Gene regulation system (TUSER)

Abstract

The present invention relates to a system for modulating gene expression based on the epigenetic regulation of specific targets, and delivery systems thereof. The invention is based on the adaptation of the CRISPR / CAS technology to a new sgRNA production system. Compositions comprising the gene regulation system and uses thereof in the medical field are also described.

Description

[0001] GENE REGULATION SYSTEM (TUSER)

[0002] DESCRIPTION

[0003] FIELD OF THE INVENTION

[0004] The present invention relates to a system for modulating gene expression based on the epigenetic regulation of specific targets, and delivery systems thereof. The invention is based on the adaptation of the CRISPR / CAS technology to a new sgRNA production system. Compositions comprising the gene regulation system and uses thereof in the medical field are also described.

[0005] STATE OF THE ART

[0006] CRISPR is a powerful gene-editing technology that has the potential to revolutionize disease treatment. To date, there are several CRISPR-based gene therapies for cancer or genetic diseases that are FDA-approved or in clinical trial phase. However, this technology still has issues that need to be addressed for wider application: the possibility of off-targeting and the ethical issue of permanent and unpredictable DNA modification still raise doubts about CRISPR / CAS9 therapies in the scientific community. Furthermore, known gene mutations do not address complex disease phenotypes, such as psychiatric and sleep disorders, with multifactorial pathogenesis modalities. In addition to genetic modifications, epigenetics exerts independent reversible fine-tuning on gene expression, making the shift from DNA editing to epigenetic control reasonable. Among epigenetic modifications, cytosine methylation at carbon 5 is one of the most well-known and flexible. 5’-Methylcytosine (5meC) is a natural biochemical modification, usually occurring at the level of CG dinucleotides and mediated by methyltransferases (DNMT-1 , DNMT-3A and DNMT-3B in humans). This is a dynamic and reversible process, because enzymes such as ten-eleven translocation methylcytosine dioxygenases (TETs) can initiate the demethylation process by converting 5meC into hydroxy-5meC, which is then converted into unmethylated cytosine.

[0007] The DNA methylation state regulates the state of chromatin as open or closed, especially at the level of promoters or regulatory regions, and therefore its accessibility to the transcription machinery that promotes gene expression. Consequently, aberrant methylation, by modulating gene transcription, can lead to a wide range of disorders, from cancer to psychiatric conditions and behavioral alterations. To date, no treatment is available for precise and specific methylation and demethylation, but only a few small molecules that inhibit DNA methyltransferase enzymes have been approved as “global” hypomethylating agents with significant side effects.

[0008] Recently, alternative CRISPR systems for epigenetic remodeling have been developed: the combination of catalytically inactive CAS9 (dCAS9) with portions of human DNMTs and bacterial methyltransferases, or with catalytic domains of human TET1 , allows to drive epigenetic writings on a specific DNA sequence.

[0009] Despite improvements in specificity, the tool retains the known issues of CRISPR-CAS9 tissue specificity and control: the sgRNA (single guide RNA) module is constitutively expressed and can lead to non-specific and / or uncontrolled targeting.

[0010] There is a need to identify a system that can allow the modulation of gene expression in a timely and controlled manner without the disadvantages highlighted by what has been described so far.

[0011] SUMMARY OF THE INVENTION

[0012] The present invention relates to a new system for modulating gene expression, based on the epigenetic regulation of specific targets, called “TUSER” (Tunable Units For Specific Epigenetic Remodeling). The invention is based on the adaptation of the CRISPR / CAS technology to a new sgRNA production system. CRISPR / CAS-based gene activation systems are used to activate or inactivate gene expression by modifying the epigenetic elements that regulate the transcriptional machinery of the target gene. Single guide RNAs (sgRNAs) convey the CRISPR / CAS systems towards the regulatory target while fused microRNAs (miRNAs) simultaneously provide specific gene expression control.

[0013] In particular, the TUSER gene regulation system is characterized by the combination of two different epigenetic regulation mechanisms: DNA methylation / de-methylation and RNA interference, and it can have different embodiments depending on how the modules are arranged within the system itself.

[0014] The “One-4-all” system is a preferred embodiment of the TUSER system, in which all the elements of the system are regulated by a single promoter.

[0015] In a first aspect, the present invention relates to a gene regulation system (“One-4-all”) and comprises a nucleotide sequence having the following elements from the 5’ end to the 3’ end: a) a nucleotide sequence coding for a promoter; b) a first portion of a CAS protein lacking nuclease activity (N-CAS); c) a first splicing site; d) an RNA guide-miRNA / siRNA system; e) a branching site; f) a polypyrimidine sequence; g) a second splicing site; h) a second portion of a CAS protein lacking nuclease activity (C-CAS); and i) a coding sequence for a catalytic portion.

[0016] In a second aspect, an Adeno-associated virus (AAV)-mediated delivery system comprising the gene regulation system according to the invention is described.

[0017] In a third aspect, a composition comprising the gene regulation system or the Adeno- associated virus (AAV)-mediated delivery system, and excipients suitable for use according to the invention, is described.

[0018] In a fourth aspect, the invention concerns a composition for use as a medicament.

[0019] In a fifth aspect, the invention relates to a composition for use in the treatment of sleep disorders, preferably for use in the treatment of insomnia or narcolepsy.

[0020] DESCRIPTION OF THE FIGURES

[0021] The invention will now be described in detail with reference to the attached Figures in which:

[0022] Figure 1 : shows a schematic representation of the TUSER gene regulation system: “One-4-all”.

[0023] Figure 2: shows a schematic representation of the TUSER gene regulation system: “Stand Alone”.

[0024] Figure 3: shows the details of the splicing sequence of the One-4-AII guide system.

[0025] Figure 4: schematic representation of the TUSER guide-miRNA / siRNA system modularity.

[0026] Figure 5: Analysis of RNA targets and construct expression as described in Example 2 and 3.

[0027] Figure 6: Example of analysis of splice sequences and identification of the optimal site of Cas dCjCas9 (Figure 6A), dCas12f (Figure 6B) and Cas EnOsdCas12f1 (Figure 6C). Figure 7: Example 1 : Visualization of the correct splicing of One-4-AII constructs.

