Products and methods for treating diseases or conditions associated with progerin expression from an aberrant LMNA gene

The REMEDY genome editing method addresses the lack of effective treatments for HGPS by using CRISPR to correct the LMNA gene mutation, reducing progerin expression and alleviating associated health issues.

WO2025240690A2PCT designated stage Publication Date: 2025-11-20RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 22 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/029485
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-15
Filing Date
2025-05-15
Publication Date
2025-11-20

AI Technical Summary

Technical Problem

Current treatments for Hutchinson-Gilford progeria syndrome (HGPS) and other conditions associated with aberrant LMNA gene expression, such as progerin, are inadequate, leading to premature aging and severe health issues with no approved therapies to slow progression.

Method used

A CRISPR/endonuclease-based genome editing method, termed REMEDY, uses guide RNA (gRNA) to induce a double-strand break in the mutant LMNA gene, leveraging the wild-type homologous chromosome as an endogenous DNA donor template for efficient correction of the C>G-to-T>A mutation without an exogenous template.

Benefits of technology

This method effectively reduces progerin expression, potentially extending lifespan and alleviating symptoms by correcting the dominant-negative C>G-to-T>A mutation in the LMNA gene, thereby treating or preventing conditions like HGPS and associated diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000018_0001
    Figure IMGF000018_0001
  • Figure IMGF000019_0001
    Figure IMGF000019_0001
  • Figure IMGF000061_0001
    Figure IMGF000061_0001
Patent Text Reader

Abstract

Disclosed herein are products, methods, and uses for treating, ameliorating, delaying the progression of, and / or preventing a disease or disorder associated with expression of an aberrant lamin A (LMNA) gene or progerin gene. Such disease or disorder includes, but is not limited to, a laminopathy, progeroid syndrome, progeria, or aging disorder resulting from the aberrant expression of LMNA or progerin. In some instances, the progeria is Hutchinson-Gilford progeria syndrome (HGPS). In some instances, the disease or disorder associated with the expression of progerin is premature aging or natural aging including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation. More particularly, disclosed herein are RNA interference-based products, methods, and uses for inhibiting or downregulating the expression of progerin. Even more particularly, the disclosure provides guide RNA and a CRISPR endonuclease for inhibiting or downregulating the expression of progerin and methods of using said guide RNA and a CRISPR endonuclease to correct a mutation in the LMNA gene and inhibit or downregulate progerin expression in cells and / or in cells of a subject having a condition resulting from the expression of progerin including, but not limited to, HGPS or progeria, an HGPS-like condition affecting LMNA mutations that affect exon 11 splicing, or a condition resulting from the expression of progerin.
Need to check novelty before this filing date? Find Prior Art

Description

PRODUCTS AND METHODS FOR TREATING DISEASES OR CONDITIONS ASSOCIATED WITH PROGERIN EXPRESSION FROM AN ABERRANT LMNA GENEINCORPORATION BY REFERENCE OF THE SEQUENCE LISTING

[0001] This application contains, as a separate part of disclosure, a Sequence Listing in computer-readable form (Filename: 59744_SeqListing.xml; Size: 40,695 bytes; Created: May 5, 2025) which is incorporated by reference herein in its entirety.FIELD

[0002] This disclosure relates to the field of the treatment of disease associated with the aberrant expression of the lamin A (LMNA) gene resulting in the expression of progerin, which makes cells unstable and leads to symptoms associated with progeria’s premature aging process or the natural aging process. In some instances, the disease or disorder associated with the aberrant expression of LMNA or progerin includes, but is not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation. More particularly, the disclosure provides a genome editing strategy, termed “REMEDY” (an acronym for REpair of heterozygous Mutations independent of Exogenous Donor template with high efficiency), using guide RNA (gRNA) with a CRISPR endonuclease that allows efficient repair of heterozygous mutations in the aberrant gene in cells without necessitating an exogenous donor DNA template. The genome editing strategy utilizes in-PAM or near-PAM CRISPR strategies to induce a double-strand break (DSB) in mutant alleles and, following the DSB, the wild-type homologous chromosome itself serves as an endogenous DNA donor template and initiates the correction of the mutant allele. Thus, the disclosure provides products, methods, and uses for treating, ameliorating, delaying the progression of, and / or preventing such disease or disorder associated with aberrant LMNA gene expression or progerin expression. Specifically, the disclosure provides products and methods for repairing a dominant-negative C*G-to-T*A mutation (c.1824 C>T; p.G608G), i.e., a spontaneous C to T substitution in the LMNA gene which encodes nuclear Lamin A and Lamin C. Even more specifically, the disclosure provides various guide RNAs (gRNAs) to correct the mutated allele in cells treated with AZD7648 post allele specific CRISPR targeting without an exogenous DNA template in the LMNA gene and methods of using to correct the aberrantexpression of LMNA or progerin expression in cells and / or in a subject demonstrating such aberrant expression of LMNA or progerin or at risk of demonstrating such aberrant expression of LMNA or progerin.BACKGROUND

[0003] Hutchinson-Gilford progeria syndrome (HGPS) or progeria, is a rare genetic condition that occurs spontaneously and is characterized by premature aging and death, mainly because of myocardial infarction, stroke, or heart failure. HGPS is inherited in an autosomal dominant manner. HGPS is primarily caused by new, non-inherited mutations that occur in the LMNA gene, specifically in codon 608 of exon 11 , located on chromosome 1 (Eriksson et al., Nature, 2003. 423(6937): 293-8). The LMNA gene encodes two essential components known as lamin A (LA or LMNA) and lamin C (LC), which form part of the nuclear lamina. This complex molecular structure is located within the inner nuclear membrane (De Sandre-Giovannoli et al., Science, 2003. 300(5628): 2055). Recent studies have revealed the crucial role of the lamina in various cellular processes, including cell division, chromatin organization, DNA replication, nuclear shape, and transcription (Goldman et al., Genes Dev, 2002. 16(5): p. 533-47). In the typical form of HGPS, the heterozygous LMNA mutation involves a substitution of a C to T nucleotide, leading to the activation of a cryptic splice donor site at position 1824 (c.1824C>T ; p.G608G) within exon 11 of the LMNA gene. Remarkably, this mutation does not alter the encoded amino acids, but causes a new alternative splicing event, leading to the formation of a mRNA lacking 150 nucleotides (Gruenbaum et al., Nat Rev Mol Cell Biol, 2005. 6(1 ): 21-31). Consequently, this mRNA is translated into a modified protein known as "progerin”, which exhibits an in-frame deletion of 50 amino acids near the C terminus (Gruenbaum et al., supra).

[0004] Progerin negatively impacts cellular functions and leads to various pathological effects in multiple tissues (i.e., cardiovascular, musculoskeletal, gastrointestinal and immune systems, skin, eyes and hair), resembling physiological aging. It also leads to death that is mainly due to myocardial infarction, stroke, or heart failure. Eliminating progerin either by knockdown, modulation of LMNA splicing, or base editing showed therapeutic efficacy in previous studies. This disclosure provides products and methods for editing the c.1824C>T; p.G608G mutation at the genomic level in affected tissues (i.e., striated muscles and the vasculature) so lifespan could be extended beyond the current average of 14 years.

[0005] LMNA is widely expressed in most differentiated cells and has a significant impact on both the structural integrity and functioning of the nucleus (Gruenbaum et al., supra). On the other hand, progerin is known to exert a dominant-negative effect on the nuclear functionof cells expressing LMNA. Additionally, progerin may negatively impact crucial processes including cell division, DNA replication, and transcription (Rober et al., Development, 1989. 105(2): 365-78; Goldman et aL, Proc Natl Acad Sci USA, 2004. 101 (24): 8963-8; Scaffidi et aL, Nat Med, 2005. 11 (4): 440-5). The toxic progerin protein elicits pathology in multiple tissues, leading to phenotypes similar to physiologic aging (e.g., atherosclerosis, alopecia, and osteoporosis) (Hennekam et al. Am J Med Genet A, 2006. 140(23): 2603-24). Progerin is known to be associated with premature aging or natural aging or a disease or disorder including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation. Currently there are no approved treatments that slow progression of HGPS, but effective progerin-targeted therapies would dramatically improve patient quality of life for patients suffering from the disease.

[0006] Since progeria arises from the expression of progerin, the most direct route to a therapy involves inhibiting the expression of progerin by targeting the aberrant LMNA gene which is responsible for progerin expression. There remains a need in the art for products and methods for targeting this gene, and the disclosure provides a new CRISPR / endonuclease-based genome editing method termed “REMEDY”, which provides advantages over existing gene correction approaches.SUMMARY

[0007] The disclosure provides products, methods, and uses for inhibiting aberrant LMNA expression or progerin expression and for treating, ameliorating, delaying the progression of, and / or preventing premature aging, natural aging or a disease or disorder associated with the expression of progerin. Such diseases or disorders include, but are not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0008] This disclosure provides a genome editing method that allows efficient repair of a dominant-negative C«G-to-T«A mutation (c.1824 C>T; p.G608G) in the LMNA gene which encodes nuclear Lamin A and Lamin C without necessitating an exogenous donor DNAtemplate. The method comprises in-PAM or near-PAM CRISPR techniques to induce a double-strand break (DSB) in the mutant allele. Following the DSB, the wild-type homologous chromosome itself serves as an endogenous DNA donor template and initiates the correction of the mutant allele.

[0009] The disclosure provides a nucleic acid comprising:(a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1-19;(b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19;(c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38; or(d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38.In some aspects, the nucleic acid further comprises a promoter and thus further comprises a promoter sequence. In some aspects, the promoter is any of U6, U7, tRNA, H1 , CMV, minimal CMV, T7, EF1 -alpha, Minimal EF1 -alpha, or a tissue-specific promoter. In some aspects, the promoter is U6, H1 , a muscle-specific promoter, or a cardiac-specific promoter. In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancerpromoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a-myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1.

[0010] The disclosure provides a vector comprising a nucleic acid comprising: (a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1-19; (b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19; (c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38; or (d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38. In some aspects, the nucleic acid further comprises a promoter and thus further comprises a promoter sequence. In some aspects, the promoter is any of U6, U7, tRNA, H1 , CMV, minimal CMV, 17, EF1- alpha, Minimal EF1-alpha, or a tissue-specific promoter. In some aspects, the promoter is U6, H1 , a muscle-specific promoter, or a cardiac-specific promoter. In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a- myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 . In some aspects, the vector is a recombinant adeno-associated virus (rAAV) vector. In some aspects, the virus lacks rep and / or cap genes. In some aspects, the vector is a self-complementary recombinant AAV (scAAV) or a single-stranded recombinant vector (ssAAV). In some aspects, the vector comprises a capsid of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV-BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101 , or any derivative thereof. In some aspects, the AAV vector is an AAV vector serotype of any of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhl 0, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV- BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101 , or any derivative thereof. In some aspects, the AAV vector is an AAV9 vector or a derivative thereof.

[0011] The disclosure provides a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) comprising a nucleic acid comprising: (a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1-19; (b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19; (c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38; or (d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising thesequence of any one of SEQ ID NOs: 20-38. In some aspects, the nucleic acid further comprises a promoter and thus further comprises a promoter sequence. In some aspects, the promoter is any of U6, U7, tRNA, H1 , CMV, minimal CMV, T7, EF1 -alpha, Minimal EF1- alpha, or a tissue-specific promoter. In some aspects, the promoter is U6, H1 , a musclespecific promoter, or a cardiac-specific promoter. In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a-myosin heavy chain (a- MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1.

[0012] The disclosure provides a ribonucleoprotein (RNP) complex comprising a CRISPR / Cas endonuclease complexed with a nucleic acid comprising: (a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1 -19; (b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19; (c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20- 38; or (d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38. In some aspects, the nucleic acid further comprises a promoter and thus further comprises a promoter sequence. In some aspects, the promoter is any of U6, U7, tRNA, H1 , CMV, minimal CMV, T7, EF1- alpha, Minimal EF1-alpha, or a tissue-specific promoter. In some aspects, the promoter is U6, H1 , a muscle-specific promoter, or a cardiac-specific promoter. In some aspects, the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 . In some aspects, the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a- myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 . In some aspects, the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease. In some aspects, the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 20-38 or a variant comprising at least orabout 90% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 20-38. In some aspects, the disclosure provides such RNP complex in a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP).

[0013] The disclosure provides a composition comprising(a) a nucleic acid of the disclosure;(b) a vector of the disclosure;(c) a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) of the disclosure; or(d) an RNP complex of the disclosure; and a pharmaceutically acceptable carrier.

[0014] The disclosure further provides a method of decreasing and / or inhibiting the expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell comprising introducing into the cell a composition comprising an RNP complex of the disclosure. In some aspects, introducing the composition into the cell is carried out by injection or by electroporation. In some aspects, the cell is in a subject. In some aspects, the subject is a human subject.

[0015] The disclosure also provides a method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of a composition comprising an RNP complex of the disclosure. In some aspects, the disease or disorder associated with an aberrant LMNA gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS. In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0016] The disclosure provides a method of genetically modifying a cell comprising an aberrant lamin A (LMNA) gene or progerin gene comprising obtaining a guide RNA (gRNA) that specifically hybridizes to a target DNA sequence within the genomic DNA of the cell,wherein the target DNA comprises a C to T substitution in the LMNA gene at position 1824; and introducing into the cell a ribonucleoprotein (RNP) complex comprising a CRISPR / Cas endonuclease with the gRNA that specifically hybridizes to the target DNA sequence. In some aspects, the gRNA comprises a nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38, or a variant thereof comprising at least or about 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38. In some aspects, the cell is in a subject. In some aspects, the cell is in a human subject. In some aspects, the human subject suffers from a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS. In some aspects, the human subject suffers from premature aging or natural aging. In some aspects, the human subject suffers from atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0017] The disclosure also provides a method of inhibiting the expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell comprising contacting the cell with(a) a nucleic acid of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure;(b) a vector of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure;(c) a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure; and / or(d) a composition of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure.

[0018] In some aspects, the nucleic acid encoding a gRNA of the disclosure and the nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure are delivered in the same nucleic acid, and / or the same vector, and / or the same nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP), and / or the same composition. In some aspects, the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease. In some aspects, the CRISPR / Cas endonuclease or the nucleic acid encoding a CRISPR / Cas endonuclease is provided in a vector, nanoparticle, extracellular vesicle,exosome, or virus-like particle (VLP). In some aspects, the nucleic acid that encodes or comprises the lamin A-targeting guide RNA (gRNA) and the CRISPR / Cas endonuclease or the nucleic acid encoding the CRISPR / Cas endonuclease are provided in the same vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP). In some aspects, the disease or disorder associated with an aberrant LMNA gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS. In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0019] The disclosure further provides a method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of(a) a nucleic acid of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure;(b) a vector of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure;(c) a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure; and / or(d) a composition of the disclosure and a CRISPR / Cas endonuclease of the disclosure or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure.

[0020] In some aspects, the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease. In some aspects, the CRISPR / Cas endonuclease or the nucleic acid encoding the CRISPR / Cas endonuclease is provided in a vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP). In some aspects, the nucleic acid that encodes or comprises the lamin A-targeting guide RNA (gRNA) and the CRISPR / Cas endonuclease or the nucleic acid encoding the CRISPR / Cas endonuclease are provided in the same vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP), or composition. In some aspects, the disease or disorder associated with an aberrant LMNAgene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS. In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0021] The disclosure provides a use of(a) a nucleic acid of the disclosure;(b) a vector of the disclosure;(c) a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) of the disclosure;(d) an RNP complex of the disclosure; and / or(d) a composition of the disclosure for the preparation of a medicament for inhibiting expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell.

[0022] The disclosure provides a use of(a) a nucleic acid of the disclosure;(b) a vector of the disclosure;(c) a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) of the disclosure;(d) an RNP complex of the disclosure; and / or(d) a composition of the disclosure for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene.

[0023] The disclosure provides a use of(a) a nucleic acid of the disclosure;(b) a vector of the disclosure;(c) a nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) of the disclosure;(d) an RNP complex of the disclosure; and / or(d) a composition of the disclosure for the preparation of a medicament for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene. In some aspects, the use of a nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, virus-like particle (VLP), or composition of the disclosure further comprises the use of a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease of the disclosure for editing the aberrant LMNA gene in a cell in vitro or ex vivo or in a cell of a subject. In some aspects, the RNP complex of the disclosure provides both the nucleic acid encoding the gRNA and the CRISPR / Cas endonuclease to edit the aberrant LMNA gene. In some aspects, the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease. In some aspects, the disease or disorder associated with an aberrant LMNA gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS. In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0024] The disclosure provides a(a) nucleic acid of the disclosure;(b) vector of the disclosure;(c) nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) of the disclosure;(d) RNP complex of the disclosure;(e) composition of the disclosure;(f) method of the disclosure; and / or(g) use of the disclosure;wherein the nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, virus-like particle (VLP), composition, RNP complex, or composition is formulated for intramuscular injection, oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration.

