Affinity-enzyme linked assay for detection of bacterial toxins using desorption-ionization mass spectrometry

Abstract

This invention relates to a method for detecting the activity of a toxin produced by bacteria of the families Peptostreptococcaceae or Clostridiaceae using mass spectrometry, which comprises the following steps: a) providing a planar surface suitable for mass spectrometry measurement, with attached affinity molecules; b) incubating the planar surface from step a) with the substrate of the toxin to be detected, to bind the substrate to the affinity molecules; c) subsequently incubating the planar surface from step b) with a sample in which the active toxin is to be detected, in the presence of a modification compound, and incubating it for a time sufficient for the substrate to react with the modification compound in the presence of the active toxin, if present in the sample, to form a modified substrate if the active toxin is present in the sample; d) removing the remnants of the sample; e) subjecting the (modified) substrate on the planar surface to matrix-assisted laser desorption / ionization, ionizing it and subsequently measuring the mass spectrum of the (modified) substrate; f) analyzing the measured mass spectrum, such that if the measured mass spectrum corresponds to the non-modified substrate, the active toxin is not present, and if the measured mass spectrum corresponds to the modified substrate or a mixture of the modified and non-modified substrate, then the active toxin is present in the sample. The invention further relates to a device for the soft landing of affinity molecule ions onto a planar surface suitable for mass spectrometry for carrying out step a) of the above method.

Description

[0001] AFFINITY-ENZYME LINKED ASSAY FOR DETECTION OF BACTERIAL TOXINS USING DESORPTION-IONIZATION MASS

[0002] SPECTROMETRY

[0003] Field of Art

[0004] The invention relates to determining the activity of toxins produced by anaerobic bacteria causing pathological intestinal infections. The detection test uses desorption ionization mass spectrometry to monitor mass changes caused by glycosylation of a protein substrate. The protein substrate from the Rho family (RhoA, Rac, Rap, Cdc42) is immobilized on a planar affinity surface that is selective for it and is as well compatible with use in mass spectrometry.

[0005] Background Art

[0006] Clostridium difficile is an anaerobic Gram-positive, spore-forming bacillus. This microorganism is a serious pathogen causing intestinal infections with a diverse clinical presentation ranging from asymptomatic cases, mild or moderate diarrhea, to severe pseudomembranous colitis and lifethreatening toxic megacolon. Because C. difficile spores are resistant and can survive in various conditions, and can withstand high temperatures, oxygen, and common disinfectants, they persist in healthcare facilities. The bacterium is often responsible for severe healthcare-associated infections. As is common with other bacterial pathogens, the spread of C. difficile can be accelerated by epidemic and hypervirulent clones, such as the clonal line RT027, which causes outbreaks in hospitals with increased severity and mortality. A decisive virulence factor is the production of secreted toxins, TcdA, TcdB, and the binary toxin CDTab. TcdA and TcdB toxins belong to the family of large clostridial toxins (LCT), which also includes the hemorrhagic toxins of Paeniclostridium sordellii and the cytotoxin C. perfringens - TpeL. Toxins in this family are typically large proteins (e.g. TcdA 308 kDa, TcdB 270 kDa) containing domains for binding to the host cell followed by translocation. They also contain an N-terminal glucosyltransferase domain responsible for inactivating members of the Ras / Rho family of small GTPases. Inactivation of Ras / Rho GTPases by glucosylation leads to disruption of the actin cytoskeleton, cellular adhesion, cytokine secretion in epithelial and immune cells, and ultimately results in cell death. TcdA and TcdB toxins can modify Ras / Rho molecules, i.e. RhoA, RhoB, RhoC, RhoG, Rael, Cdc42, and TC10.

[0007] Clinical laboratory diagnostics of C. difficile in patients with suspected Clostridioides difficile infection (CDI) is based primarily on enzyme immunoassays (e.g. microwell EIA, lateral flow EIA) detecting TcdA, TcdB, and glutamate dehydrogenase (GDH) as an antigen produced by both toxigenic and non-toxigenic strains. Commercially available molecular genetic tests for detecting the genes for TcdA, TcdB, CDTab, and GDH have also been introduced. Traditional microbiological testing or biotyping by MALDI is possible, but often complicated due to problems associated with culturing anaerobic bacteria from the Clostridiaceae family. Because of the large variability in C. difficile toxins among different strains, which vary considerably in severity, it is not sufficient merely to detect the presence and concentration of the produced toxin; it is also necessary to determine its activity, i.e. the potency of the free toxin in the stool.

[0008] Similar toxins causing gastrointestinal infections can also be produced by other bacteria (besides C. difficile), e.g. by P sordellii. For many of these, no commercial ELISA test is available, and even highly sensitive PCR can lead to erroneous identification of the true pathogen, resulting in inappropriate therapy and increased healthcare costs. Moreover, virulence genes, including those encoding toxins, can spread among microbial populations via horizontal transfer, complicating diagnosis based on the identification of microorganisms by molecular biology methods (Bumham et al., 2013). Specific detection of the active toxins TcdA and TcdB is therefore essential to confirm the correct diagnosis of infections caused by C. difficile.

