, e.g., as part of selection methods which may be performed using one or more selection reagents for selection of one or more different cell types based on the expression or presence in or on the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In certain embodiments, such surface proteins may include CD3, CD4, or CD8. In some embodiments, the selection reagent or reagents result in a separation that is affinity- or immunoaffinity -based separation.
[0149] In some embodiments, selected or isolated T cells are further enriched for naive, central memory, and / or central memory stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation. In some embodiments, enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve long-term survival, expansion, and / or engraftment following administration, which in some aspects is particularly robust in such sub-populations. See Terakura et al., (2012) Blood.1:72-82; Wang et al. (2012) J Immunother. 35 (9): 689-701. In certain embodiments, central memory T cells may include cells in various differentiation states and may be characterized by positive or high expression (e.g., surface expression) of certain cell markers and / or negative or low expression (e.g.. surface expression) of other cell markers. In some aspects, less differentiated cells, e.g., central memory cells, are longer lived and exhaust less rapidly, thereby increasing persistence and durability. In some aspects, a responder to a cell therapy, such as a CAR-T cell therapy, has increased expression of central memory genes. See, e.g., Fraietta et al. (2018) Nat Med. 24(5):563-571. In some aspects, central memory’ T cells are characterized by positive or high expression of CD45RO, CD62L, CCR7, CD28, CD3, and / or CD127. In someaspects, central memory T cells are characterized by negative or low expression of CD45RA and / or granzyme B. In certain embodiments, central memory T cells or the T cells that are surface positive for a marker expressed on central memory T cells are CCR7+CD45RA-.
[0150] In some embodiments, “depleting” or “removing” when referring to one or more particular cell type or cell population, refers to decreasing the number or percentage of the cell type or population, e.g., compared to the total number of cells in or volume of the composition, or relative to other cell types, such as by negative selection based on markers expressed by the population or cell, or by positive selection based on a marker not present on the cell population or cell to be depleted. In general, the terms depleting or removing does not require complete removal of the cell, cell type, or population from the composition.
[0151] In some embodiments, “enriching” when referring to one or more particular cell type or cell population, refers to increasing the number or percentage of the cell type or population, e.g., compared to the total number of cells in or volume of the composition, or relative to other cell types, such as by positive selection based on markers expressed by the population or cell, or by negative selection based on a marker not present on the cell population or cell to be depleted. In general, the term enriching does not require complete removal of other cells, cell type, or populations from the composition and does not require that the cells so enriched be present at or even near 100 % in the enriched composition.
[0152] Hence, it is understood that the separation need not result in 100 % enrichment or removal of a particular cell population or cells expressing a particular marker. For example, positive selection of or enrichment for cells of a particular type, such as those expressing a marker, refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker. Likewise, negative selection, removal, or depletion of cells of a particular type, such as those expressing a marker, refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
[0153] In some embodiments, the isolation and / or enrichment results in a population of enriched CD3+T cells that includes at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or at or at about 100% CD3+ T cells.
[0154] In some embodiments, the isolation and / or enrichment results in a population of enriched CD4+T cells that includes at least 60%. at least 65%, at least 70%, at least 75%. at least 80%, at least 85%, at least 90%. at least 95%, at least 98%. at least 99%, at least 99.5%, at least 99.9%, or at or at about 100% CD4+ T cells. In some embodiments, the isolation and / or enrichment results in a population of enriched CD8+T cells that includes at least 60%, at least 65%, at least 70%. at least 75%, at least 80%.at least 85%. at least 90%, at least 95%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or at or at about 100% CD8+ T cells.
[0155] In some embodiments, the selected CD4+ cell population and the selected CD8+ cell population may be combined subsequent to the selecting. In some embodiments, the T cell population has a ratio of CD4+ to CD8+ T cells of between at or about 1: 5 and at or about 5: 1. In some embodiments, the T cell population has a ratio of CD4+ to CD8+ T cells of between at or about 1:3 and at or about 3:1. In some embodiments, the T cell population has a ratio of CD4+ to CD8+ T cells of between at or about 1:2 and at or about 2:1.
[0156] In some embodiments, the CD4+ and CD8+ T cells are activated by incubation with anti-CD3 and anti-CD28 antibodies. In some embodiments, CD4+ and CD8+ T cells are activated by culturing the T cells with a soluble anti-CD3 / anti-CD28 Fab stimulatory reagent composed of the Fab agents on a streptavidin mutein backbone (see e.g., PCT publication No. WO2018 / 197949), followed by addition of D-Biotin to reversibly dissociate the Fab reagents from the backbone to disrupt the stimulation and washing off the stimulatory reagent. In some embodiments, CD4+ and CD8+ T cells are activated with Expamers as described in Poltorak, M. P., et al. Expamers: a new technology to control T cell activation. Sci Rep 10, 17832 (2020), which is incorporated by reference in its entirety. Expamer reagents comprise anti-CD3 and anti-CD28 antibody Fab fragments carrying the Twin-Strep-tag affinity tag and are used to functionalize polymerized Strep-Tactin (mutein of streptavidin) multimer backbones. D-biotin addition dissociates the Fab fragments from T cell surface.B. Genetic Disruption
[0157] In some embodiments, one or more genetic disruption is induced at one or more target sites in the T cell. In some aspects, during the engineering of the T cell, one or more genetic disruption is induced at one or more target sites in the T cell. In some aspects, the genetic disruptions at target sites at the endogenous TRAC or the B2M locus then result in targeted integration of the transgene sequences at or near that target site.
[0158] In some embodiments, one or more further targeted genetic disruptions is induced at the endogenous TRAC locus. In some embodiments, one or more further targeted genetic disruptions is induced at one or more target sites at or near the endogenous TRAC locus. In some embodiments, the genetic disruption is induced in an exon of the endogenous TRAC locus. In some embodiments, the genetic disruption is induced in an intron of the endogenous TRAC locus. In some aspects, the presence of the one or more further genetic disruption and a polynucleotide, e.g., a template polynucleotide that contains transgene sequences encoding a recombinant CAR or a portion thereof, can result in targeted integration of the transgene sequences at or near the one or more genetic disruption at the endogenous TRAC locus. In some aspects, such targeted integration produces a modified TRAC locus comprising atransgene encoding the recombinant CAR, or a portion of the recombinant CAR.
[0159] In some embodiments, one or more further targeted genetic disruptions is induced at the endogenous B2M locus. In some embodiments, one or more targeted genetic disruption is induced at one or more target sites at or near the endogenous B2M locus. In some embodiments, the genetic disruption is induced in an exon of the endogenous B2M locus. In some embodiments, the genetic disruption is induced in an intron of the endogenous B2M locus. In some aspects, the presence of the one or more further genetic disruption and a further polynucleotide, e.g., a template polynucleotide that contains transgene sequences encoding a recombinant HLA-E fusion protein or a portion thereof, can result in targeted integration of the transgene sequences at or near the one or more genetic disruption at the endogenous B2M locus. In some aspects, such targeted integration produces a modified B2M locus comprising a transgene encoding the recombinant HLA-E fusion protein, or a portion of the recombinant HLA-E fusion protein.
[0160] In some embodiments, genetic disruption results in a DNA break or a nick. In some embodiments, at the site of the DNA break, action of cellular DNA repair mechanisms can result in a knock-out (KO), an indel, an insertion, a missense or a frameshift mutation, such as a biallelic frameshift mutation, and / or a deletion of all or part of the gene. In some embodiments, the genetic disruption can be targeted to one or more exon of a gene or portion thereof, such as within the first or second exon. In some embodiments, a DNA binding protein or DNA-binding nucleic acid, which specifically binds to or hybridizes to the sequences at a region near one of the at least one target site(s), is used for targeted disruption. In some aspects, in the absence of exogenous template polynucleotides for HDR the disruption, the targeted genetic disruption results in an indel, a deletion, a mutation and / or an insertion within an exon of the gene.
[0161] In some embodiments, polynucleotides, e.g., template polynucleotides that include a transgene encoding a recombinant CAR. HLA-E fusion protein or a portion thereof, and homology sequences, can be introduced for targeted integration of the recombinant CAR-encoding transgene or the recombinant HLA-E fusion protein -encoding transgene at or near the sites of the genetic disruptions, for example a second or third target site at the TRAC and B2M loci, respectively, by HDR.
[0162] In some embodiments, the genetic disruption is carried by introducing one or more agent(s) capable of inducing a genetic disruption. In some embodiments, such agents comprise a DNA binding protein or DNA-binding nucleic acid that specifically binds to or hybridizes to the gene. In some embodiments, the agent comprises various components, such as a fusion protein comprising a DNA-targeting protein and a nuclease or an RNA-guided nuclease. In some embodiments, the agents can target one or more target sites, e.g., a first target site at a TRAC locus and / or a second target site at a B2Mlocus.
[0163] In some embodiments, the genetic disruption occurs at a target site (also referred to and / or known as “target position,” “target DNA sequence,” or “target location”). In some embodiments, target site is or includes a site on a target DNA (e.g.. genomic DNA) that is modified by the one or more agent(s) capable of inducing a genetic disruption, e.g., a Cas molecule complexed with a gRNA that specifies the target site. For example, in some embodiments, the target site may include locations in the DNA. e.g., at an endogenous TRAC and / or B2M loci, where cleavage or DNA breaks occur. In some aspects, integration of nucleic acid sequences by HDR can occur at or near the target site or target sequence. In some embodiments, a target site can be a site between two nucleotides, e.g., adjacent nucleotides, on the DNA into which one or more nucleotides is added. The target site may comprise one or more nucleotides that are altered by a template polynucleotide. In some embodiments, the target site is within a target sequence (e.g., the sequence to which the gRNA binds). In some embodiments, a target site is upstream or downstream of a target sequence.
[0164] In some embodiments, genetic disruption results in a DNA break, such as a double-strand break (DSB) or a cleavage, or a nick, such as a single-strand break (SSB). at one or more target site in the genome. In some embodiments, at the site of the genetic disruption, e.g., DNA break or nick, action of cellular DNA repair mechanisms can result in knock-out, insertion, missense or frameshift mutation, such as a biallelic frameshift mutation, deletion of all or part of the gene; or, in the presence of a repair template, e.g., a template polynucleotide, can alter the DNA sequence based on the repair template, such as integration or insertion of the nucleic acid sequences, such as a transgene encoding all or a portion of a recombinant CAR and / or a recombinant HLA-E fusion protein, contained in the template. In some embodiments, the genetic disruption can be targeted to one or more exon of a gene or portion thereof. In some embodiments, the genetic disruption can be targeted near a desired site of targeted integration of exogenous sequences, e.g.. transgene sequences encoding a recombinant CAR and / or a recombinant HLA-E fusion protein.1. Target Site at an Endogenous TRAC Locus
[0165] In some aspects, the provided engineered T cells comprise a genetic disruption at the endogenous genes that encode one or more domains, regions and / or chains of the endogenous T cell receptor (TCR). In some embodiments, the genetic disruption is targeted at the endogenous gene locus that encodes TCRa. In some embodiments, the genetic disruption is targeted at the endogenous gene encoding TCRa constant domain (TRAC in humans).
[0166] In some aspects, a genetic disruption at the TRAC locus reduces expression of the gene product of the TRAC locus (e.g., endogenous TCR alpha chain constant region (Ca)) in the T cells. Insome embodiments, the reduced expression of TRAC includes reduced expression of an endogenous TRAC mRNA. In some embodiments, the genetic disruption that reduces expression of TRAC includes reduced expression of an endogenous TCR alpha chain constant region (Ca) protein, the protein encoded by the TRAC mRNA. In some embodiments, the genetic disruption eliminates TRAC gene activity. In some embodiments, the genetic disruption includes inactivation or disruption of both alleles of the TRAC locus. In some embodiments, the genetic disruption includes inactivation or disruption of all alleles of the TRAC locus. In some embodiments, the genetic disruption comprises inactivation or disruption of all TRAC coding sequences in the cell. In some embodiments, the genetic disruption comprises an insertion of the transgene at the TRAC locus. In some embodiments, the genetic disruption comprises an indel at the TRAC locus. In some embodiments, the genetic disruption comprises an indel and results in a knockout (KO) at the TRAC locus. In some embodiments, the TRAC indels can be detected or quantitated, among a population of engineered T cells, by PCR-based methods such as ddPCR. In some embodiments, the genetic disruption is a frameshift mutation or a deletion of a contiguous stretch of genomic DNA of the TRAC gene. In some embodiments, the TRAC gene is knocked out. In some aspects, the genetically engineered T cell does not encode a functional endogenous Ca polypeptide. In some aspects, the genetically engineered T cell does not encode an endogenous Ca polypeptide. In some aspects, the genetically engineered T cell does not encode a full length endogenous Ca polypeptide. In some aspects, the expression of an endogenous Ca polypeptide is reduced or eliminated in the genetically engineered T cell. In some aspects, the pairing of a TCR[3 chain with a TCRa chain comprising an endogenous Ca is reduced or eliminated in the genetically engineered T cell. In some embodiments, the genetically engineered T cell has reduced expression of CD3 on the cell surface. In some embodiments, the genetically engineered T cell does not express detectable CD3 on the cell surface.
[0167] In some embodiments, the endogenous TCR Ca is encoded by the TRAC gene (IMGT nomenclature). An exemplar}' sequence of the human T cell receptor alpha chain constant domain (TRAC) gene locus is set forth in SEQ ID NO: 106 (NCBI Reference Sequence: NG 001332.3, TRAC). In certain embodiments, a genetic disruption is targeted at, near, or within a TRAC locus. In certain embodiments, a genetic disruption is targeted at, near, or within a TRAC locus. In particular embodiments, the genetic disruption is targeted at. near, or within an open reading frame of the TRAC locus. In certain embodiments, the genetic disruption is targeted at, near, or within an open reading frame that encodes a TCRa constant domain.
[0168] In humans, an exemplary genomic locus of TRAC comprises an open reading frame that contains 4 exons and 3 introns. An exemplary mRNA transcript of TRAC can span the sequence corresponding to coordinates Chromosome 14: 22.547.506-22,552,154, on the forward strand, with reference to human genome version GRCh38 (UCSC Genome Browser on Human Dec. 2013(GRCh38 / hg38) Assembly). Table 1 sets forth the coordinates of the exons and introns of the open reading frames and the untranslated regions of the transcript of an exemplary human TRAC locus.Table 1. Coordinates of exons and introns of exemplary human TRAC locus (GRCh38, Chromosome 14, forward strand).Start (GrCh38) End (GrCh38) Length 5’ UTR and Exon 1 22.547,506 22,547.778 273 Intron 1-2 22,547,779 22,549,637 1,859 Exon 2 22,549,638 22,549,682 45 Intron 2-3 22.549.683 22.550.556 874 Exon 3 22,550,557 22,550,664 108 Intron 3-4 22,550,665 22,551,604 940 Exon 4 and 3’ UTR 22,551,605 22,552,154 550
[0169] In some embodiments, the genetic disruption is targeted at or in close proximity to the beginning of the coding region (e.g.. the early coding region, e.g.. within 5 OObp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon). In some embodiments, the genetic disruption is targeted at early coding region of a gene of interest, e.g., TRAC, including sequence immediately following a transcription start site, within a first exon of the coding sequence, or within 500 bp of the transcription start site (e.g.. less than 500, 450, 400, 350, 300, 250, 200.150. 100 or 50 bp), or within 500 bp of the start codon (e.g., less than 500, 450, 400. 350, 300, 250, 200, 150, 100 or 50 bp).
[0170] In some embodiments, the target site is within an exon of the endogenous TRAC locus. In certain embodiments, the target site is within an intron of the endogenous TRAC locus. In some aspects, the target site is within a regulatory or control element, e.g., a promoter, 5’ untranslated region (UTR) or 3’ UTR, of the TRAC locus. In certain embodiments, the target site is within an open reading frame of an endogenous TRAC locus. In particular embodiments, the target site is within an exon within the open reading frame of the TRAC locus.
[0171] In particular embodiments, the genetic disruption is targeted at or within an open reading frame of a gene or locus of interest, e.g.. TRAC locus. In some embodiments, the genetic disruption is targeted at or within an intron within the open reading frame of a gene or locus of interest. In someembodiments, the genetic disruption is targeted within an exon within the open reading frame of the gene or locus of interest.
[0172] In particular embodiments, a genetic disruption is targeted at or within an intron. In certain embodiments, a genetic disruption is targeted at or within an exon. In some embodiments, a genetic disruption is targeted at or within an exon of a gene of interest, e.g., TRAC locus.
[0173] In some embodiments, a genetic disruption is targeted within an exon of the TRAC gene, open reading frame, or locus. In certain embodiments, the genetic disruption is within the first exon, second exon, third exon, or fourth exon of the TRAC gene, open reading frame, or locus. In particular embodiments, the genetic disruption is within the first exon of the TRAC gene, open reading frame, or locus. In some embodiments, the genetic disruption is within 500 base pairs (bp) downstream from the 5’ end of the first exon in the TRAC gene, open reading frame, or locus. In particular embodiments, the genetic disruption is between the most 5’ nucleotide of exon 1 and upstream of the most 3’ nucleotide of exon 1. In certain embodiments, the genetic disruption is within 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp, 100 bp, or 50 bp downstream from the 5’ end of the first exon in the TRAC gene, open reading frame, or locus. In particular embodiments, the genetic disruption is between 1 bp and 400 bp, between 50 and 300 bp, between 100 bp and 200 bp, or between 100 bp and 150 bp downstream from the 5’ end of the first exon in the TRAC gene, open reading frame, or locus, each inclusive. In certain embodiments, the genetic disruption is between 100 bp and 150 bp downstream from the 5’ end of the first exon in the TRAC gene, open reading frame, or locus, inclusive.
[0174] In some aspects, the target site is within an exon, such as exons corresponding to early coding regions. In some embodiments, the target site is within or in close proximity to exons corresponding to early coding region, e.g., exon 1, 2, 3, 4 or 5 of the open reading frame of the endogenous TRAC locus (such as described in Table 1 herein), or including sequence immediately following a transcription start site, within exon 1, 2, 3, 4 or 5. or within less than 500, 450, 400. 350, 300, 250. 200, 150, 100 or 50 bp of exon 1. 2, 3, 4 or 5. In some aspects, the target site is at or near exon 1 of the endogenous TRAC locus, e.g., within less than 500, 450, 400. 350, 300, 250. 200, 150, 100 or 50 bp of exon 1. In some embodiments, the target site is at or near exon 2 of the endogenous TRAC locus, or within less than 500, 450, 400, 350, 300, 250, 200. 150, 100 or 50 bp of exon 2. In some aspects, the target site is at or near exon 3 of the endogenous TRAC locus, e.g., within less than 500, 450, 400, 350.300, 250, 200, 150, 100 or 50 bp of exon 3. In some aspects, the target site is at or near exon 4 of the endogenous TRAC locus, e.g., within less than 500, 450. 400, 350, 300, 250, 200, 150, 100 or 50 bp of exon 4. In some aspects, the target site is at or near exon 5 of the endogenous TRAC locus, e.g., within less than 500, 450, 400, 350, 300. 250, 200, 150, 100 or 50 bp of exon 5. In some aspects, the target site is within a regulatory or control element, e.g., a promoter, of the TRAC locus.
[0175] In certain embodiments, a genetic disruption is targeted at, near, or within a TRAC locus. In particular embodiments, the genetic disruption is targeted at, near, or within an open reading frame of the TRAC locus (such as described in Table 1 herein). In certain embodiments, the genetic disruption is targeted at, near, or within an open reading frame that encodes a TRAC. In some embodiments, the genetic disruption is targeted at, near, or within the TRAC locus (such as described in Table 1 herein), or a sequence having at or at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to all or a portion, e.g., at or at least 500, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, or 4,000 contiguous nucleotides, of the TRAC locus (such as described in Table 1 herein).
[0176] In some embodiments, the genetic disruption is in a target site sequence in exon 1 of the TRAC gene. In some embodiments, the target site sequence in exon 1 of the endogenous TRAC gene is located within a TRAC genome region at contiguous positions within the hg38 genomic region chrl4:22,547,506-22,547,778. In some embodiments, the target site sequence in exon 1 of the endogenous TRAC gene is located at hg38 genomic coordinates chrl4:22, 547, 576-22,547,595. In some embodiments, the target site sequence in exon 1 of the endogenous TRAC gene has the sequence set forth in SEQ ID NO: 84. a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of the foregoing. In some embodiments, the target site sequence is 12, 13, 14, 15. 16, 17, 18 or 20 contiguous nucleotides of SEQ ID NO: 84.
[0177] In some embodiments, a target site at the TRAC locus comprises SEQ ID NO: 84 (GAGAATCAAAATCGGTGAAT).
[0178] In some embodiments, the genetic disruption is by editing a genomic locus, e.g.. a TRAC locus, with an RNA-guided nuclease. In some embodiments, the RNA-guided nuclease is a CRISPR / Cas nuclease. In some embodiments, the RNA-guided nuclease is Cas9. In some embodiments, the CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas9 protein and the gRNA.
[0179] In some embodiments, the nuclease is S. pyogenes Cas9 or A. meningitidis Cas9. In some embodiments, nuclease is S. pyogenes Cas9. Any of the targeting domains can be used with a S. pyogenes Cas9 molecule that generates a double stranded break (Cas9 nuclease) or a single -stranded break (Cas9 nickase). Cas9 molecules of, derived from, or based on the Cas9 proteins of other species listed herein can be used as well. In other words, while the much of the description herein uses S. pyogenes, S. aureus, N. meningitidis, and S. thermophilus Cas9 molecules, Cas9 molecules from the other species can replace them.
[0180] In some embodiments, a gRNA sequence comprises CRISPR (cr)RNA and trans-activating (tra) CRISPR (cr) RNA.
[0181] In some embodiments, for genetic disruption using a CRISPR / Cas based gene editing, a gRNA sequence that is or comprises a targeting domain sequence (in some cases also referred to as a spacer sequence) that can bind to and / or target a target site in the genome, e.g., a target site at a TRAC locus. A genome-wide gRNA database for CRISPR genome editing is publicly available, which contains exemplary single guide RNA (sgRNA) sequences targeting constitutive exons of genes in the human genome or mouse genome (see e.g., genescript.com / gRNA-database.html; see also, Sanjana et al. (2014) Nat. Methods, 11:783-4). In some aspects, the gRNA sequence is or comprises a sequence with minimal off-target binding to a non-target site or position.
[0182] In some embodiments, the spacer sequence is SEQ ID NO: 87, or a sequence having at or at least 70%, 75%. 80%, 85%, 90%, 95%. 97%, 98%, 99%, 99.5%. or 99.9% sequence identity to SEQ ID NO: 87. In some embodiments, the spacer sequence comprises a nucleic acid sequence set forth in SEQ ID NO: 87, or a contiguous portion thereof of at least 5 nucleotides (nt), 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nt. In some embodiments, the spacer sequence comprises a nucleic acid sequence set forth in SEQ ID NO: 87, or a contiguous portion thereof of at least 12, at least 13, or at least 14 nt. In some embodiments, the spacer sequence is SEQ ID NO: 87.
[0183] In some embodiments, the target site that the targeting domain of the gRNA binds to or targets is located at an early coding region of a gene of interest, such as TRAC. Targeting of the early coding region can be used to genetic disruption (i.e., eliminate expression ol) the gene of interest. In some embodiments, the early coding region of a gene of interest includes sequence immediately following a start codon (e.g., ATG), or within 500 bp of the start codon (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100, 50 bp, 40bp, 30bp, 20bp, or lObp). In particular examples, the target nucleic acid is within 200bp, 150bp, 100 bp, 50 bp, 40bp, 30bp, 20bp or lObp of the start codon. In some examples, the targeting domain of the gRNA is complementary, e.g., at least 80, 85. 90, 95, 98 or 99% complementary, e.g., fully complementary, to the target site or a complement of the target site, such as the target nucleic acid in the TRAC locus, or the targeting domain of the gRNA can bind to or hybridize to the target site or a complement of the target site.
[0184] In some embodiments, the gRNA can target a site at the TRAC locus near a desired site of targeted integration of transgene sequences, e.g.. encoding a recombinant receptor. In some aspects, the gRNA can target a site based on the amount of sequences encoding the TRAC that is desired for expression in the cell expressing the recombinant receptor. In some aspects, the gRNA can target a site within an exon of the open reading frame of the endogenous TRAC locus. In some aspects, the gRNA can target a site within an intron of the open reading frame of the TRAC locus. In some aspects, the gRNA can target a site within a regulatory' or control element, e.g., a promoter, of the TRAC locus. In some aspects, the target site at the TRAC locus that is targeted by the gRNA can be any target sitesdescribed herein. In some embodiments, the gRNA can target a site within or in close proximity to exons corresponding to early coding region, e.g., exon 1, 2. 3, 4 or 5 of the open reading frame of the endogenous TRAC locus, or including sequence immediately following a transcription start site, within exon 1, 2, 3, 4 or 5, or within less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp of exon 1, 2, 3, 4 or 5. In some embodiments, the gRNA can target a site at or near exon 2 of the endogenous TRAC locus, or within less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp of exon 2.
[0185] In some embodiments, for genetic disruption using a CRISPR / Cas based gene editing, a gRNA sequence further comprises a scaffold sequence that is responsible for Cas9 binding. In some embodiments, the scaffold sequence is SEQ ID NO: 88, or a sequence having at or at least 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, 99.5%. or 99.9% sequence identity to SEQ ID NO: 88. In some embodiments, the scaffold sequence is SEQ ID NO: 88.
[0186] In a CRISPR-endonuclease system, a spacer sequence can be designed to hybridize to a target polynucleotide that is located 5' of a PAM of the endonuclease used in the system. The spacer may perfectly match the target sequence or may have mismatches. Each endonuclease, e.g., Cas9 nuclease, has a particular PAM sequence that it recognizes in a target DNA. For example, S. pyogenes Cas9 recognizes a PAM that comprises the sequence 5'-NRG-3', where R comprises either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.
[0187] In some embodiments, the Cas9 molecule interacts with a gRNA molecule. In some embodiments, the gRNA targets for disruption the TRAC target site sequence GAGAATCAAAATCGGTGAAT (SEQ ID NO: 84) at the TRAC locus in which the gRNA includes the spacer sequence GAGAAUCAAAAUCGGUGAAU SEQ ID NO: 87 and a scaffold sequence (SEQ ID NO: 88) for S. pyogenes Cas9 (spCas9). In some embodiments, the gRNA includes base modifications. In some embodiments, the gRNA is modified by one or more modified nucleotides, wherein the one or more modified nucleotides are for increased stability of the gRNA. In some embodiments, the gRNA is SEQ ID NO: 82 or SEQ ID NO: 92. or a sequence having at or at least 70%. 75%, 80%, 85%, 90%. 95%, 97%, 98%, 99%. 99.5%, or 99.9% sequence identity’ to SEQ ID NO: 82 or SEQ ID NO: 92. In some embodiments, the gRNA sequence is SEQ ID NO: 82 or SEQ ID NO: 92.
[0188] In some aspects, a genetic disruption at the TRAC locus is introduced using a first agent comprising a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas combination.2. Target Site at an Endogenous B2M Locus
[0189] In some aspects, the provided engineered T cells comprise a genetic disruption at theendogenous genes that encode one or more domains, regions and / or chains of the endogenous Beta-2 microglobulin (B2M), for example, to knock-out (KO) or reduce or eliminate the expression of the gene product of the B2M locus.
[0190] B2M is a component of tire Major Histocompatibility Complex (MHC) class I molecule, which would not assemble on the cell surface without B2M. Thus, knockout of B2M is a method of eliminating MHC class I molecules, which reduces GVHD when CAR T cells are administered to allogeneic patients.