[0025] The disclosure includes any nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, virus-like particle (VLP), RNP complex, composition, or medicament of the disclosure wherein the nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, virus-like particle (VLP), RNP complex, composition, or medicament is formulated for intramuscular injection, oral administration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, intracerebroventricular delivery or injection, intracerebral delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration.

[0026] Further aspects and advantages of the disclosure will be apparent to those of ordinary skill in the art from a review of the following detailed description, taken in conjunction with the drawings. It should be understood, however, that the detailed description (including the drawings and the specific examples), while indicating embodiments of the disclosed subject matter, are given by way of illustration only, because various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Fig. 1 A-B provides the results of the REMEDY method in progeria patient-derived fibroblasts showed a highly efficient deletion of the mutated allele and also achieved correction of mutated allele (50% to 69% wild-type allele) in the cells treated with AZD7648 post allele specific CRISPR targeting without an exogenous DNA template. Fig. 1 A shows the results of deep sequencing analyses performed on PCR amplicons obtained using genomic DNA of treated fibroblasts as template. Deep sequencing analyzes the unique variations of amplicons present. Next Generation Sequencing (NGS) adaptors and barcodes were added to the ends of the amplicon and ran through the Illumina MiSeq. Unique amplicons that had at least 100 reads across the total reads were combined into the complete data set. The data set gathered from the reads were subjected to analysis using CRISPResso2 (http-colon-forward slash_forward slash_crispresso.pinellolab.org). The proportion of the wild-type (WT) sequence, mutated sequence, and novel indels created by each gRNA are shown. Fig. 1 B shows the results of a western blot carried out on proteinextracts collected from healthy control (HGFDFSV40T369) and patient fibroblasts (HGADFN367) that were treated with negative control guide RNAs (B2M gRNA) and allele specific progerin-targeting guide RNAs (gRNA1 and 2). gRNA1 and 2 were designed to only target the disease-causing LMNA c.1824C>T point mutation found in one the LMNA alleles in progeria patients. This mutated LMNA allele encodes three lamin isoforms, lamin A, lamin C, and progerin. The latter is the protein underlying progeria. gRNA1 and 2 are designed to correct the LMNA c.1824C>T point mutation and revert to wild-type the expression of the LMNA gene, giving rise to only lamin A and C proteins. Therefore, gRNA1 and 2 were designed not to interfere with the expression of lamin A and C. In this experiment, fibroblasts were electroporated with the Cas9-gRNA ribonucleoprotein (RNP) mix and were expanded until enough proteins were extracted for analysis using western blot. The left western blot shows that neither of the gRNAs affected the levels of lamin A and C in the treated healthy control fibroblasts. In the treated patient fibroblasts, the quantification of the western blot band intensities shows that the allele specific progerin-targeting gRNA1 had the highest efficiency in knocking down progerin (>99%) and the highest specificity as it did very slightly affect the levels of lamin A and C proteins. This data shows that REMEDY can be used to abolish progerin expression and treat progeria.

[0028] Fig. 2A-B shows the results of the REMEDY method in additional progeria patient- derived fibroblasts. Fig. 2A shows the results of a western blot carried out on protein extracts collected from Progeria patient-derived fibroblasts (HGADFN167) that were treated with a new negative control guide RNA (NT Grna; caucuguaggguugcaagcc (SEQ ID NO: ) and allele specific progerin-targeting guide RNAs (gRNA1 and 2). gRNA1 and 2 were designed to only target the disease-causing LMNA c.1824C>T point mutation found in one the LMNA alleles in progeria patients. This mutated LMNA allele encodes three lamin isoforms, lamin A, lamin C, and progerin. The latter is the protein underlying progeria. gRNA1 and 2 are designed to correct the LMNA c.1824C>T point mutation and revert to wild-type the expression of the LMNA gene, giving rise to only lamin A and C proteins. Therefore, gRNA1 and 2 were designed not to interfere with the expression of lamin A and C. In this experiment, fibroblasts were electroporated with the Cas9-gRNA ribonucleoprotein (RNP) mix and were expanded until enough proteins were extracted for analysis using western blot. The quantification of the western blot band intensities showed that the allele specific progerin-targeting gRNA1 had the highest efficiency in knocking down progerin (>99%). This additional data consolidates data shown in Fig. 1 A-B and shows that REMEDY is effective in abolishing progerin expression. Fig. 2B shows the quantification of lamin A, progerin and lamin C protein levels from Fig. 1 B and 2A western blots performed on patient-derivedtreated fibroblasts. Protein levels were normalized to levels of reference proteins (a-Tubulin or GAPDH) and to the “unedited” condition.DETAILED DESCRIPTION

[0029] The disclosure provides a novel genome editing strategy to accomplish the inhibition of progerin protein production because the expression of progerin is known to cause progeria and health problems, such as slowed growth, loss of fat tissue, hair loss, joint problems, dental problems, hearing loss, insulin resistance, cardiovascular disease, stroke, and death. Thus, in some aspects, the products and methods described herein are used in treating, ameliorating, delaying the progression of, and / or preventing progeria or Hutchinson- Gilford progeria syndrome (HGPS).

[0030] In some aspects, the products and methods described herein are used for treating, ameliorating, or preventing premature aging or natural aging. In some aspects, the products and methods described herein are used for treating, ameliorating, or preventing atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation. In some aspects, the products and methods described herein are used for treating, ameliorating, or preventing a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is HGPS.

[0031] Laminopathies and other nuclear envelopathies have a large variety of clinical symptoms including skeletal and / or cardiac muscular dystrophy, lipodystrophy and diabetes, dysplasia, dermo- or neuropathy, leukodystrophy, and progeria (premature aging). Most of these symptoms develop after birth, typically during childhood or adolescence. Some laminopathies however may lead to an early death.

[0032] Progeria is caused by a change in one gene, the lamin A (LMNA) gene. The LMNA gene makes a protein that is needed to hold the nucleus of a cell together. When the LMNA gene comprises a mutation, a flawed LMNA protein called progerin is made. Progerin makes cells unstable and appears to lead to progeria's aging process. The changed gene that causes progeria is rarely passed down in families and, in most cases, the rare gene change that causes progeria happens by chance.

[0033] LMNA mutations in humans cause a variety of diseases including, but not limited to, various laminopathies, progeroid conditions, and progeria. A subset of LMNA mutations,including those causing progeria or HGPS, are located in 3’ or carboxyl terminal sequences unique to prelamin A (exons 11 and 12) and therefore have no effect on lamin C. HGPS is caused by exon 11 point mutations that enhance usage of a suboptimal splice donor site, resulting in aberrant mRNA splicing and the production of progerin, a mutant prelamin A protein containing an internal deletion of 50 amino acids near the C-terminus. This deletion eliminates the site for ZMPSTE24-mediated endoproteolytic cleavage, which would normally convert farnesyl-prelamin A to mature lamin A (LMNA). This leaves the intact premature LMNA bonded to the methylated carboxyl farnesyl group creating the defective protein, progerin, rather than the desired protein matured LMNA.

[0034] The LMNA c.1824C>T point mutation amplifies a cryptic splice event within exon 11 of the LMNA gene, producing progerin. Approximately 90% of all HGPS cases are heterozygous for this deleterious single nucleotide polymorphism within exon 11 of the LMNA gene causing the post-translational modifications to produce progerin. The guide RNAs and the genome editing method of the disclosure were designed to specifically target this point mutation in the treatment of progeria. The prelamin A mRNA encoding for lamin A and progerin proteins is formed of exons 1-10 in addition to the remaining sequence of exon 11 and exon 12. In the case of progerin, prelamin A alternative splicing with the presence of the cryptic splice site leads to a 150-nucleotide deletion in exon 11. On the other hand, the prelamin A mRNA encoding for lamin C, after another alternative splicing event, is formed of exons 1 -10. Previous in vitro and in vivo studies showed that lamin A is dispensable and the presence of lamin C alone is enough to maintain the correct functioning of a cell, to the opposite of the absence of both lamin A and C [Fong, L.G., et al., Science. 311 :1621 -3, 2006; Fong, L.G., et al., J Clin Invest. 116:743-52, 2006; Osorio, F.G., et al., Sci Transl Med. 3:106ra107, 2011 ; Sullivan, T., et al., J Cell Biol. 147:913-20, 1999]. Therefore, the disclosure provides allele-specific CRISPR-Cas9 gene editing therapy for HGPS or Progeria.

[0035] HGPS is primarily caused by new, non-inherited mutations that occur in the LMNA gene, specifically in codon 608 of exon 11 , located on chromosome 1 (Eriksson et al., Nature, 2003. 423(6937): 293-8). The mutation occurs in exon 11 that leads to a new alternative splicing of the pre-lamina A mRNA. The product of that alternative splicing gives rise to a new lamin A mRNA lacking 150 nucleotides at the end of exon 11. This new mRNA encompasses, in addition to exons 1-11, exon 12 and encodes for the protein progerin. The disclosure comprises nucleic acids, compositions, and methods for targeting the LMNA c.1824C>T point mutation to knock down progerin mRNA levels and thus prevent production of progerin protein.

[0036] The approach described herein uses REMEDY, which is an acronym for REpair of heterozygous Mutations independent of Exogenous Donor template with high efficiency, using guide RNA (gRNA) and CRISPR to edit the C>T (c.1824C>T; p.G608G) heterozygous mutation in the LMNA gene in Progeria. CRISPR-Cas9 can correct many of the pathogenic heterozygous mutations via homology-directed repair (HDR) using an exogenous DNA template. REMEDY allows editing to occur without the use of an exogenous DNA template. With REMEDY, in-PAM or near-PAM CRISPR strategies are used to induce DSB only in mutant alleles. Using this strategy, the homologous healthy chromosome serves itself as an endogenous DNA donor template which results in highly efficient correction of heterozygous mutations.

[0037] Lamins are the major components of the nuclear lamina, a network located between inner nuclear membrane and chromatin, which plays a fundamental role in the organization of the nuclear architecture in all human cells. Lamins A and C, which are alternatively spliced products of the A-type lamin gene (LMNA), are expressed in differentiated cells, whereas B-type lamins, arising from two different genes, are ubiquitous.

[0038] The LMNA gene is located on chromosome 1 q21.2 loci and is composed of 12 exons. Exons 1-10 between Lamin A and Lamin C are identical; however, exons 11 and 12 are specific to Lamin A. The disclosure provides products and methods for treating mutations in the LMNA gene affecting exon 11 splicing or exon 12 which result in diseases such as progeria, Hutchinson-Gilford progeria syndrome (HGPS), other diseases which result in the production of progerin and / or other truncated Prelamin A transcript and / or protein isoforms (A35 and A90), and natural aging.

[0039] HGPS(OMIM: 176670) or progeria is a rare genetic disorder characterized by premature senescence, both clinically and in cell culture. HGPS was characterized by a predominant c.1824C>T mutation in the LMNA gene in 18 / 23 classical HGPS cases as well as two other mutations in two other HGPS patients. The c.1824C>T mutation turned out to affect splicing by creating a new splice donor site. Translation of the resulting mRNA produces a LMNA-A protein with an internal deletion (p.Val607_Gln656del) removing the internal proteolytic cleavage site which is used normally to remove the last 18 C-terminal amino acids to generate the mature LMNA protein. Thus, the mutation causes the production of the progerin protein, a partially deleted form of nuclear LMNA.

[0040] Children affected by the mutation appear normal at birth, but within a year develop characteristic features of failure to thrive, delayed dentition, alopecia and sclerodermatous skin changes. On average, death occurs at an age of about 13 years although some youngadults will live into their early 20s. Most patients die from progressive atherosclerosis of the coronary and cerebrovascular arteries. There are currently no great treatments for HGPS or progeria and the condition is always fatal. Various drugs are prescribed to slow down the progression of the disease or assist with symptoms of the disease, but nothing more is available to date.

[0041] In the typical form of HGPS or progeria, the heterozygous LMNA mutation involves a substitution of a C to T nucleotide, leading to the activation of a cryptic splice donor site at position 1824 (c.1824C>T; p.G608G). Remarkably, this mutation does not alter the encoded amino acids, but causes a new alternative splicing event, leading to the formation of a mRNA lacking 150 nucleotides. Consequently, this mRNA is translated into a modified protein known as "progerin”, which exhibits an in-frame deletion of 50 amino acids near the C terminus.

[0042] The disclosure provides guide RNA (gRNA), more specifically nucleic acids encoding gRNA, and nucleic acids comprising gRNA, targeting the point mutation at the splice donor site at position 1824 (c.1824C>T; p.G608G) within exon 11 of the LMNA or progerin gene (i.e., exon 12 of both of these genes is almost the same) with the goal of downregulating or inhibiting expression of the aberrant LMNA or inhibiting the progerin protein.

[0043] The disclosure includes various nucleic acids comprising, consisting essentially of, or consisting of the various nucleotide sequences described herein. In some aspects, the nucleic acid comprises the nucleotide sequence. In some aspects, the nucleic acid consists essentially of the nucleotide sequence. In some aspects, the nucleic acid consists of the nucleotide sequence.

[0044] The disclosure provides guide RNAs (gRNAs) targeting a heterozygous LMNA mutation involves a single substitution of a C to T nucleotide, leading to the activation of a cryptic splice donor site at position 1824 (c.1824C>T; p.G608G) within exon 11 of the LMNA gene. Exemplary guide RNAs (both DNA encoding the guide RNA and the guide RNA itself) used for targeting such mutation in the LMNA gene described herein include, but are not limited to, those identified in Table 1 below.

[0045] Table 1 : Guide RNA polynucleotide sequences of the disclosure.

[0046] The disclosure includes guide RNAs (gRNAs), including in some aspects, single gRNAs (sgRNAs), targeting a heterozygous LMNA mutation involves a single substitution of a C to T nucleotide, leading to the activation of a cryptic splice donor site at position 1824 (c.1824C>T; p.G608G) within exon 11 of the LMNA gene. Exemplary nucleotide sequences are set out in Table 1 above. These guide RNAs may be delivered as DNA (i.e., DNA encoding the gRNA) or they may be delivered as RNA (i.e., the gRNA itself or in a ribonucleoprotein complex with a CRISPR associated endonuclease (Gas)). Nucleoproteins are proteins conjugated with nucleic acids (either DNA or RNA). Typical nucleoproteins include ribosomes, nucleosomes and viral nucleocapsid proteins. A deoxyribonucleoprotein (DNP) is a complex of DNA and protein. A ribonucieoprotein (RNP) is a complex of RNA and RNA-binding protein.

[0047] In various aspects, the disclosure includes CRISPR-Cas systems and nucleic acids encoding Cas endonucleases (or nucleases). In some aspects, a Gas of the disclosure is a Cas9 or a Cas12 endonuclease. In some aspects, a Cas9 nuclease of the disclosure is an Staphylococcus aureus Cas9 (SaCas9) endonuclease or a Streptococcus pyogenes Cas9 (SpCas9 endonuclease). The Cas9 nuclease is targeted to specific genomic loci by a specific nucleotide guide sequence. Target sites must include a protospaceradjacent motif (PAM) at the 3' end adjacent to the target site. Different Cas9 endonucleases use different PAMs for the target sites. As for the SaCas9, the PAM sequence is NNGRR or NNGRRT. As for the SpCas9, the PAM sequence is NGG, NAG, or NG. In some aspects, an SaCas9 endonuclease is a SaCas9 NNGRR endonuclease or an SaCas9 NNGRRT endonuclease. In some aspects, an SpCas9 endonuclease is a SpCas9 NGG endonuclease, an SpCas9 NAG endonuclease, or an SpCas9 NG endonuclease. In some aspects, a Cas12 endonuclease of the disclosure is a Cas12a endonuclease or a Cpf1 endonuclease. The Cas12a endonucleases derive from Acidaminococcus sp. (AsCasI 2a) or Lachnospiraceae sp. (LbCas12a). In addition to its canonical TTTV PAM motif, AsCasI 2a has been engineered to recognize TACV, TYCV, VTTV, and TTCN while maintaining its target specificity. In some aspects, the Cas12a (or Cpf1) endonuclease is a Cas12a TYCV endonuclease.

[0048] In order to achieve the intended genome modifications using gRNA and the CRISPR / Cas system, the functional unit of the CRISPR / Cas system, the Cas9 / gRNA ribonucleoprotein (RNP) complex, has to be present in the nucleus of target cells. In various aspects, this can be achieved by delivery of different biomolecular Cas9 and gRNA formats: plasmid DNA (pDNA), RNA or Cas9 ribonucleoproteins (RNPs). The Cas9 / gRNA ribonucleoprotein (RNP) complex has to reach the nucleus of eukaryotic cells (eventually together with template DNA) for mediating the intended genomic modifications. To achieve this, different biomolecular formats can be selected and utilized for cellular delivery: plasmid DNA (pDNA) encoding for the Cas9 protein and the specific guide RNA (gRNA); a mixture of Cas9 mRNA and gRNA; or the pre-assembled RNP complex. Thus, the disclosure includes all of these formats for delivering the Cas9 / gRNA ribonucleoprotein (RNP) complex to the nucleus of target cells.

