Antibody binding to FGFR1 and conjugates comprising the same
Antibodies targeting a non-ligand binding domain of FGFR1, combined with cytotoxic payloads, provide a solution to drug resistance in FGFR1-targeted therapies, enhancing cancer treatment efficacy.
Patent Information
- Application Number
- PCT/EP2025/063974
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-21
- Filing Date
- 2025-05-21
- Publication Date
- 2025-11-27
AI Technical Summary
Current FGFR1-targeted drugs face limitations due to drug resistance, necessitating the development of alternative therapy options, particularly for cancers expressing FGFR1.
Development of antibodies that bind to FGFR1, specifically targeting the domain not involved in ligand binding, and conjugates comprising these antibodies with cytotoxic payloads to enhance therapeutic efficacy.
The antibodies and conjugates effectively internalize and deliver cytotoxic payloads to cancer cells, overcoming drug resistance and expanding treatment options for FGFR1-expressing cancers.
Smart Images

Figure EP2025063974_27112025_PF_FP_ABST
Abstract
Description
[0001] ONCONICK SP Z O O
[0002] Antibody binding to FGFR1 and conjugates comprising the same
[0003] REFERENCE TO SEQUENCE LISTING SUBMITTED AS A COMPLIANT XML 1.0 FORMAT FILE (.xml)
[0004] Pursuant to the EFS-Web legal framework and 37 CFR §§ 1.821-825 (see MPEP § 2442.03(a)), Rule 30 EPC, and § 11 PatV, an electronic sequence listing compliant with WIPO standard ST.26 in the form of an XML 1.0 format file is submitted concurrently with the instant application, and the entire contents of the sequence listing are incorporated herein by reference. For the avoidance of doubt, if discrepancies exist between the sequences mentioned in the specification and the electronic sequence listing, the sequences in the specification shall be deemed to be the correct ones.
[0005] FIELD OF THE INVENTION
[0006] The present application relates to antibodies binding to FGFR1 and conjugates comprising the same.
[0007] BACKGROUND
[0008] Fibroblast Growth Factor Receptor 1 (FGFR1) is a member of the fibroblast growth factor receptor family. These proteins consist of an extracellular region and a cytoplasmic tyrosine kinase receptor. Different FGFR family members differ from another in their ligand binding affinities and their tissue distribution. The extracellular portion of the protein interacts with fibroblast growth factors, normally setting in motion a cascade of downstream signals influencing mitogenesis and differentiation.
[0009] Mutations in FGFR1 have been associated with diseases such as Pfeiffer syndrome, Jackson- Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Furthermore, mutations in humans may lead to psychiatry related diseases such as Alzheimer disease, depression, bipolar disorder, schizophrenia and Rett syndrome.
[0010] FGFR1 -targeted drugs such as dovitinib or brivanib are primary antagonists to increased activity of mutated FGFR1. These antagonists inhibit FGFR1 activity in a dose-dependent manner and may restore normal FGFR1 activity. However, as a result of drug resistance, drugs likely become ineffective.
[0011] It is hence one object of the present invention alternative options to overcome the limitations of the above therapy approaches. It is another object of the present invention to expand the range of therapy options against cancers that express FGFR1.
[0012] These and other objects are solved by the features of the independent claims. The dependent claims disclose embodiments of the invention which may be preferred under particular circumstances. Likewise, the specification discloses further embodiments of the invention which may be preferred under particular circumstances.
[0013] SUMMARY OF THE INVENTION
[0014] The present invention provides, among others, antibodies that bind to FGFR1, and conjugates comprising such antibodies.
[0015] BRIEF DESCRIPTION OF THE FIGURES
[0016] Figure 1 : An embodiment of the anti FGFR1 antibody of the present invention in the scFv-Fc format (a). An embodiment of the anti FGFR1 antibody of the present invention in the IgG format (b). Figure 2: Scheme of scFv_A_Fc-vcMMAE conjugate.
[0017] Figure 3: scFv A Fc-vcMMAE conjugate characterization, (a) Ion Exchange Chromatography showing scFv_A_Fc-vcMMAE purification profile, (b) Analysis of the conjugation efficiency by SDS-PAGE under reducing and non-reducing conditions, (c) Analysis of conjugate purification efficiency by spectroscopic analysis. Overlay of the absorption spectra of the scFv_A_Fc, scFv_A_Fc-vcMMAE before purification and the scFv_A_Fc-vcMMAE after purification. The amount of vcMMAE drug molecules attached to one antibody molecule (DAR) was determined from the absorbance ratio at 248 nm and 280 nm. (d,e) LC-ESI-MS mass analysis of scFv A Fc protein and scFv A Fc-vcMMAE conjugate (b) mass spectrum obtained for scFv A Fc protein, (c) mass spectrum obtained for scFv A Fc-vcMMAE conjugate. DAR was determined from the difference between the mass of scFv A Fc protein and the mass of scFv_A_Fc-vcMMAE conjugate, and the mass of vcMMAE (1316 Da) (f, g) Analysis of particle size in solution for scFv A Fc protein and scFv A Fc-vcMMAE conjugate using DLS (e) DLS analysis of scFv A Fc protein, (c) DLS analysis of scFv A Fc- vcMMAE conjugate. Although the interchain disulfide bonds were reduced to generate free thiol groups on the corresponding cysteine residues for conjugation with the linker-toxin constructs, the resulting molecules retained their structural integrity.
[0018] Figure 4: Western blot analysis of FGFR1 expression levels in cancer cell lines. Anti-FGFRl antibodies: Cell Signalling, cat. nr: 9740, 1 :750. Tubulin immunostaining was used as a loading control (antibodies: Sigma, cat. nr: T6557, 1 : 10000).
[0019] Figure 5: Internalization of scFv_A_Fc-vcMMAE by U2OS cells stably expressing FGFR1 (U2OS- Rl). (a), Representative images of specific scFv_A_Fc-vcMMAE internalization into U2OS-R1 versus U2OS cells. Equal number of U2OS stably stained with CellTrace Violet (blue) and U2OS-R1 (nonstained) cells were grown together and then incubated with 20 pg of scFv_A_Fc-vcMMAE labeled with DyLight 550 (red) at 37°C for 15 minutes. The cells were fixed, stained with anti-EEAl antibody (green) and examined by confocal microscopy. U2OS-R1 cells, which lacked CellTrace Violet staining, were delineated with dotted lines based on EEA1 signal and the brightfield channel to distinguish them from stained U2OS cells. Colocalization were analyzed using Fiji software, colocalizing pixels are presented, (b), Representative live cell imaging of subcellular localization of scFv_A_Fc in U2OS-R1 cells. Cells were serum starved for 4 h and incubated with 15 pg / mL of scFv_A_Fc labeled with DyLight 550 (red) for 2 h at 37°C and stained with Lysotracker Green (green). Colocalization were analyzed using Fiji software, colocalizing pixels are presented. Bar, 10 pm.
[0020] Figure 6: Cytotoxicity of scFv_A_Fc-vcMMAE, scFv_A-Fc and vcMMAE following 96 h incubation with lung cancer cells. ECso values were calculated using Boltzman model in Microsoft Excel. n=3.
[0021] Figure 7: Cytotoxicity of scFv_A_Fc-vcMMAE, scFv_A-Fc and vcMMAE following incubation with breast cancer cells. ECso values were calculated using Boltzman model in Microsoft Excel. n=3.
[0022] Figure 8: Binding profiles of scFv A Fc and scFv A Fc-vcMMAE to human and mouse FGFR1. Different concentrations of the antibody and conjugate were injected over a CM4 sensor chip coated with ca. 610 RU of ECD FGFRl-Fc human or c.a. 590 RU of ECD FGFRl- Fc mouse (R&D Systems) and measured using SPR method. The equilibrium dissociation constant (KD), dissociation rate constant (ka, koff) and association rate constant (ka, kon) were calculated with the BIA evaluation 4.1 using a 1 : 1 Langmuir binding model.
[0023] Figure 9: In vivo tolerability of scFv A Fc- vcMMAE and scFv A Fc. Balb / c mice were administered 10 mg / kg or 20 mg / kg of scFv_A_Fc-vcMMAE or scFv_A_Fc, and a separate cohort received 15 mg / kg of scFv_A_Fc-vcMMAE on a q4dx4 schedule. Data are presented as mean ± standard deviation..
[0024] Figure 10: Demonstration of in vivo efficacy of scFv A Fc-vcMMAE. (a) SCID mice bearing NCI-H1581 NSCLC tumors were treated with scFv_A_Fc-vcMMAE or scFv_A_Fc (15 mg / kg) or vehicle (PBS) or MMAE (0.38 mg / kg - equivalent to free drug load on scFv A Fc- vcMMAE); (b) SCID mice bearing NCI-H1581 NSCLC tumors were treated with scFv A Fc- vcMMAE or scFv_A_Fc (10 mg / kg) or MMAE (0.38 mg / kg - equivalent to free drug load on scFv A Fc-vcMMAE) on a q8dx3 regimen, or vehicle (PBS); (c) SCID mice bearing NCI- 14520 NSCLC tumors were treated with scFv_A_Fc-vcMMAE or scFv_A_Fc (15 mg / kg) or vehicle (PBS) or MMAE (0,38 mg / kg - equivalent to free drug load on scFv_A_Fc-vcMMAE); (d) SCID mice bearing NCI-H520 NSCLC tumors were treated with scFv A Fc- vcMMAE or scFv_A_Fc (10 mg / kg) or MMAE (0,38 mg / kg - equivalent to free drug load on scFv A Fc- vcMMAE) on a Q8Dx4 regimen, or vehicle (PBS). Standard deviation is indicated on the graphs. Red arrows indicate drug administration time points; (e) detailed information on therapy outcomes.
[0025] Figure 11 : Blood morphology of SCID mice bearing NCI-H1581 NSCLC tumors treated with scFv_A_Fc-vcMMAE or scFv_A_Fc (single dose 15 mg / kg or 10 mg / kg q8dx3) or vehicle (PBS) or MMAE (0.38 mg / kg or 0.25 mg / kg, equivalent to the free drug load in scFv A Fc- vcMMAE). On day 20, blood samples were collected and analyzed for following parameters: White Blood Cell count (WBC), Lymphocytes (LYMPH), Monocytes (MONO), Red Blood Cell count (RBC), Hemoglobin Concentration (HGB), Hematocrit (HCT, volume percentage of red blood cells), Mean Corpuscular Volume (MCV), Mean Corpuscular Hemoglobin (MCH) and Mean Corpuscular Hemoglobin Concentration (MCHC), Red Cell Distribution Width (RDW), Platelet count (PLT) and Mean Platelet Volume (MPV). Normal reference ranges for each parameter are indicated with orange frames on the graphs, with corresponding values displayed above.. Reference data ("CB17SCID Mouse Biochemistry from North American Colonies") were obtained from Charles River Laboratories between January 2011 and December 2012.. Non-fasted samples of were collected from animals housed in Charles River’s standard production setting and analyzed with Drew Scientific HemaVet analyzer. Age: 8-10 weeks.
[0026] Figure 12: Blood morphology of SCID mice bearing NCI-H520 NSCLC tumors treated with scFv_A_Fc-vcMMAE or scFv_A_Fc (single dose 15 mg / kg or 10 mg / kg q8dx3) or vehicle (PBS) or MMAE (0.38 mg / kg or 0.25 mg / kg- equivalent to the free drug load in scFv A Fc- vcMMAE. On day 18 blood tested samples were collected and analyzed for following parameters: White Blood Cell count (WBC), Lymphocytes (LYMPH), Monocytes (MONO), Red Blood Cell count (RBC), Hemoglobin Concentration (HGB), Hematocrit (HCT, volume percentage of red blood cells), Mean Corpuscular Volume (MCV), Mean Corpuscular Hemoglobin (MCH) and Mean Corpuscular Hemoglobin Concentration (MCHC), Red Cell Distribution Width (RDW), Platelet count (PLT) and Mean Platelet Volume (MPV). Normal reference ranges for each parameters were marked with orange frames on each graph, with number values on top. Reference data ("CB17SCID Mouse Biochemistry from North American Colonies") were obtained from Charles River Laboratories between January 2011 and December 2012.. Non-fasted samples of were collected from animals housed in Charles River’s standard production setting and analyzed with Drew Scientific HemaVet analyzer. Age: 8-10 weeks. Figure 13. Comparison of FGFR1 protein expression levels across various tissues with the levels of proteins that serve as molecular targets for ADCs, currently in clinical trials. The heatmap presents normalized protein expression levels in individual tissues: white indicates no detectable expression, while red represents the highest physiological expression level of a given protein within a tissue. The map was adapted from Damelin et al. (2015), while the FGFR1 expression level was generated using the Human Proteome Map web tool [http: / / www.humanproteomemap.org., Kim et al. (2014)]. A blue arrow highlights FGFR1 expression analysis across tissues.
[0027] Figure 14: Pharmacokinetic analysis of scFv A Fc-vcMMAE.
[0028] Figure 15: Cytotoxicity of scFv_A_Fc-vcMMAE, scFv_A_Fc-tvAY, scFv_A_Fc-PEGS4- vcMMAE, scFv_A-Fc and vcMMAE, tv AY, PEGS4-vcMMAE upon incubation with U2OS and U20S-R1 cells. n=l
[0029] Figure 16: Cytotoxicity of scFv_A_Fc-SMCC-DMl following 96-hour incubation with lung cancer cell lines (NCI-H1581, NCI-H520 and NCI-HCC15) and a breast cancer cell line (SK- BR-3). DM1 was coupled to scFv A Fc using SMCC linker (succinimidyl trans-4- (maleimidylmethyl)cyclohexane-l -carboxylate) via surface amines following aa method developed by ImmunoGen and employing Antibody Mertansine (DM1) Conjugation Kit (PerKit™, CM11410). The product was purified according to kit protocol to remove unreacted drug. ECso values were calculated using Boltzman model in Microsoft Excel. n=3
[0030] Figure 17: Characterization of IgGi_A_PEG4-vcMMAE. (a,b) LC-ESI-MS mass analysis of the IgGi A protein and IgGi-PEG4-vcMMAE conjugate (a) Total Ion Chromatogram (TIC) of IgGi A and IgGi_A_PEG4-vcMMAE. Samples were reduced with DTT to dissociate ADC into light chains (LC) with 0 to 1 drug molecules (LC-ld) and heavy chains (HC) with 0 to 3 drug molecules (HC-ld, -2d, -3d). The drug-to-antibody ratio (DAR) of IgGi_A_PEG4- vcMMAE was calculated based on peak areas in the chromatogram and is presented in a table, (b) Deconvolution results of the peaks LC, LC-ld, HC, HC-ld, HC-2d, HC-3d in the mass chromatogram of IgGi_A_PEG4-vcMMAE. The mass values corresponding to each peak are summarized in a table, (c) Analysis of conjugation efficiency by SDS-PAGE under reducing and non-reducing conditions, (d) Binding profile of IgGi_A_PEG4-vcMMAE to human FGFR1. Different concentrations of conjugate were injected over a CM4 sensor chip coated with approximately610 RU of human ECD FGFRl-Fc and analyzed using SPR method. The equilibrium dissociation constant (KD) was calculated using BIAevaluation 4.1 software based on a 1 : 1 Langmuir binding model, e) Chemical structure and calculated mass of PEG4- vcMMAE.
[0031] Figure 18: Cytotoxicity of IgGi-PEG4-vcMMAE following 96-hour incubation with breast cancer cell lines. ECso values were calculated using Boltzman model in Microsoft Excel. n=l.
[0032] DETAILED DESCRIPTION OF EMBODIMENTS
[0033] Before the invention is described in detail, it is to be understood that this invention is not limited to the particular component parts of the devices described or process steps of the methods described, as such devices and methods may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It must be noted that, as used in the specification and the appended claims, the singular forms "a", "an", and "the" include singular and / or plural referents unless the context clearly dictates otherwise. It is moreover to be understood that, in case parameter ranges are given which are delimited by numeric values, the ranges are deemed to include these limitation values.
[0034] It is further to be understood that embodiments disclosed herein are not meant to be understood as individual embodiments which would not relate to one another. Features discussed with one embodiment are meant to be disclosed also in connection with other embodiments shown herein. If, in one case, a specific feature is not disclosed with one embodiment, but with another, the skilled person would understand that does not necessarily mean that said feature is not meant to be disclosed with said other embodiment. The skilled person would understand that it is the gist of this application to disclose said feature also for the other embodiment, but that just for purposes of clarity and to keep the specification in a manageable volume this has not been done.