[0009] Another motivation for detecting the active free toxin is the proper monitoring of modern biological therapy for C. difficile infection, which is based on the neutralization of free toxins by monoclonal antibodies (e.g. Bezlotoxumab). These therapies specifically target the toxins, so their efficacy can only be monitored by measuring the decrease in toxin activity in the sample. This approach is consistent with symptom-based microbiological diagnosis, as it detects the true toxigenic activity on natural substrates such as Ras / Rho family proteins. This specific approach aimed at detecting free active toxin helps to eliminate the risk of an incorrect therapeutic approach. In the past, a cytotoxicity neutralization cell culture test using stool filtrate was used for the direct detection of the toxigenic activity of clostridial toxins. Several cell lines, such as human foreskin fibroblasts, human diploid fibroblasts, Vero cells, McCoy cells, MRC-5 lung fibroblasts, and Hep2 cells, were used to detect the cytopathic effect caused by the toxin, but the reported sensitivity of the cell culture cytotoxicity neutralization test varies in reliability and has practical limitations. Other techniques have also been described, including Western blot, flow cytometry, Rael glucosylation assay, a luminometric test (Epic), a transepithelial electrical resistance (TER) assay, or a sulforhodamine B assay, as mentioned in the review article (Cox et al. DOI: 10.5772 / 68127). However, these tests either depend on cell culture or involve time-consuming procedures such as electrophoretic detection with immunoblotting (“Western blot”).

[0010] Consequently, it can be inferred that clinical practice needs a simple and reliable test that would detect toxin activity in vitro without the need to monitor or measure its cytotoxicity in a cell -based test.

[0011] Disclosure of the Invention

[0012] The aim of the present invention is to eliminate the drawbacks of the current prior art approaches and to develop a method that enables a rapid determination of enzymatically active toxins rather than merely measuring toxin molecule concentration or detecting the presence of bacteria. The determination of toxins according to the present invention is based on desorption / ionization mass spectrometry (DI-MS) used to monitor the effect of toxins on a substrate. The substrate undergoes a chemical change due to the enzymatic activity of the toxins. Toxin activity leads to modification of the recombinantly prepared substrate, which can be monitored as a change in the molecular mass of the substrate by DI-MS. Thus, the test enables direct detection of the actual activity of cytotoxic toxins, especially of TcdA and TcdB.

[0013] The invention is based on monitoring the enzymatic activity of the toxin, wherein the toxin present in the sample during measurement modifies the protein substrate by binding glucose, which is added to the analyzed solution in the form of UDP-a-D-glucose. This resulting modification can be monitored by desorption / ionization mass spectrometry as a difference in molecular mass when comparing mass spectra measured for the modified and non-modified (control) substrate. The substrate, which can be modified by the toxin, is not present in the test as a free component in the solution but is immobilized on a planar surface compatible with mass spectrometry via the affinity interaction between a tag present on the substrate and an affinity partner immobilized on the planar surface suitable for mass spectrometry. The planar surface suitable for mass spectrometry (typically a microscope slide, a MALDI plate, and / or a MALDI chip) is prepared prior to use by ambient ion soft landing, preferably at atmospheric pressure, which allows the planar surface to be modified with an affinity molecule that specifically binds the substrate.

[0014] The planar surface compatible with mass spectrometry can be, for example, a microscope slide provided on its surface with an ITO layer (a mixed indium-tin oxide), a surface suitable for desorption electrospray ionization (DESI), or any other surface compatible with MALDI (matrix- assisted laser desorption / ionization) mass spectrometers routinely used in clinical laboratories for microorganism identification, a MALDI plate, and / or a MALDI chip. The thickness of the ITO layer on the surface of the microscope slide is preferably in the range of from 10 to 1000 nm, determined on cross-section using SEM (Scanning Electron Microscopy).

[0015] The operating procedure of the enzyme-affinity assay according to the present invention is as follows: A solution of the substrate of the toxin to be determined is applied at a designated position or into a small well on the planar surface that is compatible with mass spectrometry, which is modified with an affinity molecule via ambient ion soft landing technology. After incubating the substrate with the affinity molecule on the surface, followed by washing and drying the surface, a sample to be determined (typically in the form of a solution), containing the modification compound, is applied to the surface thus enriched with the substrate bound to the affinity molecule. Preferably, UDP-a-D-glucose is used as the modification compound. A stool extract is a typical sample to be determined. If a toxin is present in the sample, the substrate is modified (by glucose binding). After the reaction, the planar surface with the sample is washed to remove any remaining sample and allowed to dry. After depositing a matrix, it is placed into the ion source of the mass spectrometer, where the substrate molecule undergoes desorption, ionization, and measurement in the mass spectrometer. From the ratio of signals in the recorded mass spectrum corresponding to the non-modified and modified (by glucose binding) substrate, the presence and activity of the toxin can be determined.