[0028] Figure 8: Analysis of expression levels of RNA guide (Figure 8A) and of MQ construct (Figure 8B) or TET construct (Figure 8C).

[0029] Figure 9: Fluorescence inhibition and modulation of HCRT expression in HEK293T cells, qualitative (Figure 9A) and quantitative (Figure 9B).

[0030] DETAILED DESCRIPTION OF THE INVENTION

[0031] The TUSER gene regulation system is a novel platform in which a modified, catalytically inactive CAS (dCas9, dCjCas9 or the small dCas12f and the enhanced version EnOsdCas12f1 ), engineered with a minimal DNA sequence that can still produce a nuclease-free protein and be used as a DNA anchor to target specific DNA sequences, has been fused with MQ1 methyltransferases or catalytic domains of human TET1 .

[0032] The invention therefore concerns, in a first aspect, a gene regulation system comprising a nucleotide sequence having the following elements from the 5’ end to the 3’ end: a) a nucleotide sequence coding for a promoter; b) a first portion of a CAS protein lacking nuclease activity (N-CAS); c) a first splicing site; d) an RNA guide-miRNA / siRNA system; e) a branching site; f) a polypyrimidine sequence; g) a second splicing site; h) a second portion of a CAS protein lacking nuclease activity (C-CAS); and i) a sequence coding for a catalytic portion.

[0033] At the end of the last element of the gene regulation system, a transcription termination site, for example the 82-nucleotide SV40 poly-A site, is inserted. In a preferred form, in the gene regulation system according to the invention, the promoter of element a) is a constitutive or tissue-specific promoter, preferably an RNA polymerase II promoter. In one embodiment, the promoter has a sequence of SEQ ID NO:1 but it can be replaced with any promoter.

[0034] Advantageously, in the gene regulation system according to the invention, the CAS protein is selected from the group consisting of dCas14, dCas12f, EnOSdCas12f1 and dCjCas9. The CAS protein binds to the guide, which in turn has the ability to bind DNA. In one embodiment, in the gene regulation system, the coding sequence for a catalytic portion of element i) is a combination of two epigenetic writers, preferably said epigenetic writers are the methyltransferase M.Sssl from Spiroplasma sp. (MQ1 ) and the catalytic domain of human Tet Methylcytosine Dioxygenase 1 (TET1 CD).

[0035] DNA methylation / demethylation is mediated by a CRISPR / CAS-based gene activation system that provides an easily programmable approach to remodel the epigenetics of a specific regulatory region and, consequently, the regulation of the downstream gene transcription. These modules consist of the combination of two epigenetic writers, the methyltransferase M.Sssl from Spiroplasma sp., MQ1 , and the catalytic domain of human Tet Methylcytosine Dioxygenase 1 (TET1 CD), fused to small CAS proteins lacking nuclease activity (for example, dCas14, dCas12f, EnOSdCas12f1 ). The activity of the system on target genes is mediated by a guide made of a scaffold sequence and a PAM sequence, specific for each CAS protein, and by a sequence complementary to the target DNA region. In the TUSER system, the guide DNA sequence is combined with a sequence encoding for a stem-loop, a three-dimensional structure, which represents the first step in the maturation of the RNA guide-miRNA / siRNA system.

[0036] MSssl (MQ1 ) is intended to mean a DNA methylase from Spiroplasma sp., MQ1 strain, having the same sequence specificity as known mammalian DNA methylases. The sequence specificity of this methylase is characterized by exclusively methylation of CpG sequences, making it a convenient tool for studying DNA methylation in eukaryotes.

[0037] TET1 or TET1 CD is intended to mean the ten-eleven translocation methylcytosine dioxygenase 1 (TET1 ), a member of the TET family of enzymes which is encoded in humans by the TET1 gene. The complete structure of TET1 comprises a double-[3- helical (DSBH) domain, a cysteine-rich domain, and a CXXC domain.

[0038] In a further embodiment, in the One-4-all gene regulation system, the second portion of a CAS protein of element h) is fused to the sequence coding for an epigenetic writer of element i).

[0039] Advantageously, in the gene regulation system the nucleotide pairs of the splice site of element c) and element g) are selected from the group consisting of AG, AC, GT, GC and AT, and may be in any combination.

[0040] In a preferred form, in the One-4-all system, the polypyrimidine sequence of element f) consists of a nucleotide selected from the group consisting of C or T and has a length in the range of 8 to 40, preferably in the range of 8 to 20, more preferably of 10 nucleotides. In one possible embodiment, the polypyrimidine sequence has a SEQ ID NO:1 1.

[0041] In one embodiment, in the gene regulation system the branching site of element e) is inserted 5 nucleotides upstream of the polypyrimidine sequence of element f), and has a sequence of general formula (I)

[0042] (I) yTnAy wherein y = T o C, and n = A, C, T or G.

[0043] In one possible embodiment, the branching site has the nucleotide sequence TGCTCAC.

[0044] The One-4-all construct (Figure 1 ) so described is spliced by eukaryotic cells and produces a full-length CAS-MQ1 / TET protein, pri-miRNAs and sgRNA (Figure 3).

[0045] Splicing of the construct can be modulated by changing T into G at the second position of the branching site. This may be useful to control both efficiency and off-target effects. As part of the coding sequence of the CAS / epigenetic writer, the RNA guide- miRNA / siRNA system is transcribed together with the coding portion of the functional molecule by a tissue-specific promoter. This feature allows the guide to be expressed only in the selected tissue, as is the case for the epigenetic writer. In contrast, the lack of specificity of canonical RNA polymerase III promoters induces the expression of the guide in any cell and this could be an off-target of the administration. Preferably in the gene regulation system according to the invention, the RNA guide- miRNA / siRNA system comprises a nucleotide sequence having the following elements from the 5’ end to the 3’ and: a) a spacer sequence; b) a coding sequence for a pri-miRNA / siRNA; c) a spacer sequence; d) a guide sequence suitable for the CAS protein; e) a spacer sequence; f) a coding sequence for a pri-miRNA / siRNA; and g) a spacer sequence.

[0046] The RNA guide-miRNA / siRNA system is inserted as an intron within the tetranucleotide splice sequence. An insertion site located in the initial part of the sequence coding for the CAS protein has been identified. This position represents a safety mechanism in case of aberrant splicing of the sequence, which leads the miss-spliced protein to a nonsense mediated decay. In this way, none of the complete or truncated forms of the epigenetic CAS / writer will be active in the cell if the sgRNA-miRNA / siRNA system is not produced.