[0191] In some aspects, a genetic disruption at the B2M locus reduces expression of the gene product of the B2M locus in the T cells. In some embodiments, the reduced expression of B2M includes reduced expression of an endogenous B2M mRNA. In some embodiments, the genetic disruption eliminates B2M gene activity. In some embodiments, the genetic disruption includes inactivation or disruption of both alleles of the B2M locus. In some embodiments, the genetic disruption includes inactivation or disruption of all alleles of the B2M locus. In some embodiments, the genetic disruption comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the genetic disruption comprises an insertion of the transgene at the B2M locus. In some embodiments, the genetic disruption comprises an indel at the B2M locus. In some embodiments, the genetic disruption comprises an indel and results in a knock-out (KO) at the B2M locus. In some embodiments, the B2M indels can be detected or quantitated, among a population of engineered T cells, by PCR-based methods such as ddPCR. In some embodiments, the genetic disruption is a frame shift mutation or a deletion of a contiguous stretch of genomic DNA of the B2M gene. In some embodiments, the B2M gene is knocked out. In some embodiments, the genetically engineered T cell has reduced expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface, optionally wherein the genetically engineered cell has no detectable expression of one or more HLA class I molecules (e.g., HLA-A class I. HLA-B class I and / or HLA-C class I) on the cell surface. In some embodiments, the genetically engineered T cell has no detectable expression of HLA-A class I, HLA-B class I and HLA-C class I on the cell surface.
[0192] In some aspects, the genetically engineered T cell does not encode a functional endogenous B2M polypeptide. In some aspects, the genetically engineered T cell does not encode an endogenous B2M polypeptide. In some aspects, the genetically engineered T cell does not encode a full length endogenous B2M polypeptide. In some aspects, the expression of an endogenous B2M polypeptide is reduced or eliminated in the genetically engineered T cell.
[0193] In some embodiments, the endogenous Beta-2 microglobulin is encoded by the B2M gene (IMGT nomenclature). An exemplary sequence of the human B2M gene locus is set forth in SEQ ID NO:93. In certain embodiments, a genetic disruption is targeted at, near, or within a B2M locus. In certain embodiments, a genetic disruption is targeted at, near, or within a B2M locus. In particular embodiments, the genetic disruption is targeted at, near, or within an open reading frame of the B2M locus.
[0194] An exemplary mRNA transcript of B2M can span the sequence corresponding to coordinates Chromosome 15: 44,711,517-44,718,145, on the forward strand, with reference to human genome version GRCh38 (UCSC Genome Browser on Human Dec. 2013 (GRCh38 / hg38) Assembly).
[0195] In some embodiments, the genetic disruption is targeted at or in close proximity to the beginning of the coding region (e.g., the early coding region, e.g.. within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon). In some embodiments, the genetic disruption is targeted at early coding region of a gene of interest, e.g., B2M, including sequence immediately following a transcription start site, within a second exon of the coding sequence, or within 500 bp of the transcription start site (e.g.. less than 500, 450, 400, 350, 300, 250, 200.150, 100 or 50 bp), or within 500 bp of the start codon (e.g., less than 500, 450, 400. 350, 300, 250, 200, 150, 100 or 50 bp).
[0196] In some embodiments, the target site is within an exon of the endogenous B2M locus. In certain embodiments, the target site is within an intron of the endogenous B2M locus. In some aspects, the target site is within a regulatory or control element, e.g., a promoter, 5’ untranslated region (UTR) or 3’ UTR, of the B2M locus. In certain embodiments, the target site is within an open reading frame of an endogenous B2M locus. In particular embodiments, the target site is within an exon within the open reading frame of the B2M locus.
[0197] In particular embodiments, the genetic disruption is targeted at or within an open reading frame of a gene or locus of interest, e.g., B2M locus. In some embodiments, the genetic disruption is targeted at or within an intron within the open reading frame of a gene or locus of interest. In some embodiments, the genetic disruption is targeted within an exon within the open reading frame of the gene or locus of interest.
[0198] In particular embodiments, the genetic disruption is within the second exon of the B2M gene, open reading frame, or locus. In some embodiments, the genetic disruption is within 500 base pairs (bp) downstream from the 5’ end of the second exon in the TRAC gene, open reading frame, or locus. In particular embodiments, the genetic disruption is between the most 5’ nucleotide of exon 2 and upstream of the most 3’ nucleotide of exon 2. In certain embodiments, the genetic disruption is within 400 bp, 350 bp, 300 bp, 250 bp, 200 bp, 150 bp. 100 bp. or 50 bp downstream from the 5’ end of the second exon in the B2M gene, open reading frame, or locus. In particular embodiments, the genetic disruption is between 1 bp and 400 bp. between 50 and 300 bp, between 100 bp and 200 bp. or between 100 bp and150 bp downstream from the 5' end of the second exon in the B2M gene, open reading frame, or locus, each inclusive. In certain embodiments, the genetic disruption is between 100 bp and 150 bp downstream from the 5 ’ end of the second exon in the B2M gene, open reading frame, or locus, inclusive.
[0199] In particular embodiments, a genetic disruption is targeted at or within an intron. In certain embodiments, a genetic disruption is targeted at or within an exon. In some embodiments, a genetic disruption is targeted at or within an exon of a gene of interest, e.g., B2M locus.
[0200] In some embodiments, the genetic disruption in the endogenous B2M gene is in a target site sequence in exon 2 of the B 2M gene. In some embodiments, the target site sequence in exon 2 of the endogenous B2M gene is located within a B2M genome region at contiguous positions within hg38 the genomic region 44,715,423-44,715.701. In some embodiments, the target site sequence in exon 2 of the endogenous B2M gene is located at hg38 genomic coordinates chrl5:44, 715, 614-44.715.634.
[0201] In some embodiments, the target site sequence in exon 2 of the endogenous B2M gene has the sequence set forth in SEQ ID NO: 85, a contiguous portion thereof of at least 14 nucleotides (nt), or a complementary sequence of the foregoing. In some embodiments, the target site sequence includes 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 contiguous nucleotides of SEQ ID NO: 85. In some embodiments, a target site at the B2M locus comprises SEQ ID NO: 85 (AGTGGGGGTGAATTCAGTGTA).
[0202] In some embodiments, the genetic disruption is by editing a genomic locus, e.g., a B2M locus, with an RNA-guided nuclease. In some embodiments, the RNA-guided nuclease is a CRISPR / Cas nuclease. In some embodiments, the RNA-guided nuclease is Casl2a (Cpfl). In some embodiments, the CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas12a protein and the gRNA.
[0203] In some embodiments, the nuclease is an Acidaminococcus sp. Cpfl variant (AsCpfl variant). Any of the targeting domains can be used with a Acidaminococcus sp. Cpfl molecule that generates a double stranded break (Casl2a nuclease) or a single-stranded break (Casl2a nickase). Casl2a molecules of, derived from, or based on the Casl2a proteins of other species listed herein can be used as well. In other words, while much of the description herein uses Acidaminococcus sp. Cas12a, Casl2a molecules from the other species can replace them, such as Lachnospiraceae bacterium or Francisella novicida.
[0204] In some embodiments, a guide RNA (gRNA) sequence comprises CRISPR (cr)RNA. In some embodiments, the crRNA comprises a DNA extension to improve efficacy of the Casl2a activity. In some embodiments, the DNA extension is set forth in SEQ ID NO: 90.
[0205] In some embodiments, for genetic disruption using a CRISPR / Cas based gene editing, a gRNA sequence that is or comprises a targeting domain sequence (in some cases also referred to as a spacer sequence) that can bind to and / or target a target site in the genome, e.g., a target site at a B2M locus. A genome-wide gRNA database for CRISPR genome editing is publicly available, which contains exemplary guide RNA sequences targeting constitutive exons of genes in the human genome or mouse genome (see e.g., genescript.com / gRNA-database.html; see also, Sanjana et al. (2014) Nat. Methods, 11:783-4). In some aspects, the gRNA sequence is or comprises a sequence with minimal off-target binding to a non-target site or position.
[0206] In some embodiments, the spacer sequence is SEQ ID NO: 105, or a sequence having at or at least 70%, 75%. 80%, 85%, 90%, 95%. 97%, 98%, 99%, 99.5%. or 99.9% sequence identity to SEQ ID NO: 105. In some embodiments, the spacer sequence comprises a nucleic acid sequence set forth in SEQ ID NO: 105, or a contiguous portion thereof of at least 5 nucleotides (nt) 6, 7, 8, 9, 10. 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nt. In some embodiments, the spacer sequence comprises a nucleic acid sequence set forth in SEQ ID NO: 105, or a contiguous portion thereof of at least 12. at least 13, or at least 14 nt. In some embodiments, the spacer sequence is SEQ ID NO: 105.
[0207] In some embodiments, for genetic disruption using a CRISPR / Cas based gene editing, a gRNA sequence further comprises a scaffold sequence that is responsible for Cas12a binding. In some embodiments, the scaffold sequence is SEQ ID NO: 89, or a sequence having at or at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 89. In some embodiments, the scaffold sequence is SEQ ID NO: 89.
[0208] A Casl2a molecule can interact with a gRNA molecule and, in concert with the gRNA molecule, homes or localizes to a site which comprises a target domain and PAM sequence.
[0209] In some embodiments, the Casl2a molecule interacts with a gRNA molecule. In some embodiments, the gRNA targets for disruption the B2M target site sequence AGTGGGGGTGAATTCAGTGTA (SEQ ID NO: 85 at the B2M locus in which the gRNA includes the DNA extension is set forth in SEQ ID NO: 90, the spacer sequence set forth in SEQ ID NO: 105, and the scaffold sequence set forth in SEQ ID NO: 89 for Casl2a. In some embodiments, the gRNA includes base modifications. In some embodiments, the gRNA is modified by one or more modified nucleotides, wherein the one or more modified nucleotides are for increased stability of the gRNA. In some embodiments, the gRNA is SEQ ID NO: 83, or a sequence having at or at least 70%, 75%. 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 83. In some embodiments, the gRNA sequence is SEQ ID NO: 83.
[0210] In some aspects, a genetic disruption at the B2M locus is introduced using a first agent comprising a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas combination.3. Methods for Genetic Disruption
[0211] In some aspects, the methods for generating the genetically engineered cells involve introducing a genetic disruption at one or more target site(s), e.g.. one or more target sites at a TRAC and / or B2M locus.
[0212] Methods for generating a genetic disruption, including those described herein, can involve the use of one or more agent(s) capable of inducing a genetic disruption, such as engineered systems to induce a genetic disruption, a cleavage and / or a double strand break (DSB) or a nick in a target site or target position in the endogenous DNA such that repair of the break by an error prone process such as non-homologous end joining (NHEJ) or repair using a repair template HDR can result in the knock out of a gene and / or the insertion of a sequence of interest (e.g., exogenous nucleic acid sequences or transgene encoding a portion of a chimeric receptor) at or near the target site or position. Also provided are one or more agent(s) capable of inducing a genetic disruption, for example at one or more target sites described herein, for use in the methods provided herein. In some aspects, the one or more agent(s) can be used in combination with the template nucleotides provided herein, for homology directed repair (HDR) mediated targeted integration of the transgene sequences. Also provided are polynucleotides (e.g., nucleic acid molecules) encoding one or more components of the one or more agent(s) capable of inducing a genetic disruption.
[0213] In some aspects, the methods for generating the genetically engineered cells involve introducing a genetic disruption at a target site at a TRAC locus and / or a further target site at a B2M locus.
[0214] In some aspects, the genetic disruptions are introduced using one or more agents comprising a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas combination. In some aspects, the one or more agents comprise a CRISPR-Cas combination comprising a guide RNA (gRNA) comprising a targeting domain that binds to the target site, and a Cas protein. In some aspects, the one or more agents comprise a first ribonucleoprotein (RNP) complex comprising the gRNA and the Cas protein.
[0215] In some embodiments, the one or more agent(s) specifically targets the at least one target site(s), e.g., a target site at a TRAC locus, a target site at a B2M locus, and / or a target site at a B2M locus. In some embodiments, tire agent comprises a ZFN, TALEN or a CRISPR / Cas combination that specifically binds to, recognizes, or hybridizes to the target site(s). In some embodiments, theCRISPR / Cas system includes an engineered crRNA / tracr RNA (“single guide RNA”) to guide specific cleavage. In some embodiments, the CRISPR / Cas system does not include an engineered tracr RNA to guide specific cleavage. In some embodiments, the agent comprises nucleases based on the Argonaute system (e.g.. from T. thermophilus, known as ‘TtAgo’. (Swarts et al. (2014) Nature 507(7491): 258-261). Targeted cleavage using any of the nuclease systems described herein can be exploited to insert the sequences of a transgene, e.g., nucleic acid sequences encoding a recombinant CAR or HLA-E fusion protein, into a specific target location, e.g., at a TRAC or at a B2M locus, using either HDR or NHEJ-mediated processes.
[0216] In some embodiments, the one or more agent(s) capable of inducing a genetic disruption comprises a DNA binding protein or DNA-binding nucleic acid that specifically binds to or hybridizes to a particular site or position in the genome, e.g., a target site or target position. In some aspects, the targeted genetic disruption, e.g., DNA break or cleavage, of the endogenous genes encoding TCR or B2M is achieved using a protein or a nucleic acid is coupled to or complexed with a gene editing nuclease, such as in a chimeric or fusion protein. In some embodiments, the one or more agent(s) capable of inducing a genetic disruption comprises an RNA-guided nuclease, or a fusion protein comprising a DNA-targeting protein and a nuclease.
[0217] In some embodiments, the agent comprises various components, such as an RNA-guided nuclease, or a fusion protein comprising a DNA-targeting protein and a nuclease. In some embodiments, the targeted genetic disruption is carried out using a DNA-targeting molecule that includes a DNA-binding protein such as one or more zinc finger protein (ZFP) or transcription activator-like effectors (TALEs), fused to a nuclease, such as an endonuclease. In some embodiments, the targeted genetic disruption is carried out using RNA-guided nucleases such as a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) system. In some embodiments, the targeted genetic disruption is carried using agents capable of inducing a genetic disruption, such as sequence-specific or targeted nucleases, including DNA-binding targeted nucleases and gene editing nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases such as a CRISPR-associated nuclease (Cas) system, specifically designed to be targeted to the at least one target site(s), sequence of a gene or a portion thereof.Exemplary ZFNs, TALEs, and TALENs are described in, e.g., Lloyd et al.. Frontiers in Immunology, 4(221): 1-7 (2013).
[0218] Various methods and compositions for targeted cleavage of genomic DNA have been described. Such targeted cleavage events can be used, for example, to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination at a predetermined chromosomal locus. See, e.g., U. S. Pat. Nos. 9,255,250; 9,200,266; 9,045,763; 9,005,973;9,150.847; 8,956,828; 8,945,868; 8.703.489; 8,586,526; 6,534,261; 6.599,692; 6,503,717; 6,689,558; 7,067.317; 7,262,054; 7,888,121; 7.972.854; 7,914,796; 7,951,925; 8.110,379; 8,409,861; U. S. Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060063231; 20080159996; 201000218264; 20120017290; 20110265198; 20130137104; 20130122591; 20130177983;20130196373; 20140120622; 20150056705; 20150335708; 20160030477 and 20160024474, the disclosures of which are incorporated by reference in their entireties.
[0219] In some embodiments, the agent comprises various components, such as an RNA-guided nuclease, or a fusion protein comprising a DNA-targeting protein and a nuclease. In some embodiments, the targeted genetic disruption is carried out using a DNA-targeting molecule that includes a DNA-binding protein such as one or more zinc finger protein (ZFP) or transcription activator-like effectors (TALEs). fused to a nuclease, such as an endonuclease. In some embodiments, the targeted genetic disruption is carried out using RNA-guided nucleases such as a clustered regularly interspaced short palindromic nucleic acid (CRISPR)-associated nuclease (Cas) system (including Cas9). In some embodiments, the targeted genetic disruption is carried using agents capable of inducing a genetic disruption, such as sequence-specific or targeted nucleases, including DNA-binding targeted nucleases and gene editing nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases such as a CRISPR-associated nuclease (Cas) system, specifically designed to be targeted to the at least one target site(s), sequence of a gene or a portion thereof. Exemplary ZFNs, TALEs, and TALENs are described in, e.g., Lloyd et al., Frontiers in Immunology, 4(221): 1-7 (2013).
[0220] Various methods and compositions for targeted cleavage of genomic DNA have been described. Such targeted cleavage events can be used, for example, to induce targeted mutagenesis, induce targeted deletions of cellular DNA sequences, and facilitate targeted recombination at a predetermined chromosomal locus. See, e.g., U. S. Pat. Nos. 9,255,250; 9.200.266; 9,045,763; 9,005,973; 9.150,847; 8,956,828; 8,945.868; 8,703,489; 8,586,526; 6.534.261; 6,599,692; 6,503,717; 6.689.558; 7.067,317; 7,262,054; 7,888.121; 7,972,854; 7,914,796; 7.951.925; 8,110,379; 8,409,861; U. S. Patent Publications 20030232410; 20050208489; 20050026157; 20050064474; 20060063231; 20080159996; 201000218264; 20120017290; 20110265198; 20130137104: 20130122591; 20130177983;20130196373; 20140120622; 20150056705; 20150335708; 20160030477 and 20160024474, the disclosures of which are incorporated by reference in their entireties.
[0221] A designed protein is a protein not occurring in nature whose design / composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP or TALE designs (canonical and non-canonical RVDs) and binding data. See, for example, U. S. Pat. Nos.9,458.205; 8,586,526; 6,140,081; 6.453.242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496.
[0222] Zinc finger proteins (ZFPs), transcription activator-like effectors (TALEs), and CRISPR system binding domains can be “engineered” to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring ZFP or TALE protein. Engineered DNA binding proteins (ZFPs or TALEs) are proteins that are non-naturally occurring. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and / or TALE designs and binding data. See, e.g., U. S. Pat. Nos. 6,140,081; 6.453.242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U. S. Publication No. 20110301073.
[0223] In some cases, the DNA-targeting molecule is or comprises a zinc-finger DNA binding domain fused to a DNA cleavage domain to form a zinc-finger nuclease (ZFN). For example, fusion proteins comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be engineered. In some cases, the cleavage domain is from the Type IIS restriction endonuclease FokI, which generally catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, e.g., U. S. Pat. Nos. 5,356,802; 5,436,150 and 5.487,994; Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269: 978-982. Some gene-specific engineered zinc fingers are available commercially. For example, a platform called CompoZr. for zinc-finger construction is available that provides specifically targeted zinc fingers for thousands of targets. See, e.g., Gaj et al.. Trends in Biotechnology, 2013, 31(7), 397-405. In some cases, commercially available zinc fingers are used or are custom designed.
[0224] In some embodiments, the one or more target site(s), e.g.. at a second target site at the TRAC locus genes can be targeted for genetic disruption by engineered ZFNs. Exemplary ZFN that target endogenous T cell receptor (TCR) genes include those described in. e.g., US 2015 / 0164954, US 2011 / 0158957, US 2015 / 0056705, US 8956828 and Torikawa et al. (2012) Blood 119:5697-5705, the disclosures of which are incorporated by reference in their entireties.
[0225] Transcription Activator like Effector (TALE) are proteins from the bacterial species Xanthomonas comprise a plurality of repeated sequences, each repeat comprising di-residues in position 12 and 13 (RVD) that are specific to each nucleotide base of the nucleic acid targeted sequence. Binding domains with similar modular base-per-base nucleic acid binding properties (MBBBD) can also bederived from different bacterial species. In some embodiments, a “TALE DNA binding domain” or “TALE” is a polypeptide comprising one or more TALE repeat domains / units. The repeat domains, each comprising a repeat variable diresidue (RVD), are involved in binding of the TALE to its cognate target DNA sequence. A single “repeat unit” (also referred to as a “repeat”) is ty pically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. TALE proteins may be designed to bind to a target site using canonical or non-canonical RVDs within the repeat units. See, e.g., U. S. Pat. Nos. 8,586,526 and 9,458,205.
[0226] In some embodiments, a “TALE -nuclease” (TALEN) is a fusion protein comprising a nucleic acid binding domain typically derived from a Transcription Activator Like Effector (TALE) and a nuclease catalytic domain that cleaves a nucleic acid target sequence. The catalytic domain comprises a nuclease domain or a domain having endonuclease activity, like for instance I-TevI, ColE7, NucA and Fok-I. In a particular embodiment, the TALE domain can be fused to a meganuclease like for instance I-Crel and I-Onul or functional variant thereof. In some embodiments, the TALEN is a monomeric TALEN. A monomeric TALEN is a TALEN that does not require dimerization for specific recognition and cleavage, such as the fusions of engineered TAL repeats with the catalytic domain of I-TevI described in WO2012138927. TALENs have been described and used for gene targeting and gene modifications (see. e.g., Boch et al. (2009) Science 326(5959): 1509-12.; Moscou and Bogdanove (2009) Science 326(5959): 1501; Christian et al. (2010) Genetics 186(2): 757-61; Li et al. (2011) Nucleic Acids Res 39(1): 359-72). In some embodiments, the TGFBR2 and / or TRAC genes can be targeted for genetic disruption by engineered TALENs. Exemplary TALEN that target endogenous T cell receptor (TCR) genes include those described in, e.g., WO 2017 / 070429, WO 2015 / 136001, US20170016025 and US20150203817, the disclosures of which arc incorporated by reference in their entireties.
[0227] In some embodiments, a “TtAgo” is a prokaryotic Argonaute protein thought to be involved in gene silencing. TtAgo is derived from the bacteria Thermus thermophilus. See, e.g. Swarts et al. (2014) Nature 507(7491): 258-26 l. Sheng et al., (2013) Proc. Natl. Acad. Sci. U. S. A. Ill, 652). A “TtAgo system” is all the components required including e.g. guide DNAs for cleavage by a TtAgo enzyme.
[0228] In some embodiments, an engineered zinc finger protein, TALE protein or CRISPR / Cas system is not found in nature and whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. See e.g., US 5,789,538; US 5,925,523; US 6,007,988; US 6,013,453; US 6,200,759; WO 95 / 19431; WO 96 / 06166; WO 98 / 53057; WO 98 / 54311; WO 00 / 27878; WO 01 / 60970; WO 01 / 88197 and WO 02 / 099084.
[0229] In some embodiments, the targeted genetic disruption of the endogenous genes such as TRAC and / or B2M in humans is carried out using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins. See Sander and Joung, (2014) Nature Biotechnology, 32(4): 347-355.
[0230] In general. “CRISPR system” refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a targeting domain sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), and / or other sequences and transcripts from a CRISPR locus.
[0231] In some aspects, the CRISPR / Cas nuclease or CRISPR / Cas nuclease system includes a noncoding guide RNA (gRNA), which sequence-specifically binds to DNA, and a Cas protein (e.g., Cas9 or Cas 12a), with nuclease functionality.
[0232] In some embodiments, the one or more agent(s) comprises a guide RNA (gRNA), having a targeting domain that binds to and / or is complementary with a target site at a TRAC gene or a complement thereof. In some embodiments, the one or more agent(s) comprises a further guide RNA (gRNA) having a targeting domain that binds to and / or is complementary with a target site at a B2M gene or a complement thereof.
[0233] In some aspects, a “gRNA molecule” is to a nucleic acid that promotes the specific targeting or homing of a gRNA molecule / Cas molecule complex to a target nucleic acid, such as a locus on the genomic DNA of a cell. gRNA molecules can be unimolecular (having a single RNA molecule), sometimes referred to herein as “chimeric” gRNAs, or modular (comprising more than one, and typically two, separate RNA molecules). In general, a guide sequence, e.g., guide RNA, is any polynucleotide sequences comprising at least a sequence portion that has sufficient complementarity with a target polynucleotide sequence, such as the TRAC and / or B2M genes in humans, to hybridize with the target sequence at the target site and direct sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, in the context of formation of a CRISPR complex, “target sequence” generally refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between the target sequence and a domain, e g., targeting domain, of the guide RNA promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. Generally, a guide sequence is selected to reduce the degree of secondary structure within theguide sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm.
[0234] In some embodiments, a guide RNA (gRNA) specific to a target locus of is used to RNA-guided nucleases, e.g., Cas, to induce a DNA break at the target site or target position. Methods for designing gRNAs and exemplary targeting domains can include those described in, e.g., WO2015 / 161276, W02017 / 193107, WO2017 / 093969, US2016 / 272999 and US2015 / 056705, the contents of which are incorporated by reference. Methods for introducing a genetic disruption at one or more target sites and gRNAs that target the target sites include those described in. e.g., WO2015 / 161276. WO2015 / 070083, WO2019 / 070541, WO2019 / 195491, WO2019 / 195492, WO2019 / 089884. and WO2020 / 223535, the contents of which are incorporated by reference.
[0235] Several exemplary gRNA structures, with domains indicated thereon, are described in WO2015 / 161276. While not wishing to be bound by theory, with regard to the three dimensional form, or intra- or inter-strand interactions of an active form of a gRNA, regions of high complementarity’ are sometimes shown as duplexes in WO2015 / 161276.
[0236] In some cases, the gRNA is a unimolecular or chimeric gRNA comprising, from 5’ to 3‘: a targeting domain which targets a target site (e.g., at the TRAC locus and / or the B2M locus); a first complementarity domain; a linking domain; a second complementarity domain (which is complementary to the first complementarity domain); a proximal domain; and optionally, a tail domain.
[0237] In other cases, the gRNA is a modular gRNA comprising first and second strands. In these cases, the first strand preferably includes, from 5’ to 3’: a targeting domain (which targets a target site); and a first complementarity domain. The second strand generally’ includes, from 5’ to 3’: optionally, a 5’ extension domain; a second complementarity domain; a proximal domain; and optionally, a tail domain.
[0238] Examples of the placement of targeting domains include those described in WO2015 / 161276. The targeting domain comprises a nucleotide sequence that is complementary, e g., at least 80, 85, 90, 95, 98 or 99% complementary', e.g., fully complementary, to the target sequence on the target nucleic acid. The strand of the target nucleic acid comprising the target sequence is referred to herein as the “complementary strand” of the target nucleic acid. Guidance on the selection of targeting domains can be found, e.g., in Fu Y et al.. Nat Biotechnol 2014 (doi: 10.1038 / nbt.2808) and Sternberg SH et al., Nature 2014 (doi: 10.1038 / naturel3011). In some examples, the targeting domain of the gRNA is complementary, e.g., at least 80, 85, 90, 95. 98 or 99% complementary, e.g., fully complementary, to the target site.
[0239] The targeting domain is part of an RNA molecule and will therefore comprise the base uracil(U), while any DNA encoding the gRNA molecule will comprise the base thymine (T). While not wishing to be bound by theory, in some embodiments, it is believed that the complementarity of the targeting domain with the target sequence contributes to specificity of the interaction of the gRNA molecule / Cas molecule complex with a target nucleic acid. It is understood that in a targeting domain and target sequence pair, the uracil bases in the targeting domain will pair with the adenine bases in the target sequence. In some embodiments, the target domain itself comprises in the 5’ to 3’ direction, an optional secondary domain, and a core domain. In some embodiments, the core domain is fully complementary with the target sequence. In some embodiments, the targeting domain is 5 to 50 nucleotides in length. The strand of the target nucleic acid with which the targeting domain is complementary is referred to herein as the complementary strand. Some or all of the nucleotides of the domain can have a modification, e.g., to render it less susceptible to degradation, improve bio-compatibility, etc. By way of non-limiting example, the backbone of the target domain can be modified with a phosphorothioate. or other modification(s). In some cases, a nucleotide of the targeting domain can comprise a 2’ modification, e.g., a 2-acetylation, e.g., a 2’ methylation, or other modification(s).