[0049] The terms “nucleotide sequence” and “polynucleotide sequence” are used interchangeably herein. In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence comprising at least or about 70%, 75%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence of any one of SEQ ID NOs: 1-38. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, 5, 6, 7, or 8 substitutions. In some aspects, the nucleotide sequence may comprise 1 , 2, 3, 4, or 5 substitutions. In some aspects, the substitutions are conservative substitutions.

[0050] In some aspects, a nucleic acid of the disclosure comprises a nucleotide sequence that specifically hybridizes to the LMNA or progerin target sequence comprising the cryptic splice donor site at position 1824 (c.1824C>T; p.G608G) within exon 11 of the LMNA gene.

[0051] In some aspects, the disclosure provides a promoter to be used with the nucleic acids provided herein. In various aspects, polymerase II promoters and polymerase III promoters are used. In some aspects, the promoter is a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, an EF1 -alpha promoter, a minimal EF1 -alpha promoter, an unc45b promoter, a CK1 promoter, a CK6 promoter, a CK7 promoter, a CK8 promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MOK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), a tMCK promoter, a minimal MOK promoter, the 250-bp fragment of the myosin light chain-2v (MLC- 2v) gene (MLC250) promoter, cardiac troponin T (cTnT) promoter, an a-myosin heavy chain (a-MHC) promoter, or a desmin promoter.

[0052] The disclosure includes a composition comprising any of the nucleic acids described herein with a carrier, diluent, excipient, or buffer. In some aspects, the composition comprises an RNP complex as described herein comprising a nucleic acid described herein and a CRISPR / CAS9 or CRISPR / Cpf1 . In some aspects, the composition is for use in editing the LMNA gene in the treatment of progeria. In various aspects, any composition of the disclosure also comprises other ingredients, such as carriers, diluents, excipients, and / or adjuvants. Acceptable carriers, diluents, excipients, and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).

[0053] In some aspects, a nucleic acid encoding a gRNA and a nucleic acid encoding a CRISPR / Cas endonuclease (“Cas”, CRISPR associated endonuclease) are introduced into the cell or tissue via vectorized or non-vectorized delivery. Thus, in some embodiments, a nucleic acid encoding a gRNA and / or a nucleic acid encoding a Cas as provided in the disclosure are introduced via a vector. In some aspects, the vector comprises both the nucleic acid encoding the gRNA and the nucleic acid encoding the Cas. In some aspects,the nucleic acid encoding the gRNA and / or the nucleic acid encoding the Cas further comprises a promoter. In some aspects, the promoter is a tissue-specific promoter and can target delivery to particular cells or tissues. In some aspects, the promoter is a ubiquitous promoter and delivery is not specifically directed to target tissues. In some aspects, when the nucleic acid or nucleic acids are delivered in a viral vector, the Cas and the gRNA or gRNAs are encoded in the genomic DNA of the virus. The viral vector is then delivered via various routes of administration to the subject or patient.

[0054] In some aspects, a nucleic acid encoding a gRNA and a nucleic acid encoding a Cas are introduced via non-vectorized delivery. In some aspects, such non-vectorized delivery includes, but is not limited to, electroporation, or via nanoparticles, extracellular vesicles, exosomes, or virus-like particles (VLPs). Thus, in some embodiments, the disclosure includes non-vectorized delivery of a nucleic acid encoding or comprising a gRNA for targeting the aberrant LMNA gene, or for an RNP complex targeting the aberrant LMNA gene, wherein the RNP complex comprises a gRNA and a Cas. In some aspects, in this context, synthetic carriers able to form complexes with nucleic acids and / or the RNP complex, and protect them from extra- and intracellular nucleases, are used as an alternative to delivery via a vector. Thus, the CRISPR / Cas endonuclease protein (e.g., the Cas9 protein) and the gRNA or gRNAs are delivered as a ribonucleoprotein complex (RNP complex) when this RNP complex is packaged in a non-viral delivery vehicle, such as a chemically synthesized nanoparticle, lipid nanoparticle, extracellular vesicle, exosome, or viral-like particle (VLP). In some aspects, the Cas is conjugated to a tissue-specific antibody or peptide.

[0055] In some aspects, therefore, such non-vectorized delivery includes the use of nanoparticles, extracellular vesicles, exosomes, or VLPs comprising the nucleic acids of the disclosure or an RNP complex of the disclosure. Nanoparticles offer unprecedented opportunities for cell-specific, controlled delivery of gRNAs or an RNP complex comprising CRISPR / Cas9 and a gRNA. In some aspects, such nanoparticles include, but are not limited to, microcapsules, liposomes, and micelles. Extracellular vesicles can be enriched with exogenous therapeutic gRNAs or RNP complexes comprising CRISPR / Cas9 and a gRNA and used for treatment of diseases by targeting pathological recipient cells. Exosomes are excellent carriers for gRNAs or an RNP complex comprising CRISPR / Cas9 and a gRNA with the advantages of low immunogenicity and low toxicity (Ohno et al., Methods Mol Biol. 2016:1448:261-70. doi: 10.1007 / 978-1 -4939-3753-0_19). Viral vectors, such as an adeno- associated virus (AAV) vector, have been used to deliver nucleic acids encoding gRNAs,nucleic acids encoding CRISPR / Cas9 endonucleases, or an RNP complex comprising a CRISPR / Cas9 endonuclease and a gRNA to target cells, including but not limited to, neurons, the brain, muscle cells, muscle, or other target cells or tissues in vivo, ex vivo, or in vitro. The disclosure also includes compositions comprising any of the vectorized or nonvectorized constructs described herein alone or in combination.

[0056] In some embodiments, therefore, the disclosure includes a vector comprising any of the nucleic acids described herein, either alone or in combination. Thus, in some aspects, a combination of gRNAs, sgRNAs, or RNP complexes can be used together to more effectively inhibit the expression of progerin or aberrant LMNA. In some aspects, this may include a combination of multiple copies of the same gRNA. In some aspects, this may include a combination of multiple gRNA all designed to target the single nucleotide substitution (C to T) within exon 11 of the LMNA gene at position 1824. Thus, embodiments of the disclosure utilize vectors (for example, viral vectors, such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule) to deliver the nucleic acids disclosed herein.

[0057] In some embodiments, the vector is an AAV vector. In some aspect, the vector is a recombinant AAV (rAAV) vector. In some aspects, the vector is a self-complementary recombinant AAV (scAAV) or a single-stranded recombinant vector (ssAAV). In some aspects, the rAAV vector lack rep and cap genes. The AAV vector possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it isan extremely stable and hardy virus. It easily withstands the conditions used to inactivate adenovirus (56o to 65oC for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0058] Thus, in some aspects, the viral vector is an adeno-associated virus (AAV), such as an AAV1 (i.e., an AAV containing AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 capsid proteins), AAVrh74 (i.e., an AAV containing AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 capsid proteins), AAVrh.10 (i.e., an AAV containing AAVrh.10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 capsid proteins), AAV13 (i.e., an AAV containing AAV13 capsid proteins), AAV-anc80 (i.e., an AAV containing AAV-anc80 capsid proteins), AAV-B1 (i.e., an AAV containing AAV-B1 capsid proteins), AAV.PHP.EB (i.e., an AAV containing AAV- PHP.EB capsid proteins), or AAVv66 (i.e., an AAV containing AAVv66 capsid proteins), and accordingly the same with AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, or any derivative thereof.

[0059] In some aspects, the AAV is a modified AAV (mAAV) capsid polypeptide as disclosed by Solid Biosciences Inc. in International Publication No. WO 2021 / 072197, which is incorporated herein by reference in its entirety. WO 2021 / 072197 provides a modified VP1 capsid enabling preferential targeted expression of a gene of interest in muscle tissues, as well as recombinant adeno-associated virus (rAAV) with the gene of interest packaged with the modified VP1 capsids, and uses thereof. More specifically, in some aspects, a nucleic acid of the disclosure further comprises a nucleotide sequence encoding a modified AAV9 (mAAV9) capsid polypeptide (SEQ ID NO: 13 as disclosed in WO 2021 / 072197) or an AAV-SLB101 capsid polypeptide (SEQ ID NO: 14 as disclosed in WO 2021 / 072197), or a sequence variant comprising at least or about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 13 or 14 of WO 2021 / 072197. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full- length sequence.

[0060] The modified AAV9 VP1 capsids and SLB101 capsids, as described in WO 2021 / 072197, enable preferential targeted expression of the nucleic acids encoding the gRNA and / or nucleic acids encoding the CRISPR / Cas endonuclease from rAAV packaged in such modified AAV9 VP1 capsids, especially in muscle tissues, including cardiac muscles (i.e., muscles in the heart), skeletal muscles (e.g., the quadriceps), and / or smooth muscles (e.g., the diaphragm muscles).

[0061] In some aspects, the disclosure utilizes adeno-associated virus (AAV) to deliver nucleic acids encoding or comprising the gRNA of the disclosure. AAV is a replicationdeficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 {1983); the complete genome of AAV3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV4 is provided in GenBank Accession No. NC_001829; the AAV5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV6 is provided in GenBank Accession No. NC_00 1862; at least portions of AAV7 and AAV8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Patent Nos.7,282,199 and 7,790,449 relating to AAV8); the AAV9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV10 genome is provided in Mol. Ther., 13(1): 67-76 (2006); the AAV11 genome is provided in Virology, 330(2): 375-383 (2004); the AAV12 genome is provided in J. Virol. 2008 Feb; 82(3): 1399-406; and the AAV13 genome is provided in J. Virol. 2008; 82: 8911 . Cis-acting sequences directing viral DNA replication (rep), encapsidation / packaging and host cell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1 , VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle andgenetics of AAV are reviewed in Muzyczka (Current Topics in Microbiology and Immunology, 158: 97-129 (1992)).

[0062] AAV possesses unique features that make it attractive as a vector for delivering foreign DNAto cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and nondividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. In some aspects, the rep and cap proteins are provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56sto 65aC for several hours), making cold preservation of AAV less critical. AAV may be lyophilized and AAV-infected cells are not resistant to superinfection.

[0063] In some embodiments, DNA plasmids of the disclosure are provided which comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art.

[0064] In some embodiments, the subject rAAV is produced based on the helper-virus- free transient transfection method, with all cis and trans components (vector plasmid and packaging plasmids, along with helper genes isolated from adenovirus) in suitable host cells such as 293 cells. The transient-transfection method is simple in vector plasmid construction and generates high-titer AAV vectors that are free of adenovirus. The modified VP1 capsid proteins can be encoded by one of the plasmids used in transient transfection of the producer cell line.

[0065] In some embodiments, the subject rAAV is produced using a recombinant herpes simplex virus (rHSV)-based AAV production system, which utilizes rHSV vectors to bring the AAV vector and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention)into the producer cells. The modified cap gene can be present in the rHSV vector that may also hosts the rAAV genome.

[0066] In some embodiments, the subject rAAV is produced using a baculovirus system that requires simultaneous infection of insect cells with several baculovirus vectors to deliver the AAV vector cassette and the Rep and Cap genes (i.e., the modified VP1 capsid gene of the invention).

[0067] In some embodiments, the subject rAAV is produced based on certain AAV producer cell lines derived from, e.g., HeLa or A549 or HEK293 cells, which stably harbored AAV Rep / cap genes (i.e., the modified VP1 capsid gene of the invention). The AAV vector cassette can either be stably integrated in the host genome or be introduced by an adenovirus that contained the cassette.

[0068] In some embodiments, such producer cell line for rAAV production comprises an rAAV provirus that encodes the gRNA and / or the nucleic acid encoding the CRISPR / Cas endonuclease, wherein the rAAV provirus is integrated into the genome of the producer cell line for rAAV production.

[0069] In some embodiments, production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV- BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, or any derivative thereof. In some aspects, the ITRs in the AAV are from a different AAV serotype. In some aspects, the AAV comprises an ITR or capsid protein which is from a different serotype, i.e., a different serotype than the rest of the vector. For example, in some aspects, AAV2 or AAV2-based ITRs are used in various AAV vectors, not only serotypes which are AAV2 or AAV2-based. In some aspects, various ITRs are interchangeable among the different serotypes of AAV. For example, in some aspects, AAV2 ITRs are interchangeable among the different serotypes of AAV. Thus, in some aspects, AAV2 ITRs are used in a different serotype of AAV vector including, but not limited to, for example, AAV9. In some aspects, AAV2 Rep helper genes are used.

[0070] In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV-BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, or any derivative thereof. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.

[0071] Recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking at least one progerin-targeted or aberrant LMNA-targeted polynucleotide or nucleotide sequence. In some embodiments, the polynucleotide is a gRNA or a polynucleotide encoding the gRNA. In some aspects, the gRNA is administered with a CRISPR endonuclease as described herein. In some aspects, the gRNA is administered with other polynucleotide constructs targeting aberrant LMNA or progerin. AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV-BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, or any derivative thereof. As set out herein above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0072] Recombinant AAV genomes of the disclosure comprise one or more AAV ITRs flanking at least one progerin-targeted or aberrant LMNA-targeted polynucleotide or nucleotide sequence. In some embodiments, the polynucleotide is a gRNA or a polynucleotide encoding the gRNA. In some aspects, the gRNA is administered with other polynucleotide constructs targeting LMNA or progerin. In some aspects, the gRNA is administered with a CRISPR endonuclease. In various aspects, the gRNA is expressed under various promoters including, but not limited to, such promoters as a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, an EF1 -alpha promoter, a minimal EF1 -alpha promoter, an unc45b promoter, a CK1 promoter, a CK6 promoter, a CK7 promoter, a CK8 promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter(MHCK7), a tMCK promoter, a minimal MOK promoter, the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene (MLC250) promoter, cardiac troponin T (cTnT) promoter, an a- myosin heavy chain (a-MHC) promoter, or a desmin promoter. AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV-BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, or any derivative thereof. As set out herein above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0073] DNA plasmids of the disclosure comprise rAAV genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1-deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV-BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any derivative thereof. In some aspects, AAV DNA in the rAAV genomes is from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV-BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1A, MYOAAV2A, MYOAAV3A, mAAV9, or AAV-SLB101 , or any derivative thereof. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11 ): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.

[0074] In some embodiments, packaging cells are provided. Packaging cells are created in order to have a cell line that stably expresses all the necessary components for AAV particle production. Retroviral vectors are created by removal of the retroviral gag, pol, and env genes. These are replaced by the therapeutic gene. In order to produce vector particles, a packaging cell is essential. Packaging cell lines provide all the viral proteins required for capsid production and the virion maturation of the vector. Thus, packaging cell lines are made so that they contain the gag, pol and env genes. Following insertion of the desired gene into in the retroviral DNA vector, and maintenance of the proper packaging cell line, it is now a simple matter to prepare retroviral vectors.

[0075] For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et aL, 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.

[0076] In some embodiments, therefore, a method of generating a packaging cell to create a cell line that stably expresses all the necessary components for AAV particle production is provided. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et aL, 1982, Proc. Natl. Acad. S6. USA, 79:2077- 2081), addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73) or by direct, blunt-end ligation (Senapathy et aL, 1984, J. BioL Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methodsemploy adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.

[0077] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbiol, and Immunol. 158:97-129). Various approaches are described in Ratschin et al., Mol. Cell. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81 :6466 (1984); Tratschin et al., Mo1. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol. , 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988). Samulski et al., J. Virol. , 63:3822- 3828 (1989); U.S. Patent No. 5,173,414; WO 95 / 13365 and corresponding U.S. Patent No. 5,658.776 ; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al., Vaccine, 13:1244-1250 (1995); Paul et al., Human Gene Therapy, 4:609-615 (1993); Clark et aL, Gene Therapy, 3:1124-1132 (1996); U.S. Patent. No. 5,786,211 ; U.S. Patent No. 5,871 ,982; U.S. Patent. No. 6,258,595; and McCarty, Mol. Ther., 16(10): 1648-1656 (2008). The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production. The production and use of various types of rAAV are specifically contemplated and exemplified.Recombinant AAV (i.e., infectious encapsidated rAAV particles) are thus provided herein. In some aspects, genomes of the rAAV lack AAV rep and cap genes; that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV. In some embodiments, the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).

[0078] The disclosure thus provides in some embodiments packaging cells that produce infectious rAAV. In one embodiment, packaging cells are stably transformed cancer cells, such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).

[0079] The rAAV, in some aspects, are purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, forexample, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002); U.S. Patent No. 6,566,118 and WO 98 / 09657.

[0080] In some embodiments, the disclosure provides a composition or compositions comprising a nucleic acid or a vector, e.g., such as a viral vector, as described herein. In some embodiments, the disclosure provides a composition or compositions comprising a nucleic acid or a vector, e.g., such as a viral vector, nanoparticles, extracellular vesicles, exosomes, or VLPs comprising the nucleic acids of the disclosure. Thus, compositions comprising delivery vehicles (such as rAAV, nanoparticles, extracellular vesicles, exosomes, or VLPs) described herein are provided. In various aspects, such compositions also comprise a pharmaceutically acceptable carrier. In general, as used herein, "pharmaceutically acceptable carrier" means all aqueous and non-aqueous solutions, sterile solutions, solvents, buffers, e.g. phosphate buffered saline (PBS) solutions, water, suspensions, emulsions, such as oil / water emulsions, various types of wetting agents, liposomes, dispersion media and coatings, which are compatible with pharmaceutical administration, in particular with parenteral administration. The use of such media and agents in pharmaceutical compositions is well known in the art, and the compositions comprising such carriers can be formulated by well-known conventional methods.