[0047] Once transcribed by RNA polymerase II, the RNA portion of the pri-miRNA / pri-siRNA takes the stem-loop conformation to be targeted by the endogenous Drosha system. This endonuclease cuts the RNA molecule at a fixed position generating the pre- miRNA / pre-siRNA molecule and releasing, on the other side, a second portion of RNA encoding for the CAS guide. Once separated, the pre-miRNA / pre-siRNA undergoes the miRNA maturation process, while the guide that remains in the nucleus exerts its function as a CAS anchoring system.

[0048] The One-4-all system allows to increase the modulation characteristics of functional molecules. For example, in case of up-regulation of the target gene expression, the miRNA / siRNA can be designed to target the up-regulated gene and modulate the hyperactivation effect. On the other hand, miRNAs can be directed against functional molecules and modulate the final effect upstream of the system pathway.

[0049] In a preferred form, the spacer sequence of the One-4-all system has a length of 10 to 100 nucleotides, preferably 10 to 25 nucleotides. Preferably, the minimum length of the RNA guide-miRNA / siRNA system is 445 nucleotides and can be repeated once, twice or three times.

[0050] Spacer sequences flanking the elements of the system are necessary to prevent cleavage of the guide RNA sequence by the enzyme DROSHA, responsible for stemloop processing.

[0051] The length of the stem loop depends on the specific miRNA selected and ranges from 60 to 280 nucleotides.

[0052] The coding sequence for a pri-miRNA / siRNA consists of: miRNA scaffold 5’, miRNA and miRNA scaffold 3’. The coding sequence for the miRNA may vary depending on the needs and target choice. In one embodiment the miRNA sequence has a SEQ ID NO: 5 and 9.

[0053] The guide RNA sequence suitable for the CAS protein of element d) is formed by a guide scaffold specific for the selected CAS and a CAS sgRNA suitable for targeting the gene of interest.

[0054] The length of the single guide RNA depends on the selected CAS protein and ranges from 80 to 180 nucleotides.

[0055] The sequences of one embodiment of the different components of the gene regulation system according to the invention, in which the CAS protein lacking nuclease activity is d-EnOsCas12f1 , are reported below.

[0056] SEQ ID NO: 1 (Nucleotide sequence of the CBH promoter)

[0057] CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCG CCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTG GAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAA GTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCC AGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATC GCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCC CCCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGA TGGGGGCGGGGGGGGGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGC GAGGGGCGGGGCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGC GGCGCGCTCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTA TAAAAAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGCGCTGCCTTCGCCCCG TGCCCCGCTCCGCCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCG TTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAG

[0058] CTGAGCAAGAGGTAAGGGTTTAAGGGATGGTTGGTTGGTGGGGTATTAATGTTTA

[0059] ATTACCTGGAGCACCTGCCTGAAATCACTTTTTTTCAGGTTGG

[0060] SEQ ID NO: 2 (First portion of a nucleotide sequence of a CAS protein devoid of nuclease activity (N-CAS): d-EnOsCAs12f1 )

[0061] ATGGGAAAGGGCGTGCTGGCCAAGGTGATGAAATACGAGCTGAGATACCTGGAT

[0062] GGTTGTGGCGACTTCAGCAATATGCAGGAGCAGGTGTGGGCCCTGCAGCGGCA

[0063] GACACGGGAAATCCTGAACAGATCCATCCAAATCGCCTTCCAATGGCGCTGCGC

[0064] CAACAGCGAGCACCACAGAAAGACCGGCGAGTACCTGGACCTGAAAACGGAAAC

[0065] CGGCTACAAGAGACTGGATGGCCACATCTACAACTGCCTGAAGGGCCAGTACGA

[0066] GGACATGGCCACATCTAACCTGAACGCCACCATCCAGAAGGCTTGGAAGAAGTA

[0067] TAACTCCAGCAAGAAGGAAATCCTGAGGGGCAGCATGAGCATCCCCAGCTACAA

[0068] GATGAACCAGCCTCTGCGACTGGACAAGAATACCGTGAAACTGTCTGAGGGCGA

[0069] GCGGAACCCAATCGTGACCCTGACACTGTTTAGCGACAAGTTCAAGCGGGCCCA

[0070] GGGCGTGTCCAACGTGAAGTTTAGCATGCCTCTGCACGACGGCACCCAGAGAGC

[0071] CATCTTCGCCAACCTGATGAACGGCACCTACCAGCTGGGAGAGTGCCAGCTGGT

[0072] GTACAAACGGCCTAAGTGGTTCCTGTTCGTGACATACAAGTTCCCCCCCGTGGAA

[0073] CATCCTCTCGATCCTGACAAGATTCTGGGCGTCGCCATGGGCGAGGCCTGCGCG

[0074] CTTTATGCCTCTACATTCGGCGAGCACGGCTACCTGAAGATCGATGGAGGCGAG

[0075] ATTACAAAGTACGCCAAGAAGATGGAAGCTAGAATCCGGAGCATGCAGAAGCAG GCTGCTCACTGTGGCGAAGGCAGAATCGGGCACGGCACCAAAACAAGAGTGTCT

[0076] GTGGTGTACCAGGCCAAGGACAAG

[0077] SEQ ID NO: 3 (Spacer sequence)

[0078] >

[0079] GAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTGGTCTC

[0080] SEQ ID NO: 4 (miRNA scaffold 5’)

[0081] TGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACA

[0082] CTTGCTGGGATTACTTCGACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATT

[0083] GCTGTTGACAGTGAGCG

[0084] SEQ ID NO: 5 (miRNA: anti-mCherry)

[0085] CAAGGGCGAGGAGGATAACAT SEQ ID NO: 6 (miRNA scaffold 3’)

[0086] TGCCTACTGCCTCGGACTTCAAGGGGCTAGAATTCGAGCAATTATCTTGTTTACT

[0087] AAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGG

[0088] TATAAATTAAATCACTTT

[0089] SEQ ID NO: 7 (EnOSCas12f1 guide scaffold nucleotide sequence)

