Compositions and methods for regulating IL-2 gene expression

Abstract

Epigenetically modified DNA targeting systems, such as CRISPR-Cas / guide RNA (gRNA) systems, are provided that bind to or target one or more target sites in the IL-2 gene or its regulatory elements in cells such as lymphoid cells (e.g., T cells). In some embodiments, the provided epigenetically modified DNA targeting systems modulate the phenotype or activity of lymphoid cells, or the function of lymphoid cells such as the phenotype or activity of T cells. In some embodiments, methods and uses relating to the provided compositions in the modulation of lymphoid cells such as T cells are also provided, for example, in connection with adoptive T cell therapy.

Description

Technical Field

[0001] Cross-reference of related applications This application claims priority from U.S. Provisional Patent Application No. 63 / 530,054, filed on July 31, 2023, U.S. Provisional Patent Application No. 63 / 570,730, filed on March 27, 2024, and U.S. Provisional Patent Application No. 63 / 662,406, filed on June 20, 2024, the contents of which are hereby incorporated by reference in their entirety.

[0002] Inclusion by referencing the sequence list This application is filed in electronic format together with a sequence listing. The sequence listing is provided as a file of 548,241 bytes entitled 22474_2002940_SeqList.xml created on July 16, 2024. The information in electronic format of the sequence listing is hereby incorporated by reference in its entirety.

[0003] field In some aspects, the present disclosure relates to epigenetic modification DNA targeting systems, such as CRISPR-Cas / guide RNA (gRNA) systems, that bind to or target the interleukin-2 (IL-2) gene or its regulatory elements in lymphocytes (e.g., T cells). In some aspects, the epigenetic modification DNA targeting systems provided by the present disclosure regulate the phenotype or activity of lymphocytes, such as the function of lymphocytes, e.g., the phenotype or activity of T cells. In some aspects, the epigenetic modification targeting systems provided by the present disclosure enable transcriptional control or regulation of interleukin (IL-2) expression. In some aspects, the present disclosure relates to methods and uses related to compositions provided in the regulation of lymphocytes, such as T cells, for example, related to methods of lymphocyte therapy, including adoptive T cell therapy.

Background Art

[0004] background The administration of lymphoid cells (e.g., T cells) targeting specific antigens, also known as adoptive cell therapy (ACT), is a promising approach to treating diseases such as cancer. However, current ACT therapies face challenges, including suboptimal T cell function, proliferation, and persistence. Therefore, novel and improved methods are needed to overcome these challenges. This disclosure addresses these and other needs. [Overview of the project]

[0005] overview In some embodiments, the Specified provides an epigenetic modification DNA targeting system comprising a plurality of DNA targeting modules for increasing the transcription of an interleukin (IL-2) gene, wherein each DNA targeting module comprises a fusion protein comprising (a) a DNA-binding domain for targeting a target site of the IL-2 gene, and (b) at least one transcription activator effector domain. In any part of the embodiments provided, the DNA-binding domain of each fusion protein comprises a clustered regularly interspaced short palindromic repeats (Cas)-related protein, a zinc finger protein (ZFP), a transcription activator-like effector (TALE), a meganuclease, a homing endonuclease, or an I-SceI enzyme, or a variant thereof, and optionally, the DNA-binding domain comprises any catalytically inactive variant thereof, and if the DNA-binding domain of each fusion protein comprises a Cas protein, the DNA targeting system further comprises at least two gRNAs, each capable of targeting the Cas protein to a target site.

[0006] In some of the embodiments provided, the multiple DNA targeting modules consist of 2 to 6 DNA targeting modules. In some of the embodiments provided, the multiple DNA targeting modules consist of 2 DNA targeting modules. In some of the embodiments provided, the multiple DNA targeting modules consist of 3 DNA targeting modules. In some of the embodiments provided, the multiple DNA targeting modules consist of 4 or 5 DNA targeting modules.

[0007] In any part of the embodiments provided, each target site is located within the genomic coordinates GRCh38(hg38)chr4:122,451,261~122,593,946 of the human genome assembly. In any part of the embodiments provided, each target site is located in the putative regulatory region of the IL-2 gene, and the putative regulatory region is characterized by having one or more of the following: epigenetic marks, regulatory properties, or transcription factor motifs.

[0008] In some of the embodiments provided, the epigenetic mark includes histone H3K27 acetylation. In some of the embodiments provided, at least one transcription activator effector domain can catalyze the acetylation of histone H3 lysine 27 at a target site, or mobilize an enzyme that catalyzes the acetylation of histone H3 lysine 27 at a target site. In some of the embodiments provided, the enzyme that catalyzes the acetylation is an acetyltransferase. In some of the embodiments provided, the enzyme that catalyzes the acetylation is a histone acetyltransferase.

[0009] In some of the embodiments provided, the estimated regulatory region is a promoter or enhancer. In some of the embodiments provided, each target site is located within the promoter or enhancer.

[0010] In any part of the provided embodiments, each target site is independently (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,488,840~122, The genome coordinates selected from the group consisting of (5) 491,890, (6) 122,507,000-122,508,985, (7) chr4: 122,539,300-122,544,050, and (8) chr4: 122,576,890-122,579,315 are located within the target region corresponding to the human genome assembly GRCh38 (hg38). In any part of the provided embodiments, each target site is independently located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0011] In some of the embodiments provided, at least two of the multiple DNA targeting modules target different target sites. In some of the embodiments provided, the at least two different target sites are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, and (4) chr4:122,488,840~122 The genome coordinates selected from the group consisting of (5) 122,507,000~122,508,985, (6) chr4:122,539,300~122,544,050, and (7) chr4:122,576,890~122,579,315 are located in two different target regions corresponding to the human genome assembly GRCh38 (hg38). In any part of the embodiments provided, at least two distinct target sites are located in two distinct target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0012] In some of the embodiments provided, at least three of the multiple DNA targeting modules target different target sites. In some of the embodiments provided, the at least three different target sites are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, and (4) chr4:122,488,840~122 The genome coordinates are selected from the group consisting of (5) 122,507,000~122,508,985, (6) chr4:122,539,300~122,544,050, and (7) chr4:122,576,890~122,579,315 and are located in three different target regions corresponding to the human genome assembly GRCh38 (hg38). In any part of the embodiments provided, at least three distinct target sites are located in three different target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0013] In some of the embodiments provided, at least four of the multiple DNA targeting modules target different target sites, or at least five of the multiple DNA targeting modules target different target sites. In some of the embodiments provided, the at least four different target sites or the at least five different target sites are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,48 The genomic coordinates selected from the group consisting of (8,840~122,491,890, (5)122,507,000~122,508,985, (6)chr4:122,539,300~122,544,050, and (7)chr4:122,576,890~122,579,315 are located in four different target regions corresponding to the human genome assembly GRCh38 (hg38). In any part of the provided embodiments, at least four different target sites or at least five different target sites are located in four different target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0014] In some of the embodiments provided, each of the multiple DNA targeting modules targets a different target site. In some of the embodiments provided, each target site is (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,488,840~122,491 The genome coordinates selected from the group consisting of (5) 122,507,000~122,508,985, (6) chr4:122,539,300~122,544,050, and (7) chr4:122,576,890~122,579,315 are located in different target regions corresponding to the human genome assembly GRCh38 (hg38). In any part of the provided embodiments, each target site is located in a different target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050. In any part of the provided embodiments, at least two of the DNA targeting modules of the multiple DNA targeting modules target the same target site.

[0015] In some of the embodiments provided, the DNA-binding domain is a zinc finger protein. In some of the embodiments provided, each fusion protein of a plurality of DNA-targeting modules is different. In some of the embodiments provided, each of the DNA-targeting modules shares the same fusion protein and each contains a different guide nucleic acid that is complementary to a different target site. In some of the embodiments provided, the guide nucleic acid is a guide RNA (gRNA).

[0016] In some of the embodiments provided, the DNA-binding domain of the fusion protein is a clustered, regularly arranged short palindromic sequence repeat-associated (Cas) protein or a variant thereof. In some of the embodiments provided, at least one DNA targeting module targets a target site corresponding to genomic coordinates human genome assembly GRCh38(hg38)chr4:122,451,000–122,460,000. In some of the embodiments provided, at least one DNA targeting module targets a target site corresponding to genomic coordinates human genome assembly GRCh38(hg38)chr4:122,488,840–122,491,890. In some of the embodiments provided, at least one DNA targeting module targets a target site corresponding to genomic coordinates human genome assembly GRCh38(hg38)chr4:122,507,000–122,508,985. In any part of the provided embodiments, at least one DNA targeting module targets a target site corresponding to the genomic coordinates of human genome assembly GRCh38(hg38)chr4:122,539,300~122,544,050.

[0017] In some embodiments, this specification provides an epigenetically modified DNA targeting system comprising (a) a fusion protein comprising a DNA-binding domain which is a clustered and regularly arranged short palindromic sequence repeat-associated (Cas) protein or a variant thereof, and at least one transcription activator effector domain, and (b) a plurality of gRNAs, each comprising at least two guide RNAs (gRNAs) which target a target site of the interleukin-2 (IL-2) gene. In any part of the embodiments provided, the DNA targeting system increases the transcription of the interleukin (IL-2) gene.

[0018] In some of the embodiments provided, the multiple gRNAs are 2 to 6 gRNAs. In some of the embodiments provided, the multiple gRNAs are 2 gRNAs. In some of the embodiments provided, the multiple gRNAs are 3 gRNAs. In some of the embodiments provided, the multiple gRNAs are 4 gRNAs or 5 gRNAs.

[0019] In some of the embodiments provided, each target site is located within the genomic coordinates human genome assembly GRCh38(hg38)chr4:122,451,261~122,593,946. In some of the embodiments provided, each target site is located in the putative regulatory region of the IL-2 gene, and the putative regulatory region is characterized by having one or more of the following: epigenetic marks, regulatory properties, or transcription factor motifs. In some of the embodiments provided, the epigenetic marks include histone H3K27 acetylation. In some of the embodiments provided, at least one transcription activator effector domain can catalyze histone H3 lysine 27 acetylation at the target site, or can recruit an enzyme that catalyzes histone H3 lysine 27 acetylation at the target site. In some of the embodiments provided, the enzyme that catalyzes acetylation is an acetyltransferase.

[0020] In some of the embodiments provided, the estimated regulatory region is a promoter or enhancer. In some of the embodiments provided, each target site is located within the promoter or enhancer.

[0021] In any part of the provided embodiments, each target site is independently (1) chr4: 122,451,000~122,460,000, (2) chr4: 122,465,000~122,472,000, (3) chr4: 122,479,410~122,482,750, (4) chr4: 122,488,840~122,4 The genomic coordinates selected from the group consisting of (5) 122,507,000~122,508,985, (6) chr4: 122,539,300~122,544,050, and (7) chr4: 122,576,890~122,579,315 are located within the target region corresponding to the human genome assembly GRCh38 (hg38). In any part of the provided embodiments, each target site is independently located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0022] In any part of the embodiments provided, the DNA targeting system targets at least two different target sites, optionally two, three, four, or five different target sites, each of which is located within a different target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0023] In some embodiments, the Specified Epigenetic Modification DNA Targeting System comprises (a) a fusion protein comprising a DNA-binding domain which is a clustered and regularly arranged short palindromic sequence repeat-associated (Cas) protein or a variant thereof, and at least one transcription activator effector domain, and (b) (1) chr4:122,465,000~122,472,000, (2) chr4:122,479,410~122,482,750, and (3) chr4:122,488,840~122 An epigenetic modification DNA targeting system is provided, comprising at least one guide RNA (gRNA) that targets a target site of the interleukin-2 (IL-2) gene located within a target region corresponding to a human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (491,890), (4)122,507,000~122,508,985, (4)chr4:122,539,300~122,544,050, and (6)chr4:122,576,890~122,579,315. In any part of the provided embodiments, at least one gRNA targets a target site of the interleukin-2 (IL-2) gene located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,488,840~122,491,890, (2) 122,507,000~122,508,985, and (3) chr4:122,539,300~122,544,050.

[0024] In any part of the embodiments provided, at least one gRNA is 1 to 6 gRNAs.

[0025] In some of the embodiments provided, the Cas protein or its variant is a variant Cas protein which is an inactivated (dCas) protein. In some of the embodiments provided, the dCas protein lacks nuclease activity. In some of the embodiments provided, the dCas protein is a dCas9 protein. In some of the embodiments provided, the dCas protein is a dCas12 protein.

[0026] In some of the embodiments provided, the dCas9 protein is the Streptococcus pyogenes dCas9 (dSpCas9) protein. In some of the embodiments provided, the dSpCas9 protein contains at least one amino acid mutation selected from D10A and H840A with respect to the position numbering in SEQ ID NO: 62. In some of the embodiments provided, dSpCas9 contains an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, dSpCas9 is as described in SEQ ID NO: 63.

[0027] In some of the embodiments provided, the dCas9 protein is the Staphylococcus aureus dCas9 (dSaCas9) protein. In some of the embodiments provided, dSaCas9 contains at least one amino acid mutation selected from D10A and N580A with respect to the positional numbering in SEQ ID NO: 64. In some of the embodiments provided, the dSaCas9 protein contains an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, dSaCas9 is as described in SEQ ID NO: 65.

[0028] In some of the embodiments provided, each gRNA includes a gRNA spacer sequence complementary to the target site of its respective gene. In some of the embodiments provided, each gRNA targets a target site in IL-2 that includes any of the aforementioned sequences described in SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40, or any of the aforementioned complementary sequences. In some of the embodiments provided, each gRNA targets a target site in IL-2 described in any of the aforementioned sequences described in SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40, or any of the aforementioned complementary sequences.

[0029] In any part of the provided embodiments, each gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a continuous portion thereof of at least 14 nt.

[0030] In some embodiments, the Specified Epigenetic Modification DNA Targeting System comprises a fusion protein comprising (a) a DNA-binding domain which is a zinc finger protein (ZFP) or a variant thereof, and at least one transcription activator effector domain, wherein the ZFP has (1) chr4:122,465,000~122,472,000, (2) chr4:122,479,410~122,482,750, and (3) chr4:122,488,840~ An epigenetic modification DNA targeting system is provided that targets a target site of the interleukin-2 (IL-2) gene located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (122,491,890), (4)122,507,000~122,508,985, (4)chr4:122,539,300~122,544,050, and (6)chr4:122,576,890~122,579,315. In some of the embodiments provided, the ZFP targets a target site in the interleukin-2 (IL-2) gene located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,488,840~122,491,890, (2) 122,507,000~122,508,985, and (3) chr4:122,539,300~122,544,050. In some of the embodiments provided, the ZFP targets a target site in IL-2 containing the sequence described in any one of sequence numbers 186~188.

[0031] In some of the embodiments provided, the ZFP targets the target site described in SEQ ID NO: 186. In some of the embodiments provided, the ZFP includes a zinc finger recognition region comprising six zinc fingers, denoted as F1-F6 in order from the N-terminus to the C-terminus, and is selected from the following F1-F6: F1: QNAHRKT (SEQ ID NO: 195), F2: RKYYLAK (SEQ ID NO: 196), F3: RSAHLSR (SEQ ID NO: 197), F4: QSGDLTR (SEQ ID NO: 198), F5: RSDHLTQ (SEQ ID NO: 199), and F6: DSANLSR (SEQ ID NO: 200). In some of the embodiments provided, the ZFP includes the sequence or a portion thereof described in SEQ ID NO: 189, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the ZFP comprises the sequence described in SEQ ID NO: 189. In some of the embodiments provided, the ZFP is encoded by the sequence or a portion thereof described in SEQ ID NO: 192, or by an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the ZFP is encoded by the sequence described in SEQ ID NO: 192.

[0032] In some of the embodiments provided, the ZFP targets the target site described in SEQ ID NO: 187. In some of the embodiments provided, the ZFP includes a zinc finger recognition region comprising six zinc fingers, represented as F1 to F6 in order from the N-terminus to the C-terminus, and is selected from the following F1 to F6: F1: DSSHLEL (SEQ ID NO: 201), F2: DRSNLTR (SEQ ID NO: 202), F3: RSDNLSE (SEQ ID NO: 203), F4: VRRALSS (SEQ ID NO: 204), F5: QSGALAR (SEQ ID NO: 205), and F6: RLDWLPM (SEQ ID NO: 206). In some of the embodiments provided, the ZFP includes the sequence or a portion thereof described in SEQ ID NO: 190, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the ZFP comprises the sequence described in SEQ ID NO: 190. In some of the embodiments provided, the ZFP is encoded by the sequence or a portion thereof described in SEQ ID NO: 193, or by an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the ZFP is encoded by the sequence described in SEQ ID NO: 193.

[0033] In some of the embodiments provided, the ZFP targets the target site described in SEQ ID NO: 188. In some of the embodiments provided, the ZFP includes a zinc finger recognition region comprising six zinc fingers, represented as F1-F6 in order from N-terminus to C-terminus, selected from the following F1-F6: F1: RSDNLSV (SEQ ID NO: 207), F2: RSAHLSR (SEQ ID NO: 208), F3: QNAHRKT (SEQ ID NO: 209), F4: LRHHLTR (SEQ ID NO: 210), F5: TSSNRKT (SEQ ID NO: 211), and F6: TSNLSR (SEQ ID NO: 212). In some of the embodiments provided, the ZFP includes the sequence or a portion thereof described in SEQ ID NO: 191, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the ZFP comprises the sequence described in SEQ ID NO: 191. In some of the embodiments provided, the ZFP is encoded by the sequence or a portion thereof described in SEQ ID NO: 194, or by an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the ZFP is encoded by the sequence described in SEQ ID NO: 194.

[0034] In some embodiments, the Specified Information provides an epigenetic modified DNA targeting system comprising: (a) a fusion protein comprising a DNA-binding domain which is an inactivated Cas9 (dSpCas9) derived from Streptococcus pyogenes and at least one transcription activator effector domain; and (b) at least one guide RNA (gRNA) that targets a target site of the interleukin-2 (IL-2) gene, wherein the gRNA comprises a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a gRNA spacer sequence comprising at least 14 nt of the same continuum.

[0035] In some of the embodiments provided, the dSpCas9 protein contains at least one amino acid mutation selected from D10A and H840A with respect to the position numbering in SEQ ID NO: 62. In some of the embodiments provided, dSpCas9 contains an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, dSpCas9 is as described in SEQ ID NO: 63.

[0036] In some of the embodiments provided, each gRNA targets a target site in IL-2 that includes the sequence described in any one of SEQ ID NOs: 43, 45, 47, 49, 51, 53, 55, 57, or 59, any of the aforementioned portions containing at least 14 nucleotides (nt), or any of the aforementioned complementary sequences.

[0037] In any part of the provided embodiments, each gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or a continuous portion thereof of at least 14 nt.

[0038] In some embodiments, this specification provides an epigenetic modified DNA targeting system comprising: (a) a fusion protein comprising a DNA-binding domain which is an inactivated Cas9 (dSaCas9) derived from Staphylococcus aureus and at least one transcription activator effector domain; and (b) at least one guide RNA (gRNA) that targets a target site of the interleukin-2 (IL-2) gene, wherein the gRNA comprises a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or at least 14 nt of the same continuous portion.

[0039] In some of the embodiments provided, dSaCas9 includes at least one amino acid mutation selected from D10A and N580A with respect to the position numbering in SEQ ID NO: 64. In some of the embodiments provided, the dSaCas9 protein includes an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, dSaCas9 is as described in SEQ ID NO: 65.

[0040] In some of the embodiments provided, each gRNA independently includes a spacer sequence of 14nt to 24nt in length. In some of the embodiments provided, each gRNA independently includes a spacer sequence of 16nt to 22nt in length. In some of the embodiments provided, each gRNA independently includes a spacer sequence of 18nt, 19nt, 20nt, 21nt, or 22nt in length.

[0041] In any part of the provided embodiments, each gRNA includes a gRNA spacer sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a continuous portion thereof of at least 14 nt of any of the aforementioned sequences.

[0042] In any part of the provided embodiments, each gRNA includes a gRNA spacer sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or a continuous portion thereof of at least 14 nt of any of the aforementioned sequences.

[0043] In some of the embodiments provided, the DNA targeting system includes at least two gRNAs that target the same target site. In some of the embodiments provided, the DNA targeting system includes at least two copies of the same gRNA. In some of the embodiments provided, the gRNA includes a gRNA spacer sequence that includes the sequence described in SEQ ID NO: 23. In some of the embodiments provided, the gRNA includes a gRNA spacer sequence that includes the sequence described in SEQ ID NO: 23.

[0044] In some of the embodiments provided, the DNA targeting system includes at least two gRNAs that target different target sites. In some of the embodiments provided, each gRNA in the DNA targeting system targets a different target site.

[0045] In some of the embodiments provided, at least one gRNA targets a target site corresponding to the genomic coordinates human genome assembly GRCh38(hg38)chr4:122,451,000–122,460,000. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, or a gRNA spacer sequence including a contiguous portion thereof of at least 14 nt. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 11, or a gRNA spacer sequence including a contiguous portion thereof of at least 14 nt, optionally the gRNA spacer sequence being described in SEQ ID NO: 11.

[0046] In any part of the embodiments provided, at least one gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, or a contiguous portion thereof of at least 14 nt. In any part of the embodiments provided, at least one gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 42, or a contiguous portion thereof of at least 14 nt, and optionally the gRNA spacer sequence is described in SEQ ID NO: 42.

[0047] In some of the embodiments provided, at least one gRNA targets a target site 50–150 kilobases (kb) upstream of the IL-2 transcription start site (TSS). In some of the embodiments provided, at least one gRNA targets a target site corresponding to genomic coordinates human genome assembly GRCh38(hg38)chr4:122,488,840–122,491,890. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, or a gRNA spacer sequence of at least 14 nt including a contiguous portion thereof. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 23, or a gRNA spacer sequence of at least 14 nt including a contiguous portion thereof, optionally the gRNA spacer sequence being described in SEQ ID NO: 23. In any part of the provided embodiments, at least one gRNA comprises the sequence described in SEQ ID NO: 25, or a gRNA spacer sequence comprising at least 14 nt of the same sequence, optionally the gRNA spacer sequence being described in SEQ ID NO: 25.

[0048] In any part of the provided embodiments, at least one gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, or a contiguous portion thereof of at least 14 nt. In any part of the provided embodiments, at least one gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 50, or a contiguous portion thereof of at least 14 nt, and optionally the gRNA spacer sequence is described in SEQ ID NO: 50.

[0049] In some of the embodiments provided, at least one gRNA targets a target site corresponding to the genomic coordinates human genome assembly GRCh38(hg38)chr4:122,507,000~122,508,985. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, or a gRNA spacer sequence of at least 14 nt including a contiguous portion thereof. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 27, or a gRNA spacer sequence of at least 14 nt including a contiguous portion thereof, optionally the gRNA spacer sequence being described in SEQ ID NO: 27.

[0050] In any part of the embodiments provided, at least one gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 56, SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt. In any part of the embodiments provided, at least one gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 56, or a contiguous portion thereof of at least 14 nt, and optionally the gRNA spacer sequence is described in SEQ ID NO: 56. In any part of the embodiments provided, at least one gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt, and optionally the gRNA spacer sequence is described in SEQ ID NO: 58.

[0051] In some of the embodiments provided, at least one gRNA targets a target site corresponding to the genomic coordinates human genome assembly GRCh38(hg38)chr4:122,539,300~122,544,050. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, or a gRNA spacer sequence of at least 14 nt including a contiguous portion thereof. In some of the embodiments provided, at least one gRNA includes the sequence described in SEQ ID NO: 37, or a gRNA spacer sequence of at least 14 nt including a contiguous portion thereof, optionally the gRNA spacer sequence being described in SEQ ID NO: 37.

[0052] In some of the embodiments provided, the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO: 23. In some of the embodiments provided, the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO: 25. In some of the embodiments provided, the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO: 27. In some of the embodiments provided, the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO: 37. In some of the embodiments provided, the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 23, and the second gRNA comprising the spacer sequence described in SEQ ID NO: 37. In some of the embodiments provided, the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 23, and the second gRNA comprising the spacer sequence described in SEQ ID NO: 25. In some of the embodiments provided, the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 23, and the second gRNA comprising the spacer sequence described in SEQ ID NO: 27. In any part of the provided embodiments, the DNA targeting system includes a first gRNA, a second gRNA, and a third gRNA, described by three gRNAs selected from the group consisting of a gRNA containing the spacer sequence described in SEQ ID NO: 11, a gRNA containing the spacer sequence described in SEQ ID NO: 23, a gRNA containing the spacer sequence described in SEQ ID NO: 27, and a gRNA containing the spacer sequence described in SEQ ID NO: 37.

[0053] In any part of the provided embodiments, the DNA targeting system comprises a first gRNA, a second gRNA, a third gRNA, and a fourth gRNA, wherein the first gRNA comprises the spacer sequence described in SEQ ID NO: 11, the second gRNA comprises the spacer sequence described in SEQ ID NO: 23, the third gRNA comprises the spacer sequence described in SEQ ID NO: 27, the fourth gRNA comprises the spacer sequence described in SEQ ID NO: 37, and optionally further comprises a fifth gRNA, wherein the fifth gRNA comprises the spacer sequence described in SEQ ID NO: 25.

[0054] In any part of the provided embodiments, the DNA targeting system comprises a first gRNA and a second gRNA described by two gRNAs selected from the group consisting of a gRNA containing the spacer sequence described in SEQ ID NO: 42, a gRNA containing the spacer sequence described in SEQ ID NO: 50, a gRNA containing the spacer sequence described in SEQ ID NO: 56, and a gRNA containing the spacer sequence described in SEQ ID NO: 58, wherein the two gRNAs are (i) a gRNA containing the spacer sequence described in SEQ ID NO: 42 and a gRNA containing the spacer sequence described in SEQ ID NO: 50, (ii) a gRNA containing the spacer sequence described in SEQ ID NO: 42 and a gRNA containing the spacer sequence described in SEQ ID NO: 56, (iii) a gRNA containing the spacer sequence described in SEQ ID NO: 42 and a gRNA containing the spacer sequence described in SEQ ID NO: 58, (iv) a gRNA containing the spacer sequence described in SEQ ID NO: 50 and a gRNA containing the spacer sequence described in SEQ ID NO: 56, or (v) a gRNA containing the spacer sequence described in SEQ ID NO: 50 and a gRNA containing the spacer sequence described in SEQ ID NO: 58. In any part of the embodiments provided, the DNA targeting system comprises a first gRNA, a second gRNA, and a third gRNA described by three gRNAs selected from the group consisting of a gRNA containing the spacer sequence described in SEQ ID NO: 42, a gRNA containing the spacer sequence described in SEQ ID NO: 50, a gRNA containing the spacer sequence described in SEQ ID NO: 56, and a gRNA containing the spacer sequence described in SEQ ID NO: 58, wherein the three gRNAs are (i) a gRNA containing the spacer sequence described in SEQ ID NO: 42, a gRNA containing the spacer sequence described in SEQ ID NO: 50, and a gRNA containing the spacer sequence described in SEQ ID NO: 56, or (ii) a gRNA containing the spacer sequence described in SEQ ID NO: 42, a gRNA containing the spacer sequence described in SEQ ID NO: 50, and a gRNA containing the spacer sequence described in SEQ ID NO: 58.

[0055] In any part of the provided embodiments, the DNA targeting system further comprises a fusion protein comprising a DNA-binding domain which is a zinc finger protein (ZFP) or a variant thereof, and at least one transcription activator effector domain, wherein the ZFP targets a target site in IL-2 which comprises the sequence described in any one of SEQ ID NOs. 186-288.

[0056] In any part of the embodiments provided, each activator of transcription effector domain is an NCOA3 domain, a FOXO3 domain, an NCOA3-FOXO3-NCOA3 domain, a VP64 domain, a p65 activation domain, a p300 domain, an Rta domain, a CBP domain, a VPR domain, a VPH domain, an HSF1 domain, a TET protein domain, and optionally the TET protein is TET1, a TET protein domain, a SunTag domain, or any of the aforementioned domains, parts, variants, or abbreviations. In any part of the embodiments provided, each activator of transcription effector domain is p300.

[0057] In some of the embodiments provided, each activator-of-transcription effector domain includes at least one VP16 domain, or a variant or portion thereof, that exhibits transcriptional activating activity. In some of the embodiments provided, each activator-of-transcription effector domain includes a VP16 tetramer (VP64) domain, or a variant or portion thereof, that exhibits transcriptional activating activity. In some of the embodiments provided, each activator-of-transcription effector domain is a VP64 domain.

[0058] In some of the embodiments provided, each activator-of-transcription effector domain includes an NCOA3 domain, or a variant or portion thereof, that exhibits transcriptional activation activity. In some of the embodiments provided, each activator-of-transcription effector domain includes a FOXO3 domain, or a variant or portion thereof, that exhibits transcriptional activation activity. In some of the embodiments provided, each activator-of-transcription effector domain includes an NCOA3-FOXO3-NCOA3 domain. In some of the embodiments provided, each activator-of-transcription effector domain is an NCOA3-FOXO3-NCOA3 domain. In some of the embodiments provided, each activator-of-transcription effector domain further includes a VP16 tetramer (VP64) domain.

[0059] In any part of the embodiments provided, at least one activator-of-transcription effector domain comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in SEQ ID NO: 66, or any of the foregoing.

[0060] In any part of the embodiments provided, at least one activator-of-transcription effector domain comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in SEQ ID NO: 181, or any of the foregoing.

[0061] In any part of the provided embodiments, at least one transcription activator effector domain is fused to the N-terminus, C-terminus, or both the N-terminus and C-terminus of the DNA-binding domain.

[0062] In some of the embodiments provided, the fusion protein further comprises one or more nuclear localization signals (NLS). In some of the embodiments provided, the fusion protein further comprises a DNA-binding domain, at least one effector domain, and one or more linkers connecting two or more of the one or more nuclear localization signals. In some of the embodiments provided, the fusion protein comprises the sequence described in SEQ ID NO: 100, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the fusion protein comprises the sequence described in SEQ ID NO: 100.

[0063] In some of the embodiments provided, the fusion protein includes one of the sequences described in SEQ ID NOs. 5, 61, 182, and 213-215, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, the fusion protein includes one of the sequences described in SEQ ID NOs. 5, 61, 182, and 213-215. In some of the embodiments provided, the fusion protein includes the sequence described in SEQ ID NO. 5. In some of the embodiments provided, the fusion protein includes the sequence described in SEQ ID NO. 61. In some of the embodiments provided, the fusion protein includes the sequence described in SEQ ID NO. 182. In some of the embodiments provided, the fusion protein includes the sequence described in SEQ ID NO. 213. In some of the embodiments provided, the fusion protein includes the sequence described in SEQ ID NO. 214. In some of the embodiments provided, the fusion protein includes the sequence described in SEQ ID NO. 215.

[0064] In some of the embodiments provided, transient delivery of an epigenetically modified DNA targeting system to lymphoid cells promotes increased IL-2 expression, optionally compared to lymphoid cells that have not received the epigenetically modified DNA targeting system. In some of the embodiments provided, the lymphoid cells are T cells. In some of the embodiments provided, the lymphoid cells are natural killer (NK) cells. In some of the embodiments provided, the lymphoid cells are derived from primary cells. In some of the embodiments provided, the lymphoid cells are derived from T cell or NK cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells. In some of the embodiments provided, the modified lymphoid cells express an engineered antigen receptor, optionally a chimeric antigen receptor.

[0065] In some of the embodiments provided, transient delivery of an epigenetically modified DNA targeting system to T cells promotes an increase in IL-2 expression upon T cell stimulation, optionally compared to T cells that have not received the epigenetically modified DNA targeting system. In some of the embodiments provided, the DNA targeting system increases IL-2 expression by a log2 factor of 1.0 or greater in lymphoid cells that come into contact with the DNA targeting system. In some of the embodiments provided, the DNA targeting system increases IL-2 expression by a log2 factor of 2.0 or greater in lymphoid cells that come into contact with the DNA targeting system. In some of the embodiments provided, the DNA targeting system increases IL-2 expression by a log2 factor of 2.5 or greater in lymphoid cells that come into contact with the DNA targeting system. In some of the embodiments provided, the DNA targeting system increases IL-2 expression by a log2 factor of 2.75 or greater in lymphoid cells that come into contact with the DNA targeting system.

[0066] In some of the embodiments provided, T cell stimulation is performed by anti-CD3 and anti-CD28 activating reagents. In some of the embodiments provided, T cells express an engineered antigen receptor, optionally a chimeric antigen receptor, or an eTCR. In some of the embodiments provided, the engineered antigen receptor is a chimeric antigen receptor (CAR) or an engineered T cell receptor (eTCR) directed to an antigen, and T cell stimulation is antigen-specific stimulation of the CAR or eTCR, optionally, T cell stimulation is performed by an antigen-expressing target cell. In some of the embodiments provided, T cells express a chimeric antigen receptor (CAR) directed to an antigen, and T cell stimulation is antigen-specific stimulation of the CAR, optionally, T cell stimulation is performed by an antigen-expressing target cell. In some of the embodiments provided, T cell stimulation is restimulation of the T cell after at least one previous T cell stimulation.

[0067] In some of the embodiments provided, the gRNA further comprises the scaffold sequence described in SEQ ID NO: 8. In some of the embodiments provided, the gRNA further comprises the scaffold sequence described in SEQ ID NO: 41.

[0068] In any part of the embodiments provided, the DNA targeting system does not introduce gene disruption or DNA cleavage.

[0069] In some embodiments, the Specified provides a guide RNA (gRNA) that targets a target site of the interleukin (IL-2) gene, wherein the target site is selected from any of the following: a portion of the sequence described in any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40, which includes at least 14 nucleotides (nt), or a target site which includes any of the aforementioned complementary sequences.

[0070] In any part of the provided embodiments, the target site is one of the sequences described in SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40, or any of the complementary sequences described above. In any part of the provided embodiments, the gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a contiguous portion thereof of at least 14 nt. Optionally, the gRNA includes the gRNA spacer sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a contiguous portion thereof of at least 14 nt.