[0081] In some aspects, the disclosure provides AAV transducing cells for the delivery of nucleic acids as described herein. Methods of transducing a target cell with rAAV, in vivo or in vitro, are included in the disclosure. The methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a rAAV of the disclosure to a subject, including an animal (such as a human being) in need thereof. If the dose is administered prior to development of the disease or disorder, the administration is prophylactic. If the dose is administered after the development of the disease or disorder, the administration is therapeutic. In embodiments of the disclosure, an effective dose or a therapeutically effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disease or disorder being treated, that slows or prevents progression of the disease or disorder, that slows or prevents progression of the disease or disorder, that diminishes the extent of the disease or disorder, that results in remission (partial or total) of the disease or disorder, and / or that prolongs survival.

[0082] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersionmedium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0083] Titers of rAAV to be administered in methods of the disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1x106, about 1x107, about 1x108, about 1x109, about 1x101°, about 1x1011, about 1x1012, about 1x1013, about 1x1014, about 1x1015, about 1x1016, to about 1x1017or more DNase resistant particles (DRP) per ml. Dosages may also be expressed in units of viral genomes (vg) (e.g., about 1x107vg, about 1x108vg, about 1 x109vg, about 1 x1010vg, about 1 x1011vg, about 1 x1012vg, about 1 x1013vg, about 1x1014vg, about 1x1015vg, about 1x1016vg, and about 1x1017vg, respectively). In some aspects, dosages are expressed in units of viral genomes (vg) per kilogram (kg) body weight (e.g., about 1 x107vg / kg, about 1 x108vg / kg, about 1 x109vg / kg, about 1 x1010vg / kg, about 1x1011vg / kg, about 1x1012vg / kg, about 1x1013vg / kg, about 1x1014vg / kg, about 1 x1015vg / kg, about 1x1016vg / kg, and about 1x1017vg / kg, respectively). Additional information regarding an effective dose, or a therapeutically effective dose, as used herein, is provided herein below.

[0084] In some aspects, the disclosure provides a method of delivering to a cell or to a subject any one or more nucleic acids of the disclosure. Thus, the disclosure provides methods of delivering or therapeutically administering a LMNA-targeting or progerin- targeting gRNA (or sgRNA) to a cell or to a subject comprising a mutation in the LMNA gene associated with the expression of progerin and the methods comprise delivering to a cell or to a subject comprising a cell comprising a mutation in the LMNA gene any one or more nucleic acids comprising a nucleotide sequence comprising at least or about 80% sequence identity to the sequence of any one of SEQ ID NOs: 1 -38, or a nucleotide sequence that specifically hybridizes to the LMNA target sequence comprising a single nucleotide substitution of C to T within exon 1 1 at position 1824 of the LMNA gene. In some aspects, the sequence identity is over the full-length sequence. In some aspects, the sequence identity is not limited to the full-length sequence.

[0085] In some aspects, a nucleic acid of the disclosure is delivered via a vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP). In some aspects, anucleic acid of the disclosure is delivered in a ribonucleoprotein (RNP) complex comprising a CRISPR / Cas endonuclease, wherein the endonuclease is complexed with the nucleic acid. In some aspects, the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 (or Cas12a) endonuclease. In some aspects, the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 20-38 or a variant comprising at least or about 90% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 20-38.

[0086] In some aspects, the disclosure provides a method of decreasing and / or inhibiting the expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell comprising introducing into the cell a nucleic acid encoding a CRISPR / Cas endonuclease (or the CRISPR / Cas endonuclease itself) and nucleic acid comprising (a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1 -19; (b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19; (c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38; or (d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38.

[0087] In some aspects, the nucleic acid delivered to the cell by injection or by electroporation. In some aspects, the cell is in a human subject.

[0088] In some aspects, the disclosure provides a method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of a nucleic acid encoding a CRISPR / Cas endonuclease (or the CRISPR / Cas endonuclease itself) and nucleic acid comprising (a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1-19; (b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19; (c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38; or (d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38.

[0089] In some aspects, the disease or disorder associated with an aberrant LMNA gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder. In someaspects, the progeria is Hutchinson-Gilford progeria syndrome (HGPS). In some aspects, the disease or disorder is premature aging or natural aging. In some aspects, the disease or disorder associated with the aberrant expression of LMNA or progerin is atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0090] In some aspects, the disclosure provides a method of genetically modifying a cell comprising an aberrant lamin A {LMNA) gene or progerin gene comprising obtaining a guide RNA (gRNA) that specifically hybridizes to a target DNA sequence within the genomic DNA of the cell, wherein the target DNA comprises a C to T substitution in the LMNA gene at position 1824; and introducing into the cell a ribonucleoprotein (RNP) complex comprising a CRISPR / Cas endonuclease with the gRNA that specifically hybridizes to the target DNA sequence. In some aspects, the gRNA comprises a nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38, or a variant thereof comprising at least 90% identity to the sequence of any one of SEQ ID NOs: 20-38. In some aspects, the cell is in a human subject. In some aspects, the human subject suffers from a laminopathy, progeroid syndrome, progeria, or aging disorder. In some aspects, the progeria is Hutchinson-Gilford progeria syndrome.

[0091] In some aspects, the disclosure provides a method of inhibiting the expression of an aberrant lamin A {LMNA) gene or progerin gene in a cell comprising contacting the cell with a nucleic acid encoding a CRISPR / Cas endonuclease (or the CRISPR / Cas endonuclease itself) and nucleic acid comprising (a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1-19; (b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19; (c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38; or (d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38, and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease. In some aspects, the nucleic acid that encodes or comprises the lamin A-targeting guide RNA (gRNA) and the CRISPR / Cas endonucleaseor the nucleic acid encoding the CRISPR / Cas endonuclease are provided in the same vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP). In some aspects, the cell is in a human subject. In some aspects, the human subject suffers from a laminopathy, progeroid syndrome, progeria, or aging disorder, such as HGPS.

[0092] The disclosure also provides a method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of a nucleic acid encoding a gRNA as described herein and a CRISPR / Cas endonuclease or a nucleic acid encoding the CRISPR / Cas endonuclease.

[0093] In some aspects, the method comprises delivering the nucleic acids in one or more AAV vectors. In some aspects, the method comprises delivering the nucleic acids to the cell via non-vectorized delivery as described herein.

[0094] The term “naturally-occurring” or “unmodified” or “wild type” as used herein as applied to a nucleic acid, a polypeptide, a cell, or an organism, refers to a nucleic acid, polypeptide, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that Is present in an organism (Including viruses) that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is wild type (and naturally occurring).

[0095] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient" refers to a subject under the treatment of a clinician, e.g., physician.

[0096] The term “treatment” or “treating” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease,pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0097] In some aspects, expression of the aberrant LMNA gene or progerin gene, or expression of the aberrant LMNA protein or progerin protein is decreased in a cell or in a subject by the methods provided herein by at least or about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 96, about 97, about 98, about 99, or 100 percent.

[0098] In some aspects, the disclosure provides AAV transducing cells for the delivery of nucleic acids encoding the aberrant LMNA-targeting or progerin-targeting gRNA or nucleic acids comprising the gRNAs as described herein. Methods of transducing a target cell with rAAV, in vivo or in vitro, are included in the disclosure. The methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a rAAV of the disclosure to a subject, including an animal (such as a human being) in need thereof. If the dose is administered prior to development of progeria or HGPS, the administration is prophylactic. If the dose is administered after the development of progeria or HGPS, the administration is therapeutic. In embodiments of the disclosure, an effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the condition, such as progeria, or aging symptom associated with a defective LMNA gene or progerin gene, being treated, that slows or prevents progression of progeria (or HGPS) or other symptom associated with an aberrant exon 12 of the LMNA or progerin gene, that slows or prevents progression of the progeria, that diminishes the extent of disease, that results in remission (partial or total) of the progeria, and / or that prolongs survival. In some aspects, the progeria is HGPS. In some aspects, an effective dose or therapeutically effective dose is a dose that alleviates or improves at least one of symptom of atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0099] The disclosure provides sterile injectable solutions comprising RNP complexes of the disclosure. Sterile injectable solutions are prepared by incorporating RNP complexes in the required amount in the appropriate solvent with various other ingredients enumeratedabove, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0100] The disclosure provides methods for genome editing, and more specifically for genetically modifying a cell by editing / repairing a mutation in the LMNA gene of the cell. In one embodiment, such method is referred to herein as “REMEDY”, i.e., REpair of heterozygous Mutations independent of Exogenous Donor template with high efficiency. REMEDY is provided herein in the disclosure for repairing heterozygous mutations independent of exogenous donor template with high efficiency utilizing endonuclease ribonucleoprotein complexes (such as, for example, Cas9 / RNPs) to modify or edit the mutated gene in a cell without the necessity of exogenous donor DNA template. Thus, as provided herein, REMEDY is used to repair a dominant-negative C«G-to-T*A mutation (c.1824 C>T; p.G608G) which causes a spontaneous C to T substitution in the LMNA gene of a human subject and results in progeria. Heterozygous mutations affect either a single allele in dominant or sex-linked inheritance patterns, or both alleles in the case of biallelic autosomal recessive inheritance. These mutations can be corrected by clustered regularly interspaced short palindromic repeats (CRISPR) mediated homology-directed repair (HDR) and exogenous DNA templates. Introducing exogenous HDR templates into the cells via electroporation, infection, lipofection, or by viral delivery approaches can not only result in low editing efficiency but can also cause cell death, loss of regenerative potential, and adds additional manufacturing and financial burdens. Thus, there was a need to develop an approach to efficiently edit heterozygous mutations independent of an exogenous DNA donor template. The disclosure therefore provides REMEDY for the efficient repair of a heterozygous mutation in the LMNA gene, i.e., a dominant-negative C*G-to-T»A mutation (c.1824 C>T; p.G608G) which causes a spontaneous C to T substitution in cells of subjects suffering from or at risk of suffering from progeria without the need of a donor template. REMEDY exploits natural processes of the cell cycle to trigger the homologous recombination mechanism between wild-type and mutant homologues chromosomes. In Go- phase in human cells, double-strand breaks (DSB) result in movement of the homologous chromosomes to the DSB site and formation of a transient contact (Gandhi et al., Cell Cycle. 2013;12(4):547-552. doi:10.4161 / cc.23754). CRISPR-induced DSB triggers recombinationbetween homologous chromosome arms in fly lines (Brunner et aL, Life Sci Alliance. 2019;2(3):e201800267. doi:10.26508 / lsa.201800267) and homologous chromosome exchange in cells with biallelic mutations is known to occur (Wang et aL, Nat Biotechnol. 2018;36(9):839-842. doi:10.1038 / nbt.4219). To initiate the HDR between the homologous chromosomes, a DSB is introduced in the mutant allele. Mutant allele-specific targeting in heterozygous mutations is achieved by designing gRNAs that contain mutated nucleotide(s) located near-PAM or in-PAM sequence (Wu et al., Theranostics. 2020;10(7):3118-3137. doi:10.7150 / thno.43298; Koblan et aL, Nature. 2021 ;589(7843):608-614. doi : 10.1038 / S41586-020-03086-7).

[0101] Thus, the methods of the disclosure provide an in-PAM or near-PAM gRNA design strategy to induce a targeted DSB only in the mutant allele and initiate the recruitment of the homologous healthy chromosome to serve itself as an endogenous DNA donor template for correction of heterozygous mutations (Fig. 1 A) without requiring an exogenous DNA donor template for mutation correction. Such DSB in the mutant allele is carried out by direct delivery of a CRISPR / Cas9 system as a ribonucleoprotein (RNP) complex consisting of Cas9 protein and single guide RNA (sgRNA). An RNP or an RNP complex (for example, a Cas9 / RNP) is comprised of two components, recombinant endonuclease protein (e.g., a Cas9 endonuclease) complexed with a CRISPR loci. The endonuclease complexed to the CRISPR loci is referred to as a CRISPR / Cas guide RNA. The CRISPR loci comprises the synthetic single-guide RNA (gRNA) comprised of an RNA sequence that hybridizes to the target sequence, a complementary repeat RNA sequence (crRNA) and a trans complementary repeat sequence (tracrRNA). The CRISPR / Cas guide RNA hybridizes to a target sequence, e.g., the LMNA target sequence, within the genomic DNA of the cell. In some aspects, the CRISPR / Cas endonuclease is a type II CRISPR / Cas endonuclease. In some cases, the CRISPR / Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA. The Cas9 / RNP is capable of cleaving genomic targets with higher efficiency than foreign DNA-dependent approaches due to its delivery as a functional complex. Additionally, rapid clearance of the Cas9 / RNP from the cell may reduce the off-target effects, such as induction of apoptosis.

[0102] In various embodiments, the disclosure provides methods of genetically modifying the LMNA gene in a cell comprising obtaining guide RNA (gRNA) specific for a target DNA sequence in the cell, i.e., specific for repairing a dominant-negative C*G-to-T«A mutation (c.1824 C>T; p.G608G); and transfecting or transducing (for example, introducing via electroporation) into a cell comprising this mutation, a ribonucleoprotein (RNP) complexcomprising a CRISPR / Cas endonuclease 9 (Cas9) complexed with a corresponding CRISPR / Cas guide RNA that hybridizes to the target sequence within the genomic DNA of the cell. Genome editing tools like the CRISPR / Cas system have gained great attentions over the past decade for treating genetic disorders. CRISPR-associate protein 9 can be adapted to genome editing with a customized CRISPR RNA (crRNA) together with a common transactivating CRISPR RNA (tracrRNA) or an artificial single guide RNA (sgRNA) which was a chimeric crRNA-tracrRNA hybrid. Two critical components of the CRISPR / Cas9 system are Cas9 nuclease and sgRNA. The CRISPR / Cas9 gene-targeting is directed by the sgRNA formed by hybridization of a tracrRNA and a crRNA. The targeting crRNA is composed by a ~20-nt sequence (the protospacer) complementary to the target DNA with the sequence requirement of a protospacer adjacent motif (PAM) (5'-NGG for the mostly used SpCas9). The tracrRNA hybridizes to the crRNA and binds directly to the Cas9 nuclease to form a ribonucleoprotein (RNP) complex. The CRISPR / Cas9 gene-editing function is directed by the Cas9 nuclease. There are two lobes of the Cas9 nuclease: a nuclease (NUC) lobe and a target recognition (REC) lobe. The RuvC, HNH and PAM- interacting domains comprise the NUC lobe. The HNH domain cleaves the target DNA strand complementary to crRNA while the RuvC domain cleaves the other strand, finally resulting in a double-stranded break (DSB) at the target site. DSBs are mainly repaired by nonhomologous end joining (NHEJ) or homology directed repair (HDR).

[0103] The disclosure provides compounds and methods for the efficient delivery of the CRISPR / Cas9 complex into the nucleus of a target cell. The CRISPR / Cas9 complex, in various aspects, is delivered in the forms of plasmid DNA (pDNA), messenger RNA (mRNA) or ribonucleoprotein (RNP, which is the Cas9 protein complexed with a sgRNA). Direct delivery of an RNP complex avoids many of pitfalls associated with pDNA or mRNA delivery. RNP delivery enables the swiftest genome editing by reason of eliminating the need for intracellular transcription and translation. Meanwhile, the transient genome editing not only permits high editing efficiency, but also reduces off-target effects, insertional mutagenesis, and immune responses. What's more, RNP delivery offers a robust platform for cells with low transcription and translation activity, and also enables advances in genome-editing efficacy in multiple contexts including embryonic stem cells, induced pluripotent stem cells, and tissue stem cells. These advantages of RNP delivery make it a promising platform in the field of CRISPR / Cas genome editing.

[0104] In some aspects, an endonuclease as provided herein is any class II CRISPR effector, which can be programmed with a CRISPR RNA to bind and cleave complementaryDNA targets. In some aspects, Cas9 endonuclease (also referred to herein as “Cas9”) is the class II CRISPR effector. Such Cas9 and is not limited to the Cas9 of Streptococcus pyogenes (SpCas9) typically used for a synthetic Cas9. In one aspect, the Cas9 can come from a different bacterial source. Substitution of the Cas9 can also be used to increase the targeting specificity so less gRNA needs to be used. Thus, for example, the Cas9 can be derived from Staphylococcus aureus (SaCas9), Acidaminococcus sp. (AsCpfl), Clustered Regularly Interspaced Short Palindromic Repeats from Prevotella and Francisella 1 (Cpf1) derived from Lachnospiracase bacterium (LbCpfl), Neisseria meningitidis (NmCas9), Streptococcus thermophilus (StCas9), Campylobacter jejuni (CjCas9), enhanced SpCas9 (eSpCas9), SpCas9-HF1 , Fok1 -Fused dCas9, expanded Cas9 (xCas9), and / or catalytically dead Cas9 (dCas9). Additionally other Cas endonucleases can be used in place of a Cas9 system such as, for example, CasX, CasY, Cas14, Cas4, Csn2, Cas13a, Cas13b, Cas13c, Cas13d, C2c1 , or C2c3 or using any other type of engineered Cas protein including prime editing. In some aspects, therefore, Cas9 or Cpf1 is the CRISPR effector used in methods of the disclosure.