[0090] AGGGCCGACTTCCCGGCCCAAAATCGAGACAGTAGCCGTAAAACGTTGAGTTTC

[0091] AGCGTGGGCGACACACTCGAAAAGGTTAAGATATGCACATAGTAATCCGTGCATG

[0092] AGCCGCGAAAGCGGCTTGAAGG

[0093] SEQ ID NO: 8 (CAS sgRNA directed against HCRT promoter)

[0094] TTGTGCTCCCAGATTCCTGGGTGCAAG

[0095] SEQ ID NO: 9 (miRNA: anti-GFP)

[0096] GGCTACGTCCAGGAGCGCACC

[0097] SEQ ID NO: 10 (Spacer sequence)

[0098] GAGACCTGCTCACCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG

[0099] SEQ ID NO: 11 (Polypyrimidine sequence)

[0100] CTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCAC

[0101] SEQ ID NO: 12 (Second portion of a nucleotide sequence of a CAS protein lacking nuclease activity (C-CAS): d-EnOsCAs12f1 )

[0102] GGCCAGATTCAGAGATACCATCAACCACAGATACTCTAAGGCCCTGATCGACTAC

[0103] GCCCTGAAGAACCAGTGTGGCACCATCCAGATGGAAGATCTGACCGGCATCAAG

[0104] GAAGATACAGGATTTCCAAAGTTCCTGAGACATTGGACCTACTACGACCTGCAGA

[0105] GCAAGATCGAGGCTAAGGCCGCCGAGCACGGCATCCAAGTTGTCAAGATCAACC

[0106] CTAGACACACCAGCCAGCGCTGCAGCAGATGTGGACACATCGACAAAGCCAATA

[0107] GAACCAGCCAAGCTGATTTCTGCTGCACCAAGTGCGGCTTCAGCGCCAATGCCG

[0108] CCTTTAATGCCAGCCAGAACATCAGCATCAGAAACATCGACAAGATTATCGCCAA

[0109] GGCTATCGGCGCCAACCGGAAGCAGACC

[0110] SEQ ID NO: 13 (Spacer sequence)

[0111] AGCAGGGCTGAC

[0112] SEQ ID NO: 14 (NLS (Nuclear Localization Signal)-Sequence)

[0113] CCCAAGAAGAAGAGGAAGGTG

[0114] SEQ ID NO: 15 (Coding sequence for a catalytic moiety) AGCAAAGTGGAGAACAAAACAAAGAAGCTGAGAGTGTTCGAAGCCTTCGCCGGC ATTGGCGCCCAGAGAAAGGCCCTGGAGAAAGTGAGGAAGGACGAGTACGAGAT CGTGGGACTGGCCGAGTGGTATGTGCCCGCCATCGTCATGTACCAGGCCATCCA TAACAACTTCCACACCAAGCTAGAGTACAAGTCCGTCAGCAGAGAGGAGATGATC GACTACCTAGAGAACAAGACCCTGTCCTGGAACAGCAAGAACCCCGTCAGCAAC GGATACTGGAAGAGGAAGAAGGATGACGAGCTGAAGATCATCTACAACGCCATC AAGCTGTCCGAAAAGGAGGGCAACATTTTCGACATCAGGGACCTCTACAAGAGG ACACTGAAGAACATCGACCTGCTCACCTACAGCTTCCCTTGCCAGGACCTGAGC CAGCTAGGCATCCAGAAGGGCATGAAGAGGGGAAGCGGCACCAGATCCGGCCT GCTCTGGGAGATCGAAAGAGCCCTGGACTCCACCGAGAAGAACGACCTGCCTAA GTACCTCCTCATGGAGAACGTGGGAGCCCTGCTGCACAAGAAGAACGAGGAGGA GCTGAACCAATGGAAGCAGAAGCTGGAGAGCCTGGGCTACCAGAACAGCATCGA AGTCCTCAATGCTGCCGATTTCGGATCCAGCCAGGCCAGGAGGAGAGTGTTCAT GATCTCCACCCTCAATGAGTTCGTGGAACTGCCTAAGGGCGACAAGAAGCCCAA GAGCATCAAAAAGGTGCTGAACAAGATCGTGAGCGAGAAGGACATCCTCAACAA CCTGCTGAAATACAACCTCACCGAATTCAAGAAGACCAAGTCCAACATCAACAAG GCCAGCCTGATCGGCTACTCCAAGTTCAACTCCGAGGGCTATGTGTACGACCCC GAGTTCACAGGCCCCACACTGACAGCTAGCGGCGCCAACTCCAGGATCAAGATC AAGGACGGCAGCAACATCAGGAAGATGAACAGCGACGAAACCTTCCTGTACATC GGCTTTGACAGCCAGGACGGCAAGAGAGTGAACGAAATCGAGTTCCTGACCGAG AACCAGAAGATCTTCGTGTGTGGCAACAGCATCAGCGTGGAGGTGCTGGAGGCC ATCATTGACAAGATCGGCGGC

[0115] In an alternative embodiment, when the CAS protein lacking nuclease activity in the gene regulation system according to the invention is d-Cas12f, SEQ ID NO: 2 is replaced by SEQ ID NO: 17, SEQ ID NO: 7 is replaced by SEQ ID NO: 19, and SEQ ID NO: 12 is replaced by SEQ ID NO: 21 .

