Yeast mutant strain with high glycolipid productivity

Abstract

Provided is a yeast mutant strain having high glycolipid productivity. A yeast mutant strain in which the expression of a polypeptide comprising an amino acid sequence represented by SEQ ID NO: 2 or an amino acid sequence being at least 90% identical to the amino acid sequence represented by SEQ ID NO: 2 is suppressed or inactivated.

Description

High-glucosidase-producing yeast mutants

[0001] The present invention relates to a mutant strain with high glycolipid productivity and a method for producing glycolipids using said mutant strain.

[0002] Sophorolipids are glycolipids produced by microorganisms, primarily yeast, consisting of long-chain hydroxy fatty acids and sophorose. Sophorolipids are amphiphilic lipids with strong surface activity and excellent biodegradability, and in recent years have attracted attention for their use as biosurfactants. Because sophorolipids are produced by microorganisms and primarily comprise nonionic components, they have good skin affinity and are therefore used as penetration enhancers for cosmetics. Furthermore, because sophorolipids are highly biodegradable and effective even with small amounts, they are increasingly being used in cleaning agents such as dishwashing detergents.

[0003] Starmerella bombicola (formerly Candida bombicola), a non-pathogenic basidiomycete yeast, is a well-known sophorolipid-producing yeast. The sophorolipid produced by Starmerella bombicola has a lactone or acid structure, exhibits a critical micelle concentration of 40-100 mg / L, and reduces the surface tension of water from 72.8 mN / m to 30 mN / N (Non-Patent Document 1). The physicochemical properties of sophorolipids vary depending on their structure. It has been reported that properties such as antibacterial activity and surfactant activity change depending on whether the sophorolipid is in the lactone or acid form, or the fatty acid species constituting the sophorolipid (Non-Patent Documents 1 and 2).

[0004] When sophorolipids are used as detergents or cosmetic ingredients, they must compete with currently used surfactants. Conventional surfactants are bulk chemicals and therefore produced at extremely low cost. Therefore, there is a strong demand for reducing the production cost of sophorolipids.

[0005] Research and improvements have been conducted on the sophorolipid production process, mainly focusing on yield, purification methods, and foaming technology (Patent Documents 1 and 2). A method for improving sophorolipid productivity by modifying specific genes in Starmerella bombicola has also been reported (Patent Documents 3 and 4). To further reduce costs, new means for improving sophorolipid productivity are needed.

[0006] (Patent Document 1) JP 2003-9896 (Patent Document 2) JP 2014-150774 (Patent Document 3) Patent No. 6563721 (Patent Document 4) Patent No. 6725506 (Non-Patent Document 1) Appl Microbiol Biotech,2007,76(1):23-34 (Non-Patent Document 2) J SURFACT DETERG,2006,9,QTR 1: 57-62

[0007] The present invention relates to the following 1) to 4): 1) A yeast mutant in which the expression of a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated. 2) A method for producing a yeast mutant, comprising suppressing or inactivating the expression of a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 in yeast. 3) A method for improving the glycolipid-producing ability of yeast, comprising suppressing or inactivating the expression of a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 in yeast. 4) A method for producing glycolipids, comprising culturing the yeast mutant according to 1). Detailed Description of the Invention

[0008] The present invention relates to providing a yeast mutant capable of producing glycolipids with high efficiency, and a method for producing glycolipids using the same.

[0009] The present inventors have found that yeast in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 has been suppressed or inactivated has improved glycolipid-producing ability.

[0010] The present invention provides a yeast mutant strain having high glycolipid-producing ability. The yeast mutant strain of the present invention is capable of efficiently producing glycolipids.

[0011] (1. Definitions) In this specification, the identity of an amino acid sequence or a nucleotide sequence is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing an analysis using the Search homology program in the genetic information processing software GENETYX Ver. 12, with the unit size to compare (ktup) set to 2.

[0012] As used herein, "at least 90% identity" with respect to an amino acid sequence or a nucleotide sequence means identity of 90% or more, preferably 95% or more, more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more.