[0240] In various embodiments, the targeting domain is 16-26 nucleotides in length (i.e. it is 16 nucleotides in length, or 17 nucleotides in length, or 18, 19, 20. 21, 22, 23, 24. 25 or 26 nucleotides in length.C. Targeted Integration via Homology-directed Repair (HDR)
[0241] In some of the embodiments provided herein, homology -directed repair (HDR) can be utilized for targeted integration of a specific portion of the template polynucleotide containing a transgene, e.g.. nucleic acid sequence encoding a recombinant CAR or a NK cell inhibitory moiety (e.g., recombinant HLA-E fusion protein). In some embodiments, the targeted integration is at a particular location in the genome, e.g., the TRAC locus or the B2M locus.
[0242] In some embodiments, homology -directed repair (HDR) can be utilized for targeted integration or insertion of one or more nucleic acid sequences, e.g., transgene sequences, at one or more target site(s) in the genome. In some embodiments, the nuclease-induced HDR can be used to alter a target sequence, integrate a transgene at a particular target location, and / or to edit or repair a mutation in a particular target gene.
[0243] Alteration of nucleic acid sequences at the target site can occur by HDR with an exogenously provided polynucleotide (also referred to as donor polynucleotide or template sequence). For example, the template polynucleotide provides for alteration of the target sequence, such as insertion of the transgene contained within the template polynucleotide. In some embodiments, a plasmid or a vector can be used as a template for homologous recombination. In some embodiments, a linear DNA fragment can be used as a template for homologous recombination. In some embodiments, a single stranded templatepolynucleotide can be used as a template for alteration of the target sequence by alternate methods of homolog}' directed repair (e.g., single strand annealing) between the target sequence and the template polynucleotide. Template polynucleotide-effected alteration of a target sequence depends on cleavage by a nuclease, e.g., a targeted nuclease such as CRISPR / Cas. Cleavage by the nuclease can comprise a double strand break or two single strand breaks.
[0244] In some embodiments, “recombination” refers to a process of exchange of genetic information between two polynucleotides. In some embodiments, “homologous recombination (HR)” refers to the specialized form of such exchange that takes place, for example, during repair of doublestrand breaks in cells via homology -directed repair mechanisms. This process requires nucleotide sequence homology, uses a template polynucleotide to template repair of a target DNA (i.e.. the one that experienced the double-strand break, e.g.. target site in the endogenous gene), and is variously known as “non-crossover gene conversion” or “short tract gene conversion,” because it leads to the transfer of genetic information from the template polynucleotide to the target. In some embodiments, such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the template polynucleotide, and / or “synthesis-dependent strand annealing,” in which the template polynucleotide is used to resynthesize genetic information that will become part of the target, and / or related processes. Such specialized HR often results in an alteration of the sequence of the target molecule such that part or all of the sequence of the template polynucleotide is incorporated into the target polynucleotide. As described herein, the genetic disruption of the target site or target position can be created by any mechanisms, such as ZFNs, TALENs, CRISPR / Cas system, e.g., CRISPR / Cas9 or CRISPR / Cas 12a, or TtAgo nucleases.
[0245] In some embodiments, double strand cleavage is affected by a nuclease, e g., a Cas molecule having cleavage activity associated with an HNH-like domain and cleavage activity associated with a RuvC-like domain, e.g., an N-terminal RuvC-like domain, e.g., a wild type Cas nuclease.
[0246] In some embodiments, DNA repair mechanisms can be induced by a nuclease after (1) a single double-strand break, (2) two single strand breaks, (3) two double stranded breaks with a break occurring on each side of the target site, (4) one double stranded break and two single strand breaks with the double strand break and two single strand breaks occurring on each side of the target site (5) four single stranded breaks with a pair of single stranded breaks occurring on each side of the target site, or (6) one single stranded break. In some embodiments, a single-stranded template polynucleotide is used and the target site can be altered by alternative HDR.
[0247] Template polynucleotide-effected alteration of a target site depends on cleavage by a nuclease molecule. Cleavage by the nuclease can comprise a nick, a double strand break, or two singlestrand breaks, e.g., one on each strand of the DNA at the target site. After introduction of the breaks on the target site, resection occurs at the break ends resulting in single stranded overhanging DNA regions.
[0248] In canonical HDR, a double-stranded template polynucleotide is introduced, comprising homologous sequence to the target site that will either be directly incorporated into the target site or used as a template to insert the transgene or correct the sequence of the target site. After resection at the break, repair can progress by different pathways, e.g., by the double Holliday junction model (or double strand break repair, DSBR, pathway) or the synthesis-dependent strand annealing (SDSA) pathway.
[0249] In some embodiments, other DNA repair pathways such as single strand annealing (SSA), single-stranded break repair (SSBR), mismatch repair (MMR), base excision repair (BER). nucleotide excision repair (NER), intrastrand cross-link (ICL), translesion synthesis (TLS), error -free postreplication repair (PRR) can be employed by the cell to repair a double-stranded or single-stranded break created by the nucleases.
[0250] In some embodiments, one or more different template polynucleotides are used for targeting integration of the transgene at one or more different target sites. For targeting integration at different target sites, one or more genetic disruptions (e.g., DNA break) are generated at one or more of the target sites; and one or more different homology sequences are used for targeting integration of the transgene into the respective target site. In some embodiments, the transgene inserted at each site is the same or substantially the same. In some embodiments, transgene inserted at each site are different. In some embodiments, two or more different transgenes, encoding two or more different domains or chains of a protein, is inserted at one or more target sites.
[0251] The sequence of interest in the template polynucleotide may comprise one or more sequences encoding a functional polypeptide (e.g., a cDNA), with or without a promoter.
[0252] In some embodiments, nuclease-induced HDR results in an insertion of a transgene (also called “exogenous sequence" or “transgene sequence") for expression of a transgene for targeted insertion. The template polynucleotide sequence is typically not identical to the genomic sequence where it is placed. A template polynucleotide sequence can contain a non-homologous sequence flanked by two regions of homology to allow for efficient HDR at the location of interest. Additionally, template polynucleotide sequence can comprise a vector molecule containing sequences that are not homologous to the region of interest in cellular chromatin. A template polynucleotide sequence can contain several, discontinuous regions of homology to cellular chromatin. For example, for targeted insertion of sequences not normally present in a region of interest, said sequences can be present in a transgene and flanked by regions of homology to sequence in the region of interest.
[0253] In some aspects, nucleic acid sequences of interest, including coding and / or non-coding sequences and / or partial coding sequences, that are inserted or integrated at the target location in the genome can also be referred to as “transgene,” “transgene sequences,” “exogenous nucleic acids sequences,” “heterologous sequences” or “donor sequences.” In some aspects, the transgene is a nucleic acid sequence that is exogenous or heterologous to an endogenous genomic sequences, such as the endogenous genomic sequences at a specific target locus or target location in the genome, of a T cell, e.g., a human T cell. In some aspects, the transgene is a sequence that is modified or different compared to an endogenous genomic sequence at a target locus or target location of a T cell, e.g., a human T cell. In some aspects, the transgene is a nucleic acid sequence that originates from or is modified compared to nucleic acid sequences from different genes, species and / or origins. In some aspects, tire transgene is a sequence that is derived from a sequence from a different locus, e.g., a different genomic region or a different gene, of the same species.
[0254] Polynucleotides for insertion can also be referred to as “transgene” or “exogenous sequences” or “donor” polynucleotides or molecules. The template polynucleotide can be DNA, singlestranded and / or double-stranded and can be introduced into a cell in linear or circular form. The template polynucleotide can be RNA single-stranded and / or double-stranded and can be introduced as a RNA molecule (e.g.. part of an RNA virus). See also, U. S. Patent Publication Nos. 20100047805 and 20110207221. The template polynucleotide can also be introduced in DNA form, which may be introduced into the cell in circular or linear form. If introduced in linear form, the ends of the template polynucleotide can be protected (e.g., from exonucleolytic degradation) by known methods. For example, one or more dideoxynucleotide residues are added to the 3’ terminus of a linear molecule and / or self-complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al. (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al. (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified intemucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues. If introduced in double-stranded form, the template polynucleotide may include one or more nuclease target site(s), for example, nuclease target sites flanking the transgene to be integrated into the cell's genome. See. e.g., U. S. Patent Publication No. 20130326645.
[0255] In some embodiments, the double-stranded template polynucleotide includes sequences (also referred to as transgene) greater than 1 kb in length, for example between 2 and 200 kb, between 2 and 10 kb (or any value therebetween). The double-stranded template polynucleotide also includes at least one nuclease target site, for example. Typically, the nuclease target sites are outside the transgene sequences, for example. 5’ and / or 3’ to the transgene sequences, for cleavage of the transgene. The nuclease cleavage site(s) may be for any nuclease(s). In some embodiments, the nuclease target site(s) containedin the double-stranded template polynucleotide are for the same nuclease(s) used to cleave the endogenous target into which the cleaved template polynucleotide is integrated via homologyindependent methods.
[0256] In some embodiments, the nucleic acid template system is double stranded. In some embodiments, the nucleic acid template system is single stranded. In some embodiments, the nucleic acid template system comprises a single stranded portion and a double stranded portion.
[0257] In some embodiments, the presence of a genetic disruption (e.g., a DNA break, such as described in Section I. B, and a template polynucleotide containing one or more homology arms (e.g., containing nucleic acid sequences homologous sequences surrounding the genetic disruption) can induce or direct HDR. with homologous sequences acting as a template for DNA repair. Based on homology between the endogenous gene sequence surrounding the genetic disruption and the 5’ and / or 3’ homology arms included in the template polynucleotide, cellular DNA repair machinery can use the template polynucleotide to repair the DNA break and resynthesize genetic information at the site of the genetic disruption, thereby effectively inserting or integrating the transgene sequences in the template polynucleotide at or near the site of the genetic disruption. In some embodiments, the genetic disruption can be generated by any of the methods for generating a targeted genetic disruption described herein.
[0258] Also provided are polynucleotides (in some aspects, referred to as “template polynucleotides’’, e.g., comprising transgene sequences encoding a recombinant CAR or NK cell inhibitory moiety), as described herein. In some embodiments, the provided polynucleotides can be employed in the methods described herein, e.g.. involving HDR, to target transgene sequences.
[0259] In some embodiments, the template polynucleotide is or comprises a polynucleotide containing a transgene (exogenous or heterologous nucleic acids sequences) encoding a recombinant CAR or an NK cell inhibitory moiety (e.g., a recombinant HLA-E fusion protein or a portion thereof), and homolog}' sequences (e.g., homology arms) that are homologous to sequences at or near the endogenous genomic site, e.g., at the endogenous TRAC locus or at the endogenous B2M locus. In some aspects, the template polynucleotide is introduced as a linear DNA fragment or comprised in a vector. In some aspects, the step for inducing genetic disruption and the step for targeted integration (e.g., by introduction of the template polynucleotide) are performed simultaneously or sequentially.1. CAR Transgene
[0260] In some embodiments, the T cell is engineered with a chimeric antigen receptor. Any of a variety of CARs can be engineered into the T cell, such as any described in Section IV. In some embodiments, the CAR is introduced into the T cell by targeted insertion into a genomic loci in the T cell. In some embodiments, the targeted insertion is by HDR. In some embodiments, the targetedinsertion is by CRISPR / Cas-mediated HDR of a donor template comprising a polynucleotide sequence encoding the CAR. In some embodiments, the endogenous gene loci is any of the disrupted loci as described herein. In some embodiments, the endogenous gene locus is the endogenous TRAC gene.
[0261] In some aspects, in the presence of a genetic disruption at a target site at a TRAC locus (e.g., as described in Section I. B.l), and a polynucleotide, such as the template polynucleotide having homology with sequences at or near the target site in an endogenous TRAC locus, can be used to modify the DNA in the T cell by targeted insertion (for example, a knock-in (KI)) of a transgene (e.g., a recombinant CAR). In some embodiment, the transgene is targeted at or around the TRAC locus, for example by homology-dependent repair (HDR). In some embodiments, the homology sequences of the template polynucleotide target the transgene at a TRAC locus.
[0262] In some embodiments, a polynucleotide, such as a template polynucleotide having homology with sequences at or near one or more target site(s) in the endogenous DNA can be used to alter the structure of a target DNA, e.g., targeted insertion of the transgene encoding a recombinant CAR or a portion thereof. In some embodiments, the template polynucleotide contains homology sequences (e.g.. homology arms) flanking the transgene, e.g., nucleic acid sequences encoding a recombinant CAR or a portion thereof, for targeted insertion. In some embodiments, the homology sequences target the transgene at a TRAC locus. In some aspects, the transgene encoding the CAR within the template polynucleotide can be used to guide the location of target sites and / or homology arms. In some aspects, the target site of genetic disruption of the TRAC gene can be used as a guide to design template polynucleotides and / or homology arms used for HDR. In some embodiments, the genetic disruption can be targeted near a desired site of targeted integration of transgene sequences (e.g., encoding a recombinant CAR or a portion thereof). In some aspects, the target site is within an exon of the open reading frame of the TRAC locus. In some aspects, the target site is within an intron of the open reading frame of the TRAC locus.
[0263] In some embodiments, the template polynucleotide includes additional sequences (coding or non-coding sequences) between the homology arms, such as a regulatory sequences, such as promoters and / or enhancers, splice donor and / or acceptor sites, internal ribosome entry site (IRES), sequences encoding ribosome skipping elements (e.g., 2A peptides), markers and / or SA sites, and / or one or more additional transgenes.
[0264] In some embodiments, the transgene contained in the polynucleotide, e.g.. template polynucleotide, comprises a sequence encoding a recombinant CAR or a portion thereof. In some embodiments, the transgene can encode any of the recombinant CARs described herein or any chains, regions and / or domains thereof. In some embodiments, the transgene encodes a recombinant chimericantigen receptor (CAR) or any chains, regions and / or domains thereof. In some aspects, the transgene encodes a CAR comprising a CD19-binding domain. In some aspects, the polynucleotide, e.g., template polynucleotide, comprises any transgene sequences provided herein or a nucleic acid sequence encoding any recombinant CAR described herein, e.g., in Section IV.
[0265] In some aspects, the polynucleotide, e.g., template polynucleotide, comprises any transgene sequences provided herein or a nucleic acid sequence encoding any recombinant CAR described herein, e.g., in Section IV. In some embodiments, the encoded recombinant CAR or portion thereof contains one or more domains that shares complete, e.g., at or about 100% identity, to all or a portion and / or fragment of an endogenous CAR constant domain.
[0266] In some embodiments, the transgene encoding the CAR comprises the nucleic acid sequence set forth in SEQ ID NO: 94, or a sequence that has at least at or about 90%, 91%, 92%, 93%. 94%, 95%, 96%, 97%, 98%. or 99% sequence identity to SEQ ID NO: 94.
[0267] In some embodiments, the transgene comprises a nucleic acid sequence having at or at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to all or a portion of the nucleic acid sequence set forth in SEQ ID NO: 94.
[0268] In certain embodiments, the polynucleotide, e.g.. template polynucleotide contains and / or includes a transgene encoding all or a portion of a recombinant CAR. In particular embodiments, the transgene is targeted at a target site(s) that is within a gene, locus, or open reading frame that encodes an endogenous receptor, e.g., an endogenous gene encoding one or more regions of a CAR.
[0269] In some embodiments, the template polynucleotide contains the transgene, e.g., recombinant CAR-encoding nucleic acid sequences, flanked by homology sequences (also called “homology arms”) on the 5’ and 3’ ends, to allow the DNA repair machinery, e.g., homologous recombination machinery, to use the template polynucleotide as a template for repair, effectively inserting the transgene into the target site of integration in the genome. The homology arm should extend at least as far as the region in which end may occur, e.g., in order to allow the resected single stranded overhang to find a complementary region within the template polynucleotide. The overall length could be limited by parameters such as plasmid size or viral packaging limits. In some embodiments, a homology arm does not extend into repeated elements, e.g., ALU repeats or LINE repeats.
[0270] Exemplary homology arm lengths include at least or at least about or is or is about 50, 100.200. 250, 300, 400, 500, 600, 700, 750, 800. 900, 1000, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, the homology arm length is 50-100, 100-250, 250-500. 500-750, 750-1000, 1000-2000, 2000-3000, 3000-4000, or 4000-5000 nucleotides. Exemplary homology arm lengths include less than orless than about or is or is about 50, 100, 200, 250, 300, 400, 500, 600. 700, 750, 800, 900, 1000, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, the homology arm length is 50-100, 100-250, 250-500, 500-750, 750-1000, 1000-2000, 2000-3000, 3000-4000, or 4000-5000 nucleotides.
[0271] In some embodiments, the template polynucleotide comprises about 500 to 1000, e.g., 600 to 900 or 700 to 800, base pairs of homology on either side of the target site at the endogenous gene, such as a second target site at an endogenous TRAC locus. In some embodiments, the template polynucleotide comprises at least or less than or about 200, 300, 400, 500. 600, 700, 800. 900 or 1000 base pairs, homology 5’ of the target site, 3’ of the target site, or both 5’ and 3’ of the target site, e.g., within the TRAC gene, locus, or open reading frame (e.g., described in Table 1 herein).
[0272] In some embodiments, the template polynucleotide comprises about 10, 20, 30, 40. 50, 100, 200. 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 base pairs homology 3’ of the target site. In some embodiments, the template polynucleotide comprises about 100 to 500, 200 to 400 or 250 to 350, base pairs homolog}' 3’ of the transgene and / or target site. In some embodiments, the template polynucleotide comprises less than about 100, 90. 80, 70, 60, 50, 40, 30, 20, 15, or 10 base pairs homology 5’ of the target site, e.g., within the TRAC gene, locus, or open reading frame (e.g., described in Table 1 herein). In some embodiments, the template polynucleotide comprises about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 base pairs homology 5’ of the target site. In some embodiments, the template polynucleotide comprises about 100 to 500, 200 to 400 or 250 to 350, base pairs homology 5' of the transgene and / or target site. In some embodiments, the template polynucleotide comprises less than about 100. 90, 80, 70, 60, 50, 40, 30, 20, 15, or 10 base pairs homology 3’ of the target site, e g., within the TRAC gene, locus, or open reading frame (e.g., described in Table 1 herein).
[0273] In some embodiments, a template polynucleotide is to a nucleic acid sequence which can be used in conjunction with one or more agent(s) capable of introducing a genetic disruption to alter the structure of a target site. In some embodiments, the target site is modified to have the some or all of the sequence of the template polynucleotide, typically at or near cleavage site(s). In some embodiments, the template polynucleotide is single stranded. In some embodiments, the template polynucleotide is double stranded. In some embodiments, the template polynucleotide is DNA. e.g., double stranded DNA. In some embodiments, the template polynucleotide is single stranded DNA. In some embodiments, the template polynucleotide is encoded on the same vector backbone, e.g. AAV genome, plasmid DNA, as the Cas9 and gRNA. In some embodiments, the template polynucleotide is excised from a vector backbone in vivo, e.g., it is flanked by gRNA recognition sequences. In some embodiments, the template polynucleotide is on a separate polynucleotide molecule as the Cas9 and gRNA. In some embodiments, the Cas9 and the gRNA are introduced in the form of a ribonucleoprotein (RNP) complex, and dietemplate polynucleotide is introduced as a polynucleotide molecule, e.g., in a vector.
[0274] In some embodiments, the polynucleotide, e.g., template polynucleotide, alters the structure of the target site, e.g., insertion of transgene, by participating in a homology directed repair event. In some embodiments, the template polynucleotide alters the sequence of the target site. In some embodiments, the template polynucleotide includes sequence that corresponds to a site on the target sequence that is cleaved by one or more agent(s) capable of introducing a genetic disruption. In some embodiments, the template polynucleotide includes sequence that corresponds to both, a first site on the target sequence that is cleaved in a first agent capable of introducing a genetic disruption, and a second site on the target sequence that is cleaved in a second agent capable of introducing a genetic disruption.
[0275] In some embodiments, a template polynucleotide comprises the following components: [5’ homology7arm]-[transgene]-[3’ homology arm]. The homology arms provide for recombination into the chromosome, thus insertion of the transgene into the DNA at or near the cleavage site, e.g., target site(s). In some embodiments, the homology arms flank the most distal target site(s).
[0276] In some embodiments, the 3’ end of the 5‘ homology arm is the position next to the 5‘ end of the transgene. In some embodiments, the 5‘ homology arm can extend at least 10, 20, 30, 40, 50, 100, 200, 300, 400. 500, 600, 700. 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides 5’ from the 5’ end of the transgene. In some embodiments, the 5’ end of the 3’ homology arm is the position next to the 3’ end of the transgene. In some embodiments, the 3’ homology arm can extend at least 10, 20, 30. 40, 50, 100. 200, 300, 400, 500, 600. 700, 800, 900. 1000. 1500. 2000. 3000. 4000, or 5000 nucleotides 3’ from the 3’ end of the transgene.
[0277] In some embodiments, for targeted insertion, the homology arms, e.g.. the 5’ and 3’ homology arms, may each comprise about 1000 base pairs (bp) of sequence flanking the most distal gRNAs (e.g., 1000 bp of sequence on either side of the target site).
[0278] It is contemplated herein that one or both homology anns may be shortened to avoid including certain sequence repeat elements, e.g.. Alu repeats or LINE elements. For example, a 5’ homology arm may be shortened to avoid a sequence repeat element. In some embodiments, a 3 ’ homology arm may be shortened to avoid a sequence repeat element. In some embodiments, both the 5’ and the 3 ’ homology arms may be shortened to avoid including certain sequence repeat elements. It is contemplated herein that template polynucleotides for targeted insertion may be designed for use as a single-stranded oligonucleotide, e.g., a single -stranded oligodeoxynucleotide (ssODN). When using a ssODN. 5’ and 3’ homology arms may range up to about 200 base pairs (bp) in length, e.g., at least 25.50, 75, 100, 125, 150, 175, or 200 bp in length. Longer homology arms are also contemplated for ssODNs as improvements in oligonucleotide synthesis continue to be made. In some embodiments, alonger homology arm is made by a method other than chemical synthesis, e.g., by denaturing a long double stranded nucleic acid and purifying one of the strands, e.g., by affinity for a strand-specific sequence anchored to a solid substrate.
[0279] Similarly, in some embodiments, the template polynucleotide has a 5' homology arm, a transgene, and a 3’ homology arm, such that the template polynucleotide extends substantially the same distance on either side of the target site. For example, the homology arms may have different lengths, but the transgene may be selected to compensate for this. For example, the transgene may extend further 5’ from the target site than it does 3’ of the target site, but the homology arm 5’ of the target site is shorter than the homology arm 3’ of the target site, to compensate. The converse is also possible, e.g.. that the transgene may extend further 3’ from the target site than it does 5’ of the target site, but the homology arm 3’ of the target site is shorter than the homology arm 5’ of the target site, to compensate.
[0280] The template polynucleotide can be linear single stranded DNA. In some embodiments, the template polynucleotide is (i) linear single stranded DNA that can anneal to the nicked strand of the target DNA, (ii) linear single stranded DNA that can anneal to the intact strand of the target DNA, (iii) linear single stranded DNA that can anneal to the transcribed strand of the target DNA, (iv) linear single stranded DNA that can anneal to the non-transcribed strand of the target DNA, or more than one of the preceding.
[0281] In some embodiments, the template polynucleotide is a single stranded nucleic acid. In another embodiment, the template polynucleotide is a double stranded nucleic acid. In some embodiments, the template polynucleotide is linear double stranded DNA. The length may be. e.g.. about 200-5000 nucleotides, e.g.. about 200, 300, 400. 500, 600. 700, 800, 900. 1000. 1200. 1400. 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. The length may be, e.g., at least 200, 300, 400, 500, 600, 700. 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. In some embodiments, the length is no greater than 200, 300, 400. 500, 600. 700, 800, 900. 1000. 1200. 1400. 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. In some embodiments, a double stranded template polynucleotide has a length of about 160 nucleotides, e.g., about 200-4000. 300-3500. 400-3000, 500-2500, 600-2000, 700-1900. 800-1800, 900-1700, 1000-1600. 1100-1500 or 1200-1400 nucleotides.
[0282] In some embodiments, the template polynucleotide is circular double stranded DNA, e.g., a plasmid. In some embodiments, the template polynucleotide comprises about 500 to 1000 nucleotides of homology on either side of the transgene and / or the target site. In some embodiments, the template polynucleotide comprises about 10. 20, 30, 40, 50. 100, 200, 300, 400, 500, 600, 700, 800. 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3’ of the target site or transgene,or both 5’ and 3' of the target site or transgene. In some embodiments, the template polynucleotide comprises at least 10, 20. 30, 40, 50, 100, 200. 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotide comprises no more than 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene.
[0283] In some embodiments, the template polynucleotide contains homology arms for targeting the endogenous TRAC locus. In some embodiments, the genetic disruption of the TRAC locus is introduced at early coding region the gene, including sequence immediately following a transcription start site, within a first exon of the coding sequence, or within 500 bp of the transcription start site (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp), or within 500 bp of the start codon (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp). In some embodiments, the genetic disruption is introduced using any of the targeted nucleases and / or gRNAs described in Section I. B.l herein. In some embodiments, the template polynucleotide comprises about 500 to 1000, e g., 600 to 900 or 700 to 800. nucleotides of homology on either side of the genetic disruption introduced by the targeted nucleases and / or gRNAs. In some embodiments, the template polynucleotide comprises about 500. 600, 700, 800.900 or 1000 nucleotides of 5’ homology arm sequences, which is homologous to 500, 600. 700, 800, 900 or 1000 nucleotides of sequences 5’ of the genetic disruption (e.g., at TRAC locus), the transgene, and about 500. 600, 700, 800, 900 or 1000 nucleotides of 3’ homology arm sequences, which is homologous to 500, 600, 700, 800, 900 or 1000 nucleotides of sequences 3’ of the genetic disruption (e.g., at TRAC locus). In some embodiments, exemplary 5’ and 3’ homology arms for targeted integration at the TRAC locus are set forth in SEQ ID NO: 76 and 77, respectively.
[0284] In some instances, the template polynucleotide comprises a promoter, e g., a promoter that is exogenous and / or not present at or near the target locus. In some embodiments in which the functional polypeptide encoding sequences are promoterless, expression of the integrated transgene is then ensured by transcription driven by an endogenous promoter or other control element in the region of interest.
[0285] The transgene, including the transgene encoding the recombinant CAR or a portion thereof, can be inserted so that its expression is driven by the endogenous promoter at the integration site, namely the promoter that drives expression of the endogenous gene into which the transgene is inserted (e.g., TRAC). For example, the coding sequences in the transgene can be inserted without a promoter, but inframe with the coding sequence of the endogenous target gene, such that expression of the integrated transgcnc is controlled by the transcription of the endogenous promoter at the integration site. In some embodiments, the transgene encoding the recombinant CAR or a portion thereof and / or the one or morefurther transgene independently is operably linked to the endogenous promoter of the gene at the target site. In some embodiments, a ribosome skipping element / self-cleavage element, such as a 2A element, is placed upstream of the transgene coding sequence, such that the ribosome skipping element / self-cleavage element is placed in-frame with the endogenous gene, such that the expression of the transgene encoding tlie recombinant or a portion thereof and / or the one or more further transgene is operably linked to the endogenous promoter.
[0286] In some embodiments, the transgene encoding the recombinant CAR or a portion thereof and / or the one or more second transgene independently comprises one or more multicistronic element(s). In some embodiments, the one or more multicistronic element(s) are upstream of the transgene encoding the recombinant CAR or a portion thereof and / or the one or more second transgene. In some embodiments, the multicistronic element(s) is positioned between the transgene encoding the recombinant CAR or a portion thereof and the one or more second transgene. In some embodiments, the ribosome skip element comprises a sequence encoding a ribosome skip element selected from among a T2A, a P2A. a E2A or a F2A or an internal ribosome entry site (IRES).