[0116] In a further alternative embodiment, when the CAS protein lacking nuclease activity in the gene regulation system according to the invention is d-CjCas9, SEQ ID NO: 2 is replaced by SEQ ID NO: 18, SEQ ID NO: 7 is replaced by SEQ ID NO: 20, and SEQ ID NO: 12 is replaced by SEQ ID NO: 22. SEQ ID NO: 17 (First portion of a nucleotide sequence of a CAS protein devoid of nuclease activity (N-CAS): d-Cas12f)

[0117] GCCAAAAACACCATTACCAAAACACTGAAACTGCGTATTGTGCGTCCGTATAATA

[0118] GCGCAGAAGTGGAAAAAATTGTTGCCGACGAAAAAAACAACCGCGAAAAAATCG

[0119] CACTGGAAAAGAACAAAGACAAAGTGAAAGAAGCCTGCAGCAAACATCTGAAAGT

[0120] TGCAGCATATTGTACCACACAGGTTGAACGTAATGCATGCCTGTTTTGTAAAGCA

[0121] CGTAAACTGGATGACAAATTCTACCAAAAACTGCGTGGTCAGTTTCCGGATGCAG

[0122] TTTTTTGGCAAGAAATCAGCGAAATTTTTCGCCAGCTGCAGAAACAGGCAGCAGA

[0123] AATCTATAATCAGAGCCTGATCGAACTGTACTACGAGATTTTTATCAAAGGCAAAG GTATTGCAAATGCCAGCAGCGTTGAACATTATCTGAGTAGAGTTTGTTATAGACGT

[0124] GCAGCAGAACTGTTTAAAAACGCAGCAATTGCAAGCGGTCTGCGTAGCAAAATCA

[0125] AAAGCAATTTTCGTCTGAAAGAACTGAAAAACATGAAAAGTGGTCTGCCGACCAC

[0126] CAAAAGCGATAATTTTCCGATTCCGCTGGTTAAACAGAAAG

[0127] SEQ ID NO: 18 (First portion of a nucleotide sequence of a CAS protein devoid of nuclease activity (N-CAS): d-CjCas9)

[0128] ATGGCCAGAATCCTGGCCTTCGCTATCGGCATCAGCAGCATCGGCTGGGCCTTC

[0129] AGCGAGAACGACGAGCTGAAGGACTGCGGCGTGCGGATCTTCACCAAGGTGGA

[0130] AAACCCCAAGACCGGCGAGAGCCTGGCCCTGCCCAGAAGGCTGGCCAGAAGCG

[0131] CCCGGAAGAGACTGGCCAGACGGAAGGCCCGGCTGAACCACCTGAAGCACCTG

[0132] ATCGCCAACGAGTTCAAGCTGAACTACGAGGACTACCAGAGCTTCGACGAGTCC

[0133] CTGGCCAAGGCCTACAAGGGCAGCCTGATCAGCCCCTACGAGCTGCGGTTCCG GGCCCTGAACGAGCTGCTGAGCAAGCAGGACTTCGCCAGAGTGATCCTGCACAT

[0134] TGCCAAGCGGAGAGGCTACGACGACATCAAGAACAGCGACGACAAAGAGAAGG

[0135] GCGCCATCCTGAAGGCCATCAAGCAGAACGAGGAAAAGCTGGCCAACTACCAGT

[0136] CCGTGGGCGAGTACCTGTACAAAGAGTACTTCCAGAAGTTCAAAGAGAACAGCA

[0137] AAGAATTCACCAACGTGCGGAACAAGAAAGAAAGCTACGAGCGGTGTATCGCCC

[0138] AGAGCTTCCTGAAGGATGAGCTGAAGCTGATCTTCAAGAAGCAGAGAGAGTTCG

[0139] GCTTCAGCTTCAGCAAGAAATTCGAGGAAGAG

[0140] SEQ ID NO: 19 (d-Cas12f guide scaffold nucleotide sequence) GGGCTTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTTAGGGGA TTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTT TCTTCGGAAAGTAACCCTCGAAACAAATTCATTTGAATGAAGGAATGCAAC SEQ ID NO: 20 (d-CjCas9 guide scaffold nucleotide sequence)

[0141] GTTTTAGTCCCTGAAAAGGGACTAAAATAAAGAGTTTGCGGGACTCTGCGGGGTT

[0142] ACAATCCCCTAAAACCGC

[0143] SEQ ID NO: 21 (Second portion of a nucleotide sequence of a CAS protein lacking nuclease activity (C-CAS): d-Cas12f)

[0144] GTGGTCAGTATACCGGTTTTGAAATTAGCAATCATAATAGCGACTTCATCATCAAG

[0145] ATTCCGTTTGGTCGTTGGCAGGTCAAAAAAGAGATTGATAAATATCGTCCGTGGG

[0146] AGAAATTTGACTTTGAACAGGTTCAGAAAAGCCCGAAACCGATTAGCCTGCTGCT

[0147] GAGCACCCAGCGTCGTAAACGTAATAAAGGTTGGAGCAAAGATGAAGGCACCGA AGCCGAAATCAAAAAAGTTATGAATGGCGATTATCAGACCAGCTACATTGAAGTTA

[0148] AACGTGGCAGCAAAATCTGTGAAAAAAGCGCATGGATGCTGAATCTGAGCATTGA

[0149] TGTTCCGAAAATTGATAAAGGTGTGGATCCGAGCATTATTGGTGGTATTGCAGTT

[0150] GGTGTTAGATCACCGCTGGTTTGCGCAATTAACAATGCATTTAGCCGTTATAGCA TCAGCGATAACGACCTGTTTCACTTCAACAAGAAAATGTTTGCACGTCGTCGTATC CTGCTGAAAAAAAACCGTCATAAACGTGCAGGTCATGGTGCAAAAAACAAACTGA

[0151] AACCGATCACCATTCTGACCGAAAAAAGTGAACGTTTTCGCAAAAAGCTGATTGA

[0152] ACGTTGGGCATGTGAAATCGCGGATTTCTTCATTAAAAACAAAGTTGGCACCGTG

[0153] CAGATGGAAAATCTGGAAAGCATGAAACGTAAAGAGGACAGCTATTTTAACATTC

[0154] GCCTGCGTGGCTTTTGGCCGTATGCAGAAATGCAGAACAAAATCGAATTCAAACT

[0155] GAAGCAGTATGGCATCGAAATTCGTAAAGTTGCACCGAATAATACCAGCAAAACC

[0156] TGTAGCAAATGTGGCCATCTGAACAACTATTTCAACTTCGAGTACCGCAAGAAAA ACAAATTCCCGCACTTTAAATGCGAAAAATGCAACTTCAAAGAAAACGCCGCGTA TAATGCAGCCCTGAATATTTCAAACCCGAAACTGAAAAGCACCAAAGAGAGACCG SEQ ID NO: 22 (Second portion of a nucleotide sequence of a CAS protein lacking nuclease activity (C-CAS): d-CjCas9)