[0013] As used herein, "an amino acid sequence in which one or several amino acids have been deleted, substituted, added, or inserted" refers to an amino acid sequence in which 1 to 75, preferably 1 to 40, more preferably 1 to 20, even more preferably 1 to 10, even more preferably 1 to 8, even more preferably 1 to 5, and even more preferably 1 to 3 amino acids have been deleted, substituted, added, or inserted. Furthermore, "a nucleotide sequence in which one or several nucleotides have been deleted, substituted, added, or inserted" refers to a nucleotide sequence in which 1 to 220, preferably 1 to 120, more preferably 1 to 60, even more preferably 1 to 30, even more preferably 1 to 24, even more preferably 1 to 15, and even more preferably 1 to 9 nucleotides have been deleted, substituted, added, or inserted. As used herein, "addition" of an amino acid or nucleotide includes addition of an amino acid or nucleotide to one or both ends of a sequence.

[0014] As used herein, "upstream" and "downstream" in relation to a gene refer to upstream and downstream in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter on the DNA sense strand, and "upstream" of a gene means the 5' region of the gene on the DNA sense strand.

[0015] As used herein, "yeast" refers to glycolipid-producing yeast, and "glycolipid-producing yeast" refers to yeast capable of producing glycolipids. Among these, sophorolipid-producing yeast is preferred. Examples of such yeast include ascomycetes such as Starmerella, Candida, and Wickerhamiella, with Starmerella being preferred. Examples of the genus Starmerella include Starmerella bombicola, etc. Examples of the genus Candida include Candida bogoriensis, Candida batistae, Candida apicola, etc. Examples of the genus Wickerhamiella include Wickerhamiella domericqiae, etc. A more preferred example is Starmerella bombicola.

[0016] The polypeptide whose expression is suppressed or inactivated in the yeast mutant strain of the present invention is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto. The amino acid sequence shown in SEQ ID NO: 2 is an amino acid sequence based on a specific ORF discovered as a result of ORF analysis conducted by the present inventors on Starmerella bombicola, for which ORF analysis had not been fully performed. As shown in the Examples below, a yeast mutant strain lacking a gene encoding the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 has improved glycolipid-producing ability. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is presumed to be a polypeptide involved in the glycolipid-producing ability of yeast, and suppressing or inactivating the expression of this polypeptide improves the glycolipid-producing ability of yeast. A BLAST search at the National Center for Biotechnology Information (NCBI) revealed that a protein with high sequence identity to the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 was a transcriptional repressor called TUP1 derived from Sugiyamaella lignohabitans, but the sequence identity between the two was low at 62.9%. Therefore, the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is thought to be a previously unknown novel protein, and has been named b0790 protein.

[0017] As used herein, a "polypeptide corresponding to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2" refers to a polypeptide consisting of an amino acid sequence that is at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2. Examples of amino acid sequences that are at least 90% identical to the amino acid sequence shown in SEQ ID NO: 2 include amino acid sequences in which one or more amino acids have been deleted, substituted, added, or inserted relative to the amino acid sequence shown in SEQ ID NO: 2. A polypeptide corresponding to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 is a polypeptide that improves the glycolipid-producing ability of yeast by suppressing or inactivating its expression.

[0018] As used herein, "a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:2, i.e., the b0790 gene" preferably refers to a gene consisting of the nucleotide sequence shown in SEQ ID NO:1.

[0019] As used herein, a "gene encoding a polypeptide corresponding to a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2" refers to a gene having the same function as the b0790 gene, and is preferably a gene consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1, and encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide corresponding thereto. Examples of nucleotide sequences having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1 include nucleotide sequences in which one or several nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence shown in SEQ ID NO: 1.

[0020] (2. Yeast Mutant Strain) The present invention provides a yeast mutant strain (hereinafter referred to as the mutant strain of the present invention). In the mutant strain of the present invention, the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto is suppressed or inactivated. Preferably, the mutant strain of the present invention is a mutant strain produced by artificially modifying yeast to suppress or inactivate the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto.

