Room-temperature argonaute protein-based multiplex nucleic acid amplification-free digital encoding-decoding detection method
By employing a room-temperature Argonaute protein-mediated multiplex nucleic acid amplification-free digital encoding-decoding detection method, combined with fluorescence microscopy imaging and artificial intelligence algorithms, this method solves the problems of insufficient sensitivity and complex operation in existing technologies for detecting foodborne pathogens. It achieves efficient and convenient multiplex nucleic acid detection, which is suitable for food safety testing.
Patent Information
- Application Number
- PCT/CN2025/094443
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-27
- Filing Date
- 2025-05-13
- Publication Date
- 2025-12-04
AI Technical Summary
Existing methods for detecting foodborne pathogens suffer from insufficient sensitivity, cumbersome operation, high cost, and susceptibility to contamination. In particular, they are difficult to achieve efficient and accurate nucleic acid detection when using multiple target detection.
A room-temperature Argonaute protein-mediated multiplex nucleic acid amplification-free digital encoding-decoding detection method is adopted. By using fluorescence microscopy imaging and artificial intelligence algorithms, fluorescently encoded nanomagnetic particles are used to carry out biorecognition molecular hybridization reactions, enabling the simultaneous detection of multiple targets.
It achieves highly sensitive, specific, and easy-to-operate nucleic acid detection, capable of simultaneously detecting multiple pathogens, with a detection limit of 6 CFU/mL. It also exhibits good consistency with traditional methods, high detection efficiency, and is suitable for food safety testing.
Smart Images

Figure CN2025094443_04122025_PF_FP_ABST
Abstract
Description
A multiplex nucleic acid amplification-free digital encoding-decoding detection method based on room temperature Argonaute protein TECHNICAL FIELD
[0001] The present application relates to a multiplex nucleic acid amplification-free digital encoding-decoding detection method based on room temperature Argonaute protein, belonging to the field of nucleic acid molecule detection. BACKGROUND
[0002] Food safety is a hot issue of concern. Among them, the most important one is still the food safety problem induced by foodborne diseases. Foodborne pathogenic bacteria mainly refer to pathogenic bacteria that can cause food poisoning or food as a transmission medium, mainly including Salmonella, Escherichia coli, Vibrio parahaemolyticus, Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes (referred to as Listeria monocytogenes), Enterobacter sakazakii, etc. Foodborne pathogenic bacteria can quickly spread in the environment and food samples, induce foodborne diseases such as recurrent intestinal inflammation, diarrhea, vomiting, chronic kidney disease, and even death, posing a serious risk to human health. Therefore, accurate and sensitive detection of pathogenic bacteria in food has important practical significance.
[0003] Currently, the methods for detecting foodborne pathogenic bacteria mainly include traditional microbial culture method, immunodetection method, PCR method, etc. The microbial culture method has good accuracy, but it is time-consuming and not suitable for rapid detection. The sensitivity of the immunodetection method is not enough to meet the needs of trace foodborne pathogenic bacteria detection. The PCR method has the advantage of high sensitivity, but it needs a clean environment and is easily contaminated by aerosols. Digital biosensors with single-molecule sensitivity are increasingly popular in nucleic acid detection, especially the CRISPR / Cas-mediated digital droplet PCR (ddPCR) strategy, however, the non-specific trans-cleavage of CRISPR / Cas enzyme is limited by multiple targets when detecting simultaneously. In addition, the production of droplets in ddPCR usually requires a microfluidic chip, which is expensive in equipment and consumables and the whole process is complicated and time-consuming, and is easily contaminated. SUMMARY
[0004] To address the aforementioned issues, this invention proposes a room-temperature Argonaute protein-based multiplex nucleic acid amplification-free digital encoding-decoding detection method. This method combines biochemical reactions with visualized microsphere counting and artificial intelligence algorithms. Biorecognition molecules corresponding to the analyte are coupled to the surfaces of a carrier and a signal probe, respectively, to perform DNA hybridization reactions and fluorescently encode the nanoparticles. The sample is then photographed using a fluorescence microscope to obtain fluorescence images. Finally, artificial intelligence is used to directly decode and count the fluorescent microscopic images of the carrier nanoparticles carrying the fluorescent probes based on the differences in fluorescence signals carried after the carrier and signal probes bind, thereby achieving digital readout of the sample concentration. This invention uses signal probes of different colors to distinguish different detection targets, enabling the simultaneous detection of multiple targets.
[0005] The above objective is achieved through the following technical solution:
[0006] This invention first provides a method for detecting target nucleic acid molecules, the method comprising the following steps:
[0007] (1) Preparation of luminescent magnetic nanoparticles: Argonaute enzyme was sequentially mixed with guide DNA, nucleic acid sample to be tested, nucleic acid probe and magnetic nanoparticle conjugate and incubated to obtain fluorescently encoded magnetic nanoparticles. After washing, the nanoparticles were dispersed in an aqueous solution to obtain a solution containing luminescent magnetic nanoparticles.
[0008] (2) Algorithm decoding: The solution containing luminescent magnetic nanoparticles obtained in step (1) is subjected to fluorescence development to obtain a development image. The obtained development image is decoded using an artificial intelligence algorithm. Based on the number of fluorescent nanoparticles on the development image, the concentration information of the target nucleic acid molecules to be tested is output.
[0009] The guide DNA includes: guide DNA1 and guide DNA2; guide DNA1 and guide DNA2 target and bind to the target nucleic acid molecule, and the binding sites of guide DNA1 and guide DNA2 on the target nucleic acid molecule are adjacent and without spacer sequences;
[0010] The nucleic acid probe is modified with fluorescent groups, biotin, and quencher groups;
[0011] The nanomagnetic particle coupling material is: nanomagnetic particles whose surfaces are sequentially modified with tyrosine and streptavidin;
[0012] The Argonaute enzyme targets the target nucleic acid molecule via the guide DNA, cleaves the target nucleic acid molecule, and generates secondary guide DNA, which is at least partially reverse complementary to the nucleic acid probe.
[0013] In one embodiment, the method for decoding using the artificial intelligence algorithm includes the following steps:
[0014] S1. Obtain the color of the developed image through a target detection algorithm, and classify the different colors;
[0015] S2. The classified images are binarized using the watershed algorithm to remove background noise interference.
[0016] S3. Perform a counting operation on the image processed by S2.
[0017] In one implementation, the counting operation includes the following steps:
[0018] a. Obtain the length and width information of the nanomagnetic particles in the developed image, and perform a counting operation on the nanomagnetic particles with an aspect ratio greater than 0.7 and less than or equal to 2 nanometers.