[0157] GTGCTGAGCGTCGCCTTCTACAAGAGAGCCCTGAAGGACTTCAGCCACCTCGTG GGCAACTGCAGCTTCTTCACCGACGAGAAGAGAGCCCCCAAGAACAGCCCCCTG GCCTTCATGTTCGTGGCCCTGACCCGGATCATCAACCTGCTGAACAATCTGAAGA ACACCGAGGGCATCCTGTACACCAAGGACGACCTGAACGCCCTGCTGAATGAGG

[0158] TGCTGAAGAACGGCACCCTGACCTACAAGCAGACCAAGAAGCTGCTGGGCCTGA

[0159] GCGACGACTACGAGTTTAAGGGCGAGAAGGGCACCTACTTCATCGAGTTCAAGA

[0160] AGTACAAAGAGTTCATCAAGGCCCTGGGCGAGCACAACCTGAGCCAGGACGATC

[0161] TGAATGAGATCGCCAAGGACATCACCCTGATCAAGGACGAGATTAAGCTGAAGAA

[0162] GGCCCTGGCCAAATACGACCTGAATCAGAACCAGATCGACAGCCTGAGCAAGCT

[0163] GGAATTCAAGGATCACCTGAACATCAGCTTCAAGGCTCTGAAGCTGGTCACCCCC

[0164] CTGATGCTGGAAGGCAAGAAGTACGACGAGGCCTGCAACGAGCTGAACCTGAAG

[0165] GTGGCCATCAACGAGGACAAGAAGGACTTCCTGCCCGCCTTCAACGAAACCTAC

[0166] TACAAGGACGAAGTGACCAACCCCGTGGTGCTGCGGGCCATCAAAGAATACCGG

[0167] AAGGTGCTGAATGCCCTGCTCAAGAAATACGGCAAGGTGCACAAGATCAACATC

[0168] GAGCTGGCCCGGGAAGTGGGCAAGAACCACAGCCAGCGGGCCAAGATCGAGAA

[0169] AGAGCAGAACGAAAACTACAAGGCCAAGAAGGACGCTGAGCTGGAATGCGAGAA

[0170] GCTGGGACTGAAGATCAACAGCAAGAACATCCTGAAGCTGCGGCTGTTCAAAGA

[0171] ACAGAAAGAGTTCTGCGCCTACAGCGGCGAGAAGATCAAGATCAGCGATCTGCA

[0172] GGACGAGAAGATGCTGGAAATCGACGCCATCTACCCCTACAGCCGGTCCTTCGA

[0173] CGACAGCTACATGAACAAGGTGCTGGTGTTCACCAAACAGAACCAGGAAAAACT

[0174] GAACCAGACCCCCTTCGAGGCCTTCGGCAACGACAGCGCCAAGTGGCAGAAAAT

[0175] CGAGGTGCTGGCCAAGAACCTGCCCACCAAGAAACAGAAGAGAATCCTGGACAA

[0176] GAATTACAAGGACAAAGAGCAGAAGAACTTCAAGGACCGGAACCTGAACGACAC

[0177] CCGGTATATCGCCCGGCTGGTGCTGAACTACACAAAGGACTACCTGGATTTCCT

[0178] GCCCCTGTCCGACGACGAGAACACCAAGCTGAACGATACCCAGAAAGGCTCCAA

[0179] GGTGCACGTGGAAGCCAAGAGCGGCATGCTGACCAGCGCCCTGAGACACACCT

[0180] GGGGCTTCAGCGCCAAGGATCGGAACAACCATCTGCACCACGCCATCGACGCC

[0181] GTGATCATTGCCTACGCCAACAACAGCATCGTGAAGGCCTTCTCCGACTTCAAGA

[0182] AAGAACAGGAAAGCAACAGCGCCGAGCTGTACGCCAAGAAGATCTCTGAGCTGG

[0183] ACTACAAGAACAAGCGGAAGTTCTTCGAGCCCTTCAGCGGCTTCCGGCAGAAGG

[0184] TGCTGGATAAGATCGACGAGATCTTCGTGTCCAAGCCCGAGCGGAAGAAGCCCT

[0185] CTGGCGCCCTGCACGAGGAAACCTTCAGAAAAGAGGAAGAGTTCTACCAGTCCT

[0186] ACGGCGGCAAAGAAGGCGTGCTGAAGGCCCTCGAGCTGGGCAAGATCAGAAAA

[0187] GTGAACGGCAAGATCGTGAAGAACGGGGACATGTTCCGGGTGGACATCTTCAAG CACAAAAAGACCAACAAGTTCTACGCCGTGCCCATCTACACAATGGACTTCGCCC

[0188] TGAAGGTGCTGCCCAACAAGGCCGTGGCCCGGTCCAAGAAGGGCGAGATCAAG

[0189] GACTGGATTCTGATGGACGAGAACTACGAGTTCTGCTTTAGCCTGTACAAGGACT

[0190] CCCTGATCCTGATCCAGACCAAGGACATGCAGGAACCCGAGTTCGTCTACTACAA CGCCTTCACCAGCAGCACCGTGTCCCTGATCGTGTCTAAGCACGACAACAAGTT

[0191] CGAGACACTGAGCAAGAACCAGAAGATCCTGTTCAAGAACGCCAACGAGAAAGA

[0192] AGTGATCGCCAAGAGCATCGGCATCCAGAATCTGAAGGTGTTCGAGAAGTACAT

[0193] CGTGTCCGCCCTGGGAGAAGTGACAAAGGCCGAGTTCCGGCAGAGAGAGGACT TCAAAAAG The sequences of the different components of the gene regulation system according to the invention are reported in Table 1 .

[0194] Table 1 : SEQ ID NO: 10

[0195] In a second aspect, an Adeno-associated virus (AAV)-mediated delivery system comprising the gene regulation system according to the invention is described.

[0196] In a third aspect, a composition comprising the gene regulation system or the Adeno- associated virus (AAV)-mediated delivery system, and excipients suitable for use according to the invention, is described.

[0197] In a fourth aspect, the invention concerns a composition for use as a medicament.

[0198] In a fifth aspect, the invention relates to a composition for use in the treatment of sleep disorders, preferably for use in the treatment of insomnia or narcolepsy, and generally circadian cycle disorders.

[0199] As indicated above, the TUSER gene regulation system, characterized by the combination of two different epigenetic regulation mechanisms, may have different embodiments depending on how the modules are arranged within the system itself.

