Plasmid backbone capable of improving stability of polyadenylic acid tail

Abstract

The present invention relates to the field of in-vitro transcription, in particular to a plasmid backbone capable of improving the stability of the polyadenylic acid tail. Provided is an expression cassette, sequentially comprising: a rop gene, a replicon ori, and a resistance gene, wherein the rop gene, the replicon ori, and the resistance gene are connected by means of linker fragments. Low-copy pmRVacSL and medium-copy pmRVacM plasmid vector systems are established by means of artificial modification. Since pmRVacSL is a low-copy vector, the plasmid DNA yield is relatively low. The pmRVacM plasmid backbone addresses the problem of low plasmid DNA yield of pmRVacSL. The vector system not only enables stable replication of polyA tail sequences of 150 bp or more, but also allows for rapid addition of genes of interest and polyadenylic acid (polyA) sequences, efficiently and rapidly obtaining the target DNA template for mRNA in vitro transcription.

Description

A plasmid backbone that can improve the stability of polyadenylate tails

[0001] This application claims priority to Chinese Patent Application No. 2024107045581, filed on May 31, 2024, entitled "A plasmid backbone for improving the stability of polyadenylate tails", the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention relates to the field of in vitro transcription, and more particularly to a plasmid backbone that can improve the stability of polyadenylate tails. Background Technology

[0003] mRNA vaccines involve injecting a synthetic mRNA sequence encoding a protein antigen into the human body. This directs the body to express the corresponding protein and induces a specific immune response, achieving the goals of disease prevention and treatment. Compared to traditional vaccines, they offer several advantages, including strong immunogenicity, high safety, and ease of research, development, and production.

[0004] The polyA tail is an important feature of eukaryotic mRNA, composed of multiple adenosine nucleotides located at the 3' end of the mRNA. It plays a crucial role in basic expression regulation, particularly in translation and controlling mRNA stability. The polyA tail prevents exonucleases from degrading the 3' end of mRNA, increasing mRNA stability. Furthermore, during translation, the polyA tail acts as a "translational enhancer." Studies have shown that removing the polyA site can reduce mRNA expression levels by up to 10-fold.

[0005] Currently, there are three main methods for adding polyA tails when synthesizing mRNA via IVT: 1) enzymatic synthesis, where a polyA polymerase derived from *E. coli* is added after mRNA transcription; 2) co-transcription, where the polyA sequence already present in the template plasmid DNA or PCR product is directly transcribed; and 3) amplification of the plasmid using phi29 DNA polymerase and in vitro rolling circle amplification (RCA) technology. Co-transcription tailing maintains the homogeneity of the final product, reduces process steps, and saves costs, making it a preferred method. Some scientists have also explored alternative approaches, using segmented polyA co-transcription, which can reduce polyA deletion.

[0006] The preparation of mRNA plasmid DNA templates usually involves bacterial fermentation for large-scale plasmid production. However, during bacterial amplification, the polyA tail of plasmids carrying long polynucleotide sequences may shorten as the bacteria continue to amplify. Furthermore, when the polyA sequence on the plasmid is greater than 100 bp, it is more likely to become unstable during culture and then experience base loss and shortening, which poses a significant challenge to production. Summary of the Invention

[0007] In view of this, the present invention provides a plasmid backbone that can improve the stability of polyadenylated nucleotide tails. The present invention establishes low-copy pmRVacSL and medium-copy pmRVacM plasmid vector systems through artificial modification. Since pmRVacSL is a low-copy vector, the plasmid DNA yield is relatively low. The pmRVacM plasmid backbone solves the problem of low plasmid DNA yield of pmRVacSL. This vector system not only ensures stable replication of polyA tail sequences of 150 bp or more, but also allows for the rapid addition of genes of interest and polyadenylated nucleotide (polyA) sequences, efficiently and quickly obtaining DNA templates for in vitro transcription of target mRNA.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention provides an expression cassette, comprising, in sequence: a rop gene, a replicon ori, and a resistance gene;

[0010] The rop gene, the replicon ori, and the resistance gene are connected by a linker fragment.

[0011] In some embodiments of the present invention, the expression cassette, from the 5' end to the 3' end, sequentially includes: a rop gene, a replicon ori, and a resistance gene;

[0012] The rop gene, the replicon ori, and the resistance gene are connected by a linker fragment.