[0287] The transgene may be inserted into an endogenous gene such that all, some or none of the endogenous gene is expressed. In some embodiments, the transgene (e.g., with or without peptide-encoding sequences) is integrated into any endogenous locus. In some embodiments, the transgene is integrated into an endogenous TRAC locus.
[0288] In some embodiments, exogenous sequences may also include transcriptional or translational regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals. Further, the control elements of the genes of interest can be operably linked to reporter genes to create chimeric genes (e.g., reporter expression cassettes). In an exemplary embodiment, the template polynucleotide includes homology arms for targeting at the TRAC locus, regulatory sequences, e.g.. promoter, and nucleic acid sequences encoding a recombinant CAR.
[0289] In some cases, the ribosome skipping element / self-cleavage element, such as a T2A, can cause the ribosome to skip (ribosome skipping) synthesis of a peptide bond at the C-tenninus of a 2A element, leading to separation between the end of the 2A sequence and the next peptide downstream (see, for example, de Felipe, Genetic Vaccines and Ther. 2:13 (2004) and de Felipe et al. Traffic 5:616-626 (2004)). This allows the inserted transgene to be controlled by the transcription of the endogenous promoter at the integration site, e.g., TRAC promoter. Exemplary' ribosome skipping element / self-cleavage element include 2A sequences from the foot-and-mouth disease virus (F2A, e.g., SEQ ID NO: 95). equine rhinitis A virus (E2A, e.g., SEQ ID NO: 96). Thosea asigna virus (T2A, e.g., SEQ ID NO: 97or SEQ ID NO: 98), and porcine teschovirus-1 (P2A, e.g., ID NO: 99 or SEQ ID NO: 100) as described in U. S. Patent Publication No. 20070116690. In some embodiments, the template polynucleotide includes a P2A ribosome skipping element (sequence set forth in SEQ ID NO: 99 or SEQ ID NO: 100 upstream of the transgene, e.g., recombinant TCR encoding nucleic acids or between the sequences encoding a TCRa chain and the sequences encoding a TCR[3 chain.
[0290] In some embodiments, transgene may comprise a promoter and / or enhancer, for example a constitutive promoter or an inducible or tissue-specific promoter. In some embodiments, the promoter is or comprises a constitutive promoter. Exemplary constitutive promoters include, any described herein, such as a human elongation factor la promoter (EF1α). In some embodiments, the constitutive promoter is a synthetic or modified promoter. In some embodiments, the promoter is a tissue-specific promoter or a viral promoter. In some embodiments, the promoter is a non-viral promoter. In some embodiments, the promoter is a modified EF1αpromoter with HTLV1 enhancer, for example set forth in SEQ ID NO: 91. In some embodiments, the transgene does not include a regulatory element, e.g. promoter.
[0291] In some embodiments, a “tandem” cassette is integrated into the selected site. In some embodiments, one or more of the “tandem” cassettes encode one or more polypeptide or factors, each independently controlled by a regulator}’ element or all controlled as a multi-cistronic expression system. In some embodiments, such as those where the polynucleotide contains a first and second nucleic acid sequence, the coding sequences encoding each of the different polypeptide chains can be operatively linked to a promoter, which can be the same or different. In some embodiments, the nucleic acid molecule can contain a promoter that drives the expression of two or more different polypeptide chains. In some embodiments, such nucleic acid molecules can be multicistronic (bicistronic or tricistronic, see e.g., U. S. Patent No. 6.060,273). In some embodiments, transcription units can be engineered as a bicistronic unit containing an IRES (internal ribosome entry site), which allows coexpression of gene products by a message from a single promoter. Alternatively, in some cases, a single promoter may direct expression of an RNA that contains, in a single open reading frame (ORF), two or three polypeptides separated from one another by sequences encoding a self-cleavage peptide (e.g., 2A sequences) or a protease recognition site (e.g., furin), as described herein. The ORF thus encodes a single polypeptide, which, either during (in the case of 2A) or after translation, is processed into the individual proteins. In some embodiments, the “tandem cassette” includes the first component of the cassette comprising a promoterless sequence, followed by a transcription termination sequence, and a second sequence, encoding an autonomous expression cassette or a multi-cistronic expression sequence. In some embodiments, the tandem cassette encodes two or more different polypeptides or factors, e.g., two or more chains or domains of a recombinant TCR. In some embodiments, nucleic acid sequences encoding two or more chains or domains of the recombinant TCR are introduced as tandem expression cassettes or bi- or multi-cistronic cassettes, into one target DNA integration site.
[0292] The transgene may be inserted into an endogenous gene such that all, some or none of the endogenous gene is expressed. In some embodiments, the transgene (e.g., with or without peptide-encoding sequences) is integrated into any endogenous locus. In some embodiments, the transgene is integrated into an endogenous TRAC locus.
[0293] In some embodiments, exogenous sequences may also include transcriptional or translational regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals. Further, the control elements of the genes of interest can be operably linked to reporter genes to create chimeric genes (e.g., reporter expression cassettes). In an exemplary embodiment, the template polynucleotide includes homology arms for targeting at the TRAC locus, regulatory sequences, e.g., promoter, and nucleic acid sequences encoding a recombinant TCR.
[0294] In some embodiments, exemplary template polynucleotides contain transgene encoding a recombinant T cell receptor under the operable control of the human elongation factor 1 alpha (EF1α) promoter with HTLV1 enhancer (sequence set forth in SEQ ID NO: 91), 5’ homology arm sequence of approximately 600 bp (e.g., set forth in SEQ ID NO: 76), 3’ homology7arm sequence of approximately 600 bp (e.g., set forth in SEQ ID NO: 77) that are homologous to sequences surrounding tire target integration site in exon 1 of the human TCRa constant domain (TRAC) gene.
[0295] In some embodiments, exemplary template polynucleotides contain transgene encoding a CAR (sequence set forth in SEQ ID NO: 136), 5’ homology ann sequence of approximately 600 bp (e.g.. set forth in SEQ ID NO: 76). 3’ homology arm sequence of approximately 600 bp (e.g., set forth in SEQ ID NO: 77) that are homologous to sequences surrounding the target integration site in exon 1 of the human TCRa constant domain (TRAC) gene. In some embodiments, the template polynucleotide further contains other nucleic acid sequences, e.g.. nucleic acid sequences encoding a marker, e.g.. a surface marker or a selection marker. In some embodiments, the template polynucleotide further contains viral vector sequences, e g., adeno-associated virus (AAV) vector sequences.
[0296] A polynucleotide can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance. Moreover, template polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with materials such as a liposome, nanoparticle or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
[0297] In other aspects, the template polynucleotide is delivered by viral and / or non-viral gene transfer methods. In some embodiments, the template polynucleotide is delivered to the cell via an adeno associated virus (AAV), such as any described herein.
[0298] In some embodiments, the template polynucleotide is comprised in a viral vector, and is at least at or about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000. 5250. 5500. 5750, 6000, 7000, 7500, 8000, 9000 or 10000 nucleotides in length, or any value between any of the foregoing. In some embodiments, the polynucleotide is comprised in a viral vector, and is between at or about 2500 and at or about 5000 nucleotides, at or about 3500 and at or about 4500 nucleotides, or at or about 3750 nucleotides and at or about 4250 nucleotides in length. In some embodiments, the polynucleotide is comprised in a viral vector, and is at or about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000 or 10000 nucleotides in length.
[0299] In some embodiments, the template polynucleotide is an adenovirus vector, e.g.. an AAV vector, e.g., a ssDNA molecule of a length and sequence that allows it to be packaged in an AAV capsid. The vector may be, e.g., less than 5 kb and may contain an ITR sequence that promotes packaging into the capsid. The vector may be integration-deficient. In some embodiments, the template polynucleotide comprises about 150 to 1000 nucleotides of homology on either side of the transgene and / or the target site. In some embodiments, the template polynucleotide comprises about 100, 150. 200, 300, 400. 500, 600. 700, 800, 900. 1000. 1500. or 2000 nucleotides 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotide comprises at least 100. 150, 200, 300, 400, 500. 600, 700, 800. 900, 1000, 1500, or 2000 nucleotides 5’ of the target site or transgene. 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotide comprises at most 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene.
[0300] In some embodiments, the template polynucleotide is a lentiviral vector, e.g., an IDLV (integration deficiency lentivirus).
[0301] The double-stranded template polynucleotides described herein may include one or more non-natural bases and / or backbones. In particular, insertion of a template polynucleotide with methylated cytosines may be carried out using the methods described herein to achieve a state of transcriptional quiescence in a region of interest.
[0302] The polynucleotide may comprise any transgene of interest (exogenous sequence).Exemplaty exogenous sequences include, but are not limited to any polypeptide coding sequence (e.g., cDNAs or fragments thereof), promoter sequences, enhancer sequences, epitope tags, marker genes, cleavage enzyme recognition sites and various types of expression constructs. Marker genes include, but are not limited to, sequences encoding proteins that mediate antibiotic resistance (e.g., ampicillin resistance, neomycin resistance, G418 resistance, puromycin resistance), sequences encoding colored orfluorescent or luminescent proteins (e.g., green fluorescent protein, enhanced green fluorescent protein, red fluorescent protein, luciferase), and proteins which mediate enhanced cell growth and / or gene amplification (e.g.. dihydrofolate reductase). Epitope tags include, for example, one or more copies of FLAG, His, myc, Tap, HA or any detectable amino acid sequence.
[0303] In some embodiments, the transgene comprises a polynucleotide encoding any polypeptide of which expression in the cell is desired, including, but not limited to antibodies, antigens, enzymes, receptors (cell surface or nuclear), hormones, lymphokines, cytokines, reporter polypeptides, growth factors, and functional fragments of any of the foregoing. In some embodiments, the coding sequences may be. for example, cDNAs.
[0304] In some embodiments, the transgene further encodes one or more marker(s). In some embodiments, the one or more marker(s) is a transduction marker, surrogate marker and / or a selection marker.
[0305] In some embodiments, the marker is a transduction marker or a surrogate marker. A transduction marker or a surrogate marker can be used to detect cells that have been introduced with the polynucleotide, e.g., a polynucleotide encoding a recombinant CAR. In some embodiments, the transduction marker can indicate or confirm modification of a cell. In some embodiments, the surrogate marker is a protein that is made to be co-expressed on the cell surface with the recombinant CAR. In particular embodiments, such a surrogate marker is a surface protein that has been modified to have little or no activity. In certain embodiments, the surrogate marker is encoded on the same polynucleotide that encodes the recombinant TCR. In some embodiments, the nucleic acid sequence encoding the recombinant TCR is operably linked to a nucleic acid sequence encoding a marker, optionally separated by an internal ribosome entry site (IRES), or a nucleic acid encoding a self-cleaving peptide or a peptide that causes ribosome skipping, such as a 2A sequence, such as a T2A, a P2A, an E2A or an F2A.Extrinsic marker genes may in some cases be utilized in connection with engineered cell to permit detection or selection of cells and. in some cases, also to promote cell suicide.
[0306] In some embodiments, the marker is a molecule, e.g., cell surface protein, not naturally found on T cells or not naturally found on the surface of T cells, or a portion thereof.
[0307] In some embodiments, the molecule is a non-self molecule, e.g., non-self protein, i.e., one that is not recognized as "‘self’ by the immune system of the host into which the cells will be adoptively transferred.
[0308] In some embodiments, the marker serves no therapeutic function and / or produces no effect other than to be used as a marker for genetic engineering, e.g., for selecting cells successfully engineered.In other embodiments, the marker may be a therapeutic molecule or molecule otherwise exerting some desired effect, such as a ligand for a cell to be encountered in vivo, such as a costimulatory or immune checkpoint molecule to enhance and / or dampen responses of the cells upon adoptive transfer and encounter with ligand.
[0309] In some embodiments, the polynucleotide contains the structure: [5' homology arm]-[transgene sequence] -[3' homology arm]. In some embodiments, the polynucleotide contains the structure: [5' homology arm]-[multicistronic element]-[transgene sequence]-[3' homology arm]. In some embodiments, the polynucleotide contains the structure: [5' homology arm] -[promoter] -[transgene sequence]-[3' homology arm],
[0310] Construction of such expression cassettes, following the teachings of the present specification, utilizes methodologies well known in molecular biology (see, for example. Ausubel or Maniatis). Before use of the expression cassette to generate a transgenic animal, the responsiveness of the expression cassette to the stress-inducer associated with selected control elements can be tested by introducing the expression cassette into a suitable cell line (e.g., primary cells, transformed cells, or immortalized cell lines).2. NK cell inhibitory moiety
[0311] In some embodiments, the T cell is genetically engineered with an NK cell inhibitory moiety’ that is a recombinant ligand of an NK inhibitory receptor. In some aspects, the provided engineered cells lack endogenous expression of, or have reduced expression of, a ligand for an NK inhibitory receptor, which may otherwise render the cell susceptible to NK cell-mediated cytotoxicity’. For instance, as a result of complete elimination of B2M in accord with provided methods, T cells can become more vulnerable to attack by Natural Killer (NK) cells, which treat them as non-sclf.
[0312] In some embodiments, the NK cell inhibitory moiety is introduced into the T cell by targeted insertion into a genomic loci in the T cell. In some embodiments, the targeted insertion is by HDR. In some embodiments, the targeted insertion is by CRISPR / Cas-mediated HDR of a donor template comprising a polynucleotide sequence encoding the NK cell inhibitory moiety’. In some embodiments, the endogenous gene loci is any of the disrupted loci as described herein. In some embodiments, the endogenous gene locus is the endogenous B2M gene.
[0313] In some aspects, in the presence of a genetic disruption at a target site at a B2M locus (e.g.. as described in Section I. B.2), and a polynucleotide, such as the template polynucleotide having homology with sequences at or near the target site in an endogenous B2M locus, can be used to modify the DNA in the T cell by targeted insertion (for example, a knock-in (KI)) of a transgcnc (e.g., encoding a recombinant HLA-E fusion protein). In some embodiments, the targeted insertion is at or around theB2M locus, for example by homology -dependent repair (HDR). In some embodiments, the homology sequences of the template polynucleotide target the transgene at a B2M locus.
[0314] In some aspects, the transgene (e.g.. exogenous nucleic acid sequences) within the template polynucleotide can be used to guide tire location of target sites and / or homology arms. In some aspects, the target site of genetic disruption can be used as a guide to design template polynucleotides and / or homology arms used for HDR. In some embodiments, the genetic disruption can be targeted near a desired site of targeted integration of transgene sequences (e.g., encoding a recombinant HLA-E fusion protein or a portion thereof). In some aspects, the target site is within an exon of the open reading frame of the B2M locus. In some aspects, the target site is within an intron of the open reading frame of the B2M locus.
[0315] In some embodiments, the recombinant NK cell modulator includes a ligand or binding portion of a ligand capable of binding to an NK cell inhibitory receptor CD94 / NKG2A, LIR-1 / ILT2, KIR2DL4, LIR-2 / ILT4 or SIRPa.
[0316] In some embodiments, the NK cell inhibitory moiety is an MHC-E (or HLA-E), MHC-G (or HLA-G) or CD47.
[0317] In some embodiments, the NK cell inhibitory moiety is CD47 (e.g., NCBI Ref. Sequence Nos. NP 001768.1 and NP 942088.1). CD47 engages with SIRPa and thrombospondin- 1 (TSP-1) and has established its role as an inhibitory receptor involved in immune evasion by cancers through inhibition of phagocytosis, antigen presentation, and T / NK cell inhibition. In particular, engagement of SIRPa by CD47 mediates a strong inhibitory signal in NK cells. An exemplary sequence of CD47 is set forth in SEQ ID NO:135. In some embodiments, the cell comprises a CD47 polypeptide having at least 95%, 96%, 97%. 98%, 99%, or more sequence identity to an amino acid sequence as set forth in SEQ ID NO:135. In some embodiments, the cell comprises a CD47 polypeptide having the amino acid sequence as set forth in SEQ ID NO:135. In some embodiments, the polynucleotide encoding CD47 is operably linked to a promoter. In some embodiments, a transgene polynucleotide sequence encoding CD47 is integrated into the genome of the cell by targeted or non-targeted methods of insertion, such as described further below.
[0318] In some embodiments, the NK cell inhibitory moiety includes an HLA-E or an HLA-G molecule. The sequence of an exemplary HLA-E is set forth in SEQ ID NO: 132 (corresponding to amino acids 164 to 500 of SEQ ID NO: 81). The sequence of an exemplary HLA-G is set forth in SEQ ID NO: 133. Expression of HLA-E and HLA-G on the surface of cells can be recognized by inhibitory receptor on NK cells to modulate NK cell activation. In some cases, the binding of peptides (e.g. nonameric peptides), typically derived from signal peptides of classical MHC class I molecules, canstabilize expression of HLA-E and HLA-G on the surface of cells. Typically, like the classical MHC molecules, HLA-E and HLA-G are expressed as a heterodimer containing an a heavy chain and a light chain (also called P-2 microglobulin). Thus, stable expression of HLA-E and HLA-G NK cell inhibitory receptors typically also require expression of B2M. In some cases, the complex of NKG2A and CD94 is involved in the recognition of HLA-E and its peptide (e.g. derived from a leader sequence of another peptide), which can mediate an inhibitory signal by the NK cell. In some embodiments, the inhibitory signal of HLA-G is mediated through the interaction with the NK receptors LIR-1 / ILT2, KIR2DL4 and, in some cases, ILT4.
[0319] In some embodiments, an HLA-E chain or HLA-G chain can be introduced into the cells, such as by using an expression vector. In some embodiments, the cell also expresses a 2 microglobulin ( 2M) or a component or functional fragment thereof. In some cases, at least a portion of the 2M enhances proper MHC folding and expression on the cell surface, including proper folding and expression of HLA-E or HLA-G. An exemplary sequence of 2M is set forth in SEQ ID NO: 134. In some embodiments, the 2M is covalently associated with the HLA-E or HLA-G. In some embodiments, the 2 is expressed as a hybrid or fusion molecule with HLA-E or HLA-G. In some embodiments, a single HLA-E chain or HLA-G chain and 2-microglobulin can be introduced into cell as a fusion protein. In some embodiments, expression of a recombinant HLA-E or HLA-G molecule on the surface of the cell can be stabilized by the addition of a binding peptide. In some embodiments, the binding peptide comprises a nonameric peptide.
[0320] Single chain fusion molecules of MHC proteins are known and described in the art (see e.g. published U. S. Pat. Appl. No. US20050196404. In some embodiments, the single chain fusion HLA-E or HLA-G protein comprises [32M or a functional portion thereof covalently linked to the mature a chain HLA-E or HLA-G or functional portion thereof. In some embodiments, the a chain HLA-E or HLA-G can include a transmembrane domain for cell surface expression of the fusion molecule. In some embodiments, the transmembrane domain is the native transmembrane domain of the a chain of the HLA-E or HLA-G. In some embodiments, the single chain fusion can further include a HLA-E or HLA-G binding peptide sufficient to stabilize expression of the HLA-E or HLA-G molecule on the surface. For example, in some embodiment, for stable expression of HLA-E, the binding peptide is a leader sequence of another MHC class I molecule, such as a classical MHC class I molecule, as described or known in the art.
[0321] In some embodiments, the binding peptide is a portion of a signal sequence from an MHC class I molecule. In some embodiments, the binding peptide is VMAPRTLVL (SEQ ID NO: 107), VMAPRTLLL (SEQ ID NO: 108), VMAPRTVLL (SEQ ID NO: 109), VMAPRTLFL (SEQ ID NO:110), or VMAPRTLIL (SEQ ID NO: 111). In some embodiments, the binding peptide is VMAPRTLVL (SEQ ID NO: 107).
[0322] In some embodiments, the single chain MHC fusion molecule includes one or more linkers joining the components of the fusion molecule. In some embodiments, the fusion comprises one or more linkers between the binding peptide and B2M. the B2M and class I (e.g. HLA-E) a chain and / or between the binding peptide and class I a chain. In some embodiments, the fusion molecule is constructed to contain in order: HLA-E binding peptide, linker 1. B2M. linker 2 and HLA-E a chain. The linker typically is a peptide linker, e.g., a flexible and / or soluble peptide linker. Among the linkers are those rich in glycine and serine and / or in some cases threonine. In some embodiments, the linker comprises 10 to 20 residues, such as at least or about 10, 15, or 20 residues. In some embodiments, one or more linkers is (G₄S)₃₋₄ (SEQ ID NO: 101). In some embodiments, the linker is (G₄S)₂₋₃ (SEQ ID NO: 102) or GGGAS(G₄S)₂ (SEQ ID NO: 103). In some embodiments, the encoding nucleic acid molecule of the HLA-E fusion protein can include an N-terminal signal sequence for entry into the ER is required. In some embodiments, the signal sequence of B2M is normally used.
[0323] In some embodiments, the MHC molecule is a single chain trimer (SCT). In some embodiments, the SCT comprises a single polypeptide comprising an antigenic peptide followed by a first flexible linker that connects the C terminus of the peptide to die N terminus of a B2M, and a second flexible linker that connects the C terminus of the B2M with the N terminus of a heavy' chain of an HLA-E molecule. In some embodiments, the linker comprises a cysteine, which can form a disulfide bond with a cysteine on die HLA-E heavy chain, including a disulfide trap SCT (dtSCT). For example, in some embodiments the linker between the peptide and the B2M comprises the sequence GCGASGGGGSGGGGS (SEQ ID NO: 104). Examples of SCT molecules are known in the art, including, for example, as described in US20050196404.
[0324] In some embodiments, the covalently linked peptide epitope is cleaved via a built-in protease cleavage site, and the cleaved peptide epitope can bind to the peptide binding site of the single chain protein for stabilization of the molecule.
[0325] In some embodiments, the transgene encoding the HLA-E fusion protein comprises a nucleotide sequence recited in SEQ ID NO: 138 or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 138. In some embodiments, the nucleotide sequence of the transgene is recited in SEQ ID NO: 138.
[0326] In some embodiments, a polynucleotide, such as a template polynucleotide having homology with sequences at or near one or more target site(s) in the endogenous DNA can be used to alter the structure of a target DNA, e.g., targeted insertion of the transgene encoding an NK cell inhibitory moiety.such as a recombinant HLA-E fusion protein or a portion thereof. In some embodiments, the template polynucleotide contains homology sequences (e.g., homology arms) flanking the transgene, e.g., nucleic acid sequences encoding a recombinant HLA-E fusion protein or a portion thereof, for targeted insertion. In some embodiments, the homology’ sequences target the transgene at a B2M locus. In some embodiments, the template polynucleotide includes additional sequences (coding or non-coding sequences) between the homology’ arms, such as a regulatory sequences, such as promoters and / or enhancers, splice donor and / or acceptor sites, internal ribosome entry site (IRES), sequences encoding ribosome skipping elements (e.g., 2A peptides), markers and / or SA sites, and / or one or more additional transgenes. In some embodiments, the transgene contained in the polynucleotide, e.g., template polynucleotide, comprises a sequence encoding a recombinant HLA-E fusion protein or a portion thereof. In some embodiments, the transgene can encode any of the recombinant HLA-E molecules described herein. In some aspects, the polynucleotide, e.g., template polynucleotide, comprises any transgene sequences provided herein or a nucleic acid sequence encoding any recombinant HLA-E described herein.
[0327] In certain embodiments, the polynucleotide, e.g.. template polynucleotide contains and / or includes a transgene encoding all or a portion of a recombinant HLA-E fusion protein. In particular embodiments, the transgene is targeted at a target site(s) that is within a gene, locus, or open reading frame that encodes an endogenous receptor, e.g.. an endogenous gene encoding one or more regions of a HLA-E fusion protein.
[0328] In some embodiments, the template poly nucleotide contains the transgene, e.g., recombinant HLA-E -encoding nucleic acid sequences, flanked by homology' sequences (also called “homology arms”) on the 5’ and 3’ ends, to allow the DNA repair machinery, e.g., homologous recombination machinery, to use the template polynucleotide as a template for repair, effectively inserting the transgene into the target site of integration in the genome. The homology arm should extend at least as far as the region in which end resection may occur, e.g., in order to allow the resected single stranded overhang to find a complementary region within the template polynucleotide. The overall length could be limited by parameters such as plasmid size or viral packaging limits. In some embodiments, a homology arm does not extend into repeated elements, e.g.. ALU repeats or LINE repeats.
[0329] Exemplary’ homology arm lengths include at least or at least about or is or is about 50, 100.200, 250, 300, 400, 500, 600, 700, 750, 800. 900, 1000, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, the homology’ arm length is 50-100, 100-250, 250-500. 500-750, 750-1000, 1000-2000, 2000-3000, 3000-4000, or 4000-5000 nucleotides. Exemplary’ homology’ arm lengths include less than or less than about or is or is about 50, 100, 200, 250, 300, 400, 500, 600, 700, 750, 800, 900, 1000, 2000, 3000, 4000, or 5000 nucleotides. In some embodiments, the homology arm length is 50-100, 100-250,250-500, 500-750, 750-1000, 1000-2000, 2000-3000, 3000-4000. or 4000-5000 nucleotides.
[0330] In some embodiments, the template polynucleotide comprises about 500 to 1000, e.g., 600 to 900 or 700 to 800, base pairs of homology on either side of the target site at the endogenous gene, such as a second target site at an endogenous B2M locus. In some embodiments, the template polynucleotide comprises at least or less than or about 200, 300, 400, 500, 600, 700, 800. 900 or 1000 base pairs, homology 5’ of the target site, 3’ of the target site, or both 5’ and 3’ of the target site, e.g., within the B2M gene, locus, or open reading frame.
[0331] In some embodiments, the template polynucleotide comprises about 10, 20, 30, 40. 50, 100.200. 300, 400, 500. 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 base pairs homology 3’ of the target site. In some embodiments, the template polynucleotide comprises about 100 to 500, 200 to 400 or 250 to 350, base pairs homology’ 3’ of the transgene and / or target site. In some embodiments, the template polynucleotide comprises less than about 100, 90. 80, 70, 60, 50, 40, 30, 20, 15, or 10 base pairs homology 5’ of the target site, e.g., within the B2M gene, locus, or open reading frame. In some embodiments, the template polynucleotide comprises about 10, 20, 30, 40, 50. 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000. or 5000 base pairs homology 5’ of the target site. In some embodiments, the template polynucleotide comprises about 100 to 500, 200 to 400 or 250 to 350, base pairs homology 5’ of the transgene and / or target site. In some embodiments, the template polynucleotide comprises less than about 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, or 10 base pairs homology 3’ of the target site, e.g., witfiin the B2M gene, locus, or open reading frame.
[0332] In some embodiments, a template polynucleotide is to a nucleic acid sequence which can be used in conjunction with one or more agent(s) capable of introducing a genetic disruption to alter the structure of a target site. In some embodiments, the target site is modified to have the some or all of the sequence of the template polynucleotide, typically at or near cleavage site(s). In some embodiments, the template polynucleotide is single stranded. In some embodiments, the template polynucleotide is double stranded. In some embodiments, the template polynucleotide is DNA. e.g., double stranded DNA. In some embodiments, the template polynucleotide is single stranded DNA. In some embodiments, the template polynucleotide is encoded on the same vector backbone, e.g. AAV genome, plasmid DNA. as the Casl2a and gRNA. In some embodiments, the template polynucleotide is excised from a vector backbone in vivo, e.g., it is flanked by gRNA recognition sequences. In some embodiments, the template polynucleotide is on a separate polynucleotide molecule as the Casl2a and gRNA. In some embodiments, the Casl2a and the gRNA are introduced in the form of a ribonucleoprotein (RNP) complex, and the template polynucleotide is introduced as a polynucleotide molecule, e.g., in a vector. Types or nucleic acids and vectors for delivery' include any of those described in Section I. D.