[0016] One object of the present invention is a method of detection of the activity of toxins produced by bacteria of the Clostridiaceae or Peptostreptococcaceae families using mass spectrometry, wherein said method comprises the following steps: a) providing a planar surface suitable for mass spectrometry with immobilized affinity molecules for binding a substrate of a toxin to be detected, b) incubating the planar surface with the substrate of a toxin to be detected, resulting in a planar surface suitable for mass spectrometry with the immobilized affinity molecules and with the substrate of a toxin to be detected bound to them, c) subsequently, incubating the planar surface from step b) with a sample in which the active toxin is to be detected, in the presence of a modification compound, and incubating said planar surface for a time sufficient to allow the substrate to react with the modification compound in the presence of the active toxin, if present in the sample, to form a modified substrate if the active toxin is present in the sample, d) removing the remnants of the sample, e) subjecting the (modified) substrate on the planar surface to matrix-assisted laser desorption / ionization (MALDI), ionizing it and subsequently measuring the mass spectrum of the (modified) substrate, f) analyzing the recorded mass spectrum from step e) by comparing it with the spectra of the non-modified and / or modified substrate, wherein if the measured mass spectrum corresponds to the non-modified substrate, the active toxin is not present in the sample, and if the measured mass spectrum corresponds to the modified substrate or a mixture of the modified and / or nonmodified substrate, then the active toxin is present in the sample.

[0017] In a preferred embodiment, the incubation in step c) takes place in the presence of a mixture of protease inhibitors, which inhibit a large number of proteases present in real samples (such as stool samples), which would otherwise distort the assay results. The mixture of protease inhibitors can be a mixture inhibiting serine proteases, cysteine proteases, and metalloproteases (e.g. cOmplete Mini EDTA free or a mixture of phenylmethyl sulfonyl fluoride (0.1 mM), iodoacetamide (0.1 mM), pepstatin (1 mM), and 1,10-phenanthroline (1 mM)).

[0018] The modification compound is a co-substrate for the toxin substrate. The modification compound is preferably uridine-5'-diphospho-a-D-glucopyranoside (UDP-a-D-glucose). UDP-a-D-glucose is attached in the form of glucose to the substrate due to the enzymatic activity of the toxin to be detected. In the incubation solution in step c), the modification compound is present in excess (relative to the molar amount of the substrate), for example as part of the buffer used. In one embodiment, the buffer suitable for step c) of the above method may be a reaction buffer selected from the group comprising Good’s buffers, HEPES buffer, Tris buffer, TAPSO buffer, MOPS buffer, and glycylglycine buffer, enriched with the aforementioned modification compound.

[0019] The toxin to be detected is preferably selected from cytotoxic toxins produced by bacteria of the Peptostreptococcaceae or Clostridiaceae families, preferably the toxin is TcdA and / or TcdB produced by bacteria of the Peptostreptococcaceae or Clostridiaceae families. Said toxins catalyze the reaction of the substrate with the modification compound.

[0020] The substrate of the toxin to be detected is a protein selected from the group comprising GTP- binding proteins, in particular Rho, Rac, Rap, and Cdc42 (Cell division control protein 42). More preferably, the substrate is a Rho protein, most preferably RhoA or RhoB.

[0021] However, proteins from the Rho family (RhoA, Rac, Rap, and Cdc42) are insoluble in water, so they cannot be used directly as reaction substrates; their solubilization must first be ensured. This is achieved by adding a suitable tag, in this case a GST-Tag. This tag is added by cloning the gene of the substrate protein into the pGEX expression plasmid, e.g. into pGEX-6PI. Unlike other common vectors, this vector allows the direct addition of a GST-Tag. The cloned sequence, however, must not contain a stop codon. Experimentally, it was found that the GST-Tag ensures solubilization of Rho, Rac, Rap, and Cdc42 proteins, subsequently facilitates their binding to the affinity surface, and at the same time does not affect the resulting conformation of the substrate that would prevent toxin-induced glucosylation.

[0022] Therefore, it is particularly advantageous to prepare the substrate of the toxin to be detected using the pGEX expression plasmid, which provides a GST-Tag bound to the toxin substrate, thereby also ensuring its solubility in step b), during which incubation of the planar surface with said substrate takes place. If the substrate were not dissolved in the reaction mixture of step b), efficient binding of the toxin substrate to the planar surface could not be guaranteed, and the sensitivity of the method could thereby be significantly reduced.

[0023] In one embodiment, the affinity molecule is an affinity protein (i.e. a protein capable of affinity interaction with the substrate), and step a), providing a planar surface suitable for mass spectrometry with affinity molecules attached to the planar surface, can be carried out using the ambient ion soft landing of said affinity protein.

[0024] The molecule of the affinity protein capable of binding the substrate molecule is deposited directly on the planar surface compatible with mass spectrometry. After being deposited, the protein from the Rho, Rac, Rap, Cdc42 group is then available for the enzymatic reaction with the toxin to be detected. According to the present invention, a key advantage of the affinity surface for mass spectrometry is the immobilization of the affinity protein molecule directly on the surface compatible with mass spectrometry, without requiring additional fixation or the addition of other support substances to maintain the native structure of the protein substrate on the surface.