[0105] In some aspects, to make the RNP complex, crRNA and tracrRNA may be mixed at a 1 :1 , 2:1 , or 1 :2 ratio of concentrations between about 50 pM and about 500 pM (for example, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 35, 375, 400, 425, 450, 475, or 500 pM), preferably between 100 pM and about 300 pM, most preferably about 200 pM at 95 degrees C for about 5 min to form a crRNA:tracrRNA complex (i.e., the guide RNA). The crRNA:tracrRNA complex may then be mixed with between about 20 pM and about 50pM (for example 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 4748, 49, or 50 pM) final dilution of a Cas endonuclease (such as, for example, Cas9 or Cpf1 ). Once bound to the target sequence in the target cell, the CRISPR loci can modify the genome by repairing the mutation. The allele specific gRNA approach used in REMEDY is another advantage of the method as it potentially minimizes the number of off targets since it is designed to only target the mutant allele.

[0106] The disclosure provides methods for the delivery of RNP complexes to the cell to repair the LMNA gene. In some aspects, an RNP complex of the disclosure is a Cas9 / RNP or a Cpfl / RNP. The strategies and materials for intracellular delivery of proteins and nucleic acids are well known in the art. However, considering the unique characteristics of RNP complexes, i.e. the complex composition and charge property, there are specific requirements when developing delivery systems for RNP when compared with proteins andnucleic acids. Methods for RNP delivery include, but are not limited to, physical approaches such as microinjection, electroporation, biolistic and microfluidic techniques, and synthetic carriers, such as lipid nanoparticles and cell-derived vesicles, polymers, nanogels, inorganic nanoparticles and DNA nanoclews. Such methods for RNP delivery are provided by Zhang et al. (Theranostics 2021 ; 11 (2) :614-648), incorporated herein by reference in its entirety. An RNP complex, in some aspects, is delivered via a vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP). In some aspects, the Cas9 or Cas12a (Cpf 1 ) endonuclease or a nucleic acid encoding the Cas9 or Cas12a (Cpf1) endonuclease is delivered separately. In some aspects, the gRNA or the nucleic acid encoding the gRNA is delivered separately. In some aspects, the gRNA is delivered as a DNA, wherein the nucleic acid is delivered with a promoter upstream of the DNA sequence to express the gRNA in the cells and / or in the cells of a subject.

[0107] The disclosure, in some embodiments, also provides the addition of HDR enhancers which improve the efficiency of the correction of the mutation. Modulation of HDR within the context of CRISPR-genome editing has led to the identification of small molecules that enhance CRISPR-mediated HDR efficiency in various cell types, i.e., HDR enhancers. Because REMEDY correction is regulated by HDR between homologous chromosomes, the addition of HDR enhancers including, but not limited to an IDT HDR enhancer (e.g., IDT Alt- R HDR Enhancer V2) and AZD7648, as DNA-PK inhibitors, is included.

[0108] The homology repair pathway takes place during the S and G2 phases when a DNA template is available, such as a sister chromatid or an exogenous DNA template. HDR enhancers, such as IDT HDR enhancer and AZD7648, have been shown to arrest or pause the cell cycle at G1 and S at high frequency (Fok et al., Nat Commun. 2019;10(1 ):5065. doi:10.1038 / s41467-019-12836-9). Thus, the use of such HDR enhancers improve cell cycle synchronization resulting in homology repair between homologous chromosomes that are now in contact following CRISPR mediated DSB in the mutant chromosome. NGS and Sanger sequencing results have shown enhanced correction of the mutation (e.g., in some aspects, up to a 40% increase in correction) after treating the cells with AZD7648 or the IDT HDR enhancer and the REMEDY methods of the disclosure.

[0109] It is understood and herein contemplated that the disclosed methods may be utilized with any cell type that comprises a C«G-to-T«A mutation (c.1824 C>T; p.G608G) in the LMNA gene, including cells that are present in a subject, including in a human subject, or in vitro or ex vivo.

[0110] Administration" to a subject includes any route of introducing or delivering to a subject an agent. Administration can be carried out by any suitable route, including oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injections or infusion techniques), and the like. "Concurrent administration", "administration in combination", "simultaneous administration" or "administered simultaneously" as used herein, means that the compounds are administered at the same point in time or essentially immediately following one another. In the latter case, the two compounds are administered at times sufficiently close that the results observed are indistinguishable from those achieved when the compounds are administered at the same point in time. "Systemic administration" refers to the introducing or delivering to a subject an agent via a route which introduces or delivers the agent to extensive areas of the subject's body (e.g. greater than 50% of the body), for example through entrance into the circulatory or lymph systems. By contrast, "local administration" refers to the introducing or delivery to a subject an agent via a route which introduces or delivers the agent to the area or area immediately adjacent to the point of administration and does not introduce the agent systemically in a therapeutically significant amount. For example, locally administered agents are easily detectable in the local vicinity of the point of administration, but are undetectable or detectable at negligible amounts in distal parts of the subject's body. Administration includes self-administration and the administration by another.

[0111] In some aspects, administration of an effective amount or effective dose of the RNPs of the disclosure include administering them in a composition and / or in a vector, including but not limited to AAV, nanoparticles, extracellular vesicles, exosomes, or VLPs. Administration may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraventricular, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. Route(s) of administration and serotype(s) of AAV components of rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure may be chosen and / or matched by those skilled in the art taking into account the disease state being treated and the target cells / tissue(s), such as cells that express aberrant LMNA or progerin. In some embodiments, the composition or medicament is formulated for intramuscular injection, oral administration, subcutaneous administration or injection, intradermal administration orinjection, intraventricular delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration. In some embodiments, the route of administration is intramuscular. In some embodiments, the route of administration is intravenous or intraventricular.

[0112] In some aspects, actual administration of rAAV of the present disclosure may be accomplished by using any physical method that will transport the rAAV recombinant vector into the target tissue of an animal. Administration according to the disclosure includes, but is not limited to, injection into muscle, the bloodstream, the central nervous system, and / or directly into the brain or other organ. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as muscle. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared for oral administration, as injectable formulations, or as topical formulations to be delivered to the muscles by subcutaneous, intradermal, and / or transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure. The rAAV can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0113] For purposes of intramuscular injection, solutions in an adjuvant such as sesame or peanut oil or in aqueous propylene glycol can be employed, as well as sterile aqueous solutions. Such aqueous solutions can be buffered, if desired, and the liquid diluent first rendered isotonic with saline or glucose. Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or a pharmacologically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxpropylcellulose. A dispersion of rAAV can also be prepared in glycerol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.

[0114] “Effective amount” of an agent or composition of the disclosure refers to a sufficient amount of the agent or composition to provide a desired effect. The amount ofagent or composition that is "effective" will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified "effective amount." However, an appropriate "effective amount" in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an "effective amount" of an agent or composition can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An "effective amount" of an agent or composition necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0115] A “pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier that is acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil / water or water / oil emulsion) and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.

[0116] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), suitable mixtures thereof, and vegetable oils. In some aspects, proper fluidity is maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol,sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0117] In some aspects, the formulation comprises a stabilizer. The term "stabilizer" refers to a substance or excipient which protects the formulation from adverse conditions, such as those which occur during heating or freezing, and / or prolongs the stability or shelflife of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars, such as sucrose, lactose and mannose; sugar alcohols, such as mannitol; amino acids, such as glycine or glutamic acid; and proteins, such as human serum albumin or gelatin.

[0118] In some aspects, the formulation comprises an antimicrobial preservative. The term "antimicrobial preservative" refers to any substance which is added to the composition that inhibits the growth of microorganisms that may be introduced upon repeated puncture of the vial or container being used. Examples of antimicrobial preservatives include, but are not limited to, substances such as thimerosal, 2-phenoxyethanol, benzethonium chloride, and phenol.

[0119] The term "transduction" is used to refer to the administration / delivery of one or more of the LMNA-targeting gRNA or sgRNA or an RNP complex comprising the LMNA- targeting gRNA or sgRNA, or nucleic acid comprising an LMNA-targeting or progerin- targeting gRNA or sgRNA, described herein to a recipient cell either in vivo or in vitro, via a replication-deficient rAAV of the disclosure resulting in decreased expression of progerin by the recipient cell.

[0120] In one aspect, transduction with rAAV is carried out in vitro. In one embodiment, desired target cells are removed from the subject, transduced with rAAV and reintroduced into the subject. Alternatively, syngeneic or xenogeneic cells can be used where those cells will not generate an inappropriate immune response in the subject.

[0121] Suitable methods for the transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells are transduced in vitro by combining rAAV with cells, e.g., in appropriate media, and screening for those cells harboring the DNA of interest using conventional techniques such as Southern blots and / or PCR, or by using selectable markers. Transduced cells can then be formulated into pharmaceutical compositions, and the composition introduced into the subject by various techniques, suchas by intramuscular, intravenous, subcutaneous and intraperitoneal injection, or by injection into smooth and cardiac muscle, using e.g., a catheter.

[0122] The disclosure provides methods of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) that comprises DNA that encodes microRNA designed to downregulate or inhibit the expression of the aberrant LMNA gene or progerin gene (and the resulting expression of the aberrant LMNA or progerin protein) to a cell or to a subject in need thereof. In some aspects, the effective dose is therefore a therapeutically effective dose.

[0123] In some embodiments, the dose or effective dose of rAAV administered is about 1 .0x101° vg / kg to about 1 .0x1016vg / kg. In some aspects, 1 .0x1010vg / kg is also designated 1 .0 E10 vg / kg, which is simply an alternative way of indicating the scientific notation. Likewise, 1011is equivalent to E1 1 , and the like. In some aspects, the dose of rAAV administered is about 1 .0x1011vg / kg to about 1 .0x1015vg / kg. In some aspects the dose of rAAV is about 1 .0x1010vg / kg, about 2.0x101° vg / kg, about 3.0x1010vg / kg, about 4.0x101° vg / kg, about 5.0x101° vg / kg, about 6.0x1010vg / kg, about 7.0x101° vg / kg, about 8.0x1010vg / kg, about 9.0x101° vg / kg, about 1.0x1011vg / kg, about 2.0x1011vg / kg, about 3.0x1011vg / kg, about 4.0x1011vg / kg, about 5.0x1011vg / kg, about 6.0x1011vg / kg, about 7.0x1011vg / kg, about 8.0x1011vg / kg, about 9.0x1011vg / kg, about 1 .0x1012vg / kg, about 2.0x1012vg / kg, about 3.0x1012vg / kg, about 4.0x1012vg / kg, about 5.0x1012vg / kg, about 6.0x1012vg / kg, about 7.0x1012vg / kg, about 8.0x1012vg / kg, about 9.0x1012vg / kg, about 1 .0x1013vg / kg, about 2.0x1013vg / kg, about 3.0x1013vg / kg, about 4.0x1013vg / kg, about 5.0x1013vg / kg, about 6.0x1013vg / kg, about 7.0x1013vg / kg, about 8.0x1013vg / kg, about 9.0x1013vg / kg, about 1 .0x1014vg / kg, about 2.0x1014vg / kg, about 3.0x1014vg / kg, about 4.0x1014vg / kg, about 5.0x1014vg / kg, about 6.0x1014vg / kg, about 7.0x1014vg / kg, about 8.0x1014vg / kg, about 9.0x1014vg / kg, about 1 .0x1015vg / kg, about 2.0x1015vg / kg, about 3.0x1015vg / kg, about 4.0x1015vg / kg, about 5.0x1015vg / kg, about 6.0x1015vg / kg, about 7.0x1015vg / kg, about 8.0x1015vg / kg, about 9.0x1015vg / kg, or about 1 .0x1016vg / kg.

[0124] In some aspects, an initial dose is followed by a second greater dose. In some aspects, an initial dose is followed by a second same dose. In some aspects, an initial dose is followed by one or more lesser doses. In some aspects, an initial dose is followed by multiple doses which are the same or greater doses.

[0125] Methods of transducing a target cell with a delivery vehicle (such as an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP)), in vivo or in vitro,are included in the disclosure. Transduction of cells with an rAAV of the disclosure results in sustained expression of LMNA-targeting or progerin-targeting gRNA, sgRNA. The disclosure thus provides rAAV and methods of administering / delivering rAAV which express LMNA-targeting or progerin-targeting gRNA in the cell(s) in vitro or in vivo in a subject. In some aspects, the subject is a mammal. In some aspects, the mammal is a human. These methods include transducing cells and tissues (including, but not limited to, tissues such as muscle including, but not limited to, cardiac muscle) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements. The term “transduction” is used to refer to, as an example, the administration / delivery of a nucleic acid comprising a nucleotide sequence encoding a LMNA-targeting or progerin-targeting gRNA or sgRNA or an RNP complex comprising CRISPR / Cas9 or CRISPR / Cpf1 and a sgRNA to a target cell either in vivo or in vitro, via a replication-deficient rAAV described herein resulting in the decreased expression or inhibition of expression of aberrant LMNA mRNA and / or protein or progerin mRNA and / or protein by the target cell.

[0126] The in vivo methods comprise the step of administering an effective dose (or therapeutically effective dose), or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to a subject (including a human subject) in need thereof. Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to a subject in need thereof. If the dose or doses is administered prior to development of a dlsorder / disease, the administration is prophylactic. If the dose or doses is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, that slows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival.

[0127] In some embodiments, compositions and methods of the disclosure are used in treating, ameliorating, or preventing a disease or disorder such as progeria, premature aging, natural aging or a condition associated with the aberrant expression of LMNA or progerin (for example, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hipweakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation) due to the mutation in exon 11 . In various aspects, such progeria is Hutchinson-Gilford progeria syndrome (HGPS).

[0128] In persons known to have a de novo single nucleotide substitution (C > T) within exon 11 of the LMNA gene at position 1824, the methods of the disclosure, in various aspects, are methods of preventing progeria, including HGPS, and the methods of treating the subject may be carried out before the onset of progeria to prevent the disease. In other various aspects, the methods of the disclosure are carried out after diagnosis and, therefore, are methods of treating or ameliorating the disease.

[0129] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the products and methods disclosed herein for decreasing the expression of the LMNA gene and protein or the progerin gene and protein and treating diseases or disorders associated with a mutation of exon 11 of the LMNA gene or progerin gene, such as progeria. Outcome measures include, but are not limited to, reduction or elimination of aberrant LMNA RNA or progerin mRNA or aberrant LMNA or progerin protein in affected tissues. The lack of expression of progerin and / or the downregulation of expression of progerin in the cell is detected by measuring the level of progerin protein by methods known in the art including, but not limited to, RT-PCR, QRT- PCR, RNAscope, Western blot, immunofluorescence, or immunohistochemistry in muscle biopsied before and after administration of the rAAV to determine the improvement.

[0130] In some embodiments, the level of progerin gene expression or progerin protein expression in a cell of the subject is decreased after administration of the nucleic acid and / or the RNP complex comprising the nucleic acid comprising the gRNA targeting the single nucleotide substitution (C > T) within exon 11 of the LMNA gene at position 1824, or the vector, e.g., rAAV, or nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) comprising the nucleic acid and / or the RNP complex comprising the nucleic acid comprising the gRNA targeting the single nucleotide substitution (C > T) within exon 11 of the LMNA gene at position 1824 as compared to the level of progerin gene expression or protein expression before administration of the nucleic acid, RNP complex, or vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) comprising the nucleic acid and / or RNP complex comprising the nucleic acid comprising the gRNA targeting the single nucleotide substitution (C > T) within exon 11 of the LMNA gene at position 182. In some aspects, expression of progerin is decreased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%. In various aspects, improved growth, improved weight gain, improved joint mobility, improved increase in body fat, improved hair growth (i.e., decreased alopecia), improved cardiovascular health (such as decreased atherosclerosis or decreased arterial plaque), improved vision (i.e., decrease in cataract development), improved muscle strength, improved muscle function, improved mobility and stamina, or increased lifespan show an improvement by at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100%.

[0131] In some aspects, a positive therapeutic outcome for treatment with the methods of the disclosure is a reduction in growth failure, a reduction in wrinkled skin, a reduction in balding or alopecia, a reduction in stiffness in joints, a reduction in arthritis, a reduction in tough skin, a reduction in the loss of body fat, a reduction in osteoporosis, a reduction in craniofacial abnormalities associated with progeria, a reduction in plaque buildup in the arteries, and / or increased lifespan after administration of the treatment comprising the LMNA-targeted gRNAs and CRISPR / Cas9 endonuclease or CRISPRZCpfl endonuclease as compared to the conditions in the patient before administration of the treatment comprising the LMNA-targeted gRNAs and CRISPR / Cas9 endonuclease or CRISPRZCpfl endonuclease. In some aspects, such positive therapeutic outcome shows an improvement of at least about 2%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 100% percent, or at least about greater than 100% compared to control or with respect to the subject’s condition prior to treatment.