[0019] b. When the aspect ratio of the magnetic bead is greater than 2, it is determined that the nanomagnetic particles have magnetic chain adhesion. The nanomagnetic particles are then divided into individual nanomagnetic particles with an aspect ratio greater than 0.7, and the counting operation is then performed.
[0020] In one embodiment, the Argonaute enzyme may be a room-temperature Argonaute enzyme, which can bind to guide DNA and target target nucleic acid molecules at room temperature, and cleave the target nucleic acid. As an alternative example, without limitation, the room-temperature Argonaute enzyme may be derived from *Clostridium butyrium*, and more specifically, *Clostridium butyrium* JBH-BD1, which has the amino acid sequence shown in the NCBI accession number WP_058142162.1.
[0021] The Clostridium butyrium species JBH-BD1 has the accession number CCTCC No. M2022151 and is disclosed in Chinese Patent CN116103200A.
[0022] In one embodiment, the amount of Argonaute enzyme used is not less than 1 mg / mL.
[0023] In one embodiment, the target nucleic acid molecule may be a nucleic acid molecule of a microorganism. The microorganism may further be a pathogenic microorganism, including but not limited to viruses, bacteria, fungi, chlamydia, and mycoplasma. As an example, without limitation, the pathogenic microorganism may be at least one of Salmonella typhimurium, Listeria monocytogenes, and Staphylococcus aureus.
[0024] In one embodiment, the biotin modification is located at the 5' end or the 3' end of the nucleic acid probe. Optionally, it is located at the 5' end of the nucleic acid probe.
[0025] In one embodiment, the fluorescent group and the quenching group are each independently located at the 5' end or the 3' end of the nucleic acid probe.
[0026] In one embodiment, the 5' end of the nucleic acid probe is a T base, which is modified with a biotin molecule and coupled to a fluorescent group.
[0027] In one embodiment, the fluorescent group includes, but is not limited to: FAM, Alexa fluor 405, HEX, CY3, CY5, ROX, VIC, JOE, TET, Texas Red, or combinations thereof.
[0028] In one embodiment, the quenching group includes, but is not limited to: TAMARA, BHQ, DABSYL, or combinations thereof.
[0029] In one embodiment, the guide DNA is a single-stranded DNA (ssDNA) molecule.
[0030] In one embodiment, the 5' end of the guide DNA is modified with a phosphate group.
[0031] In one embodiment, the guide DNA may contain an additional n pairs of guide DNA, each pair of guide DNA containing two ssDNAs, each pair of ssDNAs specifically targeting and binding to different target nucleic acid molecules for the detection of different target nucleic acid molecules; where n is a natural number ≥1.
[0032] In one implementation, the guide DNA may be of the same or different lengths.
[0033] In one embodiment, the guide DNA is 16 to 26 nt in length, preferably 21 nt.
[0034] In one embodiment, the guide DNA and the nucleic acid probe are selected from any one of the following (a)-(c):
[0035] (a) First set of guide DNA and nucleic acid probes:
[0036] Guide DNA 1: 5'P-AGCCTAACATATCCAGGTGCT 3',
[0037] Guide DNA 2: 5'P-CTCGTGAAAGCGAATTCGGAA 3';
[0038] Nucleic acid probe: 5' fluorescent group - / ibiodt / CATATCCAGGTGCTCTCGTGAAAGCGAAT - quenching group 3';
[0039] (b) Second set of guide DNA and nucleic acid probes:
[0040] Guide DNA 1: 5'P-ATATTGTTGACAGGAGCTCTT 3',
[0041] Guide DNA 2: 5'P-CTATAACCGTCGCCTTCATAG 3';
[0042] Nucleic acid probe: 5' fluorescent group - / ibiodt / TGACAGGAGCTCTTCTATAACCGTTCGCCT- quencher group 3';
[0043] (c) Third group of guide DNA and nucleic acid probes:
[0044] Guide DNA 1: 5'P-ATGTAAAAGCCGTCTTGATAA 3',
[0045] Guide DNA 2: 5'P-TCTTTAGTAGTACCGAAGCTG 3';
[0046] Nucleic acid probe: 5' fluorescent group - / ibiodt / AGCCGTCTTGATAATCTTTAGTAGTACCG - quenching group 3';
[0047] Where P represents the 5' phosphorylation modification of the oligonucleotide.
[0048] In one embodiment, the fluorescent groups modified on each group of nucleic acid probes are different, and the quenching groups modified on each group of nucleic acid probes may be the same or different.
[0049] In one embodiment, the amount of guide DNA used is 2-3 μM. Optionally, the amount of the second group of guide DNA is 3 μM, and the amounts of the first and third groups of guide DNA are 2 μM.
[0050] In one embodiment, the concentration of the nucleic acid probe is 2-3 μM. Optionally, the concentration of the fluorescent probe is 3 μM when the target nucleic acid molecule is Staphylococcus aureus; 2 μM when the target nucleic acid molecule is Listeria monocytogenes; and 2 μM when the target nucleic acid molecule is Salmonella typhimurium.
[0051] In one embodiment, the room-temperature Argonaute protein and guide DNA are mixed and incubated at 20-40°C for at least 10 minutes. Alternatively, they are incubated at 37°C for 30 minutes.
[0052] In one embodiment, the incubation conditions of the nanomagnetic particle coupling material in the reaction system are: 20-40°C for at least 10 minutes. Alternatively, it can be 37°C for 30 minutes.
[0053] In one embodiment, the method for detecting the target nucleic acid molecule is an in vitro method.
[0054] In one implementation, the method is non-diagnostic and non-therapeutic.
[0055] The present invention also provides a kit for detecting target nucleic acid molecules, the kit comprising: Argonaute enzyme, guide DNA, nucleic acid probe, and magnetic nanoparticle conjugate;
[0056] The guide DNA includes: guide DNA1 and guide DNA2; guide DNA1 and guide DNA2 target and bind to the target nucleic acid molecule, and the binding sites of guide DNA1 and guide DNA2 on the target nucleic acid molecule are adjacent and without spacer sequences;
[0057] The nucleic acid probe is modified with fluorescent groups, biotin, and quencher groups;
[0058] The nanomagnetic particle coupling material is: nanomagnetic particles whose surfaces are sequentially modified with tyrosine and streptavidin;
[0059] The Argonaute enzyme targets the target nucleic acid molecule via the guide DNA, cleaves the target nucleic acid molecule, and generates secondary guide DNA, which is at least partially reverse complementary to the nucleic acid probe.