[0013] In some embodiments of the present invention, the rop gene in the above expression cassette includes a wild type or a mutant type; the mutant type is obtained by means of the wild type through any of the following:

[0014] (I) Remove the start codon; or

[0015] (II) Mutate the start codon to the stop codon.

[0016] In some embodiments of the present invention, the rop gene in the above expression cassette has:

[0017] (1) A nucleotide sequence as shown in any of SEQ ID NO:1 to SEQ ID NO:3; or

[0018] (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function to the nucleotide sequence shown in (1); or

[0019] (3) A nucleotide sequence that is at least 80%, 85%, 90% or 95% identical to the nucleotide sequence shown in (1) or (2).

[0020] In some embodiments of the present invention, the sequence of SEQ ID NO:1 in the above expression box is: GTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGA.

[0021] In some embodiments of the present invention, the sequence of SEQ ID NO:2 in the above expression box is: ACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGA.

[0022] In some embodiments of the present invention, the sequence of SEQ ID NO:3 in the above expression box is: TAAACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGA.

[0023] In some embodiments of the present invention, in the above expression cassette, the replicon ori includes: wild type or mutant type; the mutant type is obtained by mutating the nucleotide sequence of the wild type at position 442.

[0024] In some embodiments of the present invention, in the above expression cassette, the mutant includes a G mutation at position 442 of the wild-type nucleotide sequence to A.

[0025] In some embodiments of the present invention, in the above-described expression box, the replicon ori has:

[0026] (4) A nucleotide sequence as shown in SEQ ID NO:4 or SEQ ID NO:5; or

[0027] (5) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (4), and which has the same or similar function as the nucleotide sequence shown in (4); or

[0028] (6) A nucleotide sequence that is at least 80%, 85%, 90% or 95% identical to the nucleotide sequence shown in (4) or (5).

[0029] In some embodiments of the present invention, in the above expression cassette, the sequence of SEQ ID NO:4 is: TTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAA。

[0030] In some embodiments of the present invention, the sequence of SEQ ID NO:5 in the above expression box is:

[0031] In some embodiments of the present invention, the resistance gene in the above expression cassette includes a kanamycin resistance gene.

[0032] In some embodiments of the present invention, the sequence of the kanamycin resistance gene in the above expression cassette is shown in SEQ ID NO:11.

[0033] In some embodiments of the present invention, the connecting segment in the above-described expression box has:

[0034] (7) A nucleotide sequence as shown in any of SEQ ID NO:6 to SEQ ID NO:10; or

[0035] (8) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (7), and which has the same or similar function as the nucleotide sequence shown in (7); or

[0036] (9) A nucleotide sequence that is at least 80%, 85%, 90% or 95% identical to the nucleotide sequence shown in (7) or (8).

[0037] In some embodiments of the present invention, the sequence of SEQ ID NO:6 in the above expression box is: TGAGAGCGTCCCGCGGCCGCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCA.

[0038] In some embodiments of the present invention, the sequence of SEQ ID NO:7 in the above expression box is: TGAGAGCGTCCCGCGGCCGCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACCATCA.

[0039] In some embodiments of the invention, in the above expression cassette, SEQ ID The sequence of NO:8 is: CACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCG CACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTGCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTT.

[0040] In some embodiments of the present invention, the sequence of SEQ ID NO:9 in the above expression box is: GAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAG.

[0041] In some embodiments of the present invention, the sequence of SEQ ID NO:10 in the above expression box is: ACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACCGGTCGA.

[0042] In some embodiments of the present invention, in the above-described expression box, the connecting segments include: connecting segment 1 to connecting segment 4;

[0043] The linker fragment 1 is located at the 5' end of the rop gene;

[0044] The linker fragment 2 is located between the rop gene and the replicon ori;

[0045] The linker fragment 3 is located between the replicon ori and the resistance gene;

[0046] The linker fragment 4 is located at the 3' end of the resistance gene.

[0047] In some embodiments of the present invention, the sequence of the connecting fragment 1 in the above expression box is as shown in SEQ ID NO:6 or SEQ ID NO:7.

[0048] In some embodiments of the present invention, the sequence of the connecting fragment 2 in the above expression box is as shown in SEQ ID NO:8.