[0200] In addition to the “One-4-all” system described above, in which all the system elements are regulated by a single promoter, in a second embodiment, the TUSER system can be formulated as a “Stand Alone”. (Figure 2)

[0201] The Stand Alone complex consists of two separate coding portions whose expression is driven by the respective promoter thereof.

[0202] This gene regulation system comprises a nucleotide sequence having the following elements from the 5’ end to the 3’ end: a) a nucleotide sequence coding for a promoter; b) a CAS protein lacking nuclease activity and retaining the ability to anchor to a target DNA sequence; c) a sequence coding for an epigenetic writer; d) a second nucleotide sequence coding for a promoter; and e) an RNA guide-miRNA / siRNA system.

[0203] At the end of the last element of the gene regulatory system, a termination sequence is inserted. In one embodiment this sequence is the Pol-Il terminator of SEQ ID NO:16.

[0204] SEQ ID NO:16 (Pol-Il terminator)

[0205] CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTT GACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCA TCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGAC AGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGA

[0206] The strategic advantage of this system consists in selecting two different promoters that respond to different stimuli. For example, the promoter upstream of the functional molecules may be selected to confer tissue specificity, while the promoter of the RNA guide-miRNA / siRNA system may be selected to activate expression based on the activation of particular cellular pathways.

[0207] In the Stand Alone complex, the RNA guide-miRNA / siRNA system is not inserted as an intronic sequence included in the coding part of the CAS protein and can be transcribed by an RNA polymerase II promoter. In fact, the RNA guide-miRNA / siRNA system allows to choose promoter sequences showing a tissue specificity that represents a further control of the entire system, unlike the CRISPR / CAS guide system which is instead limited to type III RNA polymerase promoters (such as 7SK, U6 or H1 ) lacking tissue specificity.

[0208] The strategic advantage of the TUSER gene regulation system, therefore, depends on the combination of selected targets and methylation / de-methylation.

[0209] In the case of cis regulation, the target of the demethylating epigenetic writer can be a regulatory DNA, while the target of a miRNA / siRNA encoded in the guide system can be directed against the 3’UTR of the mRNA of the same target as the epigenetic writer. In this case, the primary effect is to increase the target expression while the secondary effect consists in reducing the final concentration of the mRNA species.

[0210] In the case of autoregulation, the target of the methylating / demethylating epigenetic writer can be directed against the regulatory regions of the target, while the guide- encoded miRNA / siRNA can be directed towards the mRNA of the writer. In this case, the effect of the miRNA consists in decreasing the levels of epigenetic mRNAs and, consequently, in modulating the effect and persistence of the epigenetic remodeling of the primary target.

[0211] In the case of synergy, the methylating / demethylating epigenetic writer and the miRNA / siRNA can be directed against two different targets belonging to the same pathway. In this case, the final effect consists in synergistically targeting the same biological process thus increasing the desired effect.

[0212] In the case of multisystem, the guidance system may be composed of multiple modules encoding for different guides and miRNAs / siRNAs. In this case, the target selection allows to combine the regulation types described above.

[0213] Examples of embodiments of the present invention are reported below, provided for illustrative purposes.

[0214] EXAMPLES

[0215] Design of the miRNA-sqRNA complex

[0216] To ensure correct splicing of the intronic guide module, we modified the Pangolin algorithm to include the following rules for identifying the target sequence:

[0217] - the first two bases of the intron (position +1 , +2) must be “GT”, “GO” or “AT”, while the last two bases of the intron (position -2, -1 ) may be “AG” or “AC”.

[0218] - a polypyrimidine tract, consisting of “C” or “T”, is included in position -13 to -3.

[0219] - a branching site is present 5 nucleotides upstream of the polypyrimidine tract. The branching site ensures correct splicing of the intron, and it is a 5-nucleotide sequence yTnAy (where y=“T” or “C”, n=“A”, “C”, “T” or “G”).

[0220] - If the splicing sequence consists of 5’-AT / {N} / AC-3’, no pyrimidine sequence is included.

[0221] To ensure correct non-sense mediated decay (NMD) in case of incorrect splicing (for example due to intron retention) of the construct, the 50-nucleotide rule was followed: in mammals, a termination codon located more than 50 nucleotides upstream of the final exon junction is generally recognized as premature and leads to NMD. This was done for various small-sized Cas proteins, such as CjCas9, Cas12f, and EnOsCas12f1 , fused respectively to the catalytic domains of methylating and demethylating enzymes (Figures 6A, 6B, and 6C).

[0222] The sequence of the target miRNA inserted in the guide system was associated with the pri-microRNA miR-30 scaffold, with some modifications, which optimize the assembly of the miRNA / shRNA and facilitate the processing thereof, while sequences from the 3’ and 5’ sides of human [3-globin intron 2, recognized as “strongly splicing regions”, were used as intronic spacer regions. (Figure 6)

[0223] Cell lines and transfection used in Examples 1 , 2 and 3.

[0224] N2A and HEK293T cell lines were obtained from the American Tissue Collection Center (ATCC, Manassas VA). Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS and 1 % penicillin / streptomycin and maintained at 37°C and 5% CO2. Both lines were transfected with a vector constitutively expressing eGFP-puromycin and mCHERRY under the CMV and Ef 1 a promoters, respectively, and stably expressing clones were selected with the selection antibiotic puromycin (2ug / ml). These clones were then used as a platform to test the efficacy of the constructs by transient transfection with the vector encoding for One4all TUSER (MQ1 , TET or their control versions). Transfections were performed in 12-well plates using 1000 ng of vector DNA mixed with Lipofectamine 2000 (Life Technologies, cat. # 1 1668019) according to the manufacturer’s instructions.

[0225] Example 1 : Splicing analysis: rtPCR

[0226] Total RNA was extracted from cells with miRneasy mini kit (Qiagen) following the supplier’s instructions, and cDNA was synthesized by oligo-dT, using 1 pg of total RNA to obtain cDNA from mature mRNA transcripts only, with the retrotranscription OneScript Plus cDNA Synthesis Kit (Applied Biological Materials) following the supplier’s instructions.