[0060] In one embodiment, the guide DNA and the nucleic acid probe are selected from any one of the following (a)-(c):
[0061] (a) First set of guide DNA and nucleic acid probes:
[0062] Guide DNA 1: 5'P-AGCCTAACATATCCAGGTGCT 3',
[0063] Guide DNA 2: 5'P-CTCGTGAAAGCGAATTCGGAA 3';
[0064] Nucleic acid probe: 5' fluorescent group - / ibiodt / CATATCCAGGTGCTCTCGTGAAAGCGAAT - quenching group 3';
[0065] (b) Second set of guide DNA and nucleic acid probes:
[0066] Guide DNA 1: 5'P-ATATTGTTGACAGGAGCTCTT 3',
[0067] Guide DNA 2: 5'P-CTATAACCGTCGCCTTCATAG 3';
[0068] Nucleic acid probe: 5' fluorescent group - / ibiodt / TGACAGGAGCTCTTCTATAACCGTTCGCCT- quencher group 3';
[0069] (c) Third group of guide DNA and nucleic acid probes:
[0070] Guide DNA 1: 5'P-ATGTAAAAGCCGTCTTGATAA 3',
[0071] Guide DNA 2: 5'P-TCTTTAGTAGTACCGAAGCTG 3';
[0072] Nucleic acid probe: 5' fluorescent group - / ibiodt / AGCCGTCTTGATAATCTTTAGTAGTACCG- quencher group 3'; where P is the 5' end phosphorylation modification of oligonucleotide.
[0073] In one embodiment, the fluorescent groups modified on each group of nucleic acid probes are different, and the quenching groups modified on each group of nucleic acid probes may be the same or different.
[0074] In one embodiment, the preparation method of the nanomagnetic particle coupling material includes the following steps:
[0075] (1) N-hydroxysulfosuccinimide, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride, tyrosine and nanomagnetic particles were mixed and reacted with shaking to obtain modified nanomagnetic particles.
[0076] (2) The modified magnetic nanoparticles obtained in step (1) are washed, mixed with hydrogen peroxide, streptavidin and horseradish peroxidase, magnetically separated and washed to obtain the magnetic nanoparticle conjugate.
[0077] In one embodiment, the concentration of tyrosine in the reaction system is 0.2-1.2 mg / mL, optionally 0.4 mg / mL.
[0078] In one embodiment, the concentration of streptavidin in the reaction system is not less than 100 μg / mL, and can be selected as 120-150 μg / mL.
[0079] In one embodiment, the hydrogen peroxide is saturated hydrogen peroxide, and its concentration in the reaction system is 0.03%-0.05% (v / v).
[0080] In one embodiment, the final concentration of the horseradish peroxidase in the reaction system is 0.01-0.03 U / mL, optionally 0.0128 U / mL.
[0081] The present invention also provides the application of the above method or the above kit in the preparation of products for detecting target nucleic acid molecules.
[0082] In one embodiment, the target nucleic acid molecule is derived from at least one of Salmonella Typhimurium, Listeria monocytogenes, and Staphylococcus aureus.
[0083] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.
[0084] Compared with the prior art, the present invention has the following beneficial effects:
[0085] 1. This invention utilizes uniformly sized, well-dispersed, and magnetically separated nanoparticles to replace traditional water-in-oil droplets as digital carriers, avoiding the complex DNA amplification process of water-in-oil droplets and saving time and costs; at the same time, the magnetically separated nanoparticles can effectively eliminate background interference, ensuring the sensitivity of detection.
[0086] 2. This invention combines the tyramine system with magnetic nanoparticles, which increases the number of binding sites between the magnetic nanoparticles and streptavidin, thereby achieving multiple signal amplification and greatly improving nucleic acid detection performance.
[0087] 3. This invention uses nanomagnetic particles amplified by a tyramine system as a carrier. By cleaving the target with room-temperature Argonaute enzyme, the biotinylated fluorescent probe can be cleaved a second time by room-temperature Argonaute enzyme and used as an encoding tool to fluorescently encode the nanomagnetic particles. Then, an artificial intelligence algorithm is used for decoding, thereby realizing the digital readout of the target concentration.
[0088] 4. The detection system in this invention has high sensitivity, strong specificity, simple operation, high detection efficiency, and broad application prospects.
[0089] 5. This method can achieve highly sensitive detection of pathogenic bacteria. In the detection of Staphylococcus aureus, Listeria monocytogenes, and Salmonella typhimurium, the detection limits for the three strains reached 6 CFU / mL, 6 CFU / mL, and 7 CFU / mL, respectively. Furthermore, with the increase of the concentration of the target DNA of a single pathogenic bacterium (i.e., the bacterial concentration), the number of luminescent magnetic nanoparticles increased. The concentration of the three bacteria was positively correlated with the fluorescent conjugate, exhibiting excellent linearity (R0). 2 >0.98).
[0090] 6. The method of this invention shows good consistency with the manual method (R 2 =0.99), and the technical effect is better than the existing Image J software. Attached Figure Description
[0091] Figure 1: A flowchart of the entire process of this invention, where a: the principle of the two-step precise cleavage reaction mediated by Argonaute enzyme at room temperature. b: the synthesis of the MB–TA–SA conjugate and its combination with a fluorescent probe to achieve fluorescent encoding. c: a schematic diagram of imaging and AI-mediated decoding after fluorescent encoding of the nanomagnetic particle conjugate.
[0092] Figure 2: Preparation and purification of Argonaute enzyme at room temperature.
[0093] Figure 3: Electrophoresis diagram of the 5' end group preference of the guide DNA strand of Argonaute enzyme at room temperature.
[0094] Figure 4: Electrophoresis diagram of guided DNA strand length optimization by Argonaute enzyme at room temperature.
[0095] Figure 5: Electrophoresis diagram of optimized nucleic acid cleavage time of Argonaute enzyme at room temperature.
[0096] Figure 6: Schematic diagram of the synthesis of MB–TA–SA conjugates and their combination with fluorescent probes to achieve fluorescence encoding.
[0097] Figure 7: Optimization of preparation conditions for MB–TA–SA conjugates, a: Optimization of tyrosine concentration, b: Optimization of streptavidin concentration, c: Optimization of hydrogen peroxide concentration and dosage, d: Optimization of HRP enzyme dosage.
[0098] Figure 8: Schematic diagram of the two-step precise cleavage reaction mediated by Argonaute enzyme at room temperature.