[0049] In some embodiments of the present invention, the sequence of the connecting fragment 3 in the above expression box is as shown in SEQ ID NO:9.

[0050] In some embodiments of the present invention, the sequence of the connecting fragment 4 in the above expression box is as shown in SEQ ID NO:10.

[0051] In some embodiments of the present invention, the expression box described above has:

[0052] (10) A nucleotide sequence as shown in any of SEQ ID NO:12 to SEQ ID NO:16; or

[0053] (11) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (10), and which has the same or similar function as the nucleotide sequence shown in (10); or

[0054] (12) A nucleotide sequence that is at least 80%, 85%, 90% or 95% identical to the nucleotide sequence shown in (10) or (11).

[0055]

[0056]

[0057]

[0058]

[0059]

[0060] The present invention also provides a recombinant plasmid comprising: the above-described expression cassette and acceptable gene elements.

[0061] In some embodiments of the present invention, the acceptable gene elements in the recombinant plasmid include one or more of the following: polyA, 5'UTR, 3'UTR, promoter, multiple cloning site, and restriction enzyme site.

[0062] In some embodiments of the present invention, the recombinant plasmids described above further include a backbone plasmid, which includes any one of a low-copy backbone plasmid, a medium-copy backbone plasmid, and a high-copy backbone plasmid.

[0063] In some embodiments of the present invention, the recombinant plasmid further includes a backbone plasmid, wherein the backbone plasmid is a low-copy backbone plasmid.

[0064] The present invention also provides a host, transformation and / or transfection of the above recombinant plasmid.

[0065] The present invention also provides the application of the above expression cassette, the above recombinant plasmid and / or the above host in any of the following:

[0066] (I) Preparation of mRNA; and / or

[0067] (II) Preparation of mRNA drugs, formulations, or drug combinations; and / or

[0068] (III) Improve plasmid stability; and / or

[0069] (IV) Increase plasmid yield.

[0070] The present invention also provides products comprising: the above-described expression cassette, the above-described recombinant plasmid, and / or the above-described host.

[0071] This invention artificially modifies and constructs a plasmid backbone that can maintain stable replication during bacterial amplification even when a polyA tail of more than 150 bp is inserted, without the phenomenon of polyA tail shortening. Attached Figure Description

[0072] Figure 1 shows TBE-PAGE gel images of polyA tails of different lengths of pmRVac plasmid; from left to right, they are Ladder, 150A, 120A, 100A, 80A, 60A and Ladder; where the Ladders from top to bottom are 300bp, 200bp and 100bp;

[0073] Figure 2 shows TBE-PAGE gel images of polyA tails of different lengths for the pmRVacSL plasmid; from left to right, they are Ladder, 65A, 80A, 100A, 120A, 150A and Ladder; where the Ladders from top to bottom are 300bp, 200bp and 100bp;

[0074] Figure 3 shows a comparison of plasmid DNA yields for the four mutants pmRVacSL and pmRVacM.

[0075] Figure 4 shows the TBE-PAGE gel images of the polyA tails of pmRVacSL and pmRVacM; from left to right, they are Ladder, pmRVacSL-120A, pmRVacSL-150A, pmRVacM(GtoA)-120A, pmRVacM(GtoA)-150A, pmRVacM(remove GTG)-120A, pmRVacM(remove GTG)-150A, pmRVacM(GTG to TAA)-120A, pmRVacM(GTG to TAA)-150A, pmRVacM(remove GGAGG)-120A, pmRVacM(remove GGAGG)-150A, and Ladder; where, from top to bottom, the Ladder values ​​are 300bp, 200bp, and 100bp.

[0076] Figure 5 shows the correct polyA ratio of pmRVacSL plasmid DNA;

[0077] Figure 6 shows the pmRVac plasmid skeleton map;

[0078] Figure 7 shows the pmRVacSL plasmid backbone map;

[0079] Figure 8 shows the pmRVacM(G toA) plasmid backbone map;

[0080] Figure 9 shows the pmRVacM (remove GTG) plasmid backbone map;

[0081] Figure 10 shows the pmRVacM(GTG to TAA) plasmid backbone map;

[0082] Figure 11 shows the backbone map of the pmRVacM (remove GGAGG) plasmid. Detailed Implementation

[0083] This invention discloses a plasmid backbone that can improve the stability of polyadenylate tails. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve this. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can obviously make modifications or appropriate changes and combinations to the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0084] This invention obtains three vector backbones through artificial modification: pmRVac, pmRVaSL, and pmRVacM. pmRVac is a high-copy vector with the plasmid backbone vector originating from pUC ori; pmRVacSL is a low-copy vector; and pmRVacM is a medium-copy vector. Both pmRVacSL and pmRVacM plasmid backbone vectors originate from pBR322 ori. pmRVacM is obtained from the pmRVacSL backbone vector through base mutation and deletion, which significantly increases the yield of plasmid DNA.