[0227] To verify the correct splicing of the construct and the production of mRNA, two primers were designed outside the intronic sequence to amplify the cDNA, isolated as described above and then visualized on a 1 % agarose gel. The amplification of the correct splicing isoforms was visualized by electrophoresis on agarose gel. The gel bands were then extracted and sequenced with Sanger. (Figure 7). From the detailed description and the Examples reported above, the advantages achieved by the gene regulation system of the present invention are apparent. In particular, this system has proven to be surprisingly and advantageously suitable for all types of targets and modulable according to the type of regulation required.

[0228] Example 2: Expression analysis of the construct: qPCR

[0229] RNA and cDNA were obtained as previously described; real-time quantitative PCR was performed with SyberGreen assays in a QuantStudio 7 real-time PCR system (Life Technologies). Changes in mRNA levels were determined as the difference in the threshold cycle (2"-AACt) between the target gene and the reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Two biological replicates were carried out for each construct. With this analysis, the expression levels of the guide and the epigenetic writer (MQ1 or TET) are evaluated. The guide directed against the human HCRT gene was expressed in samples in which the two One4all constructs, with both MQ1 and TET, were inserted. MQ1 and TET are overexpressed at the RNA level in cells transfected with the One4all TUSER construct containing MQ and TET as the epigenetic writers, respectively, and compared to the control constructs, lacking the guide-mi RNA block but still containing the epigenetic writer (Figure 8). This example shows how the production efficiency of the One4all TUSER constructs is higher compared to existing systems.

[0230] Example 3: Fluorescence inhibition and modulation of HCRT expression in HEK293T cells.

[0231] The experiments were performed in parallel using the following two TUSER vectors: one with EnOsCas12f1 fused to MQ1 and the other fused to TET. Both vectors contain an sgRNA directed against hHCRT (promoter of the human orexin gene) and two miRNAs directed against mCHERRY (red fluorescent protein) and eGFP (green fluorescent protein), respectively, inserted in the control module.

[0232] Control plasmids were obtained by modifying miRNAs and sgRNAs with scrambled sequences (same nucleotide content but with a non-targeting random sequence) by site- directed mutagenesis. We tested TUSER in a cell line model that stably expresses eGFP, mCHERRY, while HCRT is naturally expressed. This system represents a tool to easily test vectors using imaging, by measuring the loss of green and red fluorescence using confocal microscopy and qPCR. The results show that orexin (HCRT) expression levels are negatively modulated by the construct expressing the MQ methyltransferase, while they are increased by the TET construct. Similarly, red and green fluorescence decrease in samples treated with both vectors. The result of this example indicates that the construct is subject to splicing, and the methylating / demethylating protein, guide and miRNAs against eGFP and mCherry are correctly formed (Figure 9). The 21 miRNA nucleotides can be replaced by any other natural or artificial sequence, and the guide can be encoded to target specific sequences, and this experiment represents a proof of concept of TUSER functionality and applicability.

Claims

CLAIMS1 . A gene regulatory system comprising a nucleotide sequence having the following elements from the 5’ end to the 3’ end: a) a nucleotide sequence coding for a promoter; b) a first portion of a CAS protein lacking nuclease activity (N-CAS); c) a first splicing site; d) an RNA guide-miRNA / siRNA system; e) a branching site; f) a polypyrimidine sequence; g) a second splicing site; h) a second portion of a CAS protein lacking nuclease activity (C-CAS); and i) a coding sequence for a catalytic portion.

2. The gene regulatory system according to claim 1 , wherein the promoter of element a) is a constitutive or tissue-specific promoter, preferably an RNA polymerase II promoter.

3. The gene regulatory system according to any one of claims 1 or 2, wherein the CAS protein is selected from the group consisting of dCas14, dCas12f, EnOSdCasI 2f 1 , and dCjCas9.

4. The gene regulatory system according to any one of claims 1 to 3, wherein the coding sequence for a catalytic portion of element i) is a combination of two epigenetic writers, preferably said epigenetic writers are the methyltransferase M.Sssl of Spiroplasma sp. (MQ1 ) and the catalytic domain of Human TET Methylcytosine Dioxygenase 1 (TET1 CD).

5. The gene regulatory system according to any one of claims 1 to 4, wherein the second portion of a CAS protein of element h) is fused with the coding sequence for a catalytic portion of element i).

6. The gene regulatory system according to any one of claims 1 to 5, wherein the two nucleotides of the splicing site of element c) and element g) are selected from the group consisting of AG, AC, GT, GC, and AT.

7. The gene regulatory system according to any one of claims 1 to 6, wherein the polypyrimidine sequence of element f) consists of a nucleotide selected from the group consisting of C or T, and has a length in the range of 8 to 20.

8. The gene regulatory system according to any one of claims 1 to 7, wherein the branching site of element e) is inserted 5 nucleotides upstream of the polypyrimidine sequence of element f), and has a sequence of general formula (I)(I) yTnAy wherein y = T or C, and n = A, C, T or G.

9. The gene regulatory system according to any one of claims 1 to 8, wherein the RNA guide-miRNA / siRNA system comprises a nucleotide sequence having the following elements from the 5’ end to the 3’ end: a) a spacer sequence; b) a coding sequence for a pri-miRNA / siRNA; c) a spacer sequence; d) a guide sequence suitable for the CAS protein; e) a spacer sequence; f) a coding sequence for a pri-miRNA / siRNA; and g) a spacer sequence.

10. The gene regulatory system according to any one of claims 1 to 9, wherein the spacer sequence has a length between 10 and 100 nucleotides.1 1. The gene regulatory system according to any one of claims 1 to 10, wherein the minimum length of the RNA guide-miRNA / siRNA system is 445 nucleotides.

12. The gene regulatory system according to any one of claims 1 to 1 1 , wherein the RNA guide-miRNA / siRNA system is repeated once, twice, or three times.

13. An Adeno-associated virus (AAV)-mediated delivery system comprising the gene regulatory system according to any one of claims 1 to 12.

14. A composition comprising the gene regulatory system according to any one of claims1 to 12 or the Adeno-associated virus (AAV)-mediated delivery system according to claim 13 and excipients suitable for use.

15. A composition according to claim 14, for use as a medicament.

16. A composition according to claim 14, for use in the treatment of sleep disorders, preferably for use in the treatment of insomnia or narcolepsy.

Images