[0333] In some embodiments, the polynucleotide, e.g., template polynucleotide, alters the structure of the target site, e.g., insertion of transgene, by participating in a homology directed repair event. In some embodiments, the template polynucleotide alters the sequence of the target site. In some embodiments, the template polynucleotide includes sequence that corresponds to a site on the target sequence that is cleaved by one or more agent(s) capable of introducing a genetic disruption. In some embodiments, the template polynucleotide includes sequence that corresponds to both, a first site on the target sequence that is cleaved in a first agent capable of introducing a genetic disruption, and a second site on the target sequence that is cleaved in a second agent capable of introducing a genetic disruption.
[0334] In some embodiments, a template polynucleotide comprises the following components: [5’ homology arm]-[transgene]-[3’ homology arm]. The homology arms provide for recombination into the chromosome, thus insertion of the transgene into the DNA at or near the cleavage site, e.g., target site(s). In some embodiments, the homology arms flank the most distal target site(s).
[0335] In some embodiments, the 3’ end of the 5‘ homology arm is the position next to the 5’ end of the transgene. In some embodiments, the 5’ homology arm can extend at least 10, 20, 30, 40. 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides 5’ from the 5' end of the transgene. In some embodiments, the 5' end of the 3’ homology' arm is the position next to the 3’ end of the transgene. In some embodiments, the 3’ homology' arm can extend at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides 3’ from the 3’ end of the transgene.
[0336] In some embodiments, for targeted insertion, the homology arms, e.g., the 5’ and 3’ homology arms, may each comprise about 1000 base pairs (bp) of sequence flanking the most distal gRNAs (e.g., 1000 bp of sequence on either side of the target site).
[0337] It is contemplated herein that one or both homology arms may be shortened to avoid including certain sequence repeat elements, e.g., Alu repeats or LINE elements. For example, a 5’ homology arm may be shortened to avoid a sequence repeat element. In some embodiments, a 3 ‘ homology arm may be shortened to avoid a sequence repeat element. In some embodiments, both the 5’ and the 3 ’ homology arms may be shortened to avoid including certain sequence repeat elements. It is contemplated herein that template polynucleotides for targeted insertion may be designed for use as a single-stranded oligonucleotide, e.g., a single -stranded oligodeoxynucleotide (ssODN). When using a ssODN, 5’ and 3’ homology arms may range up to about 200 base pairs (bp) in length, e.g., at least 25, 50, 75, 100, 125, 150, 175, or 200 bp in length. Longer homology' arms are also contemplated for ssODNs as improvements in oligonucleotide synthesis continue to be made. In some embodiments, a longer homology arm is made by a method other than chemical synthesis, e.g., by denaturing a longdouble stranded nucleic acid and purifying one of the strands, e.g., by affinity for a strand-specific sequence anchored to a solid substrate.
[0338] Similarly, in some embodiments, the template polynucleotide has a 5' homology arm, a transgene, and a 3’ homology arm, such that the template polynucleotide extends substantially the same distance on either side of the target site. For example, the homology arms may have different lengths, but the transgene may be selected to compensate for this. For example, the transgene may extend further 5’ from the target site than it does 3’ of the target site, but the homology arm 5’ of the target site is shorter than the homology arm 3’ of the target site, to compensate. The converse is also possible, e.g., that the transgene may extend further 3’ from the target site than it does 5’ of the target site, but the homology arm 3’ of the target site is shorter than the homology arm 5’ of the target site, to compensate.
[0339] The template polynucleotide can be linear single stranded DNA. In some embodiments, the template polynucleotide is (i) linear single stranded DNA that can anneal to the nicked strand of the target DNA, (ii) linear single stranded DNA that can anneal to the intact strand of the target DNA, (iii) linear single stranded DNA that can anneal to the transcribed strand of the target DNA, (iv) linear single stranded DNA that can anneal to the non-transcribed strand of the target DNA, or more than one of the preceding.
[0340] In some embodiments, the template polynucleotide is a single stranded nucleic acid. In another embodiment, the template polynucleotide is a double stranded nucleic acid. In some embodiments, the template polynucleotide is linear double stranded DNA. The length may be, e.g.. about 200-5000 nucleotides, e.g.. about 200, 300, 400. 500, 600, 700, 800, 900. 1000. 1200. 1400, 1600, 1800, 2000. 2500. 3000. 4000 or 5000 nucleotides. The length may be. e.g.. at least 200. 300, 400. 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. In some embodiments, the length is no greater than 200, 300, 400, 500, 600. 700. 800, 900, 1000. 1200. 1400, 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. In some embodiments, a double stranded template polynucleotide has a length of about 160 nucleotides, e.g., about 200-4000. 300-3500. 400-3000, 500-2500, 600-2000, 700-1900. 800-1800. 900-1700, 1000-1600. 1100-1500 or 1200-1400 nucleotides.
[0341] In some embodiments, the template polynucleotide is circular double stranded DNA, e.g., a plasmid. In some embodiments, the template polynucleotide comprises about 500 to 1000 nucleotides of homology on either side of the transgene and / or the target site. In some embodiments, the template polynucleotide comprises about 10. 20, 30, 40, 50. 100, 200, 300, 400, 500, 600, 700, 800. 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3‘ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotidecomprises at least 10, 20. 30, 40, 50, 100, 200. 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotide comprises no more than 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene.
[0342] In some embodiments, the length of any of the polynucleotides, e.g., template polynucleotides, is at or about 200-10000 nucleotides, e.g., at or about 200, 300, 400, 500. 600, 700, 800.900, 1000, 1200, 1400, 1600. 1800. 2000. 2500. 3000. 4000. 5000. 6000, 7000, 8000, 9000 or 10000 nucleotides, or a value between any of the foregoing. In some embodiments, the length is at least at or about 200, 300, 400. 500, 600, 700. 800, 900. 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10000 nucleotides, or a value between any of the foregoing. In some embodiments, the length is no greater than at or about 200, 300. 400, 500, 600. 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 4000, 5000, 6000. 7000. 8000. 9000 or 10000 nucleotides. In some embodiments, the length is at or about 200-4000. 300-3500. 400-3000, 500-2500, 600-2000, 700-1900, 800-1800, 900-1700, 1000-1600, 1100-1500 or 1200-1400 nucleotides. In some embodiments, the polynucleotide is at least at or about 2500. 2750. 3000. 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000 or 10000 nucleotides in length, or any value between any of the foregoing. In some embodiments, the polynucleotide is between at or about 2500 and at or about 5000 nucleotides, at or about 3500 and at or about 4500 nucleotides, or at or about 3750 nucleotides and at or about 4250 nucleotides in length. In some embodiments, the polynucleotide is at or about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000.7500, 8000, 9000 or 10000 nucleotides in length. The length is about 200-5000 base pairs, e.g., about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. The length is at least 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. In some embodiments, the length is no greater than 200, 300, 400, 500, 600, 700, 800. 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 4000 or 5000 nucleotides. In some embodiments, a single stranded template polynucleotide has a length of about 160 nucleotides, e.g., about 200-4000, 300-3500, 400-3000, 500-2500, 600-2000, 700-1900, 800-1800. 900-1700, 1000-1600, 1100-1500 or 1200-1400 nucleotides.
[0343] In some embodiments, the template polynucleotide contains homology arms for targeting the endogenous B2M locus. In some embodiments, the genetic disruption of the B2M locus is introduced at early coding region the gene, including sequence immediately following a transcription start site, within a first exon of the coding sequence, or within 500 bp of the transcription start site (e.g., less than 500, 450, 400. 350, 300, 250, 200, 150, 100 or 50 bp), or within 500 bp of the start codon (e.g., less than 500. 450,400. 350, 300, 250, 200, 150, 100 or 50 bp). In some embodiments, the genetic disruption is introduced using any of tire targeted nucleases and / or gRNAs described in Section LB herein. In some embodiments, the template polynucleotide comprises about 500 to 1000, e.g., 600 to 900 or 700 to 800. nucleotides of homology on either side of the genetic disruption introduced by the targeted nucleases and / or gRNAs. In some embodiments, the template polynucleotide comprises about 500, 600, 700, 800, 900 or 1000 nucleotides of 5‘ homolog}' arm sequences, which is homologous to 500, 600, 700, 800, 900 or 1000 nucleotides of sequences 5’ of the genetic disruption (e.g., at B2M locus), the transgene, and about 500, 600, 700, 800, 900 or 1000 nucleotides of 3’ homolog}' arm sequences, which is homologous to 500, 600, 700, 800, 900 or 1000 nucleotides of sequences 3 ‘ of the genetic disruption (e.g., at B2M locus). In some embodiments, exemplary 5’ and 3’ homology arms for targeted integration at the B2M locus are set forth in SEQ ID NO: 79 and SEQ ID NO: 80, respectively.
[0344] In some instances, the template polynucleotide comprises a promoter, e.g., a promoter that is exogenous and / or not present at or near the target locus. In some embodiments in which the functional polypeptide encoding sequences are promoterless, expression of the integrated transgene is then ensured by transcription driven by an endogenous promoter or other control element in the region of interest.
[0345] The transgene, including the transgene encoding the recombinant HLA-E fusion protein or a portion thereof, can be inserted so that its expression is driven by the endogenous promoter at the integration site, namely the promoter that drives expression of the endogenous gene into which the transgene is inserted (e.g., B2M). For example, the coding sequences in tire transgene can be inserted without a promoter, but in-frame with the coding sequence of the endogenous target gene, such that expression of the integrated transgene is controlled by the transcription of the endogenous promoter at the integration site. In some embodiments, the transgene encoding the recombinant HLA-E fusion protein or a portion thereof and / or the one or more further transgene independently is operably linked to the endogenous promoter of the gene at the target site. In some embodiments, a ribosome skipping element / self-cleavage element, such as a 2A element, is placed upstream of the transgene coding sequence, such that the ribosome skipping element / self-cleavage element is placed in-frame with the endogenous gene, such that the expression of the transgene encoding the recombinant or a portion thereof and / or the one or more further transgene is operably linked to the endogenous promoter.
[0346] In some embodiments, the transgene encoding the recombinant HLA-E fusion protein or a portion thereof and / or the one or more further transgene independently comprises one or more multicistronic element(s). In some embodiments, the one or more multicistronic element(s) are upstream of the transgene encoding the recombinant HLA-E fusion protein or a portion thereof and / or the one or more second transgcnc. In some embodiments, the multicistronic clcmcnt(s) is positioned between the transgene encoding the recombinant HLA-E fusion protein or a portion thereof and the one or moresecond transgene. In some embodiments, the ribosome skip element comprises a sequence encoding a ribosome skip element selected from among a T2A, a P2A. a E2A or a F2A or an internal ribosome entry site (IRES).
[0347] The transgene may be inserted into an endogenous gene such that all, some or none of the endogenous gene is expressed. In some embodiments, the transgene (e.g.. with or without peptide-encoding sequences) is integrated into any endogenous locus. In some embodiments, the transgene is integrated into an endogenous B2M locus.
[0348] In some embodiments, exogenous sequences may also include transcriptional or translational regulatory' sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals. Further, the control elements of the genes of interest can be operably linked to reporter genes to create chimeric genes (e.g., reporter expression cassettes). In an exemplary embodiment, the template polynucleotide includes homology arms for targeting at the B2M locus, regulatory' sequences, e.g., promoter, and nucleic acid sequences encoding a recombinant HLA-E.
[0349] In some embodiments, exemplary template polynucleotides contain a transgene encoding a HLA-E fusion protein (sequence set forth in SEQ ID NO: 86), 5’ homology arm sequence of approximately 800 bp (e.g., set forth in SEQ ID NO: 79), 3’ homology ann sequence of approximately 800 bp (e.g., set forth in SEQ ID NO: 80) that are homologous to sequences surrounding die target integration site of the human B2M gene. In some embodiments, the template polynucleotide further contains other nucleic acid sequences, e.g., nucleic acid sequences encoding a marker, e.g., a surface marker or a selection marker. In some embodiments, the template polynucleotide further contains viral vector sequences, e.g., adeno-associated virus (AAV) vector sequences. In some embodiments, a template polynucleotide for inserting an HLA-E fusion protein into an endogenous B2M locus comprises the sequence set forth in SEQ ID NO: 137.
[0350] A polynucleotide can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance. Moreover, template polynucleotides can be introduced as naked nucleic acid, as nucleic acid complexed with materials such as a liposome, nanoparticle or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)).
[0351] In other aspects, the template polynucleotide is delivered by viral and / or non-viral gene transfer methods. In some embodiments, the template polynucleotide is delivered to the cell via an adeno associated virus (AAV), such as any described herein.
[0352] In some embodiments, the template polynucleotide is comprised in a viral vector, and is at least at or about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000. 5250. 5500. 5750, 6000, 7000, 7500, 8000, 9000 or 10000 nucleotides in length, or any value between any of the foregoing. In some embodiments, the polynucleotide is comprised in a viral vector, and is between at or about 2500 and at or about 5000 nucleotides, at or about 3500 and at or about 4500 nucleotides, or at or about 3750 nucleotides and at or about 4250 nucleotides in length. In some embodiments, the polynucleotide is comprised in a viral vector, and is at or about 2500, 2750, 3000, 3250, 3500, 3750, 4000, 4250, 4500, 4760, 5000, 5250, 5500, 5750, 6000, 7000, 7500, 8000, 9000 or 10000 nucleotides in length.
[0353] In some embodiments, the template polynucleotide is an adenovirus vector, e.g.. an AAV vector, e.g., a ssDNA molecule of a length and sequence that allows it to be packaged in an AAV capsid. The vector may be, e.g., less than 5 kb and may contain an ITR sequence that promotes packaging into the capsid. The vector may be integration-deficient. In some embodiments, the template polynucleotide comprises about 150 to 1000 nucleotides of homology on either side of the transgene and / or the target site. In some embodiments, the template polynucleotide comprises about 100, 150. 200, 300, 400. 500, 600. 700, 800, 900. 1000. 1500. or 2000 nucleotides 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotide comprises at least 100. 150, 200, 300, 400, 500. 600, 700, 800. 900, 1000, 1500, or 2000 nucleotides 5’ of the target site or transgene. 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotide comprises at most 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene.
[0354] In some embodiments, the template polynucleotide is a lentiviral vector, e.g., an IDLV (integration deficiency lentivirus).
[0355] The double-stranded template polynucleotides described herein may include one or more non-natural bases and / or backbones. In particular, insertion of a template polynucleotide with methylated cytosines may be carried out using the methods described herein to achieve a state of transcriptional quiescence in a region of interest.
[0356] In some embodiments, die transgene further encodes one or more marker(s). In some embodiments, the one or more marker(s) is a transduction marker, surrogate marker and / or a selection marker.
[0357] In some embodiments, the marker is a transduction marker or a surrogate marker. A transduction marker or a surrogate marker can be used to detect cells that have been introduced with the polynucleotide, e.g., a polynucleotide encoding a recombinant HLA-E fusion protein. In someembodiments, the transduction marker can indicate or confirm modification of a cell. In some embodiments, the surrogate marker is a protein that is made to be co-expressed on the cell surface with the recombinant HLA-E fusion protein. In particular embodiments, such a surrogate marker is a surface protein that has been modified to have little or no activity.
[0358] In some embodiments, the polynucleotide contains the structure: [5' homology' arm]-[transgene sequence] -[3' homology arm]. In some embodiments, the polynucleotide contains the structure: [5' homology arm]-[multicistronic element]-[transgene sequence]-[3' homology arm]. In some embodiments, the polynucleotide contains the structure: [5' homology arm] -[promoter] -[transgene sequence]-[3' homology arm],
[0359] Construction of such expression cassettes, following the teachings of the present specification, utilizes methodologies well known in molecular biology (see, for example. Ausubel or Maniatis). Before use of the expression cassette to generate a transgenic animal, the responsiveness of the expression cassette to the stress-inducer associated with selected control elements can be tested by introducing the expression cassette into a suitable cell line (e.g., primary' cells, transformed cells, or immortalized cell lines).D. Delivery of Agents for Genetic Disruption and Template Polynucleotides
[0360] In some embodiments, the genetic disruption, such as a genetic disruption at an endogenous TRAC and / or B2M locus is carried out by delivering or introducing one or more agent(s) capable of inducing a genetic disruption, e.g., Cas9, Casl2a, and / or gRNA components, to a cell, using any of a number of known delivery' method or vehicle for introduction or transfer to cells, for example, using viral delivery vectors, or any of the known methods or vehicles for delivering Cas molecules and gRNAs. Exemplary' methods arc described in, e.g., Wang ct al. (2012) J. Immunother. 35(9): 689-701; Cooper ct al. (2003) Blood. 101:1637-1644; Verhoeyen et al. (2009) Methods Mol Biol. 506: 97-114; and Cavalieri et al. (2003) Blood. 102(2): 497-505. In some embodiments, nucleic acid sequences encoding one or more components of one or more agent(s) capable of inducing a genetic disruption is introduced into die cells, e.g., by any methods for introducing nucleic acids into a cell described herein or known. In some embodiments, a vector encoding components of one or more agent(s) capable of inducing a genetic disruption such as a CRISPR guide RNA and / or a Cas enzyme can be delivered into the cell.
[0361] In some embodiments, the one or more agent(s) capable of inducing a genetic disruption, e.g.. one or more agent(s) that is a Cas9 / gRNA and / or Casl2a / gRNA. is introduced into the cell as a ribonucleoprotein (RNP) complex. RNP complexes include a sequence of ribonucleotides, such as an RNA or a gRNA molecule, and a protein, such as a Cas9 protein, a Casl2a protein, or variant thereof. For example, the Cas protein is delivered as RNP complex that comprises a Cas protein and a gRNA molecule targeting the target sequence, e.g., using electroporation or other physical delivery method. Insome embodiments, the RNP is delivered into the cell via electroporation or other physical means, e.g., particle gun, Calcium Phosphate transfection, cell compression or squeezing. In some embodiments, the RNP can cross the plasma membrane of a cell without the need for additional delivery’ agents (e.g., small molecule agents, lipids, etc.). In some embodiments, delivery’ of the one or more agent(s) capable of inducing genetic disruption, e.g., CRISPR / Cas, as an RNP offers an advantage that the targeted disruption occurs transiently, e.g., in cells to which the RNP is introduced, without propagation of the agent to cell progenies. For example, delivery by RNP minimizes the agent from being inherited to its progenies, thereby reducing the chance of off-target genetic disruption in the progenies. In such cases, the genetic disruption and the integration of transgene can be inherited by the progeny cells, but without the agent itself, which may further introduce off-target genetic disruptions, being passed on to the progeny cells.
[0362] Agent(s) and components capable of inducing a genetic disruption, e.g., a Cas9 molecule and / or a Casl2a molecule and gRNA molecule, can be introduced into target cells in a variety of forms using a variety of delivery methods and formulations, as set forth in Tables 2 and 3, or methods described in. e.g., WO 2015 / 161276; US 2015 / 0056705, US 2016 / 0272999. US 2017 / 0211075; or US 2017 / 0016027. As described further herein, the delivery methods and formulations can be used to deliver template polynucleotides and / or other agents to the cell (such as those required for engineering the cells) in prior or subsequent steps of the methods described herein. When a Cas protein or gRNA component is encoded as DNA for delivery the DNA may typically’ but not necessarily’ include a control region, e.g., comprising a promoter, to effect expression. Exemplary promoters for Cas9 molecule sequences include, e.g.. CMV, EF1α, EFS, MSCV, PGK. or CAG promoters. Useful promoters for gRNAs include, e.g., Hl. EF-la, tRNA or U6 promoters. Promoters with similar or dissimilar strengths can be selected to tune the expression of components. Sequences encoding a Cas molecule may comprise a nuclear localization signal (NLS), e.g., an SV40 NLS. In some embodiments a promoter for a Cas molecule or a gRNA molecule may be, independently, inducible, tissue specific, or cell specific. In some embodiments, an agent capable of inducing a genetic disruption is introduced RNP complexes.Table 2. Exemplary Delivery' MethodsElementsCommentsCas gRNAMolecule(s) molecule(s)In this embodiment, a Cas molecule and a gRNA are transcribed DNA DNA from DNA. In this embodiment, they are encoded on separate molecules.ElementsCas gRNA CommentsMolecule(s) molecule(s)DNA In this embodiment, a Cas molecule and a gRNA are transcribed from DNA, here from a single molecule.In this embodiment, a Cas molecule is transcribed from DNA, and DNA RNAa gRNA is provided as in vitro transcribed or synthesized RNA In this embodiment, a Cas molecule is translated from in vitro mRNA RNA transcribed mRNA, and a gRNA is provided as in vitro transcribed or synthesized RNA.mRNA DNA In this embodiment, a Cas molecule is translated from in vitro transcribed mRNA, and a gRNA is transcribed from DNA. Protein DNA In this embodiment, a Cas molecule is provided as a protein, and a gRNA is transcribed from DNA.Protein RNA In this embodiment, a Cas molecule is provided as a protein, and a gRNA is provided as transcribed or synthesized RNA.Table 3. Comparison of Exemplary Delivery MethodsDelivery Duration of Type of Delivery Vector / Mode into NonDividing Expression GenomeIntegration Molecule Cells Delivered Physical (e.g., electroporation,particle gun, Calcium Phosphate Nucleic transfection, cell compression or YES Transient NO Acids and squeezing) Proteins Retrovirus NO Stable YES RNA YES / NOLentivirus YES Stable with RNA modificationsViral Adenovirus YES Transient NO DNA Adeno-Associated DNA Virus (AAV) YES Stable NOVeryVaccinia Virus YES NO DNATransientDelivery Duration of Type of Delivery Vector / Mode into NonExpression GenomeDividing Integration Molecule Cells Delivered Herpes Simplex Virus YES Stable NO DNA Depends on Nucleic Cationic Liposomes YES Transient what is Acids and delivered Proteins Non -ViralPolymeric Depends on Nucleic Nanoparticles YES Transient what is Acids and delivered Proteins Attenuated Bacteria YES Transient NO Nucleic Acids Engineered Nucleic YES Transient NOBiological Acids Non-Viral BacteriophagesDelivery Mammalian VirusNucleic Vehicles like Particles YES Transient NOAcids Biological liposomes:Erythrocyte Ghosts Nucleic YES Transient NOand Exosomes Acids
[0363] In some embodiments, DNA encoding Cas molecules and / or gRNA molecules, or RNP complexes comprising a Cas molecule and / or gRNA molecules, can be delivered into cells by known methods or as described herein. For example, Cas9-encoding and / or gRNA-encoding DNA can be delivered, e.g.. by vectors (e.g., viral ornon-viral vectors), non-vector based methods (e.g.. using naked DNA or DNA complexes), or a combination thereof. Similarly. Casl2a-encoding and / or gRNA-encoding DNA can be delivered, e.g., by vectors (e.g., viral or non-viral vectors), non-vector based methods (e.g., using naked DNA or DNA complexes), or a combination thereof. In some embodiments, the polynucleotide containing the agent(s) and / or components thereof is delivered by a vector (e.g., viral vector / virus or plasmid). The vector may be any described herein.
[0364] In some aspects, a CRISPR enzyme (e.g. Cas nuclease) in combination with (and optionally complexed with) a guide sequence is delivered to the cell. For example, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. For example, one or more elements of a CRISPR system are derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. Staphylococcus aureus or Neisseria meningitides.
[0365] In some embodiments, the polynucleotide containing the agent(s) and / or components thereof or RNP complex is delivered by a non-vector based method (e.g.. using naked DNA or DNA complexes). For example, the DNA or RNA or proteins or combination thereof, e.g.. ribonucleoprotein (RNP) complexes, can be delivered, e.g., by organically modified silica or silicate (Ormosil), electroporation, transient cell compression or squeezing (such as described in Lee, et al. (2012) Nano Lett 12: 6322-27, Kollmannsperger et al (2016) Nat Comm 7, 10372), gene gun, sonoporation, magnetofection, lipid-mediated transfection, dendrimers, inorganic nanoparticles, calcium phosphates, or a combination thereof.
[0366] In some embodiments, delivery via electroporation comprises mixing the cells with the Cas-and / or gRNA-encoding DNA or RNP complex in a cartridge, chamber or cuvette and applying one or more electrical impulses of defined duration and amplitude. In some embodiments, delivery via electroporation is performed using a system in which cells are mixed with the Cas-and / or gRNA-encoding DNA in a vessel connected to a device (e.g., a pump) which feeds the mixture into a cartridge, chamber or cuvette wherein one or more electrical impulses of defined duration and amplitude are applied, after which the cells are delivered to a second vessel.
[0367] In some embodiments, the delivery vehicle is a non-viral vector. In some embodiments, the non-viral vector is an inorganic nanoparticle. Exemplary inorganic nanoparticles include, e.g., magnetic nanoparticles (e.g., Fe₃MnO₂) and silica. The outer surface of the nanoparticle can be conjugated with a positively charged polymer (e.g., polyethylenimine, polylysine, polyserine) which allows for attachment (e.g., conjugation or entrapment) of pay load. In some embodiments, the non-viral vector is an organic nanoparticle. Exemplary organic nanoparticles include, e.g., SNALP liposomes that contain cationic lipids together with neutral helper lipids which are coated with polyethylene glycol (PEG), and protamine-nucleic acid complexes coated with lipid. Exemplary lipids and polymers for gene transfer include those described in, for example. WO 2019 / 195492 and WO 2020 / 223535.
[0368] In some embodiments, the vehicle has targeting modifications to increase target cell update of nanoparticles and liposomes, e.g., cell specific antigens, monoclonal antibodies, single chain antibodies, aptamers, polymers, sugars, and cell penetrating peptides. In some embodiments, the vehicle uses fusogenic and endosome-destabilizing peptides / polymers. In some embodiments, the vehicle undergoes acid-triggered conformational changes (e.g., to accelerate endosomal escape of the cargo). In some embodiments, a stimulus-cleavable polymer is used, e.g., for release in a cellular compartment. For example, disulfide-based cationic polymers that are cleaved in the reducing cellular environment can be used.
[0369] In some embodiments, the delivery vehicle is a biological non-viral delivery vehicle. In someembodiments, the vehicle is an attenuated bacterium (e.g., naturally or artificially engineered to be invasive but attenuated to prevent pathogenesis and expressing the transgene (e.g.. Listeria monocytogenes, certain Salmonella strains, Bifidobacterium longum, and modified Escherichia coli). bacteria having nutritional and tissue-specific tropism to target specific cells, bacteria having modified surface proteins to alter target cell specificity ). In some embodiments, the vehicle is a genetically modified bacteriophage (e.g., engineered phages having large packaging capacity, less immunogenicity, containing mammalian plasmid maintenance sequences and having incorporated targeting ligands). In some embodiments, the vehicle is a mammalian virus-like particle. For example, modified viral particles can be generated (e.g., by purification of the “empty” particles followed by ex vivo assembly of the virus with the desired cargo). The vehicle can also be engineered to incorporate targeting ligands to alter target tissue-specificity. In some embodiments, the vehicle is a biological liposome. For example, the biological liposome is a phospholipid-based particle derived from human cells (e.g., erythrocyte ghosts, which are red blood cells broken down into spherical structures derived from the subject (e.g., tissue targeting can be achieved by attachment of various tissue or cell-specific ligands), or secretory exosomes -subject-derived membrane-bound nanovescicles (30 -100 nm) of endocytic origin (e.g., can be produced from various cell types and can therefore be taken up by cells without the need for targeting ligands).
[0370] In some embodiments, RNA encoding Cas molecules and / or gRNA molecules, can be delivered into cells, e.g., target cells described herein, by known methods or as described herein. For example, Cas-encoding and / or gRNA-encoding RNA can be delivered, e.g.. by microinjection, electroporation, transient cell compression or squeezing (such as described in Lee. et al. (2012) Nano Lett 12: 6322-27), lipid-mediated transfection, peptide -mediated delivery, e.g., cell-penetrating peptides, or a combination thereof.