[0085] The raw materials and reagents used in the plasmid backbone that improves the stability of polyadenylate tails provided by this invention are all commercially available. The invention is further illustrated below with reference to examples:

[0086] Example 1: Construction of pmRVac vectors containing polyA tails of different lengths

[0087] (1) The pmRVac-EGFP plasmid was obtained by modifying the pUC57 high-copy vector.

[0088] (2) The pmRVac-EGFP plasmid was digested with restriction endonucleases BsrGI and NotI, and purified linearized pmRVac backbone containing the EGFP target gene was obtained by gel extraction kit.

[0089] (3) Gene synthesis of plasmids containing polyA tails of different lengths, digestion of plasmids containing pure polyA tail fragments of different lengths using restriction endonucleases BsrGI and NotI, and obtaining purified fragments containing polyA tails of different lengths using a gel extraction kit.

[0090] (4) The purified linearized pmRVac backbone containing the EGFP target gene and the purified fragments containing polyA tails of different lengths were ligated by T4 ligase to obtain the reaction system of pmRVac vectors containing polyA tails of different lengths containing the target gene EGFP.

[0091] (5) The T4 ligase reaction system was transferred into VB UltraStable competent cells by chemical transformation. Transformation steps: Thaw the competent cells on ice for 30 min, add the T4 ligase reaction system to the competent cells, incubate on ice for 30 min, incubate in a hot water bath at 42℃ for 1 min, incubate on ice for 2 min, add LB medium and incubate at 37℃ with shaking for 1 h, then take an appropriate amount of bacterial culture and plate it onto LB solid plates containing kanamycin, and incubate upside down at 37℃ for 16 h.

[0092] (6) Several single colonies were randomly picked from the plate and placed in a small amount of sterile water. Using this bacterial culture as a template, specific forward and reverse primers and PCR enzymes were designed to perform bacterial PCR. The PCR results were verified by gel electrophoresis. Clones with expected PCR results were inoculated into LB liquid medium containing kanamycin and cultured at 37°C with shaking for 16 hours. A portion of the cultured bacterial culture was stored in glycerol, and the remaining culture was used to extract plasmids using a plasmid extraction kit. This yielded pmRVac plasmids containing polyA tails of different lengths.

[0093] (7) The plasmid was digested with restriction endonuclease BtgI to digest the polyA tails containing 60A, 80A, 100A, 120A and 150A and the DNA sequences at both ends, to obtain fragments containing polyA tails with lengths of 111bp, 131bp, 151bp, 171bp and 201bp, respectively.

[0094] (8) The stability of the polyA tail was identified by TBE-PAGE gel electrophoresis. It was observed that when the pmRVac vector backbone carried a polyA tail of more than 100 bp, recombination and replication instability occurred (as shown in Figure 1). The pmRVac plasmid backbone map is shown in Figure 6.

[0095] Example 2: Construction of pmRVacSL vectors containing polyA tails of different lengths

[0096] (1) Using pBR322 low copy plasmid as DNA template, specific forward and reverse primers and PCR enzymes were designed for PCR amplification. The purified linearized backbone with pBR322 Rop and pBR322 Ori was obtained by gel recovery kit.

[0097] (2) The pmRVac plasmid in Example 1 was digested with restriction endonucleases DraI and NotI, and purified DNA fragments containing Kanamycin resistance and the target gene EGFP were obtained by gel recovery kit.

[0098] (3) The purified linearized backbone containing pBR322Rop and pBR322 Ori and the DNA fragment containing Kanamycin resistance and the target gene EGFP were ligated by Gibson reaction to obtain an in vitro transcription vector containing the target gene EGFP.

[0099] (4) Following steps (5) and (6) of Example 1, the pmRVacSL plasmid is obtained.