[0071] In some of the embodiments provided, the gRNA includes the sequence described in SEQ ID NO: 11, or a gRNA spacer sequence including at least 14 nt of the continuum thereof, optionally the gRNA spacer sequence being described in SEQ ID NO: 11. In some of the embodiments provided, the gRNA includes the sequence described in SEQ ID NO: 23, or a gRNA spacer sequence including at least 14 nt of the continuum thereof, optionally the gRNA spacer sequence being described in SEQ ID NO: 23. In some of the embodiments provided, the gRNA includes the sequence described in SEQ ID NO: 25, or a gRNA spacer sequence including at least 14 nt of the continuum thereof, optionally the gRNA spacer sequence being described in SEQ ID NO: 25. In some of the embodiments provided, the gRNA includes the sequence described in SEQ ID NO: 27, or a gRNA spacer sequence including at least 14 nt of the continuum thereof, optionally the gRNA spacer sequence being described in SEQ ID NO: 27. In any part of the embodiments provided, the gRNA comprises the sequence described in SEQ ID NO: 37, or a gRNA spacer sequence comprising at least 14 nt of the sequence, optionally the gRNA spacer sequence being described in SEQ ID NO: 37.

[0072] In some of the embodiments provided, the gRNA includes a spacer sequence of 14nt to 24nt in length. In some of the embodiments provided, the gRNA includes a spacer sequence of 16nt to 22nt in length. In some of the embodiments provided, the gRNA includes a spacer sequence of 18nt, 19nt, 20nt, 21nt, or 22nt in length.

[0073] In any part of the embodiments provided, the gRNA further comprises the scaffold sequence described in Sequence ID No. 8.

[0074] In some embodiments, the Specified Provision provides a guide RNA (gRNA) that targets a target site of the interleukin (IL-2) gene, wherein the target site is selected from the sequence described in any one of SEQ ID NOs. 43, SEQ ID NOs. 45, SEQ ID NOs. 47, SEQ ID NOs. 49, SEQ ID NOs. 51, SEQ ID NOs. 53, SEQ ID NOs. 55, SEQ ID NOs. 57, or SEQ ID NOs. 59, any of the aforementioned portions containing at least 14 nucleotides (nt), or any of the aforementioned complementary sequences. In some embodiments of the provided embodiments, the target site is the sequence described in any one of SEQ ID NOs. 43, SEQ ID NOs. 45, SEQ ID NOs. 47, SEQ ID NOs. 49, SEQ ID NOs. 51, SEQ ID NOs. 53, SEQ ID NOs. 55, SEQ ID NOs. 57, or SEQ ID NOs. 59, or any of the aforementioned complementary sequences. In any part of the provided embodiments, the gRNA includes a gRNA spacer sequence comprising the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt, and optionally, the gRNA includes the gRNA spacer sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt.

[0075] In some of the embodiments provided, the gRNA comprises the sequence described in SEQ ID NO: 42, or a gRNA spacer sequence comprising at least 14 nt of the same continuum, optionally the gRNA spacer sequence being described in SEQ ID NO: 42. In some of the embodiments provided, the gRNA comprises the sequence described in SEQ ID NO: 50, or a gRNA spacer sequence comprising at least 14 nt of the same continuum, optionally the gRNA spacer sequence being described in SEQ ID NO: 50.

[0076] In some of the embodiments provided, the gRNA comprises the sequence described in SEQ ID NO: 56, or a gRNA spacer sequence comprising at least 14 nt of the same continuum, optionally the gRNA spacer sequence being described in SEQ ID NO: 56. In some of the embodiments provided, the gRNA comprises the sequence described in SEQ ID NO: 58, or a gRNA spacer sequence comprising at least 14 nt of the same continuum, optionally the gRNA spacer sequence being described in SEQ ID NO: 58.

[0077] In some of the embodiments provided, the gRNA includes a spacer sequence of 14nt to 24nt in length. In some of the embodiments provided, the gRNA includes a spacer sequence of 16nt to 22nt in length. In some of the embodiments provided, the gRNA includes a spacer sequence of 18nt, 19nt, 20nt, 21nt, or 22nt in length.

[0078] In any part of the embodiments provided, the gRNA further comprises the scaffold sequence described in Sequence ID No. 41.

[0079] In some embodiments, this specification provides gRNA combinations comprising two or more gRNAs, each selected from the gRNAs provided herein.

[0080] In some embodiments, this specification provides (a) a clustered and regularly arranged short palindromic sequence repeat-associated (Cas) protein or a variant thereof derived from Streptococcus pyogenes, and (b) a Cas-guide RNA (gRNA) combination comprising at least one gRNA provided herein. In some of the embodiments provided, the Cas protein or a variant thereof is an inactivated (dSpCas9) protein. In some of the embodiments provided, the dCas protein lacks nuclease activity. In some of the embodiments provided, the dSpCas9 protein comprises at least one amino acid mutation selected from D10A and H840A with respect to the position numbering in SEQ ID NO: 62. In some of the embodiments provided, dSpCas9 comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In any part of the embodiments provided, dSpCas9 is described in Sequence ID No. 63.

[0081] In some embodiments, this specification provides (a) a clustered and regularly arranged short palindromic sequence repeat-associated (Cas) protein or a variant thereof derived from Staphylococcus aureus, and (b) a Cas-guide RNA (gRNA) combination comprising at least one gRNA provided herein. In some of the embodiments provided, the Cas protein or a variant thereof is an inactivated (dSaCas9) protein. In some of the embodiments provided, the dCas protein lacks nuclease activity. In some of the embodiments provided, the dSaCas9 protein comprises at least one amino acid mutation selected from D10A and N580A with respect to the position numbering in SEQ ID NO: 64. In some of the embodiments provided, dSaCas9 comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some of the embodiments provided, dSaCas9 is described in Sequence ID No. 65.

[0082] In some embodiments, the Specified provides polynucleotides encoding epigenetically modified DNA targeting systems provided herein. In some embodiments, the Specified provides polynucleotides encoding at least one DNA targeting module of epigenetically modified DNA targeting systems provided herein. In some embodiments, the Specified provides polynucleotides encoding a fusion protein and at least one gRNA of epigenetically modified DNA targeting systems provided herein.

[0083] In some embodiments, the Specified provides polynucleotides encoding gRNAs provided herein. In some embodiments, the Specified provides polynucleotides encoding gRNA combinations provided herein. In some embodiments, the Specified provides polynucleotides encoding Cas-gRNA combinations provided herein. In some embodiments, the Specified provides fusion proteins of epigenetic modified DNA targeting systems provided herein, and polynucleotides encoding one or more gRNAs provided herein. In any part of the embodiments provided, the polynucleotide encoding the fusion protein is mRNA.

[0084] In some embodiments, this specification provides vectors comprising polynucleotides provided herein. In some of the embodiments provided, the vector is a viral vector. In some of the embodiments provided, the vector is an adeno-associated virus (AAV) vector. In some of the embodiments provided, the vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9.

[0085] In some of the embodiments provided, the vector is a non-viral vector. In some of the embodiments provided, the non-viral vector is selected from lipid nanoparticles, liposomes, exosomes, or cell-permeable peptides. In some of the embodiments provided, the non-viral vector is lipid nanoparticles. In some of the embodiments provided, the vector exhibits immune cell targeting, and optionally, the vector exhibits T cell targeting.

[0086] In some embodiments, the Specified herein provides modified lymphoid cells comprising an epigenetic modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, or a polynucleotide provided herein.

[0087] In some embodiments, modified lymphoid cells comprising epigenetic modifications or phenotypic modifications obtained from epigenetic modification DNA targeting systems provided herein, gRNAs provided herein, gRNA combinations provided herein, CRISPR Cas-gRNA combinations provided herein, or contact with polynucleotides provided herein are provided.

[0088] In some of the embodiments provided, the modified lymphoid cells are modified T cells. In some of the embodiments provided, the modified lymphoid cells are modified natural killer (NK) cells. In some of the embodiments provided, the modified lymphoid cells are derived from primary cells. In some of the embodiments provided, the modified lymphoid cells are derived from T cell or NK cell progenitors, pluripotent stem cells, or induced pluripotent stem cells. In some of the embodiments provided, the modified lymphoid cells further include chimeric antigen receptors (CARs).

[0089] In some embodiments, modified T cells are provided herein, comprising an epigenetic modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, or a polynucleotide provided herein. In some embodiments, modified T cells are provided herein, comprising epigenetic modifications or phenotypic modifications obtained from contact with an epigenetic modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, or a polynucleotide provided herein. In some of the embodiments provided herein, the modified T cells are derived from cells of the subject. In some of the embodiments provided herein, the modified T cells are derived from primary T cells. In some of the embodiments provided herein, the modified T cells are derived from T cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells. In some of the embodiments provided herein, the T cells are tumor-infiltrating lymphocytes (TILs). In some of the embodiments provided, the modified T cell further comprises an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

[0090] In some embodiments, the Specified provides a method for increasing IL-2 transcription in lymphoid cells, the method comprising introducing into lymphoid cells an epigenetic modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, a polynucleotide provided herein, or a vector provided herein.

[0091] In some embodiments, methods are provided herein for increasing IL-2 production in or by lymphoid cells, the methods comprising introducing into lymphoid cells an epigenetic modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, a polynucleotide provided herein, or a vector provided herein. In some of the embodiments provided, the lymphoid cells are T cells. In some of the embodiments provided, the lymphoid cells are natural killer (NK) cells. In some of the embodiments provided, the lymphoid cells are derived from primary cells. In some of the embodiments provided, the lymphoid cells are derived from T cell or NK cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells. In some of the embodiments provided, the lymphoid cells express an engineered antigen receptor, optionally a chimeric antigen receptor (CAR).

[0092] In some embodiments, methods are provided herein for increasing the transcription of IL-2 in T cells, the methods comprising introducing into T cells an epigenetically modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, a polynucleotide provided herein, or a vector provided herein. In some embodiments, methods are provided herein for increasing the production of IL-2 in or by T cells, the methods comprising introducing into T cells an epigenetically modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, a polynucleotide provided herein, or a vector provided herein. In some embodiments herein, the T cells are tumor-infiltrating lymphocytes (TILs). In some embodiments herein, the T cells express an engineered antigen receptor, optionally a chimeric antigen receptor, or a T cell receptor (eTCR).

[0093] In some embodiments, the Specified provides a method for promoting the persistence of immune cells to repeated stimulation, the method comprising introducing into T cells an epigenetic modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, a polynucleotide provided herein, or a vector provided herein, after introduction, the T cells being subjected to a plurality of repeated stimuli that initiate a T cell activation signal. In some of the embodiments provided, the stimulation is with anti-CD3 and anti-CD28 activating reagents. In some of the embodiments provided, the T cells are tumor-infiltrating lymphocytes (TILs). In some of the embodiments provided, the T cells express an engineered antigen receptor, optionally a chimeric antigen receptor, or a T cell receptor (eTCR). In any part of the embodiments provided, the engineered antigen receptor is a chimeric antigen receptor (CAR) or an engineered T cell receptor (eTCR) directed to an antigen, and T cell stimulation is antigen-specific stimulation of the CAR or eTCR, and optionally, T cell stimulation is by an antigen-expressing target cell. In any part of the embodiments provided, the T cells express a chimeric antigen receptor (CAR) directed to an antigen, and T cell stimulation is antigen-specific stimulation of the CAR, and optionally, T cell stimulation is by an antigen-expressing target cell. In any part of the embodiments provided, T cell stimulation is restimulation of the T cells after at least one previous T cell stimulation. In any part of the embodiments provided, the T cells are T cells in the subject, and the method is performed in vivo.

[0094] In some of the embodiments provided, the T cells are T cells derived from the subject or derived from cells of the subject, and the method is performed ex vivo. In some of the embodiments provided, the method is performed in vitro.

[0095] In some of the embodiments provided, the T cells are primary T cells. In some of the embodiments provided, the T cells are derived from T cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells.

[0096] In some of the embodiments provided, introduction is by transient delivery to T cells. In some of the embodiments provided, introduction is by electroporation, transfection, or transduction.

[0097] In some embodiments, modified lymphoid cells produced by the methods provided herein are provided herein.

[0098] In some embodiments, this specification provides a pharmaceutical composition comprising a plurality of modified lymphoid cells provided herein. In some embodiments, this specification provides a pharmaceutical composition comprising a plurality of modified T cells provided herein. In any part of the embodiments provided herein, the pharmaceutical composition provided herein comprises pharmaceutically acceptable excipients.

[0099] In some embodiments, this specification provides a method for treating a disease or condition in a subject, the method comprising administering to the subject a composition comprising modified lymphoid cells provided herein or a pharmaceutical composition provided herein. In some embodiments, this specification provides a method for treating a disease or condition in a subject, the method comprising administering to the subject a composition comprising modified T cells provided herein or a pharmaceutical composition provided herein.

[0100] In some of the embodiments provided, T cells or modified T cells are adoptive T cell therapy for treating a disease or condition in a subject. In some of the embodiments provided, T cells or modified T cells are tumor-infiltrating lymphocytes (TILs). In some of the embodiments provided, modified T cells express recombinant receptors specific to a target antigen associated with the disease or condition.

[0101] In some embodiments, the Specified provides a method for treating a disease or condition in a subject, the method comprising administering to the subject an adoptive T cell therapy for treating a disease or condition in the subject, an epigenetic modified DNA targeting system provided herein, a gRNA provided herein, a combination of gRNAs provided herein, a CRISPR Cas-gRNA combination provided herein, a polynucleotide provided herein, or a vector provided herein.

[0102] 2. In any part of the embodiments provided, the T cells are tumor-infiltrating lymphocytes (TILs). In any part of the embodiments provided, the T cells express recombinant receptors specific to disease- or condition-related target antigens. In any part of the embodiments provided, the recombinant receptors are engineered T cell receptors (eTCRs) or chimeric antigen receptors (CARs).

[0103] In any part of the embodiments provided, the target antigen is a tumor antigen.

[0104] In any part of the embodiments provided, the disease or condition is cancer. In any part of the embodiments provided, the cancer is either a blood cancer or a solid tumor.

[0105] In any part of the embodiments provided, the disease or condition is an autoimmune condition and / or an inflammatory condition.

[0106] In some of the embodiments provided, the administration increases the transcription of IL-2 in lymphoid cells.

[0107] In some of the embodiments provided, the administration increases the transcription of IL-2 in T cells. [Brief explanation of the drawing]

[0108] [Figure 1] A shows the IL-2 locus within the GRCh38 (hg38) human genome assembly genomic coordinates chr4:122,451,261–122,593,946, with seven distinct regions annotated. B shows a plot of log2 factor change (log2fc) vs. log2 factor change between two different donors. Large black dots enclosed in boxes represent validated hits. C shows the distribution of hits at target sites across various regions within the IL-2 locus. [Figure 2A] This graph shows the IL-2 expression rate after the first stimulation of Her2 CAR T cells delivered with mRNA encoding the dSpCas9-2xVP64 effector fusion protein and various SpCas9 IL-2 targeting gRNAs. The solid line defines the IL-2 expression rate when using the control guide RNA IL-2 gRNA-1. The dashed line shows the IL-2 expression rate of Her2 CAR T cells ("CAR"). [Figure 2B] Figure 2A shows the IL-2 expression rate of the same Her2 CAR T cells after a second stimulation. The solid line defines the IL-2 expression rate when using the control guide RNA IL-2 gRNA-1. The dashed line shows the IL-2 expression rate of Her2 CAR T cells ("CAR"). [Figure 2C] Figure 2A shows the IL-2 expression rate of the same Her2 CAR T cells after a third stimulation. The solid line defines the IL-2 expression rate when using the control guide RNA IL-2 gRNA-1. The dashed line shows the IL-2 expression rate of Her2 CAR T cells ("CAR"). [Figure 3] A shows the change in IL-2 expression between the first and third stimuli for gRNA IL-2_H, gRNA IL-2 gRNA-1, and gRNA SpNT, as well as other gRNAs. B shows the ratio of IL-2+ CAR T cells to untargeted gRNA SpNT between the first and third stimuli for gRNA IL-2_H, gRNA IL-2 gRNA-1, and other gRNAs. Data points representing gRNA IL-2_H and gRNA IL-2 gRNA-1 are shown. White circles represent data using gRNA SpNT. [Figure 4] This shows the mean fluorescence intensity (MFI) of Her2 CAR T cells transiently expressing a dCas9 effector fusion protein for IL-2 activation targeted by the guide RNA IL-2_H, compared to other guides. Data points for gRNA IL-2_H and gRNA IL-2 gRNA-1 are shown. White circles represent data using gRNA SpNT. [Figure 5A] A schematic diagram illustrates an experimental design for testing the functionality of iPSC-derived natural killer cells in relation to the post-delivery functionality of an IL-2-targeting DNA targeting system and the increase in cytokine secretion, by differentiating induced pluripotent stem cells (iPSCs) into immune effector cells (induced natural killer or iNK cells), and then delivering mRNA encoding CAR lentivirus, dSpCas9-2xVP64 fusion protein, and IL-2-targeting gRNA. [Figure 5B] This shows the tumor cell count over time, normalized to the tumor cell count at the start of the experiment (T0), after incubation with either induced natural killer cells (iNK), CAR+ iNK cells (iNK+CAR), or CAR+ iNK cells delivered with mRNA encoding the dSpCas9-2xVP64 fusion protein and gRNA targeting IL-2 (iNK+CAR+IL-2). [Figure 5C] This shows the secretion of IL-2 in induced natural killer (iNK) cells or CAR-T cells, measured in pg / mL. iNK cells under different conditions were tested, including iNK cells (-) that were not transduced by CAR lentivirus or electroporated with an IL-2-targeting DNA targeting system, iNK cells (CAR+) that were transduced by CAR lentivirus only, and iNK cells (+CAR+IL-2) that were transduced by both CAR lentivirus and electroporated with an IL-2-targeting DNA targeting system. [Figure 5D]This shows the secretion of interferon-gamma (IFNγ) in induced natural killer (iNK) cells or CAR-T cells, measured in pg / mL. iNK cells under different conditions were tested, including iNK cells (-) that were not transduced by CAR lentivirus or electroporated with an IL-2 targeted DNA targeting system, iNK cells (CAR+) that were transduced by CAR lentivirus only, and iNK cells (+CAR+IL-2) that were transduced by both CAR lentivirus and electroporated with an IL-2 targeted DNA targeting system. [Figure 6A] This shows a multiplicative increase in IL-2+ cells relative to the persistence of IL-2 activation in exemplary donors (this is the ratio of the absolute number of edited CAR+ IL-2+ cells to the absolute number of NT-controlled CAR+ IL-2+ cells in the third round of serial killing). [Figure 6B] Similarly, the increased ratio of IL-2+ cells to IL-2 activation persistence in two additional exemplary donors is shown. Selected data points representing selected gRNA combinations are highlighted for each exemplary donor. [Figure 6C] Similarly, the increased ratio of IL-2+ cells to IL-2 activation persistence in two additional exemplary donors is shown. Selected data points representing selected gRNA combinations are highlighted for each exemplary donor. [Figure 7] A shows the IL-2 expression rate after the first stimulation of Her2 CAR T cells delivered with mRNA encoding the dSpCas9-2xVP64 effector fusion protein and various SpCas9 IL-2 targeted gRNAs, or with the dSaCas9-2xVP64 effector fusion protein and various SaCas9 IL-2 targeted gRNAs. B shows the IL-2 expression rate after the second stimulation of the same Her2 CAR T cells shown in A. [Figure 8]The normalized tumor target cell counts over two stimulations of T cells derived from two donors (Donor 1 and Donor 2) delivered either chimeric antigen receptor (CAR) mRNA, mRNA encoding the dSpCas9-2xVP64 effector protein, and either IL-2 targeted gRNA (lower left subplot) or untargeted (NT) gRNA (upper right subplot). As a negative control, T cells were also given either no mRNA (mock, lower right subplot) or only CAR mRNA (upper left subplot). [Figure 9] Two exemplary dSaCas9 fusion proteins for transcriptional activation are shown: dSaCas9 (dSaCas9-NFN-VP64) (left), covalently bound to the effector domain NCOA3-FOXO3-NCOA3 (NFN) and VP64, and dSaCas9 (dSaCas9-2xVP64) (right), covalently bound to two VP64 domains. [Figure 10] The left panel shows intracellular IL-2 expression after the first stimulation, and the mean fluorescence level (MFI; corresponding to mean expression level) (right panel) is shown, using the average of two donors as the IL-2-positive cell percentage, in cells delivered with mRNA encoding dSaCas9-2xVP64, dSaCas9-VP64-NFN, or dSpCas9-2xVP64 along with the corresponding IL-2-targeting gRNA(s). No delivery of the exemplary fusion protein (CAR only) was used as a negative control. [Figure 11] This shows the alignment of a subset of engineered zinc finger protein (ZFP) target sites in IL-2 gene region 4. Each solid rectangle represents a given target site, and successful ZFPs (see Table E4) and guide RNAs (gRNAs) are annotated using boxes. [Figure 12] This shows the alignment of a subset of engineered zinc finger protein (ZFP) target sites in IL-2 region 5. Each solid rectangle represents a given target site, and successful ZFPs (see Table E4) and guide RNAs (gRNAs) are annotated using frames. [Figure 13] This shows the alignment of a subset of engineered zinc finger protein (ZFP) target sites for IL-2 transcription start sites (TSS). Each solid rectangle represents a given target site, and successful ZFPs (see Table E4) and guide RNAs (gRNAs) are annotated using frames. [Figure 14A] Table E4 illustrates IL-2 expression after delivery of the successful IL-2-targeted ZFP fusion protein dSpCas9-2xVP64 and gRNA IL2_H(SpCas9), or without delivery (CAR alone). IL-2 expression is expressed as the percentage of IL-2-positive cells after the first stimulation 72 hours after delivery (top) or the number of IL-2-positive CAR T cells after the second stimulation (bottom). [Figure 14B] Table E4 shows the total number of cells 72 hours after delivery of the successful IL-2-targeted ZFP fusion proteins listed. As a control, cells were either delivered with dSpCas9 fusion protein and the corresponding IL-2 gRNA (SpCas9), or no fusion protein was administered (CAR alone). [Modes for carrying out the invention]

[0109] Detailed explanation This specification provides an epigenetically modified DNA targeting system, wherein the DNA targeting system comprises a plurality of DNA targeting modules for increasing the transcription of an interleukin (IL-2) gene, and each DNA targeting module comprises a fusion protein comprising (a) a DNA-binding domain for targeting a target site of the IL-2 gene, and (b) at least one transcription activator effector domain. This specification further provides an epigenetically modified DNA targeting system, wherein the DNA targeting system comprises at least one DNA targeting module comprising (a) a DNA-binding domain capable of targeting a target site in the interleukin-2 (IL-2) gene or its regulatory DNA element in lymphoid cells (e.g., T cells or natural killer cells, also known as NK cells), and (b) a fusion protein capable of activating the transcription of the IL-2 gene or its regulatory element. In some embodiments, the target site is located within the IL-2 gene or its regulatory region, which is found herein to be a positive regulator of the function of lymphoid cells (e.g., T cells or NK cells) after transient transcriptional regulation of the IL-2 gene. In some such embodiments, at least one effector domain is a transcriptional activator domain, such as VP64. In some embodiments, the target site is located within 1000 base pairs of the transcription start site (TSS) of the IL-2 gene. The target site may be located within a regulatory region, such as the promoter or enhancer, of the IL-2 gene. In some embodiments, the target site is located within 50–150 kb upstream of the IL-2 gene.

[0110] In some embodiments, the epigenetically modified DNA targeting system is a synthetic transcription factor capable of increasing (or upregulating) the transcription of the IL-2 gene in a targeted manner. This specification provides an epigenetically modified DNA targeting system in which the DNA-binding domain of each fusion protein comprises a clustered and regularly arranged short palindromic sequence repeat-associated (Cas) protein, a zinc finger protein (ZFP), a transcription activator-like effector (TALE), a meganuclease, a homing endonuclease, or an I-SceI enzyme, or a variant thereof, and optionally, the DNA-binding domain comprises one of the catalytically inactive variants described above, and if the DNA-binding domain of each fusion protein comprises a Cas protein, the DNA targeting system further comprises at least two gRNAs, each capable of targeting the Cas protein to a target site.

[0111] In some embodiments, the epigenetic modified DNA-binding domain of a DNA targeting system is a nuclease-inactive, clustered, and regularly arranged short palindromic sequence repeat-related (Cas) protein (e.g., a dCas protein) or a variant thereof, which is complexed with a guide RNA (gRNA). Also provided are gRNAs for targeting a target site in the IL-2 gene or its regulatory DNA element in lymphoid cells (e.g., T cells or NK cells), where transient epigenetic regulation of gene transcription has been found to enhance the function of lymphoid cells (e.g., T cells or NK cells). Also provided are CRISPR-Cas / gRNA combinations consisting of a gRNA and a nuclease-inactive Cas such as dCas9. Furthermore, polynucleotides encoding DNA targeting systems or fusion proteins of DNA targeting systems, as well as vectors and cells containing them, are also provided. Furthermore, this specification also provides methods using an epigenetically modified DNA targeting system to modulate the transcription or phenotype or function of lymphoid cells (e.g., T cells or NK cells) and the resulting modified cells. Furthermore, this specification also provides methods using an epigenetically modified DNA targeting system to increase the transcription of the IL-2 gene or its regulatory elements. Furthermore, this specification also provides cells, such as lymphoid cells (e.g., T cells or NK cells), that are modified using any of the compositions and / or methods provided herein.

[0112] In some embodiments, the epigenetic modification DNA targeting system comprises at least one DNA targeting module, each DNA targeting module of the system being a component of the DNA targeting system capable of independently targeting one target site of the indicated IL-2 gene or its regulatory element. In some embodiments, each DNA targeting module comprises (a) a DNA-binding domain capable of targeting a target site of the IL-2 gene or regulatory element, and (b) an effector domain capable of increasing (e.g., activating) the transcription of the gene. In some embodiments, the epigenetic modification DNA targeting system comprises a plurality of DNA targeting modules. In some embodiments, the plurality of DNA targeting modules is 2 to 6 DNA targeting modules. In certain embodiments, the plurality of DNA targeting modules is 2 DNA targeting modules. In certain embodiments, the plurality of DNA targeting modules is 3 DNA targeting modules. In certain embodiments, the plurality of DNA targeting modules is 4 DNA targeting modules. In certain embodiments, the plurality of DNA targeting modules is 5 DNA targeting modules.

[0113] In some embodiments, the DNA targeting system includes a single DNA targeting module for targeting activation or increased expression of IL-2. In some embodiments, the DNA targeting module includes (a) a DNA-binding domain that can target a target site of the IL-2 gene or regulatory element, and (b) an effector domain capable of activating gene transcription.

[0114] In some embodiments, the DNA targeting system comprises multiple DNA targeting modules, each of which is intended to target the activation or increased expression of a different target site of the IL-2 gene or its regulatory element. In some embodiments, the DNA targeting system is a multiplex DNA targeting system, i.e., it targets multiple target sites of the IL-2 gene or its regulatory element. Thus, the term DNA targeting system may include a multiplex epigenetic modification DNA targeting system comprising multiple DNA targeting modules. The multiplex epigenetic modification DNA targeting systems provided herein may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 DNA targeting modules. In some embodiments, the multiplex epigenetic modification DNA targeting system comprises 2 to 6 DNA targeting modules. In some embodiments, the multiplex epigenetic modification target comprises 2 DNA targeting modules. In some embodiments, the multiplex epigenetic modification target comprises 3 DNA targeting modules. In some embodiments, the multiplex epigenetic modification target comprises four DNA targeting modules. In some embodiments, the multiplex epigenetic modification target comprises five DNA targeting modules. In some embodiments, the multiplex epigenetic modification target comprises six DNA targeting modules. In some embodiments, the multiple DNA targeting modules target a plurality of (i.e., multiple) target sites of the IL-2 gene or its regulatory elements.

[0115] In some embodiments, any two DNA targeting modules of the DNA targeting system include distinct (i.e., non-overlapping) components. In some embodiments, different DNA targeting modules of the DNA targeting system include distinct (i.e., non-overlapping) components. For example, the DNA targeting system may include a first DNA targeting module comprising a first fusion protein comprising a DNA-binding domain (e.g., a ZFN or TALE-based DNA-binding domain) that targets a first target site, and a second fusion protein comprising a second DNA-binding domain (e.g., a ZFN or TALE-based DNA-binding domain) that targets a second target site.

[0116] In some embodiments, any two DNA targeting modules of a DNA targeting system may include shared (i.e., overlapping) components. In some embodiments, different DNA targeting modules of a DNA targeting system may include shared (i.e., overlapping) components. For example, in one embodiment, the DNA targeting system may include a first DNA targeting module comprising (a) a fusion protein comprising a Cas protein and a transcription effector (e.g., activator) domain, and (b) a first gRNA that complexes with the Cas protein and targets a first target site, and a second DNA targeting module comprising (a) a fusion protein of the first DNA targeting module, and (b) a second gRNA that complexes with the Cas protein and targets a second target site. It will be understood that by providing two or more different gRNAs for a given Cas protein, the same Cas protein can be targeted to the target sites of two or more gRNAs. Conversely, different Cas protein variants (e.g., SpCas9 and SaCas9) are compatible with different gRNA scaffold sequences and PAMs. Therefore, it is possible to manipulate a single DNA targeting system containing multiple non-overlapping CRISPR / Cas-based DNA targeting modules.

[0117] The provided embodiments relate to compositions and methods for enhancing the function of lymphoid cells (e.g., T cells or NK cells), such as the effector function of one or more lymphoid cells (e.g., T cells or NK cells), by epigenetic modification of target sites in the IL-2 gene or its regulatory elements. In some embodiments, the methods may be used in connection with lymphocyte (e.g., T cell) therapy, for example, in connection with adoptive T cell therapy. In some embodiments, the phenotype or function of one or more lymphoid cells (e.g., T cells or NK cells) is increased or improved by increasing the transcription of the IL-2 gene or its regulatory elements. In some embodiments, the effector function of lymphoid cells (e.g., T cells or NK cells) is increased, which increases their ability to produce IL-2. In some embodiments, the effector function of lymphoid cells (e.g., T cells or NK cells) is enhanced, for example, the ability to produce cytokines, such as IL-2 or IFN-γ (IFNg), the ability of lymphoid cells (e.g., T cells or NK cells) to proliferate, the ability of lymphoid cells (e.g., T cells or NK cells) to kill target cells, or the ability of lymphoid cells (e.g., T cells or NK cells) to exhibit a sustained immune response. In certain embodiments, activation of the IL-2 gene or its regulatory elements improves the effector function of lymphoid cells (e.g., T cells or NK cells) after or during stimulation, including a series of stimuli that mimic the repeated state of antigen encounters that occur in vivo.

[0118] The administration of T cells targeting specific antigens, also known as adoptive cell therapy (ACT), is a promising approach to treating diseases such as cancer. However, current ACT treatments face challenges including suboptimal T cell function, proliferation, and persistence. Furthermore, the persistence and functionality of transferred T cells can vary significantly between different T cell subsets and between T cells derived from different patients. Recent clinical trials of ACT suggest that the ability to persist for extended periods in circulation depends on the differentiation stage of T cells, including their ability to retain networks of transcription factors and metabolic regulators (Pilipow K., et.al., Journal of Clinical Investigation Insight 2018;3(18):e122299). T cells transferred to patients are often highly differentiated and therefore unable to persist for extended periods, ultimately limiting an effective antitumor response. For example, while the first CAR-T cell therapy was approved by the FDA as a cell and gene therapy in 2017, patients whose cancer recurs or who do not respond to treatment often suffer from a lack of persistence of CAR T cells (Mueller et al, Blood (2018)). Furthermore, the durable benefits of CAR T cell therapy in solid tumors have not yet been observed.

[0119] Strategies to mitigate these challenges and improve the persistence, proliferation, and antitumor activity of chimeric antigen receptor (CAR)-modified T cells are being tested in preclinical and clinical settings. For example, strategies to optimize ex vivo T cell culture conditions have been explored, including the addition of cytokines during production (Besser MJ, Cytotherapy 2009;11(2):206-17), cytokine and / or receptor expression by CAR T cells (Krenciute G., Cancer Immunol Res. 2017 07;5(7):571-581), the use of proliferating pharmacological inhibitors to inhibit signaling pathways such as AKT (Urak R. et.al., Journal of Immunotherapy Cancer 2017 Mar 21;5:26) or PI3K (Peterson CT et.al., Blood Advances 2018 Feb 13;2(3):210-223), immunodepletion, and checkpoint blockade (Cherkassky L. et.al., Journal of clinical investigation 2016 Aug 1;126(8):3130-44). However, existing strategies are not entirely satisfactory. In some cases, concerns about the emergence of cytokine-induced toxicity or lymphoproliferative disorders as a result of the above strategies raise doubts about alternative approaches.

[0120] The provided embodiments relate to the identification of genomic locations in the IL-2 gene or its regulatory elements that are epigenetically modified in lymphoid cells (e.g., T cells or NK cells) to affect or promote effector function in lymphoid cells (e.g., T cells or NK cells), including when induced in a TCR and / or CAR-inducible or dependent manner, as demonstrated by evaluation of cells that produce IL-2. The provided embodiments relate to the identification of genomic locations that are epigenetically modified in lymphoid cells (e.g., T cells or NK cells) to affect or promote effector function in lymphoid cells (e.g., T cells or NK cells), including when induced in a TCR and / or CAR-inducible or dependent manner, as demonstrated by evaluation of cells that produce IL-2, have the ability to proliferate, or have the ability to kill target cells, including when induced in a T cell-inducible or dependent manner, including when induced in a T cell-inducible or dependent manner, including when induced in a T cell-inducible or dependent manner, including when induced in a T cell-inducible or dependent manner, including when induced in a T cell-inducible or dependent manner, including when induced in a T cell-inducible or dependent manner, as demonstrated by evaluation of cells that produce IL-2, have the ability to proliferate, or have the ability to kill target cells. In some embodiments, the stimulating condition or stimulating factor includes one or more factors, e.g., ligands, capable of activating the intracellular signaling domain of the TCR complex. In some embodiments, the factor turns on or initiates the TCR / CD3 intracellular signaling cascade in T cells. Such factors may include, for example, antibodies conjugated to a solid support such as beads, e.g., those specific to TCR components and / or costimulatory receptors, e.g., anti-CD3, anti-CD28, and / or one or more cytokines. In some embodiments, one or more factors are PMA and ionomycin. In some embodiments, the stimulus (e.g., T cell stimulation) is antigen-specific stimulation, and the cell is stimulated by a factor that is specific to, or provides an antigen or epitope recognized by, an antigen receptor (e.g., CAR) expressed on lymphoid cells (e.g., T cells or NK cells). For example, the stimulating factor may include antigen-expressing target cells. In certain embodiments, the phenotype is, or includes, the production or secretion of cytokines, e.g., IL-2 or IFN-γ, in response to the stimulus (e.g., T cell stimulation).Cytokine production and / or secretion contribute to the immune response and are involved in different processes, including the induction of antiviral proteins and the induction of lymphoid cell proliferation (e.g., T cells or NK cells). Cytokines are not pre-formed factors but are rapidly produced and secreted in response to cell activation. Cytokine production or secretion can be measured, detected, and / or quantified by any suitable technique known in the art.