[0371] In some embodiments, delivery via electroporation comprises mixing the cells with the RNA encoding Cas molecules and / or gRNA molecules in a cartridge, chamber or cuvette and applying one or more electrical impulses of defined duration and amplitude. In some embodiments, delivery via electroporation is performed using a system in which cells are mixed with the RNA encoding Cas molecules and / or gRNA molecules in a vessel connected to a device (e.g., a pump) which feeds the mixture into a cartridge, chamber or cuvette wherein one or more electrical impulses of defined duration and amplitude are applied, after which the cells are delivered to a second vessel.
[0372] In some embodiments, Cas molecules can be delivered into cells by known methods or as described herein. For example, Cas protein molecules can be delivered, e.g., by microinjection, electroporation, transient cell compression or squeezing (such as described in Lee. et al. (2012) Nano Lett 12: 6322-27), lipid-mediated transfection, peptide -mediated delivery, or a combination thereof. Delivery can be accompanied by DNA encoding a gRNA or by a gRNA.
[0373] In some embodiments, the one or more agent(s) capable of introducing a cleavage, e.g., a Cas / gRNA system, is introduced into the cell as a ribonucleoprotein (RNP) complex. RNP complexes include a sequence of ribonucleotides, such as an RNA or a gRNA molecule, and a protein, such as a Cas protein or variant thereof. For example, the Cas protein is delivered as RNP complex that comprises a Cas protein and a gRNA molecule targeting the target sequence, e.g., using electroporation or other physical deliver}' method. In some embodiments, the RNP is delivered into the cell via electroporation or other physical means, e.g., particle gun, calcium phosphate transfection, cell compression or squeezing.
[0374] In some embodiments, delivery via electroporation comprises mixing the cells with the Cas molecules with or without gRNA molecules in a cartridge, chamber or cuvette and applying one or more electrical impulses of defined duration and amplitude. In some embodiments, delivery via electroporation is performed using a system in which cells are mixed with the Cas molecules with or without gRNA molecules in a vessel connected to a device (e.g., a pump) which feeds the mixture into a cartridge, chamber or cuvette wherein one or more electrical impulses of defined duration and amplitude are applied, after which the cells are delivered to a second vessel.
[0375] In some embodiments, delivery via electroporation comprises mixing the cells with the Cas molecules with or without gRNA molecules in a cartridge, chamber or cuvette and applying one or more electrical impulses of defined duration and amplitude. In some embodiments, delivery via electroporation is performed using a system in which cells are mixed with the Cas molecules.
[0376] In some embodiments, the polynucleotide containing the agent(s) and / or components thereof is delivered by a combination of a vector and a non-vector based method. For example, a virosome comprises a liposome combined with an inactivated virus (e.g.. HIV or influenza virus), which can result in more efficient gene transfer than either a viral or a liposomal method alone.
[0377] In some embodiments, more than one agent(s) or components thereof are delivered to the cell. For example, in some embodiments, agent(s) capable of inducing a genetic disruption of three or more locations in the genome, e.g., a target site at a TRAC locus and a target site at a B2M locus are delivered to the cell. In some embodiments, agent(s) and components thereof are delivered using one method. For example, in some embodiments, one or more agents, for example, for inducing a genetic disruption at a target site at a TRAC locus and a further genetic disruption at a target site at a B2M locus are delivered as a first agent, e.g.. a first RNP, and a second agent, e.g., a second RNP,, respectively. In some aspects, the two or more different RNP complexes, such as an RNP targeting a target site at a TRAC locus and a further RNP targeting a target site at a B2M locus are delivered together, such as electroporated together, for example, in one electroporation reaction.
[0378] In some embodiments, one or more polynucleotides other than the one or more agent(s)capable of inducing a genetic disruption and / or component thereof, e.g.. one or more CRISPR-Cas combinations, such as a template polynucleotide for HDR-directed integration (such as any template polynucleotide described herein, e.g., in Section I. C), are delivered. In some embodiments, the polynucleotide, e.g., template polynucleotide, is delivered at the same time as one or more of the components of the Cas system. In some embodiments, the polynucleotide is delivered before or after (e.g., less than about 1 minute, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours. 6 hours, 9 hours, 12 hours, 1 day, 2 days, 3 days, 1 week, 2 weeks, or 4 weeks) one or more of the components of the Cas system are delivered. In some embodiments, the polynucleotide, e.g., template polynucleotide, is delivered by a different means from one or more of the components of the Cas system, e.g., the Cas9 molecule or the Casl2a molecule component and / or the gRNA molecule component. The polynucleotide, e.g., template polynucleotide, can be delivered by any of the delivery methods described herein. For example, the polynucleotide, e.g., template polynucleotide, can be delivered by a viral vector, e.g., any described herein such as an AAV vector, and the Cas component and / or the gRNA molecule component can be delivered by electroporation. In some embodiments, the polynucleotide, e.g., template polynucleotide, includes one or more exogenous sequences, e.g., transgene sequences that encode a recombinant CAR, a recombinant HLA-E fusion protein and / or a portion thereof and / or other exogenous gene nucleic acid sequences.
[0379] In some embodiments, the polynucleotide, e.g., a polynucleotide such as a template polynucleotide encoding the recombinant CAR, are introduced into the cells in nucleotide form, e.g., as a polynucleotide or a vector. In particular embodiments, the polynucleotide contains a transgene that encodes the recombinant CAR or a portion thereof.
[0380] In some embodiments, the polynucleotide, e.g., a polynucleotide such as a template polynucleotide encoding the recombinant HLA-E fusion protein, are introduced into the cells in nucleotide fonn. e.g., as a polynucleotide or a vector. In particular embodiments, the polynucleotide contains a transgene that encodes the recombinant HLA-E fusion protein or a portion thereof.
[0381] In some embodiments, the polynucleotide, e.g., template polynucleotide, is introduced into the cell for engineering, in addition to the agent(s) capable of inducing a targeted genetic disruption, e.g., nuclease and / or gRNAs. In some embodiments, the polynucleotide(s) may be delivered prior to, simultaneously or after the agent(s) capable of inducing a targeted genetic disruption is introduced into a cell. In some embodiments, the polynucleotide(s) are delivered simultaneously with the agents. In some embodiments, the polynucleotides are delivered prior to the agents, for example, seconds to hours to days before the agents, including, but not limited to, 1 to 60 minutes (or any time therebetween) before the agents, 1 to 24 hours (or any time therebetween) before the agents or more than 24 hours before the agents. In some embodiments, the polynucleotides are delivered after the agents, seconds to hours to daysafter the agents, including immediately after delivery of the agent, e.g., between or between about between 30 seconds to 4 hours, such as about 30 seconds, 1 minute. 2 minutes, 3 minutes, 4 minutes, 5 minutes. 6 minutes, 6 minutes, 8 minutes, 9 minutes. 10 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours or 4 hours after delivery' of the agents and / or preferably within 4 hours of delivery of the agents. In some embodiments, the polynucleotide is delivered more than 4 hours after delivery of the agents. In some embodiments, the poly nucleotides are delivered after the agents, for example, including, but not limited to, within 1 second to 60 minutes (or any time therebetween) after die agents. 1 to 4 hours (or any time therebetween) after the agents or more than 4 hours after the agents.
[0382] In some embodiments, the polynucleotides, e.g.. template polynucleotides, may be delivered using the same delivery systems as the agent(s) capable of inducing a targeted genetic disruption, e.g., nuclease and / or gRNAs. In some embodiments, the polynucleotides may be delivered using different same delivery systems as the agent(s) capable of inducing a targeted genetic disruption, e.g., nuclease and / or gRNAs. In some embodiments, the polynucleotide is delivered simultaneously with the agent(s). In other embodiments, the polynucleotide is delivered at a different time, before or after delivery of the agent(s). Any of the delivery method described herein in Section I. C (e.g.. in Tables 2 and 3) for delivery of nucleic acids in the agent(s) capable of inducing a targeted genetic disruption, e.g., nuclease and / or gRNAs, can be used to deliver the polynucleotide.
[0383] In some embodiments, the one or more agent(s) and die polynucleotide are delivered in the same format or method. For example, in some embodiments, the one or more agent(s) and the polynucleotide are both comprised in a vector, e.g., viral vector. In some embodiments, the polynucleotide is encoded on the same vector backbone, e.g. AAV genome, plasmid DNA, as the Cas and gRNA. In some aspects, the one or more agent(s) and the polynucleotide are in different formats, e.g., ribonucleic acid-protein complex (RNP) for the Cas-gRNA agent and a linear DNA for the polynucleotide, but they are delivered using the same method. In some aspects, the one or more agent(s) and the polynucleotide are in different formats, e.g., ribonucleic acid-protein complex (RNP) for the Cas-gRNA agent and the polynucleotide is in contained in an AAV vector, and the RNP is delivered using a physical delivery method (e.g.. electroporation) and the polynucleotide is delivered via transduction of AAV viral preparations. In some aspects, the polynucleotide is delivered immediately after, e.g., within about 1, 2. 3. 4, 5, 10. 20. 30, 40, 50 or 60 minutes after, the delivery of the one or more agent(s).
[0384] In some embodiments, the one or more agent(s) is or comprises a ribonucleoprotein (RNP) complex. In some embodiments, the concentration of each RNP incubated with, added to or contacted with the cells for engineering is independently at a concentration of at or about 0.01, 0.025, 0.05, 0.1, 0.25, 0.5, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7. 2.8, 2.9, 3, 4, 5, 6, 7,7.5, 8. 9, 10 pM, or a range defined by any two of the foregoing values. In some aspects, the concentration of each RNP is independently between at or about 0.025 pM and at or about 5 pM. between at or about 0.025 pM and at or about 2.5 pM, between at or about 0.025 pM and at or about 1 pM, 0.025 pM and at or about 0.5 pM, between at or about 0.025 pM and at or about 0.1 pM, or between at or about 0.025 pM and at or about 0.25 pM. In some aspects, the concentration of each RNP is independently between at or about 1 pM and at or about 5 pM. In some aspects, the concentration of each RNP is independently between at or about 1.5 pM and at or about 2.5 pM. In some aspects, the concentration of each RNP is independently between at or about 0.05 pM and at or about 1 pM. In some aspects, the concentration of each RNP is independently between at or about 0.025 pM and at or about 0.25 pM.
[0385] In some embodiments, the one or more agent(s) is or comprises a ribonucleoprotein (RNP) complex. In some embodiments, the total concentration of RNPs incubated with, added to or contacted with the cells for engineering is at a concentration of at or about 0.01, 0.025, 0.05, 0.1, 0.25, 0.5, 1, 1.1, 1.2, 1.3, 1.4, 1.5. 1.6. 1.7. 1.8. 1.9. 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8. 2.9. 3. 4, 5, 6, 7. 7.5. 8. 9, 10. 20.30, 40, or 50 pM, or a range defined by any two of the foregoing values. In some aspects, the total concentration of RNPs is between at or about 0.025 pM and at or about 5 pM. between at or about 0.025 pM and at or about 2.5 pM, between at or about 0.025 pM and at or about 1 pM, 0.025 pM and at or about 0.5 pM, between at or about 0.025 pM and at or about 0.1 pM, or between at or about 0.025 pM and at or about 0.25 pM. In some aspects, the total concentration of RNP is between at or about 1 pM and at or about 5 pM.
[0386] In some embodiments, in the RNP complex, the ratio, e.g. the molar ratio, of the gRNA and the Cas molecule or other nucleases is at or about 5:1, 4:1, 3:1, 2:1. 1:1, 1:2, 1:3, 1:4 or 1:5, or a range defined by any two of the foregoing values. In some embodiments, in the RNP complex, the ratio, e.g., molar ratio, of the gRNA and the Cas molecule or other nucleases is at or about 3:1. 2.9:1. 2.8:1. 2.7:1.2.6:1. 2.5:1. 2.4:1. 2.3:1. 2.2:1. 2.1:1, 2:1 or 1:1. or a range defined by any two of the foregoing values.
[0387] In some embodiments, the polynucleotide is a linear or circular polynucleotide, such as a linear or circular DNA or linear RNA. and can be delivered using any of the methods described in Section I. D herein (e.g., Tables 2 and 3) for delivering polynucleotides into the cell.
[0388] In particular embodiments, the polynucleotide, e.g., the template polynucleotide, are introduced into the cells in nucleotide form, e.g., as or within a non-viral vector. In some embodiments, the non-viral vector is or includes a polynucleotide, e.g., a DNA or RNA polynucleotide, that is suitable for transduction and / or transfection by any suitable and / or known non-viral method for gene delivery, such as but not limited to microinjection, electroporation, transient cell compression or squeezing (e.g..as described in Lee, et al. (2012) Nano Lett 12: 6322-27), lipid-mediated transfection, peptide-mediated delivery, e.g., cell-penetrating peptides, or a combination thereof. In some embodiments, the non-viral polynucleotide is delivered into the cell by a non-viral method described herein, such as a non-viral method listed in Table 3 herein.
[0389] In some embodiments, the polynucleotide sequence can be comprised in a vector molecule containing sequences that are not homologous to the region of interest in the genomic DNA.
[0390] In some embodiments, the polynucleotides and sequences encoding the one or more agents may be on the same vector, for example an AAV vector. In some embodiments, the polynucleotides are delivered using an AAV vector and the one or more agents for inducing a genetic disruption, e.g.. one or more CRISPR-Cas combination, are delivered as a different form, e g., as mRNAs encoding the nucleases and / or gRNAs. In some embodiments, the polynucleotides and nucleases are delivered using the same type of method, e.g., a viral vector, but on separate vectors. In some embodiments, the polynucleotides are delivered in a different delivery system as the agents capable of inducing a genetic disruption, e.g., nucleases and / or gRNAs. In some embodiments, the polynucleotide is excised from a vector backbone in vivo, e.g., it is flanked by gRNA recognition sequences. In some embodiments, the polynucleotide is on a separate polynucleotide molecule as the Cas and gRNA. In some embodiments, the Cas and the gRNA are introduced in the form of a ribonucleoprotein (RNP) complex, and the polynucleotide is introduced as a polynucleotide molecule, e.g., in a vector or a linear polynucleotide, e.g., linear DNA.
[0391] In some embodiments the vector or construct can contain a promoter and / or enhancer or regulatory elements to regulate expression of the encoded recombinant receptor. In some examples the promoter and / or enhancer or regulatory elements can be condition-dependent promoters, enhancers, and / or regulatory elements. In some examples these elements drive expression of the transgene. In some examples, the CAR transgene can be operatively linked to a promoter, such as an EFl alpha promoter with an HTLV1 enhancer (SEQ ID NO: 56). In some examples, the CAR transgene is operatively linked to a Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE; SEQ ID NO: 57), located downstream of the transgene.
[0392] In some embodiments, the vector or construct can contain a single promoter that drives the expression of one or more nucleic acid molecules. In some embodiments, such nucleic acid molecules, e.g., transcripts, can be multicistronic (bicistronic or tricistronic, see e.g., U. S. Patent No. 6,060,273). For example, in some embodiments, transcription units can be engineered as a bicistronic unit containing an IRES (internal ribosome entry site), which allows coexpression of gene products (e.g.. encoding a first and second chimeric receptor) by a message from a single promoter.
[0393] Alternatively, in some cases, a single promoter may direct expression of an RNA that contains, in a single open reading frame (ORF), two or three genes (e.g., encoding a first and second binding molecules, e.g., antibody recombinant receptor) separated from one another by sequences encoding a self-cleavage peptide (e.g., 2A cleavage sequences) or a protease recognition site (e.g., furin). The ORF thus encodes a single polypeptide, which, either during (in the case of T2A) or after translation, is cleaved into the individual proteins. In some cases, the peptide, such as T2A, can cause the ribosome to skip (ribosome skipping) synthesis of a peptide bond at the C-terminus of a 2A element, leading to separation between the end of the 2A sequence and the next peptide downstream (see, for example, de Felipe. Genetic Vaccines and Ther. 2:13 (2004) and deFelipe el al. Traffic 5:616-626 (2004)). Many 2A elements are known. Examples of 2A sequences that can be used in the methods and polynucleotides disclosed herein, without limitation, 2A sequences from the foot-and-mouth disease virus (F2A, e.g., SEQ ID NO: 58 or SEQ ID NO: 59), equine rhinitis A virus (E2A, e.g. SEQ ID NO: 60 or SEQ ID NO: 61). Thosea asigna virus (T2A, e.g., SEQ ID NO: 62, SEQ ID NO: 63, or SEQ ID NO: 64), and porcine teschovirus-1 (P2A, e.g. SEQ ID NO: 65 or SEQ ID NO: 66) as described in U. S. Patent Publication No.20070116690. In some embodiments, the one or more different or separate promoters drive the expression of one or more nucleic acid molecules encoding the one or more binding molecules, e.g., recombinant receptors.
[0394] In some embodiments, gene transfer is accomplished by first stimulating the cell, such as by combining it with a stimulus that induces a response such as proliferation, survival, and / or activation. e.g.. as measured by expression of a cytokine or activation marker, followed by transduction of the activated cells, and expansion in culture to numbers sufficient for clinical applications.E. Incubation, Cultivation and Harvesting
[0395] In some embodiments, the provided methods involve incubating the immune cells, e.g., T cells. In some embodiments, the incubating is carried out after the introducing of the one or more geneediting agents.
[0396] In some embodiments, the incubating can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g.. nutrients, amino acids, antibiotics, ions, and / or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to stimulate the immune cells. In some embodiments, the cultivating is under conditions to maintain a target amount of carbon dioxide in the cell culture. In some aspects, the amount of carbon dioxide (CO2) is between 10% and 0% (v / v) of said gas, such as between 8% and 2% (v / v) of said gas, for example an amount of or about 5% (v / v) CO2.
[0397] In some embodiments, the incubating is carried out in a cell medium. In some embodiments, the cell medium is a serum-free medium. In some embodiments, the cell medium can include one or more recombinant cytokines. In some embodiments, the cell medium is a basal medium that does not include any added recombinant cytokines.
[0398] In particular embodiments, the one or more cytokines are human recombinant cytokines. In certain embodiments, the one or more cytokines bind to receptors that are expressed by T cells. In particular embodiments, the one or more cytokines include a member of the 4-alpha-helix bundle family of cytokines. In some embodiments, members of the 4-alpha-helix bundle family of cytokines include interleukin-2 (IL-2), interleukin-4 (IL-4), interleukin-7 (IL-7), interleukin-9 (IL-9), interleukin 12 (IL-12). interleukin 15 (IL-15), granulocyte colony-stimulating factor (G-CSF). and granulocyte-macrophage colony-stimulating factor (GM-CSF). In some embodiments, the one or more cytokines include IL-15. In particular embodiments, the one or more cytokines include IL-7. In particular embodiments, the one or more cytokines include IL-2. In particular embodiments, the one or more cytokines are selected from IL-2, IL- 15, and IL-7. In particular embodiments, the cell medium contains recombinant IL-2, IL- 15, and IL-7.
[0399] In certain embodiments, the amount or concentration of the one or more cytokines are measured and / or quantified with International Units (IU). International units may be used to quantify vitamins, hormones, cytokines, vaccines, blood products, and similar biologically active substances. In some embodiments, IU are or include units of measure of tire potency of biological preparations by comparison to an international reference standard of a specific weight and strength, e.g., WHO 1st International Standard for Human IL-2, 86 / 504. International Units are the only recognized and standardized method to report biological activity units that are published and are derived from an international collaborative research effort. In particular embodiments, the IU for population, sample, or source of a cytokine may be obtained through product comparison testing with an analogous WHO standard product. For example, in some embodiments, the lU / mg of a population, sample, or source of human recombinant IL-2, IL-7, or IL-15 is compared to the WHO standard IL-2 product (NIBSC code: 86 / 500), the WHO standard IL-17 product (NIBSC code: 90 / 530), and the WHO standard IL-15 product (NIBSC code: 95 / 554), respectively.
[0400] In particular embodiments, the ED50 of recombinant human IL-2 or IL-15 is equivalent to the concentration required for the half-maximal stimulation of cell proliferation (XTT cleavage) with CTLL-2 cells. In certain embodiments, the ED50 of recombinant human IL-7 is equivalent to the concentration required for the half-maximal stimulation for proliferation of PHA-activated human peripheral blood lymphocytes. Details relating to assays and calculations of IU for IL-2 are discussed in Wadhwa et al., Journal of Immunological Methods (2013), 379 (1-2): 1-7; and Gearing and Thorpe,Journal of Immunological Methods (1988), 114 (1-2): 3-9; details relating to assays and calculations of IU for IL-15 are discussed in Soman et al. Journal of Immunological Methods (2009) 348 (1-2): 83-94.
[0401] In some embodiments, the cell medium contains IL-2, e.g., human recombinant IL -2, at a concentration between 1 lU / mL and 500 lU / mL, between 10 lU / mL and 250 JU / mL, between 50 lU / mL and 200 lU / mL, between 50 lU / mL and 150 lU / mL, between 75 lU / mL and 125 lU / mL. between 100 lU / mL and 200 lU / mL, or between 10 lU / mL and 100 lU / mL. In particular embodiments, the cell medium contains recombinant IL-2 at a concentration at or at about 50 lU / mL, 60 lU / mL, 70 lU / mL. 80 lU / mL, 90 lU / mL. 100 lU / mL. 110 lU / mL, 120 lU / mL, 130 lU / mL, 140 lU / mL, 150 lU / mL, 160 lU / mL, 170 lU / mL, 180 lU / mL, 190 lU / mL, or 100 lU / mL. In some embodiments, the cell medium contains about 100 lU / mL of recombinant IL-2, e.g.. human recombinant IL-2.
[0402] In some embodiments, the cell medium contains recombinant IL-7, e.g., human recombinant IL-7, at a concentration between 100 JU / mL and 2,000 lU / mL, between 500 lU / mL and 1,000 lU / mL, between 100 lU / mL and 500 lU / mL, between 500 lU / mL and 750 JU / mL, between 750 lU / mL and 1,000 lU / mL, or between 550 lU / mL and 650 lU / mL. In particular embodiments, the cell medium contains IL-7 at a concentration at or at about 50 IU / mL,100 lU / mL, 150 lU / mL, 200 lU / mL, 250 lU / mL, 300 lU / mL, 350 JU / mL, 400 lU / mL, 450 JU / mL, 500 lU / mL, 550 lU / mL, 600 lU / mL, 650 lU / mL, 700 lU / mL, 750 JU / mL, 800 lU / mL, 750 JU / mL, 750 lU / mL, 750 lU / mL, or 1,000 lU / mL. In particular embodiments, the cell medium contains about 600 lU / mL of IL-7, e.g., human recombinant IL-7.
[0403] In some embodiments, the cell medium contains recombinant IL-15, e.g., human recombinant IL-15, at a concentration between 1 lU / mL and 500 lU / mL, between 10 lU / mL and 250 lU / mL. between 50 lU / mL and 200 lU / mL. between 50 lU / mL and 150 lU / mL. between 75 lU / mL and 125 lU / mL, between 100 lU / mL and 200 lU / mL, or between 10 lU / mL and 100 lU / mL. In particular embodiments, the cell medium contains recombinant IL- 15 at a concentration at or at about 50 lU / mL, 60 lU / mL, 70 lU / mL, 80 lU / mL. 90 lU / mL, 100 lU / mL. 110 lU / mL. 120 lU / mL. 130 lU / mL, 140 lU / mL, 150 JU / mL, 160 lU / mL, 170 lU / mL, 180 JU / mL. 190 lU / mL. or 200 lU / mL. In some embodiments, the cell medium contains about 100 lU / mL of recombinant IL-15, e g., human recombinant IL-15.
[0404] In some embodiments, at least a portion of the incubating is carried out under conditions for recovery of the T cells from the gene editing, such as following electroporation of the cells. In certain embodiments, at least a portion of the incubating is performed under static conditions, such as conditions that do not involve centrifugation, shaking, rotating, rocking, or perfusion of media. In some embodiments, the incubating is performed under gentle mixing conditions, e.g., involving rocking. In some embodiments, the at least a portion of the incubating under static conditions is carried out for between or between about 2 hours and 30 hours, 2 hours and 26 hours, 2 hours and 22 hours, 2 hours and18 hours, 2 hours and 14 hours, 2 hours and 10 hours, 2 hours and 6 hours. 2 hours and 4 hours, 4 hours and 30 hours. 4 hours and 26 hours, 4 hours and 22 hours, 4 hours and 18 hours. 4 hours and 14 hours. 4 hours and 10 hours, 4 hours and 6 hours, 6 hours and 30 hours, 6 hours and 26 hours, 6 hours and 22 hours, 6 hours and 18 hours, 6 hours and 14 hours. 6 hours and 10 hours, 10 hours and 30 hours, 10 hours and 26 hours, 10 hours and 22 hours, 10 hours and 18 hours, 10 hours and 14 hours, 14 hours and 30 hours, 14 hours and 26 hours. 14 hours and 22 hours. 14 hours and 18 hours. 18 hours and 30 hours, 18 hours and 26 hours, 18 hours and 22 hours, 22 hours and 30 hours, 22 hours and 26 hours, or 26 hours and 30 hours, each inclusive.
[0405] In some embodiments, at least a portion of the incubating is under cultivating conditions for expansion of the cells. In some embodiments, the cultivating is carried out under conditions to induce expansion of the immune cells, e.g., T cells. In particular embodiments, the cultivating conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents, e.g., nutrients, amino acids, antibiotics, ions, and / or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to promote growth, division, and / or expansion of the immune cells, e.g.. T cells. In some embodiments, the cultivating is carried out for a time period until a desired or threshold density, concentration, or number of cells is achieved.
[0406] In some embodiments, the cultivating is carried out in a bioreactor. Examples of suitable bioreactors for the cultivating include GE Xuri W25, GE Xuri W5, Sartorius BioSTAT RM 20 | 50, Finesse SmartRocker Bioreactor Systems, and Pall XRS Bioreactor Systems. In some embodiments, the bioreactor is used to perfuse and / or mix the immune cells, e.g., T cells, during at least a portion of the cultivating.
[0407] In some embodiments, the cultivating occurs in an incubator. In some embodiments, the immune cells, e.g.. T cells, are transferred into a container for the cultivating. In some embodiments, the container is a vial. In particular embodiments, the container is a bag. In some embodiments, the immune cells, e.g., T cells, are transferred into the container under closed or sterile conditions. In some embodiments, the container, e.g., the vial or bag. is then placed into an incubator for all or a portion of the cultivating. In particular embodiments, the incubator is set at, at about, or at least 16°C, 24°C, or 35°C. In some embodiments, the incubator is set at 37°C, at about at 37°C, or at 37°C ±2°C, ±1°C, ±0.5°C, or ±0.1°C.
[0408] In some embodiments, the incubation is carried out until a threshold number of population doublings has occurred. In some embodiments, the incubation under conditions for cultivating the cells is carried out until 2. 3, 4, 5, 6, 7. 8, 9, 10 or more population doublings has occurred. In someembodiments, the incubation under conditions for cultivating the cells is carried out until 2 to 8 population doublings has occurred. In some embodiments, the incubation under conditions for cultivating the cells is carried out until 4 to 8 population doublings has occurred. In some embodiments, tire incubation under conditions for cultivating the cells is carried out until 6 or 7 population doublings has occurred.