[0132] Combination therapies are also contemplated by the disclosure. Combination as used herein includes simultaneous treatment or sequential treatments. Combinations of methods of the disclosure with standard medical treatments (e.g., lonafarnib, statins, glucocorticoids, corticosteroids and / or non-steroidal anti-inflammatory drugs) or with other inhibitory RNA constructs are specifically contemplated, as are combinations with other therapies such as those disclosed in International Publication No. WO 2013 / 016352, which is incorporated by reference herein in its entirety.

[0133] In some aspects, the disclosure provides an additional therapeutic agent, such as various small molecule compounds and compositions comprising such small molecule compounds for downregulating aberrant LMNA or progerin gene expression in the treatment of progeria, or HGPS, or in a condition associated with the aberrant expression of LMNA due to a mutation in exon 11 . In some aspects, Lonafarnib is administered as an additional therapeutic agent in combination with one or more LMNA or progerin gRNAs and CRISPR endonucleases of the disclosure. Lonafarnib, sold under the brand name ZOKINVY®, is a medication used to reduce the risk of death due to HGPS and for the treatment of certain processing-deficient progeroid laminopathies in people one year of age and older.

[0134] In some aspects, lonafarnib, statins, glucocorticoids, corticosteroids and / or nonsteroidal anti-inflammatory drugs are administered as additional therapeutic agents. In some aspects, a glucocorticoid is administered as an additional therapeutic agent in combination with one or more LMNA or progerin gRNAs and CRISPR endonucleases of the disclosure. All types of glucocorticoids are included for use in the combination therapies disclosed herein. Such glucocorticoids include, but are not limited to, prednisone, prednisolone, dexamethasone, deflazacort, beclomethasone, betamethasone, budesonide, cortisone, hydrocortisone, methylprednisolone, and triamcinolone.

[0135] Other combination therapies included in the disclosure are the LMNA-targeting or progerin-targeting gRNAs and CRISPR endonucleases, as described herein, in combination with other gRNA, miRNAs, or in combination with U7-snRNA-based gene therapy, a small molecule inhibitor of aberrant LMNA or progerin expression, oligonucleotides to inhibit aberrant LMNA or progerin through RNAi or RNAse H or exon skipping mechanisms, U7- snRNA plus any other theoretical CRISPR-based gene therapy approach.

[0136] Administration of an effective dose of a nucleic acid, viral vector, nanoparticle (for example, a lipid nanoparticle, micelle, or the like), extracellular vesicle, exosome, VLP, or composition of the disclosure may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraventricular, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal. In some aspects, an effective dose is delivered by a systemic route of administration, i.e., systemic administration. Systemic administration is a route of administration into the circulatory system so that the entire body is affected. Such systemic administration, in various aspects, takes place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation). In various aspects, an effective dose is delivered by a combinationof routes. For example, in various aspects, an effective dose is delivered intravenously and / or intramuscularly, or intravenously and intracerebroventricularly, or intraventricularly and intravenously and the like. In some aspects, an effective dose is delivered in sequence or sequentially. In some aspects, an effective dose is delivered simultaneously. Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure, in various aspects, are chosen and / or matched by those skilled in the art taking into account the condition or state of the disease or disorder being treated, the condition, state, or age of the subject, and the target cells / tissue(s) that are to express the nucleic acid or protein.

[0137] In particular, actual administration of delivery vehicle (such as an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP)) may be accomplished by using any physical method that will transport the delivery vehicle (such as an rAAV, nanoparticle, extracellular vesicle, exosome, or VLP) into a target cell of an animal. Administration includes, but is not limited to, injection into muscle, the bloodstream and / or directly into the nervous system or liver. Simply resuspending an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for tissue expression, and there are no known restrictions on the carriers or other components that can be coadministered with the rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) (although compositions that degrade DNA should be avoided in the normal manner with an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP)). Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02 / 053703, the disclosure of which is incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the affected cells and tissues by transdermal transport. Numerous formulations for intramuscular injection, subcutaneous injection, and transdermal transport have been previously developed and can be used in the practice of the disclosure. The delivery vehicle (such as an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP)) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0138] A dispersion of delivery vehicle (such as an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP)) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Linder ordinary conditions ofstorage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques known to those skilled in the art.

[0139] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0140] Sterile injectable solutions are prepared by incorporating an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0141] "Treating" includes ameliorating or inhibiting one or more symptoms of premature aging or natural aging or a condition, disease or disorder associated with the aberrant expression of LMNA or progerin including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint andspinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0142] Administration of an effective dose of a nucleic acid, viral vector, nanoparticle, extracellular vesicle, exosome, VLP, or composition of the disclosure may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intraventricular, intracerebroventricular, intracerebral, intrathecal, intraosseous, intraocular, rectal, or vaginal. In some aspects, an effective dose is delivered by a systemic route of administration, i.e., systemic administration. Systemic administration is a route of administration into the circulatory system so that the entire body is affected. Such systemic administration, in various aspects, takes place via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (generally via injection, infusion, or implantation). In various aspects, an effective dose is delivered by a combination of routes. For example, in various aspects, an effective dose is delivered intravenously and / or intramuscularly, or intravenously and intracerebroventricularly, and the like. In some aspects, an effective dose is delivered in sequence or sequentially. In some aspects, an effective dose is delivered simultaneously. Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the disclosure, in various aspects, are chosen and / or matched by those skilled in the art taking into account the condition or state of the disease or disorder being treated, the condition, state, or age of the subject, and the target cells / tissue(s) that are to express the nucleic acid or protein.

[0043] In particular, actual administration of delivery vehicle (such as an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP)) may be accomplished by using any physical method that will transport the delivery vehicle (such as an rAAV, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP)) into a target cell of an animal. Administration includes, but is not limited to, injection into muscle, the bloodstream and / or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV).Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02 / 053703, the disclosure of whichis incorporated by reference herein. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the disclosure. The delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.

[0144] A dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily obtainable by standard techniques known to those skilled in the art.

[0145] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0146] Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of theactive ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.

[0147] The disclosure also provides a kit comprising a nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP), or composition of the disclosure or produced according to a process of the disclosure. In the context of the disclosure, the term "kit" means two or more components, one of which corresponds to a nucleic acid, vector, or composition of the disclosure, and the other which corresponds to a container, recipient, instructions, or otherwise. A kit, therefore, in various aspects, is a set of products that are sufficient to achieve a certain goal, which can be marketed as a single unit.

[0148] The kit may comprise one or more recipients (such as vials, ampoules, containers, syringes, bottles, bags) of any appropriate shape, size and material containing the nucleic acid, vector, or composition of the disclosure in an appropriate dosage for administration (see above). The kit may additionally contain directions or instructions for use (e.g. in the form of a leaflet or instruction manual), means for administering the nucleic acid, vector, or composition, such as a syringe, pump, infuser or the like, means for reconstituting the nucleic acid, vector, or composition and / or means for diluting the nucleic acid, vector, or composition.

[0149] In some aspects, the kit comprises a label and / or instructions that describes use of the reagents provided in the kit. The kits also optionally comprise catheters, syringes or other delivering devices for the delivery of one or more of the compositions used in the methods described herein.

[0150] The disclosure also provides kits for a single dose of administration unit or for multiple doses. In some embodiments, the disclosure provides kits containing singlechambered and multi-chambered pre-filled syringes.

[0151] This entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. The disclosure also includes, for instance, all embodiments of the disclosure narrower in scope in any way than the variations specifically mentioned above. With respect to aspects of the disclosure described as a genus, all individual species are considered separate aspects of the disclosure. With respect to aspects of the disclosure described or claimed with "a" or "an," it should be understood thatthese terms mean "one or more" unless context unambiguously requires a more restricted meaning.

[0152] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the disclosure.

[0153] The term "and / or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term."

[0154] The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It includes, however, also the concrete number, e.g., about 10 includes 10.

[0155] Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein the term "comprising" can be substituted with the term "containing" or "including" or sometimes when used herein with the term "having."

[0156] When used herein, "consisting of" excludes any element, step, or ingredient not specified in the claim element. When used herein, "consisting essentially of" does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.

[0157] In each instance herein any of the terms "comprising", "consisting essentially of" and "consisting of" may be replaced with either of the other two terms.

[0158] It should be understood that this disclosure is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the subject matter of the disclosure, which is defined solely by the claims.

[0159] All publications and patents cited throughout the text of this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated byreference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.

[0160] A better understanding of the disclosure and of its advantages will be obtained from the following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the disclosure. It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.EXAMPLES

[0161] Additional aspects and details of the disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting.Example 1 Materials and Methods

[0162] Study Design. The objective of the study was to explore new strategies for the treatment of progeria resulting from expression of the progerin protein resulting from a mutation of the Lamin A (LMNA) gene. In this study, a novel strategy, i.e. , termed “REMEDY”, a genome editing strategy that is an acronym for REpair of heterozygous Mutations independent of Exogenous Donor template with high efficiency, using guide RNA (gRNA) and CRISPR endonuclease was used to target a single nucleotide substitution (C > T) within exon 11 of the LMNA gene at position 1824. In REMEDY, in-PAM or near-PAM CRISPR strategies were used to induce a double-strand break (DSB) in the mutant allele. Following the DSB, the wild-type homologous chromosome itself serves as an endogenous DNA donor template and initiates the correction of the mutant allele. The cells are treated concurrently with HDR enhancers, such as AZD7648 (i.e., a DNA-PK inhibitor) or Alt-R HDR Enhancer V2 (Integrated DNA Technologies), which further improves the efficiency of the correction for which the goal is to correct the mutation so progerin expression is knocked down.

[0163] Patient Derived Fibroblasts. This study was performed in compliance with the standards set by the National Institute of Health (NIH) and was reviewed and approved by the Institutional Review Board (IRB) at Nationwide Children’s Hospital (IRB number 14- 00719). Written, informed consent was obtained from the participants prior to inclusion in the study. Samples from the participants were identified by numbers, not names. Patient derivedhuman skin fibroblasts were collected under IRB and maintained in Dulbecco's modified Eagle's medium (DMEM, Gibco™, Catalog # 11960044) supplemented with GlutaMAX (Gibco™, Catalog #35050061 ) and 15% heat inactivated Fetal Bovine Serum (GenClone Catalog # 25-514H) FBS at 37°C and 5% CO2. Human primary Progeria dermal fibroblast cell lines were obtained from The Progeria Research Foundation (PRF) Cell and Tissue Bank. The HGPS cell lines used were designated HGADFN367. Progeria fibroblasts were grown in DMEM media supplemented with GlutaMAX, 20% FBS, 1% Non-Essential Amino Acids (NEAA) (Thermo Fisher, Catalog # 11140050) and 1% Pen / Strep (Gibco™, Catalog # 15070-063).

[0164] Mouse myoblasts and fibroblasts. All animal experiments were performed in compliance with the standards set by the National Institute of Health (NIH) and were reviewed and approved by the Research Institute at Nationwide Children’s Hospital Animal Care and Use Committee (IACUC approval number: AR18-00123). All experiments were conducted in compliance with the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. All mice were sacrificed in accordance with ethical standards; overdose of xylazine / ketamine anesthesia was used to euthanize the mice. Skeletal muscles were collected from one VcpR155H / + mouse after euthanasia (The Jackson Laboratory, Strain #:021968). Protocol was adapted from Shahini et al. (Efficient and high yield isolation of myoblasts from skeletal muscle. Stem Cell Res. 2018;30:122-129. doi:10.1016 / j.scr.2O18.05.017). Briefly, muscles were minced and seeded on a Matrigel (Corning, 354234) coated cell culture dish in proliferation medium for release of myoblasts (high glucose DMEM, 20% FBS (ThermoFisher, 16000044), 10% horse serum (ThermoFisher, 26050070), 0.5% chicken embryo extract (Fisher Scientific, NC9997754), 2.5 ng / ml bFGF (Peprotech, 450-33), 10 pg / ml gentamycin (Gibco, 15-710-064), 1% Antibiotic-Antimycotic (ThermoFisher, 15240062), and 2.5 pg / ml plasmocin prophylactic (Invivogen, ant-mpp)). Released cells were pre-plated to purify myoblasts. Similarly, skin samples of one VcpR155H / + mouse were collected after the mouse was euthanized and fibroblasts were released starting in one week. Cells were maintained as mentioned in the Patient-derived fibroblasts section set forth above. All animal experiments were performed according to the ethical guidelines approved by The Research Institute at Nationwide Children’s Hospital Animal Care and Use Committee (IACUC approval number: AR18- 00123).

[0165] Preparation of allele-specific gRNAs. LMNA gRNAs were designed by using the online tool Benchling (https_colon_forward slash forward slash_benchling.com) andsynthesized by Synthego as Synthetic gRNAs resuspended in Tris / EDTA (TE) buffer to achieve a 100 pM working concentration. Nineteen guide RNAs (see Tables 2A-F provided herein below) were designed to target efficient repair of heterozygous mutations in the LMNA gene without necessity of an exogenous donor template for genome editing.

[0166] Tables 2A-F. Guide RNAs and Cas endonucleases of the disclosure.

[0167] Table 2A. Exemplary SpCas9 NGG guide RNAs.

[0168] Table 2B. Exemplary SpCas9 NAG guide RNAs.

[0169] Table 2C. Exemplary SpCas9 NG guide RNAs.

[0170] Table 2D. Exemplary SaCas9 NNGRR guide RNAs.

[0171] Table 2E. Exemplary SaCas9 NNGRRT guide RNAs.

[0172] Table 2F. Exemplary AsCpfl TYCV guide RNAs.

[0173] Allele-specific CRISPR methods carried out in fibroblasts and mouse myoblasts. Fibroblast cells were detached at least 70% confluency using TrypLE™ Express Enzyme (Fisher Scientific, Catalog #12-604-021). Cells were collected and counted using trypan blue. A total of 1 .0x105 cells were used for electroporation. The cells were electroporated using the Cas9 / RNP as 2 pL of Alt-R™ S.p. Cas9 Nuclease V3, 500 pg (IDT, Catalog # 1081059) at 62 pM, 2 pL gRNA, and 1 pL of DPBS (Corning, Catalog # 21-031 -CV). The control cells received 5 pL of DPBS. the prepared Cas9 / RNP was incubated at RT for 20 minutes. The cells were resuspended in 20 pL SE electroporation buffer (Lonza, Catalog #V4SC-1096). Resuspended cells were combined with the cas9 / RNP and loaded into the electroporation cuvette provided in the Lonza kit. The cuvette was placed into the Amaxa 4D-Nucleofector X Unit (Lonza, Catalog # AAF-1003X). The cells were electroporated with the parameters of SE buffer and a pulse code of CD-137. Post electroporation, the cells were rested for 1 minute at RT, then using prewarmed culture media, the cells were transferred to 12-well plates containing the prepared media. Cells recovered in the incubator at 37°C, 5% CO2. Mouse myoblasts were treated in a similar fashion with the only variation being 0.25x105 cells were used per electroporation.

[0174] Treatment of cells with AZD7648 and IDT HDR enhancer v2. A 1 mM solution of the DNA-PK inhibitor AZD7648 (R&D Systems, Catalog # 7825 / 10) was prepared in DMSO.1 pL AZD7648 was added per 1 mL of media. The homology-directed repair (HDR) enhancer v2 (Integrated DNA Technologies (IDT)) was used at concentration of 10 pM. The media containing AZD7648 and the IDT HDR enhancer were removed and replaced with fresh media 24 hours after the addition of cells.

[0175] DNA isolation and PCR. Genomic DNA was isolated from edited and non-edited cells using DNeasy® Blood & Tissue Kit (Qiagen, Catalog #69504). Isolated DNA was subjected to PCR amplification using the Platinum™ SuperFi II PCR Master Mix (ThermoFisher, Catalog # 12368010). Following PCR, each sample was purified following the QIAquick® PCR Purification Kit (Qiagen, Catalolg # 28104). Purified samples were run on Invitrogen™ E-Gel™ Agarose Gels with SYBR™ Safe DNA Gel Stain, 2% (Fisher Scientific, Catalog # A45205) using the E-Gel™ Power Snap Electrophoresis System Starter Kit, SYBR Safe 2% (Thermofisher, Catalog # G8322ST) to validate the PCR product. All PCR primers utilized for next generation sequencing (NGS) and Sanger sequencing are provided in Table 3 below.

[0176] Table 3. Sanger sequencing primers.

[0177] Sanger sequencing. Purified PCR samples along with the corresponding primers were sent to Azenta / Genewiz (www.genewiz.com) for Sanger sequencing. The received ab1 files were analyzed using ICE (ice.synthego.com). Briefly, unaffected samples of cell types similar to the patient samples were used as the control sample to which the unedited patient sample and CRISPR / cas9 edited cells were compared. The gRNA used during a knockout (KO) needs to be changed to the wild type (WT) sequence without the mutation present in the patient sample.