[0021] Preferably, the mutant strain of the present invention is a mutant strain in which the expression of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide equivalent thereto is suppressed compared to the strain before mutation (parent strain). In one embodiment, the mutant strain of the present invention can be a mutant strain in which the expression level of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide equivalent thereto is reduced to 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, and even more preferably 5% or less compared to the parent strain. Even more preferably, the mutant strain of the present invention can be a mutant strain in which the expression level of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide equivalent thereto is reduced to an undetectable level (below the expression level of a negative control or background). The expression level of a polypeptide can be measured by commonly used protein expression quantification methods, such as, but not limited to, colorimetry, fluorometry, Western blotting, ELISA, radioimmunoassay, etc.

[0022] The mutant strain of the present invention has improved glycolipid-producing ability due to the suppression or inactivation of expression of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 or a polypeptide corresponding thereto. Here, "improved glycolipid-producing ability" refers to an improvement in glycolipid production in the mutant strain of the present invention compared to the strain before mutation (parent strain), and "glycolipid" refers to a glycolipid containing glucose or an acetylated form thereof as the sugar constituting the sugar or sugar chain. The glycolipid production amount by the mutant strain of the present invention having improved glycolipid-producing ability is preferably improved by 105% or more, more preferably 110% or more, even more preferably 120% or more, and even more preferably 130% or more compared to the glycolipid production amount by the parent strain. Preferably, the glycolipid-producing ability herein is based on the glycolipid production amount after 20 to 200 hours of culture, more preferably after 50 to 200 hours of culture.

[0023] Means for suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto include a method of deleting or inactivating the gene encoding it, a method of inactivating mRNA transcribed from the gene encoding it, a method of suppressing translation of mRNA of the gene encoding it by RNA interference using siRNA or the like, a method of mutating the gene encoding it to reduce the activity of the polypeptide, a method of inactivating the polypeptide with an inhibitor such as an aptamer or an antibody, etc. In a preferred embodiment, the mutant strain of the present invention is a mutant strain in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a gene equivalent thereto has been deleted or inactivated.

[0024] Methods for deleting or inactivating a gene in a yeast cell include introducing a mutation (deletion, insertion, substitution, or addition) into one or more nucleotides in the nucleotide sequence of the target gene, substituting or inserting another nucleotide sequence into the nucleotide sequence, or deleting part or all of the nucleotide sequence. Alternatively, similar mutations or substitutions, insertions, or deletions of nucleotide sequences may be performed in a control region, such as the promoter region, of the target gene. For example, by introducing a mutation into the promoter that controls the expression of the target gene or replacing it with a lower-expressing promoter, promoter activity can be reduced or eliminated, thereby reducing or eliminating mRNA transcription from the target gene, thereby inactivating the target gene.

[0025] Specific techniques for the above-mentioned mutagenesis, or substitution, insertion, or deletion of nucleotide sequences can be methods for genetic modification of microorganisms known in the art. Examples of such methods include, but are not limited to, ultraviolet irradiation, site-specific mutagenesis, homologous recombination using SOE-PCR (splicing by overlap extension PCR: Gene, 1989, 77:61-68), and genome editing using artificial DNA nucleases or programmable nucleases.

[0026] After the above-mentioned mutagenesis or substitution, insertion, or deletion of a nucleotide sequence, genetic analysis or evaluation of the expression level of mRNA or polypeptide encoded by the target gene can be performed to select cells having the desired mutation, thereby obtaining the mutant strain of the present invention.

[0027] Alternatively, when the gene is deleted or inactivated by homologous recombination using SOE-PCR, a drug resistance marker gene can be incorporated into the gene deletion DNA fragment to be substituted for the target gene DNA, and cells into which the deletion DNA fragment has been introduced can be cultured on a drug-containing medium, and growing colonies can be isolated to obtain a mutant strain in which the target gene has been deleted. Furthermore, the mutation may be confirmed by the above-mentioned genetic analysis or evaluation of the expression level of the polypeptide. By the above procedure, a yeast mutant strain of the present invention can be obtained in which a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or a gene corresponding thereto has been deleted or inactivated.

[0028] Alternatively, the mutant strain of the present invention in which the expression of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide corresponding thereto is suppressed or inactivated can be obtained by confirming the improved glycolipid production ability in the mutant strain prepared by the above procedure.