[0100] (5) Referring to steps (2) to (6) of Example 1, pmRVacSL plasmids containing polyA tails of different lengths can be obtained.

[0101] (6) The pmRVacSL plasmid was digested with restriction endonuclease BtgI to digest the polyA tails containing 65A, 80A, 100A, 120A and 150A and the DNA sequences at both ends, resulting in fragments containing polyA tails with lengths of 116bp, 131bp, 151bp, 171bp and 201bp, respectively.

[0102] (7) The stability of the polyA tail was identified by TBE-PAGE gel electrophoresis. It was observed that the pmRVacSL vector backbone, carrying a polyA tail of up to 150 bp, maintained stable replication during bacterial amplification and did not undergo recombination (Figure 2). The pmRVacSL plasmid backbone map is shown in Figure 7.

[0103] Example 3: Construction of the pmRVacM vector system

[0104] (1) The pmRVacM vector system is derived from the pmRVacSL vector system through base mutation and removal.

[0105] (2) The study found that the increase in pUC copy number was due to a point mutation in RNA II, which was suppressed by the Rom / Rop protein or by lowering the growth temperature to 30°C. Therefore, a G to A mutation was introduced into the nucleotide 112 segment of the RNA II transcript, which is adjacent to the complementary region of RNA I (at position -1 on the RNA I transcript), thus obtaining the pmRVacM(G to A) plasmid vector. The pmRVacM(G to A) plasmid backbone is shown in Figure 8.

[0106] (3) Since the Rop gene encoding the Rop protein can promote the conversion of the unstable RNA I-RNA II complex into a stable complex and reduce the copy number (source - plasmid pMB1), the start codon GTG is removed to prevent Rop protein expression while retaining its DNA sequence, thus obtaining the pmRVacM (remove GTG) plasmid vector. The pmRVacM (remove GTG) plasmid backbone is shown in Figure 9.

[0107] (4) By mutating the start codon GTG to TAA, the Rop protein is not expressed, but its DNA sequence is preserved, thus obtaining the pmRVacM(GTG to TAA) plasmid vector. The pmRVacM(GTG to TAA) plasmid backbone is shown in Figure 10.

[0108] (5) By removing the ribosome binding site GGAGG of the Rop gene, the Rop protein is not expressed, but its DNA sequence is retained, thus obtaining the pmRVacM (remove GGAGG) plasmid vector. The pmRVacM (remove GGAGG) plasmid backbone is shown in Figure 11.

[0109] (6) The yield of pmRVacSL plasmid containing the 120A and 150A tails of the target gene EGFP was compared with that of pmRVacM(G to A), pmRVacM(remove GTG), pmRVacM(GTG to TAA) and pmRVacM(remove GGAGG) plasmids containing the 120A and 150A tails of the target gene EGFP.

[0110] (7) Plasmid DNA yield: 10 μL of single-clone bacterial culture was inoculated into 2 mL of LB medium, cultured in 15 mL shaking tubes at 37 °C and 250 rpm for 15 h in a shaker, and the concentration was determined after extraction using a plasmid mini-extraction kit.

[0111] (8) It can be found that the most significant increase in plasmid DNA yield is achieved by mutating the start codon GTG of the Rop gene in the pmRVacSL plasmid backbone to TAA, with a 1.5-fold increase per mL of bacterial culture and a significant difference (as shown in Figure 3).

[0112] (9) The plasmids in step (6) were digested with the restriction endonuclease BtgI and identified by TBE-PAGE. The 120A and 150A polyA tails of pmRVacSL and the four mutants pmRVacM were still able to replicate stably (as shown in Figure 4).

[0113] Example 4: Correct proportion of polyA tail in pmRVacSL plasmid

[0114] (1) The pmRVacSL plasmid was digested with restriction endonucleases NcoI and SapI, and the purified linearized pmRVacSL backbone was obtained by gel recovery kit.

[0115] (2) Gene synthesis of plasmids containing polyA tails of different lengths, digestion of plasmids containing pure polyA tail fragments of different lengths using restriction endonucleases NcoI and SapI, and obtaining purified DNA fragments containing polyA tails of different lengths using a gel extraction kit.

[0116] (3) The purified linearized pmRVacSL backbone and the purified DNA fragments containing polyA tails of different lengths were ligated by T4 ligase reaction to obtain the reaction system of in vitro transcription vectors containing polyA tails of different lengths.