[0025] The affinity protein molecule is preferably selected from the group comprising streptavidin, avidin, neutravidin, an antibody against the tag formed by amino acids 98-106 of human influenza hemagglutinin (hereafter referred to as an anti-HA-tag antibody), an antibody against the Spot-tag (hereafter referred to as an anti-Spot-tag antibody), a single-domain antibody against the Spot-tag (referred to hereafter as an anti-Spot-tag single-domain antibody), a single-domain camelid antibody against the C-tag (referred to hereafter as an anti-C-tag single-domain camelid antibody), an antibody against the polypeptide tag derived from the c-myc gene (referred to hereafter as an anti-MYC-tag antibody), a single-domain antibody against the polypeptide tag derived from the c-myc gene (referred to hereafter as an anti-MYC-tag single-domain antibody), an antibody against the Flag-tag (referred to hereafter as an anti-Flag-tag antibody), an antibody against the histidine tag (an amino acid sequence containing 6 to 8 histidines, hereafter referred to as an anti- His-tag antibody), and an antibody against the histidine tag conjugated with phycoerythrin (hereafter referred to as an anti-PE-His-tag antibody).

[0026] Spot-tag is a sequence of 12 amino acids: PDRVRAVSHWSS (SEQ. No. 1).

[0027] In a preferred embodiment, the anti -His-tag antibody or the anti-PE-His-tag antibody is connected to sepharose for chelating affinity chromatography (“immobilized metal ion affinity chromatography,” referred to hereafter as IMAC sepharose).

[0028] The principle of this step lies in depositing the affinity molecule directly onto the planar surface compatible with mass spectrometry using a soft-landing device for ions. The device uses electrospray, an inert carrier gas, and a heated chamber to convert the affinity molecule from a solution into a form of desolvated ions. The desolvated ion formed by electrospray ionization from the affinity protein molecule lands on the surface compatible with mass spectrometry, its charge is neutralized, and it is immobilized on the surface in its neutral molecular form. An important advantage of the invention is the fact that preparing a planar surface suitable for mass spectrometric measurement with affinity protein molecules attached to said planar surface (the affinity plate) takes place at atmospheric pressure, in a short time (on the order of a few minutes), and with high efficiency of transferring the affinity protein molecule onto the surface.

[0029] In a preferred embodiment, the preparation of the planar surface suitable for mass spectrometry measurement intended for attaching the affinity protein molecule for substrate binding in step a) is performed by ambient ion soft landing of the affinity protein molecule (multiply charged proteins without their solvation shell) onto the planar surface, preferably at atmospheric pressure. The electrospray ionization is carried out in a closed space, preferably in a three-way junction, into which carrier gas is supplied from one inlet at a pressure in the range of 0.05 to 0.5 Pa, and at the second inlet, the stock solution of the affinity protein molecule is delivered, to which a voltage in the range of 200 to 8000 V is applied. The output of the three-way junction carries the formed charged aerosol, which is then introduced into the evaporation space heated to a temperature in the range of from 30 to 80 °C. The dried aerosol is deposited onto the mass spectrometry surface positioned behind the evaporation space. The mass spectrometry surface is connected to a second high-voltage source of the same magnitude but opposite polarity to that used for electrospray ionization. Between the evaporation space and the mass spectrometry surface, there may be an additional element, e.g. a mask optionally connected to the second high-voltage source, which allows the ion beam to focus and create an array of positions of the biomolecule-modified surface, thereby increasing the efficiency of the planar surface modification. Typically, an inert gas such as nitrogen, helium, or argon is used as the carrier gas. The concentration of the stock solution of the affinity protein to be sprayed is usually in the range of from 0.5 to 50 pM, and the solvent is preferably selected from the group comprising electrospray buffers - e.g. ammonium bicarbonate or ammonium acetate.

[0030] The high voltage applied to the mask is used for further focusing the ion beam and improving the efficiency of surface modification.

[0031] In one embodiment, step b) of binding the substrate of the toxin to be detected onto the surface coated with the affinity molecule obtained in step a) can be carried out as follows. The substrate in solution is deposited on the planar surface modified with the affinity molecules and incubated for a period sufficiently long to allow the substrate to bind to the affinity molecules. Incubation is preferably performed in a device that prevents the drying of droplets during incubation, more preferably in a so-called humidity chamber. This step can be repeated. The advantage of a second application of the substrate is to increase its amount, which facilitates detection after reaction with the toxin.

[0032] After incubation, a rapid washing step is performed with a binding / washing buffer and then with deionized water. The binding / washing buffer is usually selected from the group comprising buffers listed in Good’s list of buffers, preferably HEPES (4-(2-hy droxy ethyl)- 1 -piperazineethanesulfonic acid) buffer, Tris (tris(hydroxymethyl)aminomethane) buffer, MOPS (3-(N- morpholin)propanesulfonic acid) buffer, glycylglycine buffer, or TAPSO (3-[N- Tris(hydroxymethyl)methylamino]-2-hydroxypropanesulfonic acid) buffer, possibly modified by the addition of divalent metal ions (for example Mg2+, Mn2+or Ca2+), nonionic detergents, monovalent ions of alkali metals, and / or reducing agents (for example dithiothreitol or tris(2- carboxyethyl)phosphine). The surface is then allowed to dry, preferably at room temperature.