[0121] In certain embodiments, the function of lymphoid cells (e.g., T cells or NK cells) is the production of one or more cytokines. In certain embodiments, the production of one or more cytokines is measured, detected, and / or quantified by intracellular cytokine staining. Flow cytometry-based intracellular cytokine staining (ICS) is a suitable technique for examining cytokine production at the single-cell level. It detects the production and accumulation of cytokines within cells (e.g., within the endoplasmic reticulum) after cell stimulation, allowing for the identification of cell populations that are positive or negative for the production of specific cytokines, or the separation of high-producing and low-producing cells based on thresholds. ICS can also be used in combination with other flow cytometry protocols for immunophenotyping using cell surface markers, or in combination with MHC multimers, to access cytokine production in specific cell subgroups, making it a flexible and versatile method. Other single-cell techniques for measuring or detecting cytokine production include, but are not limited to, ELSPOT, limiting dilution, and cloning of lymphoid cells (e.g., T cells or NK cells).

[0122] In some embodiments, certain target sites of the present disclosure were identified by a screening method involving transient delivery. This screening method involved transient delivery of a DNA-binding domain-effector fusion protein (also known as an "epieditor") to lymphoid cells (e.g., T cells or NK cells) (i.e., delivery in a manner that results in transient expression and / or presence of the fusion protein in lymphoid cells (e.g., T cells or NK cells)), followed by primary or sequential stimulation of the cells to evaluate the effect on functional lymphoid cell (e.g., T cells or NK cells) cytokines. It has been found herein that transient delivery of epigenetically modified DNA targeting systems enables the identification of genomic targets whose regulation substantially affects the function of lymphoid cells (e.g., T cells or NK cells) without requiring the permanent presence of the epigenetically modified DNA targeting system and / or stable knockdown or knockout of the IL-2 gene or regulatory element. This approach is advantageous because its regulation does not rely on the permanent integration of the editor, such as through lentiviral transduction, thus enabling the identification of target sites that offer a better safety profile. Furthermore, transient screening strategies allow for the identification of target sites with a durable effect of the epigenetic modified DNA targeting system, which is not masked as a result of permanent integration into the genome and expression therefrom. This is in contrast to other screening approaches that employ lentiviral delivery of the DNA system (Schmidt et al. 2022 Science, 375, DOI: 10.1126 / science.abj4008, Freimer et al. 2022 Nature Genetics, 54: 1133-1144).

[0123] The provided embodiments can be used to target the IL-2 gene or its regulatory elements that, when transcriptionally modified by epigenetic modification, can significantly facilitate or promote the function of lymphoid cells (e.g., T cells or NK cells), including effector activity necessary for the persistence and function of lymphoid cells (e.g., T cells or NK cells). Such lymphoid cell (e.g., T cells or NK cells) profiles are expected to result in durable effector function, e.g., the ability to produce IL-2 upon TCR or antigen stimulation. Such lymphoid cell (e.g., T cells or NK cells) profiles are expected to result in durable effector function, have better compatibility / proliferation advantages, and have the ability to produce proliferative cytokines (e.g., IL-2) and / or cytotoxic cytokines (e.g., IFNg) upon TCR or antigen stimulation. In particular, the provided embodiments provide epigenetically modified DNA targeting systems (i.e., “epi-editing systems”) and methods that can provide long-term effector function with better compatibility. This approach provides a substantial clinical solution that avoids problems related to the persistence, suboptimal functionality, and / or exhaustion of lymphoid cells (e.g., T cells or NK cells). Furthermore, since epigenetic modification of cells does not alter DNA at the sequence level, the safety concerns associated with gene editing approaches are avoided. The ability to epigenetically control the differentiation fate of lymphoid cells (e.g., T cells or NK cells) provides a favorable approach to increasing the proportion or number of lymphoid cells (e.g., T cells or NK cells) within a lymphoid cell population (e.g., T cells or NK cells).

[0124] All publications referenced herein, including patent documents, scientific articles, and databases, are incorporated by reference as a whole for all purposes, to the same extent that each individual publication is incorporated by reference individually. If any definitions contained herein conflict with or contradict any definitions contained herein by reference in any patent, application, publication, or other publication incorporated herein by reference, the definitions contained herein shall prevail.

[0125] The section headings used in this specification are for organizational purposes only and should not be construed as limiting the subjects described.

[0126] I. DNA Targeting Systems This specification provides an epigenetic modification DNA targeting system comprising a plurality of DNA targeting modules for increasing the transcription of the interleukin (IL-2) gene, wherein each DNA targeting module comprises a fusion protein comprising (a) a DNA-binding domain for targeting a target site of the IL-2 gene, and (b) at least one transcription activator effector domain. In some embodiments, a DNA targeting system is provided that is capable of specifically targeting a target site of the IL-2 gene or its regulatory element and activating the transcription of the IL-2 gene or its regulatory element. In some embodiments, the DNA targeting system targets one or more target sites of the IL-2 gene or its regulatory element and increases (e.g., activates) the transcription of the gene. In some embodiments, the IL-2 gene is located in lymphoid cells, e.g., T cells. In some embodiments, the IL-2 gene is located in lymphoid cells, e.g., NK cells. In some embodiments, the target site of the IL-2 gene is a target site in the IL-2 gene or its regulatory DNA element. In some embodiments, transcriptional regulation is an increase in the transcription of the IL-2 gene or its regulatory element. In the embodiments provided, with respect to the IL-2 gene or its regulatory element to be targeted, the DNA targeting system comprises a fusion protein comprising a DNA-binding domain that binds to a target site of the gene and an effector domain for increasing the transcription of the IL-2 gene or its regulatory element. In some embodiments, the DNA targeting system provided can regulate, for example, increase the transcription of the IL-2 gene or its regulatory element in cells. In some embodiments, transcriptional regulation of gene expression by the DNA targeting system provided herein can promote or improve the function of lymphoid cells. In certain embodiments, the DNA targeting system provided promotes the function of lymphoid cells (e.g., T cells or NK cells), for example, the effector function of one or more lymphoid cells (e.g., T cells or NK cells), by epigenetically modifying a target site in the IL-2 gene or its regulatory element.

[0127] In some embodiments, at least one effector domain includes a transcription activator effector domain for increasing the transcription of the IL-2 gene or its regulatory element (e.g., activating or increasing gene transcription compared to gene transcription in the absence of a DNA targeting system), for example, any effector domain for transcriptional activation. In some embodiments, the effector domain is a transcription activator effector domain.

[0128] In some embodiments, the effector domain directly or indirectly results in an increase in transcription of the IL-2 gene or its regulatory elements. In some embodiments, the effector domain induces, catalyzes, or results in transcriptional activation. In some embodiments, the effector domain induces transcriptional activation. In some embodiments, the effector domain is a VP64 domain, a p65 activation domain, a p300 domain, an Rta domain, a CBP domain, a VPR domain, a VPH domain, an HSF1 domain, a TET protein domain, optionally comprising a TET protein domain where the TET protein is TET1, a SunTag domain, or any of the aforementioned domains, parts, variants, or abbreviations. In some embodiments, the effector domain is VP64.

[0129] In some embodiments, the DNA targeting system comprises a fusion protein having (a) at least one DNA-binding domain capable of targeting a target site, and (b) at least one effector domain capable of increasing the transcription of the IL-2 gene or its regulatory element. In some embodiments, the at least one effector domain is a transcription activator effector domain. The fusion protein may be, for example, any preferred fusion protein described in Section IF.

[0130] In some embodiments, the DNA-binding domain includes or is derived from a CRISPR-related (Cas) protein, a zinc finger protein (ZFP), a transcription activator-like effector (TALE), a meganuclease, a homing endonuclease, an I-SceI enzyme, or a variant thereof. In some embodiments, the DNA-binding domain includes a catalytically inactive (e.g., nuclease-inactive or nuclease-inactivated) variant of any of the aforementioned. In some embodiments, the DNA-binding domain includes an inactivated Cas9 (dCas9) protein or a variant thereof that is catalytically inactivated to the extent that it is inactive to nuclease activity and cannot cleave DNA. The DNA-binding domain may be any preferred DNA-binding domain described, for example, in sections IC and ID.

[0131] In some embodiments, the DNA-binding domain comprises or is derived from a Cas protein or variant thereof, such as a nuclease-inactive Cas or dCas (e.g., dCas9), and the DNA targeting system comprises one or more gRNAs, such as a combination of guide RNAs (gRNAs) (e.g., two gRNAs or three gRNAs). In some embodiments, the gRNA comprises a spacer sequence capable of targeting and / or hybridizing to a target site. In some embodiments, the gRNA is capable of complexing with a Cas protein or variant thereof. In some embodiments, the gRNA directs or recruits the Cas protein or variant thereof to the target site. The gRNA may be any suitable gRNA described, for example, in Section IC2.

[0132] In some embodiments, the DNA targeting system is for increasing the transcription of the IL-2 gene or its regulatory elements, and the fusion protein of the DNA targeting module is a dCas9-VP64 fusion protein, such as a dCas9-2xVP64 fusion protein. In some embodiments, the fusion protein is one of those described herein, for example, in Section IF.

[0133] Exemplary components and properties of the DNA targeting system are provided below in the following subsections.

[0134] A. DNA targeting module and multiplex DNA targeting system In some embodiments, the epigenetic modification DNA targeting system comprises at least one DNA targeting module, each DNA targeting module of the system being a component of the DNA targeting system capable of independently targeting one target site of the IL-2 gene or its regulatory element. In some embodiments, each DNA targeting module comprises (a) a DNA-binding domain that can be targeted to a target site, and (b) an effector domain for increasing the transcription of the IL-2 gene or its regulatory element. In some embodiments, the DNA-binding domain of at least one DNA-targeting module comprises a clustered and regularly arranged short palindromic sequence repeat-related (Cas) protein, zinc finger protein (ZFP), transcription activator-like effector (TALE), meganuclease, homing endonuclease, or I-SceI enzyme, or a variant thereof, and optionally, the DNA-binding domain comprises any catalytically inactive variant thereof, and if the DNA-binding domain of each fusion protein comprises a Cas protein, the DNA-targeting system further comprises at least two gRNAs, each capable of targeting the Cas protein to a target site.

[0135] In some embodiments, the DNA targeting module is a CRISPR / Cas-based DNA targeting module. In some embodiments, in a CRISPR / Cas-based DNA targeting module, the DNA-binding domain of the fusion protein is a Cas protein or a variant thereof (e.g., a dCas protein such as dCas9), and the DNA targeting module further comprises a gRNA for targeting the DNA-binding domain to a target site.

[0136] In some embodiments, the DNA targeting module is a zinc finger protein (ZFP)-based DNA targeting module. In some embodiments, in a ZFP-based DNA targeting module, the DNA-binding domain of the fusion protein is an engineered zinc finger protein (eZFP).

[0137] In some embodiments, the DNA targeting module is a transcription activator-like effector (TALE)-based DNA targeting module. In some embodiments, in a TALE-based DNA targeting module, the DNA-binding domain of the fusion protein is an engineered TALE.

[0138] In some embodiments, the DNA targeting system comprises multiple DNA targeting modules, each targeting a different target site in the IL-2 gene or its regulatory element. In some embodiments, the DNA targeting system comprises multiple DNA targeting modules, each targeting the same target site in the IL-2 gene or its regulatory element. In some embodiments, the DNA targeting system is a multiplex DNA targeting system. In some embodiments, the multiplex DNA targeting system targets different target sites in the IL-2 gene or its regulatory element. In some embodiments, the multiplex DNA targeting system targets the same target site in the IL-2 gene or its regulatory element. Therefore, the term DNA targeting system may include a multiplex epigenetic modification DNA targeting system comprising multiple DNA targeting modules. In some embodiments, the multiplex epigenetic modification DNA targeting system comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30, or more DNA targeting modules. In some embodiments, the epigenetic modification DNA targeting system includes multiple DNA targeting modules. In some embodiments, the multiple DNA targeting modules consist of 2 to 6 DNA targeting modules. In certain embodiments, the multiple DNA targeting modules consist of 2 DNA targeting modules. In certain embodiments, the multiple DNA targeting modules consist of 3 DNA targeting modules. In certain embodiments, the multiple DNA targeting modules consist of 4 DNA targeting modules. In certain embodiments, the multiple DNA targeting modules consist of 5 DNA targeting modules.

[0139] In some embodiments, any two DNA targeting modules of the DNA targeting system may include separate (i.e., non-overlapping) components. For example, the DNA targeting system may include a first DNA targeting module comprising a first fusion protein having a DNA-binding domain (e.g., a ZFN or TALE-based DNA-binding domain) that targets a first target site, and a second fusion protein having a second DNA-binding domain (e.g., a ZFN or TALE-based DNA-binding domain) that targets a second target site.

[0140] In some embodiments, any two DNA targeting modules of a DNA targeting system may include shared (i.e., overlapping) components. For example, a DNA targeting system may include i) a first DNA targeting module comprising (a) a fusion protein containing a Cas protein and an effector domain, and (b) a first gRNA that complexes with the Cas protein and targets a first target site, and ii) a second DNA targeting module comprising (a) the fusion protein of the first DNA targeting module, and (b) a second gRNA that complexes with the Cas protein and targets a second target site. It will be understood that by providing two or more different gRNAs for a given Cas protein, it becomes possible for the Cas protein to be targeted to the target sites of two or more gRNAs. Conversely, different Cas protein variants (e.g., SpCas9 and SaCas9) are compatible with different gRNA scaffold sequences and PAMs, as described herein. Thus, it is possible to operate a single DNA targeting system comprising multiple non-overlapping CRISPR / Cas-based DNA targeting modules.

[0141] In some embodiments, this specification provides an epigenetic modification DNA targeting system comprising a plurality of DNA targeting modules for increasing the transcription of the IL-2 gene or its regulatory element. In some embodiments, the plurality of DNA targeting modules include a first DNA targeting module for increasing the transcription of the IL-2 gene or its regulatory element by targeting a first target site, and a second DNA targeting module for increasing the transcription of the IL-2 gene or its regulatory element by targeting a second target site. In some embodiments, each DNA targeting module comprises a fusion protein comprising (a) a DNA-binding domain for targeting a first target site of the IL-2 gene or its regulatory element to the DNA targeting module, and (b) at least one effector domain. In some embodiments, each DNA targeting module comprises a transcription activator effector domain for increasing the transcription of the IL-2 gene or its regulatory element.

[0142] B. IL-2 gene target sites for promoting the activation and function of lymphocytes (e.g., T cells or NK cells) In some embodiments, the Specified Information provides target sites of the IL-2 gene or its regulatory elements, in which increased transcription of the IL-2 gene or its regulatory elements promotes the activation or function of lymphoid cells (e.g., T cells or NK cells). In some embodiments, the target sites are targeted using one of the provided DNA targeting systems.

[0143] In some embodiments, the target site is the IL-2 gene or its regulatory element, and increased gene expression promotes the activation or function of lymphoid cells. In some embodiments, the target site is the IL-2 gene or its regulatory element, and increased gene expression promotes the activation or function of lymphoid cells (e.g., T cells or NK cells). In some embodiments, the target site is the IL-2 gene or its regulatory element, and increased gene expression promotes the activation or function of natural killers.

[0144] In some embodiments, the target site is targeted by a DNA targeting system, for example, by a DNA targeting module of a DNA targeting system such as one of those described herein. In some embodiments, the target site is a target site of the IL-2 gene or its regulatory element. In some embodiments, the target site of the IL-2 gene is located in the IL-2 gene itself or in its regulatory DNA element. In some embodiments, the target site is a target site in the IL-2 gene. In some embodiments, the gene is the IL-2 gene or its regulatory element. In some embodiments, the gene is the IL-2 gene or its regulatory element in a cell. In some embodiments, the cell is an immune cell, for example, a T cell or an NK cell. In some embodiments, a multiplex epigenetic modification DNA targeting system is provided that targets a combination of at least two target sites of the IL-2 gene or its regulatory element as described herein.

[0145] In some embodiments, the DNA targeting system targets or binds to a target site in the IL-2 gene or its regulatory element, such as any of those described herein. In some embodiments, the target site is located in the IL-2 gene or its regulatory element. In some embodiments, the regulatory DNA element is a sequence to which a gene regulatory protein can bind and which can affect the transcription of the gene. In some embodiments, the regulatory DNA element is a cis, trans, distal, proximal, upstream, or downstream regulatory DNA element of the gene. In some embodiments, the regulatory DNA element is a distal regulatory element of the gene. In some embodiments, the regulatory DNA element is a proximal regulatory DNA element of the gene. In some embodiments, the regulatory DNA element is an upstream regulatory element of the gene. In some embodiments, the gene is IL-2. In some embodiments, the regulatory DNA element is a promoter or enhancer of the gene. In some embodiments, the target site is located in the promoter, enhancer, exon, intron, untranslated region (UTR), 5'UTR, or 3'UTR of the gene. In some embodiments, the regulatory DNA element is a promoter. In some embodiments, the promoter is a nucleotide sequence to which RNA polymerase binds and to which gene transcription begins. In some embodiments, the promoter is a nucleotide sequence located within approximately 100 bp, 500 bp, 1000 bp, or more from the gene's transcription start site. In some embodiments, the promoter is within 500 bp from the gene's transcription start site. In some embodiments, the target site is located within a sequence of unknown or known function suspected to be able to control gene expression. In some embodiments, the target site is within 50–150 kb (inclusive) upstream of the IL-2 gene.

[0146] 1. Lymphatic cells and regulated effector function In some embodiments, the provided DNA targeting system and / or DNA targeting provides transcriptional activation that increases the expression of the IL-2 gene or its regulatory elements. In some embodiments, the IL-2 gene is a gene whose expression modulates the cellular phenotype. In some embodiments, the IL-2 gene can modulate the phenotype in lymphoid cells (e.g., T cells or NK cells). In some embodiments, increased expression of the IL-2 gene or its regulatory elements modulates the phenotype. In some embodiments, regulated expression of the IL-2 gene promotes increased function of lymphoid cells. In some embodiments, regulated expression of the IL-2 gene promotes increased effector function of T cells upon T cell stimulation. In some embodiments, regulated expression of the IL-2 gene promotes increased effector function of NK cells.

[0147] In some embodiments, the effector function of lymphoid cells is increased compared to lymphoid cells in which IL-2 gene expression is not increased by the provided DNA targeting system. In some embodiments, the effector function of T cells is increased compared to T cells in which IL-2 gene expression is not increased by the provided DNA targeting system. In some embodiments, the effector function of NK cells is increased compared to NK cells in which IL-2 gene expression is not increased by the provided DNA targeting system. Methods for modulating the function of T cells or other lymphoid cells by the provided DNA targeting system are described below and further in Section IV.

[0148] In some embodiments, the IL-2 gene is enhanced by a DNA targeting system, e.g., any DNA targeting system provided herein. In some embodiments, the DNA targeting system is transiently delivered to cells. In some embodiments, for example, delivery of the DNA targeting system by transient delivery promotes increased effector function in modified lymphoid cells. In some embodiments, the effector function of lymphoid cells is increased compared to equivalent lymphoid cells that have not been delivered with the DNA targeting system. In some embodiments, for example, delivery of the DNA targeting system by transient delivery promotes increased effector function in T cells upon T cell stimulation. In some embodiments, the effector function of T cells is increased compared to equivalent T cells that have not been delivered with the DNA targeting system. In some embodiments, for example, delivery of the DNA targeting system by transient delivery promotes increased effector function in natural killer cells. In some embodiments, the effector function of NK cells is increased compared to equivalent NK cells that have not been delivered with the DNA targeting system.

[0149] In some embodiments, transient delivery refers to any delivery method that results in the expression and / or presence of one or more components of a DNA targeting system in a cell for a limited period of time. For example, delivery of mRNA encoding a fusion protein of a DNA targeting system to a cell (e.g., by electroporation) may result in transient expression of the fusion protein in the cell until the mRNA is degraded. In other embodiments, a DNA targeting system may be expressed from one or more nucleic acids encoding the DNA targeting system, and the nucleic acids encoding the DNA targeting system are not integrated into the cell's genome but are eventually degraded and / or removed from the cell so that the expression of the DNA targeting system does not persist. In other embodiments, one or more components of a DNA targeting system, such as a fusion protein and optionally gRNA, may be synthesized in vitro and delivered directly to a cell (e.g., by electroporation) without the need for an expression vector, resulting in transient presence of the DNA targeting system until the fusion protein and / or gRNA are degraded. In some embodiments, transient delivery differs from non-transient delivery methods that result in stable expression, such as methods that involve the integration of an expression vector of the DNA targeting system or its components into the cell's genome.

[0150] In some embodiments, delivery of a DNA targeting system to cells (e.g., lymphoid cells such as T cells or NK cells) via transient delivery promotes a phenotype in the cells (e.g., lymphoid cells such as T cells or NK cells). In some embodiments, the phenotype is increased activation or function in the cells (e.g., lymphocytes such as T cells or NK cells). In some embodiments, delivery of a DNA targeting system to cells (e.g., modified lymphoid cells such as T cells or NK cells) via transient delivery promotes increased activation or function in the cells (e.g., lymphoid cells such as T cells or NK cells). In some embodiments, the phenotype is the function of modified lymphoid cells upon stimulation of modified lymphoid cells. In some embodiments, the phenotype is increased effector function of T cells upon T cell stimulation. In some embodiments, the phenotype is increased effector function of NK cells upon NK cell stimulation. In some embodiments, the function of lymphoid cells is increased compared to lymphoid cells to which the epigenetic DNA targeting system has not been delivered. In some embodiments, the effector function of T cells is increased compared to T cells that have not received an epigenetic DNA targeting system. In some embodiments, the effector function of NK cells is increased compared to NK cells that have not received an epigenetic DNA targeting system. In some embodiments, increased expression (e.g., transcription) of the IL-2 gene or its regulatory elements results in increased effector function of T cells upon T cell stimulation. In some embodiments, increased expression (e.g., transcription) of the IL-2 gene or its regulatory elements results in increased effector function of NK cells. In some embodiments, the effector function of T cells is characterized by IL-2 production. In some embodiments, the effector function of T cells is characterized by activity selected from the group consisting of IL-2 production, IFN-γ production, TNF-α production, T cell proliferation, or any combination thereof. In some embodiments, the effector function of NK cells is characterized by IL-2 production.In some embodiments, the effector function of NK cells is characterized by activity selected from the group consisting of IL-2 production, IFN-γ production, or any combination thereof.

[0151] In some embodiments, the provided DNA targeting system promotes or enhances the effector function of T cells that may occur after stimulation in vitro, ex vivo, or in vivo. In some embodiments, T cell stimulation is polyclonal T cell stimulation. In some embodiments, T cell stimulation is by anti-CD3 and anti-CD28 activating reagents. In some embodiments, T cell stimulation is antigen-specific activity mediated or induced by the specific binding of an antigen to an antigen receptor on the surface of a T cell. In some embodiments, T cells express a chimeric antigen receptor (CAR) or engineered T cell receptor (eTCR) directed toward the antigen, and T cell stimulation is antigen-specific stimulation of the CAR or eTCR. In some embodiments, T cell stimulation is by an antigen-expressing target cell. In some embodiments, T cell stimulation occurs when a T cell comes into contact with a cell expressing an antigen. In some embodiments, T cell stimulation is restimulation of a T cell after at least one previous T cell stimulation. In some embodiments, T cells are stimulated, and then a provided DNA targeting system is transiently delivered to them before evaluation of the T cell effector function or phenotype.

[0152] In certain embodiments, a cell composition containing T cells is stimulated with an anti-CD3 / anti-CD28 activating reagent for a certain period of time, and effector function is measured at one or more time points during or after incubation. In some embodiments, such activating reagent has anti-CD3 / anti-CD28 coated on a support such as magnetic beads or other matrix. Exemplary activating reagents are Dynabeads® or T Cell TransAct®. In some embodiments, T cells are incubated with the activating reagent for a time of 3 to 72 hours, e.g., 12 to 48 hours, e.g., 12, 18, 24, 36, or 48 hours, or any value in between the aforementioned. In some embodiments, cells may be directly evaluated for effector function, such as cytokine production or the ability to proliferate. In some embodiments, the culture supernatant may be collected and the amount of soluble factors, e.g., cytokines, may be detected. In some embodiments, T cells may be collected and re-exposed to the activating reagent to monitor cytolytic activity. In some embodiments, cells may be restimulated one or more times by a continuous stimulation method, and the effector function after each stimulation may be evaluated sequentially.

[0153] In certain embodiments, antigen-specific activity is measured by incubating a cell composition containing lymphoid cells (e.g., T cells or NK cells) expressing an antigen receptor, e.g., CAR, with antigen-expressing cells for a certain period of time, and effector function is measured at one or more time points during or after incubation. In some embodiments, lymphoid cells (e.g., T cells or NK cells) are incubated with antigen-specific factors, e.g., antigen-expressing cells, for a period of time between 3 and 96 hours, e.g., 12 to 72 hours, e.g., 12, 24, 48, 72 hours, or any value in between the aforementioned. In some embodiments, cells may be directly evaluated for effector function, such as the ability to produce cytokines or proliferate. In some embodiments, the culture supernatant may be collected and the amount of soluble factors, e.g., cytokines, may be detected. In some embodiments, lymphoid cells (e.g., T cells or NK cells) may be collected and re-exposed to antigen-expressing target cells to monitor cell killing (cytolytic activity) of the target cells. In some embodiments, cells may be restimulated one or more times by a sequential stimulation method, and effector function after each stimulation may be evaluated sequentially. In some embodiments, lymphoid cells (e.g., T cells or NK cells) having an engineered antigen receptor (e.g., CAR) are incubated with a certain number of antigen-expressing cells in an effector-to-target (E:T) ratio of 1:4 to 4:1, for example, a ratio of 1:4, 1:3, 1:2, or 1:1.

[0154] In some embodiments, lymphoid cells (e.g., T cells or NK cells) exhibit increased cytokine production. In some embodiments, the increase in cytokine production occurs upon T cell stimulation. In some embodiments, the effector function of T cells is characterized by cytokine production. In some embodiments, the effector function of natural killer cells is characterized by cytokine production. In some embodiments, cytokine production increases by at least about 1.1, 1.2, 1.3, 1.4, 1.5, 2, 5, 10, 50, 100, or more compared to cells to which the epigenetic modified DNA targeting system has not been delivered. In some embodiments, cytokine production is IL-2 production. In some embodiments, cytokine production is IL-2, IFN-γ, TNF-α, or a combination thereof. In some embodiments, the effector function of T cells is characterized by IL-2 production. In some embodiments, cells (e.g., T cells) exhibit increased IL-2 production. In some embodiments, the effector function of T cells is characterized by IFN-γ production. In some embodiments, cells (e.g., T cells) exhibit increased IFN-γ production. In some embodiments, the effector function of T cells is characterized by IL-2 production and IFN-γ production. In some embodiments, cells (e.g., T cells) exhibit increased IL-2 production and IFN-γ production. In some embodiments, the effector function of T cells is characterized by multifunctional production of IL-2, IFN-γ, and TNF-α. In some embodiments, cells (e.g., T cells) exhibit increased IL-2, IFN-γ, and TNF-α production.

[0155] In some embodiments, the effector function of NK cells is characterized by IL-2 production. In some embodiments, cells (e.g., NK cells) show increased IL-2 production. In some embodiments, the effector function of natural killer cells is characterized by IFN-γ production. In some embodiments, cells (e.g., NK cells) show increased IFN-γ production. In some embodiments, the effector function of NK cells is characterized by IL-2 production and IFN-γ production. In some embodiments, cells (e.g., NK cells) show increased IL-2 production and IFN-γ production. In some embodiments, the effector function of NK cells is characterized by multifunctional production of IL-2, IFN-γ, and TNF-α. In some embodiments, cells (e.g., NK cells) show increased IL-2, IFN-γ, and TNF-α production.

[0156] Suitable techniques for measuring the production or secretion of soluble factors such as cytokines are known in the art. The production and / or secretion of soluble factors can be measured by determining the extracellular concentration or amount of the factor, or by determining the amount of transcriptional activity of the gene encoding the factor. Suitable techniques include, but are not limited to, immunoassays, aptamer-based assays, histological or cytological assays, mRNA expression level assays, enzyme-linked immunosorbent assays (ELISA), immunoblotting, immunoprecipitation, radioimmunoassays (RIA), immunostaining, flow cytometry assays, surface plasmon resonance (SPR), chemiluminescence assays, lateral flow immunoassays, inhibitory assays or avidity assays, protein microarrays, high-performance liquid chromatography (HPLC), Meso-Scale Discovery (MSD) electrochemiluminescence, and bead-based multiplex immunoassays (MIA). In some embodiments, suitable techniques may use detectable conjugate reagents that specifically bind to the soluble factor.

[0157] In some embodiments, cytokine production is measured as the percentage of cells positive for cytokines, for example, by intracellular cytokine staining (ICS) and flow cytometry. Intracellular cytokine staining (ICS) by flow cytometry is a suitable technique for examining cytokine production at the single-cell level. It detects cytokine production and accumulation in the endoplasmic reticulum after cell stimulation, allowing for the identification of cell populations that are positive or negative for the production of specific cytokines, or the separation of high-producing and low-producing cells based on thresholds. ICS can also be used in combination with other flow cytometry protocols for immunophenotyping using cell surface markers, or in combination with MHC multimers, to access cytokine production in specific cell subgroups, making it an extremely flexible and versatile method. Other single-cell techniques for measuring or detecting cytokine production include, but are not limited to, ELSPOT, limiting dilution, and T cell cloning.

[0158] In some embodiments, cytokine production is measured as the amount of cytokines secreted from cells, for example, by ELISA (enzyme-linked immunosorbent assay). ELISA is a plate-based assay technique designed to detect and quantify substances such as peptides, cytokines, antibodies, and hormones. In ELISA, soluble factors such as cytokines must be immobilized on a solid-phase surface and then complexed with an enzyme-linked antibody. Detection is achieved by evaluating the binding enzyme activity through incubation with a substrate that produces a detectable signal.

[0159] In some embodiments, the effector function of lymphoid cells (e.g., T cells or NK cells) is characterized by activity that further includes the proliferation of lymphoid cells (e.g., T cells or NK cells). In some embodiments, the cells (e.g., T cells or NK cells) exhibit increased proliferation. In some embodiments, the increase in proliferation occurs upon T cell stimulation. In some embodiments, the proliferation increases by at least about 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 2 times, 5 times, 10 times, 50 times, 100 times, or more, compared to cells that have not been delivered with the epigenetic modified DNA targeting system. In some embodiments, proliferation is measured as an increase in the number of cells before and after stimulation. In some embodiments, the increase in proliferation is measured as the number of cells after stimulation in a cell population that has been delivered with the epigenetic modified DNA targeting system compared to the number of cells after stimulation in a cell population that has not been delivered with the epigenetic modified DNA targeting system. In some embodiments, the cells (e.g., T cells or NK cells) do not exhibit increased proliferation.

[0160] In some embodiments, the effector function of lymphoid cells (e.g., T cells or NK cells) is characterized by activity that further includes target cell killing. In some embodiments, the cells (e.g., T cells or NK cells) exhibit increased target cell killing. In some embodiments, the increased target cell killing occurs upon T cell stimulation. In some embodiments, stimulation is carried out by bringing the cells (e.g., T cells or NK cells) into contact with the target cells. In some embodiments, lymphoid cells (e.g., T cells or NK cells) are incubated with antigen-expressing target cells in a ratio of 4:1 to 1:4 (inclusive), e.g., 1:4, 1:3, 1:2, or 1:1. In some embodiments, target cell killing is increased by at least about 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 2 times, 5 times, 10 times, 50 times, 100 times, or more compared to cells to which the epigenetic modified DNA targeting system has not been delivered. In some embodiments, killing is measured as the ability of a cell to kill a target cell when it comes into contact with the target cell.

[0161] In some embodiments, the effector function of natural killer cells is characterized by activity that further includes target cell killing. In some embodiments, cells (e.g., natural killer cells) exhibit increased target cell killing. In some embodiments, the increased target cell killing occurs upon natural killer cell stimulation. In some embodiments, stimulation is carried out by bringing cells (e.g., natural killer cells) into contact with target cells. In some embodiments, natural killer cells are incubated with antigen-expressing target cells in a ratio of 4:1 to 1:4 (inclusive), e.g., 1:4, 1:3, 1:2, or 1:1. In some embodiments, target cell killing is increased by at least about 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 2 times, 5 times, 10 times, 50 times, 100 times, or more compared to cells to which the epigenetic modified DNA targeting system has not been delivered. In some embodiments, killing is measured as the ability of cells to kill target cells when in contact with them.

[0162] Target cell killing can be measured, for example, by any suitable assay described in the examples herein. In some embodiments, killing is measured by an in vitro assay, where cells to which the epigenetic modified DNA targeting system has been delivered are co-cultured with target cells, and the number of target cells is measured over time. In some embodiments, a reduction in the number and / or proliferation of target cells indicates target cell killing. Cell lysis activity can be measured by directly or indirectly measuring the number of target cells over time. For example, target cells may be incubated with a detectable marker, e.g., a marker detectable after target cells have lysed, or a detectable marker detectable in viable target cells, before being incubated with antigen receptor (e.g., CAR) expressing cells. These readouts directly or indirectly provide the number of target cells and / or target cell death, which can be measured at different time points in the assay. A decrease in the number of target cells and / or an increase in target cell death indicates the cell lysis activity of the cells. Suitable methods for performing cell lysis assays are known in the art and include, but are not limited to, chromium-51 release assays, non-radioactive chromium assays, and flow cytometry assays using fluorescent dyes such as carboxyfluorescein succinimimidyl ester (CFSE), PKH-2, and PKH-26.

[0163] In some embodiments, the effector function of lymphoid cells (e.g., T cells or NK cells) is characterized by activity that further includes persistence of lymphoid cells (e.g., T cells or NK cells). In some embodiments, cells (e.g., T cells or NK cells) exhibit increased persistence (e.g., persistence of T cells or NK cells). In some embodiments, persistence relates to the ability of cells to remain present in the presence of target cells and / or to maintain an immune response. In some embodiments, persistence may be measured in vitro or in vivo, for example, after administration of cells to a subject. Persistence may be measured by any preferred method described, for example, in Section IV.