[0035] Furthermore, the content of the prior art documents referred to herein is incorporated by reference. This refers, particularly, for prior art documents that disclose standard or routine methods. In that case, the incorporation by reference has mainly the purpose to provide sufficient enabling disclosure, and avoid lengthy repetitions. According to one aspect of the invention, an antibody that binds to FGFR1, or a target-binding fragment or derivative of such antibody, is provided, which a) comprises a set of three heavy chain and three light chain complementarity determining regions (CDR) comprised in the heavy chain / light variable domain sequence pair of SEQ ID NOs 7 and 8, b) comprises the set of three heavy chain and three light chain complementarity determining regions (CDR) as set forth in SEQ ID NOs 1 - 6, c) comprises the set of heavy chain / light chain complementarity determining regions (CDR) of b), with the proviso that at least one of the CDRs has up to 3 amino acid substitutions relative to the respective SEQ ID NOs, and / or d) comprises the set of heavy chain / light chain complementarity determining regions (CDR) of b) or c), with the proviso that at least one of the CDRs has a sequence identity of > 66 % to the respective CDRs comprised in the SEQ ID NOs, wherein the CDRs are embedded in a suitable protein framework, preferably a variable domain framework, so as to be capable to bind to FGFR1.
[0036] These sequences define the CDR regions of antibody “A”, or derivatives thereof.
[0037] Fibroblast growth factor receptor 1 (FGFR1, UniProt identifier: Pl 1362; Entrez identifier: 2260), also known as basic fibroblast growth factor receptor 1, fms-related tyrosine kinase-2, and CD331, is a receptor tyrosine kinase whose ligands are specific members of the fibroblast growth factor family. FGFR1 has been shown to be associated with inter alia Pfeiffer syndrome and clonal eosinophilias.
[0038] FGFR1 is a member of the fibroblast growth factor receptor (FGFR) family, which in addition to FGFR1, includes FGFR2, FGFR3, FGFR4, and FGFRL1. FGFR1-4 are cell surface membrane receptors that possess tyrosine kinase activity. A full-length representative of these four receptors consists of an extracellular region composed of three immunoglobulin-like domains, a single hydrophobic stretch which passes through the cell's surface membrane, and a cytoplasmic tyrosine kinase domain. When bonded to FGFs, these receptors form dimers with any one of the four other FGFRs and then cross-phosphorylate key tyrosine residues on their dimer partners. These newly phosphorylated sites bind cytosolic docking proteins such as FRS2, PRKCG and GRB2 which proceed to activate cell signalling pathways that lead to cellular differentiation, growth, proliferation, prolonged survival, migration, and other functions. FGFRL1 lacks a prominent intracellular domain and tyrosine kinase activity; it may serve as a decoy receptor by binding with and thereby diluting the action of FGFs. There are 18 known FGFs that bind to and activate one or more of the FGFRs: FGF1 to FGF10 and FGF16 to FGF23. Fourteen of these, FGF1 to FGF6, FGF8, FGF10, FGF17, and FGF19 to FGF23 (called “FGFR1 ligands” herein) bind and activate FGFR1. FGFs binding to FGFR1 is promoted by their interaction with cell surface heparan sulfate proteoglycans and, with respect to FGF19, FGF20, and FGR23, the transmembrane protein Klotho.
[0039] FGFR1, when bound to a proper FGF, elicits cellular responses by activating signalling pathways that include the: a) Phospholipase C / PI3K / AKT, b) Ras subfamily / ERK, c) Protein kinase C, d) IPs-induced raising of cytosolic Ca2+, and e) Ca2+ / calmodulin-activated elements and pathways. The exact pathways and elements activated depend on the cell type being stimulated plus other factors such as the stimulated cells microenvironment and previous as well as concurrent history of stimulation. Activation of the gamma isoforms of phospholipase C (PLCy) (see PLCG1 and PLCG2) illustrates one mechanism by which FGFR1 activates cell stimulating pathways.
[0040] Somatic mutations and epigenetic changes in the expression of the FGFR1 gene occur in and are thought to contribute to various types of lung, breast, hematological, and other types of cancers. These mutations do either lead to a) amplification of the FGFR1 gene, resulting in overexpression of FGFR1 in respective malignant cells, or b) the fusion of FGFR1 with various other genes due to Chromosomal translocations or Interstitial deletions, thus create genes that encode chimeric FGFR1 Fusion proteins. These proteins have increased or even continuously active FGFR1 -derived tyrosine kinase activity and thereby continuously stimulate the cell growth and proliferation.
[0041] Regarding a), amplification of the FGFR1 gene (four or more copies) has for example been observed in 9 to 22% of patients with non-small-cell lung carcinoma (NSCLC). FGFR1 amplification was highly correlated with a history of tobacco smoking and proved to be the single largest prognostic factor in a cohort of patients suffering this disease. Further, about 1% of patients with other types of lung cancer show amplifications in FGFR1.
[0042] Amplification of FGFR1 also occurs in -10% of estrogen receptor positive breast cancers, particularly of the luminal subtype B form of breast cancer. The presence of FGFR1 amplification has been correlated with resistance to hormone blocking therapy and found to be a poor prognostic factor in the disease.
[0043] Elevated expression of FGFR1 was also detected in 10 of 10 human Rhabdomyosarcoma tumors and 4 of 4 human cell lines derived from rhabdomyocarcoma.
[0044] Regarding b), the fusion of FGFR1 with various other genes due to Chromosomal translocations or Interstitial deletions create genes that encode chimeric FGFR1 Fusion proteins, as seen in in certain rare hematological cancers. These proteins have increased or continuously active FGFR1 -derived tyrosine kinase and thereby stimulate the cell growth and proliferation. These mutations occur in the early stages of myeloid and / or lymphoid cell lines and are the cause of or contribute to the development and progression of certain types of hematological malignancies that have increased numbers of circulating blood eosinophils, increased numbers of bone marrow eosinophils, and / or the infiltration of eosinophils into tissues. These neoplasms were initially regarded as eosinophilias, hypereosinophilias, Myeloid leukemias, myeloproliferative neoplasms, myeloid sarcomas, lymphoid leukemias, or non-Hodgkin lymphomas. Based on their association with eosinophils, unique genetic mutations, and known or potential sensitivity to tyrosine kinase inhibitor therapy, they are now being classified together as clonal eosinophilias. These mutations are described by connecting the chromosome site for the FGFR1 gene, 8pl 1 (i.e. human chromosome 8's short arm [i.e. p] at position 11) with another gene such as the MY018A whose site is 17q 11 (i.e human chromosome 17's long arm at position 11) to yield the fusion gene annotated as t(8; 17)(p 11 ;ql 1). Acquired abnormalities of the FGFR1 gene are further found in -14% of urinary bladder Transitional cell carcinomas (almost all are amplifications), -10% of squamous cell Head and neck cancers (-80% amplifications, 20% other mutations), -7% of endometrial cancers (half amplifications, half other types of mutations), -6% of prostate cancers (half amplifications, half other mutations), -5% of ovarian Papillary serous cystadenocarcinoma (almost all amplifications), -5% of colorectal cancers (-60 amplifications, 40% other mutations),; -4% of sarcomas (mostly amplifications), <3% of Glioblastomas (Fusion of FGFR1 and TACC1 (8pl 1) gene), <3% of Salivary gland cancer (all amplifications); and <2% in certain other cancers.
[0045] Hence, FGFR1 offers a target for cancer intervention by two different modes of action, namely a) using FGFR1 as a target for cytotoxic intervention by means of an antibody drug conjugate, immunocytokine, immunotoxin or radioimmunoconjgate, and b) blocking FGFR1 receptor function by means of a suitable binding moiety, e.g., by an anti FGFR1 antibody (so as to interfere with FGFR1 ligand binding)
[0046] The antibody according to the invention is yet a non-blocking antibody. Blocking antibodies are less suitable for drug delivery via FGFR1, because the internalization of FGFR1, with ideally a toxic payload bound thereto in the form of e.g. an antibody drug conjugate, hinges on FGFR1 ligand binding. A blocking antibody carrying a toxic payload would interfere with such ligand binding, and could hence not be internalized, which would affect its anti-cancer efficacy.
[0047] The inventors have shown that the antibody according to the invention binds to domain DI of FGFR1, which is a domain not involved in ligand binding. ####
[0048] FGFR1 comprises an extracellular ligand-binding domain composed of three immunoglobulin- like domains (D1-D3), a single transmembrane helix domain, and an intracellular domain with tyrosine kinase activity. The three immunoglobin(Ig)-like domains, DI, D2, and D3, present a stretch of acidic amino acids (known as the acid box) between DI and D2. This acid box can participate in the regulation of ligand binding to FGFR1. In fact, Immunoglobulin-like domains D2 and D3 are sufficient for ligand binding, meaning blocking antibodies typically bind to D2 and / or D3. One such antibody is M6123 of Merck (Yu et al, 2020), which is described as a potent and selective FGFR1 antagonist with ADCC-enhanced effector conferred by an afucosylated backbone.
[0049] As used herein, the term antibody drug conjugate (ADC) refers to a conjugate protein which comprises an antibody, a drug as a conjugation partner and a linker. A drug is a chemical molecule of typically a known structure which, when administered to an organism, produces a specific biological effect. Typically, the antibody drug conjugate has the potential to localize on tumor lesions and locally produce the biological effect.
[0050] As used herein, the term immunocytokine refers to a fusion protein comprising an antibody and a cytokine. Typically, the immunocytokine has the potential to localize on tumor lesions and locally activate immune responses.
[0051] As used herein, the term immunotoxin (also called recombinant immunotoxin) refers to a conjugate or fusion protein which comprises an antibody and a toxin in which the toxin is a small molecular toxin and / or a protein or peptide toxin. Typically, the immunotoxin has the potential to localize on tumor lesions and locally induce cytotoxicity.
[0052] As used herein, the term radioimmunoconjgate refers to a conjugate protein which comprises an antibody as the protein or peptide and a radioactive entity as the conjugation partner. Typically, the radioimmunoconjugate has the potential to localize on tumor lesions and locally deliver radiation.
[0053] According to one embodiment of the invention, the CDRs are determined according to the definition of Kabat, Chothia or MacCallum, preferably wherein the CDRs are determined according to the numbering set forth in Table 1.
[0054] Methods for the production and / or selection of humanised mAbs are known in the art. For example, US6331415 by Genentech describes the production of chimeric antibodies, while US6548640 by Medical Research Council describes CDR grafting techniques and US5859205 by Celltech describes the production of humanised antibodies.
[0055] Humanized antibodies are antibodies in which the complementarity determining regions stem from a parent antibody taken from a non-human species and are grafted into the framework (at least the variable domain) of a human antibody, like e.g. of an IgGl, IgG2 or IgG4. The humanized antibody binds the same target as the parent antibody, but, due to its grafting into a human framework, has reduced immunogenicity (like e.g HAMA response). For this reason, a humanized antibody is structurally different from its parent (e.g. murine) antibody.
[0056] In humanization, the step of grafting the CDRs into a human framework is often followed by a step of affinity maturation, to reacquire affinity that was lost in the grafting process. This process further modifies the sequence of the human antibody, including its CDRs.
[0057] As used herein, the term “CDR” or “complementarity determining region” is intended to mean the non-contiguous antigen combining sites found within the variable region of both heavy and light chain polypeptides. These particular regions have been described by Kabat et al. (1977), Chothia et al. (1987) and MacCallum et al., (1996) where the definitions include overlapping or subsets of amino acid residues when compared against each other. Nevertheless, application of either definition to refer to a CDR of an antibody or grafted antibodies or variants thereof is intended to be within the scope of the term as defined and used herein. The amino acid residues which encompass the CDRs as defined by each of the above cited references are set forth below in Table 1 as a comparison.
[0058] Table 1: CDR definitions
[0059] As used herein, the term “framework” when used in reference to an antibody variable domain is entered to mean all amino acid residues outside the CDR regions within the variable domain of an antibody. Therefore, a variable domain framework is between about 100-120 amino acids in length but is intended to reference only those amino acids outside of the CDRs.
[0060] As used herein, the term “capable to bind to target X” has to be understood as meaning that respective binding domain binds the target with a KD of 10'4or smaller. KD is the equilibrium dissociation constant, a ratio of koff / kon, between the antibody or fragment and its antigen. KD and affinity are inversely related. The KD value relates to the concentration of antibody or fragment (the amount of antibody or fragment needed for a particular experiment) and so the lower the KD value (lower concentration) and thus the higher the affinity of the binding domain. The following table shows typical KD ranges of monoclonal antibodies
[0061] Table 2: KDand Molar Values
[0062] Preferably, the antibody or fragment has up to 2 amino acid substitutions, and more preferably up to 1 amino acid substitution.
[0063] Preferably, at least one of the CDRs of the antibody or fragment has a sequence identity of > 67 %; > 68 %; > 69 %; > 70 %; > 71 %; > 72 %; > 73 %; > 74 %; > 75 %; > 76 %; > 77 %; > 78 %; > 79 %; > 80 %; > 81 %; > 82 %; > 83 %; > 84 %; > 85 %; > 86 %; > 87 %; > 88 %; > 89 %; > 90 %; > 91 %; > 92 %; > 93 %; > 94 %; > 95 %; > 96 %; > 97 %; > 98 %; > 99 %, and most preferably 100 % to the respective SEQ ID NO.
[0064] “Percentage of sequence identity” as used herein, is determined by comparing two optimally aligned biosequences (amino acid sequences or polynucleotide sequences) over a comparison window, wherein the portion of the corresponding sequence in the comparison window may comprise additions or deletions (z.e., gaps) as compared to the reference sequence, which does not comprise additions or deletions, for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
[0065] The terms “identical” or percent “identity,” in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same sequences. Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (z.e., at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity over a specified region, or, when not specified, over the entire sequence of a reference sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. The disclosure provides polypeptides that are substantially identical to the polypeptides exemplified herein. With respect to amino acid sequences, identity or substantial identity can exist over a region that is at least 5, 10, 15 or 20 amino acids in length, optionally at least about 25, 30, 35, 40, 50, 75 or 100 amino acids in length, optionally at least about 150, 200 or 250 amino acids in length, or over the full length of the reference sequence. With respect to shorter amino acid sequences, e.g., amino acid sequences of 20 or fewer amino acids, substantial identity exists when one or two amino acid residues are conservatively substituted, according to the conservative substitutions defined herein.
[0066] Preferably, at least one of the CDRs has been subject to CDR sequence modification, including
[0067] • affinity maturation, and / or
[0068] • reduction of immunogenicity
[0069] Affinity maturation in the process by which the affinity of a given antibody is increased in vitro. Like the natural counterpart, in vitro affinity maturation is based on the principles of mutation and selection. It has successfully been used to optimize antibodies, antibody fragments or other peptide molecules like antibody mimetics. Random mutations inside the CDRs are introduced using radiation, chemical mutagens or error-prone PCR. In addition, the genetic diversity can be increased by chain shuffling. Two or three rounds of mutation and selection using display methods like phage display usually results in antibody fragments with affinities in the low nanomolar range. For principles see Eylenstein et al. (2016) or US20050169925A1, the content of which is incorporated herein by reference for enablement purposes.
[0070] Engineered antibodies contain murine-sequence derived CDR regions that have been engrafted, along with any necessary framework back-mutations, into sequence-derived V regions. Hence, the CDRs themselves can cause immunogenic reactions when the humanized antibody is administered to a patient. Methods of reducing immunogenicity caused by CDRs are disclosed in Harding et al. (2010), or US2014227251A1, the content of which is incorporated herein by reference for enablement purposes.
[0071] According to an embodiment of the invention, the CDRs are determined according to the definition of Kabat, Chothia or MacCallum. Preferably the CDRs are determined according to the numbering set forth in Table 1.
[0072] According to embodiments of the invention, the antibody, fragment or derivative comprises a) the heavy chain / light chain variable domain (HCVD / LCVD) pairs set forth in the following pairs of SEQ ID NOs 7 and 8, b) the heavy chain / light chain variable domains (HCVD / LCVD) pairs of a), with the proviso that
[0073] • the HCVD has a sequence identity of > 80 % to the respective SEQ ID NO, and / or
[0074] • the LCVD has a sequence identity of > 80 % to the respective SEQ ID NO, c) the heavy chain / light chain variable domains (VD) pairs of a) or b), with the proviso that at least one of the HCVD or LCVD has up to 10 amino acid substitutions relative to the respective SEQ ID NO, said antibody or fragment still being capable to bind to FGFR1.