[0029] (3. Method for improving glycolipid-producing ability in a mutant strain) The mutant strain of the present invention, which is produced by suppressing or inactivating the expression of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto, has improved glycolipid-producing ability compared to the strain before mutation (parent strain). Therefore, the present invention also provides a method for improving glycolipid-producing ability of yeast, which comprises suppressing or inactivating the expression of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a polypeptide equivalent thereto in yeast.

[0030] (4. Method for Producing Glycolipids) The mutant strain of the present invention has improved glycolipid-producing ability. Furthermore, the mutant strain of the present invention can produce glycolipids using hydrocarbon chains, fatty acids, etc. of various chain lengths as substrates. Therefore, by culturing the mutant strain of the present invention together with a substrate of an appropriate chain length, glycolipids containing constituent hydrocarbon chains, fatty acids, etc. of a desired chain length can be efficiently produced. Therefore, the present invention also provides a method for producing glycolipids, which comprises culturing the mutant strain of the present invention.

[0031] The glycolipid is not particularly limited as long as it is a glycolipid that can be produced by the mutant strain of the present invention, but preferably includes a glycolipid containing glucose or an acetylated form thereof as the sugar constituting the sugar or sugar chain, more preferably includes a glycolipid containing glucose, sophorose, cellobiose or an acetylated form thereof as the sugar or sugar chain, even more preferably includes sophorolipid, Bola-type sophorolipid, Bola-type sophoroside, alkyl sophoroside, alkyl glucoside, Bola-type glucoside, acidic glucolipid and cellobioselipid, even more preferably includes sophorolipid, Bola-type sophoroside, alkyl sophoroside, and even more preferably includes sophorolipid.

[0032] In the method for producing glycolipids of the present invention, the mutant strain of the present invention is cultured in a medium containing substrates such as fatty acids, fatty acid alkyl esters, triacylglycerols, diacylglycerols, monoacylglycerols, fats and oils, alkanes, alkenes, alkynes, alcohols, etc. After the culture, glycolipids are recovered from the medium and, if necessary, appropriately purified to produce glycolipids.

[0033] The medium used for the above-mentioned culture can be a conventional medium containing a carbon source, a nitrogen source, inorganic salts, and, if necessary, organic trace nutrients such as amino acids and vitamins. The medium may be either a synthetic medium or a natural medium.

[0034] The carbon and nitrogen sources contained in the medium may be of any type that can be utilized by the mutant strain to be cultured. Examples of carbon sources include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysates, and molasses; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used alone or in combination of two or more. Examples of nitrogen sources include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; nitrates, urea, and the like.

[0035] Examples of the inorganic salts include phosphates, magnesium salts, calcium salts, iron salts, manganese salts, etc. Examples of the organic trace nutrients include amino acids, vitamins, fatty acids, nucleic acids, and peptones containing these, casamino acids, yeast extract, soy protein hydrolysates, etc. When using an auxotrophic mutant strain that requires amino acids or the like for growth, the required nutrients may be supplemented.

[0036] Preferred examples of substrates that can be contained in the medium include C12-22 fatty acids and their alkyl esters, triacylglycerols containing C12-22 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-22 fatty acids or their alkyl esters, C12-22 alkanes, C12-22 alkenes, C12-22 alkynes, and C12-22 alcohols. More preferred examples include C12-18 fatty acids and their alkyl esters, triacylglycerols containing C12-18 fatty acids or their alkyl esters, diacylglycerols and monoacylglycerols, oils and fats containing C12-18 fatty acids or their alkyl esters, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, and C12-18 alcohols. Even more preferred examples include C12-18 fatty acids and their alkyl esters, and C12-18 alcohols.

[0037] More specific examples of the substrate include, but are not limited to, the C12-22 fatty acids, which may be saturated or unsaturated, and may be straight-chain or branched, such as lauric acid, tridecylic acid, myristic acid, pentadecylic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, behenic acid, palmitoleic acid, oleic acid, linoleic acid, α-linolenic acid, γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, and docosahexaenoic acid; the alkyl esters of the C12-22 fatty acids include alkyl esters of the above-listed fatty acids having 1 to 4 carbon atoms, preferably methyl esters and ethyl esters; and the fats and oils containing the C12-22 fatty acids or alkyl esters thereof include coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.