[0164] In certain embodiments, the ability of lymphoid cells (e.g., T cells or NK cells) to persist can be measured as a pharmacokinetic property of the cell composition after administration to a subject. In some embodiments, pharmacokinetic parameters may include exposure, number, concentration, persistence, and proliferation. In some cases, pharmacokinetics may be measured as the peak plasma concentration (C) after administration. max ), peak time (i.e., maximum plasma concentration (C) max The time when ) occurred, T max ), minimum plasma concentration (i.e., minimum plasma concentration between administrations of therapeutic agents, e.g., CAR+ T cells, C min ), elimination half-life (T 1 / 2 ), and parameters such as area under the curve (i.e., area under the curve, AUC, generated by plotting the time-versus-plasma concentration of the therapeutic agent CAR+ T cells) can be evaluated by measuring these parameters. Parameters of administered manipulated lymphoid cells (e.g., NK cells or T cells) can be measured in a blood sample from the subject. For example, nucleic acid-based methods such as quantitative PCR (qPCR), or flow cytometry-based methods, or other assays such as immunoassays, ELISA, or chromatography / mass spectrometry-based assays can be used.

[0165] In some embodiments, nucleic acid-based methods such as quantitative PCR (qPCR) are used to assess the number of cells expressing an antigen receptor (e.g., CAR-expressing cells administered for T-cell-based therapy) in a sample of blood, serum, organ, or tissue of interest (e.g., a disease site, e.g., a tumor sample). In some embodiments, persistence is quantified as the number of receptor-expressing cells (e.g., CAR-expressing cells) per microgram of DNA, e.g., copies of CAR-encoding DNA or plasmid, or per microliter of blood or serum sample, or per microliter of peripheral blood mononuclear cells (PBMCs) or leukocytes or lymphoid cells (e.g., T cells or NK cells), e.g., the number of CAR-expressing cells. In some embodiments, primers or probes used in qPCR or other nucleic acid-based methods are specific to bind to, recognize, and / or amplify the nucleic acid encoding the antigen receptor, and / or regulatory elements, e.g., promoters, transcriptional and / or post-transcriptional regulatory elements, or response elements, or other components or elements of plasmids and / or vectors, including markers, e.g., surrogate markers. In some embodiments, the primer may be specific to a regulatory element such as a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0166] In some embodiments, any of the phenotypes described herein, for example, increased IL-2 production, is observed after stimulation (e.g., T cell stimulation). In some embodiments, any of the phenotypes described herein, for example, increased IL-2 production, increased IFN-γ production, increased IL-2 production and increased IFN-γ production, increased IL-2, IFN-γ and TNF-α production, increased or unincreased proliferation, increased target cell killing, and / or increased persistence, is observed after stimulation (e.g., T cell stimulation).

[0167] In some embodiments, phenotypes such as any of the phenotypes described herein, including increased effector function of lymphoid cells (e.g., T cells or NK cells), occur 48 hours or more after transient delivery of the epigenetically modified DNA targeting system to lymphoid cells (e.g., T cells or NK cells). In some embodiments, phenotypes such as increased effector function of lymphoid cells (e.g., T cells or NK cells) occur up to 6 days, 9 days, 12 days, 15 days, 21 days, 28 days, 35 days, 42 days, 49 days, 56 days, 63 days, 71 days, or longer after transient delivery of the epigenetically modified DNA targeting system to lymphoid cells (e.g., T cells or NK cells).

[0168] In some embodiments, the phenotype is characterized by the cell surface phenotype of the cells. In some embodiments, the phenotype includes the expression of IL-2+. In some embodiments, the phenotype includes the expression of one or more cell surface markers selected from IL-2+, TNFa+, IFNg+, or any combination thereof. In some embodiments, the phenotype is the phenotype in lymphoid cells (e.g., T cells or NK cells) such as CD3+ T cells, which may be CD4+ T cells or CD8+ T cells. Therefore, in some embodiments, the phenotype includes the expression of one or more cell surface markers selected from CD3+, CD4+, CD8+, IL-2+, TNFa+, IFNg+, or any combination thereof. In some embodiments, the phenotype includes the expression of IL-2+. In some embodiments, the phenotype includes the expression of IL-2+ and IFNg+.

[0169] It is understood that the embodiments of the epigenetic modification DNA targeting system provided are not limited to increasing (e.g., activating) the expression of the IL-2 gene or its regulatory elements in T cells and promoting a specific phenotype. In addition to T cells, lymphoid cells may include NK cells, NKT cells, any cells differentiated from stem cells into such lymphoid cells, and / or any cells differentiated from progenitor cells, e.g., common lymphoid progenitor cells (CLPs). In some embodiments, lymphoid cells differentiate from stem cells, e.g., hematopoietic stem cells or progenitor cells, or progenitor cells. In some embodiments, lymphoid cells transdifferentiate from non-hematopoietic non-pluripotent cells.

[0170] In some embodiments, the lymphoid cells for regulation are isolated or enriched populations of lymphoid immune cells, e.g., isolated or enriched populations of T cells, NK cells, and / or NKT cells. In some embodiments, the cells for regulation are isolated or enriched T cells. In some embodiments, the cells for regulation are isolated or enriched NK cells. In some embodiments, the cells for regulation are isolated or enriched NK T cells. In some embodiments, an isolated or enriched population or subpopulation of immune cells, including T cells, NK cells, and / or NKT cells for regulation, can be obtained from a single unit of blood using any number of techniques known to those skilled in the art, such as Ficoll® isolation. In one embodiment, T cells, NK cells, or NKT cells derived from the circulating blood of an individual are obtained by apheresis and isolated from other nucleated leukocytes, erythrocytes, and platelets by Ficoll® isolation or affinity-based selection, etc. In some embodiments, the cells are primary cells. In some embodiments, primary cells are isolated or enriched from a peripheral blood sample derived from a subject, such as a human subject.

[0171] In some embodiments, lymphoid cells for regulation are differentiated in vitro from stem cells or progenitor cells. In some embodiments, lymphoid cells, such as T cells, NK cells, or NKT cells, or their lineage, may be differentiated from stem cells, hematopoietic stem cells or progenitor cells (HSCs), or progenitor cells. Progenitor cells may be CD34+ hematopoietic endothelial cells, pluripotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, or NKT cell progenitor cells. In some embodiments, progenitor cells are lymphoid progenitor cells, such as common lymphoid progenitor cells, early thymic progenitor cells, pre-T cell progenitor cells, pre-NK progenitor cells, T progenitor cells, NK progenitor cells, or NKT progenitor cells. Stem cells may be pluripotent stem cells such as induced pluripotent stem cells (iPSCs) and embryonic stem cells (ESCs). iPSCs are reprogrammed pluripotent cells that do not exist naturally. Once the target cells are reprogrammed into a pluripotent state, they can then be programmed or differentiated into a desired cell type or subtype, such as T cells, NK cells, or NKT cells.

[0172] In some embodiments, iPSCs are differentiated into T cells, NK cells, or NKT cells by a multi-step differentiation platform, where cells at various developmental stages can be induced to exhibit a hematopoietic phenotype ranging from fully differentiated T cells, NK cells, or NKT cells from mesodermal stem cells (see, for example, U.S. Patent No. 10,626,372).

[0173] In some embodiments, a population or subpopulation of lymphoid cells is transdifferentiated in vitro from non-hematopoietic fate non-pluripotent cells to hematopoietic cells, or from non-pluripotent cells of a first hematopoietic cell type to a different hematopoietic cell type, which may be a specific type of fully differentiated immune cell such as T cells, NK cells, or NKT progenitor cells (see, for example, U.S. Patent No. 9,376,664 and U.S. Patent Application No. 15 / 072,769, the disclosures of which are incorporated herein in their entirety). In some embodiments, non-hematopoietic fate non-pluripotent cells are somatic cells such as cutaneous fibroblasts, adipose tissue-derived cells, and human umbilical vein endothelial cells (HUVECs). Somatic cells useful for transdifferentiation may be immortalized somatic cells.

[0174] To induce pluripotency or increase potency in cells (Takahashi, K., and Yamanaka, S., Cell 126, 663-676 (2006), Takahashi et al., Cell 131, 861-872 (2007), Yu et al., Science 318, 1917-1920 (2007), Zhou et al., Cell Stem Cell 4, 381-384 (2009), Kim et al., Cell Stem Cell 4, 472-476 (2009), Yamanaka et al., 2009, Saha, K., Jaenisch, R., Cell Stem Cell 5, 584-595 (2009)), and to improve the efficiency of reprogramming (Shi et al., Cell Stem Cell 2, 525-528 (2008a), Shi et al., Cell Stem Cell 3,568-574(2008b), Huangfu et al., Nat Biotechnol 26,795-797(2008a), Huangfu et al., Nat Biotechnol 26,1269-1275(2008b), Silva et al., Plos Bio 6,e253.Doi:10.1371 / journal.Pbio.0060253(2008), Lyssiotis et al., PNAS 106,8912-8917(2009), Ichida et al., Cell Stem Cell 5,491-503(2009), Maherali, N., Hochedlinger, K., Curr Biol Various strategies have been explored (19, 1718-1723 (2009b), Esteban et al., Cell Stem Cell 6, 71-79 (2010), and Feng et al., Cell Stem Cell 4, 301-312 (2009)), and these disclosures are incorporated herein by reference in their entirety.

[0175] Cells that are positive (+) for a particular cell surface marker are understood to be cells that express the marker on their surface at a detectable level. Similarly, cells that are negative (-) for a particular cell surface marker are understood to be cells that express the marker on their surface at an undetectable level. Antibodies and other binding entities can be used to detect the expression level of the marker protein to identify or detect a given cell surface marker. Suitable antibodies may include polyclonal, monoclonal, fragment (e.g., Fab fragment), single-chain antibodies, and other forms of specific binding molecules. Antibody reagents for the above cell surface markers are readily known to those skilled in the art. Several well-known methods for evaluating the expression level of a surface marker or protein may be used, such as affinity-based methods, e.g., immunoaffinity-based methods, e.g., detection by flow cytometry in relation to the surface marker. In some embodiments, the label is a fluorophore, and the method for detecting or identifying the cell surface marker on a cell (e.g., a T cell or NK cell) is by flow cytometry. In some embodiments, different labels are used for each of the different markers by multicolor flow cytometry. In some embodiments, surface expression can be determined by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting the binding of the antibody to the marker.

[0176] In some embodiments, cells (e.g., T cells or NK cells) are positive (pos or +) for a particular marker if that marker, which may be an intracellular or surface marker, is detectably present on or within the cell. In some embodiments, surface expression is positive if flow cytometry staining is detectable at a level substantially higher than staining detected using isotype-matched controls under otherwise identical conditions and procedures, and / or at a level substantially similar to, or possibly higher than, that of cells known to be positive for the marker, and / or at a level higher than that of cells known to be negative for the marker.

[0177] In some embodiments, cells (e.g., T cells or NK cells) are negative (neg or -) for a particular marker if that marker, which may be an intracellular or surface marker, is not detectably present on or within the cell. In some embodiments, surface expression is negative if the staining is not detectable by flow cytometry at a level substantially higher than the staining detected using an isotype-matched control under otherwise identical conditions and the same procedure, and / or at a level substantially lower than that of cells known to be positive for the marker, and / or at a level substantially similar to that of cells known to be negative for the marker.

[0178] In some embodiments, the phenotype may be characterized by one or more functions of the cell. In some embodiments, the phenotype is characterized by the multifunctional activity of a lymphoid cell (e.g., a T cell or NK cell) producing multiple lymphoid cell (e.g., a T cell or NK cell) stimulating cytokines, as determined in a multifunctional cytokine secretion assay after stimulation of lymphoid cells with a stimulating factor. In some embodiments, the lymphoid cell (e.g., a T cell or NK cell) is multifunctional to produce two or more cytokines. In some embodiments, the lymphoid cell (e.g., a T cell or NK cell) is multifunctional to produce two or more cytokines selected from interferon-gamma (IFN-γ), interleukin-2 (IL-2), and TNF-α. In some embodiments, the multifunctional lymphoid cell (e.g., a T cell or NK cell) produces IFN-γ, IL-2, and TNF-α. In some embodiments, the stimulating factor is a nonspecific or non-antigen-dependent lymphoid cell stimulating factor. In some embodiments, the nonspecific or non-antigen-dependent lymphoid cell stimulator is a polyclonal stimulator. In some embodiments, the nonspecific or non-antigen-dependent stimulator includes PMA / ionomycin, anti-CD3 / anti-CD28, phytohemagglutinin (PHA), or concanavalin A (ConA). In some embodiments, the nonspecific or non-antigen-dependent lymphoid cell stimulator contains PMA / ionomycin.

[0179] In certain embodiments, the production of one or more cytokines is measured, detected, and / or quantified by intracellular cytokine staining. Flow cytometry-based intracellular cytokine staining (ICS) is a suitable technique for examining cytokine production at the single-cell level. It detects cytokine production and accumulation in the endoplasmic reticulum after cell stimulation, allowing for the identification of cell populations that are positive or negative for the production of specific cytokines, or the separation of high-producing and low-producing cells based on thresholds. In some embodiments, as described above, stimulation can be carried out using non-specific stimuli, such as antigen-specific stimuli. For example, PMA / ionomycin can be used for non-specific cell stimulation. ICS can also be used in combination with other flow cytometry protocols for immunophenotyping using cell surface markers, or in combination with MHC multimers, to access cytokine production in specific cell subgroups, making it an extremely flexible and versatile method. Other single-cell techniques for measuring or detecting cytokine production include, but are not limited to, ELSPOT, limiting dilution, and T cell cloning. In some embodiments, assays for assaying the multifunctional cytokine secretion of multiple cytokines may include multiplex assays or other assays for evaluating multifunctionality (see, for example, Xue et al., (2017) Journal for ImmunoTherapy of Cancer 5:85).

[0180] 2. Target sites for increasing IL-2 transcription In some embodiments, delivery of a DNA targeting system increases the transcription of the IL-2 gene or its regulatory element. In some embodiments, the target site is described herein as a target site of IL-2 where the increased transcription promotes a phenotypic effect in cells. In some embodiments, the target site may be located on the IL-2 gene itself or be a regulatory DNA element of IL-2 as described herein. In some embodiments, the target site is provided herein as a target site of the IL-2 gene or its regulatory DNA element where the increased transcription promotes an increase in the effector function of lymphoid cells (e.g., T cells or NK cells). In some embodiments, the increased transcription promotes an increase in the effector function of lymphoid cells (e.g., T cells or NK cells) upon cell stimulation (e.g., T cell stimulation).

[0181] In some embodiments, each target site of the epigenetic modification DNA targeting system is located within the genomic coordinates GRCh38(hg38)chr4:122,451,261~122,593,946 of the human genome assembly. In some embodiments, each target site is located in the putative regulatory region of the IL-2 gene, characterized by having one or more of the following: epigenetic marks, regulatory properties, or transcription factor motifs. In some embodiments, the putative regulatory region is a promoter or enhancer. In some embodiments, the target site is located in a promoter or enhancer.

[0182] In some embodiments, the DNA targeting system includes a plurality of DNA targeting modules. In some embodiments, each DNA targeting module targets a target site. In some embodiments, the plurality of DNA targeting modules target at least a first target site and a second target site of the IL-2 gene or its regulatory element. In some embodiments, the second target site is different from the first target site. In some embodiments, the second target site is the same as the first target site.

[0183] In some embodiments, multiple DNA targeting modules target at least a first target site, a second target site, and a third target site of the IL-2 gene or its regulatory element. In some embodiments, the first, second, and third target sites are all different from each other.

[0184] In some embodiments, the DNA targeting system targets a combination of target sites of the IL-2 gene or regulatory element described herein for transcriptional activation. In some embodiments, the target site is located within the genomic coordinates GRCh38(hg38)chr4:122,451,261~122,593,946 of the human genome assembly. In some embodiments, the target site is located on a gene or a regulatory DNA element of a gene. In some embodiments, the target site is located on the IL-2 gene body. In some embodiments, the target site is located on the IL-2 locus. In some embodiments, the target site is a regulatory element located on the IL-2 locus. In some embodiments, the regulatory element is a sequence to which a gene regulatory protein can bind and which can affect the transcription of the gene. In some embodiments, the regulatory DNA element is a cis, trans, distal, proximal, upstream, or downstream regulatory DNA element of the gene. In some embodiments, the regulatory DNA element is a cis, trans, distal, proximal, upstream, or downstream regulatory DNA element of the IL-2 gene.

[0185] In some embodiments, there are seven identified target regions within the IL-2 locus. In some embodiments, the target region exhibits features that indicate a regulatory region. In certain embodiments, the features may be epigenetic marks. In certain embodiments, the features may be regulatory properties. In certain embodiments, the features may be associated transcription factor (TF) motifs.

[0186] In some embodiments, the target site is located on the IL-2 gene itself. In some embodiments, the target site is within 100 kb of the IL-2 transcription start site (TSS). In some embodiments, the target site is 50 to 150 kilobases (kb) upstream of the IL-2 gene and the IL-2 transcription start site (TSS). In some embodiments, the target site is a regulatory DNA element of the IL-2 gene, located 50 to 150 kb upstream of the IL-2 gene and the IL-2 TSS.

[0187] In some embodiments, each target site of the epigenetic modified DNA targeting system is independently (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,488,8 The genome coordinates selected from the groups consisting of (40-122,491,890), (5)122,507,000-122,508,985, (6)chr4:122,539,300-122,544,050, and (7)chr4:122,576,890-122,579,315 are located within the target region corresponding to the human genome assembly GRCh38 (hg38). In some embodiments, each target site of the epigenetic modification DNA targeting system is independently located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0188] In some embodiments, the target site is located on the IL-2 gene itself. In some embodiments, the target site is within 100 kb of the IL-2 transcription start site (TSS). In some embodiments, the target site is located within GRCh38(hg38)chr4:122,451,000–122,460,000. In some embodiments, the target site is located in the region of interest identified as region 1. In some embodiments, the target site includes the sequence described in SEQ ID NO: 12, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 12 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 12. In some embodiments, the target site is as described in SEQ ID NO: 12. In some embodiments, the target site includes the sequence described in SEQ ID NO: 14, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 14 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 14. In some embodiments, the target site is as described in SEQ ID NO: 14.In some embodiments, the target site includes the sequence described in SEQ ID NO: 16, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 16 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 16. In some embodiments, the target site is as described in SEQ ID NO: 16. In some embodiments, the target site includes the sequence described in SEQ ID NO: 18, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 18 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 18. In some embodiments, the target site is as described in SEQ ID NO: 18. In some embodiments, the target site includes the sequence described in Sequence ID No. 20, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity.In some embodiments, the target site is a contiguous portion of Sequence ID No. 20 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in Sequence ID No. 20. In some embodiments, the target site is as described in Sequence ID No. 20. In some embodiments, the target site includes the sequence described in Sequence ID No. 43, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of Sequence ID No. 43 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in Sequence ID No. 43. In some embodiments, the target site is as described in Sequence ID No. 43. In some embodiments, the target site includes the sequence described in Sequence ID No. 45, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 45 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 45. In some embodiments, the target site is as described in SEQ ID NO: 45.In some embodiments, the target site includes the sequence described in SEQ ID NO: 47, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 47 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 47. In some embodiments, the target site is as described in SEQ ID NO: 47.

[0189] In some embodiments, the target site is located within the genomic coordinates GRCh38(hg38)chr4:122,465,000–122,472,000. In some embodiments, the target site is located within the genomic coordinates GRCh38(hg38)chr4:122,479,410–122,482,750. In some embodiments, the target site is located within the genomic coordinates GRCh38(hg38)chr4:122,488,840–122,491,890.

[0190] In some embodiments, the target site is located 50–150 kilobases (KB) upstream of the IL-2 gene and the IL-2 transcription start site (TSS). In some embodiments, the target site is a regulatory DNA element of the IL-2 gene, located 50–150 kb upstream of the IL-2 gene and the IL-2 TSS. In some embodiments, the regulatory DNA element is a distal regulatory element of the IL-2 gene. In some embodiments, the regulatory DNA element is an upstream regulatory element of the IL-2 gene. In some embodiments, the target site is located within the genomic coordinates human genome assembly GRCh38(hg38)chr4:122,507,000–122,508,985. In some embodiments, the target site is located in a region of interest identified as region 4. In some embodiments, the target site includes the sequence described in SEQ ID NO: 22, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 22 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 22. In some embodiments, the target site is as described in SEQ ID NO: 22. In some embodiments, the target site includes the sequence described in Sequence ID No. 24, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity.In some embodiments, the target site is a contiguous portion of SEQ ID NO: 24 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 24. In some embodiments, the target site is as described in SEQ ID NO: 24. In some embodiments, the target site includes the sequence described in SEQ ID NO: 26, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of Sequence ID No. 26 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in Sequence ID No. 26. In some embodiments, the target site is as described in Sequence ID No. 26. In some embodiments, the target site includes the sequence described in Sequence ID No. 49, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 49 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 49. In some embodiments, the target site is as described in SEQ ID NO: 49.In some embodiments, the target site includes the sequence described in SEQ ID NO: 51, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 51 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 51. In some embodiments, the target site is as described in SEQ ID NO: 51. In some embodiments, the target site includes the sequence described in SEQ ID NO: 53, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 53 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 53. In some embodiments, the target site is as described in SEQ ID NO: 53. In some embodiments, the target site includes the sequence described in Sequence ID No. 55, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity.In some embodiments, the target site is a contiguous portion of SEQ ID NO: 55 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 55. In some embodiments, the target site is as described in SEQ ID NO: 55. In some embodiments, the target site includes the sequence described in SEQ ID NO: 186, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of sequence number 186 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in sequence number 186. In some embodiments, the target site is as described in sequence number 186. In some embodiments, the target site includes the sequence described in sequence number 187, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 187 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 187. In some embodiments, the target site is as described in SEQ ID NO: 187.In some embodiments, the target site includes the sequence described in SEQ ID NO: 188, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 188 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 188. In some embodiments, the target site is as described in SEQ ID NO: 188.

[0191] In some embodiments, the target site is located within the genomic coordinates GRCh38(hg38)chr4:122,539,300~122,544,050 of the human genome assembly. In some embodiments, the target site is located in the region of interest identified as region 5. In some embodiments, the target site includes the sequence described in Sequence ID No. 28, its contiguous portion of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of Sequence ID No. 28 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in Sequence ID No. 28. In some embodiments, the target site is as described in Sequence ID No. 28. In some embodiments, the target site includes the sequence described in Sequence ID No. 30, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 30 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 30. In some embodiments, the target site is as described in SEQ ID NO: 30.In some embodiments, the target site includes the sequence described in SEQ ID NO: 32, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 32 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 32. In some embodiments, the target site is as described in SEQ ID NO: 32. In some embodiments, the target site includes the sequence described in SEQ ID NO: 57, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 57 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 57. In some embodiments, the target site is as described in SEQ ID NO: 57. In some embodiments, the target site includes the sequence described in Sequence ID No. 59, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity.In some embodiments, the target site is a contiguous portion of SEQ ID NO: 59 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 59. In some embodiments, the target site is as described in SEQ ID NO: 59.

[0192] In some embodiments, the target site is located within the genomic coordinates human genome assembly GRCh38(hg38)chr4:122,576,890~122,579,315. In some embodiments, the target site is located in the region of interest identified as region 6. In some embodiments, the target site includes the sequence described in Sequence ID No. 34, its contiguous portion of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 34 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 34. In some embodiments, the target site is as described in SEQ ID NO: 34. In some embodiments, the target site includes the sequence described in SEQ ID NO: 36, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 36 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 36. In some embodiments, the target site is as described in SEQ ID NO: 36.In some embodiments, the target site includes the sequence described in SEQ ID NO: 38, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 38 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 38. In some embodiments, the target site is as described in SEQ ID NO: 38. In some embodiments, the target site includes the sequence described in SEQ ID NO: 40, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of SEQ ID NO: 40 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is located within a sequence containing the sequence described in SEQ ID NO: 40. In some embodiments, the target site is as described in SEQ ID NO: 40.

[0193] Table 1 shows exemplary target sites for IL-2.

[0194] [Table 1] TIFF2026528753000003.tif112158

[0195] In some embodiments, at least two of the multiple DNA targeting modules of the epigenetically modified DNA targeting system target the same target site. In some embodiments, the at least two identical target sites of the epigenetically modified DNA targeting system are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, and (4) chr4:122,488 The genomic coordinates selected from the group consisting of (5) 122,507,000, 122,508,985, (6) chr4: 122,539,300, 122,544,050, and (7) chr4: 122,576,890, 122,579,315 are located in the same target region corresponding to the human genome assembly GRCh38 (hg38). In some embodiments, at least two identical target sites of the epigenetic modification DNA targeting system are located in the same target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0196] In some embodiments, the DNA targeting system targets a first target site and a second target site of IL-2, where the first and second target sites are the same. In certain embodiments, each of the same target sites of IL-2 includes the sequence described in SEQ ID NO: 12. In certain embodiments, each of the same target sites of IL-2 includes the sequence described in SEQ ID NO: 24. In certain embodiments, each of the same target sites of IL-2 includes the sequence described in SEQ ID NO: 26.

[0197] In some embodiments, at least two of the multiple DNA targeting modules of the epigenetic modified DNA targeting system target different target sites. In some embodiments, the at least two different target sites of the epigenetic modified DNA targeting system are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,488, The genomic coordinates selected from the group consisting of (5) 840-122,491,890, (6) 122,507,000-122,508,985, (7) chr4: 122,539,300-122,544,050, and (8) chr4: 122,576,890-122,579,315 are located in two different target regions corresponding to the human genome assembly GRCh38 (hg38). In some embodiments, at least two distinct target sites of the epigenetic modification DNA targeting system are located in two distinct target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0198] In some embodiments, the DNA targeting system targets a first target site and a second target site, where the first and second target sites are different. In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12, and the second target site of IL-2 includes the sequence described in SEQ ID NO: 24. In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12, and the second target site of IL-2 includes the sequence described in SEQ ID NO: 26. In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12, and the second target site of IL-2 includes the sequence described in SEQ ID NO: 28. In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12, and the second target site of IL-2 includes the sequence described in SEQ ID NO: 38. In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 24, and the second target site of IL-2 includes the sequence described in SEQ ID NO: 26. In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12, and the second target site of IL-2 includes the sequence described in SEQ ID NO: 28. In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12, and the second target site of IL-2 includes the sequence described in SEQ ID NO: 38.

[0199] Table 2 shows exemplary pairings of target sites.

[0200] [Table 2]

[0201] In some embodiments, the DNA targeting system targets a first target site, a second target site, and a third target site, where all three target sites are different. In some embodiments, at least three of the multiple DNA targeting modules of the epigenetic modification DNA targeting system target different target sites. In some embodiments, the at least three different target sites of the epigenetic modification DNA targeting system are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,488, The genomic coordinates are selected from the group consisting of (5) 840-122,491,890, (6) 122,507,000-122,508,985, (7) chr4: 122,539,300-122,544,050, and (8) chr4: 122,576,890-122,579,315, and are located in three different target regions corresponding to the human genome assembly GRCh38 (hg38). In some embodiments, at least three distinct target sites of the epigenetic modification DNA targeting system are located in three distinct target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0202] In some embodiments, the DNA targeting system targets a first target site, a second target site, a third target site, and a fourth target site, where all four target sites are different. In some embodiments, at least four of the multiple DNA targeting modules of the epigenetic modification DNA targeting system target different target sites. In some embodiments, the at least four different target sites of the epigenetic modification DNA targeting system are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,488, The genomic coordinates are selected from the groups consisting of (5) 840-122,491,890, (6) 122,507,000-122,508,985, (7) chr4: 122,539,300-122,544,050, and (8) chr4: 122,576,890-122,579,315 and are located in four different target regions corresponding to the human genome assembly GRCh38 (hg38). In some embodiments, at least four distinct target sites of the epigenetic modification DNA targeting system are located in four distinct target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0203] In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12 (GACTTAGTGCAATGCAAGAC), the second target site of IL-2 includes the sequence described in SEQ ID NO: 24 (CTCTCTCTGCAGACAGGGCA), the third target site of IL-2 includes the sequence described in SEQ ID NO: 28 (GGCAGGGTAGAGAAGTAGAG), and the fourth target site of IL-2 includes the sequence described in SEQ ID NO: 38 (GGAAATGACATGCTTGAAGT).

[0204] In some embodiments, the DNA targeting system targets a first target site, a second target site, a third target site, a fourth target site, and a fifth target site, where all five target sites are different. In some embodiments, at least five of the multiple DNA targeting modules of the epigenetic modification DNA targeting system target different target sites. In some embodiments, the at least five different target sites of the epigenetic modification DNA targeting system are (1) chr4:122,451,000~122,460,000, (2) chr4:122,465,000~122,472,000, (3) chr4:122,479,410~122,482,750, (4) chr4:122,488, The genomic coordinates are selected from the group consisting of (5) 840-122,491,890, (6) 122,507,000-122,508,985, (7) chr4: 122,539,300-122,544,050, and (8) chr4: 122,576,890-122,579,315, and are located in five different target regions corresponding to the human genome assembly GRCh38 (hg38). In some embodiments, at least five distinct target sites of the epigenetic modification DNA targeting system are located in five distinct target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4:122,451,000~122,460,000, (2) chr4:122,488,840~122,491,890, (3) 122,507,000~122,508,985, and (4) chr4:122,539,300~122,544,050.

[0205] In certain embodiments, the first target site of IL-2 includes the sequence described in SEQ ID NO: 12 (GACTTAGTGCAATGCAAGAC), the second target site of IL-2 includes the sequence described in SEQ ID NO: 24 (CTCTCTCTGCAGACAGGGCA), the third target site of IL-2 includes the sequence described in SEQ ID NO: 26 (GGCAGGGTAGAGAAGTAGAG), the fourth target site of IL-2 includes the sequence described in SEQ ID NO: 28 (GGCAGGGTAGAGAAGTAGAG), and the fifth target site of IL-2 includes the sequence described in SEQ ID NO: 38 (GGAAATGACATGCTTGAAGT).

[0206] In some embodiments, delivery of the DNA targeting system increases the expression (e.g., transcription) of the IL-2 gene or its regulatory elements. In some embodiments, the increase in gene expression in cells (e.g., T cells or NK cells) is greater than a log2 factor change of about 1.0. For example, the log2 factor change is greater than 1.5 or about 1.5, 2.0 or about 2.0, 2.5 or about 2.5, 3.0 or about 3.0, 4.0 or about 4.0, 5.0 or about 5.0, 6.0 or about 6.0, 7.0 or about 7.0, 8.0 or about 8.0, 9.0 or about 9.0, 10.0 or about 10.0, or any value between any of the above, compared to the IL-2 gene expression level in control cells.

[0207] C.CRISPR / Cas-based DNA targeting system and DNA binding domain This specification provides a CRISPR / Cas system-based multiplex epigenetic targeted DNA targeting system, i.e., a CRISPR / Cas-based DNA targeting system that can bind to a target site of the IL-2 gene or its regulatory element, or a combination of target sites, for example, a combination of target sites within the IL-2 gene or its regulatory element. Exemplary target sites include any or any combination described in Section IB above. In some embodiments, the CRISPR / Cas DNA-binding domain is nuclease-inactive and includes, for example, a dCas (e.g., dCas9), thereby allowing the system to bind to the target site of the IL-2 gene or its regulatory element without mediating nucleic acid cleavage at the target site. The CRISPR / Cas-based DNA targeting system can be used to activate or increase the expression of the IL-2 gene or its regulatory element in cells such as lymphoid cells (e.g., T cells or NK cells). In some embodiments, the CRISPR / Cas-based DNA targeting system may include any known Cas enzyme, and generally a nuclease-inactive form or a dCas. In some embodiments, the CRISPR / Cas-based DNA targeting system comprises a fusion protein of a nuclease-inactive Cas protein or a variant thereof and an effector domain, as well as at least one gRNA. In some embodiments, the effector domain increases the transcription of the IL-2 gene or its regulatory element (for example, the effector domain is a transcription activator, e.g., one of those described in Section IE1).

[0208] The CRISPR system (also known as the CRISPR / Cas system or CRISPR-Cas system) refers to a conserved microbial nuclease system found in bacterial and archaeal genomes, providing a form of adaptive immunity against invading phages and plasmids. Clustered and regularly arranged short palindromic sequence repeats (CRISPRs) refer to loci containing multiple repeating DNA elements separated by non-repetitive DNA sequences called spacers. Spacers are short sequences of foreign DNA integrated into the genome between CRISPR repeats, functioning as "memories" of past exposures. Spacers encode the DNA-targeting portion of RNA molecules that confer specificity to nucleic acid cleavage by the CRISPR system. CRISPR loci contain, or are adjacent to, one or more CRISPR-related (Cas) genes that can act as RNA-induced nucleases to mediate cleavage, and non-protein-coding DNA elements that encode RNA molecules capable of programming the specificity of CRISPR-mediated nucleic acid cleavage.

[0209] In the type II CRISPR / Cas system, which contains the Cas protein Cas9, two RNA molecules and the Cas9 protein form a ribonucleoprotein (RNP) complex that directs Cas9 nuclease activity. The CRISPR RNA (crRNA) is complementary to the target nucleic acid sequence (target site) and contains a spacer sequence that encodes the sequence specificity of the complex. The transactivated crRNA (tracrRNA) bases pair with the crRNA moiety and form a structure that complexes with the Cas9 protein, thus forming the Cas / RNA RNP complex.

[0210] Naturally occurring CRISPR / Cas systems, such as those possessing Cas9, have been engineered to enable efficient programming of Cas / RNA RNPs to target desired sequences in target cells for both gene editing and gene expression regulation. TracrRNAs and crRNAs have been engineered to form a single chimeric guide RNA molecule, commonly referred to as a guide RNA (gRNA), as described, for example, in WO2013 / 176772, WO2014 / 093661, WO2014 / 093655, Jinek, M. et al. Science 337(6096):816-21(2012), or Cong, L. et al. Science 339(6121):819-23(2013). The gRNA spacer sequence can be selected by the user to target the Cas / gRNA RNP complex to a desired gene locus, e.g., a desired target site in a target gene.