[0033] The substrate is typically a protein that is a natural substrate for the active toxin. In some embodiments, the substrate may be a recombinant protein containing the natural protein substrate and a tag. Preferably, the toxin substrate to be detected is selected from the group consisting of GTP -binding proteins, namely Rho, Rac, Rap, and Cdc42, advantageously modified with a GST- Tag to increase its solubility. GST-Tag is a 26 kDa protein, Glutathione S-Transferase (GST), used for protein separation and purification, which is usually attached to the protein’s N-terminus.

[0034] To achieve the binding interaction between the affinity molecules immobilized on the surface and the protein substrate, various tags can be used in combination with corresponding affinity molecules. Examples of tag combinations that can be attached to the substrate, along with the corresponding affinity molecules, include:

[0035] 1 / tag: Avi-tag; immobilized affinity molecules on the surface: avidin, streptavidin, or neutravidin;

[0036] 2 / tag: Flag-tag; immobilized affinity molecules on the surface: anti-Flag-tag antibody;

[0037] 3 / tag: MYC-tag; immobilized affinity molecules on the surface: anti-MYC-tag antibody or anti- MYC-tag single-domain antibody;

[0038] 4 / tag: a tag composed of amino acids 98-106 of human influenza hemagglutinin (HA-tag); immobilized affinity molecule on the surface: anti-HA-tag antibody;

[0039] 5 / tag: Spot-tag; immobilized affinity molecules on the surface: anti-Spot-tag antibody or anti- Spot-tag single-domain antibody;

[0040] 6 / tag: C-tag; immobilized affinity molecule on the surface: single-domain anti-C-tag camelid antibody;

[0041] 7 / tag: Strep-tag; immobilized affinity molecules on the surface: streptavidin;

[0042] 8 / tag: histidine tag (hereafter referred to as His-tag); immobilized affinity molecules on the surface: anti-His-tag antibody or anti-PE-His-tag antibody.

[0043] Said Avi-tag is a sequence of 15 amino acids that recognizes biotin, which binds to lysine within this sequence.

[0044] Said C-tag is a peptide bound by a single-domain camelid antibody.

[0045] Said His-tag is a peptide with an amino acid sequence containing 6 to 8 histidines, preferably conjugated with phycoerythrin (PE-His-tag).

[0046] In one embodiment, step c) of enzymatic modification of the substrate by the active toxin to be detected in the sample is carried out as follows:

[0047] The reaction between the toxin and the substrate takes place in a reaction buffer containing from 0.5 to 50 wt. % stool sample. It is allowed to incubate on the planar surface suitable for mass spectrometry with a sandwich of affinity molecule and substrate in a device used to prevent droplet drying during incubation, preferably in a humidity chamber, for a maximum of 4 hours, preferably from 0.5 to 2.5 hours, more preferably from 1 to 2 hours, at temperatures in the range of from 30 to 40 °C. The reaction buffer is usually a buffer from Good’s list of buffers, as described above, preferably HEPES, Tris, TAPSO, MOPS, or glycylglycine buffer, enriched with the modification compound, which can be, for example, UDP-a-D-glucose. In one embodiment, step d) of removing remnants of the sample from the planar surface compatible with mass spectrometry involves washing the planar surface with a washing buffer, followed by washing either with deionized water or a suitable buffer. This step removes residues of the sample solution from the planar surface that could interfere with detection by mass spectrometry. The washing buffer is preferably a buffer from Good’s list of buffers, more preferably a HEPES buffer, Tris buffer, TAP SO buffer, MOPS buffer, or glycyl glycine buffer. It is advantageous that the final washing step before applying the MALDI matrix is performed either with deionized water or a volatile buffer compatible with mass spectrometry. Preferably, the buffer compatible with mass spectrometry is selected from the group comprising ammonium bicarbonate and ammonium acetate.

[0048] In one embodiment, step e) of desorption, ionization, and mass spectrometry detection of the (modified) substrate is performed directly from the planar surface compatible with mass spectrometry (e.g. a MALDI chip). Any desorption ionization technique can be used. The planar surface compatible with mass spectrometry is placed into the ion source of the mass spectrometer, which may be at atmospheric pressure or under vacuum, depending on the type of mass spectrometer. If the ion source requires a vacuum, sufficient time for pumping down must be considered before measurement. Some ionization modes may require coverage of the sample position on the planar surface with a compound promoting ionization (e.g. a MALDI matrix), while other ionization methods may act directly on the sample. Depending on the specific desorption-ionization technique, an energetic beam of laser light, charged particles, charged droplets, or fast atoms is directed at the sample position, and mass analysis is performed, resulting in a recorded mass spectrum.

[0049] In one embodiment, step f) involves analyzing the mass spectrum of the modified substrate compared to the mass spectrum of the non-modified substrate. If the measured mass spectrum corresponds to the non-modified substrate, the active toxin was not present in the sample where it was to be detected. If the measured mass spectrum corresponds to the modified substrate or a mixture of the modified and non-modified substrate, the active toxin to be detected was present in the sample.