[0409] In certain embodiments, the cultivating is for, for about, or for at least 18 hours, 24 hours, 30 hours, 36 hours, 40 hours, 48 hours, 54 hours. 60 hours, 72 hours, 84 hours. 96 hours, or more than 96 hours. In some embodiments, the cultivating is performed for an amount of time between 30 minutes and 2 hours, between 1 hour and 8 hours, between 6 hours and 12 hours, between 12 hours and 18 hours, between 16 hours and 24 hours, between 18 hours and 30 hours, between 24 hours and 48 hours, between 24 hours and 72 hours, between 42 hours and 54 hours, between 60 hours and 120 hours, between 96 hours and 120 hours, between 90 hours and 120 hours, between 1 days and 7 days, between 3 days and 8 days, between 1 day and 3 days, between 4 days and 6 days, or between 4 days and 5 days. In some embodiments, the cultivating is carried out for no more than 14 days. In some embodiments, the cultivating is carried out for no more than 12 days. In some embodiments, the cultivating is carried out for no more than 10 days. In some embodiments, the cultivating is carried out for no more than 8 days. In some embodiments, the cultivating is carried out for no more than 6 days. In some embodiments, the cultivating is carried out for no more than 5 days. In some embodiments, the cultivating is carried out for between or between about 12 hours and 36 hours, inclusive. In some embodiments, the cultivating is carried out for between or between about 18 hours and 30 hours, inclusive. In some embodiments, the cultivating is carried out for between or between about 22 hours and 26 hours, inclusive. In particular embodiments, the cultivating is for or for about 24 hours.
[0410] In some embodiments, the provided methods involve harvesting the genetically engineered immune cells, e.g., T cells, expressing the recombinant protein. In some embodiments, the harvesting is carried out following the engineering. In some embodiments, the harvesting is performed carried out following the cultivating.
[0411] In some embodiments, one or more polishing step of the harvested cells can be carried out. In some embodiments, the polishing step is carried out to enrich for successfully engineered cells by removing or depleting cells that have not been engineered. In some embodiments, polishing of the engineered cells is carried out by depleting CD3+ T cells to remove T cells that have not been edited by disruption of the TRAC locus. In some embodiments, a selection step (e.g., polishing step) is useful for increasing product control and / or decreasing between engineering process variance. In some embodiments, tire engineered T cells arc depleted for CD3+ T cells, such as by immunoaffinity-bascd selection for CD3+ T cells. In some embodiments, the immunoaffinity’ -based selection involvescontacting the cells with an antibody or antigen-binding fragment thereof directed against the target antigen (e.g., CD3). In certain embodiments, the immunoaffinity reagents are immobilized on the outside surface of a bead. In particular embodiments, the bead is a magnetic bead. In some embodiments, the depleting cells bound to the immunoaffinity reagent involves exposing the cells to a magnetic field, in which the cells not bound to the magnet are recovered as CD3+ depleted cells and harvested. In some embodiments, the affinity -based selection is via magnetic-activated cell sorting (MACS) (Miltenyi Biotech, Auburn, CA). Magnetic Activated Cell Sorting (MACS), e.g., CliniMACS systems are capable of high -purity selection of cells having magnetized particles attached thereto.
[0412] In some embodiments, the provided methods involve formulating the harvested genetically engineered immune cells, e.g., T cells. In some embodiments, the harvested genetically engineered immune cells, e.g., T cells, are formulated in a container, such as a bag or vial.
[0413] In some embodiments, the harvested genetically engineered immune cells, e.g., T cells, are formulated for administration to a subject. In some embodiments, the harvested genetically engineered immune cells, e.g.. T cells, are formulated in a pharmaceutically acceptable buffer, which may, in some aspects, include a pharmaceutically acceptable carrier or excipient. In some embodiments, the harvested genetically engineered immune cells, e.g., T cells, are formulated in the presence of a pharmaceutically acceptable excipient.
[0414] In some embodiments, the harvested genetically engineered immune cells, e.g., T cells, are formulated for cryopreservation. In some embodiments, the harvested genetically engineered immune cells, e.g.. T cells, are formulated in tire presence of a cryoprotectant. In some embodiments, the harvested genetically engineered immune cells, e.g.. T cells, are formulated with a cyropreservative solution that contains 1.0% to 30% DMSO solution, such as a 5% to 20% DMSO solution or a 5% to 10% DMSO solution. In some embodiments, the cryopreservation solution is or contains, for example, PBS containing 20% DMSO and 8% human serum albumin (HSA). or other suitable cell freezing media. In some embodiments, the cryopreservative solution is or contains, for example, at least or about 7.5% DMSO. In some embodiments, the harvested genetically engineered immune cells, e.g., T cells, are frozen, e.g., cryoprotected or cryopreserved, in media and / or solution with a final concentration of or of about 12.5%, 12.0%, 11.5%, 11.0%, 10.5%, 10.0%, 9.5%, 9. 0%, 8.5%, 8.0%, 7.5%, 7.0%, 6.5%, 6.0%, 5.5%, or 5.0% DMSO, or between 1% and 15%. between 6% and 12%, between 5% and 10%, or between 6% and 8% DMSO. In particular embodiments, the harvested genetically engineered immune cells, e.g., T cells, are frozen, e.g., cryoprotected or cryopreserved. in media and / or solution with a final concentration of or of about 5.0%, 4.5%, 4.0%, 3.5%, 3.0%, 2.5%, 2.0%, 1.5%, 1.25%, 1.0%, 0.75%, 0.5%, or 0.25% HSA, or between 0.1% and -5%, between 0.25% and 4%, between 0.5% and 2%, or between 1% and 2% HSA.IL EXEMPLARY FEATURES OF GENETICALLY ENGINEERED CELLS
[0415] In some embodiments, cells and compositions according to the provided disclosure (e.g. cells comprising a modified TRAC locus comprising a transgene sequence encoding a recombinant CAR or a portion thereof, and / or a modified B2M locus comprising a transgene sequence encoding a recombinant HLA-E fusion protein or a portion thereol) exhibit an altered immunogenic profile compared to a corresponding or reference cell or composition.
[0416] Graft-versus-host disease (GVHD), also known as graft versus host disease, is a common complication following an allogeneic tissue or cell transplant. It is commonly associated with stem cell or bone marrow transplant but the term also applies to other forms of tissue or cell therapy graft. Immune cells (white blood cells) in the tissue (the graft) recognize the recipient (the host) as “foreign”. The transplanted immune cells then attack the host's body cells. GVHD can also occur after a blood transfusion if the blood products used have not been irradiated or treated with an approved pathogen reduction system.
[0417] In some aspects, the provided embodiments are based on observations that the efficacy of adoptive cell therapy may be limited by the development of an immune response in the subject to the cells and / or construct administered. In some embodiments, exogenous engineered cells when administered to a subject can be recognized by a host’s immune response as foreign. In some embodiments, such recognition can occur when cells are allogenic to the host subject to which they are administered. In some embodiments, such recognition can occur even when the cells are autologous to the host subject to which they are administered, such as when the cells are engineered with a recombinant molecule or receptor (e.g. CAR) that is not native to or normally expressed by the cells. In some embodiments, development of a host immune response to administered cells, either allogenic or autologous cells, can result in host-versus-graft responses that can lead to rejection of adoptively transferred cells.
[0418] In some embodiments, the provided engineered cells, compositions and methods can be used regardless of the HLA type or subtype of the subject, which can, in some aspects, permit “off-the-shelf’ delivery to a wider variety of recipients. In some embodiments, the provided compositions and methods can be used to provide adoptive cell therapy using allogeneic cells engineered to treat a disease or disorder. In some cases, using allogeneic cells can provide certain advantages. In some embodiments, cells with known safety and efficacy profiles can be prepared for a wider variety of patients. For example, cells can be derived from a healthy donor and delivered to a subject that may be too sick to provide cells suitable for genetic engineering. In some cases, a subject may have a defect or disease in the cells or cell type typically used for a particular adoptive cell therapy regimen, such that cells from ahealthy donor can be used that replace or supplement the diseased cells. In some cases, the ability to engineer or administer allogeneic cells permits the preparation of cells in advance, which can reduce the time needed before being delivered to a patient. In some cases, the engineered allogenic cells may present lower risks of causing graft-versus-host disease or host-versus-graft disease.
[0419] In some embodiments, the provided cells and compositions are less immunogenic and / or result in a reduced degree of recognition of the engineered cell by the host immune system upon administration of the cells. In some embodiments, the provided cells and compositions result in a reduced risk of development of graft-vs-host and / or host-vs-graft disease. In some embodiments, the provided cells and compositions are more cytotoxic and / or result in increased killing of tumor cells upon administration of the cells. In some embodiments, the provided cells and compositions exhibit increased efficiency and / or result in longer utility in the killing of tumor cells upon administration of the cells. In some cases, reference to a “reference cell” or “reference composition” (and / or a “corresponding cell” or a “corresponding composition”), may refer to a cell or composition (such as a T cell or composition of T cells) that are obtained, isolated, generated, produced and / or incubated under the same or substantially the same conditions, except that the such cells do not have a reduction, deletion, elimination, knockout or disruption in expression of the TRAC and B2M gene and / or do not express a recombinant CAR and / or HLA-E fusion protein. In some aspects, except for not containing introduction of the CAR and / or the recombinant HLA-E fusion protein and / or genetic disruption of the TRAC and / or B2M genes, such cells or T cells are treated identically or substantially identically as T cells or cells that have been introduced with CAR and / or the recombinant HLA-E fusion protein and / or genetic disruption of the TRAC and / or B2M genes, such that any one or more conditions that can influence the activity or properties of the cell is not varied or not substantially varied between the cells other than the introduction of the agent.
[0420] In some embodiments, the reduction, disruption, deletion or elimination of expression of the TRAC and / or B2M genes in the provided engineered cells does not impair or alter the function or activity of the recombinant receptor compared to a reference cell or composition. In some embodiments, the recombinant receptor retains specific binding to the antigen. In some embodiments, the recombinant receptor retains activating or stimulating activity, upon antigen binding, to induce cytotoxicity, proliferation, survival or cytokine secretion in cells. In some embodiments, the engineered cells of the provided compositions retain a functional property or activity compared to a corresponding or reference composition when assessed under the same conditions. In some embodiments, the cells retain cytotoxicity, proliferation, survival or cytokine secretion compared to such a corresponding or reference composition.III. CHIMERIC ANTIGEN RECEPTORS
[0421] In some embodiments, the provided genetically engineered T cells contain or are engineered to contain a chimeric antigen receptor (CAR). The CAR generally includes an extracellular domain comprising an extracellular binding domain (also called “extracellular antigen binding domain”) directed against an antigen or antigens, in which the extracellular domain is linked to one or more intracellular signaling components, in some aspects via linkers and / or transmembrane domain(s). In some embodiments, the extracellular binding domain provides a means for binding an antigen or antigens. In some embodiments, the extracellular binding domain includes an antibody or antibody fragment that provides specificity for a desired antigen or antigens. In some aspects, the recombinant receptor, e.g., CAR, further includes a spacer and / or a transmembrane domain or portion. In some aspects, the spacer and / or transmembrane domain can link the extracellular portion containing the antigen binding domain and the intracellular signaling region(s) or domain(s). In some embodiments, the CAR includes in order from N- to C- terminus: the extracellular binding domain, a spacer, a transmembrane domain, and an intracellular signaling domain. In such embodiments, the spacer is interposed between the extracellular binding domain and the transmembrane domain.
[0422] In some embodiments, the intracellular signaling domain is a stimulating or an activating intracellular domain portion, such as a T cell stimulating or activating domain, providing a primary activation signal or primary signal. In some embodiments, the intracellular signaling domain comprises an intracellular signaling domain capable of inducing a primary activation signal in a T cell. In some embodiments, the intracellular signaling domain is a domain from a T cell receptor (TCR) component and / or comprises an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the intracellular signaling domain is a cytoplasmic signaling domain of a CD3-zeta (CD3ζ) chain, for instance a human CD3^ chain. In some embodiments, the intracellular signaling domain contains or additionally contains a costimulatory signaling domain to facilitate effector functions. In some embodiments, the intracellular signaling region further comprises a costimulatory signaling region, such as an intracellular signaling domain of a T cell costimulatory molecule or a signaling portion thereof. In some embodiments, the costimulatory signaling region is between the transmembrane region and the intracellular signaling domain. Upon specific binding to the molecule, e.g., antigen, the receptor generally delivers an immunostimulatory signal, such as an IT AM -transduced signal, into the cell, thereby promoting an immune response targeted to the disease or condition. In some embodiments, chimeric receptors when genetically engineered into immune cells can modulate T cell activity, and, in some cases, can modulate T cell differentiation or homeostasis, thereby resulting in genetically engineered cells with improved longevity, survival and / or persistence in vivo, such as for use in adoptive cell therapy methods.
[0423] Exemplary antigen receptors, including CARs, and methods for engineering and introducing such receptors into cells, include those described, for example, in international patent applicationpublication numbers W0200014257, WO2013126726. WO2012 / 129514, WO2014031687, WO2013 / 166321, W02013 / 071154, W02013 / 123061, U. S. patent application publication numbers US2002131960, US2013287748, US20130149337, U. S. Patent Nos.: 6.451,995, 7,446,190, 8,252,592, 8,339.645, 8,398,282, 7,446,179, 6,410,319. 7,070,995, 7,265,209, 7,354,762. 7,446,191, 8,324,353, and 8,479.118, and European patent application number EP2537416, and / or those described by Sadelain et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PloS ONE 8(4): e61338; Turtle et al., Curr. Opin. Immunol., 2012 October; 24(5): 633-39; Wu et al., Cancer, 2012 March 18(2): 160-75. In some aspects, die antigen receptors include a CAR as described in U. S. Patent No.: 7,446,190, and those described in International Patent Application Publication No.: WO / 2014055668 Al. Examples of the CARs include CARs as disclosed in any of the aforementioned publications, such as WO2014031687, US 8,339,645. US 7.446.179, US 2013 / 0149337, U. S. Patent No.: 7,446,190, US Patent No.: 8,389,282, Kochenderfer et al., 2013, Nature Reviews Clinical Oncology, 10, 267-276 (2013); Wang et al. (2012) J. Immunother. 35(9): 689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also WO2014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, U. S. Patent No.: 7.446,190, and US Patent No.: 8,389,282.
[0424] The CAR generally includes an extracellular antigen binding domain, such as a portion of an antibody molecule, generally a variable heavy (VH) chain region and / or variable light (VL) chain region of an antibody. Among the provided receptors are CARs in which the extracellular binding domain is composed of variable region sequences (e.g., variable heavy chain and variable light chain sequences) of antibodies or antigen-binding fragments thereof. In some embodiments, the extracellular binding domain is an scFv antibody fragment. In some embodiments, the antibody or antigen-binding portion thereof is expressed on cells as part of a chimeric antigen receptor (CAR), that binds, such as specifically binds, to die antigen (c.g., CD 19). In some embodiments, the CAR contains an extracellular domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the CAR also includes a spacer domain (e.g. hinge domain) separating the extracellular binding domain and the transmembrane domain.
[0425] In some aspects, the CAR contains an extracellular binding domain (e.g., CD19 binding domain and a transmembrane domain that contains a transmembrane portion of CD28). The extracellular domain and transmembrane can be linked directly or indirectly. In some embodiments, the extracellular domain and transmembrane are linked by a spacer, such as any described herein. In some embodiments, the chimeric antigen receptor contains an intracellular domain containing a CD3zeta intracellular signaling domain and a signaling domain of a T cell costimulatory molecule. In some embodiments, the costimulatory signaling domain is between the transmembrane domain and CD3zeta intracellular signaling domain. In some aspects, the T cell costimulatory molecule is 4- IBB.
[0426] Also provided herein are polynucleotides encoding any of the provided recombinant receptors, such as any of the provided CARs.
[0427] In some embodiments, the CARs are encoded by polynucleotides. The provided polynucleotides can be incorporated into constructs, such as deoxyribonucleic acid (DNA) or RNA constructs, such as those that can be introduced into cells for expression of the encoded CAR. Hence, also provided herein are engineered cells containing any of the provided CARs. Exemplary engineered cells and methods of preparing same are described in Section VI. Also provided herein are compositions and articles of manufacture and uses of any of the engineered cells. Also provided are cells expressing the recombinant receptors and uses thereof in adoptive cell therapy, such as treatment of diseases and disorders associated with expression of the antigen, such as CD 19 expression.A. Extracellular Antigen-Binding Domains
[0428] The extracellular binding domain of a CAR provides a means for binding to an antigen or antigens. In some embodiments, the CAR includes an extracellular binding domain that is an antigenbinding portion or portions of an antibody molecule. In some embodiments, the antigen-binding domain is a portion of an antibody molecule, generally including a variable heavy (VH) chain region and / or variable light (VL) chain region of the antibody. In some embodiments, the CAR includes an antigenbinding portion or portions of an antibody molecule, such as a single-chain antibody fragment (scFv) derived from the variable heavy' (VH) and variable light (VL) chains of a monoclonal antibody (mAb). In some embodiments, the an...
Claims
CLAIMSWHAT IS CLAIMED:
1. A genetically engineered T cell comprising:(a) a genetic disruption in the endogenous TRAC gene, wherein the genetic disruption in the endogenous TRAC gene is in a target site in exon 1 of the TRAC gene, and wherein the target site in exon 1 of the TRAC gene has the sequence set forth in SEQ ID NO: 84, a contiguous portion thereof of at least 12 nucleotides (nt), or a complementary sequence of the foregoing:(b) a transgene encoding a CD 19 chimeric antigen receptor (CAR) comprising the amino acid sequence set forth in SEQ ID NO: 78, wherein the transgene encoding the CD19 CAR is integrated at the target site in exon 1 of the TRAC gene;(c) a genetic disruption in the endogenous B-2 microglobulin (B2M) gene; wherein the genetic disruption in the endogenous B2M gene is in a target site in exon 2 of the B2M gene, and wherein the target site in exon 2 of the B2M gene has the sequence set forth in SEQ ID NO: 85, a contiguous portion thereof of at least 12 nucleotides (nt), or a complementary sequence of the foregoing; and(d) a transgene encoding a single chain HLA-E fusion protein comprising the amino acid sequence set forth in SEQ ID NO:
81. wherein the transgene encoding the single chain HLA-E fusion protein is integrated at the target site in exon 2 of the B2M gene.
2. The genetically engineered T cell of claim 1, wherein one or more alleles of the endogenous TRAC gene are disrupted.
3. The genetically engineered T cell of claim 1 or 2, wherein all alleles of the endogenous TRAC gene are disrupted.
4. The genetically engineered T cell of any of claims 1-3, wherein the genetically engineered T cell has reduced protein expression of TCR alpha chain encoded from the endogenous TRAC gene, optionally wherein the genetically engineered T cell has reduced protein expression of the TCR alpha chain on the surface of the T cell, more optionally wherein the genetically engineered T cell does not express detectable TCR alpha chain.
5. The genetically engineered T cell of any of claims 1-4, wherein the genetically engineered T cell has reduced expression of CD3 on the cell surface, optionally wherein the genetically engineered T cell does not express detectable CD3 on the cell surface.
6. The genetically engineered T cell of any of claims 1-5. wherein one or more alleles of the endogenous B2M gene are disrupted.
7. The genetically engineered T cell of any of claims 1-6, wherein all alleles of the endogenous B2M gene are disrupted.
8. The genetically engineered T cell of any of claims 1-7. wherein the genetically engineered T cell has reduced protein expression of B2M encoded from the endogenous B2M gene, optionally wherein the genetically engineered T cell does not express detectable B2M.
9. The genetically engineered T cell of any of claims 1-8, wherein the genetically engineered T cell has reduced expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface, optionally wherein the genetically engineered cell has no detectable expression of one or more HLA class I molecules (e.g.. HLA-A class I, HLA-B class I and / or HLA-C class 1) on the cell surface.
10. The genetically engineered T cell of any of claims 1-9, wherein the genetically engineered T cell has no detectable expression of HLA-A class I. HLA-B class I and HLA-C class I on the cell surface.
11. The genetically engineered T cell of any of claims 1-10, wherein the single chain HLA-E fusion protein is capable of engaging inhibitory receptors on the surface of NK cells.
12. The genetically engineered T cell of any of claims 1-11, wherein the transgene encoding the CD 19 CAR is present in the disrupted TRAC gene in the T cell under the operable control of a promoter.
13. The genetically engineered T cell of claim 12, wherein the promoter is a heterologous promoter of the / RAC gene.
14. The genetically engineered T cell of claim 13, wherein the heterologous promoter is or comprises a human elongation factor 1 alpha (EF1α) promoter or a variant thereof.
15. The genetically engineered T cell of any of claims 1-14, wherein the transgene encoding the CD19 CAR comprises the sequence set forth in SEQ ID NO:136.
16. The genetically engineered T cell of any of claims 1-15. wherein the transgene encoding the single chain HLA-E fusion protein comprises the sequence set forth in SEQ ID NO: 86.
17. The genetically engineered T cell of any of claims 1-16, wherein the transgene encoding the CD19 CAR comprises the sequence set forth in SEQ ID NO: 136 and the transgene encoding the single chain HLA-E fusion protein comprises the sequence set forth in SEQ ID NO: 86.
18. The genetically engineered T cell of any of claims 1-17, wherein the T cell is a primary T cell.
19. The genetically engineered T cell of claim 18, wherein the primary T cell is from a human donor.
20. The genetically engineered T cell of claim 19. wherein the human donor is a healthy donor aged 18 to 35 years old and having a body mass index (BMI) less than 30 kg / m2.
21. The genetically engineered T cell of claim 20, wherein the healthy donor is male.
22. The genetically engineered T cell of claim 20, wherein the healthy donor is female.
23. The genetically engineered T cell of claim 22, wherein the female is nulliparous and non-pregnant.
24. A method of producing a genetically engineered T cell, the method comprising:(a) introducing into a T cell a first CRISPR-Cas sy stem comprising a Cas protein and a guide RNA (gRNA) for inducing a genetic disruption at a target site in exon 1 of an endogenous T cell receptor alpha constant (TRAC) gene; wherein the target site in exon 1 of the endogenous TRAC gene has the sequence set forth in SEQ ID NO: 84, a contiguous portion thereof of at least 12 nucleotides (nt), or a complementary sequence of the foregoing, and the gRNA comprises a spacer sequence that is complementary to the target site;(b) introducing into the T cell a second CRISPR-Cas system comprising a Cas protein and a guide RNA (gRNA) for inducing a genetic disruption at a target site in exon 2 of an endogenous B-2 microglobulin (B2M) gene, wherein the target site in exon 2 of the B2M gene has the sequence set forth in SEQ ID NO: 85, a contiguous portion thereof of at least 12 nucleotides (nt), or a complementary sequence of the foregoing, and the gRNA comprises a spacer sequence that is complementary to the target site;(c) introducing into the T cell a polynucleotide comprising a transgene encoding a CD 19 chimeric antigen receptor (CAR) comprising the amino acid sequence set forth in SEQ ID NO: 78; and (d) introducing into the T cell a polynucleotide comprising a transgene encoding a single chain HLA-E fusion protein comprising the amino acid sequence set forth in SEQ ID NO: 81.
25. The method of claim 24, wherein each CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising the Cas protein and the gRNA.
26. The method of claim 25, wherein the first CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising a Cas9 protein and the gRNA.
27. The method of any of claims 24-26, wherein the Cas is a S. pyogenes Cas9 (spCas9).
28. The method of any of claims 24-27, wherein the spacer sequence of the gRNA complementary to the target site in exon 1 of the endogenous TRAC gene comprises the nucleic acid sequence of SEQ ID NO: 87, or a contiguous portion thereof of at least 12 nt.
29. The method of any of claims 24-28, wherein introducing the first CRISPR-Cas system disrupts one or more alleles of the endogenous TRAC gene.
30. The method of any of claims 24-29, wherein introducing the first CRISPR-Cas system disrupts all alleles of the endogenous TRAC gene.
31. The method of any of claims 24-30, wherein introducing the first CRISPR-Cas system into the T cell reduces protein expression of TCR alpha chain encoded from the endogenous TRAC gene, optionally protein expression of the TCR alpha chain on the surface of the T cell, more optionally wherein there is no detectable expression of TCR alpha chain in the T cell.
32. The method of any of claims 24-31, wherein the second CRISPR-Cas system is a ribonucleoprotein (RNP) complex comprising a Casl2a protein and the gRNA.
33. The method of claim 32, wherein the Casl2a is Francisella novicida Casl2a (FnCasl2a), Lachnospiraceae bacterium Casl2a (LbCasl2a). Acidaminococcus,sp. Casl2a (AsCasl2a).
34. The method of any of claims 24-33, wherein the spacer sequence of the gRNA complementary to the target site in exon 2 of the endogenous B2M gene comprises the nucleic acid sequence of SEQ ID NO: 105, or a contiguous portion thereof of at least 12 nt.
35. The method of any of claims 24-34, wherein introducing the second CRISPR-Cas system disrupts one or more alleles of the endogenous B2M gene.
36. The method of any of claims 24-34, wherein introducing the second CRISPR-Cas system disrupts all alleles of the endogenous B2M gene.
37. The method of any of claims 24-36, wherein introducing the second CRISPR-Cas system reduces protein expression of B2M encoded from the endogenous B2M gene, optionally wherein there is no detectable expression of B2M in the T cell.
38. The method of any of claims 24-37. wherein introducing the second CRISPR-Cas system reduces expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface, optionally wherein there is no detectable expression of one or more HLA class I molecules (e.g., HLA-A class I, HLA-B class I and / or HLA-C class I) on the cell surface.
39. The method of any of claims 24-38, wherein introducing the second CRISPR-Cas system results in no detectable expression of HLA-A class I, HLA-B class I and HLA-C class I on the cell surface.
40. The method of any of claims 24-39, wherein each gRNA independently comprises a spacer sequence between 14 nt and 24 nt, or between 16 nt and 22 nt in length.
41. The method of any of claims 24-40. wherein each gRNA independently comprises a spacer sequence that is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length.
42. The method of any of claims 24-41, wherein each gRNA further comprises a scaffold sequence for binding the respective Cas protein.
43. The method of any of claims 24-42, wherein the gRNA is modified by one or more modified nucleotides, wherein the one or more modified nucleotides are for increased stability of the gRNA.
44. The method of any of claims 24-43, wherein the gRNA targeting the endogenous TRAC gene comprises the sequence set forth in SEQ ID NO: 82 or SEQ ID NO: 92.
45. The method of any of claims 24-44. wherein the gRNA targeting the endogenous B2M gene comprises the sequence set forth in SEQ ID NO: 83.
46. The method of any of claims 24-45, wherein the gRNA targeting the endogenous TRAC gene and / or the gRNA targeting the endogenous B2M gene induces a double strand break.
47. The method of any of claims 24-46, wherein the transgene encoding a single chain HLA-E fusion protein is integrated via homology directed repair (HDR) at the target site in the B2M gene.
48. The method of any of claims 24-47, wherein the polynucleotide comprising the transgene encoding the single chain HLA-E fusion protein further comprises one or more homology arm(s) linked to the transgene, wherein the one or more homology arm(s) comprise a sequence homologous to nucleic acid sequences surrounding the target site sequence in the endogenous B2M gene.
49. The method of claim 48, wherein the polynucleotide comprising the transgene encoding the single chain HLA-E fusion protein comprises the structure [5’ homology arm]-[transgene]-[3’ homology arm], wherein the 5’ homology arm and 3’ homology arm comprises nucleic acid sequences homologous to the nucleic acid sequences surrounding the target site sequence in the endogenous B2M gene.
50. The method of claim 48 or claim 49, wherein the 5’ homology arm and 3’ homology arm independently are at or about 200, 300, 400, 500, 600, 700 or 800 nucleotides in length, or any value between any of the foregoing.
51. The method of any of claims 48-50, wherein the 5' homology arm comprises the sequence set forth in SEQ ID NO: 79 or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 79 or a partial sequence thereof,and / or the 3’ homology arm comprises the sequence set forth in SEQ ID NO: 80, a sequence that has at least at or about 90%, 91%. 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 80 or a partial sequence thereof.