[0211] Cas proteins are also engineered to be catalytically inactivated or nuclease-inactive to enable targeting of Cas / gRNA RNPs without inducing cleavage at the target site. Mutations in Cas proteins can reduce or neutralize the nuclease activity of the Cas protein, or catalytically inactivate the Cas protein. Cas proteins with reduced or neutralized nuclease activity are referred to as inactivated Cas (dCas) or nuclease-inactive Cas (iCas) proteins, as interchangeably referred to herein. Exemplary inactivated Cas9 (dCas9) derived from S. pyogenes contains silencing mutations in the RuvC and HNH nuclease domains (D10A and H840A), as described, for example, in WO2013 / 176772, WO2014 / 093661, Jinek, M. et al. Science 337(6096):816-21 (2012), and Qi, L. et al. Cell 152(5):1173-83 (2013). Exemplary dCas variants derived from the Cas12 system (i.e., Cpf1) are described, for example, in WO2017 / 189308 and Zetsche, B. et al. Cell 163(3):759-71 (2015). Conserved domains that mediate nucleic acid cleavage, such as the RuvC and HNH endonuclease domains, are readily identifiable in Cas orthologs and can be mutated to produce inactive variants, for example, as described in Zetsche, B. et al. Cell 163(3):759-71 (2015).

[0212] dCas fusion proteins containing transcriptional and / or epigenetic regulators are used as versatile platforms for ectopic regulation of gene expression in target cells. These include fusions of Cas with effector domains such as transcriptional activators. For example, fusion of dCas9 with a transcriptional activator such as VP64 (a polypeptide composed of four tandem copies of VP16, the 16-amino acid transactivation domain of herpes simplex virus) can result in potent induction of gene expression. Various dCas fusion proteins possessing effector domains include, for example, WO2014 / 197748, WO2016 / 130600, WO2017 / 180915, WO2021 / 226555, WO2013 / 176772, WO2014 / 152432, WO2014 / 093661, WO2021 / 247570, Adli, M. Nat. Commun. 9, 1911 (2018), Perez-Pinera, P. et al. Nat. Methods 10, 973-976 (2013), Mali, P. et al. Nat. Biotechnol. 31, 833-838 (2013), and Maeder, M. Let al. Nat. Methods. As described in 10,977-979 (2013), Gilbert, LA et al. Cell 154(2):442-451 (2013), and Nunez, J K et al. Cell 184(9):2503-2519 (2021), they can be manipulated for the regulation of gene expression.

[0213] In some embodiments, a DNA targeting system is provided comprising a fusion protein comprising a DNA-binding domain containing a nuclease-inactive Cas protein or a variant thereof, and an effector domain (i.e., a transcription activator) for increasing transcription or inducing transcriptional activation when targeted to the IL-2 gene or regulatory element in a cell (e.g., a lymphoid cell (e.g., a T cell or NK cell)). In some embodiments, the dCas protein is any suitable dCas protein, e.g., one of those described in Section IC1. In some embodiments, the dCas protein is a dCas9 protein such as dSpCas9 or dSaCas9. In some embodiments, at least one effector domain is any preferred transcription activator effector domain, e.g., any of those described in Section IE1, e.g., VP64. In some embodiments, the epigenetic mark includes histone H3K27 acetylation. In some embodiments, the effector domain can catalyze the acetylation of histone H3 lysine 27 at the target site, or recruit an enzyme that catalyzes the acetylation of histone H3 lysine 27 at the target site. In some embodiments, the enzyme that catalyzes the acetylation is an acetyltransferase.

[0214] In some embodiments, at least one effector domain is VP64. In some embodiments, the fusion protein is, for example, a dCas9-VP64 fusion protein as described in Section IF. In such embodiments, the DNA targeting system also includes one or more gRNAs (e.g., as described in Section IC2) provided in combination with or as a complex with a dCas protein or a variant thereof for targeting the DNA targeting system to a target site of the IL-2 gene or its regulatory element. In some embodiments, the fusion protein is guided by a guide RNA to a specific target site sequence of the IL-2 gene or its regulatory element, where the effector domain increases or activates the transcription of the IL-2 gene or its regulatory element by mediating targeted epigenetic modifications. In some embodiments, the gRNA combination guides the fusion protein to a combination of target site sequences in a combination of target sites, where the effector domain increases or activates the transcription of the combination of target sites found in the IL-2 gene or its regulatory element by mediating targeted epigenetic modifications. Any of the various effector domains that increase or activate transcription may be used, as further described below.

[0215] 1. CRISPR / Cas-based DNA-binding domain In some embodiments, the DNA-binding domain includes or is derived from a CRISPR-related (Cas) protein or a variant thereof. In certain embodiments herein, the Cas protein is nuclease-inactive (i.e., a dCas protein).

[0216] In some embodiments, the Cas protein originates from a Class 1 CRISPR system (i.e., a multiple Cas protein system), such as a Type I, Type III, or Type IV CRISPR system. In some embodiments, the Cas protein originates from a Class 2 CRISPR system (i.e., a single Cas protein system), such as a Type II, Type V, or Type VI CRISPR system. In some embodiments, the Cas protein originates from a Type V CRISPR system. In some embodiments, the Cas protein originates from the Cas12 protein (i.e., Cpf1) or a variant thereof, as described, for example, in WO2017 / 189308 and Zetsche, B. et al. Cell. 163(3):759-71 (2015). In some embodiments, the Cas protein originates from a Type II CRISPR system. In some embodiments, the Cas protein is, for example, WO2013 / 176772, WO2014 / 152432, WO2014 / 093661, WO2014 / 093655, Jinek, M. et al. Science 337(6096):816-21(2012), Mali, P. et al. Science 339(6121):823-6(2013), Cong, L. et al. Science 339(6121):819-23(2013), Perez-Pinera, P. et al. Nat. Methods 10, 973-976(2013), or Mali, P. et al. As described in al. Nat. Biotechnol. 31, 833-838 (2013), it is derived from the Cas9 protein or its variants. Various CRISPR / Cas systems and associated Cas proteins for use in gene editing and regulation are described, for example, in Moon, SB et al. Exp. Mol. Med. 51, 1-11 (2019), Zhang, FQRev. Biophys. 52, E6 (2019), and Makarova K Set al. Methods Mol. Biol. 1311: 47-75 (2015).

[0217] In some embodiments, the dCas9 protein may contain sequences derived from naturally occurring Cas9 molecules or variants thereof. In some embodiments, the dCas9 protein may contain sequences derived from naturally occurring Cas9 molecules or variants thereof from S. pyogenes, S. thermophilus, S. aureus, C. jejuni, N. meningitidis, F. novicida, S. canis, S. auricularis. In some embodiments, the dCas9 protein contains sequences derived from naturally occurring Cas9 molecules from S. aureus. In some embodiments, the dCas9 protein contains sequences derived from naturally occurring Cas9 molecules from S. pyogenes.

[0218] Non-limiting examples of Cas9 orthologs from other bacterial strains include Acaryochloris marina MBIC11017, Acetohalobium arabaticum DSM 5501, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans ATCC 23270, Alicyclobacillus acidocaldarius LAA1, Alicyclobacillus acidocaldarius subsp.acidocaldarius DSM 446, Allochromatium vinosum DSM 180, Ammonifex degensii KC4, Anabaena variabilis ATCC 29413, Arthrospira maxima CS-328, Arthrospira platensis str.Paraca, Arthrospira sp.PCC 8005, Bacillus pseudomycoides DSM 12442, Bacillus selenitireducens MLS10, Burkholderiales bacterium 1_1_47, Caldicellulosiruptor becscii DSM 6725, Candidatus Desulforudis audaxviator MP104C, Caldicellulosiruptor hydrothermalis 108、Clostridium phage c-st、Clostridium botulinum A3 str.Loch Maree、Clostridium botulinum Ba4 str.657、Clostridium difficile QCD-63q42、Crocosphaera watsonii WH 8501、Cyanothece sp.ATCC 51142、Cyanothece sp.CCY0110、Cyanothece sp.PCC 7424、Cyanothece sp.PCC 7822、Exiguobacterium sibiricum 255-15、Finegoldia magna ATCC 29328、Ktedonobacter racemifer DSM 44963、Lactobacillus delbrueckii subsp.bulgaricus PB2003 / 044-T3-4、Lactobacillus salivarius ATCC 11741、Listeria innocua、Lyngbya sp.PCC 8106、Marinobacter sp.ELB17、Methanohalobium evestigatum Z-7303、Microcystis phage Ma-LMM01、Microcystis aeruginosa NIES-843、Microscilla marina ATCC 23134、Microcoleus chthonoplastes PCC 7420、Neisseria meningitidis、Nitrosococcus halophilus Nc4、Nocardiopsis dassonvillei subsp.dassonvillei DSM 43111、Nodularia spumigena CCY9414、Nostoc sp.PCC 7120, Oscillatoria sp.PCC 6506, Pelotomaculum_thermopropionicum SI, Petrotoga mobilis SJ95, Polaromonas naphthalenivorans CJ2, Polaromonas sp.JS666, Pseudoalteromonas haloplanktis TAC125, Streptomyces pristinaespiralis ATCC 25486, Streptomyces pristinaespiralis ATCC 25486, Streptococcus thermophilus, Streptomyces viridochromogenes DSM 40736, Streptosporangium roseum DSM 43021, Synechococcus sp.Examples include, but are not limited to, the Cas proteins identified in PCC 7335 and Thermosipho africanus TCF52B (Chylinski et al., RNA Biol., 2013;10(5):726-737).

[0219] In some embodiments, the Cas protein is a variant lacking nuclease activity (i.e., a dCas protein). In some embodiments, the Cas protein is mutated to have reduced or eliminated nuclease activity. Such Cas proteins are referred to as deactivated (or dead) Cas (dCas) or nuclease-inactive Cas (iCas) proteins, as interchangeably referred to herein. In some embodiments, the variant Cas9 protein is a variant Cas9 protein that is either lacking nuclease activity or an inactivated Cas9 (dCas9 or iCas9) protein.

[0220] In some embodiments, the Cas9 protein or its variants are derived from the Staphylococcus aureus Cas9 (SaCas9) protein or its variants. In some embodiments, the variant Cas9 is the Staphylococcus aureus dCas9 protein (dSaCas9) containing at least one amino acid mutation selected from D10A and N580A with respect to the positional numbering in SEQ ID NO: 64. In some embodiments, the variant Cas9 protein contains an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0221] In some embodiments, the Cas9 protein or a variant thereof is derived from the Streptococcus pyogenes Cas9 (SpCas9) protein or a variant thereof. In some embodiments, the variant Cas9 is the Streptococcus pyogenes dCas9 (dSpCas9) protein containing at least one amino acid mutation selected from D10A and H840A with respect to the positional numbering in SEQ ID NO: 62. In some embodiments, the variant Cas9 protein contains an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0222] 2. Guide RNA (gRNA) In some embodiments, the gRNA can be complexed with a Cas protein or a variant thereof. In some embodiments, the gRNA can hybridize to a target site or includes a gRNA spacer sequence (also known as a spacer sequence or guide sequence) that is complementary to a target site, e.g., any target site described herein, e.g., any target site in the genome. In some embodiments, the gRNA includes a scaffold sequence that complexes with or binds to a Cas protein. In some embodiments, a gRNA specific to a target locus of interest (e.g., a regulatory DNA element of the IL-2 locus) is used to recruit an RNA-inducible protein (e.g., a Cas protein) or a variant thereof, or a fusion protein containing such an RNA-inducible protein (e.g., a Cas polypeptide), to the target site.

[0223] In some embodiments, the Cas protein (e.g., dCas9) is provided in combination with or as a complex with one or more guide RNAs (gRNAs). In some embodiments, the gRNA is a nucleic acid that facilitates the specific targeting or homing of the gRNA / Cas RNP complex to a target site of the IL-2 gene or its regulatory element, such as any of those described in Section IB above. In some embodiments, the target site of the gRNA may be referred to as a protospacer.

[0224] This specification provides gRNAs, such as gRNAs, that target or bind to target sites of the IL-2 gene or its regulatory elements, such as any of those described in Section IB of this specification. This specification provides gRNAs, such as gRNAs that target or can bind to regulatory DNA elements of the IL-2 gene locus. In some embodiments, the gRNA binds to target sites located on the IL-2 gene and / or the regulatory DNA elements of the IL-2 gene. In some embodiments, the gRNA binds to target sites located on the IL-2 gene. In some embodiments, the gRNA binds to target sites located on the regulatory DNA elements of the IL-2 gene.

[0225] In some embodiments, the gRNA can complex with a Cas protein or a variant thereof. In some embodiments, the gRNA can hybridize to a target site or includes a gRNA spacer sequence (i.e., a spacer sequence or guide sequence) that is complementary to a target site, for example, any of the target sites described herein. In some embodiments, the gRNA includes a scaffold sequence that complexes with or binds to a Cas protein.

[0226] In some embodiments, the “gRNA molecule” is a nucleic acid that facilitates the specific targeting or homing of the gRNA molecule / Cas9 molecule complex to a target nucleic acid, such as a gene locus on the cellular genomic DNA. Generally, the spacer sequence of the guide RNA is any polynucleotide sequence that includes at least a portion of a sequence that has sufficient complementarity to the target polynucleotide sequence, for example, at the IL-2 locus in humans, to hybridize with the target sequence at the target site and induce sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, in relation to the formation of the CRISPR complex, the “target sequence” is a sequence in which the spacer sequence is designed to have complementarity, where hybridization between the target sequence and the spacer sequence of the guide RNA facilitates the formation of the CRISPR complex. Complete complementarity is not necessarily required, as long as there is sufficient complementarity to induce hybridization and facilitate the formation of the CRISPR complex. Generally, the spacer sequence is selected to reduce the degree of secondary structure within the spacer sequence. The secondary structure can be determined by any preferred polynucleotide folding algorithm.

[0227] In some embodiments, a guide RNA (gRNA) specific to a target gene locus of interest (e.g., the IL-2 locus in humans) is used in conjunction with an RNA-induced nuclease or a variant thereof, e.g., a nuclease-inactive Cas variant, to target a target site or location in the provided DNA targeting system. Methods for designing gRNAs and exemplary spacer sequences are known. Exemplary gRNA structures having specific domains and scaffold regions, capable of associating with specific RNA-induced nucleases or variants thereof, e.g., nuclease-inactive Cas variants, are also known. In some embodiments, the gRNA molecule includes a scaffold sequence, e.g., a sequence that can be complexed with a Cas protein. In some embodiments, the scaffold sequence is specific to the Cas protein.

[0228] In some embodiments, the gRNAs provided herein are chimeric gRNAs. Generally, gRNAs can be monomolecular (i.e., composed of a single RNA molecule) or modular (containing multiple, typically two distinct RNA molecules). Modular gRNAs can be manipulated to become monomolecular, in which case sequences from distinct modular RNA molecules are contained within a single gRNA molecule, and may be referred to as chimeric gRNAs, synthetic gRNAs, or single gRNAs. In some embodiments, a chimeric gRNA is a fusion of two non-coding RNA sequences: a crRNA sequence and a tracrRNA sequence, as described, for example, in WO2013 / 176772 or Jinek, M. et al. Science 337(6096):816-21(2012). In some embodiments, the chimeric gRNA mimics the naturally occurring crRNA:tracrRNA double helix involved in the type II effector system, where the naturally occurring crRNA:tracrRNA double helix acts as a guide for the Cas9 protein. Exemplary types of CRISPR / Cas systems and associated gRNA structures are described, for example, in Moon et al. Exp.Mol.Med.51,1-11(2019), Zhang,FQRev.Biophys.52,E6(2019), Makarova et al. Methods Mol.Biol.1311:47-75(2015), WO2013 / 176772, or Jinek,M. et al. Science 337(6096):816-21(2012).

[0229] Guide RNA can include at least one spacer sequence and a CRISPR repeat sequence that hybridize with the target nucleic acid sequence of interest. In the type II system, the gRNA also includes a second RNA called a tracrRNA sequence. In type II guide RNA (gRNA), the CRISPR repeat sequence and the tracrRNA sequence hybridize to form a double helix. In type V guide RNA (gRNA), the crRNA forms the double helix. In both systems, this double helix binds to a site-specific polypeptide, thereby allowing the guide RNA and site-specific polypeptide to form a complex. The gRNA can provide target specificity to the complex through association with the site-specific polypeptide. Therefore, the gRNA can induce the activity of the site-specific polypeptide.

[0230] In some embodiments, the spacer sequence of the gRNA is a polynucleotide sequence that includes at least a portion of the target site that hybridizes with the target site in the target gene and has sufficient complementarity to the target site to induce sequence-specific binding of the Cas / gRNA (or CRISPR) complex to the target site sequence. Complete complementarity is not necessarily required, as long as sufficient complementarity is present to cause hybridization. In some embodiments, the gRNA includes a spacer sequence that is, for example, at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% complementary (e.g., perfectly complementary) to the target site. The strand of target nucleic acid containing the target site sequence may be referred to as the “complementary strand” of the target nucleic acid. In some embodiments, the spacer sequence is a user-defined sequence. Guidance on the selection of spacer sequences can be found, for example, in Fu et al., Nat Biotechnol 2014 32:279-284 and Sternberg et al., Nature 2014 507:62-67.

[0231] In some embodiments, the gRNA targets a target site in double-stranded DNA. Therefore, in some embodiments, the target site sequence may be defined by the sequence to which the gRNA spacer hybridizes, or by a sequence complementary to the sequence to which the gRNA spacer hybridizes. In some embodiments, the target site sequence may be defined by the sequence to which the gRNA spacer replaces in order to hybridize into DNA. In some embodiments, the target site sequence is the sequence to which the gRNA hybridizes.

[0232] In some embodiments, the gRNA spacer sequence is approximately 14 nucleotides (nt) to approximately 26 nt, or 16 nt to 22 nt in length. In some embodiments, the gRNA spacer sequence is 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt, 22 nt, 23 nt, 24 nt, 25 nt, or 26 nt in length. In some embodiments, the gRNA spacer sequence is 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt in length. In some embodiments, the gRNA spacer sequence is 18 nt in length. In some embodiments, the gRNA spacer sequence is 19 nt in length. In some embodiments, the gRNA spacer sequence is 20 nt in length. In some embodiments, the gRNA spacer sequence is 21 nt in length. In some embodiments, the gRNA spacer sequence is 22 nt in length.

[0233] In some embodiments, the gRNA is a continuum of two non-coding RNA sequences: a crRNA sequence and a tracrRNA sequence. The gRNA can target a desired DNA sequence by swapping a sequence that encodes a 20 bp protospacer, which confers targeting specificity via complementary base pairing with the desired DNA target. The gRNA mimics the naturally occurring crRNA:tracrRNA double helix involved in type II CRISPR / Cas systems (e.g., Cas9). For example, this double helix, which may contain a 42-nucleotide crRNA and a 75-nucleotide tracrRNA, acts as a guide for the Cas9 protein to cleave the target nucleic acid. The terms “target region,” “target sequence,” or “protospacer,” as used interchangeably herein, refer to a region of the IL-2 gene or regulatory element targeted by a CRISPR / Cas9-based system. A CRISPR / Cas9-based system may contain two or more gRNAs, where the two or more gRNAs target different DNA sequences. The target DNA sequences may or may not overlap. The target DNA sequence can be located within or near the same gene or a different gene. The PAM sequence follows the target sequence or protospacer at the 3' end of the protospacer. The PAM requirements differ depending on the type II system. For example, the Streptococcus pyogenes type II system uses the "NGG" sequence, where "N" can be any nucleotide.

[0234] The target site of a gRNA may be referred to as a protospacer. In some embodiments, the spacer is designed to target a specific protospacer adjacent motif (PAM), i.e., a protospacer having a sequence immediately adjacent to the protospacer that contributes to and / or is required for Cas binding specificity. The PAM requirements for targeting vary depending on the CRISPR / Cas system. For example, in some embodiments, S. pyogenes Cas9 uses PAM 5'-NGG-3' (SEQ ID NO: 68), where N is any nucleotide. In some embodiments, the PAM of the gRNA for complexing with a type V CRISPR / Cas system, e.g., Cas12a (also known as Cpf1) or its variants, uses TTTV (SEQ ID NO: 67), where V is A, C, or G. In some embodiments, S. aureus Cas9 uses PAM 5'-NNGRRT-3' (SEQ ID NO: 69), where N is any nucleotide and R is G or A. In some embodiments, N. meningitidis Cas9 is PAM 5'-NNNNGATT-3' (SEQ ID NO: 70), where N is any nucleotide. In some embodiments, C. jejuni Cas9 is PAM 5'-NNNNRYAC-3' (SEQ ID NO: 71), where N is any nucleotide, R is G or A, and Y is C or T. In some embodiments, S. thermophilus is PAM 5'-NNAGAAW-3' (SEQ ID NO: 72), where N is any nucleotide and W is A or T. In some embodiments, F. Novicida Cas9 is PAM 5'-NGG-3' (SEQ ID NO: 68), where N is any nucleotide. In some embodiments, T. denticola Cas9 is PAM 5'-NAAAAC-3' (SEQ ID NO: 73), where N is any nucleotide. In some embodiments, Cas12a (also known as Cpf1) derived from various species is used, specifically PAM 5'-TTTV-3' (SEQ ID NO: 74).In some embodiments, the Cas protein may use or be manipulated to use a PAM different from those described above. For example, a mutant SpCas9 protein may use the PAMs 5'-NGG-3' (SEQ ID NO: 68), 5'-NGAN-3' (SEQ ID NO: 75), 5'-NGNG-3' (SEQ ID NO: 76), 5'-NGAG-3' (SEQ ID NO: 77), or 5'-NGCG-3' (SEQ ID NO: 78), where N is any nucleotide. In some embodiments, the protospacer flanking motif (PAM) of the gRNA for complexing with S. pyogenes Cas9 or a variant thereof is NGG as described in SEQ ID NO: 68. In some embodiments, the PAM of the gRNA for complexing with S. aureus Cas9 or a variant thereof is NNGRRT as described in SEQ ID NO: 69. Methods for designing or identifying gRNA spacer sequences and / or protospacer sequences in specific regions are known. The gRNA spacer sequence and / or protospacer sequence may be determined based on the type of Cas protein used and the associated PAM sequence.

[0235] The spacer sequence may be selected to reduce the degree of secondary structure within the spacer sequence. The secondary structure may be determined by any suitable polynucleotide folding algorithm.

[0236] In some embodiments, the gRNA (including the guide sequence) contains the uracil (U) base, while the DNA encoding the gRNA molecule contains the thymine (T) base. While we do not wish to be bound by theory, in some embodiments, the complementarity of the guide sequence with the target sequence is thought to contribute to the specificity of the interaction between the gRNA / Cas molecule complex and the target nucleic acid. In a guide-target sequence pair, it is understood that the uracil base in the guide sequence pairs with the adenine base in the target sequence. A gRNA spacer sequence as used herein may be defined by a DNA sequence encoding a gRNA spacer and / or an RNA sequence of the spacer.

[0237] In some embodiments, the gRNA contains modified nucleotides, for example, to increase stability. In some embodiments, one, more, or all of the nucleotides of the gRNA may have modifications, for example, to reduce the gRNA's susceptibility to degradation and / or to improve its biocompatibility. As a non-limiting example, the gRNA backbone may be modified with phosphorothioates or other modifications. In some cases, the nucleotides of the gRNA may include 2' modifications, such as 2-acetylation, 2'-methylation, or other modifications.

[0238] Methods for designing gRNAs and exemplary targeting domains include, for example, International PCT Publications WO2014 / 197748, WO2016 / 130600, WO2017 / 180915, WO2021 / 226555, WO2013 / 176772, WO2014 / 152432, WO2014 / 093661, and Examples include those listed in WO2014 / 093655, WO2015 / 089427, WO2016 / 049258, WO2016 / 123578, WO2021 / 076744, WO2014 / 191128, WO2015 / 161276, WO2017 / 193107, and WO2017 / 093969.

[0239] In some embodiments, the gRNA includes a scaffold sequence. In some embodiments, the scaffold sequence (which may include a crRNA sequence and / or a tracrRNA sequence) varies depending on the Cas protein. In some embodiments, different CRISPR / Cas systems have different gRNA scaffold sequences for association with the Cas protein. In some embodiments, the exemplary scaffold sequence for S. aureus Cas9 includes the sequence described in SEQ ID NO: 41, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to SEQ ID NO: 41, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequence for S. aureus Cas9 includes the sequence described in SEQ ID NO: 41. In some embodiments, the exemplary scaffold sequence for S. pyogenes Cas9 includes the sequence described in SEQ ID NO: 8, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to SEQ ID NO: 8, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequence for S. pyogenes Cas9 includes the sequence described in SEQ ID NO: 8.

[0240] In some embodiments, exemplary scaffold sequences for Acidaminococcus sp.Cas12a include the sequence described in SEQ ID NO: 123, or sequences having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to SEQ ID NO: 123, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequence of CasPhi-2 includes the sequence described in SEQ ID NO: 124, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to SEQ ID NO: 124, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequences of Un1Cas12f1 include the sequence described in SEQ ID NO: 125, the sequence "GGAATGAAC" (SEQ ID NO: 126), or the sequence "TTTTATTTT" (SEQ ID NO: 127), or sequences having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to SEQ ID NOs: 125, 126, or 127, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequence of Un1Cas12f1 includes the sequence described in sequence number 213, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to sequence number 213, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity.In some embodiments, the exemplary scaffold sequence of Un1Cas12f1 includes the sequence described in sequence number 126, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to sequence number 126, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequence of Un1Cas12f1 includes the sequence described in sequence number 127, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to sequence number 127, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequence of C. jejuni Cas9 includes the sequence described in SEQ ID NO: 128, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to SEQ ID NO: 128, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the exemplary scaffold sequence of Cas12k includes the sequence described in sequence number 129, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to sequence number 129, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity.In some embodiments, the exemplary scaffold sequence of CasMini includes the sequence described in SEQ ID NO: 130, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with respect to SEQ ID NO: 130, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity.

[0241] In some embodiments, gRNAs can target DNA targeting systems to direct the activity of associated polypeptides (e.g., fusion proteins, DNA targeting systems, effector domains, etc.) to specific target sites within a target nucleic acid (e.g., regulatory DNA elements at the IL-2 locus).

[0242] a. gRNA for transcriptional activation In some embodiments, the gRNAs provided herein target a target site on the IL-2 gene or its regulatory element for transcriptional activation. In some embodiments, the target site is located on the IL-2 gene. In some embodiments, the target site is located on the regulatory DNA element of the gene. In some embodiments, the regulatory DNA element is a sequence to which a gene regulatory protein can bind and which can affect the transcription of the gene. In some embodiments, the regulatory DNA element is a sequence to which a gene regulatory protein can bind and which can affect the transcription of the IL-2 gene. Exemplary target sites and combinations of target sites for gRNAs in multiplex DNA binding systems are any of those described in Section IB.

[0243]

[0244] In some embodiments, the gRNA targets a target site comprising a sequence selected from any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, and 40 shown in Table 1, a continuous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, and 40 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is set forth in any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, and 40.

[0245] In some embodiments, the gRNA targets a target site comprising the sequence set forth in SEQ ID NO: 12, a continuous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of the sequence set forth in SEQ ID NO: 12 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site sequence is set forth in SEQ ID NO: 12.

[0246] In some embodiments, the gRNA targets a target site comprising the sequence set forth in SEQ ID NO: 24, a continuous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of the sequence set forth in SEQ ID NO: 24 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the target site sequence is set forth in SEQ ID NO: 24.

[0247] In some embodiments, the gRNA targets a target site comprising the sequence set forth in SEQ ID NO: 26, a continuous portion thereof of at least 14 nucleotides, a complementary sequence of any of the foregoing, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100%, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of the sequence set forth in SEQ ID NO: 26 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the target site sequence is set forth in SEQ ID NO: 26.

[0248] In some embodiments, the gRNA targets a target site comprising the sequence described in SEQ ID NO: 28, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of the sequence described in SEQ ID NO: 28 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site sequence is described in SEQ ID NO: 28.

[0249] In some embodiments, the gRNA targets a target site comprising the sequence described in SEQ ID NO: 38, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of the sequence described in SEQ ID NO: 38 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site sequence is described in SEQ ID NO: 38.

[0250] In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with the sequence described in Sequence ID No. 8 (GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC), or all or part thereof, or a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the scaffold sequence is described in Sequence ID No. 8.

[0251] In some embodiments, any of the provided gRNA sequences are provided in combination with or complexed with a fusion protein containing Cas9. In some embodiments, Cas9 is dCas9. In some embodiments, dCas9 is dSpCas9, for example, the dSpCas9 described in SEQ ID NO: 63.

[0252] In some embodiments, a multiplex epigenetic modified DNA targeting system comprising a combination of gRNAs is provided herein.

[0253] In some embodiments, the gRNA includes a spacer sequence selected from any one of the sequence numbers 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, and 39 shown in Table 3, or at least 14nt of such a contiguous portion, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of any one of sequence numbers 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, and 39, having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in any one of sequence numbers 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, and 39.

[0254] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 11, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 11 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 11.

[0255] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 23, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 23 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 23.

[0256] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 25, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 25 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 25.

[0257] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 27, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 27 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 27.

[0258] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 37, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 37 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 37.

[0259] [Table 3]

[0260] In some embodiments, the Specified provides combinations of gRNAs, each targeting a target site of the IL-2 gene or its regulatory element for transcriptional activation. In some embodiments, the Specified provides a multiplex epigenetic modification DNA targeting system comprising a combination of gRNAs.

[0261] In some embodiments, the gRNA combination includes at least two gRNAs that target at least two different target sites for transcriptional activation of IL-2. In some embodiments, the gRNA combination includes at least two gRNAs that target two identical target sites for transcriptional activation. In some embodiments, the gRNAs target a combination of target sites selected from the combinations of target sites listed in Table 1. In some embodiments, the gRNAs target a combination of target sites listed in Table 2.

[0262] In some embodiments, each gRNA in a gRNA combination is selected from one of the gRNAs described herein for targeted transcriptional activation. Exemplary gRNA pair combinations are listed in Table 4.

[0263] [Table 4]

[0264] In some embodiments, the gRNA combination includes at least two gRNAs that target the same target site. In some embodiments, the gRNA combination includes a first gRNA targeted at a first target site and a second gRNA targeted at the same first target site. In some embodiments, the gRNA combination includes a first gRNA targeted at a first target site and a second gRNA targeted at a second target site, where the target sites are the same.

[0265] In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of IL-2 comprising the sequence set forth in SEQ ID NO: 11, and a second gRNA targeting a target site of IL-2 comprising the sequence set forth in SEQ ID NO: 11. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of IL-2 comprising the sequence set forth in SEQ ID NO: 23, and a second gRNA targeting a target site of IL-2 comprising the sequence set forth in SEQ ID NO: 23. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of IL-2 comprising the sequence set forth in SEQ ID NO: 25, and a second gRNA targeting a target site of IL-2 comprising the sequence set forth in SEQ ID NO: 25.

[0266] In some embodiments, the combination of gRNAs comprises at least two gRNAs targeting at least two target sites. In some embodiments, the combination of gRNAs comprises a first gRNA targeted to a first target site and a second gRNA targeted to a second target site, where the target sites are different.

[0267] In some embodiments, the gRNA combination includes a first gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 11, and a second gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 23. In some embodiments, the gRNA combination includes a first gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 11, and a second gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 25. In some embodiments, the gRNA combination includes a first gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 11, and a second gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 27. In some embodiments, the gRNA combination includes a first gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 11, and a second gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 37. In some embodiments, the gRNA combination includes a first gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 23, and a second gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 25. In some embodiments, the gRNA combination includes a first gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 23, and a second gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 27. In some embodiments, the gRNA combination includes a first gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 23, and a second gRNA that targets an IL-2 target site containing the sequence described in SEQ ID NO: 37.

[0268] In some embodiments, the gRNA combination includes at least three gRNAs targeting at least three target sites. In certain embodiments, the at least three target sites are different target sites. In certain embodiments, the gRNA combination includes a first gRNA targeted at a first target site, a second gRNA targeted at a second target site, and a third gRNA targeted at a third target site. In some embodiments, at least two of the three target sites may be the same. In some embodiments, the gRNA combination includes at least three gRNAs targeting at least two target sites.

[0269] In some embodiments, the gRNA combination comprises at least four gRNAs targeting at least four target sites. In certain embodiments, the at least four target sites are different target sites. In certain embodiments, the gRNA combination comprises a first gRNA targeted at a first target site, a second gRNA targeted at a second target site, a third gRNA targeted at a third target site, and a fourth gRNA targeted at a fourth target site. In some embodiments, at least two of the four target sites may be the same. In some embodiments, the gRNA combination comprises at least four gRNAs targeting at least three target sites.

[0270] In a particular embodiment, the first gRNA includes the spacer sequence (GACUUAGUGCAAUGCAAGAC) described in SEQ ID NO: 11, the second gRNA includes the spacer sequence (CUCUCUCUGCAGACAGGGCA) described in SEQ ID NO: 23, the third gRNA includes the spacer sequence (AGAGGGAAGUGUCACAUAAU) described in SEQ ID NO: 27, and the fourth gRNA includes the spacer sequence (GGAAAUGACAUGCUUGAAGU) described in SEQ ID NO: 37.

[0271] In some embodiments, the gRNA combination includes at least five gRNAs targeting at least five target sites. In certain embodiments, the at least five target sites are different target sites. In certain embodiments, the gRNA combination includes a first gRNA targeted at a first target site, a second gRNA targeted at a second target site, a third gRNA targeted at a third target site, a fourth gRNA targeted at a fourth target site, and a fifth gRNA targeted at a fifth target site. In some embodiments, at least two of the five target sites may be the same. In some embodiments, the gRNA combination includes at least five gRNAs targeting at least four target sites.

[0272] In a particular embodiment, the first gRNA includes the spacer sequence (GACUUAGUGCAAUGCAAGAC) described in SEQ ID NO: 11, the second gRNA includes the spacer sequence (CUCUCUCUGCAGACAGGGCA) described in SEQ ID NO: 23, the third gRNA includes the spacer sequence (GGCAGGGUAGAGAAGUAGAG) described in SEQ ID NO: 25, the fourth gRNA includes the spacer sequence (AGAGGGAAGUGUCACAUAAU) described in SEQ ID NO: 27, and the fifth gRNA includes the spacer sequence (GGAAAUGACAUGCUUGAAGU) described in SEQ ID NO: 37.

[0273] In some embodiments, the gRNA combination targets, for example, the combination of target sites for transcriptional activation shown in Table 2.

[0274] Table 5 shows exemplary pairings of SpCas9 guide RNA (gRNA) and target sites.