[0075] These sequences define the VH and VL domains of antibody “A”, or derivatives thereof.
[0076] For clarity, embodiments of antibody “A” encompass, inter alia, the following:
[0077] Table 3: Some formats of antibody "A"
[0078] A “variable domain” when used in reference to an antibody or a heavy or light chain thereof is intended to mean the portion of an antibody which confers antigen binding onto the molecule and which is not the constant region. The term is intended to include functional fragments thereof which maintain some of all of the binding function of the whole variable region. Variable region binding fragments include, for example, functional fragments such as Fab, F(ab)2, Fv, single chain Fv (scFv) and the like. Such functional fragments are well known to those skilled in the art. Accordingly, the use of these terms in describing functional fragments of a heteromeric variable region is intended to correspond to the definitions well known to those skilled in the art. Such terms are described in, for example, Huston et al., (1993) or Pliickthun and Skerra (1990).
[0079] Preferably, the HCVD and / or LCVD has a sequence identity of > 81 %; > 82 %; > 83 %; > 84 %; > 85 %; > 86 %; > 87 %; > 88 %; > 89 %; > 90 %; > 91 %; > 92 %; > 93 %; > 94 %; > 95 %; > 96 %; > 97 %; > 98 %; > 99 %; or most preferably 100 % to the respective SEQ ID NO.
[0080] According to embodiments of the invention, at least one amino acid substitution is a conservative amino acid substitution.
[0081] According to another aspect of the invention, an antibody that binds to FGFR1, or a targetbinding fragment or derivative of such antibody, is provided, which has a binding affinity of > 50 % to FGFR1 compared to that of the antibody, derivative or fragment according to the above description.
[0082] As used herein the term “binding affinity” is intended to mean the strength of a binding interaction and therefore includes both the actual binding affinity as well as the apparent binding affinity. The actual binding affinity is a ratio of the association rate over the disassociation rate. Therefore, conferring or optimizing binding affinity includes altering either or both of these components to achieve the desired level of binding affinity. The apparent affinity can include, for example, the avidity of the interaction. For example, a bivalent heteromeric variable region binding fragment can exhibit altered or optimized binding affinity due to its valency.
[0083] A suitable method for measuring the affinity of a binding agent is through surface plasmon resonance (SPR). This method is based on the phenomenon which occurs when surface plasmon waves are excited at a metal / liquid interface. Light is directed at, and reflected from, the side of the surface not in contact with sample, and SPR causes a reduction in the reflected light intensity at a specific combination of angle and wavelength. Biomolecular binding events cause changes in the refractive index at the surface layer, which are detected as changes in the SPR signal. The binding event can be either binding association or disassociation between a receptorligand pair. The changes in refractive index can be measured essentially instantaneously and therefore allows for determination of the individual components of an affinity constant. More specifically, the method enables accurate measurements of association rates (kon) and disassociation rates (koir).
[0084] Measurements of konand koir values can be advantageous because they can identify altered variable regions or optimized variable regions that are therapeutically more efficacious. For example, an altered variable region, or heteromeric binding fragment thereof, can be more efficacious because it has, for example, a higher konvalued compared to variable regions and heteromeric binding fragments that exhibit similar binding affinity. Increased efficacy is conferred because molecules with higher konvalues can specifically bind and inhibit their target at a faster rate. Similarly, a molecule of the invention can be more efficacious because it exhibits a lower koir value compared to molecules having similar binding affinity. Increased efficacy observed with molecules having lower koir rates can be observed because, once bound, the molecules are slower to dissociate from their target. Although described with reference to the altered variable regions and optimized variable regions of the invention including, heteromeric variable region binding fragments thereof, the methods described above for measuring associating and disassociation rates are applicable to essentially any antibody or fragment or fragment thereof for identifying more effective binders for therapeutic or diagnostic purposes.
[0085] Another suitable method for measuring the affinity of a binding agent is through surface is by FACS / scatchard analysis. See inter alia example 1 for a respective description. Methods for measuring the affinity, including association and disassociation rates using surface plasmon resonance are well known in the arts and can be found described in, for example, Jonsson and Malmquist, (1992) and Wu et al. (1998). Moreover, one apparatus well known in the art for measuring binding interactions is a Biacore 2000 instrument which is commercially available through Pharmacia Biosensor, (Uppsala, Sweden).
[0086] Preferably said target binding affinity is > 51%, > 52%, > 53%, > 54%, > 55%, > 56%, > 57%,
[0087] > 58%, > 59%, > 60%, > 61%, > 62%, > 63%, > 64%, > 65%, > 66%, > 67%, > 68%, > 69%,
[0088] > 70%, > 71%, > 72%, > 73%, > 74%, > 75%, > 76%, > 77%, > 78%, > 79%, > 80%, > 81%
[0089] > 82%, > 83%, > 84%, > 85%, > 86%, > 87%, > 88%, > 89%, > 90%, > 91%, > 92%, > 93%
[0090] > 94%, > 95%, > 96%, > 97%, > 98%, and most preferably > 99 % compared to that of the reference binding agent.
[0091] According to another aspect of the invention, an antibody that binds to FGFR1, or a targetbinding fragment or derivative of such antibody is provided, which competes for binding to FGFR1 with the antibody, derivative or fragment according to the above description.
[0092] According to another aspect of the invention, an antibody or a target-binding fragment or derivative of such antibody is provided that binds to essentially the same, or the same, region on FGFR1 as the antibody, derivative or fragment according to the above description.
[0093] As used herein, the term “region” shall be understood to mean an extracellular region, a domain, a subdomain, or a secondary structure (e.g. loop), or preferably an epitope.
[0094] As regards the format or structure of such antibody or fragment, the same preferred embodiments as set forth above apply. In one embodiment, said antibody or fragment is a monoclonal antibody, or a target-binding fragment or derivative thereof retaining target binding capacities, or an antibody mimetic.
[0095] As used herein, the term "competes for binding" is used in reference to one of the antibodies defined by the sequences as above, meaning that the actual antibody or fragment as an activity which binds to the same target, or target epitope or domain or subdomain, as does said sequence defined antibody or fragment, and is a variant of the latter. The efficiency (e.g., kinetics or thermodynamics) of binding may be the same as or greater than or less than the efficiency of the latter. For example, the equilibrium binding constant for binding to the substrate may be different for the two antibodies.
[0096] Such competition for binding can be suitably measured with a competitive binding assay. Such assays are disclosed in Finco et al. 2011, the content of which is incorporated herein by reference for enablement purposes, and their meaning for interpretation of a patent claim is disclosed in Deng et al 2018, the content of which is incorporated herein by reference for enablement purposes.
[0097] In order to test for this characteristic, suitable epitope mapping technologies are available, including, inter alia,
[0098] • X-ray co-crystallography and cryogenic electron microscopy (cryo-EM)
[0099] • Array-based oligo-peptide scanning
[0100] • Site-directed mutagenesis mapping
[0101] • High-throughput shotgun mutagenesis epitope mapping
[0102] • Hydrogen-deuterium exchange
[0103] • Cross-linking-coupled mass spectrometry
[0104] These methods are, inter alia, disclosed and discussed in Banik et al (2010), and DeLisser (1999), the content of which is herein incorporated by reference for enablement purposes.
[0105] According to an embodiment of the invention, the antibody or fragment or derivative is a monoclonal antibody, or a target-binding fragment or derivative thereof retaining target binding capacities.
[0106] According to an embodiment of the invention, the antibody or fragment or derivative is in at least one of the formats selected from the group consisting of: IgG, scFv, scFv-Fc, scFv- diabody, Fab, or (Fab)?.
[0107] As used herein, the term “monoclonal antibody (mAb)” shall refer to an antibody composition having a homogenous antibody population, i.e., a homogeneous population consisting of a whole immunoglobulin, or a fragment or derivative thereof retaining target binding capacities. Particularly preferred, such antibody is an IgG antibody, or a fragment or derivative thereof retaining target binding capacities. Immunoglobulin G (IgG) is a type of antibody. Representing approximately 75% of serum antibodies in humans, IgG is the most common type of antibody found in blood circulation. IgG molecules are created and released by plasma B cells. Each IgG has two antigen binding sites.
[0108] IgG antibodies are large molecules with a molecular weight of about 150 kDa made of four peptide chains. It contains two identical class y heavy chains of about 50 kDa and two identical light chains of about 25 kDa, thus a tetrameric quaternary structure. The two heavy chains are linked to each other and to a light chain each by disulfide bonds. The resulting tetramer has two identical halves, which together form the Y-like shape. Each end of the fork contains an identical antigen binding site. The Fc regions of IgGs bear a highly conserved N-glycosylation site. The N-glycans attached to this site are predominantly core-fucosylated diantennary structures of the complex type. In addition, small amounts of these N-glycans also bear bisecting GlcNAc and a-2,6-linked sialic acid residues.
[0109] There are four IgG subclasses (IgGl, 2, 3, and 4) in humans, named in order of their abundance in serum (IgGl being the most abundant).
[0110] As used herein, the term “fragment” shall refer to fragments of such antibody retaining target binding capacities, e.g.
[0111] • a CDR (complementarity determining region)
[0112] • a hypervariable region,
[0113] • a variable domain (Fv)
[0114] • an IgG or IgM heavy chain (consisting of VH, CHI, hinge, CH2 and CH3 regions)
[0115] • an IgG or IgM light chain (consisting of VL and CL regions), and / or
[0116] • a Fab and / or F(ab)2.
[0117] As used herein, the term “derivative” shall refer to protein constructs being structurally different from, but still having some structural relationship to, the common antibody concept, e.g., scFv, Fab and / or F(ab)2, as well as bi-, tri- or higher specific antibody constructs, and further retaining target binding capacities. All these items are explained below. Other antibody derivatives known to the skilled person are Diabodies, Camelid Antibodies, Nanobodies, Domain Antibodies, bivalent homodimers with two chains consisting of scFvs, IgAs (two IgG structures joined by a J chain and a secretory component), shark antibodies, antibodies consisting of new world primate framework plus non-new world primate CDR, dimerized constructs comprising CH3+VL+VH, and antibody conjugates (e.g. antibody or fragments or derivatives linked to a toxin, a cytokine, a radioisotope or a label). These types are well described in the literature and can be used by the skilled person on the basis of the present disclosure, without adding further inventive activity.
[0118] Methods for the production of a hybridoma cell are disclosed in Kohler & Milstein (1975).
[0119] Methods for the production and / or selection of fully human mAbs are known in the art. These can involve the use of a transgenic animal which is immunized with the respective protein or peptide, or the use of a suitable display technique, like yeast display, phage display, B-cell display or ribosome display, where antibodies from a library are screened against FGFR1 in a stationary phase.
[0120] In vitro antibody libraries are, among others, disclosed in US6300064 by MorphoSys and US6248516 by MRC / Scripps / Stratagene. Phage Display techniques are for example disclosed in US5223409 by Dyax. Transgenic mammal platforms are for example described in EP1480515A2 by Taconic Artemis.
[0121] IgG, IgM, scFv, scFv-Fc, scFv-diabody, Fab and / or F(ab)2 are antibody formats well known to the skilled person. Related enabling techniques are available from the respective textbooks.
[0122] As used herein, the term “Fab” relates to an IgG / IgM fragment comprising the antigen binding region, said fragment being composed of one constant and one variable domain from each heavy and light chain of the antibody.
[0123] As used herein, the term “F(ab)2” relates to an IgG / IgM fragment consisting of two Fab fragments connected to one another by disulfide bonds. 1 As used herein, the term “scFv” relates to a single-chain variable fragment being a fusion of the variable regions of the heavy and light chains of immunoglobulins, linked together with a short linker, usually serine (S) or glycine (G). This chimeric molecule retains the specificity of the original immunoglobulin, despite removal of the constant regions and the introduction of a linker peptide. scFv-Fc and scFv-diabody are modified formats of scFv. scFv-Fc consists of two scFv domains each of which is fused to an Fc domain. Both resulting chains are typically held together by two disulfide bonds arranged in the hinge region. A diabody is composed of two scFv. Depending on the specificities of these two parts a diabody can be monospecific, i.e. both scFv are directed against the same antigen, or bispecific, i.e. the two scFv are directed against two different antigens.
[0124] Modified antibody formats are for example bi- or trispecific antibody constructs, antibodybased fusion proteins, immunoconjugates and the like. These types are well described in the literature and can be used by the skilled person on the basis of the present disclosure, with adding further inventive activity.
[0125] According to another aspect of the invention, a conjugate or fusion protein is provided, which conjugate or fusion protein comprises an a) anti FGFR1 antibody provided in
[0126] (i) a bivalent scFv-Fc format or
[0127] (ii) an IgG format, and b) one or more effector entities fused or conjugated thereto.
[0128] As used herein, the term “bivalent scFv-Fc format” relates to a recombinant homodimeric antibody format in which an scFv fragment is fused to an antibody Fc domain. The structure is typically as follows:
[0129] (N-VH-VL-CH2-CH3-C)2 or
[0130] (N-VL-VH-CH2-CH3-C)2 with N and C representing the N- and C-terminus. Note that the term “bivalent” relates to the fact that the homodimeric construct comprises, in total, two scFv domains (i.e., one for each chain), while for example tetravalent formats would comprise four scFv domains (i.e., two for each chain). As used herein, the term “IgG format” relates to an antibody format which, by definition, is bivalent (meaning having two VH / VL pairs) The structure is typically as follows:
[0131] (N-VH-CH1-CH -CH3-C / / N-VL-CL-C)2
[0132] According to another aspect of the invention, a conjugate or fusion protein is provided which comprising an anti FGFR1 antibody according to the above description.
[0133] According to embodiments of such conjugate or fusion protein, the antibody’s Fc domain is taken from IgGl or IgG4.
[0134] Antibody IgGl and IgG4 isotypes comprise two interchain disulfide bonds, whereas IgG2 and IgG3 have four or even more. Hence, in particular in the scFv-Fc format, the use of an Fc domain from IgGl and IgG4 allows better control of the actual conjugation sites, and the drug- to-antibody ratio.
[0135] According to embodiments of such conjugate or fusion protein, the effector entity is at least one selected from the group consisting of
[0136] • small molecular toxin
[0137] • inflammatory cytokine
[0138] • peptide- or protein toxin, and / or
[0139] • radioactive entity
[0140] Small molecular toxins are typically the conjugation partner in what is commonly known as antibody drug conjugate. Inflammatory cytokines are typically the fusion partner in what is commonly known as immunocytokine. Peptide- or protein toxins are typically the fusion partner in what is commonly known as immunotoxin. Radioactive entities are typically the conjugation partner in what is commonly known as radioimmunoconjugate.
[0141] As used herein, the term “fusion” relates to a protein which is composed of at least two parts each of a different protein. Typically, the parts are either artificially linked together by recombinant DNA technology or naturally by DNA translocation forming a single gene which is translated into a single protein molecule or the parts are associated together by e.g., disulfide bonds or other protein-protein interactions forming a single protein complex.
[0142] As used herein, the term “conjugate” relates to a molecule which is composed of at least two parts of which at least one part is a protein or peptide. The other part / parts is / are called the conjugation partner / partners and can be covalently bound e.g., directly or by a linker molecule to the protein or peptide, or which can be associated to the protein or peptide by interactions such as van der Waal force, hydrophobic free energy, hydrogen bonds or ionic electronic bonds. Typically, such conjugation partner can be other protein or peptides such as toxins or cytokines, or organic or inorganic molecules such as small molecular toxins or radioactive entities.
[0143] As used herein, the term “linker” relates to a molecule that covalently connects two molecules forming a single molecule. The linker may be further designed in a way that the resulting connection can be reversed leading to a specific release of the conjugation partner. The reversion may be due to chemical or physical triggers such as cleavage by low / high pH, by elevated level of ferrous iron or by photo-sensitive, or biological triggers by e.g., specific enzymatic cleavage.
[0144] As used herein, the term “small molecular toxin” means a molecule, typically an organic molecule, of small molecular weight not exceeding a molecular weight of 2'500 Dalton, that is cytotoxic or cytostatic to mammalian cells. Such toxins can for example interfere with mitosis or with protein translation.
[0145] As used herein, the term “inflammatory cytokine” relates to a type of signaling molecule that is secreted by immune cells or associated cells to promote a biological process called inflammation. Such signaling molecule is for example interleukin-1 (IL-1), , IL-12, and IL- 18, tumor necrosis factor alpha (TNF-a), interferon gamma (IFNy) or granulocyte-macrophage colony stimulating factor (GM-CSF).