[0099] Figure 9: Schematic diagram of fluorescence encoding and AI algorithm-mediated decoding of nanomagnetic particle conjugates.
[0100] Figure 10: Schematic diagram of the decoding process of artificial intelligence algorithm.
[0101] Figure 11: Comparison chart of the accuracy of artificial intelligence algorithms, where a and b represent the results of counting magnetic beads using different methods, and c represents the correlation between manual counting and counting by artificial intelligence algorithms.
[0102] Figure 12: Optimization of guide DNA concentration for three bacteria, where a, b, and c represent Salmonella Typhimurium, Staphylococcus aureus, and Listeria monocytogenes, respectively.
[0103] Figure 13: Optimization of fluorescent probe concentrations for three bacteria, where a, b, and c represent Salmonella Typhimurium, Staphylococcus aureus, and Listeria monocytogenes, respectively.
[0104] Figure 14: Decoding results of fluorescence images of three bacteria at different concentrations.
[0105] Figure 15: Relationship between different concentrations of Salmonella Typhimurium DNA and signals processed by artificial intelligence algorithms.
[0106] Figure 16: Relationship between different concentrations of Staphylococcus aureus DNA and signals processed by artificial intelligence algorithms.
[0107] Figure 17: Relationship between different concentrations of Listeria monocytogenes DNA and signals processed by artificial intelligence algorithms.
[0108] Figure 18: Investigation on the anti-interference properties of three bacteria, where a, b, and c represent Salmonella Typhimurium, Staphylococcus aureus, and Listeria monocytogenes, respectively.
[0109] Figure 19: Specificity study of the three bacteria, where a, b, and c represent Salmonella Typhimurium, Staphylococcus aureus, and Listeria monocytogenes, respectively.
[0110] Figure 20: Relationship between different concentrations of DNA and signals processed by artificial intelligence algorithms when three foodborne pathogens are detected simultaneously.
[0111] Figure 21: Real sample detection, where a, b, c, and d represent egg samples, chicken samples, and shrimp samples (in c, 1-20 are live shrimp and 21-40 are frozen shrimp), respectively. The consistency of the results of this invention and qPCR detection is compared. Detailed Implementation
[0112] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available products or can be prepared by known methods.
[0113] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention.
[0114] The main sources of reagents used:
[0115] Magnetic nanoparticles: purchased from Ocean Nano Tech (USA), product code MC3000-10. Streptavidin: purchased from Beyotime Biotechnology Co., Ltd. Tyramine: purchased from Beyotime Biotechnology Co., Ltd. Guide DNA and biotin-modified fluorescent probes for Salmonella Typhimurium, Listeria Monotamate, and Staphylococcus aureus were synthesized by Sangon Biotech (Shanghai) Co., Ltd. 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxythiosuccinimide active ester (sulfo-NHS) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Tween-20 and bovine serum albumin (BSA) were purchased from Amresco.
[0116] Preparation methods for the relevant reagents used:
[0117] PBS buffer (10mM, pH=7.4): Take 8.00g NaCl, 0.20g KCl, 0.20g KH2PO4 and 2.90g Na2HPO4·12H2O and dilute to volume in a 1000mL volumetric flask, then shake well.
[0118] MES buffer (0.1M, pH=6.0): Dissolve 21.325g of MES in deionized water and bring the volume to 1000mL to obtain solution A; dissolve 4g of NaOH in deionized water and bring the volume to 1000mL to obtain solution B; mix 1000mL of solution A and 400mL of solution B and shake well.
[0119] PBST and MEST solutions: Add 0.5 mL of L-20 to 1000 mL of prepared PBS or MES buffer and shake well.
[0120] Example 1: Preparation and purification of Argonaute enzyme at room temperature
[0121] The experimental procedure is shown in Figure 2.
[0122] The gene encoding the room-temperature Argonaute enzyme, CbAgo, is derived from Clostridium butyricum JBH-BD1 (CCTCC No: M2022151, disclosed in patent CN116103200A). The NCBI accession number for the amino acid sequence of the Argonaute enzyme is: WP_058142162.1.
[0123] Strain construction: Based on the amino acid sequence, the above gene CbAgo was synthesized into the plasmid pET28a expression vector, with the 6×His tag located at the N-terminus of the protein. The expression vector was transformed into Escherichia coli Rosetta(DE3) strain to obtain the Argonaute enzyme expression strain.
[0124] Preparation of Argonaute enzyme at room temperature by fermentation: Inoculate the strain into LB medium at a ratio of 3% and incubate at 37°C until OD (digestion occurs). 600 To induce protein expression, 0.2 mM IPTG was added and the cells were cultured at 18°C for 20 h to reach a pH of 0.7-0.8. The cell pellet was collected and resuspended in affinity buffer (20 mM Tris-HCl, 500 mM NaCl, 2 mM MgCl2, pH 8.0) with 1 mM PMSF. Cells were then lysed using a high-pressure homogenizer. The lysate was then centrifuged at 17000 g for 1 h at 4°C, and the supernatant was transferred to a column packed with Ni-NTA. After three loading cycles, contaminating proteins were washed with a gradient of affinity buffers containing different concentrations of imidazole. The final target protein was eluted at a concentration of 200 mM imidazole. SDS-PAGE is shown in Figure 2. The eluent containing the protein was replaced with ultrafiltration (Millipore) and the protein was placed in storage buffer (20 mM Tris-HCl, 500 mM NaCl, 1 mM DTT, 10% glycerol, pH 7.5). Flash-freeze in liquid nitrogen at -80°C.
[0125] Example 2: Optimization of Argonaute enzyme preference for guide DNA groups and guide DNA strand length at room temperature
[0126] Argonaute enzyme nucleic acid preferential cleavage experiment at room temperature:
[0127] Argonaute enzyme (1 mg / mL):guide DNA (4 μM):target sequence (2 μM) in a volume ratio of 2:2:1 was mixed in cleavage reaction buffer (2×reaction buffer: 20 mM Tris, 0.5 mM MnCl2, pH 7.5) and reacted at 37 °C for 1 h. Then, loading buffer (2×loading buffer: 95% Formamide, 0.025% Bromophenol Blue, 0.025% SDS, 0.5 mM EDTA) was added, and the reaction was terminated by heating at 95 °C for 5 min. The cleavage products were analyzed by 16% denaturing gel electrophoresis.
[0128] When analyzing the group preference and guide chain length of room-temperature Argonaute enzyme, the target sequence is: 5'-TAACAATAACAAGTCTCGTAACCAGTCCAAGAACAGAAACCAGTCAAATGACCGTGGT-3'.