[0038] The C12-22 alkanes may be straight-chain or branched, and examples thereof include dodecane, tridecane, tetradecane, pentadecane, hexadecane, hexadecene, heptadecane, octadecane, nonadecane, icosane, henicosane, and docosane; the C12-22 alkenes may be straight-chain or branched, and examples thereof include 1-dodecene, 1-tridecene, 1-tetradecene, 1-pentadecene, and 1-hexadecane. Examples of the C12-22 alkyne include decene, 1-heptadecene, 1-octadecene, 1-nonadecene, 1-icosene, 1-heneicosene, and 1-docosene; the C12-22 alkyne may be linear or branched, and examples thereof include 1-dodecyne, 1-tridecyne, 1-tetradecyne, 1-pentadecyne, 1-hexadecyne, 1-heptadecyne, 1-octadecyne, 1-nonadecyne, 1-icosine, 1-heneicosine, and 1-docosine.

[0039] The C12-22 alcohol may be a saturated or unsaturated alcohol, and may be a straight-chain or branched-chain alcohol, and examples thereof include lauryl alcohol, tridecyl alcohol, myristyl alcohol, pentadecyl alcohol, cetyl alcohol, heptadecyl alcohol, stearyl alcohol, isostearyl alcohol, nonadecyl alcohol, arachidyl alcohol, behenyl alcohol, palmitoleyl alcohol, oleyl alcohol, linoleyl alcohol, and linolenyl alcohol.

[0040] The substrates listed above can be used alone or in combination of two or more. Preferably, fatty acids having a chain length of any of C12 to C18 or their alkyl esters, or triacylglycerols, diacylglycerols, monoacylglycerols, or fats and oils containing them, or alkanes, alkenes, alkynes, or alcohols having a chain length of any of C12 to C18, are used, and more preferably fatty acids having a chain length of any of C12 to C18 or their alkyl esters are used. Even more preferably, fatty acids having a chain length of any of C16 to C18 or their alkyl esters are used, even more preferably, C18 fatty acids or their alkyl esters are used, and even more preferably, oleic acid or its alkyl esters are used. Also preferably used is rapeseed oil, whose main component is triacylglycerol containing a large amount of oleic acid as a constituent fatty acid.

[0041] The content of the substrate that can be contained in the medium (at the time of adding the substrate) is preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less, or preferably 1 to 30% by mass, 1 to 20% by mass, 1 to 15% by mass, 3 to 30% by mass, 3 to 20% by mass, 3 to 15% by mass, 5 to 30% by mass, 5 to 20% by mass, or 5 to 15% by mass.

[0042] The culture conditions may be any conditions that allow the mutant strain of the present invention to produce glycolipids by fermentation. Culturing is preferably carried out under aerobic conditions, and common methods such as aeration and agitation culture and shaking culture can be applied. The culture temperature is preferably 20 to 33°C, more preferably 25 to 30°C, and even more preferably 28 to 30°C. The initial pH of the medium (30°C) is preferably 2 to 7, more preferably 3 to 6. The culture time is preferably about 24 to 200 hours, and more preferably 50 to 200 hours.

[0043] In the above-mentioned culture, the mutant strain of the present invention may be cultured under conditions in which the cells grow, thereby producing glycolipids by fermentation, or the mutant strain of the present invention may be cultured in a resting cell state, i.e., in a state in which growth and proliferation have stopped, thereby producing glycolipids by fermentation.

[0044] The method for recovering glycolipids from the culture medium after cultivation is not particularly limited, and may be performed according to a known recovery method. For example, glycolipids in the culture medium can be recovered or purified by solvent extraction using ethyl acetate, butanol, etc., fractional precipitation, liquid-liquid partitioning, column chromatography, high-performance liquid chromatography, etc., either alone or in combination as appropriate.

[0045] The following compositions, manufacturing methods, uses, and methods are further disclosed herein as exemplary embodiments of the present invention, but the present invention is not limited to these embodiments.