[0146] As used herein, the term “peptide- or protein toxin“ relates to a protein or peptide which is cytotoxic or cytostatic to mammalian cells. Such toxins can interfere e.g., with mitosis, protein translation or cell membrane integrity. As used herein, the term “radioactive entity” relates to a molecule which comprises at least one radioactive atom (often called “isotope"). Radioactivity is a process by which an unstable atomic nucleus loses energy to its surrounding matter. The resulting ionizing radiation may damage the surrounding matter. Examples of such unstable atoms are Yttrium90, Iodinel31 and Lutetium 177.
[0147] According to embodiments of such conjugate, at least one effector entity is conjugated to the antibody via a cysteine residue in a hinge region of the antibody’s Fc domain.
[0148] Conjugation through antibody cysteines minimizes ADC heterogeneity relative to lysine conjugation because there are fewer potential conjugation sites. The process typically involves partial reduction of four antibody interchain disulfide bonds to reactive cysteine thiol groups, followed by conjugation of payloads containing thiol-specific maleimide linkers. The maleimide linkers typically used for cysteine conjugation result in thio-succinimide linkages between the pay load and the antibody.
[0149] This step requires either total or partial reduction of interchain disulfide bonds, as e.g. accomplished with reducing agents like TCEP (Tris(2-chlorethyl)phosphate) or DTT (Dithiothreitol).
[0150] In the scFv-Fc format, there are only two cysteine residues per antibody chain that can be used for drug coupling. This allows site specific conjugation as well as a highly reproducible DAR. These two cysteine residues are involved in the interchain disulfide bonds.
[0151] It has been discussed in the prior art that reducing these disulfide bonds, so as to use the free thiols of the reduced cysteine residues to conjugate toxin linker construct to, results in the permanent loss of structural disulfide bonds, which may reduce the stability of the ADC in vivo (Nunes et al 2015, Flygare et al 2013, Ducry and Stump 2010, Fu et al 2022 and Levengood et al 2017).
[0152] One way to overcome this problem is the so-called Thiomab technology, in which artificially introduced cysteine residues not involved in inter chain or intrachain disulfide bonds are being used as conjugation points. However, the inventors of the present invention have experimentally shown that conjugates built upon the scFv-Fc format, with the interchain disulfide bonds reduced and toxin-linker constructs conjugated to the resulting free thiols, as well as “naked” scFv-Fc formats with reduced interchain disulfide bonds only, remain dimers in solution, and do not dissociate. For this purpose, the molecules were subjected to particle size analysis using Dynamic Light Scattering (DLS). The obtained result showed that both molecules are present in the solution only in one form (Figure 3f and g).
[0153] Without being bound to theory, it may be hypothesized, at least with regard to the variant with the toxin-linker construct conjugated thereto, that the organic (= hydrophobic) toxin molecule may increase the hydrodynamic radius, and, as such, the hydration shell, of the entire conjugate.
[0154] In the full IgGl or IgG4 format, two cysteine residues per antibody heavy chain form disulfide bonds with the respective counterparts on the other heavy chain, and two further cysteine residues form disulfide bonds with the respective counterparts on the light chains. By carefully adjusting the conjugation protocol, in particular by creating conditions in which the antibody interchain disulfide bonds are only partly reduced, the DAR can as well be controlled. At the same time, the dimeric integrity of the construct can be maintained, because, stochastically, at least one interchain disulfide bond connecting the light chain with the heavy chain, and at least one disulfide bond connecting the two heavy chains, will be maintained.
[0155] According to embodiments of such conjugate or fusion protein, the hinge region of the antibody’s Fc domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO: 24.
[0156] In the following, the respective cysteine resides (bold, underline) of a typical hinge region used in an scFv-Fc format (SEQ ID NO: 15) or in an IgG format (SEQ ID NO: 24) are shown.
[0157] DKTHTCPPCPAPELLGGP ( SEQ ID NO : 15 )
[0158] EPKSCDKTHTCPPCPAPELLGGP ( SEQ ID NO : 24 ) According to embodiments, the conjugate comprises at least a maleimide linker conjugating a small molecular toxin to a cysteine residue of the antibody, preferably to a cysteine residue in a hinge region of the antibody’s Fc domain.
[0159] According to embodiments, the conjugate comprises at least one of
[0160] • a maleimidocaproyl linker,
[0161] • a valine-citrulline linker, or a valine-alanine linker, and / or
[0162] • a p-amino benzyloxy carbonyl (PABC) linker
[0163] As used herein, the terms “linker” and “spacer” are being used interchangeably. In one embodiment, the conjugate comprises a linker comprising
[0164] (i) a maleimidocaproyl group (often abbreviated “Me”),
[0165] (ii) a valine-citrulline (“Val-Cif ’ or “vc”) group or a valine-alanine (“Vai-Ala” or va) group, and
[0166] (iii) a para-aminobenzyl carbamate (PABC) group.
[0167] The complete linker construct is often called “Mc-Val-Cit-PABC” or “Mc-Val-Ala-PABC” and is conjugated, via the mal eimide residue of MC, to a cysteine residue of the antibody, and, via the benzyloxy carbonyl of PABC, to the small molecular toxin.
[0168] Other linker constructs may comprise for example
[0169] • a Maleimidopropionyl group (Mp) instead of maleimidocaproyl (Me)
[0170] • a polyethylenglycol chain (PEG)nbetween Mp or Me and Vai-Ala or Val-Cit
[0171] • a threonine-valine (”Thr-Val” or tv) group
[0172] • a Glycine-Glycine-Phenylalanine-Glycine (”Gly-Gly-Phe-Gly” or ggfg) group
[0173] According to embodiments of such conjugate, the small molecular toxin is at least one selected from the group consisting of
[0174] • Maytansinoides, e.g. Mertansine, Ansamitocin, Ravtansin, DM4, DM1 • Calicheamicins, e.g. Ozogamicin,
[0175] • Doxorubicin,
[0176] • Auristatins, e.g., Monomethyl Auristatin F (MMAF), Monomethyl Auristatin E, (MMAE) or Auristatin Y,
[0177] • Taxanes, e.g., Paclitaxel or Docetaxel,
[0178] • Pyrrolobenzodiazepine (PBD),
[0179] • Anthracy clines, e.g., PNU- 159682
[0180] • Amatoxins, e.g.a-Amanitin, P-Amanitin or y-Amanitin,
[0181] • Cyclosporine,
[0182] • Methotrexate, and / or
[0183] • Topoisomerase inhibitors, like e.g. Exatecan or Deruxtecan.
[0184] According to embodiments of such conjugate, the toxin-linker construct may have one of the formulae as shown in Table 4:
[0185] Table 4: examples of toxin-linker construct to be used in the conjugate according to the invention
[0186] The arrow marks the group which is conjugated to the antibody.
[0187] Mc-Val-Cit-PABC-MMAE (or vcMMAE) designates monomethyl auristatin E (MMAE, toxin) conjugates to a cysteine residue in the antibody chain by means of a maleimidocaproyl-valine- citrulline PABC linker.
[0188] DM1-SMCC designates a mertansine DM1 (toxin) conjugated to the SMCC linker, (succinimidyl trans-4-(maleimidylmethyl)cyclohexane-l -carboxylate) linker, linked to an amine group of the antibody. PEG4-vcMMAE designates monomethyl auristatin E (MMAE, toxin) conjugates to a cysteine residue in the antibody chain by means of a maleimidocaproyl-valine-citrulline PABC linker with additional four molecules of PEG.
[0189] Mc-Thr-Val-AuY (or mctvAY) designates auristatin Y (toxin) conjugated to a cysteine residue in the antibody chain by means of a maleimidocaproyl-threonine-valine linker.
[0190] According to embodiments, the conjugate has a drug-to antibody ratio (DAR) of between > 3,5 and < 4.
[0191] As used herein, the term “DAR” is the average number of effector molecules, preferably of toxin molecules, linked to each antibody. DAR is a key property used to measures the quality of ADC because it can significantly affect ADC efficacy. DAR can for example be determined by the method as described by Tang et. al (2017), the content of which is incorporated herein by reference for enablement purposes.
[0192] As discussed above, in particular in the scFv-Fc format, the use of an Fc domain from IgGl or IgG4 allows better control of the actual conjugation sites, and the drug-to-antibody ratio. There are only two cysteine residues per antibody chain that can be used for drug coupling, allowing site specific conjugation as well as a highly reproducible DAR.
[0193] In the full IgGl or IgG4 format, two cysteine residues per antibody heavy chain form disulfide bonds with the respective counterparts on the other heavy chain, and two further cysteine residues form disulfide bonds with the respective counterparts on the light chains. By carefully adjusting the conjugation protocol, in particular by creating conditions in which the antibody interchain disulfide bonds are only partly reduced (see experimental section).
[0194] According to yet another aspect of the invention, the antibody, conjugate or fusion protein according to the above description is provided for (the manufacture of a medicament for) use in the treatment of a human or animal subject
[0195] • being diagnosed for,
[0196] • suffering from or
[0197] • being at risk of developing cancer. This language is deemed to encompass both the swiss type claim language accepted in some countries (in this case, brackets are deemed absent) and EPC2000 language (in this case, brackets and content within the brackets is deemed absent).
[0198] According to yet another aspect of the invention, a method for treating or preventing a cancer in a human or animal subject is provided, which method comprises administration of the antibody, conjugate or fusion protein according the above description to a patient, in one or more therapeutically sufficient doses.
[0199] EXAMPLES
[0200] While the invention has been illustrated and described in detail in the drawings and foregoing description, such illustration and description are to be considered illustrative or exemplary and not restrictive; the invention is not limited to the disclosed embodiments. Other variations to the disclosed embodiments can be understood and effected by those skilled in the art in practicing the claimed invention, from a study of the drawings, the disclosure, and the appended claims. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims should not be construed as limiting the scope.
[0201] All amino acid sequences disclosed herein are shown from N-terminus to C-terminus; all nucleic acid sequences disclosed herein are shown 5'->3'.
[0202] Proteins
[0203] The extracellular domains (ECD) of FGFR1 IIIc, FGFR2 IIIc, FGFR3 IIIc, and FGFR4 were produced as Fc fusion proteins (human IgGi Fc), using CHO-S cells transfected with pLEVl 13 vectors carrying the respective FGFR sequences. Proteins were purified by Protein A affinity chromatography, following procedures described by Sokolowska et al. (2014). A soluble Fc fragment was obtained in the same manner.
[0204] Recombinant FGF2, fused to an N-terminal GST tag, was expressed in E. coli using the pDEST15 vector and purified by sequential GSH-Sepharose and heparin-Sepharose chromatography as described by Sletten et al. (2014).
[0205] Selection of antibodies by phage display
[0206] Human scFv phage display libraries along with helper phage KM13, E. coli TGI, and E. coli HB2151 strains, were sourced from Source BioScience (Nottingham, UK). Libraries were cultured and screened independently, following the supplier’s protocols.
[0207] For selection, Nunc MaxiSorp® 96-well plates (Thermo Fisher Scientific, Waltham, MA, USA) were coated with 100 pg / mL of ECD FGFRl-Fc in PBS and incubated overnight at room temperature (RT). After washing with PBS, wells were blocked with 2% MPBS (Marvel milk in PBS) for 2 hours. Prior to each panning cycle, approximately 1012phage particles suspended in 2% MPBS were pre-absorbed for 40 minutes at RT with a molar excess of Fc protein (10- fold relative to antigen) to deplete Fc-reactive clones. The pre-adsorbed phage suspension was then incubated with ECD FGFR1 -Fc-coated wells for 2 hours at RT (initial 40 minutes with rotation, followed by 1 hour 20 minutes without agitation).
[0208] Non-specific binders were removed by sequential washing (10 times with PBS-0.1% Tween 20 in the first round, 20 times in subsequent rounds), followed by 10 washes with PBS. Specifically bound phage particles were eluted using 100 mM tri ethylamine and neutralized immediately with 1 M Tris-HCl, pH 7.2. Amplification of eluted phage for subsequent selection rounds was performed according to procedures by Viti et al. (2000) and Lee et al. (2007).
[0209] Screening of individual clones by ELISA
[0210] Following the third panning round, individual bacterial colonies were cultured in 96-well plates containing 2*TY medium supplemented with 100 pg / mL ampicillin and 1% glucose. Cultures were grown at 37°C with shaking (200 rpm) for 4 hours. Cells were harvested by centrifugation, resuspended in induction medium (2*TY with 100 pg / mL ampicillin and 0.5 mM IPTG), and incubated at 30°C for 16 hours to facilitate scFv expression.
[0211] For screening, Nunc MaxiSorp® 96-well plates were coated overnight at RT with either 50 pg / mL ECD FGFRl-Fc or 50 pg / mL Fc control protein in PBS, followed by blocking with 2% MPBS for 2 hours. Bacterial supernatants, containing soluble scFvs tagged with c-myc, were mixed with 2% Marvel milk and 1 pg / mL of anti-c-myc monoclonal antibody (clone 9E10, Sigma- Aldrich, St. Louis, MO, USA) and applied to the coated wells for 1 hour at RT. Unbound material was removed by washing.
[0212] Detection was performed using horseradish peroxidase-conjugated goat anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA, USA) as the secondary antibody. Signal development was achieved with TMB liquid substrate (Sigma-Aldrich), and reactions were stopped with 1 M H2SO4. Absorbance was measured at 450 nm. Identification of FGFRl-binding scFv fragments using SPR
[0213] Bacterial supernatants containing soluble scFv fragments (identical to those used for ELISA) were passed through 0.22 pm filters and analysed for binding to FGFR1 using surface plasmon resonance (SPR) on a Biacore® 3000 system (GE Healthcare). The ECD FGFRl-Fc protein was immobilized onto a CM5 sensor chip at a surface density of approximately 7000 RU via standard amine coupling in 10 mM sodium acetate buffer, pH 5.0. Filtered supernatants (20 pL) were injected at a flow rate of 10 pL / min, and dissociation was recorded over a 120-second interval. The sensor surface was regenerated between cycles with 10 mM glycine, pH 1.5. Data analysis was performed using BIAevaluation 4.1 software.
[0214] Affinity maturation of scFv clones
[0215] Affinity maturation libraries were generated by introducing targeted diversity into specific complementarity-determining regions (CDRs) of the best parental clones. Randomized mutations were introduced at amino acid positions 31, 32, and 33 of the heavy chain, as well as positions 31, 31a, and 32 of the light chain, following the numbering schemes of Tomlinson et al. (1992) and Cox et al. (1994). Mutagenesis was carried out by PCR using primer pairs A / B, C / D, and E / F (Table 5). Resulting DNA fragments were assembled and further amplified with primers A / F (Table 5), before being cloned into the pIT2 phagemid vector. Recombinant constructs were electroporated into freshly prepared E. coli TGI cells as described by Villa et al. (2008).
[0216] The transformed bacterial libraries were utilized for phage display, generating phage particles displaying the diversified scFv repertoire. These were subjected to two consecutive selection rounds using streptavidin-coated surfaces and biotinylated ECD FGFRl-Fc antigen. Sitespecific in vitro biotinylation of ECD_FGFR1-Fc-Avi was performed using biotin-protein ligase (GeneCopoeia, Rockville, MD, USA) in accordance with the manufacturer’s guidelines, and labeling efficiency was verified via mass spectrometry.
[0217] Phage panning was performed with methodological adaptations based on Viti et al. (2000). In the first round, approximately 1012phage particles were incubated with 100 nM biotinylated antigen for 2 hours at room temperature. Phage-antigen complexes were captured with streptavidin-coated magnetic beads (Dynabeads, Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), washed extensively, and bound phage were eluted using 100 mM triethylamine.
[0218] For the second selection round, the incubation with biotinylated antigen was shortened to 30 minutes, followed by a 90-minute competition with a four-fold molar excess of non-biotinylated ECD FGFRl-Fc. This competitive elution step was designed to enrich clones exhibiting slower dissociation kinetics ("off-rate selection").
[0219] Following selection, enriched clones underwent screening by ELISA and surface plasmon resonance (SPR) analysis. The top-performing scFv variants, based on binding parameters, were expressed, purified, and subjected to detailed kinetic characterization as outlined in the main experimental procedures.