[0050] The molar mass of the modified substrate increases by the molar mass of the modification compound residue that was attached to the substrate, which is detected in the mass spectrum at a higher m / z value than that of the non-modified substrate. Step a) of the above-described method (attaching affinity molecules to the planar surface suitable for mass spectrometry) can in one embodiment be carried out by ambient ion soft landing of the affinity protein, preferably at atmospheric pressure. The stock solution of the affinity molecule, typically a buffered (e.g. ammonium bicarbonate or ammonium acetate) solution of an affinity protein such as avidin, streptavidin, neutravidin, etc., is converted into an aerosol by electrospray from a spray nozzle, preferably a microneedle, connected to a high-voltage source. The aerosol is then dried by passing through an evaporation space and, preferably, through a mask connected to the second high-voltage source. Depending on the shape of the mask, beams of desolvated ions of the affinity molecules then fall onto the planar surface suitable for mass spectrometry, usually a microscope slide provided on its surface with an ITO layer (a mixed indium-tin oxide), a surface suitable for desorption electrospray ionization (DESI), or any other surface compatible with MALDI mass spectrometers routinely used in clinical laboratories to identify microorganisms, such as a MALDI plate and / or a MALDI chip, where, if not connected to the second high-voltage source via the mask, it is connected directly to the planar surface suitable for mass spectrometry.

[0051] In one embodiment, the device for ambient ion soft landing of an affinity molecule onto a planar surface suitable for mass spectrometry to carry out step a) of the method according to the invention comprises a pump, preferably a microsyringe pump, which is connected to a reservoir containing the solution of the affinity molecule. The reservoir for the affinity molecule solution can be, for example, a syringe that can be driven by the microsyringe pump. The connection between the pump and the reservoir can be direct or via a piston. The outlet of the reservoir for the affinity molecule solution (e.g. the syringe’s outlet) is provided with a conductive part, which is connected to the first high-voltage source. The outlet of the reservoir for the affinity molecule solution is further connected, for example via a tube, to a distributor. The distributor is also connected to the carrier gas inlet and to a micro-spray nozzle (e.g. a needle), which is configured for spraying the affinity molecule solution as an aerosol into the evaporation space and optionally a mask, onto the planar surface suitable for mass spectrometry.

[0052] The distributor serves to mix the stock solution of the affinity molecule with the carrier gas.

[0053] The optimal distance between the micro-spray nozzle and the evaporation space is in the range of from 0.5 to 3 cm. The evaporation space is preferably a heated desolvation tube. The desolvation tube is preferably heated to a temperature in the range of from 30 to 80 °C, more preferably from 40 °C to 60 °C.

[0054] An optional mask can preferably be placed downstream from the evaporation space. The optimal distance between the evaporation space and the mask is in the range of from 0.5 to 15 cm. If the distance between the evaporation space and the mask is too large, beam divergence occurs; if it is too short, final drying is insufficient.

[0055] In one embodiment, the mask is non-conductive. In this embodiment, the planar surface suitable for mass spectrometry is connected to the second high-voltage source.

[0056] In another embodiment, the mask is conductive and connected to the second high-voltage source. In one embodiment, the mask is independent (separate). In this embodiment, the optimal distance between the mask and the planar surface suitable for mass spectrometry is in the range of from 0.5 to 15 cm.

[0057] In one embodiment, the mask is connected directly (e.g. glued) to the planar surface suitable for mass spectrometry.

[0058] Another subject matter of the present invention is also the use of the method for detection of activity of cytotoxic toxins produced by Peptostreptococcaceae and Clostridiaceae families for in vitro detection of infection caused by bacteria of the Peptostreptococcaceae or Clostridiaceae families.

[0059] Brief Description of Drawings

[0060] Fig. 1 : A schematic depiction of a device for the ambient ion soft landing of an affinity molecule onto a planar surface suitable for mass spectrometry.

[0061] Fig. 2: Relevant parts of plasmid sequences for the preparation of recombinant RhoA protein with various tags: A) RhoA-Avi-tag plasmid (SEQ. NO. 2), used in Example 3; B) RhoA-Flag-tag plasmid (SEQ. NO. 5), used in Example 5; C) RhoA-MYC-tag plasmid (SEQ. NO. 7), used in Example 6; D) RhoA-HA-tag plasmid (SEQ. NO. 3), used in Example 4; E) RhoA-Spot-tag plasmid (SEQ. NO. 9), used in Example 7; F) RhoA-C-tag plasmid (SEQ. NO. 10), used in Example 8.

[0062] Fig. 3: Amino acid sequences of the tags of the recombinant RhoA protein: A) Flag-tag (SEQ. NO. 6), used in Example 5; B) MYC-tag (SEQ. NO. 8), used in Example 6; C) HA-tag (SEQ. NO. 4), used in Example 4; D) Spot-tag (SEQ. NO. 1), used in Example 7; E) His-tag (SEQ. NO. 11), used in Example 9.