[0046] [1] A yeast mutant strain in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated. [2] The mutant strain of [1], in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is deleted or inactivated. [3] The mutant strain of [2], in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is deleted or inactivated. [4] The mutant strain of any one of [1] to [3], in which the yeast is a glycolipid-producing yeast. [5] The mutant strain of any one of [1] to [4], in which the yeast is a Starmerella yeast, preferably Starmerella bombicola. [6] The mutant strain according to any one of [1] to [5], which has improved glycolipid-producing ability compared to the strain before mutation. [7] The mutant strain according to any one of [4] to [6], wherein the glycolipid is selected from the group consisting of Bola-type sophorolipid, Bola-type sophoroside, alkylsophoroside, alkylglucoside, Bola-type glucoside, acidic glucolipid, and cellobioselipid, preferably selected from sophorolipid, Bola-type sophoroside, and alkylsophoroside, and more preferably sophorolipid.

[0047] [8] A method for producing a yeast mutant, comprising suppressing or inactivating expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 in a yeast. [9] The method according to [8], comprising deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[10] The method according to [9], comprising deleting or inactivating a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[11] The method according to any one of [8] to

[10] , wherein the yeast is a glycolipid-producing yeast.

[12] The method according to any one of [8] to

[11] , wherein the yeast is a Starmerella yeast, preferably Starmerella bombicola.

[13] The method according to any one of [8] to

[12] , wherein the glycolipid-producing ability of the mutant strain is improved compared to that of the strain before mutation.

[14] The method according to any one of

[11] to

[13] , wherein the glycolipid is selected from the group consisting of a Bola-type sophorolipid, a Bola-type sophoroside, an alkylsophoroside, an alkylglucoside, a Bola-type glucoside, an acidic glucolipid, and a cellobioselipid, preferably a sophorolipid, a Bola-type sophoroside, and an alkylsophoroside, and more preferably a sophorolipid.

[0048]

[15] A method for improving glycolipid productivity in yeast, comprising suppressing or inactivating the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[16] The method according to

[15] , comprising deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[17] The method according to

[16] , comprising deleting or inactivating a gene encoding a polypeptide consisting of a nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2.

[18] The method according to any one of

[15] to

[17] , wherein the yeast is a Starmerella yeast, preferably Starmerella bombicola.

[19] The method according to any one of

[15] to

[18] , wherein the glycolipid is selected from a Bola-type sophorolipid, a Bola-type sophoroside, an alkylsophoroside, an alkylglucoside, a Bola-type glucoside, an acidic glucolipid, and a cellobioselipid, preferably a sophorolipid, a Bola-type sophoroside, and an alkylsophoroside, and more preferably a sophorolipid.

[0049]

[20] A method for producing a glycolipid, comprising culturing the yeast mutant strain according to any one of [1] to [7].

[21] The method according to

[20] , wherein the glycolipid is selected from a Bola-type sophorolipid, a Bola-type sophoroside, an alkylsophoroside, an alkylglucoside, a Bola-type glucoside, an acidic glucolipid, and a cellobioselipid, preferably a sophorolipid, a Bola-type sophoroside, and an alkylsophoroside, and more preferably a sophorolipid.

[22] The method according to

[20] or

[21] , wherein the culture medium for the culture contains the following substrates: at least one substrate selected from the group consisting of C12 to C22 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C22 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, fats and oils containing C12 to C22 fatty acids or alkyl esters thereof, C12 to C22 alkanes, C12 to C22 alkenes, C12 to C22 alkynes, and C12 to C22 alcohols; At least one substrate selected from the group consisting of C12 to C18 fatty acids and alkyl esters thereof, triacylglycerols containing C12 to C18 fatty acids or alkyl esters thereof, diacylglycerols and monoacylglycerols, fats and oils containing C12 to C18 fatty acids or alkyl esters thereof, C12 to C18 alkanes, C12 to C18 alkenes, C12 to C18 alkynes, and C12 to C18 alcohols; or at least one substrate selected from the group consisting of C12 to C18 fatty acids and alkyl esters thereof.

[23] The method according to

[22] , wherein the content of the substrate in the medium is preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less, or preferably 1 to 30% by mass, 1 to 20% by mass, 1 to 15% by mass, 3 to 30% by mass, 3 to 20% by mass, 3 to 15% by mass, 5 to 30% by mass, 5 to 20% by mass, or 5 to 15% by mass.