[0220] Table 5: Sequences of oligonucleotide primers used for affinity maturation
[0221] Preparation of soluble scFv antibody fragments
[0222] E. coli HB2151 cells electroporated with pIT2 plasmids encoding scFv sequences were cultured in 2*TY medium supplemented with 100 pg / mL ampicillin and 0.1% glucose until reaching an ODeoo of 0.8. Protein expression was induced with 0.5 mM IPTG, followed by overnight incubation at 30°C. Cells were harvested by centrifugation (4,000 ref, 4°C, 40 minutes) and supernatants were clarified by filtration through 0.22 pm membranes.
[0223] Soluble scFv fragments were isolated from the culture supernatant via Protein A affinity chromatography (Protein A Sepharose Fast Flow Resin), employing the same purification protocol as for ECD_FGFR-Fc proteins. Purified fractions were evaluated by SDS-PAGE and mass spectrometry. To ensure monomeric purity, samples were subjected to size-exclusion chromatography on a Superdex 75 10 / 300 GL column (GE Healthcare) using an AKTA™ system. The monomeric fraction was collected and used for kinetic measurements by SPR.
[0224] Determination of binding kinetics for antibody fragments by SPR
[0225] Binding kinetics of antibody fragments to FGFR1 were evaluated using a Biacore® 3000 instrument at 25°C. The human ECD FGFRl-Fc (produced as described previously) and mouse ECD FGFRl-Fc purchased from R&D Systems, USA, was immobilized on a CM5 sensor chip at a surface density of -650 RU (low-density) via standard amine coupling in 10 mM sodium acetate buffer (pH 5.0). Experiments were conducted in PBS-PN buffer (PBS supplemented with 0.005% v / v surfactant P20 and 0.02% NaNs, pH 7.2).
[0226] A series of antibody concentrations were injected (60 pL) at a flow rate of 30 pL / min. Dissociation phases were monitored for 180 seconds. Between cycles, the sensor surface was regenerated with 10 mM glycine, pH 1.5. Kinetic parameters were determined by fitting the data to a 1 : 1 Langmuir binding model using BIAevaluation 4.1 software, providing association (ka, kon), dissociation (kd, koff) rate constants and equilibrium dissociation constants (KD). Each measurement was performed in duplicate.
[0227] Specificity assessment by SPR
[0228] To select antibody fragments with high specificity for FGFR1 and minimal cross-reactivity with related receptors, surface plasmon resonance (SPR) analysis was performed against a panel of FGFR family members and other receptor tyrosine kinases. Recombinant fusion proteins ECD_FGFR2-Fc IIIc, ECD_FGFR3-Fc IIIc, ECD_FGFR4-Fc IIIc (produced as described previously), along with VEGFR2-Fc (357-KD-050 / CF, R&D Systems, USA) and PDGFRP-Fc (385-PR-100 / CF, R&D Systems, USA), were immobilized on CM5 sensor chips at approximately 7000 RU surface density. An Fc control protein was immobilized at around 1000 RU, using the same amine coupling procedure.
[0229] Binding experiments were carried out on a Biacore® 3000 instrument with PBS-PN buffer as running buffer. Monomeric scFv fractions (1 pM), scFv-Fc fusion proteins (0.5 pM) or IgG (0.5 pM) antibodies were injected in 20 pL volumes at a flow rate of 10 pL / min. Dissociation was monitored for 90 seconds post-injection. Sensor chip surfaces were regenerated with 10 mM glycine buffer at pH 1.5. Data from sensograms were processed and analyzed using BIAevaluation 4.1 software.
[0230] SPR-based competition binding assay
[0231] To identify non-blocking antibody fragments that bind FGFR1 at epitopes distinct from the FGF2 interaction site, a competition assay was performed using surface plasmon resonance (SPR). Sequential injections of 100 pL solutions containing 1 pM FGF2 and 1 pM monomeric scFv fractions were applied in pairwise combinations over a CM5 sensor chip with approximately 650 RU of immobilized ECD_FGFR1-Fc. The assays were conducted at a flow rate of 30 pL / min. Dissociation was monitored for 90 seconds following each injection. Sensor surface regeneration was performed with 10 mM glycine buffer (pH 1.5). Binding data were analyzed using BIAevaluation 4.1 software.
[0232] To further assess the binding epitope and determine whether the selected antibody fragments recognized regions outside the FGF2 binding interface, additional SPR analyses were conducted using a truncated FGFR1 construct containing only subdomains D2 and D3 (D2D3_FGFR1-Fc). The binding of selected clones to the truncated receptor variant was evaluated under the same experimental conditions as described above.
[0233] Preparation of scFv A diabody
[0234] The homodimeric diabody format of scFv A was generated by introducing a pentapeptide linker (GGGGS) between the VH and VL domains, following the approach described by Villa et al. (2008). The VH and VL fragments were amplified from scFv A plasmid DNA using primer pairs G / I and J / H (Table 5), respectively. The resulting PCR products were assembled by overlap extension PCR with primer pair G / H and cloned into the pIT2 expression vector.
[0235] Expression and purification of the diabody were carried out using the same protocol established for scFv fragments, including affinity purification steps. The purified product was further processed by size-exclusion chromatography to isolate the dimeric fraction, which was subsequently used for surface plasmon resonance (SPR) kinetic analysis. Table 6: Oligonucleotide primers used for preparation of antibody bivalent formats
[0236] Production and purification of scFv A Fc fusion protein
[0237] The scFv A Fc construct was assembled by amplifying the scFv-encoding DNA fragment through two successive PCR reactions using primer pairs K / L and M / L (Table 6). These primers introduced an extracellular signal peptide sequence and a Hindlll restriction site at the 5' terminus (AAGCTTTGAACCACCATGGAATGGAGCTGGGTCTTTCTCTTCTTCCTGTCAGTAA CGACTGGTGTCCACTCC) (SEQ ID NO: 40), as well as a Kpn2I site at the 3' terminus. The amplified product was digested with Hindlll and Kpn2I restriction enzymes and subsequently ligated into the corresponding sites of the pLEV113-Kpn2I-Fc expression vector, which encodes the Fc region of human IgGi.
[0238] Expression of the resulting construct (pLEVl 13-scFv_A-Fc) was performed in CHO-S suspension cells. Cultures were maintained in serum-free, protein-free PowerCHO-2CD medium (Lonza) supplemented with 8 mM L-glutamine and penicillin / streptomycin. Cells were propagated in Thomson Optimum Growth™ flasks under shaking conditions (rpm adjusted per flask size) at 37°C with 8% CO2. Subculturing was conducted every 2-3 days at seeding densities between 0.1-0.3 x 106cells / mL
[0239] For transfection, cells were seeded at 0.6 x 106cells / mL one day prior. On the day of transfection, cell pellets were resuspended in ProCHO4 medium (Lonza) at 2 x 106cells / mL. Plasmid DNA (1 mg / mL) and PEI (1 mg / mL) were separately diluted in 150 mM NaCl, mixed at a 1 :4 weight ratio, incubated for 10 minutes at room temperature, and added to cell cultures (1.25 pg DNA per 106cells; total addition volume was 10% of the culture volume). Transfected cells were incubated for 4 hours (37°C, 120 rpm, 8% CO2), then diluted with an equal volume of fresh PowerCHO-2CD medium containing antibiotics, achieving ~1 x 106cells / mL. Cultures were maintained at 31 °C for protein production.
[0240] At 24 hours post-transfection, cultures were supplemented with an additional 4 mM L- glutamine (resulting in 8 mM final concentration). Cell culture supernatants were harvested on day 11 by centrifugation (15,000 x g, 4°C, 25 minutes), followed by the addition of EDTA to a final concentration of 2 mM. Supernatants were filtered using STERICAP™ PLUS filters (Millipore) and kept on ice to prevent proteolysis.
[0241] Purification of scFv A Fc was carried out on a BioRad NGC low-pressure chromatography system using HiTrap MabSelect SuRe 5 mL (Cytiva, Merck) affinity columns. Columns were equilibrated with PBS (pH 7.2) before applying the clarified supernatant at a flow rate of 1.5 mL / min overnight. The following day, columns were washed sequentially with Wash Buffer A (18 mM Na2HPO4, 33 mM NaEEPCL, 300 mM NaCl, 0.1% Tween 20, 2 mM EDTA, pH 7.4) and Wash Buffer B, containing elevated NaCl concentration (650 mM).
[0242] Elution of the antibody was performed in reverse mode using 100 mM sodium citrate buffer (pH 3.5) at 0.5 mL / min. Eluted fractions (1 mL) were collected into tubes preloaded with 200 pL of 1 M Tris (pH 9.0) for immediate neutralization. Final buffer exchange to PBS (pH 7.2) was performed using HiTrap Desalting columns (1 mL, GE Healthcare).
[0243] The purified scFv A Fc protein was characterized by SDS-PAGE, Western blotting with anti- Fc-HRP conjugated antibodies (KPL, 4-10-2020), UV absorbance spectroscopy, and mass spectrometry to confirm purity, identity, and glycosylation status.
[0244] Construction of IgGi format of scFv A
[0245] The IgGi format of scFv A was constructed by cloning the antigen-binding fragments (Fv) of the scFv A Fc antibody into two separate expression vectors: one encoding the constant regions of the human IgGi heavy chain (pSF-CMV-HuIgGi-HC) and the other encoding the human kappa light chain constant regions (pSF-CMV-HuKappa LC). For heavy chain vector construction, the pSF-CMV-HuIgGi-HC plasmid was linearized by inverse PCR using primers A and B (Table 7). The heavy chain variable region of antibody A, including an N-terminal extracellular targeting signal peptide and a Hindlll restriction site, was amplified from the pLEVl 13 -scFv A Fc template using primers C and D (Table 7). The resulting insert and linearized plasmid were digested with Xhol and Hindlll restriction enzymes, followed by ligation to generate the full-length heavy chain expression plasmid: pSF- CMV-HuIgGi_A_HC.
[0246] For light chain vector assembly, the pSF-CMV-HuKappa LC plasmid was propagated in E. coli DHIOa cells and purified by standard plasmid isolation procedures. The vector was then digested with Hindlll and BseRI restriction enzymes. The light chain variable region of antibody A was amplified from pLEVl 13 -scFv_A-Fc through three sequential PCR reactions using primer pairs E / G, F / G, and C / G, which introduced an N-terminal signal peptide with a Hindlll site and a Btsl-v2 restriction site at the 3 ’ end. The amplified fragment was digested and ligated into the prepared pSF-CMV-HuKappa LC vector, resulting in the plasmid pSF- CMV-HuKappa_A LC.
[0247] All recombinant constructs were verified by DNA sequencing to confirm correct assembly.
[0248] Table 7: Oligonucleotide primers used for preparation of a IgGi antibody format
[0249] Constructs encoding IgGi A antibody was co-transfected into the CHO-S cells in the molar ratio of 3:2 (HC:LC) using 1.25 pg of total DNA per 1 x 106cells. Protein was expressed in CHO-S cells and purified from the culture supernatant using HiTrap Mab Select SuRe 5 ml (Cytiva, Merck) according to protocol developed and described for pLEVl 13-scFv_A-Fc.
[0250] Cell lines and culture conditions
[0251] Human cancer cell lines NCI-H520, DMS 114, NCI-H1581, NCI-H446, SK-BR-3, MCF-7, BT-474, T-47D, MCF-10A, U2OS, and SNU-16 were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Additional cell lines, including HCC15, COLO-699, and JIMT-1, were acquired from the Leibniz Institute DSMZ - German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany). The HCC95 cell line was provided by Dr. Minna and Dr. Gazdar (UT Southwestern Medical Center, Dallas, TX, USA). All cell lines were maintained according to the respective supplier’s recommended protocols and were used for experiments within six months of resuscitation. U2OS cells engineered for stable FGFR1 expression (U20S-R1), kindly provided by Dr. Ellen M. Haugsten (Norwegian Radium Hospital), were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% (v / v) fetal bovine serum, penicillin (100 U / mL), streptomycin (0.1 mg / mL), and geneticin (0.2 mg / mL, Thermo Fisher Scientific).
[0252] FGFR1 expression levels across all cell lines were assessed by Western blot analysis of wholecell lysates, using a specific anti-FGFRl antibody (dilution 1 :750, Cat. No. 9740, Cell Signaling Technology, Danvers, MA, USA). CHO-S cells used in expression studies were obtained from Thermo Fisher Scientific and cultured as described in previous sections.
[0253] Antibody labeling, internalization, and specificity analysis
[0254] Recombinant proteins including scFv A, scFv A Fc, and FGF2 were fluorescently labeled with DyLight 550 (Thermo Fisher Scientific) using the manufacturer’s standard protocol.
[0255] For internalization studies, cells were cultured on glass coverslips, with poly-D-lysine coating (Sigma-Aldrich) applied for NCLH1581 cells. Upon reaching approximately 70% confluence, cells were incubated at 37°C with DyLight 550-labeled scFv_A (20 pg / mL), scFv_A_Fc (20 pg / mL), or FGF2 (1 pg / mL) in the presence of heparin (50 U / mL). Incubation times were set to 15 minutes, 2 hours, or 24 hours, after which cells were washed with PBS, fixed in 4% formaldehyde (15 minutes, room temperature), permeabilized in 0.5% Triton X-100 (10 minutes, 4°C), and blocked with a solution containing 1% BSA, 10% normal goat serum, and 0.3 M glycine in PBST (1 hour, room temperature).
[0256] Subsequently, cells were incubated overnight at 4°C with primary antibodies specific for early endosome antigen 1 (EEA1, 241 IS, BD Biosciences) diluted in PBST supplemented with 10 mg / mL BSA. Secondary detection was performed at room temperature for 1 hour using Al exaFluor 488-conjugated goat anti-rabbit IgG (ab 150077, Abeam). Nuclear staining was conducted with DAPI (Thermo Fisher Scientific), and samples were mounted using ProLong Gold Antifade Mountant (Thermo Fisher Scientific).
[0257] Confocal microscopy was performed using a Cell Observer SD system (Zeiss) equipped with a Qlmaging Rolera EM-C2 EMCCD camera, using 40* or 63 x oil immersion objectives. Z-stack images were acquired with 0.24 pm spacing and 0.106 pm pixel resolution. Image preprocessing involved background subtraction (rolling ball radius of 50 pixels) using Fiji software (Schindelin et al., 2012). Colocalization analysis was performed by calculating Pearson’s correlation coefficients using Fiji software or Imaris 8.1 software (Bitplane, Zurich, Switzerland).
[0258] For assessing antibody specificity, U2OS cells were stained with CellTrace Violet (Thermo Fisher Scientific) following manufacturer instructions. Equal numbers of CellTrace-stained U2OS cells and unstained U2OS-R1 cells were co-cultured to 70% confluence, then incubated with 20 pg / mL of DyLight 550-labeled scFv_A_Fc for 15 minutes at 37°C. Cells were subsequently fixed, permeabilized, stained for EEA1, and analyzed by confocal microscopy under identical imaging conditions. DyLight 550 fluorescence intensities were quantified in Fiji software, with cell identity determined by the presence or absence of CellTrace Violet labeling. Regions of interest (ROIs) corresponding to individual cells were delineated based on signals from the EEA1 channel and confirmed by brightfield images to accurately define cell boundaries.
[0259] To assess the subcellular localization of scFv A Fc in living FGFR1 -expressing cells, live-cell fluorescence microscopy was performed using U2OS-R1 cells. Cells were seeded on glassbottom dishes and serum-starved for 4 hours prior to imaging. Subsequently, cells were incubated with DyLight 550-labeled scFv_A_Fc (15 pg / mL) for 2 hours at 37°C. Lysosomes were stained with LysoTracker Green (Thermo Fisher Scientific) according to the manufacturer’s instructions. Fluorescence imaging was performed immediately after staining. Colocalization of scFv_A-Fc (DyLight 550, red channel) with lysosomal compartments (LysoTracker Green, green channel) was analyzed using Fiji software. scfv A Fc-vcMMAE preparation scFv A Fc was conjugated to a cytotoxic drug, maleimidocaproyl-Val-Cit-PABC- monomethyl auristatin E (MedChem Express, Monmouth Junction, NJ, USA) - abbreviated vcMMAE. Essentially, vcMMAE was covalently coupled to thiol groups of reduced cysteines from the interchain disulfides of scFv A Fc antibody. Total disulfide bonds reduction within the Fc fragment was achieved by addition of TCEP pH 7.0 in ten times molar excess over the scFv A Fc protein. The reaction was conducted in PBS (50 mM NaCl, 18 mM NaH2PO4, 33 mM Na2HPC>4 pH 7.4) with 1 mM EDTA and sequentially incubated at increasing temperatures: 30 min at RT, 30 min at 30°C and 120 min at 37°C (3 hours it total). Reduced protein was filtered using 0,22 pm filter units to remove any potential protein precipitates. A four-fold molar excess of vcMMAE (38 mM in DMAc) per each available protein -SH group was added to a new tube and then resuspended in 70 pL of PBS, 1 mM EDTA per 1 pL of vcMMAE. The reduced scFv A Fc was subsequently added to the tube and conjugation reaction was carried out for 3 hours at 4 °C with mild rotation. The solution was than cleared by filtering through 0,22 pm filter units.