[0117] (4) Referring to steps (5) and (6) of Example 1, pmRVacSL plasmids with polyA tails of different lengths can be obtained.

[0118] (5) The correct proportion of the polyA tail of the pmRVacSL plasmid DNA was verified by TBE-PAGE gel and Sanger sequencing (Figure 5).

[0119] The foregoing has provided a detailed description of a plasmid backbone that improves the stability of polyadenylate tails, as provided by this invention. Specific examples have been used to illustrate the principles and implementation methods of this invention. The descriptions of the above embodiments are merely for the purpose of helping to understand the method and core ideas of this invention. It should be noted that those skilled in the art can make various improvements and modifications to this invention without departing from its principles, and these improvements and modifications also fall within the protection scope of the claims of this invention.

[0120] sequence list

Claims

1. An expression cassette, characterized in that, comprises, in sequence: a rop gene, a replicon ori, and a resistance gene; the rop gene, the replicon ori, and the resistance gene are connected by a connecting fragment.

2. The expression cassette of claim 1, wherein, the rop gene comprises a wild type or a mutant; the mutant is obtained after the wild type is subjected to any of the following: (I) removal of the initiation codon; or (II) mutation of the initiation codon into a termination codon.

3. The expression cassette of claim 1 or 2, wherein, the rop gene has: (1) a nucleotide sequence as shown in any of SEQ ID NO: 1 to SEQ ID NO: 3; or (2) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in (1), and a nucleotide sequence that is functionally identical or similar to the nucleotide sequence as shown in (1); or (3) a nucleotide sequence that is at least 80%, 85%, 90%, or 95% identical to the nucleotide sequence as shown in (1) or (2).

4. The expression cassette of any one of claims 1 to 3, wherein, the replicon ori comprises: a wild type or a mutant; the mutant is obtained after the wild type is subjected to mutation at position 442 of the nucleotide sequence.

5. The expression cassette of claim 4, wherein, the mutant comprises mutation of G at position 442 of the nucleotide sequence of the wild type into A.

6. The expression cassette of any one of claims 1 to 5, wherein, the replicon ori has: (4) a nucleotide sequence as shown in SEQ ID NO: 4 or SEQ ID NO: 5; or (5) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in (4), and a nucleotide sequence that is functionally identical or similar to the nucleotide sequence as shown in (4); or (6) a nucleotide sequence that is at least 80%, 85%, 90%, or 95% identical to the nucleotide sequence as shown in (4) or (5).

7. The expression cassette of any one of claims 1 to 6, wherein, the resistance gene comprises: a kanamycin resistance gene.

8. The expression cassette of any one of claims 1 to 7, wherein, the connecting fragment has: (7) a nucleotide sequence as shown in any of SEQ ID NO: 6 to SEQ ID NO: 10; or (8) a nucleotide sequence obtained by substitution, deletion, or addition of one or more bases to the nucleotide sequence as shown in (7), and a nucleotide sequence that is functionally identical or similar to the nucleotide sequence as shown in (7); or (9) a nucleotide sequence that is at least 80%, 85%, 90%, or 95% identical to the nucleotide sequence as shown in (7) or (8).

9. The expression cassette of any one of claims 1 to 8, wherein, the connecting fragment comprises: connecting fragment 1 to connecting fragment 4; the connecting fragment 1 is located at the 5' end of the rop gene; the connecting fragment 2 is located between the rop gene and the replicon ori; the connecting fragment 3 is located between the replicon ori and the resistance gene; the connecting fragment 4 is located at the 3' end of the resistance gene.

10. A recombinant plasmid characterized in that, comprises: the expression cassette of any of claims 1 to 9 and an acceptable genetic element.

11. A host, characterized in that, transforming and / or transfecting the recombinant plasmid of claim 10.

12. Use of the expression cassette of any of claims 1 to 9, the recombinant plasmid of claim 10, and / or the host of claim 11 in any of the following: (I) preparation of mRNA; and / or (II) preparation of an mRNA drug, preparation, or pharmaceutical combination; and / or (III) increasing the stability of the plasmid; and / or (IV) increasing the yield of the plasmid.

13. A product characterized by, comprising: the expression cassette of any one of claims 1 to 9, the recombinant plasmid of claim 10 and / or the host of claim 11.

Images