[0178] NGS Deep Sequencing. Purified PCR samples were sent to the Center for Computational & Integrative Biology at Massachusetts General Hospital (dnacore.mgh.harvard.edu) for NGS deep . Samples were run on the Illumina MiSeq with 2x100bp reads. Data was analyzed through the CRISPResso2 (crispresso.pinellolab.org / ) data analysis tool. Briefly, the CRISPResso2 data analysis tool aligns each read to all allelic variants present in the controls and matches the read to the allele that is more similar.

[0179] Single Cell Cloning. Cells were detached and diluted to 1x104 cells / ml in culture media. A suspension of 5 cells / mL was prepared from the 1x104 cells / mL solution by adding 25 pL to 50 mL of culture media. 200 pL of the new dilution was added to each well of a 96- well plate. The plates were monitored for 7-10 days to assess for single cell colonies. Upon reaching an appropriate cell number, PCR was performed on the isolated DNA, and the DNA was purified and sent for Sanger sequencing to validate a homogeneous population.Example 2REMEDY Achieved Highly Efficient Deletion and Correction of the Mutated Allele in the LMNA Gene in Progeria Patient-Derived Fibroblasts

[0180] REMEDY (REpair of heterozygous Mutations independent of Exogenous Donor template with high efficiency), a genome editing strategy, was used to correct a mutation in Hutchinson-Gilford progeria syndrome (HGPS or progeria) caused by a dominant-negative C«G-to-T*A mutation (c.1824 C>T; p.G608G) in the LMNA gene which encodes nuclear Lamin A and Lamin C (Sharma et al., Indian J Clin Biochem. 2020;35(1):3-7.doi:10.1007 / sl 2291 -019-00849-6; Koblan et aL, Nature. 2021 ;589(7843):608-614. doi : 10.1038 / S41586-020-03086-7).

[0181] REMEDY was designed to allow efficient repair of heterozygous mutations in human and mouse cells without necessitating an exogenous donor DNA template. In REMEDY, in-PAM or near-PAM CRISPR strategies are used to induce a double-strand break (DSB) in mutant alleles. Following the DSB, the wild-type homologous chromosome itself serves as an endogenous DNA donor template and initiates the correction of the mutant allele. Concurrently treating the cells with homology-directed repair (HDR) enhancers, such as, for example, a DNA-PK inhibitor that enhances radiation, chemotherapy and olaparib activity (e.g., AZD7648), further improved the efficiency of the correction for treating a disease with a heterozygous mutation, such as progeria.

[0182] In-PAM or near-PAM gRNAs were designed and two of the gRNAs were tested in Progeria fibroblasts comprising the heterozygous c.1824 C>T in the LMNA gene or control fibroblasts (see Table 4 below).

[0183] Table 4 provides sequences of the gRNAs tested and the target sequences of the mutated LMNA gene (c.1824 C>T; p.G608G and the wildtype (normal or control) LMNA gene.

[0184] Table 4. DNA sequences encoding gRNA1 and gRNA2 and target LMNA sequences.

[0185] REMEDY was used correct the dominant-negative OG-to-T«A mutation (c.1824 C>T; p.G608G) in the LMNA gene mutation in progeria patient-derived fibroblasts or in control (progeria patient-derived fibroblasts that have been electroporated without any Cas9 or gRNA). Fibroblast cells were detached at least 70% confluency using TrypLE™ Express Enzyme (Fisher Scientific, Catalog #12-604-021). Cells were collected and counted using trypan blue. A total of 1 .0x105 cells were used for electroporation. The cells were electroporated using the Cas9 / RNP as 2 pL of Alt-R™ S.p. Cas9 Nuclease V3, 500 pg (IDT, Catalog # 1081059) at 62 pM, 2 pL gRNA, and 1 pL of DPBS (Corning, Catalog # 21-031- CV). The control cells received 5 pL of DPBS. the prepared Cas9 / RNP was incubated at RT for 20 minutes. The cells were resuspended in 20 pL SE electroporation buffer (Lonza, Catalog #V4SC-1096). Resuspended cells were combined with the cas9 / RNP and loaded into the electroporation cuvette provided in the Lonza kit. The cuvette was placed into the Amaxa 4D-Nucleofector X Unit (Lonza, Catalog # AAF-1003X). The cells were electroporated with the parameters of SE buffer and a pulse code of CD-137. Post electroporation, the cells were rested for 1 minute at RT, then using prewarmed culture media, the cells were transferred to 12-well plates containing the prepared media. Cells recovered in the incubator at 37°C, 5% CO2.

[0186] Results of the REMEDY technique in in progeria patient-derived fibroblasts showed a highly efficient deletion of the mutated allele and also achieved correction of mutated allele (50% to 69% wild-type allele) in the cells treated with AZD7648 post allele specific CRISPR targeting without an exogenous DNA template. Fig. 1 A-B provides the results of the REMEDY method in progeria patient-derived fibroblasts showed a highly efficient deletion of the mutated allele and also achieved correction of mutated allele (50% to 69% wild-type allele) in the cells treated with AZD7648 post allele specific CRISPR targeting without an exogenous DNA template. Fig. 1 A shows the results of deep sequencing analyses performed on PCR amplicons obtained using genomic DNA of treated fibroblasts as template. Deep sequencing analyzes the unique variations of amplicons present. Next Generation Sequencing (NGS) adaptors and barcodes were added to the ends of the amplicon and ran through the Illumina MiSeq. Unique amplicons that had at least 100 reads across the total reads were combined into the complete data set. The data set gathered from the reads were subjected to analysis using CRISPResso2 (http-colon-forward slash_forward slash_crispresso.pinellolab.org / ). The proportion of the wild-type (WT) sequence, mutated sequence, and novel indels created by each gRNA are shown. Fig. 1 B shows the results of a western blot carried out on protein extracts collected from healthy control (HGFDFSV40T369) and patient fibroblasts (HGADFN367) that were treated with negativecontrol guide RNAs (B2M gRNA) and allele specific progerin-targeting guide RNAs (gRNA1 and 2). gRNA1 and 2 were designed to only target the disease-causing LMNA c.1824C>T point mutation found in one the LMNA alleles in progeria patients. This mutated LMNA allele encodes three lamin isoforms, lamin A, lamin C, and progerin. The latter is the protein underlying progeria. gRNA1 and 2 are designed to correct the LMNA c.1824C>T point mutation and revert to wild-type the expression of the LMNA gene, giving rise to only lamin A and C proteins. Therefore, gRNA1 and 2 were designed not to interfere with the expression of lamin A and C. In this experiment, fibroblasts were electroporated with the Cas9-gRNA ribonucleoprotein (RNP) mix and were expanded until enough proteins were extracted for analysis using western blot. The left western blot shows that neither of the gRNAs affected the levels of lamin A and C in the treated healthy control fibroblasts. In the treated patient fibroblasts, the quantification of the western blot band intensities shows that the allele specific progerin-targeting gRNA1 had the highest efficiency in knocking down progerin (>99%) and the highest specificity as it did very slightly affect the levels of lamin A and C proteins. This data shows that REMEDY can be used to abolish progerin expression and treat progeria.

[0187] Fig. 2A-B shows the results of the REMEDY method in additional progeria patient-derived fibroblasts. Fig. 2A shows the results of a western blot carried out on protein extracts collected from Progeria patient-derived fibroblasts (HGADFN167) that were treated with a new negative control guide RNA (NT Grna; caucuguaggguugcaagcc (SEQ ID NO: ) and allele specific progerin-targeting guide RNAs (gRNA1 and 2). gRNA1 and 2 were designed to only target the disease-causing LMNA c.1824C>T point mutation found in one the LMNA alleles in progeria patients. This mutated LMNA allele encodes three lamin isoforms, lamin A, lamin C, and progerin. The latter is the protein underlying progeria. gRNA1 and 2 are designed to correct the LMNA c.1824C>T point mutation and revert to wild-type the expression of the LMNA gene, giving rise to only lamin A and C proteins. Therefore, gRNA1 and 2 were designed not to interfere with the expression of lamin A and C. In this experiment, fibroblasts were electroporated with the Cas9-gRNA ribonucleoprotein (RNP) mix and were expanded until enough proteins were extracted for analysis using western blot. The quantification of the western blot band intensities showed that the allele specific progerin-targeting gRNA1 had the highest efficiency in knocking down progerin (>99%). This additional data consolidates data shown in Fig. 1 A-B and shows that REMEDY is effective in abolishing progerin expression. Fig. 2B shows the quantification of lamin A, progerin and lamin C protein levels from Fig. 1 B and 2A western blots performed on patient- derived treated fibroblasts. Protein levels were normalized to levels of reference proteins(??-Tubulin or GAPDH) and to the "unedited" condition. Thus, as demonstrated in the data above, REMEDY can be used to abolish progerin expression and treat progeria.Example 3 HDR enhancers Improved the Efficiency of Correction of REMEDY

[0188] Because REMEDY correction is regulated by HDR between homologous chromosomes, it was hypothesized that the addition of HDR enhancers, such as IDT Alt-R HDR Enhancer V2 and AZD7648, as DNA-PK inhibitors, could improve the efficiency of correction achieved by REMEDY (Selvaraj et al., Nat Biotechnol. August 3, 2023 (published online); doi:10.1038 / s41587-023-01888-4) in cells with the LMNA gene mutation.. In a different disease model of encephalopathy, treating fibroblast cells with REMEDY and with IDT Alt-R Enhancer V2 post Cas9 / RNP electroporation resulted in a further increase in the frequency of the wild-type allele to 83% and to 82% in the cells treated with AZD7648 as measured by ICE. This means 30% of the cells became homozygous for the wild-type gene.

[0189] NGS deep sequencing was carried out and data was analyzed with CRISPResso where a similar percentage of correction (22% wild-type homozygous gene) was identified. To ensure the stability of the edits and to confirm that the findings were not related to sequencing artifacts or loss of heterozygosity, single cell cloning of the cells that were targeted with allele specific gRNA and treated with HDR enhancer was carried out. Based on Sanger sequencing and NGS data, it was expected that one out of five clones (20% of the cells) would be fully corrected to a wild-type homozygous gene. This was indeed confirmed by the Sanger sequencing of five single cell clones that were grown for more than 10 days. The NGS and Sanger sequencing showed enhanced correction after treating the cells with AZD7648 and IDT HDR enhancer (50% to 70%) along with REMEDY.Example 4Quantification of Progerin Expression in Cells Treated with REMEDY

[0190] Using REMEDY, the LMNA mutation in HGPS fibroblasts, fibroblast-derived skeletal muscle cells (FibroMyoD cells), iPSC-derived cardiac, endothelial, and vascular smooth muscle (VSM) cells is being edited. Each of these models is good for studying consequences of Progerin accumulation (Chen, Z., et al., Reprogramming progeria fibroblasts re-establishes a normal epigenetic landscape. Aging Cell, 2017. 16(4): p. 870- 887).

[0191] Because REMEDY has already been tested by electroporating patient-derived fibroblasts with two gRNAs and Cas9 ribonucleoproteins (RNPs) and shown correction of the abnormal splice site, editing of the mutated allele using Next-Generation Sequencing (NGS)is being carried out to measure reversion of Progerin-induced cell toxicity by performing the following assays: digital droplet PCR (ddPCR) and western blots to quantify reduction of progerin levels; immunofluorescence to quantify the percent of nuclei with reduced threadlike ProMyelocytic Leukemia Nuclear Bodies (PML-NBs), percent of Seri 39-phosphorylated histone variant H2A (y-H2AX, a marker of DNA Damage Response)-positive nuclei (Bidault, G., et al., Progerin Expression Induces Inflammation, Oxidative Stress and Senescence in Human Coronary Endothelial Cells. Cells, 2020. 9(5)), and expression of DNA-dependent protein kinase catalytic subunit (DNA-PKC) in HGPS VSMCs (Urushihara, Y., et al., DNA-PK inhibition causes a low level of H2AX phosphorylation and homologous recombination repair in Medaka (Oryzias latipes) cells. Biochem Biophys Res Commun, 2012. 429(3-4): p. 131-6); flow cytometry and Beta-Gio Assay kit to quantify senescence-associated P-galactosidase activity (Goldman, R.D., et al., Accumulation of mutant lamin A causes progressive changes in nuclear architecture in Hutchinson-Gilford progeria syndrome. Proc Natl Acad Sci U S A, 2004. 101 (24): p. 8963-8; Chen, Z., et al., Reprogramming progeria fibroblasts reestablishes a normal epigenetic landscape. Aging Cell, 2017. 16(4): p. 870-887; Harhouri,K., et al., Antisense-Based Progerin Downregulation in HGPS-Like Patients' Cells. Cells, 2016. 5(3)).Example 5 Gene Editing with REMEDY Results in a Decrease in Progerin Expression In Vivo in a Humanized Mouse Model

[0192] In vivo, the therapeutic efficacy of REMEDY guide RNAs of the disclosure is being tested for Proof-Of-Concept (POC) in the LmnaG608G / G608G HGPS mouse model. This mouse model phenotypically recapitulates hallmark symptoms of HGPS, such as hair loss, VSMC defects, lack of subcutaneous fat, musculoskeletal abnormalities, and reduced lifespan (Gordon, L.B., W.T. Brown, and F.S. Collins, Hutchinson-Gilford Progeria Syndrome, in GeneReviews((R)), M.P. Adam, et al., Editors. 1993: Seattle (WA); Gordon,L.B., et al., Impact of farnesylation inhibitors on survival in Hutchinson-Gilford progeria syndrome. Circulation, 2014. 130(1): p. 27-34; Varga et al., “Progressive vascular smooth muscle cell defects in a mouse model of Hutchinson-Gilford progeria syndrome”, Proc Natl Acad Sci U S A, 2006. 103(9): p. 3250-5).

[0193] AAV vectors encoding the endonuclease and the various REMEDY gRNAs targeting the LMNA gene mutation (AAV.REMEDY) are systemically delivered in mice using retro-orbital, intravenous and intraperitoneal injections. Functional, lifespan, histological and expression outcome measures are carried out in these mice as previously reported (Wein et al., “Systemic delivery of an AAV9 exon-skipping vector significantly improves or preventsfeatures of Duchenne muscular dystrophy in the Dup2 mouse”, Mol Ther Methods Clin Dev, 2022. 26: p. 279-293; Simmons et al., “Pre-clinical dose-escalation studies establish a therapeutic range for U7snRNA-mediated DMD exon 2 skipping”, Mol Ther Methods Clin Dev, 2021 . 21 : p. 325-340; Potter et al., “Dose- Escalation Study of Systemically Delivered rAAVrh74.MHCK7.micro-dystrophin in the mdx Mouse Model of Duchenne Muscular Dystrophy”, Hum Gene Ther, 2021 . 32(7-8): p. 375-389; Zygmunt et aL, “rAAVrh74.MCK.GALGT2 Demonstrates Safety and Widespread Muscle Glycosylation after Intravenous Delivery in C57BL / 6J Mice”, Mol Ther Methods Clin Dev, 2019. 15: p. 305-319; Wein et al., “Translation from a DMD exon 5 IRES results in a functional dystrophin isoform that attenuates dystrophinopathy in humans and mice”, Nat Med, 2014. 20(9): p. 992-1000; Flanigan et al., “A first-in-human phase l / lla gene transfer clinical trial for Duchenne muscular dystrophy using rAAVrh74.MCK.GALGT2”, Mol Ther Methods Clin Dev, 2022. 27: p. 47-60; Vetter et al., “Automated immunofluorescence analysis for sensitive and precise dystrophin quantification in muscle biopsies:, Neuropathol Appl Neurobiol, 2022. 48(3): p. e12785; Gushchina et aL, “Systemic PPMO-mediated dystrophin expression in the Dup2 mouse model of Duchenne muscular dystrophy,” Mol Ther Nucleic Acids, 2022. 30: p. 479- 492).

[0194] Briefly, to compare the effect of injection route and timing on in vivo gene editing, short- and long-term therapeutic efficacy of REMEDY gRNAs by retro-orbital injection of P3 (3-day-old) and P14 (2-week-old) mice and by intraperitoneal and intravenous injection of P14 mice at 6-week and 6-month endpoints, respectively, is carried out as has been reported previously (Koblan et aL, “In vivo base editing rescues Hutchinson-Gilford progeria syndrome in mice. Nature, 2021. 589(7843): p. 608-614). Four cohorts are established for comparison, e.g.,: i) C57BL / 6 wild-type mice, ii) untreated mice, iii) saline-injected mice, and iv) AAV.REMEDY-injected HGPS mice to assess functional (open-field, hanging wire and rotarod tests) outcome measures. In addition, histological, gene editing and molecular outcomes in aorta, heart, skeletal muscles (quadriceps, gastrocnemius and triceps, liver, kidney, spleen, lungs, visceral fat, white adipose tissue (WAT), skin and bone is assessed. Further, escalating doses of AAV preparation are tested, e.g., does of : i) 2x1012, 2x1013and 2x1014AAV particle / kg (Driedonks et al., “Pharmacokinetics and biodistribution of extracellular vesicles administered intravenously and intranasally to Macaca nemestrina", J Extracell Biol, 2022. 1 (10)).