[0260] To purify scFv A Fc- vcMMAE, the conjugation mixture was ten times diluted in 10 mM MES, pH 6.2 and loaded on a HiTrap Carboxymethyl Sepharose Fast Flow FP (GE Healthcare) using AKTA™ purification system. The excess of vcMMAE was washed out with excess of 10 mM MES until MMAE absorbance at 255 nm was no longer observed. scFv_A_Fc-vcMMAE conjugate was eluted from the column using buffer containing 10 mM Sodium Citrate, 100 mM Arginine, 5% Glycerol, 494 mM NaCl, 6 mM KC1, 0,1% PEG 3350, pH 5.6. At this stage, the conjugate was stored at -80°C. Prior to use, conjugate was desalted into PBS pH 7.2 using HiTrap Desalting column (GE Healthcare).
[0261] IgGi_A_PEG4-vcMMAE preparation
[0262] IgGi A was conjugated to a cytotoxic drug (MMAE) via maleimide containing linker with a four-carbon polyethylene glycol spacer, cathepsin B-cleavable valine-alanine dipeptide, and self-immolating group (PABC): maleimidocaproyl-PEG4-Val-Cit-PABC-monomethyl auristatin E (MedChem Express, Monmouth Junction, NJ, USA) - abbreviated PEG4- vcMMAE. Essentially, PEG4-vcMMAE was covalently coupled to thiol groups of partially reduced cysteines from the interchain disulfides of IgGi A antibody. Partial disulfide bond reduction (around 4 out of 8 disulfide bonds) was achieved by addition of TCEP pH 7.0 in 2.75 times molar excess over the IgGi A protein. The reduction reaction was conducted in PBS (50 mM NaCl, 18 mM NaH2PO4, 33 mM Na2HPC>4 pH 7.4) with 1 mM EDTA at increasing temperatures: 30 min at RT, 30 min at 30°C and 120 min at 37°C (3 hours it total). Reduced protein was filtered using 0,22 pm filter units to remove any potential protein precipitates. A four-fold molar excess of PEG4-vcMMAE (38 mM in DMAc) over SH group of protein was added to a new tube and then resuspended in 70 pL of PBS, 1 mM EDTA per 1 pL of PEG4- vcMMAE. The reduced IgGi A was subsequently added to the tube and conjugation reaction was carried out for 3 hours at 15 °C. The solution was than cleared by filtering through 0,22 pm filter units.
[0263] To purify IgGi_A_PEG4-vcMMAE, the conjugation mixture was ten times diluted in 10 mM MES, pH 6.2 and loaded on a HiTrap Carboxymethyl Sepharose Fast Flow FP (Cytiva, Merck) using NGC BioRad purification system. The excess of PEG4-vcMMAE was washed out with 10 mM MES until MMAE absorbance at 248 nm was no longer observed. IgGi_A_PEG4- vcMMAE conjugate was eluted from the column using a buffer containing 10 mM sodium citrate, 100 mM Arginine, 5% Glycerol, 494 mM NaCl, 6 mM KC1, 0,1% PEG 3350, pH 5.6. At this stage, the conjugate was stored at -80°C. Prior to use conjugate was desalted into PBS pH 7.2 using HiTrap Desalting column (Cytiva, Merck).
[0264] LC-ESI-MS analysis of antibodies
[0265] The scFv A Fc-vcMMAE, scFv A Fc, or reduced IgGi_A_PEG4-vcMMAE and IgGi A preparations, each at a concentration of 1 mg / mL (1 pL), were separated using liquid chromatography (LC) and analyzed by high-resolution mass spectrometer using electrospray ionization (ESI-MS)
[0266] Cytotoxicity assessment of Antibody-Drug Conjugates
[0267] The cytotoxic effects of the generated antibody-drug conjugates (ADCs) were evaluated on a panel of FGFR1 -positive human cell lines, including U2OS-R1, NCI-H520, NCI-H1581, DMS114, NCI-H446, COLO-699, SK-BR-3, JIMT-1, BT-474, and T-47D. Additionally, cell lines exhibiting low FGFR1 expression, namely HCC15, HCC95 and U2OS, were included as controls.
[0268] Cells were seeded in 96-well plates at a density of 2000 cells / well for U2OS and 5000 cells / well for all other lines. After a 24-hour incubation at 37°C in a humidified atmosphere containing 5% CO2, cells were treated with serial dilutions of the following test compounds: scFv_A-Fc, scFv A Fc-vcMMAE, scFv_A-Fc-PEG4-vcMMAE, scFv_A-Fc-tvAY, scFv_A_Fc-SMCC- DM1, IgGi_A-PEG4-vcMMAE, free MMAE, and vcMMAE.
[0269] Following compound addition, cells were incubated for an additional 96 hours under standard culture conditions. Cell viability was determined using alamarBlue® reagent (Thermo Fisher Scientific), following the manufacturer's protocol. All sample dilutions were tested in triplicate, and each cytotoxicity assay was independently repeated three times.
[0270] Animals for in vivo studies
[0271] The maximum tolerated dose (MTD) and pharmacokinetic profile of the scFv A Fc-vcMMAE antibody-drug conjugate were evaluated in non-tumor-bearing female Balb / c mice. Antitumor efficacy and toxicity studies were conducted in CB17SCID female mice xenografted with human lung cancer models. Animals were provided by Animalab Sp. z 0.0. and sourced from Charles River Laboratories, Wilmington, MA. Animal experiments were performed at the Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, in compliance with national regulations and the European Directive 2010 / 63 / EU on the protection of animals used for scientific purposes (L 276 / 33), as approved by the Polish National Ethical Committee for Animal Experiments (KKE). The animals were housed in air-conditioned rooms (temperature 22 ± 20C) equipped with a filter system with humidity (55% ± 10%) and adjustable lighting day / night 12 / 12 in individually ventilated cages with a floor area of 501 cm2, 185 mm high in the number of max. 5 mice / cage with constant access to water and standard rodent feed. To enrich the animal environment, cages were provided with the nest materials, wooden or paper rolls, metal climbing harnesses (adapted for mice, hung on the mesh of the cage top cover) and plastic booths or tunnels. Individual elements of enrichment of the environment was exchanged / diversified. . scFv A Fc-vcMMAE Maximum Tolerated Dose (MTD) study
[0272] In vivo tolerability of scFv_A_Fc-vcMMAE was studied in Balb / c mice. Mice were randomly grouped according to their body weight. Three animals per group were administrated with one dose of scFv_A_Fc-vcMMAE or scFv_A_Fc (10 mg / kg or 20 mg / kg) or four doses of scFv_A_Fc-vcMMAE or scFv_A_Fc (15 mg / kg) applied every 4 days (q4dx4) by injection through a tail vein. Mice were weighed and observed daily until the end of experiment.
[0273] Pharmacokinetic analysis of scFv A Fc-vcMMAE in mouse plasma
[0274] Balb / c mice were randomly grouped according to their body weight (3 mice in each group) and administered a single dose of 15 mg / kg scFv_A_Fc-vcMMAE (based on the antibody component) via the tail vein. Three control mice received no ADC treated. Mice were anesthetized, bled, sacrificed, and organs were dissected at the following time points: 1 hour, 4 hours, 1 day, 2 days, 4 days, 7 days, 14 days, 21 days, 28 days, 35 days, 42 days, and 49 days after ADC administration (total 39 animals).
[0275] For the assessment of pharmacokinetic parameters of scFv A Fc-vcMMAE, blood samples were collected from animals into K2EDTA tubes and centrifuged at 2200 x g for 15 minutes to isolate plasma. Plasma samples were stored at -80 °C in collection tubes until analysis for ADC and free drug concentrations. Plasma concentrations of total scFv A Fc-vcMMAE was measured by ELISA kit according to manufacturer instructions (EDI™ Intact MMAE ADC ELISA Kit, KTR-782, Epitope Diagnostics, Inc.), whereas free MMAE was measured by ESI- LC-MS technique. Pharmacokinetic (PK) parameters were derived using the standard algorithms for noncompartmental pharmacokinetic analysis.
[0276] In vivo efficacy of scFv A Fc-vcMMAE in mouse xenograft models
[0277] To obtain localized, subcutaneous models of human lung cancer, human lung cancer cells NCI- 141581 and NCI-H520 were implanted into the right flanks of SCID CB-17 / Icr- Prkdcscld / IcrIcoCr mice. The cells were resuspended in a mixture of PBS and Matrigel (BD Matrigel Cat #: 354248) in a volume of 100 pL / mouse in a 3: 1 ratio, then 5 x 106cells were subcutaneously implanted in each mice. On the day of cell inoculation the mean body weight of all mice was ~ 22 g. Mice were randomized with respect to the size of the tumors on day 10 (NCI-H1581) or day 7 (NCI-H520) of the experiment when the mean size of the tumors reached ~ 70-80 mm3. Mice were divided into groups of 9. Treatment started at day of randomization and consisted of intravenous injections of scFv_A_Fc-vcMMAE (15 mg / kg or 10 mg / kg), scFv_A_Fc (15 mg / kg or 10 mg / kg) or MMAE (0,38 mg / kg or 0,25 mg / kg) once or every eight day for 3 (q8d x 3) or 4 injections (q8dx4). Test preparations were formulated in PBS and administered at a volume of 10 pL per gram of mouse body weight. The animals were monitored daily. The body weight of the animals and tumor volume were measured three times a week, until the end of the study. Tumor volume was determined using the formula TW = (L x W2) / 2, where T was transverse dimension and L longitudinal dimension of the tumor. The procedure was carry on until average tumor volume in the group reaches approximately 1000- 1500 mm3and did not adversely affect the condition of the animals.
[0278] Blood Collection:
[0279] Prior to euthanasia, blood samples were collected from the experimental animals. For this purpose, the eyeball from the venous sinus of the eye was carefully removed approximately 15 minutes after the administration of buprenorphine, while the animals were under the influence of isoflurane anesthesia. Additionally, on the day of euthanasia for the control groups, mice in the test groups (receiving scFv A Fc-vcMMAE) underwent an additional blood collection procedure, involving the extraction of 50 pL of blood from the zygomatic vein. The collected blood samples were subjected to comprehensive analysis, including blood morphology and biochemical parameter assessment, and any remaining plasma was stored for further investigations.
[0280] Euthanasia and Tissue Collection:
[0281] Following the blood collection procedures, the mice were humanely euthanized by dislocation of the cervical vertebrae. Subsequently, internal organs and tumors were carefully examined for macroscopic changes. Tissues of interest were collected and immediately placed in 10% Neutral Buffered Formalin (Sigma HT501128) with a pH range of 6.9-7.1.
[0282] Histopathological Analysis:
[0283] The collected organs and tumor tissues were transferred into paraffin blocks and prepared for histopathological analysis. This analysis was conducted in collaboration with Prof. Piotr Z. Dzi^giel, PhD, from the Wroclaw Medical University (Uniwersytet Medyczny im. Piastow Slqskich we Wroclawiu). The prepared tissue sections were subsequently evaluated by independent pathologists who were blinded to the experimental data. Their assessments focused on determining the histological grade and the presence of necrosis in the tissue samples. This methodology ensured rigorous and comprehensive evaluation of the experimental outcomes, with expert pathologists providing objective assessments of the histopathological characteristics of the collected tissues.
[0284] Example 1: Drug-to-Antibody ratio of scfv A Fc-vcMMAE is well-defined
[0285] The number of cytotoxic compound molecules per one molecule of the antibody (DAR) in the purified scFv A Fc- vcMMAE was determined using two research methods: spectroscopy and mass spectrometry. The UV spectra of MMAE, scFv_A_Fc-vcMMAE and scFv_A_Fc (Figure 3c) enabled the calculation of the molar ratio of MMAE to the antibody in scFv A Fc- vcMMAE preparation, based on the formula adapted from Hamblett et al. (2004). Analysis revealed the DAR 4.09, indicating that all four cysteines available in the scFv A Fc protein undergo the reduction and conjugation.
[0286] Precise determination of the DAR parameter for the scFv A Fc-vcMMAE was prepared using high-resolution mass spectrometry with an ESI ion source combined with liquid chromatography (LC-ESI-MS). Figure 3d and e shows mass spectra of the scFv A Fc and scFv A Fc-vcMMAE subjected to deconvolution. The spectra obtained for the scFv A Fc protein showed two major peaks with a molecular weight of 52678 Da (monomer) and 105355 Da (dimer) (Figure 3d). Analysis of scFv A Fc-vcMMAE conjugate, revealed one major signal from the monomer with the mass of 55397 Da and lower signal of 110471 Da recognized as a dimer (Figure 3e). The observed increase in the molecular weight of the scFv A Fc-vcMMAE monomer compared to the unmodified scFv A Fc protein was 2719 Da, which corresponds to 2.07 of the vcMMAE molecule per one scFv_A_Fc monomer molecule (vcMMAE mass 1316 Da). Analogical mass analysis for the dimeric form, have shown a conjugate mass increase of 5116 Da, which corresponds to about 3.89 vcMMAE molecules per scFv A Fc dimer molecule. The presented data have shown that the DAR parameter value for scFv A Fc- vcMMAE is 4, and the conjugation reaction of vcMMAE to scFv_A_Fc occurs with almost 100% efficiency.
[0287] An increase in the intensity of the signal corresponding to the monomeric form and a decrease in the size of the dimeric form peak in the mass spectrum of scFv A Fc-vcMMAE (Figure 3d and e), as well as SDS PAGE analysis of conjugate under non-reducing conditions (Figure 3b) further suggests the effective reduction of disulfide bridges and efficient attachment of cytotoxic compound molecules to all available -SH groups within scFv A Fc carrier antibody fragment.
[0288] Example 2: scfv A Fc-vcMMAE is present as a dimer in solution
[0289] To evaluate whether scFv A Fc-vcMMAE remain dimer in a solution, the molecule was subjected to particle size analysis using the Dynamic Light Scattering, DLS method. The obtained result showed that the scFv A Fc-vcMMAE preparation, like the unmodified scFv A Fc protein, is present in the solution only in one form (Figure 3f and g). The radius of the scFv A Fc-vcMMAE molecule was 5.1 nm, which corresponds to a molecule of approximately 151 kDa. The above result suggests that the conjugate is a dimer with a mass of approximately 41 kDa greater than expected (Figure 3g). For comparison, the radius of the scFv A Fc molecule was 4.4 nm, which corresponds to a molecule with a mass of about 106 kDa (Figure 3f) and is close to the value determined by mass spectrometry. We assumed that the increase in the hydrodynamic radius of the scFv A Fc-vcMMAE molecule is related to the hydrophobicity of MMAE, which increases the hydration shell of the entire conjugate.
[0290] Example 3: FGFR1 is expressed in multiple lung cancer and breast cancer cell lines
[0291] FGFR1 expression levels were evaluated by Western blot analysis across a panel of cell lines. The analysis confirmed varying levels of FGFR1 expression, indicating that both lung and breast cancer cell lines could serve as suitable models for assessing the cytotoxic activity of scFv_A_Fc-vcMMAE and IgGi_A-vcMMAE (Figure 4).
[0292] Example 4: scFv A Fc-vcMMAE is selectively internalized into FGFRl-expressing cells via the endocytic pathway
[0293] The internalization of the scFv A Fc-vcMMAE antibody-drug conjugate was evaluated using confocal microscopy in co-cultures of FGFR1 -positive (U2OS-R1) and FGFR1 -negative (U2OS) cells. Prior to seeding, U2OS cells were labeled with CellTrace Violet to enable distinction between FGFR1 -negative and FGFR1 -positive populations within the same imaging field. Cells were incubated with DyLight 550-labeled scFv_A_Fc-vcMMAE (scFv A Fc- vcMMAE-DL), and ADC uptake was visualized by confocal microscopy. Fluorescence signal corresponding to the conjugate was detected exclusively in U20S-R1 cells, with no detectable internalization in U2OS cells, indicating FGFR1 -dependent uptake (Figure 5).