[0129] The guide DNAs are as follows:
[0130] (1)5'P-TTCTTGGACTGGTTAC-3';
[0131] (2)5'HO-TTCTTGGACTGGTTAC-3'.
[0132] The results (Figure 3) show that Argonaute enzymes can cleave target nucleic acid chains under the guidance of both groups of DNA at room temperature. However, the nucleic acid cleavage reaction mediated by 5' phosphorylated guide DNA produces more products, which are shown as thicker and more obvious bands on the electrophoresis image.
[0133] Based on the preference of 5' phosphorylated guide DNA, we verified the optimality of room-temperature Argonaute enzyme for guide DNA length. The operation method was the same as above, except that the guide DNA length was divided into 11nt, 16nt, 21nt, and 26nt.
[0134] The specific 5' phosphorylation guide DNA sequence is as follows:
[0135] 11nt: 5'P-TTCTTGGACTG-3';
[0136] 16nt: 5'P-TTCTTGGACTGGTTAC-3';
[0137] 21nt: 5'P-TTCTTGGACTGGTTACGAGAC-3';
[0138] 26nt: 5'P-TTCTTGGACTGGTTACGAGACTTGTT-3'.
[0139] The results (Figure 4) showed that by modifying the 5' end with two groups of different lengths to guide the DNA-mediated cleavage reaction, the room-temperature Argonaute enzyme exhibited the best cleavage effect when the guided DNA was 21 nt, which was reflected in the presence of more products and more obvious bands on the electrophoresis image.
[0140] Example 3: Optimization of cleavage time by Argonaute enzyme at room temperature
[0141] The specific operation is the same as in Example 2, except that the reaction time at 37°C was adjusted to 0 min, 5 min, 10 min, 15 min, 30 min, 40 min, 60 min, 90 min, and 120 min.
[0142] The results (Figure 5) showed that within the first 60 minutes, the cleavage of the target by the room-temperature Argonaute enzyme gradually increased with time, specifically manifested as a gradual weakening of the target gel electrophoresis band and a gradual strengthening of the product gel electrophoresis band. However, between 60 and 120 minutes, the target content decreased slowly, and the product accumulation was not significantly different from that at 60 minutes, specifically manifested as no significant change in the target and product gel electrophoresis bands.
[0143] Example 4: Preparation and optimization of tyramine system for amplifying surface sites of magnetic nanoparticles and coupling with streptavidin
[0144] Figure 6 shows a schematic diagram of the construction of the nanomagnetic particle-tyramine-streptavidin (MB–TA–SA) conjugate.
[0145] 1. The construction method of MB–TA–SA is as follows:
[0146] (1) 100 μL of N-hydroxysulfosuccinimide (NHS) (5 mg / mL), 100 μL of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (10 mg / mL) and 100 μL of 2 mg / mL tyramine were added to 200 μL of 100 μg / mL magnetic nanoparticle suspension and the mixture was shaken at room temperature for 12 hours to obtain modified magnetic nanoparticles.
[0147] (2) Excess tyramine molecules in the reaction solution obtained in step (1) were removed using magnetic separation, and the resulting product was washed three times with ultrapure water. After each washing step, the modified magnetic nanoparticles were separated using magnetic separation.
[0148] (3) The washed modified magnetic nanoparticles were redissolved in 190 μL of ultrapure water, mixed with 40 μL of H2O2 and 200 μL of streptavidin (300 μg / mL), and then reacted with 40 μL of 0.15 U / mL horseradish peroxidase (HRP) for 10 minutes to catalyze the formation of MB–TA–SA conjugates. The MB–TA–SA conjugates obtained by magnetic separation were washed three times with ultrapure water, and the washed MB–TA–SA was redissolved in 200 μL of ultrapure water and stored at 4 °C until further use.
[0149] 2. Optimization of reaction conditions
[0150] The optimal conditions for the MB–TA–SA coupling experiment were determined by optimizing the concentrations of tyramine, streptavidin, hydrogen peroxide, and HRP enzyme, and by measuring the absorbance of the product at λ = 450 nm.
[0151] The specific experimental procedures are optimized to be the same as step 1 above, with the following differences:
[0152] (a) Optimization of tyramine concentration: The concentration of tyramine used was changed to 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, and 6 mg / mL;
[0153] (b) Optimization of streptavidin concentration: The concentration of streptavidin was changed to 100 μg / mL, 200 μg / mL, 300 μg / mL, 400 μg / mL, and 500 μg / mL;
[0154] (c) Optimization of hydrogen peroxide concentration: The concentration of hydrogen peroxide was set to 1%, 2%, 3%, 4%, and 5%. That is, the total volume was 100 parts, and the volume of hydrogen peroxide was (1:99), (2:98), (3:97), (4:96), and (5:95) of ultrapure water. The volume added in the reaction was still 40 μL.
[0155] (d) Optimization of HRP enzyme usage: The usage of 0.15 U / mL HRP enzyme was changed to 10 μL, 20 μL, 30 μL, 40 μL, and 50 μL.
[0156] The results showed that 2 mg / mL of tyramine provided the highest absorbance at λ = 450 nm, and the absorbance decreased after increasing to above 2 mg / mL. This phenomenon may be due to the fact that excessive tyramine reduced the ratio of EDC and NHS-activated magnetic nanoparticles. Therefore, 2 mg / mL was chosen for subsequent experiments (Fig. 7a). The absorbance increased when the streptavidin concentration increased from 50 μg to 300 μg / mL and then remained stable, possibly because the binding sites of streptavidin and tyramine were completely occupied. Therefore, 300 μg / mL was chosen for subsequent experiments (Fig. 7b). 4% hydrogen peroxide (Fig. 7c) and 40 μL of HRP (0.15 U / mL) (Fig. 7d) showed significantly increased absorbance relative to other concentrations during the detection period and were therefore selected as the optimal experimental conditions.
[0157] Example 5: Development of a single detection method for three foodborne pathogens
[0158] 1. Extraction of pathogenic bacteria genomic DNA
[0159] First, the standards for three pathogenic bacteria (Salmonella typhimurium, Listeria monocytogenes, and Staphylococcus aureus) were diluted to 10 μL using PBS buffer. 1 10 2 10 3 10 4 10 5 10 6 10 7 CFU / mL. Genomic DNA was extracted from different concentration gradients of Salmonella Typhimurium, Listeria monocytogenes, and Staphylococcus aureus according to the kit instructions.