[0275] [Table 5] TIFF2026528753000008.tif181162

[0276] In some embodiments, any of the provided gRNA sequences are provided in combination with or complexed with a fusion protein containing Cas9. In some embodiments, Cas9 is dCas9. In some embodiments, dCas9 is dSaCas9, for example, the dSaCas9 described in SEQ ID NO: 65.

[0277] In some embodiments, the gRNA targets a target site containing a sequence selected from any one of sequence numbers 43, 45, 47, 49, 51, 53, 55, 57, and 59 shown in Table 1, a contiguous portion thereof of at least 14 nucleotides, a complementary sequence to any of the aforementioned, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a sequence of any one of sequence numbers 43, 45, 47, 49, 51, 53, 55, 57, and 59, having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site is described in any one of sequence numbers 43, 45, 47, 49, 51, 53, 55, 57, and 59.

[0278] In some embodiments, the gRNA targets a target site comprising the sequence described in SEQ ID NO: 43, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of the sequence described in SEQ ID NO: 43 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site sequence is described in SEQ ID NO: 43.

[0279] In some embodiments, the gRNA targets a target site comprising the sequence described in SEQ ID NO: 51, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of the sequence described in SEQ ID NO: 51 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site sequence is described in SEQ ID NO: 51.

[0280] In some embodiments, the gRNA targets a target site comprising the sequence described in SEQ ID NO: 57, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of the sequence described in SEQ ID NO: 57 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site sequence is described in SEQ ID NO: 57.

[0281] In some embodiments, the gRNA targets a target site comprising the sequence described in SEQ ID NO: 59, a contiguous portion thereof of at least 14 nucleotides, any of the aforementioned complementary sequences, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the target site is a contiguous portion of the sequence described in SEQ ID NO: 59 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the target site sequence is described in SEQ ID NO: 59.

[0282] In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to the sequence described in Sequence ID No. 41 (GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU), or to all or part thereof, or to at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the scaffold sequence is described in Sequence ID No. 41.

[0283] In some embodiments, the gRNA includes a spacer sequence selected from any one of the sequence numbers 42, 44, 46, 48, 50, 52, 54, 56, and 58 shown in Table 6, or at least 14nt of a continuous portion thereof, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of any one of sequence numbers 42, 44, 46, 48, 50, 52, 54, 56, and 58, having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in any one of sequence numbers 42, 44, 46, 48, 50, 52, 54, 56, and 58.

[0284] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 42, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 42 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 42.

[0285] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 50, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 50 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 50.

[0286] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 56, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 56 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 56.

[0287] In some embodiments, the gRNA includes the spacer sequence described in SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt, or a sequence having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the aforementioned, or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 58 having a length of 14, 15, 16, 17, 18, or 19 nucleotides. In some embodiments, the spacer sequence of the gRNA is described in SEQ ID NO: 58.

[0288] [Table 6]

[0289] In some embodiments, the Specified provides combinations of gRNAs, each targeting a target site of the IL-2 gene or its regulatory element for transcriptional activation. In some embodiments, the Specified provides a multiplex epigenetic modification DNA targeting system comprising a combination of gRNAs.

[0290] In some embodiments, the gRNA combination comprises at least two gRNAs that target at least two different target sites for transcriptional activation. In some embodiments, the gRNA combination comprises at least two gRNAs that target two identical target sites for transcriptional activation. In some embodiments, the gRNA targets a combination of target sites selected from the combinations of target sites listed in Table 1. In some embodiments, the gRNA targets a combination of target sites selected from the group consisting of SEQ ID NOs: 43, 45, 47, 49, 51, 53, 55, 57, and 59.

[0291] In some embodiments, each gRNA in a gRNA combination is selected from any of the gRNAs described herein for targeted transcriptional activation. In some embodiments, the gRNA combination is selected from the gRNAs listed in Table 6. In some embodiments, the gRNA has a spacer sequence selected from the group consisting of SEQ ID NOs: 42, 44, 46, 48, 50, 52, 54, 56, and 58.

[0292] In some embodiments, the gRNA combination includes at least two gRNAs targeting the same target site. In some embodiments, the gRNA combination includes a first gRNA targeted at a first target site and a second gRNA targeted at the same first target site. In some embodiments, the gRNA combination includes a first gRNA targeted at a first target site and a second gRNA targeted at a second target site, where the target sites are the same.

[0293] In some embodiments, the gRNA combination comprises at least two gRNAs targeting at least two target sites. In some embodiments, the gRNA combination comprises a first gRNA targeted at a first target site and a second gRNA targeted at a second target site, where the target sites are different.

[0294] In some embodiments, the gRNA combination includes at least three gRNAs targeting at least three target sites. In certain embodiments, the at least three target sites are different target sites. In certain embodiments, the gRNA combination includes a first gRNA targeted at a first target site, a second gRNA targeted at a second target site, and a third gRNA targeted at a third target site. In some embodiments, at least two of the three target sites may be the same. In some embodiments, the gRNA combination includes at least three gRNAs targeting at least two target sites.

[0295] In some embodiments, the gRNA combination comprises at least four gRNAs targeting at least four target sites. In certain embodiments, the at least four target sites are different target sites. In certain embodiments, the gRNA combination comprises a first gRNA targeted at a first target site, a second gRNA targeted at a second target site, a third gRNA targeted at a third target site, and a fourth gRNA targeted at a fourth target site. In some embodiments, at least two of the four target sites may be the same. In some embodiments, the gRNA combination comprises at least four gRNAs targeting at least three target sites.

[0296] In some embodiments, the gRNA combination includes at least five gRNAs targeting at least five target sites. In certain embodiments, the at least five target sites are different target sites. In certain embodiments, the gRNA combination includes a first gRNA targeted at a first target site, a second gRNA targeted at a second target site, a third gRNA targeted at a third target site, a fourth gRNA targeted at a fourth target site, and a fifth gRNA targeted at a fifth target site. In some embodiments, at least two of the five target sites may be the same. In some embodiments, the gRNA combination includes at least five gRNAs targeting at least four target sites.

[0297] D. Other DNA-binding domains and DNA-targeting systems In some of the embodiments provided, the DNA-binding domain includes a zinc finger protein (ZFP), a transcription activator-like effector (TALE), a meganuclease, a homing endonuclease, or an I-SceI enzyme, or a variant thereof. In some embodiments, the DNA-binding domain includes any catalytically inactive variant described above. In some embodiments, the fusion protein of the DNA targeting system or one or more DNA targeting modules includes a DNA-binding domain as described herein, for example, a DNA-binding domain which is an engineered zinc finger protein (eZFP) or a TALE.

[0298] In some embodiments, a ZFP, zinc finger DNA-binding protein, or zinc finger-binding domain is a domain within a protein or larger protein that binds to DNA in a sequence-specific manner via one or more zinc fingers, which are regions of amino acid sequences within a binding domain whose structure is stabilized by the coordination of zinc ions. The term zinc finger DNA-binding protein is often abbreviated as zinc finger protein or ZFP. Among ZFPs are artificial or engineered ZFPs (eZFPs) that contain a ZFP domain that targets a specific DNA sequence, typically 9–18 nucleotides long, generated by the assembly of individual fingers. ZFPs include those with a single finger domain approximately 30 amino acids long, containing an alpha helix with two cysteine ​​and two invariant histidine residues coordinated via zinc in a single beta turn, and having 2, 3, 4, 5, or 6 fingers. Generally, the sequence specificity of a ZFP can be altered by making amino acid substitutions at four helical positions (-1, 2, 3, and 6) on the zinc finger recognition helix. Therefore, for example, ZFPs or ZFP-containing molecules are eZFPs that do not exist in nature, for example, those that have been engineered to bind to a target site of choice.

[0299] In some embodiments, zinc fingers are custom-designed (i.e., designed by the user) or obtained from commercial sources. Various methods are available for designing zinc finger proteins. For example, methods for designing zinc finger proteins to bind to a target DNA sequence of interest are described, for example, in Liu, Q. et al., PNAS, 94(11):5525-30 (1997), Wright, DA et al., Nat. Protoc., 1(3):1637-52 (2006), Gersbach, CA et al., Acc. Chem. Res., 47(8):2309-18 (2014), Bhakta MSet al., Methods Mol. Biol., 649:3-30 (2010), and Gaj et al., Trends Biotechnol, 31(7):397-405 (2013). Furthermore, various web-based tools are available for designing zinc finger proteins to bind to target DNA sequences. For example, see the Scripps Zinc Finger Tools design website, available at scripps.edu / barbas / zfdesign / zfdesignhome.php on the World Wide Web. Various commercial services for designing zinc finger proteins to bind to target DNA sequences are also available.For example, see the commercially available services or kits offered by Creative Biolabs (worldwide web, creative-biolabs.com / Design-and-Synthesis-of-Artificial-Zinc-Finger-Proteins.html), the Zinc Finger Consortium Modular Assembly Kit available from Addgene (worldwide web, addgene.org / kits / zfc-modular-assembly / ), or Sigma Aldrich's CompoZr Custom ZFN Service (worldwide web, sigmaaldrich.com / life-science / zinc-finger-nuclease-technology / custom-zfn.html).

[0300] In some embodiments, the fusion protein of the DNA targeting system includes an eZFP DNA-binding domain and an effector domain.

[0301] Transcription activator-like effectors (TALEs) are proteins naturally found in the bacterium Xanthomonas. TALEs comprise a repeat of multiple amino acid sequences, each repeat having binding specificity to a single base in a target sequence. Each repeat contains a pair of variable residues at positions 12 and 13 (repeat variable duodecimal, RVD) that determine the nucleotide specificity of the repeat. In some embodiments, RVDs related to the recognition of different nucleotides are HD for C, NG for T, NI for A, NN for G or A, NS for A, C, G, or T, HG for T, IG for T, NK for G, HA for C, ND for C, HI for C, HN for G, NA for G, SN for G or A, and YG for T, TL for A, VT for A or G, and SW for A. In some embodiments, RVDs may be mutated toward other amino acid residues to modulate, and in particular to enhance, this specificity to nucleotides A, T, C, and G. Binding domains with similar modular, base-by-base nucleic acid binding properties may originate from different bacterial species. These alternative modular proteins may exhibit greater sequence variability than TALE repeats.

[0302] In some embodiments, a “TALE DNA-binding domain” or “TALE” is a polypeptide comprising one or more TALE repeat domains / units. Each repeat domain, each containing repeat variable two residues (RVDs), is involved in the binding of the TALE to its congenerate target DNA sequence. A single “repeat unit” (also referred to as a “repeat”) is typically 33–35 amino acids long and exhibits at least some degree of sequence homology to other TALE repeat sequences within naturally occurring TALE proteins. TALE proteins may be designed to bind to target sites using canonical or non-canonical RVDs within the repeat unit. See, for example, U.S. Patents 8,586,526 and 9,458,205.

[0303] In some embodiments, the fusion protein of the DNA targeting system includes a TALE DNA-binding domain and an effector domain.

[0304] Zinc finger and TALE DNA-binding domains can be "engineered" to bind to a given nucleotide sequence, for example, by manipulating the recognition helical region of a naturally occurring zinc finger protein (modifying one or more amino acids), by manipulating the amino acids within the TALE repeat involved in DNA binding (repeat variable two residues or RVD region), or by systematically ordering modular DNA-binding domains such as TALE repeats or ZFP domains. Thus, an engineered zinc finger protein or TALE protein is a protein that does not exist in nature. Non-limiting examples of methods for manipulating zinc finger proteins and TALE are design and selection. An engineered protein is a protein that does not exist in nature, whose design / composition is brought about primarily by rational criteria. Rational criteria for design include the application of substitution rules, as well as the application of computerized algorithms for processing information in databases that store information on existing ZFP or TALE designs (canonical and non-canonical RVD) and binding data. For example, see U.S. Patent Nos. 9,458,205, 8,586,526, 6,140,081, 6,453,242, and 6,534,261, and see International Publication Nos. WO98 / 53058, WO98 / 53059, WO98 / 53060, WO02 / 016536, and WO03 / 016496.

[0305] 1. Exemplary ZFP In some embodiments, the DNA-binding domain comprises a zinc finger protein (ZFP). In some embodiments, exemplary ZFPs capable of binding to or binding to a target site, e.g., any of those provided herein in Section IB, are provided. In some embodiments, exemplary ZFPs may facilitate the specific targeting of an effector domain for transcriptional activation of a target site, e.g., a target site in the IL-2 gene, provided in Section I, for gene-specific transcriptional activation of IL-2. Thus, in some embodiments, exemplary ZFPs facilitate the activation and enhancement of lymphoid function.

[0306] In some embodiments, the target site of the ZFP provided herein is located within the IL-2 gene. In some embodiments, the target site within the IL-2 gene is located within region 4, region 5, or a region surrounding or containing the transcription start site (TSS). In some embodiments, the region surrounding or containing the TSS is located 50–150 kilobases (KB) upstream of the IL-2 gene and the IL-2 transcription start site (TSS). In some embodiments, the target site is located within the genomic coordinates human genome assembly GRCh38(hg38)chr4:122,507,000–122,508,985. In some embodiments, the target site within the IL-2 gene is located within region 4 or region 5.

[0307] In some embodiments, the target site of the ZFP provided herein includes the nucleotide sequence described in any one of SEQ ID NOs: 186-188, at least 12nt of that contiguous portion, or any of the aforementioned complementary sequences. In some embodiments, the target site of the ZFP provided herein includes the nucleotide sequence described in any one of SEQ ID NOs: 186-188. In some embodiments, the target site is contained in double-stranded DNA, such as genomic DNA. In some embodiments, the target site is double-stranded DNA, such as genomic DNA. In some embodiments, the ZFP is capable of binding to the target site. In some embodiments, the ZFP binds to the target site. In some embodiments, the binding is target-specific. For example, in some embodiments, the ZFP binds to the target site and does not bind to other sites containing different sequences. For example, in some embodiments, the individual ZFPs disclosed herein bind to the target site described in SEQ ID NOs: 186 and do not bind to different target sites, such as the target site described in SEQ ID NOs: 188. In some embodiments, the target site of the ZFP provided herein includes the sequences listed in Table 7.

[0308] [Table 7]

[0309] In some embodiments, the target site of the ZFP provided herein includes the nucleotide sequence described in SEQ ID NO: 186, at least 12nt of that contiguous portion, or any of the aforementioned complementary sequences.

[0310] In some embodiments, the target site of the ZFP provided herein includes the nucleotide sequence described in SEQ ID NO: 187, at least 12nt of that contiguous portion, or any of the aforementioned complementary sequences.

[0311] In some embodiments, the target site of the ZFP provided herein includes the nucleotide sequence described in SEQ ID NO: 188, at least 12nt of that contiguous portion, or any of the aforementioned complementary sequences.

[0312] In some embodiments, the features of ZFPs targeting specific target sites provided herein are shown in Table 8. In some embodiments, the ZFP comprises six zinc fingers, denoted F1-F6 in order from the N-terminus to the C-terminus, each containing the corresponding recognition regions F1-F6 shown in Table 8. In some embodiments, the recognition regions F1-F6 facilitate specific binding to the target site sequences shown in Table 8. In some embodiments, the ZFP comprises an amino acid sequence containing the recognition regions shown in Table 8. In some embodiments, the ZFP may be encoded by the DNA sequences shown in Table 8.

[0313] [Table 8] TIFF2026528753000012.tif120161TIFF2026528753000013.tif120161

[0314] In some embodiments, ZFPs, such as IL2_R4_A as described herein, are provided. In some embodiments, the ZFP targets a target site comprising the nucleotide sequence described in SEQ ID NO: 186, at least 12nt of its contiguous portion, or any of the complementary sequences described herein. In some embodiments, the ZFP targets a target site comprising the nucleotide sequence described in SEQ ID NO: 186. In some embodiments, the target site is double-stranded DNA. In some embodiments, the ZFP comprises six zinc fingers, denoted F1-F6 in order from N-terminus to C-terminus, each comprising a corresponding zinc finger recognition region F1-F6, the amino acid sequences of each zinc finger recognition region being: F1: QNAHRKT (SEQ ID NO: 195), F2: RKYYLAK (SEQ ID NO: 196), F3: RSAHLSR (SEQ ID NO: 197), F4: QSGDLTR (SEQ ID NO: 198), F5: RSDHLTQ (SEQ ID NO: 199), and F6: DSANLSR (SEQ ID NO: 200). In some embodiments, the ZFP includes the amino acid sequence or a portion thereof described in SEQ ID NO: 189, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the ZFP includes the amino acid sequence described in SEQ ID NO: 189. In some embodiments, the ZFP is encoded by the nucleotide sequence described in SEQ ID NO: 192, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the ZFP is encoded by the nucleotide sequence described in SEQ ID NO: 192.

[0315] In some embodiments, ZFPs, for example, IL2_R4_B as described herein, are provided. In some embodiments, the ZFP targets a target site comprising the nucleotide sequence described in SEQ ID NO: 187, at least 12nt of its contiguous portion, or any of the complementary sequences described herein. In some embodiments, the ZFP targets a target site comprising the nucleotide sequence described in SEQ ID NO: 187. In some embodiments, the target site is double-stranded DNA. In some embodiments, the ZFP comprises six zinc fingers, denoted F1-F6 in order from N-terminus to C-terminus, each comprising a corresponding zinc finger recognition region F1-F6, the amino acid sequences of each zinc finger recognition region being: F1: DSSHLEL (SEQ ID NO: 201), F2: DRSNLTR (SEQ ID NO: 202), F3: RSDNLSE (SEQ ID NO: 203), F4: VRRALSS (SEQ ID NO: 204), F5: QSGALAR (SEQ ID NO: 205), and F6: RLDWLPM (SEQ ID NO: 206). In some embodiments, the ZFP includes the amino acid sequence or a portion thereof described in SEQ ID NO: 190, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the ZFP includes the amino acid sequence described in SEQ ID NO: 190. In some embodiments, the ZFP is encoded by the nucleotide sequence described in SEQ ID NO: 191, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the ZFP is encoded by the nucleotide sequence described in SEQ ID NO: 191.

[0316] In some embodiments, ZFPs, for example, IL2_R5_A as described herein, are provided. In some embodiments, the ZFP targets a target site comprising the nucleotide sequence described in SEQ ID NO: 188, at least 12nt of its contiguous portion, or any of the complementary sequences described herein. In some embodiments, the ZFP targets a target site comprising the nucleotide sequence described in SEQ ID NO: 188. In some embodiments, the target site is double-stranded DNA. In some embodiments, the ZFP comprises six zinc fingers, denoted F1-F6 in order from N-terminus to C-terminus, each comprising a corresponding zinc finger recognition region F1-F6, the amino acid sequences of each zinc finger recognition region being: F1: RSDNLSV (SEQ ID NO: 207), F2: RSAHLSR (SEQ ID NO: 208), F3: QNAHRKT (SEQ ID NO: 209), F4: LRHHLTR (SEQ ID NO: 210), F5: TSSNRKT (SEQ ID NO: 211), and F6: TSNLSR (SEQ ID NO: 212). In some embodiments, the ZFP includes the amino acid sequence or a portion thereof described in SEQ ID NO: 191, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the ZFP includes the amino acid sequence described in SEQ ID NO: 191. In some embodiments, the ZFP is encoded by the nucleotide sequence described in SEQ ID NO: 194, or a nucleotide sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto. In some embodiments, the ZFP is encoded by the nucleotide sequence described in SEQ ID NO: 194.

[0317] E. Effector Domain In some embodiments, the DNA targeting systems provided herein further include one or more effector domains. In some embodiments, the one or more effector domains are transcription activator effector domains. In some embodiments, in a DNA targeting system having multiple effector domains, each effector domain is a transcription activator. In some embodiments, the herein provides a DNA targeting system comprising (a) a DNA-binding domain that can target a target site in the IL-2 gene or its regulatory DNA element, for example, any of those described in Section IC or Section ID above, and (b) a fusion protein comprising at least one effector domain.

[0318] 1. Effector domain for transcriptional activation In some embodiments, the DNA targeting systems provided herein further include one or more effector domains, for example, transcription activator effector domains. In some embodiments, the herein provides a DNA targeting system comprising (a) a DNA-binding domain capable of targeting a target site in the IL-2 gene or its regulatory element or its regulatory DNA element, for example, any DNA-binding domain described in Section ID or Section IE above, and (b) a fusion protein comprising at least one effector domain. In some embodiments, the effector domain is capable of increasing IL-2 transcription. In some embodiments, the effector domain comprises a transcription activator domain.

[0319] In some embodiments, when an effector domain is ectopically recruited to a gene or its DNA regulatory element, it activates, induces, catalyzes, or results in an increase in gene transcription. In some embodiments, the effector domain activates, induces, catalyzes, or results in transcriptional activation, transcriptional co-activation, transcriptional elongation, transcriptional derepression, transcriptional factor release, polymerization, histone modification, histone acetylation, histone deacetylation, nucleosome remodeling, chromatin remodeling, reversal of heterochromatin formation, proteolysis, ubiquitination, deubiquitination, phosphorylation, dephosphorylation, DNA methylation, DNA demethylation, histone methylation, histone demethylation, or oxidation of DNA bases. In some embodiments, the effector domain activates, induces, catalyzes, or results in transcriptional activation, transcriptional co-activation, or transcriptional elongation. In some embodiments, the effector domain induces transcriptional activation. In some embodiments, the effector domain itself has one of the aforementioned activities (i.e., acts directly). In some embodiments, the effector domain recruits and / or interacts with (i.e., acts indirectly with) a polypeptide domain having one of the aforementioned activities.

[0320] Gene expression of endogenous mammalian genes, such as human genes, can be achieved by targeting a mammalian gene or its regulatory DNA element (e.g., promoter or enhancer) via one or more gRNAs using a fusion protein containing a DNA-binding domain such as dCas9 and an effector domain such as a transcriptional activation domain. Any of the various effector domains for transcriptional activation (e.g., transcriptional activation domains) are known and can be used according to the provided embodiments. Activation of target genes by transcriptional activation domains, as well as Cas fusion proteins (including various Cas molecules) and transcriptional activation domains, is described, for example, in WO2014 / 197748, WO2016 / 130600, WO2017 / 180915, WO2021 / 226555, WO2021 / 226077, WO2013 / 176772, WO2014 / 152432, WO2014 / 093661, WO2024 / 015881, Adli, M. Nat. Commun. 9, 1911 (2018), Perez-Pinera, P. et al. Nat. Methods 10, 973-976 (2013), Mali, P. et al. This is described in al. Nat. Biotechnol. 31, 833-838 (2013) and Maeder, M. Let al. Nat. Methods 10, 977-979 (2013).

[0321] In some embodiments, the transcriptional activation domain includes a domain of a protein selected from VP64, p65, Rta, p300, CBP, VPR, VPH, HSF1, TET protein (e.g., TET1), a partially or fully functional fragment or domain thereof, or any combination thereof. In some embodiments, the transcriptional activator domain further includes at least one domain of a protein selected from FOXO3 and NCOA3, which exhibits transcriptional activation and is capable of inducing or activating transcription from a gene, is a functional transcriptional activation domain, and / or has the function of transcriptional activation. In some embodiments, the transcriptional activator domain further includes at least one domain selected from FOXO3 and NCOA3.

[0322] In some embodiments, the epigenetic mark includes histone H3K27 acetylation. In some embodiments, the effector domain can catalyze the acetylation of histone H3 lysine 27 at the target site or recruit an enzyme that catalyzes the acetylation of histone H3 lysine 27 at the target site. In some embodiments, the enzyme that catalyzes the acetylation is an acetyltransferase. In some embodiments, the transcriptional activation domain includes a VP64 domain. For example, dCas9-VP64 can be targeted to a target site by one or more gRNAs to activate a gene. VP64 is a polypeptide composed of four tandem copies of VP16, which is a 16-amino acid transactivation domain of herpes simplex virus. VP64 domains, including those in dCas fusion proteins, are described, for example, in WO2014 / 197748, WO2013 / 176772, WO2014 / 152432, and WO2014 / 093661. In some embodiments, the transcriptional activation domain comprises at least one VP16 domain, or a VP16 tetramer ("VP64") or a variant thereof. An exemplary VP64 domain is described in SEQ ID NO: 66. In some embodiments, the transcriptional activation domain comprises SEQ ID NO: 66 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to SEQ ID NO: 66 or a portion thereof. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 66.

[0323] In some embodiments, the transcriptional activation domain includes a p65 activation domain (p65AD). p65AD is the primary transactivation domain of the 65 kDa polypeptide of the NF-KB transcription factor karyotype. An exemplary sequence of the human transcription factor p65 is available in the Uniprot database under accession number Q04206. p65 domains, including those in dCas fusion proteins, are described, for example, in WO2017 / 180915 and Chavez, A. et al. Nat. Methods 12, 326-328 (2015). An exemplary p65 activation domain is described in SEQ ID NO: 79. In some embodiments, the transcriptional activation domain includes SEQ ID NO: 79 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 79 or a portion thereof. In some embodiments, the transcriptional activation domain is described in Sequence ID No. 79.

[0324] In some embodiments, the transcriptional activation domain includes an R trans-activator (Rta) domain. Rta is the earliest protein of Epstein-Barr virus (EBV) and is a transcriptional activator that induces the expression of lytic genes and causes viral reactivation. Rta domains, including those in dCas fusion proteins, are described, for example, in WO2017 / 180915 and Chavez, A. et al. Nat. Methods 12, 326-328 (2015). An exemplary Rta domain is described in SEQ ID NO: 80. In some embodiments, the transcriptional activation domain includes SEQ ID NO: 80 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 80 or a portion thereof. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 80.

[0325] In some embodiments, the transcriptional activation domain includes either a CREB-binding protein (CBP) domain or a p300 domain. In some embodiments, CBP refers to the CREB-binding protein encoded by the human CREBBP gene. CBP is a co-activator that interacts with cAMP response element-binding protein (CREB). In some embodiments, p300 refers to the histone acetyltransferase p300 protein encoded by the human EP300 gene and is a co-activator closely related to CBP. CBP and p300 each interact with various transcriptional activators to influence gene transcription (Gerritsen, ME et al. PNAS 94(7):2927-2932 (1997)). In some embodiments, the transcriptional activation domain includes a p300 domain. p300 domains (such as the catalytic core of p300) including those in dCas fusion proteins for gene activation are described, for example, in WO2016 / 130600, WO2017 / 180915, and Hilton, IB et al., Nat. Biotechnol. 33(5):510-517 (2015). An exemplary human CBP sequence is described in SEQ ID NO: 81. An exemplary human p300 sequence is described in SEQ ID NO: 82. An exemplary p300 domain is described in SEQ ID NO: 83. In some embodiments, the transcriptional activation domain includes one or a portion thereof of SEQ ID NOs: 81-83, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with one or a portion thereof of SEQ ID NOs: 81-83. In some embodiments, the transcriptional activation domain includes SEQ ID NO: 83 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 83 or a portion thereof. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 83.

[0326] In some embodiments, the transcriptional activation domain includes an HSF1 domain. In some embodiments, HSF1 refers to the heat shock factor protein 1 protein encoded by the human HSF1 gene. HSF1, including that in a dCas fusion protein for gene activation, is described, for example, in WO2021 / 226555, WO2015 / 089427, and Konermann et al. Nature 517(7536):583-8(2015). An exemplary human HSF1 sequence is described in SEQ ID NO: 84. An exemplary HSF1 domain sequence is described in SEQ ID NO: 84. In some embodiments, the transcriptional activation domain includes an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 84 or SEQ ID NO: 1775 or a portion thereof. In some embodiments, the transcriptional activation domain includes SEQ ID NO: 84 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 84 or a portion thereof. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 84.

[0327] In some embodiments, the transcriptional activation domain comprises a triplicate activator VP64-p65-Rta (also known as VPR). VPR comprises three transcriptional activation domains (VP64, p65, and Rta) fused by a short amino acid linker and can effectively upregulate the expression of a target gene. VPRs, including those in dCas fusion proteins for gene activation, are described, for example, in WO2021 / 226555 and Chavez, A. et al. Nat. Methods 12, 326-328 (2015). An exemplary VPR polypeptide is described in SEQ ID NO: 85. In some embodiments, the transcriptional activation domain comprises SEQ ID NO: 85 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 85 or a portion thereof. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 85.

[0328] In some embodiments, the transcriptional activation domain includes VPH. VPH is a triply activated factor polypeptide comprising VP64, mouse p65, and HSF1. VPH, including that in a dCas fusion protein for gene activation, is described, for example, in WO2021 / 226555. An exemplary VPH polypeptide is described in SEQ ID NO: 86. In some embodiments, the transcriptional activation domain includes SEQ ID NO: 86 or a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 86 or a portion thereof. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 86.

[0329] In some embodiments, the transcriptional activation effector domain has demethylase activity. The effector domain may include enzymes that remove methyl (CH3-) groups from nucleic acids, proteins (particularly histones), and other molecules. The effector domain may convert methyl groups to hydroxymethylcytosine in a mechanism for demethylating DNA. Alternatively, the transcriptional activation domain may convert methyl groups to hydroxymethylcytosine in a mechanism for demethylating DNA. The effector domain may catalyze this reaction. For example, the transcriptional activation domain that catalyzes this reaction may include a domain derived from a TET protein, such as TET1 (10-11 translocation methylcytosine dioxygenase 1). In some embodiments, TET1 refers to the methylcytosine dioxygenase TET1 protein encoded by the human TET1 gene. TET1 catalyzes the conversion of the modified genomic base 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) and plays a crucial role in active DNA demethylation. TET1, including that in a dCas fusion protein for gene activation, is described, for example, in WO2021 / 226555. An exemplary human TET1 sequence is described in SEQ ID NO: 87. An exemplary TET1 catalytic domain is described in SEQ ID NO: 88. In some embodiments, the transcriptional activation domain includes an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 87 or SEQ ID NO: 88 or a portion thereof. In some embodiments, the transcriptional activation domain includes an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 88 or a portion thereof. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 88.

[0330] In some embodiments, the effector domain may include a SunTag domain. A SunTag is a repeating peptide array that can recruit multiple copies of an antibody fusion protein bound to the repeating peptide. The antibody fusion protein may include additional effector domains, such as a transcriptional activation domain (e.g., VP64), to induce increased transcription of a target gene. SunTags, including those in dCas fusion proteins for gene activation, are described, for example, in WO2016 / 011070 and Tanenbaum, M. et al. Cell. 159(3):635-646 (2014). An exemplary SunTag effector domain includes a repeating GCN4 peptide having the amino acid sequence LLPKNYHLENEVARLKKLVGER (SEQ ID NO: 89), separated by a linker having the amino acid sequence GGSGG (SEQ ID NO: 90). In some embodiments, the effector domain comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in SEQ ID NO: 89, its domain, its portion, or its variant, or any of the foregoing. In some embodiments, the SunTag effector domain comprises a transcription activator effector domain (e.g., VP64) that recruits an antibody fusion protein bound to the GCN4 peptide, thereby activating transcription at a target site and acting as a transcription activator effector domain.

[0331] In some embodiments, the transcriptional activation domain includes a FOXO3 domain, i.e., a domain derived from FOXO3. In some embodiments, FOXO3 refers to the forkheadbox protein O3 encoded by the human FOXO3 gene. FOXO3 functions as a transcriptional activator that recognizes and binds to a specific DNA sequence. An exemplary human FOXO3 sequence is described in SEQ ID NO: 219. Exemplary FOXO3 domain sequences are described in SEQ ID NOs: 220 and 221. In some embodiments, the transcriptional activation domain is a sequence, domain or portion thereof, described in any of SEQ ID NOs: 219-221, for example, at least 10, 15, 20, 22, 25, 30, 35, 37, 40, 42, 45, 47, 49, 50, 55, 57, 60, 61, 62, 65, 70, 72, 75, 76, or 80 amino acids, for example, a contiguous portion thereof of at least 20 amino acids, or a variant thereof, or a portion thereof, described in any of SEQ ID NOs: 219-221 A sequence, or a domain or portion thereof, for example, comprising at least 10, 15, 20, 22, 25, 30, 35, 37, 40, 42, 45, 47, 49, 50, 55, 57, 60, 61, 62, 65, 70, 72, 75, 76, or 80 amino acids, for example, a contiguous portion thereof of at least 20 amino acids, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to a variant thereof. In some embodiments, the transcriptional activation domain is or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to SEQ ID NO: 219. In some embodiments, the transcriptional activation domain comprises a contiguous portion of SEQ ID NO: 219 having a length of at least 80 amino acids. In some embodiments, the transcriptional activation domain includes SEQ ID NO: 220. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 220. An exemplary nucleotide sequence encoding the transcriptional activation domain described in SEQ ID NO: 220 is described in SEQ ID NO: 222.In some embodiments, the transcriptional activation domain is or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 221. In some embodiments, the transcriptional activation domain comprises a contiguous portion of SEQ ID NO: 219 having a length of at least 42 amino acids. In some embodiments, the transcriptional activation domain comprises SEQ ID NO: 221. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 221.

[0332] In some embodiments, the transcriptional activation domain includes the NCOA3 domain, i.e., a domain derived from NCOA3. In some embodiments, NCOA3 refers to the nuclear receptor coactivator 3 protein encoded by the human NCOA3 gene. NCOA3 functions as a transcriptional coactivator for steroid receptors and nuclear receptors. An exemplary human NCOA3 sequence is described in SEQ ID NO: 223. Exemplary NCOA3 domain sequences are described in SEQ ID NO: 224 and SEQ ID NO: 184. In some embodiments, the transcriptional activation domain is the sequence, domain, or portion thereof described in any of SEQ ID NOs: 184, 223, and 224, for example, at least 10, 15, 20, 22, 25, 30, 35, 37, 40, 42, 45, 47, 49, 50, 55, 57, 60, 61, 62, 65, 70, 72, 75, 76, or 80 amino acids, for example, a contiguous portion thereof of at least 20 amino acids, or a variant thereof, or any of SEQ ID NOs: 184, 223, and 224. The sequences described herein, or their domains or portions thereof, for example, include at least 10, 15, 20, 22, 25, 30, 35, 37, 40, 42, 45, 47, 49, 50, 55, 57, 60, 61, 62, 65, 70, 72, 75, 76, or 80 amino acids, for example, a contiguous portion thereof of at least 20 amino acids, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to a variant thereof. In some embodiments, the transcriptional activation domain is or includes an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to SEQ ID NO: 224. In some embodiments, the transcriptional activation domain includes a contiguous portion of SEQ ID NO: 223 having a length of at least 80 amino acids. In some embodiments, the transcriptional activation domain includes SEQ ID NO: 224. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 224. An exemplary nucleotide sequence encoding the transcriptional activation domain described in SEQ ID NO: 224 is described in SEQ ID NO: 185.In some embodiments, the transcriptional activation domain is or comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 184. In some embodiments, the transcriptional activation domain comprises a contiguous portion of SEQ ID NO: 223 having a length of at least 49 amino acids. In some embodiments, the transcriptional activation domain comprises SEQ ID NO: 184. In some embodiments, the transcriptional activation domain is described in SEQ ID NO: 184.