[0063] Fig. 4: Top: Mass spectrum of the negative control; bottom: Mass spectrum of the toxin-positive sample, as described in Example 2. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line. Fig. 5: Top: Negative control spectrum; bottom: Mass spectrum of the toxin-positive sample, as described in Example 3. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0064] Fig. 6: Top: Negative control spectrum; bottom: Mass spectrum of the toxin-positive sample, as described in Example 4. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0065] Fig. 7: Top: Negative control spectrum; bottom: Mass spectrum of the toxin-positive sample, as described in Example 5. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0066] Fig. 8: Top: Negative control spectrum; bottom: Mass spectrum of the toxin-positive sample, as described in Example 6. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0067] Fig. 9: Top: Negative control spectrum; bottom: Mass spectrum of the toxin-positive sample, as described in Example 7. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0068] Fig. 10: Top: Negative control spectrum; bottom: Mass spectrum of the toxin-positive sample, as described in Example 8. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0069] Fig. 11 : Top: Negative control spectrum; bottom: Mass spectrum of the toxin-positive sample, as described in Example 9. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0070] Fig. 12: Schematic depiction of a device used to prevent droplet drying on the planar surface during incubation (a humidity chamber).

[0071] Examples

[0072] In the following examples, toxin B is mentioned as the most common toxin of Clostridioides difficile. The method works analogously for other toxins, whose substrates are RhoA family cytoskeletal proteins (e.g. toxin A), as well. The efficacy of the method has also been verified using said toxins.

[0073] Example 1 : A device for ambient ion soft landing of affinity protein molecules onto a planar surface suitable for mass spectrometry

[0074] The device for ambient ion soft landing of an affinity protein molecule onto a planar surface suitable for mass spectrometry, used in step a) of the claimed method, is depicted in Fig. 1. The device comprises a pump 2, preferably a microsyringe pump, connected to a piston 3, which is further connected to a syringe 4. The syringe 4 is configured to hold a stock solution of the affinity molecule and is provided with a conductive part 9 connected to the first high-voltage source 8. A tube 5 connects the conductive part 9 of the syringe 4 with a distributor 1_. The distributor 1 is also connected to the supply 7 of carrier gas, with the possibility of preheating, and to the micro-spray nozzle 6, preferably a micro-spray needle. The carrier gas is supplied to the device preferably at a pressure in the range of from 0.05 to 0.5 Pa. The micro-spray nozzle 6 is configured to spray the affinity molecule solution in the form of droplets, which further pass through the evaporation space 10 and a mask 13, which is connected to the second high-voltage source 11, onto the planar surface 12 suitable for mass spectrometry.

[0075] Thus, the stock solution of the affinity molecule passes from the syringe 4 into the micro-spray nozzle 6. The aerosol formed by spraying is then converted into a dry aerosol (a beam of desolvated ions) by passing through the evaporation space 10, which can optionally be heated (preferably to 30 to 80 °C), and through the mask 13 to the planar surface 12 suitable for mass spectrometry. The planar surface 12 suitable for mass spectrometry may be, for example, a microscope slide bearing an ITO layer on its surface, a surface compatible with MALDI mass spectrometers routinely used in clinical laboratories for microorganism identification, a DESI surface, a MALDI plate, and / or a MALDI chip. The high-voltage sources 8, 11 are such that they can provide a voltage in the range of from 200 to 8000 V. The carrier gas is usually nitrogen, argon, or dry air.

[0076] The high voltage applied to the conductive part 9 of the syringe 4 serves to generate the charged aerosol.

[0077] The high voltage applied to the mask 13 serves to further focus the ion beam and increase the efficiency of modifying the planar surface by creating an array of positions with modified affinity molecules. The mask 13 is not an essential technical feature of the described device; the dry aerosol can fall directly from the evaporation space 10 onto the planar surface 12. If the mask 13 is not part of the device, then the second high-voltage source 11 is connected to the planar surface 12. The evaporation space 10 was a heatable desolvation tube.

[0078] Example 2 : Detection of TcdB by monitoring glucosylation of the RhoA substrate labeled with Avi- tag

[0079] In this example, a recombinant RhoA protein labeled with an Avi-tag was used as a suitable substrate for detecting the enzymatic activity of the toxin TcdB. RhoA is commercially available and can be modified with various tags, and the corresponding partner affinity molecule can be immobilized on the surface 12 for mass spectrometry. In this example, neutravidin was used as the affinity molecule, and the RhoA protein was labeled with an Avi-tag to create binding interactions between neutravidin immobilized on the planar surface 12 compatible with mass spectrometry and the RhoA protein substrate.