[24] The method according to any one of

[20] to

[23] , further comprising recovering glycolipids from the medium after the culture.

[0050] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0051] Example 1 (1) Extraction of Genomic DNA from NBRC10243 Strain Genomic DNA was extracted and purified from Starmerella bombicola NBRC10243 strain using GenToru-kun (for yeast) High Recovery (Takara Bio Inc.) according to the attached protocol.

[0052] (2) Amplification of a DNA fragment containing a hygromycin resistance gene Unless otherwise specified, PrimeSTAR Max DNA Polymerase (Takara Bio Inc.) was used as the PCR enzyme in all subsequent steps. Using DNA (SEQ ID NO: 3) containing a hygromycin resistance gene prepared by artificial gene synthesis as a template, an expression cassette for the hygromycin resistance gene was amplified using primers (SEQ ID NO: 4: GTTGTTGCTGGAGTCTCATCTGCAAG and SEQ ID NO: 5: CCGGGTATACTAGTGATTTGAACAAAC).

[0053] (3) Amplification of 1 kbp upstream and 1 kbp downstream genomic DNA fragments of the b0790 gene Using the genomic DNA of the NBRC10243 strain obtained in (1) as a template, a 1 kbp DNA fragment downstream of the b0790 gene consisting of the nucleotide sequence shown in SEQ ID NO: 1 was amplified using primers (SEQ ID NO: 6: GCCAAGCTTGCATGCTTGGGCACCTTCTGCGCACCCAGCACGGAG and SEQ ID NO: 7: GACTCCAGCAACAACCATTAATATCGAGCTTGGCTCCTAATACTATAC), and a 1 kbp DNA fragment upstream of the b0790 gene was amplified using primers (SEQ ID NO: 8: CACTAGTATACCCGGACTTCGTATATGGCCAGGCTGCCTTGAG and SEQ ID NO: 9: AGAGTCGACCTGCAGCAATGACGATAGCGAAGATCCCAC).

[0054] (4) Amplification of Vector Fragment Using pHSG298 (Takara Bio Inc.) as a template and primers (SEQ ID NO: 10: GCATGCAAGCTTGGCACTGGCCGTC and SEQ ID NO: 11: CTGCAGGTCGACTCTAGAGGATCCCCG), a vector DNA fragment was amplified.

[0055] (5) Preparation of template plasmid pbJK9 for introduced DNA fragments. Each DNA fragment was purified from the four PCR products described in (2), (3), and (4) using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.), and then ligated using an In-Fusion HD cloning kit (Clontech). The resulting plasmid solution was used to transform ECOS Competent E. coli DH5α strain (Nippon Gene Co., Ltd.), and the cell suspension was spread on LB agar medium containing kanamycin and allowed to stand overnight at 37°C. Using the resulting colonies as templates, colony PCR was performed using Sapphire Amp (Takara Bio Inc.) as the enzyme. Introduction of the target DNA fragment was confirmed using primers (SEQ ID NO: 12: CTCTTCGCTATTACGCCAGC, and SEQ ID NO: 13: CACTTTATGCTTCCGGCTCG). The transformant carrying the plasmid in which gene introduction was confirmed was inoculated into 2 mL of LB liquid medium containing kanamycin and cultured overnight at 37° C. The plasmid was purified from this culture using NucleoSpin Plasmid EasyPure (Takara Bio Inc.) to obtain plasmid pbJK9 containing a DNA fragment in which 1 kbp upstream of the b0790 gene, an expression cassette for a hygromycin resistance gene, and 1 kbp downstream of the b0790 gene were ligated.

[0056] (6) Preparation of DNA fragment to be introduced Plasmid pbJK9 was used as a template and primers (SEQ ID NO: 14: TTGGGCACCTTCTGCGCACCCAG and SEQ ID NO: 15: CAATGACGATAGCGAAGATCC) were used to amplify a DNA fragment containing 1 kbp upstream of the b0790 gene, an expression cassette for a hygromycin resistance gene, and 1 kbp downstream of the b0790 gene. The resulting PCR product was treated with DpnI (Takara Bio), and the DNA fragment was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio).