[0333] In some embodiments, the transcriptional activation domain includes a fusion of the NCOA3 and FOXO3 domains described herein, for example, the NCOA3 domain described in SEQ ID NO: 184 and the FOXO3 domain described in SEQ ID NO: 221. In some embodiments, the transcriptional activation domain includes a fusion of two NCOA3 domains and one FOXO3. The fusion protein contains these domains, which may be arranged in any order. In some embodiments, the transcriptional activation domain is arranged from N-terminus to C-terminus as follows: a first NCOA3 domain, a FOXO3 domain, and a second NCOA3 domain (also referred to as the NCOA3-FOXO3-NCOA3 domain (NFN)). In some embodiments, the NFN is or includes an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with respect to SEQ ID NO: 181. In some embodiments, the NFN domain includes SEQ ID NO: 181. In some embodiments, the NFN domain is SEQ ID NO: 181. In some embodiments, the domains are linked to each other directly or via linkers such as peptide linkers.

[0334] In some embodiments, the fusion protein includes a transcriptional activation domain which is an NFN domain. In some embodiments, the fusion protein further includes an additional transcriptional activation domain which is a VP64 domain. In some embodiments, the NFN and VP64 domains are linked directly to each other, linked via a linker, or separated by a DNA-binding domain. In some embodiments, the NFN and VP64 domains are separated by a DNA-binding domain.

[0335] F. Fusion Protein In some embodiments, the fusion protein comprises (a) a DNA-binding domain capable of targeting multiple target sites of the IL-2 gene or its regulatory element, and (b) at least one transcription activator effector domain for increasing transcription of the IL-2 gene or its regulatory element.

[0336] In some embodiments, the fusion protein comprises at least one of the DNA-binding domains described in Section IC or Section ID of this specification, and at least one of the effector domains described in Section IE of this specification. In some embodiments, the fusion protein contains a CRISPR / Cas-based DNA-binding domain as described in Section IC, and at least one effector domain for transcriptional activation as described in Section IE1. In some embodiments, the fusion protein contains a ZFP DNA-binding domain as described in Section ID or ID1, and at least one effector domain for transcriptional activation as described in Section IE. In some embodiments, the fusion protein is targeted to a target site in the IL-2 gene or its regulatory element, resulting in increased transcription or activation of the gene. In some embodiments, the fusion protein is targeted to a target site in a combination of target sites on the IL-2 gene or its regulatory element, resulting in increased transcription or activation of the IL-2 gene.

[0337] In some embodiments, the DNA-binding domain and effector domain of the fusion protein are heterogeneous, i.e., the domains originate from different species, or at least one of the domains is not found in nature. In some embodiments, the fusion protein is an engineered fusion protein, i.e., the fusion protein is not found in nature.

[0338] In some embodiments, at least one effector domain is fused to the N-terminus, C-terminus, or both the N-terminus and C-terminus of the DNA-binding domain or its components. The at least one effector domain may be fused directly to the DNA-binding domain, or via any intervening amino acid sequence, such as a linker sequence or a nuclear localization sequence (NLS).

[0339] In some embodiments, the fusion protein of the provided DNA binding system or its DNA targeting module comprises a transcription activator effector domain and a DNA binding domain, in order from the N-terminus to the C-terminus.

[0340] In some embodiments, at least one effector domain of the fusion protein comprises multiple effector domains. In some embodiments, the fusion protein comprises two, three, or four effector domains, or more than four effector domains. In some embodiments, at least two of the effector domains of the fusion protein are different. In some embodiments, each of the effector domains of the fusion protein is different. In some embodiments, at least one effector domain comprises two effector domains, where the two effector domains are different. In some embodiments, the effector domains and DNA-binding domains may be arranged in any order.

[0341] In some embodiments, each effector domain is a transcription activator effector domain.

[0342] In some embodiments, at least one effector domain of the fusion protein comprises two different effector domains. The two different effector domains and the DNA-binding domain can be arranged in any order. In some embodiments, each effector domain is located on the N-terminal side of the DNA-binding domain, where the first effector domain is fused to the N-terminus of the second effector domain, and the second effector domain is fused to the N-terminus of the DNA-binding domain. In some embodiments, the fusion protein of the provided DNA-binding system or its DNA-targeting module comprises a first effector domain, a second effector domain, and a DNA-binding domain, in the order from N-terminus to C-terminus. In some embodiments, each effector domain is located on the C-terminal side of the DNA-binding domain, where the first effector domain is fused to the C-terminus of the DNA-binding domain, and the second effector domain is fused to the C-terminus of the first effector domain. In some embodiments, the fusion protein of the provided DNA binding system or its DNA targeting module comprises a DNA binding domain, a first effector domain, and a second effector domain, in the order from the N-terminus to the C-terminus. In some embodiments, the DNA binding domain is located between the effector domains, where one effector domain is fused to the N-terminus of the DNA binding domain and the other effector domain is fused to the C-terminus of the DNA binding domain. In some embodiments, the fusion protein of the provided DNA binding system or its DNA targeting module comprises a first effector domain, a DNA binding domain, and a second effector domain, in the order from the N-terminus to the C-terminus. In some embodiments, one or more components may be fused directly to each other or via any intervening amino acid sequence, such as a linker sequence or a nuclear localization sequence (NLS).

[0343] In some embodiments, the fusion protein includes one or more linkers. In some embodiments, the linkers are peptide linkers. In some embodiments, one or more linkers connect a DNA-binding domain or its components to at least one effector domain. The linkers may be located anywhere in the polypeptide sequence of the fusion protein, for example, between the effector domain and the DNA-binding domain or its components. The linkers may be of any length and may be designed to promote or restrict the mobility of components in the fusion protein. The linkers may include any amino acid sequence of about 2 to about 100, about 5 to about 80, about 10 to about 60, or about 20 to about 50 amino acids. The linkers may include an amino acid sequence of at least about 2, 3, 4, 5, 10, 15, 20, 25, or 30 amino acids. The linkers may include an amino acid sequence of about 100, 90, 80, 70, 60, 50, or less than 40 amino acids. Those skilled in the art can easily select a suitable linker for connecting two domains. In some embodiments, the linker is a flexible linker. Flexible linkers generally consist of small nonpolar or polar residues such as glycine, serine, or threonine. The linker may include a continuous or serial repeat of an amino acid sequence having a length of 2 to 20 amino acids. The linker may be rich in the amino acids glycine (G), serine (S), and / or alanine (A). The linker may include, for example, a GS linker. An exemplary GS linker is represented by the sequence GGGGS (SEQ ID NO: 91). The linker may also include a repeat of a sequence represented by, for example, the formula (GGGGS)n, where n is an integer representing the number of times the GGGGS sequence is repeated (e.g., 1 to 10 times). The number of times the linker sequence is repeated can be adjusted to optimize the linker length and achieve proper separation of functional domains. For example, in some embodiments, the linker is (GGGGS) nThis is a linker, where n is an integer between 1 and 10. Other examples of linkers include, for example, GGGGG (sequence number 92), GGAGG (sequence number 93), GGGGSSS (sequence number 94), or GGGGAAA (sequence number 95).

[0344] In some embodiments, an artificial linker sequence may be used. In some embodiments, the linker is EASGSGRASPGIPGSTR (SEQ ID NO: 96). In some embodiments, the linker is GIHGVPAA (SEQ ID NO: 97). In some embodiments, the linker is SSGNSNANSRGPSFSSGLVPLSLRGSH (SEQ ID NO: 98). In some embodiments, the linker is KRPAATKKAGQAKKKKASDAKSLTAWS (SEQ ID NO: 99).

[0345] In some embodiments, the inclusion of a linker in the fusion protein results in enhanced activation of the IL-2 gene or its regulatory elements.

[0346] In some embodiments, the linker is an XTEN linker. In some embodiments, the XTEN linker is a recombinant polypeptide lacking hydrophobic amino acid residues (e.g., an unstructured recombinant peptide). Exemplary XTEN linkers are described, for example, in Schellenberger et al., Nature Biotechnology 27, 1186-1190 (2009) or WO2021 / 247570. In some embodiments, the linker includes the sequence or a portion thereof described in SEQ ID NO: 100, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 100. In some embodiments, the linker includes the sequence described in SEQ ID NO: 77, or a sequence of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 amino acids of SEQ ID NO: 100. In some embodiments, the linker consists of the sequence described in SEQ ID NO: 100, or a sequence of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 amino acids of SEQ ID NO: 100. In some embodiments, the linker includes the sequence described in SEQ ID NO: 100. In some embodiments, the linker consists of the sequence described in SEQ ID NO: 100. In some embodiments, the linker includes the sequence or a portion thereof described in SEQ ID NO: 101, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of the foregoing. In some embodiments, the linker includes the sequence described in SEQ ID NO: 101, or a sequence of at least 5, 10, or 15 amino acids of SEQ ID NO: 101. In some embodiments, the linker consists of the sequence described in SEQ ID NO: 101, or a sequence of at least 5, 10, or 15 amino acids of SEQ ID NO: 101. In some embodiments, the linker includes the sequence described in SEQ ID NO: 101. In some embodiments, the linker consists of the sequence described in SEQ ID NO: 101.A suitable linker may be selected or designed based on reasonable criteria known in the art, such as those described, for example, in Chen et al. Adv. Drug Deliv. Rev. 65(10):1357-1369 (2013). In some embodiments, the linker includes the linker described in WO2021 / 247570.

[0347] In some embodiments, the fusion protein of the DNA targeting system or its targeting module comprises one or more nuclear localization signals (NLS). In some embodiments, the fusion protein described herein comprises one or more n...

Claims

1. An epigenetic modification DNA targeting system comprising multiple DNA targeting modules for increasing the transcription of the interleukin (IL-2) gene, wherein each of the DNA targeting modules is (a) A DNA-binding domain for targeting the target site of the IL-2 gene, and (b) at least one transcription activator effector domain A fusion protein containing The aforementioned epigenetic modified DNA targeting system.

2. The DNA-binding domain of each fusion protein comprises a clustered regularly interspaced short palindromic repeat (Cas)-related protein, a zinc finger protein (ZFP), a transcription activator-like effector (TALE), a meganuclease, a homing endonuclease, or an I-SceI enzyme, or a variant thereof, and optionally, the DNA-binding domain comprises one of the catalytically inactive variants described above. If the DNA-binding domain of each fusion protein contains a Cas protein, the DNA targeting system further comprises at least two gRNAs, each capable of targeting the Cas protein to a target site. The epigenetic modified DNA targeting system according to claim 1.

3. The epigenetic modified DNA targeting system according to claim 1 or claim 2, wherein the plurality of DNA targeting modules are two to six DNA targeting modules.

4. The epigenetic modified DNA targeting system according to any one of claims 1 to 3, wherein the plurality of DNA targeting modules are two DNA targeting modules.

5. The epigenetic modified DNA targeting system according to any one of claims 1 to 3, wherein the plurality of DNA targeting modules are three DNA targeting modules.

6. The epigenetic modified DNA targeting system according to any one of claims 1 to 3, wherein the plurality of DNA targeting modules are four DNA targeting modules or five DNA targeting modules.

7. An epigenetic modified DNA targeting system according to any one of claims 1 to 6, wherein each target site is located within the genomic coordinates human genome assembly GRCh38 (hg38) chr4:122,451,261 to 122,593,946.

8. The epigenetically modified DNA targeting system according to any one of claims 1 to 7, characterized in that each target site is located in the putative regulatory region of the IL-2 gene, and the putative regulatory region has one or more of the following: an epigenetic mark, a regulatory characteristic, or a transcription factor motif.

9. The epigenetic modified DNA targeting system according to claim 8, wherein the epigenetic mark includes histone H3K27 acetylation.

10. The epigenetic modified DNA targeting system according to any one of claims 1 to 9, wherein the at least one transcription activator effector domain can catalyze the acetylation of histone H3 lysine 27 at the target site, or can recruit an enzyme that catalyzes the acetylation of histone H3 lysine 27 at the target site.

11. The epigenetic modified DNA targeting system according to claim 10, wherein the enzyme that catalyzes the acetylation is an acetyltransferase.

12. The epigenetic modified DNA targeting system according to claim 10 or claim 11, wherein the enzyme that catalyzes the acetylation is a histone acetyltransferase.

13. The epigenetic modified DNA targeting system according to any one of claims 8 to 12, wherein the presumptive regulatory region is a promoter or an enhancer.

14. An epigenetic modified DNA targeting system according to any one of claims 1 to 13, wherein each target site is located in a promoter or enhancer.

15. Each target site independently measured the following values: (1) chr4: 122,451,000–122,460,000, (2) chr4: 122,465,000–122,472,000, (3) chr4: 122,479,410–122,482,750, (4) chr4: 122,488,840–122,491,890, (5) 122,507,000–122,508 An epigenetic modified DNA targeting system according to any one of claims 1 to 14, located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (6) chr4: 122, 539, 300 to 122, 544, 050, and (7) chr4: 122, 576, 890 to 122, 579, 315.

16. An epigenetic modified DNA targeting system according to any one of claims 1 to 15, wherein each target site is independently located within a target region corresponding to a human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,488,840 to 122,491,890, (3) 122,507,000 to 122,508,985, and (4) chr4: 122,539,300 to 122,544,050.

17. The epigenetic modified DNA targeting system according to any one of claims 1 to 16, wherein at least two of the plurality of DNA targeting modules target different target sites.

18. The aforementioned at least two different target sites are: (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,465,000 to 122,472,000, (3) chr4: 122,479,410 to 122,482,750, (4) chr4: 122,488,840 to 122,491,890, (5) 122,507,000 to 122,508 An epigenetic modified DNA targeting system according to any one of claims 1 to 15 and 17, wherein the target regions are located in two different target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (6) chr4:122,539,300-122,544,050 and (7) chr4:122,576,890-122,579,315.

19. The epigenetic modification DNA targeting system according to any one of claims 1 to 16, 17, and 18, wherein the at least two different target sites are located in two different target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,488,840 to 122,491,890, (3) 122,507,000 to 122,508,985, and (4) chr4: 122,539,300 to 122,544,050.

20. The epigenetic modified DNA targeting system according to any one of claims 1 to 15, wherein at least three of the plurality of DNA targeting modules target different target sites.

21. The aforementioned at least three different target sites are: (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,465,000 to 122,472,000, (3) chr4: 122,479,410 to 122,482,750, (4) chr4: 122,488,840 to 122,491,890, (5) 122,507,000 to 122,508 An epigenetic modified DNA targeting system according to any one of claims 1 to 15 and 20, wherein the target regions are located in three different target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (6) chr4:122,539,300-122,544,050 and (7) chr4:122,576,890-122,579,315.

22. An epigenetic modification DNA targeting system according to any one of claims 1 to 16, 20, and 21, wherein the at least three distinct target sites are located in three distinct target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,488,840 to 122,491,890, (3) 122,507,000 to 122,508,985, and (4) chr4: 122,539,300 to 122,544,050.

23. The epigenetic modified DNA targeting system according to any one of claims 1 to 15, wherein at least four of the plurality of DNA targeting modules target different target sites, or at least five of the plurality of DNA targeting modules target different target sites.

24. The above at least four different target sites or the above at least five different target sites are: (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,465,000 to 122,472,000, (3) chr4: 122,479,410 to 122,482,750, (4) chr4: 122,488,840 to 122,491,890, (5) 122,507,0 An epigenetic modified DNA targeting system according to any one of claims 1 to 15 and 23, wherein the target regions are located in four different target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of 00-122, 508, 985, (6) chr4: 122, 539, 300-122, 544, 050, and (7) chr4: 122, 576, 890-122, 579, 315.

25. An epigenetic modification DNA targeting system according to any one of claims 1 to 16, 23, and 24, wherein the at least four different target sites or the at least five different target sites are located in four different target regions corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,488,840 to 122,491,890, (3) 122,507,000 to 122,508,985, and (4) chr4: 122,539,300 to 122,544,050.

26. The epigenetic modified DNA targeting system according to any one of claims 1 to 15, wherein each of the plurality of DNA targeting modules targets a different target site.

27. Each target site is (1) chr4: 122,451,000–122,460,000, (2) chr4: 122,465,000–122,472,000, (3) chr4: 122,479,410–122,482,750, (4) chr4: 122,488,840–122,491,890, (5) 122,507,000–122,508,985, An epigenetic modified DNA targeting system according to any one of claims 1 to 15 and 26, wherein the target region is located in a different target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (6) chr4: 122, 539, 300 to 122, 544, 050 and (7) chr4: 122, 576, 890 to 122, 579, 315.

28. An epigenetic modified DNA targeting system according to any one of claims 1 to 16, 26, and 27, wherein each target site is located in a different target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,488,840 to 122,491,890, (3) 122,507,000 to 122,508,985, and (4) chr4: 122,539,300 to 122,544,050.

29. The epigenetic modified DNA targeting system according to any one of claims 1 to 25, wherein at least two of the plurality of DNA targeting modules target the same target site.

30. The epigenetic modified DNA targeting system according to any one of claims 1 to 29, wherein the DNA-binding domain is a zinc finger protein.

31. The epigenetic modified DNA targeting system according to any one of claims 1 to 30, wherein each fusion protein of the plurality of DNA targeting modules is different.

32. The epigenetic modified DNA targeting system according to any one of claims 1 to 29, wherein each of the DNA targeting modules shares the same fusion protein and each comprises a different guide nucleic acid that is complementary to a different target site.

33. The epigenetic modified DNA targeting system according to claim 32, wherein the guide nucleic acid is guide RNA (gRNA).

34. The epigenetic modified DNA targeting system according to any one of claims 31 to 33, wherein the DNA-binding domain of the fusion protein is a clustered, regularly arranged short palindromic sequence repeat-related (Cas) protein or a variant thereof.

35. A DNA targeting system according to any one of claims 1 to 34, wherein at least one DNA targeting module targets a target site corresponding to the genomic coordinates GRCh38 (hg38) chr4: 122,451,000 to 122,460,000 of the human genome assembly.

36. A DNA targeting system according to any one of claims 1 to 34, wherein at least one DNA targeting module targets a target site corresponding to the genomic coordinates of human genome assembly GRCh38 (hg38) chr4: 122,488,840 to 122,491,890.

37. A DNA targeting system according to any one of claims 1 to 34, wherein at least one DNA targeting module targets a target site corresponding to the genomic coordinates of human genome assembly GRCh38 (hg38) chr4: 122,507,000 to 122,508,985.

38. A DNA targeting system according to any one of claims 1 to 34, wherein at least one DNA targeting module targets a target site corresponding to the genomic coordinates of human genome assembly GRCh38 (hg38) chr4: 122,539,300 to 122,544,050.

39. An epigenetically modified DNA targeting system, (a) A fusion protein comprising a DNA-binding domain which is a clustered and regularly arranged short palindromic sequence repeat-associated (Cas) protein or a variant thereof, and at least one transcription activator effector domain, and (b) Multiple gRNAs, each containing at least two guide RNAs (gRNAs) that target a target site of the interleukin-2 (IL-2) gene. The epigenetically modified DNA targeting system, including the above.

40. The epigenetic modification DNA targeting system according to claim 39, wherein the DNA targeting system increases the transcription of the interleukin (IL-2) gene.

41. The epigenetic modified DNA targeting system according to claim 39 or claim 40, wherein the plurality of gRNAs are 2 to 6 gRNAs.

42. The epigenetic modified DNA targeting system according to any one of claims 39 to 41, wherein the plurality of gRNAs are two gRNAs.

43. The epigenetic modified DNA targeting system according to any one of claims 39 to 41, wherein the plurality of gRNAs are three gRNAs.

44. The epigenetic modified DNA targeting system according to any one of claims 39 to 41, wherein the plurality of gRNAs are four gRNAs or five gRNAs.

45. An epigenetic modified DNA targeting system according to any one of claims 39 to 44, wherein each target site is located within the genomic coordinates human genome assembly GRCh38 (hg38) chr4:122,451,261 to 122,593,946.

46. The epigenetically modified DNA targeting system according to any one of claims 39 to 45, characterized in that each target site is located in the putative regulatory region of the IL-2 gene, and the putative regulatory region has one or more of the following: an epigenetic mark, a regulatory characteristic, or a transcription factor motif.

47. The epigenetic modified DNA targeting system according to claim 46, wherein the epigenetic mark includes histone H3K27 acetylation.

48. The epigenetic modified DNA targeting system according to any one of claims 39 to 47, wherein the at least one transcription activator effector domain can catalyze the acetylation of histone H3 lysine 27 at the target site, or can recruit an enzyme that catalyzes the acetylation of histone H3 lysine 27 at the target site.

49. The epigenetic modified DNA targeting system according to claim 48, wherein the enzyme that catalyzes the acetylation is an acetyltransferase.

50. The epigenetic modified DNA targeting system according to claim 48 or claim 49, wherein the enzyme that catalyzes the acetylation is a histone acetyltransferase.

51. The epigenetic modified DNA targeting system according to any one of claims 46 to 50, wherein the presumptive regulatory region is a promoter or an enhancer.

52. An epigenetic modified DNA targeting system according to any one of claims 39 to 51, wherein each target site is located in a promoter or enhancer.

53. Each target site independently measured the following values: (1) chr4: 122,451,000–122,460,000, (2) chr4: 122,465,000–122,472,000, (3) chr4: 122,479,410–122,482,750, (4) chr4: 122,488,840–122,491,890, (5) 122,507,000–122,508,9 An epigenetic modified DNA targeting system according to any one of claims 39 to 52, located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (6) chr4: 122,539,300 to 122,544,050 and (7) chr4: 122,576,890 to 122,579,315.

54. An epigenetic modified DNA targeting system according to any one of claims 39 to 53, wherein each target site is independently located within a target region corresponding to a human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,488,840 to 122,491,890, (3) 122,507,000 to 122,508,985, and (4) chr4: 122,539,300 to 122,544,050.

55. The DNA targeting system according to any one of claims 39 to 54, wherein the DNA targeting system targets at least two different target sites, optionally two, three, four, or five different target sites, and each different target site is located within a different target region corresponding to a human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,451,000 to 122,460,000, (2) chr4: 122,488,840 to 122,491,890, (3) 122,507,000 to 122,508,985, and (4) chr4: 122,539,300 to 122,544,050.

56. An epigenetically modified DNA targeting system, (a) A fusion protein comprising a DNA-binding domain which is a clustered and regularly arranged short palindromic sequence repeat-associated (Cas) protein or a variant thereof, and at least one transcription activator effector domain, and (b) At least one guide RNA (gRNA) that targets the target site of the interleukin-2 (IL-2) gene located within the target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,465,000–122,472,000, (2) chr4: 122,479,410–122,482,750, (3) chr4: 122,488,840–122,491,890, (4) 122,507,000–122,508,985, (4) chr4: 122,539,300–122,544,050, and (6) chr4: 122,576,890–122,579,315. The epigenetically modified DNA targeting system, including the above.

57. The epigenetic modification DNA targeting system according to claim 56, wherein the at least one gRNA targets a target site of an interleukin-2 (IL-2) gene located within a target region corresponding to a human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,488,840 to 122,491,890, (2) 122,507,000 to 122,508,985, and (3) chr4: 122,539,300 to 122,544,050.

58. The epigenetic modified DNA targeting system according to claim 56 or claim 57, wherein the at least one gRNA is 1 to 6 gRNAs.

59. The epigenetic modified DNA targeting system according to any one of claims 34 to 58, wherein the Cas protein or its variant is a variant Cas protein which is an inactivated (dCas) protein.

60. The epigenetic modified DNA targeting system according to claim 59, wherein the dCas protein lacks nuclease activity.

61. The epigenetic modified DNA targeting system according to claim 59 or claim 60, wherein the dCas protein is the dCas9 protein.

62. The epigenetic modified DNA targeting system according to claim 59 or claim 61, wherein the dCas protein is the dCas12 protein.

63. The epigenetic modified DNA targeting system according to any one of claims 59 to 61, wherein the dCas9 protein is the Streptococcus pyogenes dCas9 (dSpCas9) protein.

64. The epigenetic modified DNA targeting system according to claim 63, wherein the dSpCas9 protein comprises at least one amino acid mutation selected from D10A and H840A with respect to the position numbering of SEQ ID NO:

62.

65. The epigenetic modified DNA targeting system according to claim 63 or 64, wherein the dSpCas9 comprises the sequence described in Sequence ID No. 63, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

66. The epigenetic modified DNA targeting system according to any one of claims 63 to 65, wherein the dSpCas9 is the one described in Sequence ID No.

63.

67. The epigenetic modified DNA targeting system according to any one of claims 59 to 61, wherein the dCas9 protein is Staphylococcus aureus dCas9 (dSaCas9) protein.

68. The epigenetic modified DNA targeting system according to claim 67, wherein the dSaCas9 comprises at least one amino acid mutation selected from D10A and N580A with respect to the position numbering of SEQ ID NO:

64.

69. The epigenetic modified DNA targeting system according to claim 67 or claim 68, wherein the dSaCas9 protein comprises the sequence described in SEQ ID NO: 65, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

70. The epigenetic modified DNA targeting system according to any one of claims 67 to 69, wherein the dSaCas9 is the one described in Sequence ID No.

65.

71. The epigenetic modified DNA targeting system according to any one of claims 33 to 70, wherein each gRNA includes a gRNA spacer sequence that is complementary to the target site of the respective gene.

72. Each gRNA, The sequence described in any one of the following sequence numbers: SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40, Any of the aforementioned portions, including at least 14 nucleotides (nt), or Any of the complementary sequences mentioned above This includes targeting the target site in IL-2, An epigenetically modified DNA targeting system according to any one of claims 33 to 55 and 59 to 71.

73. An epigenetic modified DNA targeting system according to any one of claims 33 to 55 and 59 to 73, wherein each gRNA targets a target site in IL-2 described in any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40, or any of the aforementioned complementary sequences.

74. Each gRNA, gRNA spacer sequences including the sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a contiguous portion thereof of at least 14 nt. including, An epigenetic modified DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, and 71 to 73.

75. An epigenetically modified DNA targeting system, (a) A fusion protein comprising a DNA-binding domain which is a zinc finger protein (ZFP) or a variant thereof, and at least one transcription activator effector domain. Includes, The aforementioned ZFP targets a target site of the interleukin-2 (IL-2) gene located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,465,000 to 122,472,000, (2) chr4: 122,479,410 to 122,482,750, (3) chr4: 122,488,840 to 122,491,890, (4) 122,507,000 to 122,508,985, (4) chr4: 122,539,300 to 122,544,050, and (6) chr4: 122,576,890 to 122,579,315. The aforementioned epigenetic modified DNA targeting system.

76. The epigenetic modification DNA targeting system according to claim 75, wherein the ZFP targets a target site of the interleukin-2 (IL-2) gene located within a target region corresponding to the human genome assembly GRCh38 (hg38) with genomic coordinates selected from the group consisting of (1) chr4: 122,488,840 to 122,491,890, (2) 122,507,000 to 122,508,985, and (3) chr4: 122,539,300 to 122,544,050.

77. The epigenetic modified DNA targeting system according to claim 75 or claim 76, wherein the ZFP targets a target site in IL-2, the ZFP comprising the sequence described in any one of sequence numbers 186 to 188.

78. The epigenetic modified DNA targeting system according to any one of claims 75 to 77, wherein the ZFP targets the target site described in Sequence ID No.

186.

79. The epigenetic modified DNA targeting system according to claim 78, wherein the ZFP includes a zinc finger recognition region comprising six zinc fingers represented as F1 to F6 in order from the N-terminus to the C-terminus, and is selected from the following F1 to F6: F1: QNAHRKT (SEQ ID NO: 195), F2: RKYYLAK (SEQ ID NO: 196), F3: RSAHLSR (SEQ ID NO: 197), F4: QSGDLTR (SEQ ID NO: 198), F5: RSDHLTQ (SEQ ID NO: 199), and F6: DSANLSR (SEQ ID NO: 200).

80. The epigenetic modified DNA targeting system according to claim 78 or 79, wherein the ZFP comprises the sequence or a portion thereof described in Sequence ID No. 189, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

81. The epigenetic modified DNA targeting system according to any one of claims 78 to 80, wherein the ZFP comprises the sequence described in Sequence ID No.

189.

82. The epigenetic modified DNA targeting system according to any one of claims 78 to 81, wherein the ZFP is encoded by the sequence or a portion thereof described in Sequence ID No. 192, or by an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

83. The epigenetic modified DNA targeting system according to any one of claims 78 to 82, wherein the ZFP is encoded by the sequence described in Sequence ID No.

192.

84. The epigenetic modified DNA targeting system according to any one of claims 75 to 77, wherein the ZFP targets the target site described in Sequence ID No.

187.

85. The epigenetic modified DNA targeting system according to claim 84, wherein the ZFP includes a zinc finger recognition region comprising six zinc fingers represented as F1 to F6 in order from the N-terminus to the C-terminus, and is selected from the following F1 to F6: F1: DSSHLEL (SEQ ID NO: 201), F2: DRSNLTR (SEQ ID NO: 202), F3: RSDNLSE (SEQ ID NO: 203), F4: VRRALSS (SEQ ID NO: 204), F5: QSGALAR (SEQ ID NO: 205), and F6: RLDWLPM (SEQ ID NO: 206).

86. The epigenetic modified DNA targeting system according to claim 84 or 85, wherein the ZFP comprises the sequence or a portion thereof described in Sequence ID No. 190, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

87. The epigenetic modified DNA targeting system according to any one of claims 84 to 86, wherein the ZFP comprises the sequence described in Sequence ID No.

190.

88. The epigenetic modified DNA targeting system according to any one of claims 84 to 87, wherein the ZFP is encoded by the sequence or a portion thereof described in Sequence ID No. 193, or by an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

89. The epigenetic modified DNA targeting system according to any one of claims 84 to 88, wherein the ZFP is encoded by the sequence described in Sequence ID No.

193.

90. The epigenetic modified DNA targeting system according to any one of claims 75 to 77, wherein the ZFP targets the target site described in Sequence ID No.

188.

91. The epigenetic modified DNA targeting system according to claim 90, wherein the ZFP includes a zinc finger recognition region comprising six zinc fingers represented as F1 to F6 in order from the N-terminus to the C-terminus, and is selected from the following F1 to F6: RSDNLSV (SEQ ID NO: 207), F2: RSAHLSR (SEQ ID NO: 208), F3: QNAHRKT (SEQ ID NO: 209), F4: LRHHLTR (SEQ ID NO: 210), F5: TSSNRKT (SEQ ID NO: 211), and F6: TSSNLSR (SEQ ID NO: 212).

92. The epigenetic modified DNA targeting system according to claim 90 or 91, wherein the ZFP includes the sequence or a portion thereof described in Sequence ID No. 191, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

93. The epigenetic modified DNA targeting system according to any one of claims 90 to 92, wherein the ZFP comprises the sequence described in Sequence ID No.

191.

94. The epigenetic modified DNA targeting system according to any one of claims 90 to 93, wherein the ZFP is encoded by the sequence or a portion thereof described in Sequence ID No. 194, or by an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

95. The epigenetic modified DNA targeting system according to any one of claims 90 to 94, wherein the ZFP is encoded by the sequence described in Sequence ID No.

194.

96. An epigenetically modified DNA targeting system, (a) A fusion protein comprising a DNA-binding domain which is an inactivated Cas9 (dSpCas9) derived from Streptococcus pyogenes, and at least one transcription activator effector domain, and (b) At least one guide RNA (gRNA) that targets a target site of the interleukin-2 (IL-2) gene, wherein the gRNA is gRNA spacer sequences including the sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a contiguous portion thereof of at least 14 nt. The gRNA containing The epigenetically modified DNA targeting system, including the above.

97. The epigenetic modified DNA targeting system according to claim 96, wherein the dSpCas9 protein comprises at least one amino acid mutation selected from D10A and H840A with respect to the position numbering of SEQ ID NO:

62.

98. The epigenetic modified DNA targeting system according to claim 96 or 97, wherein the dSpCas9 comprises the sequence described in Sequence ID No. 63, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

99. The epigenetic modified DNA targeting system according to any one of claims 96 to 98, wherein the dSpCas9 is the one described in Sequence ID No.

63.

100. Each gRNA, The sequence described in any one of the following sequence numbers: 43, 45, 47, 49, 51, 53, 55, 57, or 59. Any of the aforementioned portions, including at least 14 nucleotides (nt), or Any of the complementary sequences mentioned above This includes targeting the target site in IL-2, An epigenetically modified DNA targeting system according to any one of claims 33 to 55 and 59 to 71.

101. An epigenetic modified DNA targeting system according to any one of claims 33 to 55, 59 to 71, and 100, wherein each gRNA targets a target site in IL-2 described in any one of SEQ ID NOs. 43, SEQ ID NOs. 45, SEQ ID NOs. 47, SEQ ID NOs. 49, SEQ ID NOs. 51, SEQ ID NOs. 53, SEQ ID NOs. 55, SEQ ID NOs. 57, or any of the aforementioned complementary sequences.

102. Each gRNA, gRNA spacer sequences including the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt. including, An epigenetic modified DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, 100, and 101.

103. An epigenetically modified DNA targeting system, (a) A fusion protein comprising a DNA-binding domain which is an inactivated Cas9 (dSaCas9) derived from Staphylococcus aureus and at least one transcription activator effector domain, and (b) At least one guide RNA (gRNA) that targets a target site of the interleukin-2 (IL-2) gene, wherein the gRNA is gRNA spacer sequences including the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt. The gRNA containing The epigenetically modified DNA targeting system, including the above.

104. The epigenetic modified DNA targeting system according to claim 103, wherein the dSaCas9 comprises at least one amino acid mutation selected from D10A and N580A with respect to the numbering of the position of SEQ ID NO:

64.

105. The epigenetic modified DNA targeting system according to claim 103 or claim 104, wherein the dSaCas9 protein comprises the sequence described in SEQ ID NO: 65, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

106. The epigenetic modified DNA targeting system according to any one of claims 103 to 105, wherein the dSaCas9 is described in Sequence ID No.

65.

107. An epigenetic modified DNA targeting system according to any one of claims 33 to 74 and 96 to 106, wherein each gRNA independently contains a spacer sequence of 14 nt to 24 nt.