[0294] To assess intracellular trafficking, colocalization with early endosomes was examined. Cells were immunostained for early endosome antigen 1 (EEA1), followed by confocal imaging. Colocalization analysis between scFv_A_Fc-vcMMAE-DL and EEA1 yielded a Pearson’s correlation coefficient (PCC) of 0.53, consistent with early endosomal localization (Figure 5). In a separate live-cell fluorescence microscopy experiment, U2OS-R1 cells were incubated with DyLight 550-labeled scFv A Fc (scFv_A_Fc-DL) for 2 hours, followed by staining with LysoTracker Green to visualize lysosomes. Fluorescence imaging demonstrated colocalization of scFv_A_Fc-DL with lysosomal compartments, with a PCC value of 0.60 (Figure 5).
[0295] Furthermore, the internalization efficiency of scFv A Fc was assessed across a panel of FGFR1 -expressing lung cancer cell lines. High and selective uptake was observed, ensuring effective intracellular delivery of the therapeutic payload, (data not shown).
[0296] These findings indicate that scFv_A_Fc-based ADCs undergo FGFR1 -mediated internalization and are trafficked through endocytic pathways to lysosomal compartments, facilitating intracellular drug delivery
[0297] Example 5: High in vitro efficiency of scFv A Fc-vcMMAE in lung cancer model
[0298] To evaluate in vitro cytotoxicity, lung tumor cell lines NCI-H520, NCI-H1581, NCI-H446, DMS114, COLO699 (high level of FGFR1 expression), HCC15 (low level of FGFR1 expression) and HCC95 (low level of FGFR1 expression) were incubated with increasing concentrations of vcMMAE, unconjugated antibody scFv A Fc and conjugate scFv A Fc- vcMMAE. Cell viability was measured after 96 hours. Exposure to vcMMAE mediated nonantigen dependent killing of cell lines, whereas unconjugated antibody scFv A Fc does not interfere with cell viability (Figure 6). scFv A Fc-vcMMAE caused potent and specific killing of NCI-H520, NCI-H1581, NCI-H446, DMS114, COLO699 cells in an antigen- and concentration-dependent manner, with ECso value (median effective concentration) of 33 nM, 33 nM, 14 nM, 50 nM, 111 nM, respectively. Conclusively, this data emphasizes that scFv A Fc-vcMMAE is internalized and induces cytotoxicity in an antigen-dependent manner and that sufficient endogenous FGFR1 is present in lung cancer cells to mediate effective cell killing by the ADC molecule. Example 6: High in vitro efficiency of scFv A Fc-vcMMAE in breast cancer model
[0299] To assess in vitro cytotoxicity, breast cancer cell lines SK-BR-3 (mammary gland / breast; derived from metastatic site, adenocarcinoma, FGFR1 -positive), BT-474 (breast / duct / mammary gland; derived from solid, invasive ductal carcinoma of the breast, FGFR1 -positive), JIMT-1 (ductal breast cancer, grade 3 invasive, FGFR1 -positive), T-47D (mammary gland; derived from metastatic site, ductal carcinoma, FGFR1 -positive) and MCF7 (mammary gland / breast; derived from metastatic site of adenocarcinoma) were incubated with increasing concentrations of vcMMAE, unconjugated antibody scFv A Fc and conjugate scFv_A_Fc-vcMMAE. Cell viability was measured after 96 hours. Exposure to vcMMAE mediated non-antigen dependent killing of cells, whereas unconjugated antibody scFv A Fc does not interfere with cell viability (Figure 7). scFv A Fc-vcMMAE caused potent and specific killing of cancer cells SK-BR-3, BT-474, JIMT-1, T-47D and MCF7 cells with ECso value (median effective concentration) of 5 nM, 13 nM, 15 nM, 54 nM and 63 nM respectively. Interestingly, the observed cytotoxicity of the conjugate was not directly correlated with the level of the receptor on the cell surface (Figure 4). Our initial research suggest that it is not the amount of the receptor, but the level of internalization of the receptor-conjugate complexes into cancer cells and MMAE sensitivity, that may determine the effectiveness of antibody-drug conjugates targeting FGF receptors. Conclusively, this data emphasizes that scFv A Fc- vcMMAE is internalized and induces cytotoxicity in an antigen-dependent manner and that sufficient endogenous FGFR1 is present and active in breast cancer cells to mediate effective cell killing by the ADC molecule.
[0300] Example 7: In vivo tolerability of scFv A Fc-vcMMAE
[0301] The preclinical in vivo tolerability of scFv A Fc- vcMMAE was further characterized in studies in mice. Separate cohorts of Balb / c mice (3 animals per group) were treated with one dose of scFv_A_Fc-vcMMAE or scFv_A_Fc (10 mg / kg or 20 mg / kg) and four doses of scFv A Fc- vcMMAE or scFv_A_Fc (15 mg / kg) administrated every 4 days (q4dx4). The species used in the experiment was selected as a relevant toxicology model, based on the observed crossreactivity of scFv A Fc- vcMMAE to murine FGFR1, with an affinity constant (KD) of 2.86 nM, as determined by SPR analysis (Figure 8). No signs of toxicity were observed for the carrier antibody scFv_A_Fc at the tested dose levels. No signs of toxicity were observed following administration of the carrier antibody scFv A Fc at the tested dose levels. Administration of scFv_A_Fc-vcMMAE at a single dose of 10 mg / kg did not result in observable toxic effects in mice, whereas a single dose of 20 mg / kg induced mild toxicity, characterized by a 7% decrease in body weight observed on day 5 and transient changes in appearance, including ruffled fur, persisting for approximately two weeks postdosing (Figure 9). In the group receiving four doses of scFv_A_Fc-vcMMAE at 15 mg / kg every four days, a body weight decrease of approximately 8% was observed, maintained between days 10 and 16, accompanied by temporary changes in appearance and behavior, including ruffled fur, partial or complete eye closure, and signs of dullness noted after the fourth administration. The observed toxic effects of scFv A Fc-vcMMAE increased with successive administrations; however, after day 18, animals resumed weight gain and showed improvement in appearance (Figure 9). Importantly, no anorectic effects were observed in animals treated with either scFv_A_Fc-vcMMAE or unconjugated scFv_A_Fc.
[0302] Example 8: High in vivo efficiency of scFv A Fc-vcMMAE in lung cancer models
[0303] To investigate the in vivo efficacy of scFv_A_Fc-vcMMAE, severe combined immunodeficiency mice (CB17SCID) were implanted with human NSCLC NCI-H1581 (classified as Large Cell Lung Carcinoma) tumor cells and randomized into groups of nine with average tumor volume in the group of 70-80 mm3. The maximum tumor volume did not exceed 190 mm3. Each group was treated intravenously with one or three doses every 8 days (q8d x3) of scFv_A_Fc-vcMMAE or scFv_A_Fc, 15 mg / kg or lOmg / kg, respectively (Figure 9a, b). Separate cohorts of animals were treated with vehicle (PBS) or the free MMAE drug, dosed at 0.38 mg / kg (equivalent to free drug load on scFv_A_Fc-vcMMAE, 15 mg / kg) or 0.25 mg / kg on q8d><3 regimen (equivalent to free drug load on scFv_A_Fc-vcMMAE, 10 mg / kg) (Figure 9a, b). Treatment of tumor-bearing mice with scFv A Fc-vcMMAE resulted in complete tumor regression at both dosing schedules, with no tumor recurrence observed up to day 35 following a single dose or day 42 following triple dosing (Figure 10a, b, e). In the single-dose group, one mouse (11%) and in the triple-dose group, two mice (22%) exhibited complete and durable responses with no tumor recurrence until the end of the study. In contrast, mice treated with unconjugated scFv A Fc showed no measurable inhibition of tumor growth, while treatment with free MMAE resulted in limited tumor growth inhibition compared to the vehicle control group (PBS). All mice treated with scFv A Fc-vcMMAE maintained body weight gain and exhibited no observable signs of lethargy throughout the observation period. These findings demonstrate that treatment of FGFR1 -positive NSCLC-bearing mice with scFv A Fc- vcMMAE induced effective and durable antitumor responses, showing superior efficacy compared to unconjugated MMAE (Figure 10a, b).
[0304] As an independent validation, an additional in vivo model was employed to evaluate the antitumor efficacy of scFv A Fc-vcMMAE in lung cancer. Severe combined immunodeficiency mice (CB17SCID) were implanted with human NSCLC NCI-H520 (classified as Squamous Lung Cancer) tumor cells and randomized into groups of nine with average tumor volume in the group of 70-80 mm3. The maximum tumor volume did not exceed 140 mm3. Each group was treated intravenously with one or four doses every 8 days (q8d*4) of scFv_A_Fc-vcMMAE or scFv_A_Fc, 15 mg / kg or lOmg / kg, respectively (Figure 10c, d). Separate cohorts of animals were treated with vehicle (PBS) or the free MMAE drug, dosed at 0.38 mg / kg (equivalent to free drug load on scFv_A_Fc-vcMMAE, 10 mg / kg) or 0.25 mg / kg on q8d*4 regimen (equivalent to free drug load on scFv_A_Fc-vcMMAE, 15 mg / kg) (Figure 10c, d). In this model, treatment of tumor-bearing mice with scFv A Fc-vcMMAE resulted in near-complete tumor regression, with approximately 99% reduction in tumor volume compared to the control group, observed in both dosing schedules. No tumor relapse was detected up to day 35 following a single dose or day 63 following multiple doses (Figure 10c, d, e). In the multiple-dose group, tumor relapse occurred in three mice (33%), with two relapses observed at day 63 and one at day 142, while six mice (66%) remained disease-free until the end of the observation period (five mice observed until day 142, one animal died at day 122 due to unrelated causes). One mouse (11%) receiving multiple doses of scFv A Fc-vcMMAE exhibited a complete and durable response, whereas in five mice (55%) a residual palpable tumor capsule was detected at the end of the study, which was subjected to histopathological evaluation. Mice treated with unconjugated scFv A Fc showed no measurable tumor growth inhibition, while treatment with free MMAE resulted in only limited tumor growth inhibition relative to the vehicle control group (PBS). Consistent with prior observations, all mice treated with scFv_A_Fc-vcMMAE maintained body weight gain and showed no signs of lethargy. These results demonstrate that treatment of FGFR1 -positive SCLC-bearing mice with scFv A Fc-vcMMAE induced durable antitumor responses, showing superior efficacy compared to free MMAE (Figure 10c, d). Example 9: In vivo therapy with scFv A Fc-vcMMAE cause mild changes in platelet counts
[0305] To further evaluate the in vivo effects of scFv A Fc-vcMMAE, blood morphology parameters were assessed in mice bearing human lung cancer xenografts at day 20 or 18 following administration of scFv A Fc-vcMMAE (Figures 11 and 12, respectively). Tumors derived from NCI-H1581 and NCI-H520 cell lines induced a slight decrease in red blood cell counts, hematocrit, hemoglobin concentration, and mean corpuscular volume (MCV). Mean corpuscular hemoglobin (MCH) and mean corpuscular hemoglobin concentration (MCHC) were increased, while white blood cell (WBC), lymphocyte (LYMPH), and monocyte (MONO) counts, as well as red cell distribution width (RDW), were not affected by tumor presence.
[0306] Administration of scFv A Fc-vcMMAE did not cause significant alterations in blood morphology compared to the control group treated with vehicle (PBS), with some exceptions (Figures 11 and 12). Treatment with scFv A Fc-vcMMAE reversed the tumor-induced decrease in hemoglobin concentration in both models, restoring hemoglobin levels to within the normal range. Additionally, NCI-H1581 tumors were associated with reduced platelet counts, whereas NCI-H520 tumors caused an increase in platelet concentration in control animals. Regardless of tumor origin, scFv A Fc-vcMMAE treatment resulted in a modest decrease in platelet counts (PLT) and an increase in mean platelet volume (MPV) (Figures 11 and 12).
[0307] Taken together, these findings indicate that administration of scFv A Fc-vcMMAE at the tested dose did not induce severe hematological toxicity, with only moderate changes observed in platelet parameters (thrombocytopenia). Thrombocytopenia is a known and generally manageable adverse effect observed with several approved ADCs, such as Kadcyla (EMA, Kadcyla: https: / / www.ema.europa.eu / en / documents / product-information / kadcyla-epar- product-information_en.pdf) and Adcetris (EMA, Adcetris: https: / / www.ema.europa.eu / en / documents / product-information / adcetris-epar-product- information_en.pdf).
[0308] Example 10: FGFR1 expression profile suggest favorable therapeutic window Given the high expression levels and efficient internalization of FGFR1 in numerous solid tumors, FGFR1 represents a promising target for the development of antibody-drug conjugates (ADCs). However, since FGFR1 can also be expressed in certain normal tissues, there is a potential risk of on-target toxicity. To evaluate the safety profile of FGFR1 as a therapeutic target and to predict its expression across human tissues, we utilized the Human Proteome Map database (Kim et al., (2014), which is based on large-scale LC-MS / MS proteomic analysis.
[0309] FGFR1 expression data were analyzed and compared with expression profiles of other proteins that serve as molecular targets for ADCs currently approved or in clinical development (Figure 13). The analysis revealed no detectable FGFR1 expression in critical organs such as the heart, liver, lung, kidney, spinal cord, colon, rectum, and esophagus. Low FGFR1 expression was observed in tissues including the prostate, testes, bladder, and retina, while moderate expression was found in the pancreas. High expression levels were limited to the ovary. In comparison to other established ADC targets, FGFR1 exhibited overall lower expression in normal tissues.
[0310] These findings suggest that ADCs targeting FGFR1 are expected to exhibit a safety profile comparable to, or potentially more favorable than, currently marketed or investigational ADC therapies. Published studies further support the relevance of FGFR1 as a therapeutic target, demonstrating its frequent overexpression in various malignancies. Additionally, our experimental data indicate that not only FGFR1 abundance but also its elevated activity in cancer cells contributes to enhanced internalization of FGFR1 -targeted ADCs, thereby increasing their tumor-specific efficacy. Collectively, these results support a favorable therapeutic window for ADCs directed against FGFR1.
[0311] Example 11: Pharmacokinetics of scfv A Fc-vcMMAE: a promising approach for solid tumor treatment
[0312] The pharmacokinetic profile of scFv A Fc-vcMMAE was evaluated in Balb / c mice. Animals received a single intravenous administration of 15 mg / kg scFv_A_Fc-vcMMAE via tail vein injection, calculated based on the antibody component. Blood samples were collected at multiple time points ranging from 1 hour to 49 days post-dose. Pharmacokinetic parameters were determined by non-compartmental analysis, as shown in Figure 14. The time- concentration curves of scFv A Fc-vcMMAE and free drug MMAE appeared to follow biexponential declines.
[0313] Following administration, plasma concentrations of free MMAE were consistently low, with initial levels of approximately 10 ng / mL, declining to undetectable levels by day 14. Throughout the study period, free MMAE levels remained below 0.01% of the total ADC concentration, confirming high in vivo stability of the conjugate and effective retention of the cytotoxic payload. These results demonstrate the favorable pharmacokinetic properties of scFv_A_Fc-vcMMAE, with minimal systemic exposure to free MMAE, thereby reducing the potential risk of off-target toxicity.
[0314] The pharmacokinetic profile of scFv A Fc-vcMMAE exhibits favorable characteristics, supporting its potential for further development. The area under the curve (AUC) was determined to be 363 pg day / mL, indicating sustained systemic exposure. The volume of distribution (Vd) was calculated as 97.8 mL / kg, suggesting distribution beyond the blood compartment (Hamblett et al., 2004). The conjugate exhibited a terminal half-life (t’A) of 1.478 days and a clearance rate (CL) of 41.3 mL / day / kg, reflecting efficient elimination from circulation and a pharmacokinetic profile consistent with reduced risk of systemic accumulation.
[0315] The scFv A Fc-vcMMAE utilizes an scFv-Fc antibody format, combining the antigen-binding domain of a single-chain variable fragment (scFv) with the Fc region of human IgGi. This design retains high-affinity target binding and low dissociation rate, while preserving Fc- mediated functions such as neonatal Fc receptor (FcRn)-dependent recycling and potential effector functions. The reduced molecular size of the scFv-Fc format (-106 kDa) combined with the observed pharmacokinetic properties, including the optimal Vd, may contribute to improved tumor tissue penetration and enhanced intratumoral drug accumulation. Similar scFv- Fc-based ADCs, such as ASN004, have demonstrated favorable pharmacokinetic profiles in preclinical models and are currently under clinical evaluation.