[0160] 2. Argonaute enzyme-mediated secondary cleavage at room temperature
[0161] Figure 8 shows a schematic diagram of the Argonaute enzyme-mediated secondary cleavage process at room temperature.
[0162] Take 2 μL of 1 mg / mL Argonaute enzyme (prepared by the method described in Example 1), 2 μL of guide DNA1 and guide DNA2 (guide DNA targeting Salmonella Typhimurium in Table 1), 2 μL of 500 μM MnCl2, and 2 μL of Tris-HCl (20 mM pH = 7.5) in a 150 μL centrifuge tube and react at 37°C for 20 minutes to pre-load the guide DNA onto the Argonaute enzyme. Then add 2 μL of unwound Salmonella Typhimurium genomic DNA at different bacterial concentrations and react at 37°C for 10 minutes to obtain specific secondary guide DNA. During incubation, the secondary guide DNA re-binds to the Argonaute enzyme to form target DNA, which is used to target the quenched fluorescent probe.
[0163] For the detection of Listeria monocytogenes and Staphylococcus aureus, the procedure is the same as above, except that the guide DNA is replaced with guide DNA targeting the corresponding strain, and the genomic DNA is replaced with the genomic DNA of the corresponding strain. Guide DNA1 and DNA2 for the three bacteria are shown in Table 1, where the letter P represents a phosphate group.
[0164] Table 1 Primer sequences
[0165] 3. Nanomagnetic particles encoded with streptavidin
[0166] Two μL of biotinylated fluorescent probes (probe sequences and concentrations for different strains are shown in Table 2, where FAM, Alexa fluor 405, and Cy3 represent different fluorescent groups, ibiodt represents biotin-labeled deoxythymidine, and BHQ1 and BHQ2 represent fluorescence quenching groups) were added to a test tube containing target DNA after the reaction in step 2, and incubated at 37°C for 20 minutes. The incubation product was mixed with 50 μL of the MB-TA-SA conjugate obtained in step 1 of Example 4, and gently rotated on a rotary mixer for 30 minutes to allow the cleaved fluorescent probes to fluorescently encode the MB-TA-SA conjugate, obtaining luminescent magnetic nanoparticles. The luminescent magnetic nanoparticles were magnetically separated and then washed with 100 μL of ultrapure water, repeated three times, and finally diluted with ultrapure water to a final volume of 20 μL.
[0167] Table 2 Probe Sequences
[0168] 5. Image acquisition using laser confocal microscopy
[0169] The following steps were taken to detect the fluorescence colorimetric results of the samples using a confocal laser scanning microscope (FV 3000):
[0170] Take 20 μL of the sample obtained in step 4 above into a photographing dish, cover it with a coverslip, place it on the stage of a confocal laser scanning microscope, and turn on the instrument. Adjust the objective lens magnification to 60x and the laser emission intensity to 50%, and select the laser channel corresponding to the fluorescent probe for observation. After focusing and other adjustments are completed, the sample can be photographed. The shooting positions should be selected from left to right and from top to bottom. The same area should not be photographed repeatedly. Take 30 photographs for each sample, repeating 3 times.
[0171] Example 6: Programmable Nanomagnetic Particle-Assisted Imaging Transcoding System
[0172] Artificial intelligence decoding is achieved through the construction of the Panda counting method, as shown in Figure 9. The obtained images are first classified according to the color of the fluorescent reporter, grouped into different files, and then converted to grayscale images through binarization to filter out background interference. Successfully encoded magnetic nanoparticles exhibit strong fluorescence intensity and can be clearly identified by the algorithm after conversion to grayscale images, being identified as "1" during the decoding and counting process; those not identified by the algorithm are counted as "0" (not counted). During counting, the algorithm requires that the aspect ratio of the magnetic nanoparticles in the image be greater than 0.7. Furthermore, the high energy of the confocal laser can induce some magnetic nanoparticles to form magnetic chains, which can affect the accuracy of the counting. Therefore, an image segmentation function is added to the Panda counting method to overcome this problem by measuring the aspect ratio of the magnetic nanoparticles and segmenting when the aspect ratio is greater than 2.
[0173] Figure 10 shows a schematic diagram of the AI algorithm decoding process.
[0174] The specific steps of the AI algorithm decoding method are as follows:
[0175] Step 1: Implement the object detection task using the Fast R-CNN object detection algorithm to obtain the color of the image obtained in Example 5. Then, classify the image according to the color (blue, green, and red) (blue - Salmonella typhimurium, green - Listeria monocytogenes, red - Staphylococcus aureus) to achieve simultaneous detection of the three target bacteria.
[0176] Step 2: The classified images are binarized using the watershed algorithm to remove background noise interference and ensure the accuracy of the count.
[0177] Step 3: Perform a counting operation on the image processed in Step 2: Traverse the entire image region, obtain the bounding boxes of the nanomagnetic particles, acquire the length and width information of the magnetic beads, and calculate the height and width. For single magnetic beads with an aspect ratio greater than 0.7, the nanomagnetic particles are directly counted as 1; those less than 0.7 are ignored. This parameter is used to filter non-circular targets. When magnetic beads exhibit magnetic linkage adhesion (i.e., the aspect ratio of the nanomagnetic particles is greater than 2), the segmentation function in the algorithm is executed to segment the adhered nanomagnetic particles in the image into individual nanomagnetic particles with an aspect ratio greater than 0.7. Then, the counting code is executed, and the count value is fed back to the computer and output to achieve accurate counting. Each captured image is sequentially identified, counted, and statistically analyzed to obtain the corresponding statistical results.
[0178] In addition, to verify the accuracy of this algorithm, we compared the calculation accuracy of Panda with manual counting and counting by commercial software (Image J).
[0179] The results showed that the number of MBs counted by Panda for Staphylococcus aureus, Listeria monocytogenes, and Salmonella typhimurium were 100, 155, and 201, respectively (Fig. 11a), which showed good consistency with the manual method (Fig. 11c). However, the number of MBs obtained by ImageJ software was significantly lower than that obtained by Panda and the manual method (Fig. 11b), which may be because ImageJ processing was too uniform and the threshold was not well adjusted to obtain the best possible readings. After decoding, by calculating the number of MB-TA-SA microspheres with different fluorescent codes, a relationship curve between the concentration of foodborne pathogen DNA and the number of MB-TA-SA microspheres was established, thus enabling the calculation of the target concentration.