108. An epigenetic modified DNA targeting system according to any one of claims 33 to 74 and 96 to 107, wherein each gRNA independently contains a spacer sequence having a length of 16 nt to 22 nt.

109. An epigenetic modified DNA targeting system according to any one of claims 33 to 74 and 96 to 108, wherein each gRNA independently includes a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

110. Each gRNA, The gRNA spacer sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or The continuous portion of at least 14 nt of any of the aforementioned including, An epigenetic modified DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, and 107 to 109.

111. Each gRNA, The gRNA spacer sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or The continuous portion of at least 14 nt of any of the aforementioned including, An epigenetic modified DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, and 100 to 109.

112. The epigenetically modified DNA targeting system according to any one of claims 33 to 74 and 96 to 111, wherein the DNA targeting system comprises at least two gRNAs that target the same target site.

113. The epigenetic modified DNA targeting system according to claim 112, wherein the DNA targeting system includes at least two copies of the same gRNA.

114. The epigenetic modified DNA targeting system according to claim 113, wherein the gRNA includes a gRNA spacer sequence containing the sequence described in Sequence ID No.

23.

115. The epigenetic modified DNA targeting system according to claim 113 or claim 114, wherein the gRNA includes the gRNA spacer sequence described in Sequence ID No.

23.

116. The epigenetically modified DNA targeting system according to any one of claims 33 to 74 and 96 to 111, wherein the DNA targeting system comprises at least two gRNAs that target different target sites.

117. The epigenetically modified DNA targeting system according to any one of claims 33 to 74, 96 to 111, and 116, wherein each gRNA in the DNA targeting system targets a different target site.

118. A DNA targeting system according to any one of claims 33 to 55, 59 to 74, and 96 to 117, wherein at least one gRNA targets a target site corresponding to the genomic coordinates human genome assembly GRCh38 (hg38) chr4: 122,451,000 to 122,460,000.

119. The aforementioned at least one gRNA, gRNA spacer sequences including the sequences described in SEQ ID NOs. 9, 11, 13, 15, 17, and 19, or at least 14 nt of a continuous portion thereof. The DNA targeting system according to claim 118, including the following:

120. At least one gRNA, gRNA spacer sequence including the sequence described in Sequence ID No. 11 or at least 14 nt of that contiguous portion. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

11. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, and 112 to 119.

121. The aforementioned at least one gRNA, gRNA spacer comprising the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, or a contiguous portion thereof of at least 14 nt The DNA targeting system according to claim 118, including the following:

122. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 42, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

42. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, 100 to 109, 111 to 113, 116 to 118, and 121.

123. A DNA targeting system according to any one of claims 33 to 74 and 96 to 122, wherein at least one gRNA targets a target site 50 to 150 kilobases (kb) upstream of the IL-2 transcription start site (TSS).

124. A DNA targeting system according to any one of claims 33 to 74 and 96 to 123, wherein at least one gRNA targets a target site corresponding to the genomic coordinates human genome assembly GRCh38 (hg38) chr4: 122,488,840 to 122,491,890.

125. The aforementioned at least one gRNA, gRNA spacer sequences including the sequences described in SEQ ID NOs. 21, 23, and 25, or a contiguous portion thereof of at least 14 nt. The DNA targeting system according to claim 124, including the above.

126. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 23, or at least 14 nt of that contiguous portion. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

23. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 112 to 120, and 123 to 125.

127. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 25, or at least 14 nt of that contiguous portion. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

25. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 112 to 120, and 123 to 126.

128. The aforementioned at least one gRNA, gRNA spacer comprising the sequence described in SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, or a contiguous portion thereof of at least 14 nt The DNA targeting system according to claim 124, including the above.

129. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 50, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

50. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, 100 to 109, 111 to 113, 116 to 118, 121 to 124, and 128.

130. An epigenetic DNA targeting system according to any one of claims 33 to 74 and 96 to 129, wherein at least one gRNA targets a target site corresponding to the genomic coordinates human genome assembly GRCh38 (hg38) chr4: 122,507,000 to 122,508,985.

131. The aforementioned at least one gRNA, gRNA spacer sequences including the sequences described in SEQ ID NO: 27, SEQ ID NO: 29, and SEQ ID NO: 31, or a contiguous portion thereof of at least 14 nt. A DNA targeting system according to claim 130, including the above.

132. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 27, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

27. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 112 to 120, 123 to 127, 130, and 131.

133. The aforementioned at least one gRNA, gRNA spacer comprising the sequence described in SEQ ID NO: 56, SEQ ID NO: 58, or at least 14 nt of the same contiguous portion. A DNA targeting system according to claim 130, including the above.

134. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 56, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

56. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, 100 to 109, 111 to 113, 116 to 118, 121 to 124, 128 to 130, and 133.

135. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 58, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

58. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, 100 to 109, 111 to 113, 116 to 118, 121 to 124, 128 to 130, 133, and 134.

136. A DNA targeting system according to any one of claims 33 to 74 and 96 to 135, wherein at least one gRNA targets a target site corresponding to the genomic coordinates human genome assembly GRCh38 (hg38) chr4: 122,539,300 to 122,544,050.

137. The aforementioned at least one gRNA, gRNA spacer sequences including the sequences described in SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, and SEQ ID NO: 39, or a contiguous portion thereof of at least 14 nt. A DNA targeting system according to claim 136, including the above.

138. At least one gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 37, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

37. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123 to 127, 130 to 132, 136, and 137.

139. The DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, and 123 to 126, wherein the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO:

23.

140. The DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, and 123 to 126, wherein the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO:

25.

141. The DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123, and 130 to 132, wherein the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO:

27.

142. The DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123, and 136 to 138, wherein the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 11, and the second gRNA comprising the spacer sequence described in SEQ ID NO:

37.

143. The DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116, 117, 123 to 127, and 136 to 138, wherein the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 23, and the second gRNA comprising the spacer sequence described in SEQ ID NO:

37.

144. The DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116, 117, and 123 to 127, wherein the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 23, and the second gRNA comprising the spacer sequence described in SEQ ID NO:

25.

145. The DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116, 117, 123 to 127, and 130 to 132, wherein the DNA targeting system comprises a first gRNA and a second gRNA, the first gRNA comprising the spacer sequence described in SEQ ID NO: 23, and the second gRNA comprising the spacer sequence described in SEQ ID NO:

27.

146. A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123 to 127, 130 to 132, and 136 to 138, wherein the DNA targeting system comprises a first gRNA, a second gRNA, and a third gRNA represented by three gRNAs selected from the group consisting of a gRNA containing the spacer sequence described in SEQ ID NO: 11, a gRNA containing the spacer sequence described in SEQ ID NO: 23, a gRNA containing the spacer sequence described in SEQ ID NO: 27, and a gRNA containing the spacer sequence described in SEQ ID NO:

37.

147. The DNA targeting system comprises a first gRNA, a second gRNA, a third gRNA, and a fourth gRNA, wherein the first gRNA comprises the spacer sequence described in SEQ ID NO: 11, the second gRNA comprises the spacer sequence described in SEQ ID NO: 23, the third gRNA comprises the spacer sequence described in SEQ ID NO: 27, and the fourth gRNA comprises the spacer sequence described in SEQ ID NO:

37. Optionally, further comprising a fifth gRNA, wherein the fifth gRNA comprises the spacer sequence described in Sequence ID No.

25. A DNA targeting system according to any one of claims 33-55, 59-61, 63-66, 71-74, 96-99, 107-110, 116-120, 123-127, 130-132, and 136-138.

148. The DNA targeting system includes a first gRNA and a second gRNA represented by two gRNAs selected from the group consisting of a gRNA containing the spacer sequence described in SEQ ID NO: 42, a gRNA containing the spacer sequence described in SEQ ID NO: 50, a gRNA containing the spacer sequence described in SEQ ID NO: 56, and a gRNA containing the spacer sequence described in SEQ ID NO: 58, and optionally, the two gRNAs are (i) gRNA containing the spacer described in Sequence ID No. 42 and gRNA containing the spacer described in Sequence ID No. 50 (ii) gRNA containing the spacer described in Sequence ID No. 42 and gRNA containing the spacer described in Sequence ID No. 56 (iii) gRNA containing the spacer described in Sequence ID No. 42 and gRNA containing the spacer described in Sequence ID No. 58, (iv) gRNA containing the spacer described in SEQ ID NO: 50 and gRNA containing the spacer described in SEQ ID NO: 56, or (v) gRNA containing the spacer described in SEQ ID NO: 50 and gRNA containing the spacer described in SEQ ID NO: 58 A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, 100 to 109, 111 to 113, 116 to 118, 121 to 124, 128 to 130, 133, and 134.

149. The DNA targeting system includes a first gRNA, a second gRNA, and a third gRNA, which are represented by three gRNAs selected from the group consisting of a gRNA containing the spacer sequence described in SEQ ID NO: 42, a gRNA containing the spacer sequence described in SEQ ID NO: 50, a gRNA containing the spacer sequence described in SEQ ID NO: 56, and a gRNA containing the spacer sequence described in SEQ ID NO: 58, and optionally, the three gRNAs are: (i) gRNA containing the spacer described in SEQ ID NO: 42, gRNA containing the spacer described in SEQ ID NO: 50, and gRNA containing the spacer described in SEQ ID NO: 56, or (ii) gRNA containing the spacer described in SEQ ID NO: 42, gRNA containing the spacer described in SEQ ID NO: 50, and gRNA containing the spacer described in SEQ ID NO: 58 A DNA targeting system according to any one of claims 33 to 55, 59 to 61, 67 to 71, 100 to 109, 111 to 113, 116 to 118, 121 to 124, 128 to 130, 133, and 134.

150. The DNA targeting system further comprises a fusion protein comprising a DNA-binding domain which is a zinc finger protein (ZFP) or a variant thereof, and at least one transcription activator effector domain. The ZFP targets a target site in IL-2, and includes the sequence described in any one of sequence numbers 186 to 188. An epigenetic modified DNA targeting system according to any one of claims 96 to 149.

151. The epigenetic modified DNA targeting system according to any one of claims 1 to 150, wherein each transcription activator effector domain is an NCOA3 domain, a FOXO3 domain, an NCOA3-FOXO3-NCOA3 domain, a VP64 domain, a p65 activation domain, a p300 domain, an Rta domain, a CBP domain, a VPR domain, a VPH domain, an HSF1 domain, or a TET protein domain, and optionally the TET protein is a TET1, a SunTag domain, or any of the aforementioned domains, a portion, a variant, or a shortened form.

152. An epigenetic modified DNA targeting system according to any one of claims 1 to 151, wherein each transcription activator effector domain is p300.

153. The epigenetically modified DNA targeting system according to any one of claims 1 to 151, wherein each transcription activator effector domain comprises at least one VP16 domain, or a variant or portion thereof, that exhibits transcriptional activation activity.

154. An epigenetically modified DNA targeting system according to any one of claims 1 to 151 and 153, wherein each transcription activator effector domain comprises a VP16 tetramer (VP64) domain, a variant thereof, or a portion thereof, that exhibits transcriptional activation activity.

155. The epigenetic modified DNA targeting system according to any one of claims 1 to 151, 153, and 154, wherein each transcription activator effector domain is a VP64 domain.

156. The epigenetically modified DNA targeting system according to any one of claims 1 to 151, wherein each transcription activator effector domain includes an NCOA3 domain, a variant thereof, or a portion thereof that exhibits transcriptional activation activity.

157. An epigenetically modified DNA targeting system according to any one of claims 1 to 151, wherein each transcription activator effector domain includes a FOXO3 domain, a variant thereof, or a portion thereof that exhibits transcriptional activation activity.

158. An epigenetic modified DNA targeting system according to any one of claims 1 to 151, 156, and 157, wherein each transcription activator effector domain comprises an NCOA3-FOXO3-NCOA3 domain.

159. An epigenetically modified DNA targeting system according to any one of claims 1 to 151 and 156 to 158, wherein each transcription activator effector domain is an NCOA3-FOXO3-NCOA3 domain.

160. The epigenetic modified DNA targeting system according to claim 158, wherein each transcription activator effector domain further comprises a VP16 tetramer (VP64) domain.

161. The epigenetic modified DNA targeting system according to any one of claims 1 to 151 and 153 to 155, wherein the at least one transcription activator effector domain comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in Sequence ID No. 66, a portion thereof, or any of the foregoing.

162. The epigenetic modified DNA targeting system according to any one of claims 1 to 151, 153 to 155, and 161, wherein the at least one transcription activator effector domain comprises the sequence described in Sequence ID No.

66.

163. The epigenetic modified DNA targeting system according to any one of claims 1 to 151 and 158 to 160, wherein the at least one transcription activator effector domain comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence described in Sequence ID No. 181, a portion thereof, or any of the foregoing.

164. The epigenetic modified DNA targeting system according to any one of claims 1 to 151, 158 to 160, and 163, wherein the at least one transcription activator effector domain comprises the sequence described in SEQ ID NO:

181.

165. The epigenetic modified DNA targeting system according to any one of claims 1 to 164, wherein the at least one transcription activator effector domain is fused to the N-terminus, C-terminus, or both the N-terminus and C-terminus of the DNA-binding domain.

166. The epigenetic modified DNA targeting system according to any one of claims 1 to 165, wherein the fusion protein further comprises one or more nuclear localization signals (NLS).

167. The epigenetic modified DNA targeting system according to claim 166, wherein the fusion protein further comprises one or more linkers connecting two or more of the DNA-binding domain, the at least one effector domain, and the one or more nuclear localization signals.

168. The epigenetic modified DNA targeting system according to any one of claims 1 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123 to 126, 130 to 132, 136 to 147, 151, and 153 to 167, wherein the fusion protein comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

169. An epigenetically modified DNA targeting system according to any one of claims 1 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123 to 126, 130 to 132, 136 to 147, 151, and 153 to 168, wherein the fusion protein comprises the sequence described in SEQ ID NO:

100.

170. The epigenetic modified DNA targeting system according to any one of claims 1 to 158 and 160 to 167, wherein the fusion protein comprises any one of the sequences described in SEQ ID NOs. 5, 61, 182, and 213 to 215, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

171. The epigenetic modified DNA targeting system according to any one of claims 1 to 158, 160 to 167, and 170, wherein the fusion protein comprises any one of the sequences described in SEQ ID NOs. 5, 61, 182, and 213 to 215.

172. An epigenetic modified DNA targeting system according to any one of claims 1 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123 to 126, 130 to 132, 136 to 147, 151, 153 to 155, 161 to 162, and 165 to 167, wherein the fusion protein comprises the sequence described in SEQ ID NO:

5.

173. An epigenetic modified DNA targeting system according to any one of claims 1 to 55, 59 to 61, 67 to 74, 96 to 99, 107 to 110, 116 to 120, 123 to 126, 130 to 132, 136 to 147, 151, 153 to 155, 161 to 162, and 165 to 167, wherein the fusion protein comprises the sequence described in SEQ ID NO:

61.

174. An epigenetic modified DNA targeting system according to any one of claims 1 to 55, 59 to 61, 63 to 66, 71 to 74, 96 to 99, 107 to 110, 116 to 120, 123 to 126, 130 to 132, 136 to 147, 151, and 153 to 158 and 160 to 167, wherein the fusion protein comprises the sequence described in SEQ ID NO:

182.

175. The epigenetic modified DNA targeting system according to any one of claims 75 to 83, wherein the fusion protein comprises the sequence described in SEQ ID NO:

213.

176. The epigenetic modified DNA targeting system according to any one of claims 75 to 77 and 84 to 89, wherein the fusion protein comprises the sequence described in SEQ ID NO:

214.

177. The epigenetic modified DNA targeting system according to any one of claims 75-77 and 90-95, wherein the fusion protein comprises the sequence described in SEQ ID NO:

215.

178. The epigenetically modified DNA targeting system according to any one of claims 1 to 177, wherein transient delivery of the epigenetically modified DNA targeting system to lymphoid cells promotes an increase in IL-2 expression, optionally promoting an increase compared to lymphoid cells to which the epigenetically modified DNA targeting system has not been delivered.

179. The epigenetic modified DNA targeting system according to claim 178, wherein the lymphoid cells are T cells.

180. The epigenetic modified DNA targeting system according to claim 178, wherein the lymphoid cells are natural killer (NK) cells.

181. The epigenetic modified DNA targeting system according to any one of claims 178 to 180, wherein the lymphoid cells are derived from primary cells.

182. The epigenetic modified DNA targeting system according to any one of claims 178 to 181, wherein the lymphoid cells are derived from T cell or NK cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells.

183. The epigenetic modified DNA targeting system according to any one of claims 178 to 182, wherein the lymphoid cells express an engineered antigen receptor, or optionally a chimeric antigen receptor.

184. The epigenetically modified DNA targeting system according to claim 179, wherein transient delivery of the epigenetically modified DNA targeting system to the T cells promotes an increase in IL-2 expression upon T cell stimulation, and optionally promotes an increase compared to T cells to which the epigenetically modified DNA targeting system has not been delivered.

185. The epigenetic modified DNA targeting system according to any one of claims 178 to 184, wherein in lymphoid cells that have come into contact with the DNA targeting system, the DNA targeting system increases the expression of IL-2 by 1.0 or more by a log2 factor change.

186. The epigenetic modified DNA targeting system according to any one of claims 178 to 185, wherein in lymphoid cells that have come into contact with the DNA targeting system, the DNA targeting system increases the expression of IL-2 by 2.0 or more by a log 2 factor change.

187. The epigenetic modified DNA targeting system according to any one of claims 178 to 186, wherein in lymphoid cells that have come into contact with the DNA targeting system, the DNA targeting system increases the expression of IL-2 by 2.5 or more by a log2 factor change.

188. The epigenetic modified DNA targeting system according to any one of claims 178 to 187, wherein in lymphoid cells that have come into contact with the DNA targeting system, the DNA targeting system increases the expression of IL-2 by 2.75 or more in a log2 ratio change.

189. The epigenetic modified DNA targeting system according to any one of claims 184 to 188, wherein the T cell stimulation is performed using anti-CD3 and anti-CD28 activating reagents.

190. The epigenetic modified DNA targeting system according to any one of claims 184 to 189, wherein the T cells express an engineered antigen receptor, optionally a chimeric antigen receptor, or a T cell receptor (eTCR).

191. The epigenetic modified DNA targeting system according to claim 190, wherein the manipulated antigen receptor is a chimeric antigen receptor (CAR) directed toward an antigen or a manipulated T cell receptor (eTCR), and the T cell stimulation is antigen-specific stimulation of the CAR or eTCR, and optionally, the T cell stimulation is by an antigen-expressing target cell.

192. The epigenetic modified DNA targeting system according to claim 190, wherein the T cells express a chimeric antigen receptor (CAR) directed toward an antigen, and the T cell stimulation is antigen-specific stimulation of the CAR, and optionally, the T cell stimulation is by an antigen-expressing target cell.

193. The epigenetically modified DNA targeting system according to any one of claims 190 to 192, wherein the T cell stimulation is a restimulation of the T cell after at least one previous T cell stimulation.

194. An epigenetic modified DNA targeting system according to any one of claims 33-55, 59-61, 63-66, 71-74, 96-99, 107-110, 116-120, 123-126, 130-132, 136-147, 151, 153-174, and 178-193, wherein the gRNA further comprises the scaffold sequence described in SEQ ID NO:

8.

195. The epigenetic modified DNA targeting system according to any one of claims 33-55, 59-61, 67-71, 100-109, 111-113, 116-118, 121-124, 128-130, 133-136, 148-167, and 178-193, wherein the gRNA further comprises the scaffold sequence described in SEQ ID NO:

41.

196. The epigenetically modified DNA targeting system according to any one of claims 1 to 195, wherein the DNA targeting system does not introduce gene disruption or DNA cleavage.

197. A guide RNA (gRNA) that targets a target site of the interleukin (IL-2) gene, wherein the target site is The sequence described in any one of the following sequence numbers: SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40, Any of the aforementioned portions, including at least 14 nucleotides (nt), or Any of the complementary sequences mentioned above The gRNA selected from a target site including the gRNA.

198. The gRNA according to claim 197, wherein the target site is described in any one of SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40, or is a complementary sequence to any of the above.

199. The aforementioned gRNA, gRNA spacer sequences including the sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA is selected. The gRNA spacer sequence described in SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or at least 14 nt of the same contiguous portion. including, The gRNA according to claim 197 or claim 198.

200. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 11, or at least a 14nt contiguous portion thereof. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

11. The gRNA according to any one of claims 197 to 199.

201. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 23, or at least 14 nt of that contiguous portion. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

23. The gRNA according to any one of claims 197 to 199.

202. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 25, or at least 14 nt of that contiguous portion. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

25. The gRNA according to any one of claims 197 to 199.

203. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 27, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

27. The gRNA according to any one of claims 197 to 200.

204. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 37, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

37. The gRNA according to any one of claims 197 to 200.

205. The gRNA according to any one of claims 197 to 204, wherein the gRNA includes a spacer sequence of 14 nt to 24 nt.

206. The gRNA according to any one of claims 197 to 205, wherein the gRNA includes a spacer sequence having a length of 16 nt to 22 nt.

207. The gRNA according to any one of claims 197 to 205, wherein the gRNA includes a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

208. The gRNA according to any one of claims 197 to 207, wherein the gRNA further comprises the scaffold sequence described in Sequence ID No.

8.

209. A guide RNA (gRNA) that targets a target site of the interleukin (IL-2) gene, wherein the target site is The sequence described in any one of the following sequence numbers: 43, 45, 47, 49, 51, 53, 55, 57, or 59. Any of the aforementioned portions, including at least 14 nucleotides (nt), or Any of the complementary sequences mentioned above The gRNA selected from a target site including the gRNA.

210. The gRNA according to claim 209, wherein the target site is described in any one of SEQ ID NOs: 43, 45, 47, 49, 51, 53, 55, 57, or 59, or is a complementary sequence to any of the above.

211. The aforementioned gRNA, gRNA spacer sequences including the sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA is selected. The gRNA spacer sequence described in SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, or SEQ ID NO: 58, or at least 14 nt of the same contiguous portion. including, The gRNA according to claim 209 or claim 210.

212. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 42, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

42. The gRNA according to any one of claims 209 to 211.

213. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 50, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

50. The gRNA according to any one of claims 209 to 211.

214. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 56, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

56. The gRNA according to any one of claims 209 to 211.

215. The aforementioned gRNA, gRNA spacer sequence, including the sequence described in Sequence ID No. 58, or a contiguous portion thereof of at least 14 nt. Includes, Optionally, the gRNA spacer sequence is described in Sequence ID No.

58. The gRNA according to any one of claims 209 to 211.

216. The gRNA according to any one of claims 209 to 215, wherein the gRNA includes a spacer sequence of 14 nt to 24 nt.

217. The gRNA according to any one of claims 209 to 216, wherein the gRNA includes a spacer sequence having a length of 16 nt to 22 nt.

218. The gRNA according to any one of claims 209 to 217, wherein the gRNA includes a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

219. The gRNA according to any one of claims 209 to 218, wherein the gRNA further comprises the scaffold sequence described in Sequence ID No.

41.

220. A combination of gRNAs comprising two or more gRNAs, each selected from the gRNAs described in any one of claims 197 to 208.

221. A combination of gRNAs comprising two or more gRNAs, each selected from the gRNAs described in any one of claims 209 to 219.

222. Cas-guide RNA (gRNA) combination, (a) Clustered, regularly arranged short palindromic sequence repeat-associated (Cas) proteins or variants thereof derived from Streptococcus pyogenes, and (b) at least one gRNA according to any one of claims 197 to 208 The Cas-gRNA combination including the above.

223. The Cas-gRNA combination according to claim 222, wherein the Cas protein or its variant is an inactivated (dSpCas9) protein.

224. The Cas-gRNA combination according to claim 223, wherein the dCas protein lacks nuclease activity.

225. The Cas-gRNA combination according to claim 223 or claim 224, wherein the dSpCas9 protein comprises at least one amino acid mutation selected from D10A and H840A with respect to the position numbering of SEQ ID NO:

62.

226. The Cas-gRNA combination according to any one of claims 223 to 225, wherein the dSpCas9 comprises the sequence described in Sequence ID No. 63, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

227. The Cas-gRNA combination according to any one of claims 223 to 225, wherein the dSpCas9 is the one described in Sequence ID No.

63.

228. Cas-guide RNA (gRNA) combination, (a) Clustered, regularly arranged short palindromic sequence repeat-associated (Cas) proteins or variants thereof derived from Staphylococcus aureus, and (b) at least one gRNA according to any one of claims 209 to 219 The Cas-gRNA combination including the above.

229. The Cas-gRNA combination according to claim 228, wherein the Cas protein or its variant is an inactivated (dSaCas9) protein.

230. The Cas-gRNA combination according to claim 229, wherein the dCas protein lacks nuclease activity.

231. The Cas-gRNA combination according to claim 229 or claim 230, wherein the dSaCas9 protein comprises at least one amino acid mutation selected from D10A and N580A with respect to the position numbering of SEQ ID NO:

64.

232. The Cas-gRNA combination according to any one of claims 229 to 231, wherein the dSaCas9 comprises the sequence described in Sequence ID No. 65, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

233. The Cas-gRNA combination according to any one of claims 229 to 231, wherein the dSaCas9 is described in Sequence ID No.

65.

234. A polynucleotide encoding an epigenetic modified DNA targeting system according to any one of claims 1 to 196.

235. A polynucleotide encoding at least one DNA targeting module of an epigenetic modified DNA targeting system according to any one of claims 1 to 196.

236. A polynucleotide encoding the fusion protein and the at least one gRNA of the epigenetic modified DNA targeting system according to any one of claims 1 to 196.

237. A polynucleotide encoding the gRNA according to any one of claims 197 to 219.

238. A polynucleotide encoding the gRNA combination described in claim 220 or claim 221.

239. A polynucleotide encoding the Cas-gRNA combination according to any one of claims 222 to 233.

240. A polynucleotide encoding the fusion protein of the epigenetic modified DNA targeting system according to any one of claims 1 to 196 and one or more gRNAs according to any one of claims 197 to 219.

241. The polynucleotide according to claim 236 or claim 240, wherein the polynucleotide encoding the fusion protein is mRNA.

242. A vector comprising a polynucleotide according to any one of claims 234 to 241.

243. The vector according to claim 242, which is a viral vector.

244. The vector according to claim 242 or claim 243, which is an adeno-associated virus (AAV) vector.

245. The vector according to claim 244, selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9.

246. The vector according to claim 242, which is a nonviral vector.

247. The vector according to claim 246, wherein the non-viral vector is selected from lipid nanoparticles, liposomes, exosomes, or cell-permeable peptides.

248. The vector according to claim 246 or claim 247, wherein the non-viral vector is a lipid nanoparticle.

249. A vector according to any one of claims 242 to 248, which exhibits immune cell targeting and optionally T cell targeting.

250. An epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, or a polynucleotide according to any one of claims 234 to 241. Modified lymphoid cells, including those mentioned above.

251. Epigenetic modification or phenotypic modification resulting from contact with an epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, or a polynucleotide according to any one of claims 234 to 241. Modified lymphoid cells, including those mentioned above.

252. A modified T cell, which is a modified lymphoid cell according to claim 250 or claim 251.

253. Modified lymphoid cells according to claim 250 or claim 251, which are modified natural killer (NK) cells.

254. Modified lymphoid cells according to any one of claims 250 to 253, derived from primary cells.

255. Modified lymphoid cells according to any one of claims 250 to 254, derived from T cell or NK cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells.

256. A modified lymphoid cell according to any one of claims 250 to 255, further comprising a chimeric antigen receptor (CAR).

257. An epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, or a polynucleotide according to any one of claims 234 to 241. Modified T cells, including those mentioned above.

258. Epigenetic modification or phenotypic modification resulting from contact with an epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, or a polynucleotide according to any one of claims 234 to 241. Modified T cells, including those mentioned above.

259. Modified T cells according to claim 257 or claim 258, derived from cells of the target origin.

260. Modified T cells according to any one of claims 257 to 259, derived from primary T cells.

261. A modified T cell according to any one of claims 257 to 260, derived from a T cell progenitor, pluripotent stem cell, or induced pluripotent stem cell.

262. The modified T cell according to any one of claims 257 to 260, wherein the T cell is a tumor-infiltrating lymphocyte (TIL).

263. A modified T cell according to any one of claims 257 to 261, further comprising an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

264. A method for increasing IL-2 transcription in lymphoid cells, comprising introducing into the lymphoid cells an epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, a polynucleotide according to any one of claims 234 to 241, or a vector according to any one of claims 242 to 249.

265. A method for increasing IL-2 production in or by lymphoid cells, comprising introducing into the lymphoid cells an epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, a polynucleotide according to any one of claims 234 to 241, or a vector according to any one of claims 242 to 249.

266. The method according to claim 264 or 265, wherein the lymphoid cells are T cells.

267. The method according to claim 264 or 265, wherein the lymphoid cells are natural killer (NK) cells.

268. The method according to claim 264 or 265, wherein the lymphoid cells are derived from primary cells.

269. The method according to claim 264 or 265, wherein the lymphoid cells are derived from T cell or NK cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells.

270. The method according to any one of claims 264 to 269, wherein the lymphoid cells express an engineered antigen receptor, or optionally a chimeric antigen receptor (CAR).

271. A method for increasing IL-2 transcription in T cells, comprising introducing into T cells an epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, a polynucleotide according to any one of claims 234 to 241, or a vector according to any one of claims 242 to 249.

272. A method for increasing IL-2 production in or by T cells, comprising introducing into T cells an epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, a polynucleotide according to any one of claims 234 to 241, or a vector according to any one of claims 242 to 249.

273. The method according to claim 271 or claim 272, wherein the T cells are tumor-infiltrating lymphocytes (TILs).

274. The method according to claim 271 or claim 272, wherein the T cells express an engineered antigen receptor, optionally a chimeric antigen receptor, or a T cell receptor (eTCR).

275. A method for promoting the persistence of immune cells during repeated stimulation, the method comprising introducing into T cells an epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, a polynucleotide according to any one of claims 234 to 241, or a vector according to any one of claims 242 to 249, wherein after the introduction, the T cells are subjected to a plurality of repeated stimuli that initiate a T cell activation signal.

276. The method according to claim 275, wherein the stimulation is provided by an anti-CD3 and anti-CD28 activating reagent.

277. The method according to claim 275 or claim 276, wherein the T cells are tumor-infiltrating lymphocytes (TILs).

278. The method according to claim 275 or claim 276, wherein the T cells express an engineered antigen receptor, optionally a chimeric antigen receptor, or a T cell receptor (eTCR).

279. The method according to claim 278, wherein the manipulated antigen receptor is a chimeric antigen receptor (CAR) directed toward an antigen or a manipulated T cell receptor (eTCR), and the T cell stimulation is antigen-specific stimulation of the CAR or eTCR, and optionally the T cell stimulation is by an antigen-expressing target cell.

280. The method according to claim 278 or claim 279, wherein the T cells express a chimeric antigen receptor (CAR) directed toward an antigen, and the T cell stimulation is antigen-specific stimulation of the CAR, and optionally, the T cell stimulation is by an antigen-expressing target cell.

281. The method according to any one of claims 275 to 280, wherein the T cell stimulation is a restimulation of the T cell after at least one previous T cell stimulation.

282. The method according to any one of claims 271 to 281, wherein the T cells are T cells in a subject, and the method is performed in vivo.

283. The method according to any one of claims 271 to 281, wherein the T cells are T cells derived from the target, or derived from cells derived from the target, and the method is performed in ex vivo.

284. The method according to any one of claims 264 to 281, performed in vitro.

285. The method according to any one of claims 271 to 284, wherein the T cell is a primary T cell.

286. The method according to any one of claims 271 to 284, wherein the T cells are derived from T cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells.

287. The method according to any one of claims 271 to 284, wherein the introduction is by transient delivery to the T cells.

288. The method according to any one of claims 264 to 287, wherein the introduction is by electroporation, transfection, or transduction.

289. Modified lymphoid cells produced by the method according to any one of claims 264 to 270.

290. Modified T cells produced by the method according to any one of claims 271 to 288.

291. A pharmaceutical composition comprising a plurality of modified lymphoid cells according to any one of claims 250 to 256 and 289.

292. A pharmaceutical composition comprising a plurality of modified T cells according to any one of claims 257 to 263 and 290.

293. A pharmaceutical composition according to claim 291 or claim 292, comprising a pharmaceutically acceptable excipient.

294. A method for treating a disease or condition in a subject, comprising administering to the subject a composition comprising modified lymphoid cells according to any one of claims 250 to 256 and 289, or a pharmaceutical composition according to claim 291 or claim 292.

295. A method for treating a disease or condition in a subject, comprising administering to the subject a composition comprising modified T cells according to any one of claims 257 to 263 and 290, or a pharmaceutical composition according to claim 291 or claim 292.

296. The method according to claim 295, wherein the modified T cells are adoptive T cell therapy for treating a disease or condition in the subject.

297. The method according to claim 295 or claim 296, wherein the modified T cells are tumor-infiltrating lymphocytes (TILs).

298. The method according to claim 296, wherein the modified T cells express recombinant receptors specific to target antigens associated with the disease or condition.

299. A method for treating a disease or condition in a subject, Adoptive T-cell therapy for treating diseases or conditions in the aforementioned subjects, and An epigenetic modified DNA targeting system according to any one of claims 1 to 196, a gRNA according to any one of claims 197 to 219, a combination of gRNAs according to claim 220 or claim 221, a CRISPR Cas-gRNA combination according to any one of claims 222 to 233, or a polynucleotide according to any one of claims 234 to 241, or a vector according to any one of claims 242 to 249. The method comprising administering the above.

300. The method according to claim 299, wherein the T cells are tumor-infiltrating lymphocytes (TILs).

301. The method according to claim 299, wherein the T cells express recombinant receptors specific to target antigens associated with the disease or condition.

302. The method according to claim 298 or claim 301, wherein the recombinant receptor is an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

303. The method according to any one of claims 298, 301, and 302, wherein the target antigen is a tumor antigen.

304. The method according to any one of claims 294 to 303, wherein the disease or condition is cancer.

305. The method according to claim 304, wherein the cancer is a blood cancer or a solid tumor.

306. The method according to any one of claims 294 to 303, wherein the disease or condition is an autoimmune state and / or an inflammatory state.

307. The method according to any one of claims 295 and 304-306, wherein the administration increases the transcription of IL-2 in lymphoid cells.

308. The method according to any one of claims 294 to 306, wherein the administration increases the transcription of IL-2 in T cells.

Images