[0316] In summary, the pharmacokinetic evaluation of scFv A Fc-vcMMAE in Balb / c mice demonstrates systemic exposure, distribution, and elimination characteristics supporting its potential application in solid tumor therapy. The scFv-Fc format may offer advantages including improved tumor penetration, limited off-target exposure, and preserved Fc-mediated biological functions, potentially contributing to an expanded therapeutic window.
[0317] Example 12: scFv A Fc can serve as an efficient carrier of other drugs
[0318] To assess the in vitro cytotoxicity of scFv A Fc when coupled with various cytotoxic molecules, scFv A Fc was conjugated with mertansine DM1 using the SMCC (succinimidyl trans-4-(maleimidylmethyl)cyclohexane-l -carboxylate) linker through surface amines, as well as with two other auristatin-based payloads: maleimidocaproyl-valine-citrulline monomethyl auristatin E (vcMMAE) with an additional four molecules of PEG (PEG4-vcMMAE) and maleimidocaproyl-threonine-valine-auristatin Y (tvAY) (Krzyscik et al, 2020). FGFR1- positive cells including SK-BR-3, NCI-H1581, NCI-H520 or U2OS-R1 cells, and FGFR1- negative cells such as HCC15 or U2OS, were incubated with escalating concentrations of free drugs (vcMMAE, tv AY, or PEG4-vcMMAE), the unconjugated antibody scFv_A_Fc, and the conjugates (scFv_A_Fc-SMCC-DMl, scFv A Fc- vcMMAE, scFv_A_Fc-tvAY, or scFv_A_Fc-PEG4-vcMMAE). Cell viability was assessed 96 hours later. Exposure to free drugs resulted in non-antigen-dependent equivalent cell killing with scFv A Fc having no impact on cell viability (Figure 15). Importantly, all conjugates exhibited potent and specific cytotoxicity against FGFR1 -positive cell lines: U2OS-R1 or lung cancer cells (NCI-H1581, NCI-H520), or breast cancer cells (SK-BR-3), in an antigen- and concentration-dependent manner (Figures 15 and 16). These results support the use of scFv A Fc as a carrier for vcMMAE and its applicability for conjugation with other cytotoxic payloads.
[0319] Example 13: Antibody A formatted to IgGi is effective in drug delivery to cancer cells.
[0320] To further evaluate the drug delivery capabilities of scFv A in a full-length antibody format, the molecule was reformatted as an IgGi and subsequently conjugated to a cytotoxic payload, (Figure 17). IgGi A was produced by transient co-transfection of two plasmids encoding heavy and light chain into CHO-S cells, followed by purification using affinity chromatography and subsequent desalting. SDS-PAGE analysis of the IgGi A preparation under reducing conditions showed two distinct protein bands corresponding to the heavy and light chains, with a purity exceeding 99% (Figure 17c). Binding studies confirmed that IgGi A retained its biological activity, demonstrating high affinity for FGFR1 with a dissociation constant (KD) of 1.3 nM (Figure 17d). IgGi A was subsequently conjugated to PEG4-vcMMAE via maleimide chemistry (Figure 17e), following partial reduction of the antibody’s interchain disulfide bonds, resulting in an average drug-to-antibody ratio of four. The resulted conjugate was purified using Ion Exchange Chromatography. Obtained IgGi_A_PEG4-vcMMAE conjugate showed presence of differently substituted light and heavy chain forms with characteristic mass shifts due to drug molecules attached to each antibody chain (Figure 17c). Drug to antibody ratio and the quality of IgGi_A_PEG4-vcMMAE preparation was assessed using reversed phase LC-ESI-MS (Figure 17a, b). Each peak of the reduced ADC (Total Ion Chromatogram presented in Figure 17a) was identified by mass spectrometry (Figure 17b) and used for calculation of the weighted average DAR according to the formula DAR 2 X (S weighted peak area of heavy chain weighted peak area of light chain) / 100. The weighted average of DAR for IgGi_A_PEG4-vcMMAE was calculated to be 4.06 (table in Figure 17a).
[0321] To evaluate the in vitro cytotoxic activity of IgGi_A_PEG4-vcMMAE, the breast cancer cell lines SK-BR-3 and JIMT-1 were incubated with increasing concentrations of the ADC. Cell viability was assessed after 96 hours of treatment. IgGi_A_PEG4-vcMMAE exhibited potent cytotoxicity, with EC so values of 10.6 nM for SK-BR-3 and 12 nM for JIMT-1 cells (Figure 18). These values were comparable to those obtained for the scFv A Fc-vcMMAE ADC, which demonstrated ECso values of 5 nM and 15 nM for SK-BR-3 and JIMT-1, respectively. These results indicate that reformatting scFv A Fc into the full-length IgGi A did not impair FGFR1 binding or cytotoxic function, and that both antibody formats are suitable carriers for ADC-based targeting of FGFR1 -positive cancer cells.
[0322] References
[0323] • Kohler, G. & Milstein, C. (1975): Continuous cultures of fused cells secreting antibody of predefined specificity. In: Nature. Bd. 256, S. 495-497.
[0324] • Jonsson and Malmquist, Advances in Biosensors, 2:291-336 (1992)
[0325] • Wu et al. Proc. Natl. Acad. Sci. USA, 95:6037-6042 (1998)
[0326] • Banik, SSR; Doranz, BJ (2010). "Mapping complex antibody epitopes". Genetic Engineering & Biotechnology News. 3 (2): 25-8
[0327] • DeLisser, HM (1999). Epitope mapping. Methods Mol Biol. 96. pp. 11-20
[0328] • Finco et al, Comparison of competitive ligand-binding assay and bioassay formats for the measurement of neutralizing antibodies to protein therapeutics. J Pharm Biomed Anal. 2011 Jan 25;54(2):351-8.
[0329] • Deng et al., Enhancing antibody patent protection using epitope mapping information MAbs. 2018 Feb-Mar; 10(2): 204-209
[0330] • Huston et al., Cell Biophysics, 22: 189-224 (1993);
[0331] • Pliickthun and Skerra, Meth. Enzymol., 178:497-515 (1989) and in Day, E. D., Advanced Immunochemistry, Second Ed., Wiley-Liss, Inc., New York, N.Y. (1990)
[0332] • Harding, The immunogenicity of humanized and fully human antibodies. MAbs. 2010 May-Jun; 2(3): 256-265.
[0333] • Eylenstein, et al, Molecular basis of in vitro affinity maturation and functional evolution of a neutralizing anti-human GM-CSF antibody, mAbs, 8: 1, 176-186 (2016)
[0334] • Kabat et al., J. Biol. Chem. 252, 6609-6616 (1977)
[0335] • Chothia et al., J. Mol. Biol. 196:901-917 (1987)
[0336] • MacCallum et al., J. Mol. Biol. 262:732-745 (1996)
[0337] • Damelin M, Zhong W, Myers J, Sapra P. Evolving Strategies for Target Selection for Antibody-Drug Conjugates. Pharm Res. 2015; 32(11): 3494-507
[0338] • Kim et al., A draft map of the human proteome, Nature, 2014, 509:575-581
[0339] • Villa A, Trachsel E, Kaspar M, Schliemann C, Sommavilla R, Rybak JN, et al. A high- affinity human monoclonal antibody specific to the alternatively spliced EDA domain of fibronectin efficiently targets tumor neo-vasculature in vivo. Int J Cancer. 2008 Jun l;122(l l):2405-13. Haugsten EM, Malecki J, Bjorklund SM, Olsnes S, Wesche J. Ubiquitination of fibroblast growth factor receptor 1 is required for its intracellular sorting but not for its endocytosis. Mol Biol Cell. 2008 Aug;19(8):3390-403.
[0340] • Hamblett KJ, Senter PD, Chace DF, Sun MM, Lenox J, Cerveny CG, Kissler KM, Bernhardt SX, Kopcha AK, Zabinski RF, Meyer DL, Francisco JA. Effects of drug loading on the antitumor activity of a monoclonal antibody drug conjugate. Clin Cancer Res. 2004; 10(20): 7063-70.
[0341] • Krzyscik MA, Zakrzewska M, Otlewski J. Site-Specific, Stoichiometric-Controlled,
[0342] PEGylated Conjugates of Fibroblast Growth Factor 2 (FGF2) with Hydrophilic Auristatin Y for Highly Selective Killing of Cancer Cells Overproducing Fibroblast Growth Factor Receptor 1 (FGFR1). Mol Pharm. 2020 Jul 6;17(7):2734-2748. doi:
[0343] 10.1021 / acs.molpharmaceut.0c00419.
[0344] • Sokolowska-Wedzina A, Borek A, Chudzian J, Jakimowicz P, Zakrzewska M, Otlewski J. Efficient production and purification of extracellular domain of human FGFR-Fc fusion proteins from Chinese hamster ovary cells. Protein Expr Purif. 2014 Jul;99:50-7.
[0345] • Sletten T, Kostas M, Bober J, Sorensen V, Yadollahi M, Olsnes S, et al. Nucleolin regulates phosphorylation and nuclear export of fibroblast growth factor 1 (FGF1). PLoS One. 2014 Mar 4;9(3):e90687.
[0346] • Viti F, Nilsson F, Demartis S, Huber A, Neri D. Design and use of phage display libraries for the selection of antibodies and enzymes. Methods Enzymol. 2000;326:480-505.
[0347] • Lee CM, lomo N, Sierro F, Christ D. Selection of human antibody fragments by phage display. Nat Protoc. 2007;2(l l):3001-8.
[0348] • Tomlinson IM, Walter G, Marks JD, Llewelyn MB, Winter G. The repertoire of human germline VH sequences reveals about fifty groups of VH segments with different hypervariable loops. J Mol Biol 1992;227:776-98.
[0349] • Cox JP, Tomlinson IM, Winter G. A directory of human germ-line V kappa segments reveals a strong bias in their usage. Eur J Immunol 1994;24:827-36.
[0350] • Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: an open-source platform for biological-image analysis. Nat Methods. 2012 Jun 28;9(7):676-82.
[0351] • Tang, Y., Tang, F., Yang, Y. et al. Real-Time Analysis on Drug-Antibody Ratio of Antibody-Drug Conjugates for Synthesis, Process Optimization, and Quality Control. Sci Rep 7, 7763 (2017). • Nunes JP, Morais M, Vassileva V, Robinson E, Rajkumar VS, Smith ME, Pedley RB, Caddick S, Baker JR, Chudasama V. Functional native disulfide bridging enables delivery of a potent, stable and targeted antibody-drug conjugate (ADC). Chem Commun (Camb). 2015 Jul 7;51(53): 10624-7. doi: 10.1039 / c5cc03557k. Epub 2015 Jun 5. PMID: 26051118.
[0352] • J. A. Flygare, T. H. Pillow and P. Aristoff, Chem. Biol. Drug Des., 2013, 81, 113;
[0353] • L. Ducry and B. Stump, Bioconjugate Chem., 2010, 21, 5.
[0354] • Fu, Z., Li, S., Han, S. et al. Antibody drug conjugate: the “biological missile” for targeted cancer therapy. Sig Transduct Target Ther 7, 93 (2022). https: / / doi.org / 10.1038 / s41392- 022-00947-7
[0355] • Levengood, M. R. et al. Orthogonal cysteine protection enables homogeneous multi-drug antibody-drug conjugates. Angew. Chem. Int. Ed. 56, 733-737 (2017)
[0356] • Nadkarni DV. Conjugations to Endogenous Cysteine Residues. Methods Mol Biol. 2020;2078:37-49. doi: 10.1007 / 978-l-4939-9929-3_3. PMID: 31643048.
[0357] • Yu P et al, A novel monovalent FGFR1 antagonist: Preclinical safety profiles in rodents and non-human primates, Toxicology and Applied Pharmacology, Volume 406, 2020, 115215
[0358] SEQUENCES
[0359] The following sequences form part of the disclosure of the present application. A WIPO ST 26 compatible electronic sequence listing is provided with this application, too. For the avoidance of doubt, if discrepancies exist between the sequences in the following table and the electronic sequence listing, the sequences in this table shall be deemed to be the correct ones.
[0360] In some cases, signal peptides may be encompassed in the reproduced sequences. In such case, the sequences shall be deemed disclosed with and without signal peptides. A readily available tool to identify signal peptides in a given protein sequence is SignalP - 6.0 provided by Dansk Technical University under https: / / services.healthtech.dtu.dk / service.php7SignalP. The same applies to His tags or C-Myc tags, if existing.
[0361] Table 8: Sequence listing
Claims
What is claimed:
1. An antibody that binds to FGFR1, or a target-binding fragment or derivative of such antibody, which comprises the set of three heavy chain and three light chain complementarity determining regions (CDR) as set forth in SEQ ID NOs 1 - 6, wherein the CDRs are embedded in a suitable protein framework, preferably a variable domain framework, so as to be capable to bind to FGFR1.
2. The antibody or fragment or derivative according to claim 1, which comprises the heavy chain / light chain variable domain (HCVD / LCVD) pairs set forth in the following pairs of SEQ ID NOs 7 and 83. The antibody or fragment or derivative according to any one of the aforementioned claims, which is in at least one of the formats selected from the group consisting of: IgG, scFv, scFv-Fc, Fab, or (Fab)2.
4. A conjugate or fusion protein comprising an a) anti FGFR1 antibody provided in(i) a bivalent scFv-Fc format or(ii) an IgG format, and b) one or more effector entities fused or conjugated thereto which conjugate or fusion protein comprises the anti FGFR1 antibody according to any one of claims 1 - 3.
5. The conjugate or fusion protein according to claim 4, wherein the antibody ’ s Fc domain is taken from IgGl or IgG4.
6. The conjugate or fusion protein according to any one of claims 4 - 5, wherein the effector entity is at least one selected from the group consisting of• small molecular toxin• inflammatory cytokinepeptide- or protein toxin, and / or radioactive entity.
7. The conjugate or fusion protein according to any one of claims 4 - 6, wherein at least one effector entity is conjugated to the antibody via a cysteine residue in a hinge region of the antibody’s Fc domain.
8. The conjugate or fusion protein according to any one of claims 4 - 7, wherein the hinge region of the antibody’s Fc domain comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 15 and SEQ ID NO: 24.
9. The conjugate according to any one of claims 4 - 8, which comprises at least a maleimide linker conjugating a small molecular toxin to a cysteine residue of the antibody, preferably to a cysteine residue in a hinge region of the antibody’s Fc domain.
10. The conjugate according to any one of claims 4 - 9, which comprises at least one of• a maleimidocaproyl linker,• a valine-citrulline linker, or a caline-alanine linker, and / or• a p-amino benzyloxy carbonyl (PABC) linker.
11. The conjugate according to any one of claims 4 - 10, wherein the small molecular toxin is at least one selected from the group consisting of• Maytansinoides, e.g. Mertansine, Ansamitocin, Ravtansin, DM4, DM1,• Calicheamicins, e.g. Ozogamicin,• Doxorubicin,• Auristatins, e.g., Monomethyl Auristatin F (MMAF); Monomethyl Auristatin E (MMAE),• Taxanes, e.g., Paclitaxel or Docetaxel,• Pyrrolobenzodiazepine (PBD),• Anthracyclines, e.g., PNU-159682,• Amatoxins, e.g. a-Amanitin, P-Amanitin or y-Amanitin,• Cyclosporine,• Methotrexate, and / orTopoisomerase inhibitors, like e.g. Exatecan or Deruxtecan.
12. The conjugate according to any one of claims 4 - 11, which has a drug-to antibody ratio (DAR) of between > 3,5 and < 4.
13. The antibody, conjugate or fusion protein according to any one of claims 1 to 12 for (the manufacture of a medicament for) use in the treatment of a human or animal subject• being diagnosed for,• suffering from or• being at risk of developing cancer.
14. A method for treating or preventing a cancer in a human or animal subject, which method comprises administration of the antibody, conjugate or fusion protein according to any one of claims 1 - 12 to a patient, in one or more therapeutically sufficient doses.
Citation Information
Patent Citations
Inbred embryonic stem-cell derived mice
EP1480515A2
Anti-amyloid beta antibodies and their use
US20050169925A1
Methods for identifying antibodies with reduced immunogenicity
US20140227251A1
Directed evolution of novel binding proteins
US5223409A
Humanised antibodies
US5859205A