[0180] Example 7: Optimization of the detection method
[0181] The specific implementation methods are the same as in Examples 5 and 6, except that when optimizing the primer DNA concentration, the selected primer DNA concentrations are 1 μM, 2 μM, 3 μM, 4 μM, and 5 μM, while the fluorescent probe concentration is fixed at 5 μM. When optimizing the fluorescent probe concentration, the probe concentrations are selected as 2 μM, 3 μM, 4 μM, 5 μM, and 6 μM, and the primer DNA concentration used in this case is the optimized concentration.
[0182] Results: Based on the number of MB–TA–SA conjugates counted by Panda, 2 μM Staphylococcus aureus gDNA, 5 μM Listeria monocytogenes gDNA, and 3 μM Salmonella typhimurium gDNA were determined to be the optimal conditions (Figure 12). The optimal fluorescent probe concentrations for Staphylococcus aureus, Listeria monocytogenes, and Salmonella typhimurium were 3 μM, 2 μM, and 2 μM, respectively (Figure 13).
[0183] Example 8: Single detection of three foodborne pathogens
[0184] Under the optimized parameters of Example 7, the sensitivity of this invention for the single detection of three foodborne pathogens (Staphylococcus aureus, Listeria monocytogenes, and Salmonella typhimurium) was studied, with the specific implementation method referring to Example 5. Then, through decoding in Example 6, the number of luminescent magnetic nanoparticles at different concentrations for different strains was counted.
[0185] Figure 14 shows the output images of the number of luminescent magnetic nanoparticles at different concentrations for different strains. Figures 15 to 17 show the relationship between the number of luminescent magnetic nanoparticles and the bacterial concentration after decoding and counting. The results indicate that at a concentration of 10... 1 CFU / mL to 10 7All three foodborne pathogens were successfully detected at CFU / mL. Furthermore, the number of luminescent magnetic nanoparticles increased with increasing concentration of the target DNA of a single pathogen (i.e., bacterial concentration). The concentrations of the three bacteria were positively correlated with the fluorescent conjugates, exhibiting excellent linearity (R0). 2 >0.98). Then, the detection limits for the three bacteria were calculated using the formula (LOD = 3S / M, where S is the blank standard deviation and M is the slope of the linear range). The results showed that the detection limit for Staphylococcus aureus was 6 CFU / mL, for Listeria monocytogenes was 6 CFU / mL, and for Salmonella typhimurium was 7 CFU / mL, demonstrating the excellent detection performance of this invention under amplification-free conditions. These results indicate that this invention can be used for the rapid and accurate detection of foodborne pathogens, and that it can be used for the detection of other bacteria with only simple design of specific guide DNA.
[0186] Example 9: Investigation of Anti-interference and Specificity
[0187] The operation method is the same as in Example 5, except that the anti-interference test involves reacting the gDNA of one bacterium with its own DNA and a mixture of the bacterium's DNA with those of other bacteria (e.g., if gDNA is Staphylococcus aureus, the sample would be Staphylococcus aureus DNA, a mixture of Staphylococcus aureus DNA and Listeria monocytogenes DNA, a mixture of Staphylococcus aureus DNA and Salmonella typhimurium DNA, or a mixture of Staphylococcus aureus DNA, Listeria monocytogenes DNA, and Salmonella typhimurium DNA), and observing the signal differences. The specificity test involves reacting the gDNA of one bacterium with the DNA of a single bacterium (e.g., if gDNA is Staphylococcus aureus, the sample would be Staphylococcus aureus DNA, Listeria monocytogenes DNA, Salmonella typhimurium DNA, Escherichia coli DNA, and Vibrio parahaemolyticus DNA).
[0188] The anti-interference results (Figure 18, where a, b, and c represent Salmonella Typhimurium, Staphylococcus aureus, and Listeria monocytogenes, respectively) show that there was no significant cross-reaction among the gDNA of Salmonella Typhimurium, Staphylococcus aureus, and Listeria monocytogenes affecting the experimental results, indicating that the method of the present invention has excellent anti-interference properties against the three foodborne pathogens.
[0189] The specificity results (Figure 19, where a, b, and c represent Salmonella Typhimurium, Staphylococcus aureus, and Listeria monocytogenes, respectively) show that the signal generated by interfering with the DNA of foodborne pathogens is less than 10% of that of the target bacteria, indicating that the method of the present invention has excellent specificity for each foodborne pathogen.
[0190] The above results demonstrate that the method of the present invention has good anti-interference and specificity, and is a precise and sensitive rapid method for detecting foodborne pathogens.
[0191] Example 10: Simultaneous detection of nucleic acid molecules from three foodborne pathogens
[0192] The operation steps are the same as in Example 3, except that in step 2, during the Argonaute enzyme-mediated secondary digestion at room temperature, guide DNA from three pathogenic bacteria (2 μL guide DNA1, 2 μL guide DNA2) is added simultaneously for pre-loading, followed by the addition of genomic DNA from the three pathogenic bacteria. Furthermore, in step 4, fluorescent probes from the three pathogenic bacteria are added simultaneously for digestion, while the remaining conditions remain unchanged.
[0193] As shown in Figure 20, with the increase of the target DNA of the three pathogenic bacteria, the number of luminescent magnetic nanoparticles appearing in the captured image increased, indicating a positive correlation between the number of target DNA and the number of luminescent magnetic nanoparticles. This demonstrates that the method provided by this invention can effectively achieve simultaneous detection of different pathogenic bacteria. Furthermore, the number of luminescent magnetic nanoparticles maintained a high degree of consistency with the number in single-detection assays (Figures 15-17 and Figure 20), indicating the stability of the detection method provided by this invention.
[0194] Example 11: Application of a room-temperature Argonaute protein-based multiplex nucleic acid amplification-free digital encoding-decoding detection method in practical sample detection.
[0195] The specific implementation method is the same as steps 2-6 in Example 5, except that in step 2, the microbial genomic DNA is replaced with a microbial DNA sequence extracted from 100 samples (including live shrimp, frozen shrimp, eggs, and frozen chicken) randomly selected from a local store. The guide DNA and fluorescent probe used are the same as above. Simultaneously, the samples were tested using qPCR to evaluate the practicality of this method.
[0196] Results: Of the 100 real samples, 16 were positive for Salmonella Typhimurium, 12 were positive for Listeria monocytogenes, and 9 were positive for Staphylococcus aureus (Figure 21). The results showed good agreement with the qPCR results (correlation coefficients for the three pathogens were greater than 0.95).
[0197] These results demonstrate that the present invention possesses excellent analytical performance and can accurately quantify foodborne pathogens in real food samples. The MB-TA-SA conjugate-based MB-assisted imaging transcoding system of the present invention overcomes the shortcomings of traditional digital detection methods, such as cumbersome operation, high cost, and susceptibility to contamination, avoids complex amplification processes, and simultaneously ensures high sensitivity for detecting low concentrations of nucleic acids.