52. The method of any of claims 48-51, wherein the 5 ’ homology arm comprises the sequence set forth in SEQ ID NO: 79 and the 3’ homology arm comprises the sequence set forth in SEQ ID NO: 80.
53. The method of any of claims 24-52. wherein the transgene encoding the CD 19 CAR is integrated via homology directed repair (HDR) at the target site in the TRAC gene.
54. The method of any of claims 24-53, wherein the polynucleotide comprising the transgene encoding the CD19 CAR further comprises one or more homology arm(s) linked to the transgene, wherein the one or more homology ann(s) comprise a sequence homologous to nucleic acid sequences surrounding the target site sequence in the endogenous TRAC gene.
55. The method of claim 54, wherein the polynucleotide comprising the transgene encoding the CD19 CAR comprises the structure [5’ homology7arm]- [transgene] -[3’ homology7arm], wherein the 5’ homology7ann and 3’ homology7arm comprises nucleic acid sequences homologous to the nucleic acid sequences surrounding tire target site sequence in the endogenous TRAC gene.
56. The method of claim 54 or claim 55. wherein the 5’ homology arm and 3’ homology7arm independently are at or about 200, 300, 400, 500, 600, 700 or 800 nucleotides in length, or any value between any of the foregoing.
57. The method of any of claims 54-56. wherein the 5’ homology arm comprises the sequence set forth in SEQ ID NO: 76 or a sequence that has at least at or about 90%, 91%. 92%. 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 76 or a partial sequence thereof, and / or the 3’ homology arm comprises the sequence set forth in SEQ ID NO:
77. a sequence that has at least at or about 90%. 91%. 92%, 93%, 94%. 95%. 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 77 or a partial sequence thereof.
58. The method of any of claims 54-57. wherein the 5’ homology arm comprises the sequence set forth in SEQ ID NO: 76 and the 3’ homology arm comprises the sequence set forth in SEQ ID NO: 77.
59. The method of any of claims 47-58, wherein the transgene encoding the single chain HLA-E fusion is integrated to be under the operable control of the endogenous B2M promoter, optionally wherein the transgene encoding the single chain HLA-E fusion protein comprises one or more multicistronic element(s) positioned upstream of the nucleotide sequence encoding the single chain HLA-E fusion, more optionally wherein the one or more multicistronic element is or comprises aT2A, a P2A,an E2A, or an F2A element.
60. The method of any of claims 53-59. wherein the transgene encoding the CD19 CAR is operably linked to a heterologous promoter to control expression of the CD19 CAR.
61. The method of claim 60, wherein the heterologous promoter is or comprises a human elongation factor 1 alpha (EF1α) promoter or a variant thereof.
62. The method of any of claims 24-61, wherein:the introducing of the polynucleotide comprising the transgene encoding the CD 19 CAR is by transduction of a first viral vector comprising the polynucleotide encoding the CD 19 CAR; and the introducing of the polynucleotide comprising the transgene encoding the single chain HLA-E fusion protein is by transduction of a second viral vector comprising the polynucleotide comprising the transgene encoding the single chain HLA-E fusion protein.
63. The method of claim 62, wherein a mixture comprising the first viral vector and the second viral vector are introduced into the T cell.
64. The method of claim 62 or claim 63, wherein the first viral vector is an AAV vector and the second viral vector is an AAV vector, optionally wherein tire AAV vector is an AAV6 vector.
65. The method of any of claims 24-64, wherein the first CRISPR-Cas system and the second CRISPR-Cas system are introduced into the T cell via electroporation.
66. The method of any of claims 24-65. wherein the polynucleotide comprising the transgene encoding the CD19 CAR comprises the nucleotide sequence set forth in SEQ ID NO: 94.
67. The method of any of claims 24-66, wherein the polynucleotide comprising the transgene encoding the single chain HLA-E fusion protein comprises the nucleotide sequence set forth in SEQ ID NO: 137.
68. The method of any of claims 24-67, wherein the polynucleotide comprising the transgene encoding the CD 19 CAR comprises the nucleotide sequence set forth in SEQ ID NO: 94 and the polynucleotide comprising the transgene encoding the single chain HLA-E fusion protein comprises the nucleotide sequence set forth in SEQ ID NO: 137.
69. The method of any of claims 24-68, wherein the transgene encoding the CD19 CAR comprises the nucleotide sequence set forth in SEQ ID NO:136.
70. The method of any of claims 24-69. wherein the transgene encoding the single chain HLA-E fusion protein comprises the nucleotide sequence set forth in SEQ ID NO: 86.
71. The method of any of claims 24-70, wherein tire first CRISPR-Cas system and secondCRISPR-Cas system are introduced simultaneously.
72. The method of any of claims 65-71. wherein after the electroporation, the method comprises introducing the polynucleotides by transducing the T cells with a mixture of viral vectors, wherein the mixture of viral vectors comprises a first viral vector comprising the polynucleotide comprising the transgene encoding the CD 19 CAR and a second viral vector comprising the polynucleotide comprising the transgene encoding the single chain HLA-E fusion protein.
73. The method of claim 72, wherein the first viral vector is an AAV vector and the second viral vector is an AAV vector, optionally wherein the AAV vector is an AAV6 vector.
74. The method of claim 72 or claim 73, wherein transducing is within about 15 minutes, within about 30 minutes, within about 60 minutes, or within about 2 hours, after the electroporation.
75. The method of any of claims 72-74, wherein after the transducing the method further comprises incubating the cell under static conditions in serum free media for a period of time for recovery of the cells.
76. The method of any of claims 72-75, wherein the method further comprises expanding the T cells 2 to 8 doublings or 6 to 7 doublings, optionally expanding the T cells in the presence of one or more recombinant cytokines, optionally in the presence of one or more recombinant IL-2, IL-7 and / or IL-15.
77. The method of claim 76, wherein the expanding is carried out with perfusion.
78. The method of any of claims 24-77, wherein prior to each of the introducing, the method comprises stimulating the T cells with one or more stimulatory agent(s) under conditions to stimulate or activate the T cells, optionally wherein the one or more stimulatory agent(s) comprises anti-CD3 and / or anti-CD28 antibodies, optionally anti-CD3 / anti-CD28 Fabs.
79. The method of any of claims 24-78, wherein the T cell is a primary T cell.
80. The method of claim 79, wherein the primary T cell is from a human donor.
81. The method of claim 80, wherein the human donor is a healthy donor aged 18 to 35 years old and having a body mass index (BMI) less than 30 kg / m2.
82. The method of claim 81, wherein the healthy donor is male.
83. The method of claim 81, wherein the healthy donor is female.
84. The method of claim 83, wherein the female is nulliparous and non-pregnant.
85. The method of any of claims 24-84, wherein the method is performed ex vivo.
86. The method of any of claims 24-85, wherein the method is performed in vitro.
87. The method of any of claims 24-86, further comprising harvesting T cells produced by the method.
88. The method of claim 87, further comprising depleting CD3+ T cells from the harvested T cells.
89. The method of claim 87 or claim 88, further comprising formulating the harvested T cells with a cryoprotectant.
90. A genetically engineered T cell produced by the method of any of claims 24-89.
91. A composition comprising a population of genetically engineered T cells of any of claims 1-23.
92. A composition comprising a population of genetically engineered T cells produced by the method of any of claims 24-89.
93. The composition of claim 91 or claim 92, wherein the composition is a pharmaceutical composition comprising a pharmaceutically acceptable excipient.
94. The composition of any of claims 91-93. wherein the composition comprises a cyroprotectant, optionally wherein the cryoprotectant is DMSO.
95. The composition of any of claims 91-94, wherein the composition comprises CD4+ T cells and CD8+ T cells.
96. The composition of claim 95, wherein the ratio of CD4+ T cells to CD8+ T cells is from at or about 1: 5 to at or about 5:1, optionally from at or about 1:3 to at or about 3:1.
97. The composition of any of claims 91-96, wherein at least about 50% of the T cells are viable.
98. The composition of any of claims 91-96. wherein at least about 60% of the T cells are viable.
99. The composition of any of claims 91-96, wherein at least about 70% of the T cells are viable.
100. The composition of any of claims 91-96, wherein at least about 80% of the T cells are viable.
101. The composition of any of claims 91-96, wherein at least about 90% of the T cells are viable.
102. The composition of any of claims 91-101, wherein at least about 10% of total alleles have edited TRAC loci.
103. The composition of any of claims 91 -101, wherein at least about 20% of total alleles have edited TRAC loci.
104. The composition of any of claims 91 -101. wherein at least about 30% of total alleles have edited TRAC loci.
105. The composition of any of claims 91 -101, wherein at least about 40% of total alleles have edited TRAC loci.
106. The composition of any of claims 91 -101, wherein at least about 50% of total alleles have edited TRAC loci.
107. The composition of any of claims 91 -101, wherein at least about 60% of total alleles have edited TRAC loci.
108. The composition of any of claims 91 -101. wherein at least about 70% of total alleles have edited TRAC loci.
109. The composition of any of claims 91 -101, wherein at least about 80% of total alleles have edited TRAC loci.
110. The composition of any of claims 91 -101, wherein at least about 90% of total alleles have edited TRAC loci.
111. The composition of any of claims 91 -110, wherein at least about 10% of total alleles have edited B2M loci.
112. The composition of any of claims 91 -110, wherein at least about 20% of total alleles have edited B2M loci.
113. The composition of any of claims 91 -110, wherein at least about 30% of total alleles have edited B2M loci.
114. The composition of any of claims 91 -110, wherein at least about 40% of total alleles have edited B2M loci.
115. The composition of any of claims 91 -110, wherein at least about 50% of total alleles have edited B2M loci.
116. The composition of any of claims 91 -110, wherein at least about 60% of total alleles have edited B2M loci.
117. The composition of any of claims 91 -110, wherein at least about 70% of total alleles have edited B2M loci.
118. The composition of any of claims 91-110, wherein at least about 80% of total alleles have edited B2M loci.
119. The composition of any of claims 91-110. wherein at least about 90% of total alleles have edited B2M loci.
120. The composition of any of claims 91-119, wherein at least about 10% of total alleles have the transgene encoding the CD19 CAR integrated in the TRAC locus.
121. The composition of any of claims 91-119, wherein at least about 20% of total alleles have the transgene encoding the CD19 CAR integrated in the TRAC locus.
122. The composition of any of claims 91-119, wherein at least about 30% of total alleles have the transgene encoding the CD 19 CAR integrated in the TRAC locus.
123. The composition of any of claims 91-119. wherein at least about 40% of total alleles have the transgene encoding the CD19 CAR integrated in the TRAC locus.
124. The composition of any of claims 91-119, wherein at least about 50% of total alleles have the transgene encoding the CD19 CAR integrated in the TRAC locus.
125. The composition of any of claims 91-119, wherein at least about 60% of total alleles have the transgene encoding the CD19 CAR integrated in the TRAC locus.
126. The composition of any of claims 91-119, wherein at least about 70% of total alleles have the transgene encoding the CD 19 CAR integrated in the TRAC locus.
127. The composition of any of claims 91-119, wherein at least about 80% of total alleles have the transgene encoding the CD19 CAR integrated in the TRAC locus.
128. The composition of any of claims 91-119, wherein at least about 90% of total alleles have the transgene encoding the CD19 CAR integrated in the TRAC locus.
129. The composition of any of claims 91-128, wherein at least about 10% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
130. The composition of any of claims 91-128, wherein at least about 20% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
131. The composition of any of claims 91-128, wherein at least about 30% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
132. The composition of any of claims 91-128, wherein at least about 40% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
133. The composition of any of claims 91-128, wherein at least about 50% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
134. The composition of any of claims 91-128. wherein at least about 60% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
135. The composition of any of claims 91-128, wherein at least about 70% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
136. The composition of any of claims 91-128, wherein at least about 80% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
137. The composition of any of claims 91-128, wherein at least about 90% of total alleles have the transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus.
138. The composition of any of claims 91-137. wherein at least about 50% of the T cells are CD2+CD5+.
139. The composition of any of claims 91-137, wherein at least about 60% of the T cells are CD2+CD5+.
140. The composition of any of claims 91-137, wherein at least about 70% of the T cells are CD2+CD5+.
141. The composition of any of claims 91-137, wherein at least about 80% of the T cells are CD2+CD5+.
142. The composition of any of claims 91-137, wherein at least about 90% of the T cells are CD2+CD5+.
143. The composition of any of claims 91-142, wherein at least about 10% of the T cells are CD2+CD5+ and express the CD 19 CAR.
144. The composition of any of claims 91-142, wherein at least about 20% of the T cells are CD2+CD5+ and express the CD 19 CAR.
145. The composition of any of claims 91-142, wherein at least about 30% of the T cells are CD2+CD5+ and express the CD 19 CAR.
146. The composition of any of claims 91-142, wherein at least about 40% of the T cells are CD2+CD5+ and express the CD 19 CAR.
147. The composition of any of claims 91-142, wherein at least about 50% of the T cells are CD2+CD5+ and express the CD 19 CAR.
148. The composition of any of claims 91-142, wherein at least about 60% of the T cells are CD2+CD5+ and express the CD 19 CAR.
149. The composition of any of claims 91-142. wherein at least about 70% of the T cells are CD2+CD5+ and express the CD19 CAR.
150. The composition of any of claims 91-142, wherein at least about 80% of the T cells are CD2+CD5+ and express the CD 19 CAR.
151. The composition of any of claims 91-142, wherein at least about 90% of the T cells are CD2+CD5+ and express the CD 19 CAR.
152. The composition of any of claims 91-151, wherein the composition comprises at least about 5,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
153. The composition of any of claims 91-151. wherein the composition comprises at least about 5.500.000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
154. The composition of any of claims 91-151, wherein the composition comprises at least about 6.000.000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
155. The composition of any of claims 91-151, wherein the composition comprises at least about 6,500,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
156. The composition of any of claims 91-151, wherein the composition comprises at least about 7,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
157. The composition of any of claims 91-151, wherein the composition comprises at least about 7.500.000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
158. The composition of any of claims 91-151, wherein the composition comprises at least about 8,000.000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
159. The composition of any of claims 91-151, wherein the composition comprises at least about 8,500,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
160. The composition of any of claims 91-151, wherein the composition comprises at least about 9,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
161. The composition of any of claims 91-151, wherein the composition comprises at least about 9.500.000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
162. The composition of any of claims 91-151, wherein the composition comprises at least about 10,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
163. The composition of any of claims 91-151, wherein the composition comprises at least about 11,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
164. The composition of any of claims 91-151. wherein the composition comprises at least about 12,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
165. The composition of any of claims 91-151, wherein the composition comprises at least about 13,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
166. The composition of any of claims 91-151, wherein the composition comprises at least about 14,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
167. The composition of any of claims 91-151, wherein the composition comprises at least about 15,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
168. The composition of any of claims 91-151. wherein the composition comprises at least about 16,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
169. The composition of any of claims 91-151, wherein the composition comprises at least about 17,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
170. The composition of any of claims 91-151, wherein the composition comprises at least about 18,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
171. The composition of any of claims 91-151, wherein the composition comprises at least about 19,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
172. The composition of any of claims 91-151, wherein the composition comprises at least about 20,000,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition.
173. The composition of any of claims 91-172, wherein the composition has less than about 1 EU / mL endotoxin.
174. The composition of any of claims 91-172, wherein the composition has less than about 2 EU / mL endotoxin.
175. The composition of any of claims 91-172, wherein the composition has less than about 3 EU / mL endotoxin.
176. The composition of any of claims 91-172, wherein the composition has less than about 4 EU / mL endotoxin.
177. The composition of any of claims 91-172, wherein the composition has less than about 5 EU / mL endotoxin.
178. The composition of any of claims 91 -172, wherein the composition has less than about 6 EU / mL endotoxin.
179. The composition of any of claims 91 -172. wherein the composition has less than about 7 EU / mL endotoxin.
180. The composition of any of claims 91 -172, wherein the composition has less than about 8 EU / mL endotoxin.
181. The composition of any of claims 91 -172, wherein the composition has less than about 9 EU / mL endotoxin.
182. The composition of any of claims 91 -172, wherein the composition has less than about 10 EU / mL endotoxin.
183. The composition of any of claims 91 -172. wherein the composition has less than about 11 EU / mL endotoxin.
184. The composition of any of claims 91 -172, wherein the composition has less than about 12 EU / mL endotoxin.
185. The composition of any of claims 91 -172, wherein the composition has less than about 13 EU / mL endotoxin.
186. The composition of any of claims 91 -172, wherein the composition has less than about 14 EU / mL endotoxin.
187. The composition of any of claims 91 -172, wherein the composition has less than about 15 EU / mL endotoxin.
188. The composition of any of claims 91 -187, wherein the composition has less than about 100,000 TCR+ cells / kg patient weight.
189. The composition of any of claims 91 -187, wherein the composition has less than about 90,000 TCR+ cells / kg patient weight.
190. The composition of any of claims 91 -187, wherein the composition has less than about 80,000 TCR+ cells / kg patient weight.
191. The composition of any of claims 91 -187, wherein the composition has less than about 70,000 TCR+ cells / kg patient weight.
192. The composition of any of claims 91 -187, wherein the composition has less than about 60,000 TCR+ cells / kg patient weight.
193. The composition of any of claims 91-187, wherein the composition has less than about 50,000 TCR+ cells / kg patient weight.
194. The composition of any of claims 91 -187. wherein the composition has less than about 40,000 TCR+ cells / kg patient weight.
195. The composition of any of claims 91 -194, wherein less than about 10% of total alleles have translocation between TRAC and B2M.
196. The composition of any of claims 91 -194, wherein less than about 9% of total alleles have translocation between TRAC and B2M.
197. The composition of any of claims 91 -194, wherein less than about 8% of total alleles have translocation between TRAC and B2M.
198. The composition of any of claims 91 -194. wherein less than about 7% of total alleles have translocation between TRAC and B2M.
199. The composition of any of claims 91 -194, wherein less than about 6% of total alleles have translocation between TRAC and B2M.
200. The composition of any of claims 91 -194, wherein less than about 5% of total alleles have translocation between TRAC and B2M.
201. The composition of any of claims 91 -194, wherein less than about 4% of total alleles have translocation between TRAC and B2M.
202. The composition of any of claims 91 -194, wherein less than about 3% of total alleles have translocation between TRAC and B2M.
203. The composition of any of claims 91 -194, wherein less than about 2% of total alleles have translocation between TRAC and B2M.
204. The composition of any of claims 91 -194, wherein less than about 1% of total alleles have translocation between TRAC and B2M.
205. The composition of any of claims 91 -204, wherein the composition has no detected bacterial growth.
206. The composition of any of claims 91 -205, wherein the composition has no detected mycoplasma.
207. The composition of any of claims 91 -206, wherein the composition has no cytokine-independent growth.
208. The composition of any of claims 91-207, wherein the composition has no significant unexpected karyotype.
209. The composition of any of claims 91-208. wherein the composition is negative for the presence of HIV-1. HIV-2, HTLV-1, HTLV-2. HAV, HBV, HCV, CMV, EBV, HHV6, HHV7. HHV8. and / or B19.
210. The composition of any of claims 97-209, wherein the percentage of T cells that are viable is determined by determined by fluorescent microscopy.
211. The composition of any of claims 102-210, wherein the percentage of total alleles that have edited TRAC loci is determined by ddPCR.
212. The composition of any of claim 111-211, wherein the percentage of total alleles that have edited B2M loci is determined by ddPCR.
213. The composition of any of claim 120-212. wherein the percentage of total alleles that have a transgene encoding the CD 19 CAR integrated in the TRAC locus is determined by ddPCR.
214. The composition of any of claim 129-213, wherein the percentage of total alleles that have a transgene encoding the single chain HLA-E fusion protein integrated in the B2M locus is determined by ddPCR.
215. The composition of any of claim 138-214, wherein the percentage of T cells that are CD2+CD5+ is determined by flow cytometry.
216. The composition of any of claim 143-215, wherein the percentage of T cells that are CD2+CD5+ and express the CD19 CAR is determined by flow cytometry’.
217. The composition of any of claim 152-216. wherein the number of viable CD2+CD5+CD19 CAR+ cells per rnL of the composition is determined by flow cytometry.
218. The composition of any of claim 173-217, wherein the endotoxin level is determined by Limulus Amoebocyte Lysate (LAL).
219. The composition of any of claim 188-218, wherein the number of TCR+ cells / kg is determined by flow cytometry’ and calculated by multiplying the %TCR+ cells by viable cell number to get %TCR cells / mL, then multiplying the %TCR cells / mL by volume to obtain total number of TCR+ cells, then dividing the total number TCR+ cells by 60kg patient weight.
220. The composition of any of claim 195-219, wherein the percentage of total alleles that have translocation between TRAC and B2M is determined by ddPCR.
221. The composition of any of claim 205-220. wherein the detection of bacterial growth is determined by BacT / ALERT 3D.
222. The composition of any of claim 206-221, wherein die detection of mycoplasma is determined by qPCR.
223. The composition of any of claim 207-222. wherein the no cytokine independent growth is determined between day 31 and day 70 in a cell-based assay having a limit of detection (LOD) of about 1.5E5 cells / mL.
224. The composition of any of claim 208-223, wherein the no significant unexpected karyotype is determined by microscopy, wherein a significant unexpected karyotype is the same specific aberration or aberrant ploidy in more than 6 cells and occurs in two out of three test replicates or three out of three test replicates.
225. The composition of any of claim 209-224, wherein the presence of HIV-1, HIV-2, HTLV-1, HTLV-2, HAV, HBV, HCV, CMV, EBV, HHV6, HHV7, HHV8, and / or B19 is determined by PCR.
226. A composition comprising a population of T cells, wherein the T cells are from a healthy donor aged 18 to 35 years old and having a body mass index (BMI) less than 30 kg / m2, and wherein the composition has the following attributes:(i) at least about 70% of the T cells are viable;(ii) at least about 10% of total alleles have edited TRAC loci:(iii) at least about 10% of total alleles have edited B2M loci;(iv) at least about 10% of total alleles have a transgene encoding a single chain HLA-E fusion protein integrated in the B2M locus, such as a transgene comprising the sequence set forth in SEQ ID NO: 86, or a transgene encoding a single chain HLA-E fusion protein having an amino acid sequence set forth in SEQ ID NO: 81;(v) at least about 10% of total alleles have a transgene encoding a CD 19 CAR integrated in the TRAC locus, such as a transgene comprising the sequence set forth in SEQ ID NO: 136 or a transgene encoding a CD 19 CAR having an amino acid sequence set forth in SEQ ID NO: 78;(vi) at least about 90% of the T cells are CD2+CD5+;(vii) at least about 50% of the T cells are CD2+CD5+ and express the CD19 CAR, such as the CD19 CAR having an amino acid sequence set forth in SEQ ID NO: 78 or SEQ ID NO: 138;(viii) at least about 7,500.000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition;(ix) no detected bacterial growth;(x) less than about 5 EU / mL endotoxin;(xi) no detected mycoplasma;(xii) less than about 70,000 TCR+ cells / kg;(xiii) no cytokine-independent growth;(xiv) no significant unexpected karyotype(xv) less than about 5% of total alleles have translocation between TRAC and B2M; and (xvi) negative for the presence of HIV-1, HIV-2, HTLV-1, HTLV-2, HAV, HBV, HCV, CMV, EBV, HHV6, HHV7, HHV8, and / or B19.227 A composition comprising a population of T cells, wherein the T cells are from a healthy donor aged 18 to 35 years old and having a body mass index (BMI) less than 30 kg / m2, and wherein the composition has the following attributes:(i) at least about 70% of the T cells are viable determined by fluorescent microscopy; (ii) at least about 10% of total alleles have edited TRAC loci determined by ddPCR;(iii) at least about 10% of total alleles have edited B2M loci determined by ddPCR;(iv) at least about 10% of total alleles have a transgene encoding a single chain HLA-E fusion protein integrated in the B2M locus, such as a transgene comprising the sequence set forth in SEQ ID NO: 86, or a transgene encoding a single chain HLA-E fusion protein having an amino acid sequence set forth in SEQ ID NO: 81, determined by ddPCR;(v) at least about 10% of total alleles have a transgene encoding a CD19 CAR integrated in the TRAC locus, such as a transgene comprising the sequence set forth in SEQ ID NO: 136 or a transgene encoding a CD 19 CAR having an amino acid sequence set forth in SEQ ID NO: 78, determined by ddPCR;(vi) at least about 90% of the T cells are CD2+CD5+ determined by flow cytometry;(vii) at least about 50% of the T cells are CD2+CD5+ and express CD19 CAR, such as the CD19 CAR having an amino acid sequence set forth in SEQ ID NO: 78 or SEQ ID NO: 138, determined by flow cytometry;(viii) at least about 7,500,000 viable CD2+CD5+CD19 CAR+ cells per mL of the composition determined by flow cytometry;(ix) no detected bacterial growth determined by BacT / ALERT 3D;(x) less than about 5 EU / mL endotoxin determined by Limulus Amoebocyte Lysate (LAL);(xi) no detected mycoplasma determined by qPCR;(xii) less than about 70,000 TCR+ cells / kg determined by flow cytometry and calculated by multiplying the %TCR+ cells by viable cell number to get %TCR cells / mL, then multiplying the %TCR cells / mL by volume to obtain total number of TCR+ cells, then dividing the total number TCR+ cells by 60kg patient weight;(xiii) no cytokine-independent growth between day 31 and day 70 in a cell-based assay having a limit of detection (LOD) of about 1.5E5 cells / mL;(xiv) no significant unexpected karyotype determined by microscopy, wherein a significant unexpected kary otype is the same specific aberration or aberrant ploidy in more than 6 cells and occurs in two out of three test replicates or three out of three test replicates;(xv) less than about 5% of total alleles have translocation between TRAC and B2M determined by ddPCR; and(xvi) negative for the presence of HIV-1, HIV-2. HTLV-1. HTLV-2, HAV. HBV. HCV. CMV, EBV, HHV6. HHV7. HHV8, and / or B19 determined by PCR.
228. The composition of any of claims 91-227, wherein the composition comprises about 25xl06, about 30xl06, about 35xl06, about 40xl06, about 45xl06, about 50xl06. about 55xl06. about 60xl06, 65xl06, about 70xl06, about 75xl06, about 100x106. about 150xl06, about 200xl06, about 250x106, about 300x106, about 350x106, about 400x106, about 450x106, about 500x106, about 550x106, or about 600x106of the T cells per mL of the composition.
229. A method of treatment, the method comprising administering the T cell of any one of claims 1-23 or the composition of any one of claims 91-228 to a subject having a disease or disorder associated with CD 19.
230. The method of claim 229. wherein the disease or disorder is an autoimmune disease.
231. The method of claim 230. wherein the autoimmune disease is systemic lupus erythematosus (SLE). idiopathic inflammatory myopathies (IIM). multiple sclerosis (MS), systemic sclerosis (SSc), or rheumatoid arthritis (RA).
232. The method of any of claims 229-231. wherein about 25x10®’ about 30x10®, about 35x10®, about 40x10®, about 45x10®, about 50x10®, about 55x10®, about 60x106. 65x106. about 70x106. about 75x106, about 80x10®, about 85x10®, about 90x10®, about 95x10®, about 100x106, about 125x10®. about 150x106, about 175x10®. about 200x106, about 225x10®, about 250x10®, about 275x10®, about 300x10®, about 325x10®. about 350x10®, about 375x10®. about 400x10®, about 425x10®, about 450x10®. about 475x10®, about 500x10®, about 525x10®, about 550x10®, about 575x10®, or about 600x10® of the T cells are administered to the subject.
233. The method of any of claims 229-232, wherein less than about 5x104TCRαβ+ T cells / kg patient weight, less than about 6x104TCRαβ+ T cells / kg patient weight, or less than about 7x104TCRαβ+ T cells / kg patient weight are administered to the subject.