[0057] (7) Insertion of a DNA fragment into the NBRC10243 strain and generation of the Δb0790::hyg strain. The NBRC10243 strain was transformed by electroporation (Nepa Gene) using the DNA fragment obtained in (6) containing the 1 kbp upstream region of the b0790 gene, a hygromycin resistance gene expression cassette, and the 1 kbp downstream region of the b0790 gene. The transformed cell sap was spread on YPD + hyg agar medium (1% yeast extract, 2% tryptone, 2% glucose, 1.5% agar, 0.05% hygromycin) and allowed to stand at 30°C for 2 days. Using the resulting colonies as templates, PCR was performed using primers (SEQ ID NO: 16: CTTGACTGAGCGCTCAAGAAG and SEQ ID NO: 17: GGTGCAGCCAACCACTAATTC), and the amplified fragment was sequenced. After confirming that the introduced DNA fragment was integrated into the genome, this strain was designated the Δb0790::hyg strain. This mutant strain has an expression cassette for the hygromycin resistance gene inserted in place of the b0790 gene on the genome.

[0058] (8) Confirmation of Glycolipid Productivity of the Δb0790::hyg Strain The Δb0790::hyg strain obtained in (7) and the NBRC10243 strain were inoculated into glycolipid production medium (0.1% urea, 2% yeast extract, 5% oleic acid, 12.5% ​​glucose) and cultured with shaking at 30°C. After 72 hours of culture, 5 mL of culture medium was collected, and 4 mL of hexane was added and mixed by stirring for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the hexane fraction in the supernatant was removed. Next, 6 mL of ethyl acetate was added to the remaining solution and mixed by stirring for 5 seconds. After centrifugation at 3000 rpm and 25°C for 5 minutes, the entire ethyl acetate fraction was collected. The collected ethyl acetate fraction was volatilized by blowing nitrogen gas, and the dissolved glycolipids were precipitated. The weight of the precipitated glycolipids was measured, and the glycolipid concentration in the culture medium was calculated. The results are shown in Table 1. Compared with the NBRC10243 strain, the Δb0790::hyg strain had a glycolipid concentration increased by 32%, confirming the effect of improving glycolipid productivity.

[0059]

Claims

1. A yeast mutant strain in which the expression of a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 is suppressed or inactivated.

2. The mutant strain described in claim 1, in which a gene encoding a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 has been deleted or inactivated.

3. A mutant strain according to claim 2, in which a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 90% identity to the nucleotide sequence shown in SEQ ID NO: 1 and the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 has been deleted or inactivated.

4. The mutant strain according to any one of claims 1 to 3, wherein the yeast is a Starmerella yeast.

5. A method for producing a yeast mutant, comprising suppressing or inactivating the expression of a polypeptide in a yeast, the polypeptide comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:

2.

6. The method of claim 5, which comprises deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:

2.

7. The method according to claim 6, comprising deleting or inactivating a gene encoding a polypeptide consisting of the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO:1 and consisting of the amino acid sequence shown in SEQ ID NO:2 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

2.

8. The method according to any one of claims 5 to 7, wherein the yeast is a Starmerella yeast.

9. A method for improving the glycolipid-producing ability of yeast, comprising inhibiting or inactivating the expression of a polypeptide in yeast comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity to the amino acid sequence shown in SEQ ID NO:

2.

10. The method of claim 9, comprising deleting or inactivating a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:

2.

11. The method according to claim 10, comprising deleting or inactivating a gene encoding a polypeptide consisting of the nucleotide sequence set forth in SEQ ID NO:1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence set forth in SEQ ID NO:1, and consisting of the amino acid sequence set forth in SEQ ID NO:2, or an amino acid sequence having at least 90% identity to the amino acid sequence set forth in SEQ ID NO:

2.

12. The method according to any one of claims 9 to 11, wherein the yeast is a Starmerella yeast.

13. The method of any one of claims 9 to 12, wherein the glycolipid is a glycolipid.

14. A method for producing glycolipids, which comprises culturing the yeast mutant strain according to any one of claims 1 to 4.

15. The method of claim 14, wherein the glycolipid is a glycolipid.

Images