[0198] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A method for detecting target nucleic acid molecules, characterized in that, The method includes the following steps: (1) Preparation of luminescent magnetic nanoparticles: Argonaute enzyme was sequentially mixed with guide DNA, nucleic acid sample to be tested, nucleic acid probe and magnetic nanoparticle conjugate and incubated to obtain fluorescently encoded magnetic nanoparticles. After washing, the nanoparticles were dispersed in an aqueous solution to obtain a solution containing luminescent magnetic nanoparticles. (2) Algorithm decoding: The solution containing luminescent magnetic nanoparticles obtained in step (1) is subjected to fluorescence development to obtain a development image. The obtained development image is processed by artificial intelligence algorithm. Based on the number of fluorescent nanoparticles on the development image, the concentration information of the target nucleic acid molecules to be tested is output. The guide DNA includes: guide DNA1 and guide DNA2; The guide DNA1 and guide DNA2 target and bind to the target nucleic acid molecule, and the binding sites of the guide DNA1 and guide DNA2 on the target nucleic acid molecule are adjacent and without spacer sequences. The nucleic acid probe is modified with fluorescent groups, biotin, and quencher groups; The nanomagnetic particle coupling material is: nanomagnetic particles whose surfaces are sequentially modified with tyrosine and streptavidin; The Argonaute enzyme targets the target nucleic acid molecule via the guide DNA, cleaves the target nucleic acid molecule, and generates secondary guide DNA, which is at least partially reverse complementary to the nucleic acid probe.
2. The method according to claim 1, characterized in that, The decoding method of the artificial intelligence algorithm includes the following steps: S1. Obtain the color of the developed image through a target detection algorithm, and classify the different colors; S2. The classified images are binarized using the watershed algorithm to remove background noise interference. S3. Perform a counting operation on the image processed by S2.
3. The method according to claim 2, characterized in that, The counting operation includes the following steps: a. Obtain the length and width information of the nanomagnetic particles in the developed image, and perform a counting operation on nanomagnetic particles with an aspect ratio greater than 0.7 and less than or equal to 2; b. When the aspect ratio of the magnetic bead is greater than 2, it is determined that the nanomagnetic particles have magnetic chain adhesion. The nanomagnetic particles are then divided into individual nanomagnetic particles with an aspect ratio greater than 0.7, and the counting operation is then performed.
4. The method according to claim 1, characterized in that, The fluorescent groups include: FAM, Alexa fluor405, HEX, CY3, CY5, ROX, VIC, JOE, TET, Texas Red, or combinations thereof; the quenching groups include: TAMARA, BHQ, DABSYL, or combinations thereof.
5. The method according to claim 1, characterized in that, The 5' end of the guide DNA is modified with a phosphate group.
6. The method according to claim 5, characterized in that, The guide DNA is 16–26 nt in length.
7. The method according to claim 1, characterized in that, The target nucleic acid molecule is a nucleic acid molecule of a microorganism.
8. The method according to claim 1, characterized in that, The guide DNA contains an additional n pairs of guide DNA, each pair of guide DNA containing two ssDNAs. The ssDNAs specifically target and bind to different target nucleic acid molecules, enabling the detection of different target nucleic acid molecules; where n is a natural number ≥1.
9. The method according to claim 1, characterized in that, The guide DNA and the nucleic acid probe are selected from any one of the following (a)-(c): (a) First set of guide DNA and nucleic acid probes: Guide DNA 1: 5'P-AGCCTAACATATCCAGGTGCT 3', Guide DNA 2: 5'P-CTCGTGAAAGCGAATTCGGAA 3'; Nucleic acid probe: 5' fluorescent group - / ibiodt / CATATCCAGGTGCTCTCGTGAAAGCGAAT - quenching group 3'; (b) Second set of guide DNA and nucleic acid probes: Guide DNA 1: 5'P-ATATTGTTGACAGGAGCTCTT 3', Guide DNA 2: 5'P-CTATAACCGTCGCCTTCATAG 3'; Nucleic acid probe: 5' fluorescent group - / ibiodt / TGACAGGAGCTCTTCTATAACCGTTCGCCT- quencher group 3'; (c) Third group of guide DNA and nucleic acid probes: Guide DNA 1: 5'P-ATGTAAAAGCCGTCTTGATAA 3', Guide DNA 2: 5'P-TCTTTAGTAGTACCGAAGCTG 3'; Nucleic acid probe: 5' fluorescent group - / ibiodt / AGCCGTCTTGATAATCTTTAGTAGTACCG - quenching group 3'; Where P represents the 5' phosphorylation modification of the oligonucleotide.
10. The method according to claim 1, characterized in that, The Argonaute enzyme is derived from Clostridium butyrium.
11. The method according to claim 1, characterized in that, The amount of Argonaute enzyme used is not less than 1 mg / mL.
12. A reagent kit for detecting target molecules, characterized in that, The kit includes: Argonaute enzyme, guide DNA, nucleic acid probe, and magnetic nanoparticle conjugate; The guide DNA includes: guide DNA1 and guide DNA2; guide DNA1 and guide DNA2 target and bind to the target nucleic acid molecule, and the binding sites of guide DNA1 and guide DNA2 on the target nucleic acid molecule are adjacent and without spacer sequences; The nucleic acid probe is modified with fluorescent groups, biotin, and quencher groups; The nanomagnetic particle coupling material is: nanomagnetic particles whose surfaces are sequentially modified with tyrosine and streptavidin; The Argonaute enzyme targets the target nucleic acid molecule via the guide DNA, cleaves the target nucleic acid molecule, and generates secondary guide DNA, which is at least partially reverse complementary to the nucleic acid probe.
13. The use of the method according to any one of claims 1 to 11 or the kit according to claim 12 in the preparation of products for detecting target nucleic acid molecules.
14. The application according to claim 13, characterized in that, The target nucleic acid molecule is derived from at least one of Salmonella Typhimurium, Listeria monocytogenes, and Staphylococcus aureus.
Citation Information
Patent Citations
Biochemical analysis method for simultaneously detecting multiple target objects based on magnetic separation
CN112964868A
Nucleic acid detection method based on normal-temperature prokaryotic Argonaute protein and application thereof
CN114277109A
Multiplex nucleic acid amplification-free digital coding-decoding detection method based on normal-temperature Argonaute protein
CN118620996A