[0195] For short-term, each cohort is formed of N=6 mice per dose (Koblan et al., “In vivo base editing rescues Hutchinson-Gilford progeria syndrome in mice”, Nature, 2021.589(7843): p. 608-614). For long-term, the same outcome measures, as discussed herein above, are carried out at a 6-month endpoint. Additionally, a longevity study is used to assess lifespan over 1 ,5-year duration using new cohorts of mice of the same groups following same injection routes and doses (N=12 per cohort, dose, injection route and endpoint for statistical significance according to previous work by Koblan et al., (“In vivo base editing rescues Hutchinson-Gilford progeria syndrome in mice”, Nature, 2021 . 589(7843): p. 608-614).

[0196] Tissues are collected and on- and off-target gene editing efficiency is analyzed in all collected tissues, using NGS. In all cohorts, histopathology using H&E staining is used to assess effects of treatment on target tissues. Aortic histopathology using Movat's pentachrome staining is carried out on the hearts of treated animals to examine loss of VSMCs in aortic vessel walls (count VSMC nuclei) and periadventitial thickening. Both loss of VSMCs in aortic vessel walls and periadventitial thickening are hallmarks of aortic stiffening and cardiomyopathy. Additionally, ddPCR and western blots are carried out to quantify human LMNA and PROGERIN RNA and lamin A / C and progerin protein levels, respectively. A chronic toxicity study at a 6-month endpoint is also carried out on injected mice to determine toxicity of treatment. Blood is also collected from C57BL / 6 mice (N=6) injected with the highest AAV doses and using same injection routes as above and a comprehensive independent blinded post-mortem evaluation is carried out to determine the effects of treatment..

[0197] Reduced levels of progerin mRNA and protein are observed in cells and tissues of mice treated with this allele-specific CRISPR-Cas9-based gene editing approach compared to the levels in cells and tissues of untreated mice.

[0198] Treatment improves one or more of premature aging or natural aging or a condition, disease or disorder associated with the aberrant expression of LMNA or progerin including, but not limited to, atherosclerosis, alopecia, osteoporosis, cardiovascular disease, skin abnormalities, fat storage, stroke, myocardial infarction, stroke, heart failure, abnormalities of arterial smooth muscle, muscle atrophy, abnormalities of the retina, hip weakness, abdominal muscle weakness, joint and spinal abnormalities, lower leg weakness, shoulder weakness, hearing loss, and / or tissue inflammation.

[0199] The foregoing description is given for clearness of understanding only, and no unnecessary limitations should be understood therefrom, as modifications within the scope of the invention may be apparent to those having ordinary skill in the art.

[0200] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise” and variations such as “comprises” and “comprising” will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0201] Throughout the specification, where compositions are described as including components or materials, it is contemplated that the compositions can also consist essentially of, or consist of, any combination of the recited components or materials, unless described otherwise. Likewise, where methods are described as including particular steps, it is contemplated that the methods can also consist essentially of, or consist of, any combination of the recited steps, unless described otherwise. The invention illustratively disclosed herein suitably may be practiced in the absence of any element or step which is not specifically disclosed herein.

[0202] The practice of a method disclosed herein, and individual steps thereof, can be performed manually and / or with the aid of or automation provided by electronic equipment. Although processes have been described with reference to particular embodiments, a person of ordinary skill in the art will readily appreciate that other ways of performing the acts associated with the methods may be used. For example, the order of various of the steps may be changed without departing from the scope or spirit of the method, unless described otherwise. In addition, some of the individual steps can be combined, omitted, or further subdivided into additional steps.

[0203] All patents, publications and references cited herein are hereby fully incorporated by reference. In case of conflict between the present disclosure and incorporated patents, publications and references, the present disclosure should control.

[0204] References:1 . Ferrari S, Jacob A, Cesana D, et al. Choice of template delivery mitigates the genotoxic risk and adverse impact of editing in human hematopoietic stem cells. Cell Stem Cell. 2022;29(10):1428-1444.e9. doi:10.1016 / j.stem.2022.09.0012. Gandhi M, Evdokimova VN, Cuenco KT, Bakkenist CJ, Nikiforov YE. Homologous chromosomes move and rapidly initiate contact at the sites of double-strand breaks in genes in Go-phase human cells. Cell Cycle. 2013;12(4):547-552. doi:10.4161 / cc.237543. Brunner E, Yagi R, Debrunner M, et al. CRISPR-induced double-strand breaks trigger recombination between homologous chromosome arms. Life Sci Alliance.2019;2(3):e201800267. doi : 10.26508 / lsa.2018002674. Wang D, Li J, Song CQ, et al. Cas9-mediated allelic exchange repairs compound heterozygous recessive mutations in mice. Nat Biotechnol. 2018;36(9):839-842. doi:10.1038 / nbt.42195. Wu J, Tang B, Tang Y. Allele-specific genome targeting in the development of precision medicine. Theranostics. 2020;10(7):3118-3137. doi:10.7150 / thno.432986. Koblan LW, Erdos MR, Wilson C, et al. In vivo base editing rescues Hutchinson- Gilford progeria syndrome in mice. Nature. 2021 ;589(7843):608-614. doi:10.1038 / s41586- 020-03086-77. Conant D, Hsiau T, Rossi N, et al. Inference of CRISPR Edits from Sanger Trace Data. CRISPR J. 2022;5(1 ):123-130. doi:10.1089 / crispr.2021.01138. Clement K, Rees H, Canver MC, et al. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat Biotechnol. 2019;37(3):224-226. doi : 10.1038 / S41587-019-0032-39. Selvaraj S, Feist WN, Viel S, et al. High-efficiency transgene integration by homology-directed repair in human primary cells using DNA-PKcs inhibition. Nat Biotechnol. Published online August 3, 2023. doi:10.1038 / s41587-023-01888-410. Jensen TJ, Loo MA, Pind S, Williams DB, Goldberg AL, Riordan JR. Multiple proteolytic systems, including the proteasome, contribute to CFTR processing. Cell.1995;83(1 ):129-135. doi :10.1016 / 0092-8674(95)90241 -411 . Sharma V, Shukla R. Progeria: A Rare Genetic Syndrome. Indian J Clin Biochem. 2020;35(1 ):3-7. doi : 10.1007 / s12291-019-00849-612. Koblan LW, Erdos MR, Wilson C, et al. In vivo base editing rescues Hutchinson- Gilford progeria syndrome in mice. Nature. 2021 ;589(7843):608-614. doi:10.1038 / s41586- 020-03086-713. Porto EM, Komor AC, Slaymaker IM, Yeo GW. Base editing: advances and therapeutic opportunities. Nat Rev Drug Discov. 2020;19(12):839-859. doi:10.1038 / s41573- 020-0084-614. Fok JHL, Ramos-Montoya A, Vazquez-Chantada M, et al. AZD7648 is a potent and selective DNA-PK inhibitor that enhances radiation, chemotherapy and olaparib activity. Nat Commun. 2019;10(1):5065. doi:10.1038 / s41467-019-12836-915. Keough KC, Lyalina S, Olvera MP, Whalen S, Conklin BR, Pollard KS. AlleleAnalyzer: a tool for personalized and allele-specific sgRNA design. Genome Biol.2019;20(1 ):167. doi : 10.1186 / s13059-019-1783-316. Shahini A, Vydiam K, Choudhury D, et al. Efficient and high yield isolation of myoblasts from skeletal muscle. Stem Cell Res. 2018;30:122-129. doi:10.1016 / j.scr.2O18.05.017

[0205] Table 5: Sequences of the disclosure.

Claims

CLAIMSWe claim:1 . A nucleic acid comprising:(a) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 1 -19;(b) a nucleotide sequence that encodes a lamin A-targeting guide RNA (gRNA), the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 1-19;(c) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising at least 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38; or(d) a nucleotide sequence that comprises a lamin A-targeting gRNA, the nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38.

2. The nucleic acid of claim 1 further comprising a promoter sequence.

3. The nucleic acid of claim 2, wherein the promoter is any of U6, U7, tRNA, H1 , CMV, minimal CMV, T7, EF1 -alpha, Minimal EF1 -alpha, or a tissue-specific promoter.

4. The nucleic acid of claim 2 or 3, wherein the promoter is U6, H1 , a muscle-specific promoter, or a cardiac-specific promoter.

5. The nucleic acid of claim 4, wherein:(a) the muscle-specific promoter is unc45b, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or CK1 ; and / or(b) the cardiac-specific promoter is alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), the 250-bp fragment of the myosin light chain-2v (MLC-2v) gene promoter (MLC250), cardiac troponin T (cTnT) promoter, the a- myosin heavy chain (a-MHC) promoter, muscle creatine kinase (MCK), tMCK, minimal MCK, CK6, CK7, CK8, or CK1 .

6. A vector comprising the nucleic acid of any one of claims 1 -5.

7. The vector of claim 7, wherein the vector is a recombinant adeno-associated virus (rAAV) vector.

8. The vector of claim 7, wherein the virus lacks rep and / or cap genes.

9. The vector of claim 7 or 8, wherein the vector is a self-complementary recombinant AAV (scAAV) or a single-stranded recombinant vector (ssAAV).

10. The vector of any one of claims 7-9 comprising a capsid of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.rh74, AAV.rh8, AAV.rhIO, AAV11 , AAV12, AAV13, AAV-anc80, AAV-B1 , AAV-BR1 , AAV.PHP.EB, AAVv66, AAV2 / 1 , AAV2 / 8, or AAV2 / 9, AAVMYO, MYOAAV, MYOAAV1 A, MYOAAV2A, MYOAAV3A, modified AAV9 (mAAV9), or AAV-SLB101 , or any derivative thereof.11 . The vector of claim 10 comprising a capsid of AAV9 or a derivative thereof.

12. A nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) comprising the nucleic acid of any one of claims 1-5.

13. A ribonucleoprotein (RNP) complex comprising a CRISPR / Cas endonuclease complexed with the nucleic acid of any one of claims 1 -5.

14. The RNP complex of claim 13, wherein the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease.

15. The RNP complex of claim 13 or 14, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 20-38 or a variant comprising at least or about 90% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 20-38.

16. A nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP) comprising the RNP complex of any one of claims 13-15.

17. A composition comprising(a) the nucleic acid of any one of claims 1 -5;(b) the vector of any one of claims 6-11 ;(c) the nanoparticle, extracellular vesicle, exosome, or VLP of claim 12 or 16;(d) the RNP complex of any one of claims 13-15; and a pharmaceutically acceptable carrier.

18. A method of decreasing and / or inhibiting the expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell comprising introducing into the cell the composition of claim 17 comprising the RNP complex.

19. The method of claim 18 wherein introducing the composition into the cell is carried out by injection or by electroporation.

20. The method of claim 18, wherein the cell is in a human subject.21 . A method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of the composition of claim 17 comprising the RNP complex.

22. The method of claim 21 , wherein the disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder.

23. The method of claim 22, wherein the progeria is Hutchinson-Gilford progeria syndrome (HGPS).

24. A method of genetically modifying a cell comprising an aberrant lamin A (LMNA) gene or progerin gene comprising obtaining a guide RNA (gRNA) that specifically hybridizes to a target DNA sequence within the genomic DNA of the cell, wherein the target DNA comprises a C to T substitution in the LMNA gene at position 1824; and introducing into the cell a ribonucleoprotein (RNP) complex comprising a CRISPR / Cas endonuclease with the gRNA that specifically hybridizes to the target DNA sequence.

25. The method of claim 24, wherein the gRNA comprises a nucleotide sequence comprising the sequence of any one of SEQ ID NOs: 20-38, or a variant thereof comprising at least or about 90% sequence identity to the sequence of any one of SEQ ID NOs: 20-38.

26. The method of claim 24 or 25 wherein the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease.

27. The method of any one of claims 24-26, wherein the cell is in a human subject.

28. The method of claim 27, wherein the human subject suffers from a laminopathy, progeroid syndrome, progeria, or aging disorder.

29. The method of claim 28, wherein the progeria is Hutchinson-Gilford progeria syndrome (HGPS).

30. A method of inhibiting the expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell comprising contacting the cell with(a) the nucleic acid of any one of claims 1 -5 and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease;(b) the vector of any one of claims 6-11 and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease;(c) the nanoparticle, extracellular vesicle, exosome, or VLP of claim 12 and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease; and / or(d) the composition of claim 13 and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease.31 . The method of claim 30 wherein the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease.

32. The method of claim 30 or 31 , wherein the CRISPR / Cas endonuclease or the nucleic acid encoding a CRISPR / Cas endonuclease is provided in a vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP).

33. The method of any one of claims 30-32, wherein the nucleic acid that encodes or comprises the lamin A-targeting guide RNA (gRNA) and the CRISPR / Cas endonuclease or the nucleic acid encoding the CRISPR / Cas endonuclease are provided in the same vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP).

34. The method of any one of claims 30-33, wherein the cell is in a human subject.

35. The method of claim 34, wherein the human subject suffers from a laminopathy, progeroid syndrome, progeria, or aging disorder.

36. The method of claim 35, wherein the progeria is Hutchinson-Gilford progeria syndrome (HGPS).

37. A method of treating a subject suffering from a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene comprising administering to the subject an effective amount of(a) the nucleic acid of any one of claims 1 -5 and a CRISPR / Cas endonuclease or a nucleic acid encoding the CRISPR / Cas endonuclease;(b) the vector of any one of claims 6-11 and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease;(c) the nanoparticle, extracellular vesicle, exosome, or VLP of claim 12, and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease; and / or(d) the composition of claim 13 and a CRISPR / Cas endonuclease or a nucleic acid encoding a CRISPR / Cas endonuclease.

38. The method of claim 37 wherein the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 or Cas12a endonuclease.

39. The method of claim 37 or 38, wherein the CRISPR / Cas endonuclease or the nucleic acid encoding the CRISPR / Cas endonuclease is provided in a vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP).

40. The method of any one of claims 37-39, wherein the nucleic acid that encodes or comprises the lamin A-targeting guide RNA (gRNA) and the CRISPR / Cas endonuclease or the nucleic acid encoding the CRISPR / Cas endonuclease are provided in the same vector, nanoparticle, extracellular vesicle, exosome, or virus-like particle (VLP).41 . The method of any one of claims 37-40, wherein the human subject suffers from a laminopathy, progeroid syndrome, progeria, or aging disorder.

42. The method of claim 41 , wherein the progeria is Hutchinson-Gilford progeria syndrome (HGPS).

43. Use of(a) the nucleic acid of any one of claims 1 -5;(b) the vector of any one of claims 6-11 ;(c) the nanoparticle, extracellular vesicle, exosome, or VLP of claim 12 or 16;(d) the RNP complex of any one of claims 13-15; or(e) the composition of claim 17 for the preparation of a medicament for inhibiting expression of an aberrant lamin A (LMNA) gene or progerin gene in a cell.

44. Use of(a) the nucleic acid of any one of claims 1 -5;(b) the vector of any one of claims 6-11 ;(c) the nanoparticle, extracellular vesicle, exosome, or VLP of claim 12 or 16;(d) the RNP complex of any one of claims 13-15; or(e) the composition of claim 17for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene.

45. Use of(a) the nucleic acid of any one of claims 1 -5;(b) the vector of any one of claims 6-11 ;(c) the nanoparticle, extracellular vesicle, exosome, or VLP of claim 12 or 16;(d) the RNP complex of any one of claims 13-15; or(e) the composition of claim 17 for the preparation of a medicament for treating or ameliorating a disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene.

46. The use of any one of claims 43-45 further comprising the use of a CRISPR / Cas endonuclease or a nucleic acid encoding the CRISPR / Cas endonuclease.

47. The use of claim 46 wherein the CRISPR / Cas endonuclease is a Cas9 endonuclease or a Cpf1 endonuclease.

48. The use of any one of claims 44-47, wherein the disease or disorder associated with an aberrant lamin A (LMNA) gene or progerin gene is a laminopathy, progeroid syndrome, progeria, or aging disorder.

49. The use of claim 48, wherein the progeria is Hutchinson-Gilford progeria syndrome (HGPS).

50. The(a) nucleic acid of any one of claims 1 -5;(b) vector of any one of claims 6-11 ;(c) nanoparticle, extracellular vesicle, exosome, or VLP of claim 12 or 16;(d) RNP complex of any one of claims 13-15;(e) composition of claim 17;(f) method of any one of claims 16-42; or(g) use of any one of claims 43-49, wherein the nucleic acid, vector, nanoparticle, extracellular vesicle, exosome, VLP, composition, RNP complex, or medicament is formulated for intramuscular injection, oraladministration, subcutaneous administration or injection, intradermal administration or injection, intraventricular delivery or injection, transdermal transport, injection into the blood stream, or for aerosol administration.

Citation Information

Patent Citations

  • Production of recombinant adeno-associated virus vectors

    US5173414A

  • Generation of high titers of recombinant AAV vectors

    US5658776A

  • Adeno-associated virus materials and methods

    US5786211A

  • Hybrid adenovirus-AAV virus and methods of use thereof

    US5871982A

  • Compositions and methods for helper-free production of recombinant adeno-associated viruses

    US6258595B1