[0080] An ITO-glass planar surface compatible with mass spectrometry (a MALDI chip) was prepared by electrospray deposition of dry ions landing on surface 12 for 10 minutes using the apparatus described in Example 1, according to the following procedure:

[0081] • Syringe pump 2 flow rate: 1 pl / min

[0082] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1500 V

[0083] • Temperature of the tubular evaporation space 10: 40 °C

[0084] • Voltage of the second high-voltage source 11 on the mask 13: -1500 V

[0085] • Pressure at the carrier gas inlet 7: 0.25 MPa

[0086] • Carrier gas: nitrogen

[0087] • Carrier gas temperature: 40 °C

[0088] • Shape of the hole in mask 13 : circle with a diameter of 3 mm. A mask was prepared with an array of positions in the geometry and number of positions as required by the experiment, typically 2 or 4 rows with 8 or 12 positions each.

[0089] The syringe pump 2 was filled with a neutravidin solution (Thermo Fisher Scientific) at a concentration of 2 pmol / L in 50 mmol / L aqueous ammonium acetate solution, 30% by volume acetonitrile. The first high-voltage source 8 was connected to the conductive part 9 of the syringe 4 containing the stock solution, which was connected via capillary tube 5 to the distributor L The neutravidin stock solution was delivered via the syringe pump 2 and piston 3 into the distributor 1, where it was electrosprayed from the micro-spray needle 6 under the influence of high voltage and pressurized carrier gas from inlet 7, forming a charged aerosol. The formed charged aerosol was introduced into the tubular evaporation space 10 (5 mm diameter, 10 cm length), where it was dried and then continued through the mask 13 connected to the second high-voltage source 11 in the direction of the MALDI chip (planar surface 12) made of stainless steel. After completion of the process, both high-voltage sources 8 and 11 were switched off, and the planar surface 12 was washed with water. Using this method, 480 pmol of neutravidin was used, forming an affinity molecule layer of neutravidin with a configuration in a circle of diameter given by the mask (3 mm).

[0090] A commercially available recombinant RhoA protein (Abeam) was biotinylated using a commercially available kit (Abeam). Onto each position of the planar surface 12 with the neutravidin layer, 1 pl of the RhoA solution with Avi-tag at a concentration of 0.5 g / L was applied and incubated in a humidity chamber (a device to prevent droplet drying during incubation, as described in Example 10) for 30 minutes. After incubation, a rapid wash was performed with a solution containing 50 mM triethanolamine hydrochloride, 12 mM MgCh, 0.25 mM n-dodecyl-P- D-maltoside, pH 7.5, followed by washing with deionized water. The planar surface 12 was then dried at room temperature. Another 1 pl of the same RhoA solution with Avi-tag was applied again, and the surface was washed and allowed to dry at room temperature, thus creating the planar surface 12 suitable for mass spectrometry with recombinant RhoA bound to immobilized neutravidin. In total, 30 pmol of RhoA (substrate protein) was deposited on the planar surface 12 suitable for mass spectrometry.

[0091] A stool extract in the following reaction buffer: 50 mM triethanolamine hydrochloride, 12 mM MgCh, 7 mM guanosine diphosphate (GDP), 1.5 mM uridine-5'-diphospho-a-D-glucopyranoside (UDP-a-D-glucose), 0.05% n-dodecyl-P-D-maltoside with a cocktail of protease inhibitors (cOmplete Mini EDTA free, pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to obtain the following 10x dilution series: from 500 to 0.05 pg TcdB / ml.

[0092] Each concentration of the sample was applied (1 pl) onto a position on the planar surface 12 compatible with mass spectrometry bearing RhoA-Avi-tag as the substrate, and left to incubate in the humidity chamber (the device described in Example 10) for 30 to 60 minutes at room temperature. UDP-a-D-glucose was used as the modification compound.

[0093] After incubation, the MALDI chip was washed, in this case with the aforementioned washing buffer (a solution containing 50 mM triethanolamine hydrochloride, 12 mM MgCh, 0.25 mM n- dodecyl-P-D-maltoside, pH 7.5), followed by rinsing with deionized water.

[0094] In this example, MALDI-TOF (time of flight) mass spectrometry was used as the detection technique. The planar surface 12 (MALDI chip) with the completed incubation reaction was washed three times with the above washing buffer and twice with deionized water. The washed MALDI chip was allowed to dry at room temperature. Each position was overlaid with sinapinic acid matrix prepared according to the manufacturer’s standard protocol (Bruker), and the planar surface 12 compatible with mass spectrometry was placed into the MALDI-TOF mass spectrometer ion source for desorption, ionization, and mass spectrum measurement. The spectrum shown in Fig. 4 was obtained using standard settings. The mass spectrum from the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, indicated by the vertical line. Example 3 : Detection of TcdB by monitoring the glucosylation of recombinantly prepared RhoA labeled with Avi-tag

[0095] In this example, as in Example 2, an Avi -tag-lab eled RhoA protein was used as a substrate suitable for detecting the enzymatic activity of the toxin. Neutravidin was used as the affinity molecule immobilized on the planar surface compatible with mass spectrometry, and the RhoA labeled with Avi-tag was prepared by recombinant expression to achieve binding interactions between neutravidin immobilized on the surface and the RhoA protein substrate.

[0096] RhoA labeled with Avi-tag was prepared by recombinant expression. The expression of Avi-tag- labeled RhoA was based on (Self et al. doi: 10.1016 / 0076-6879(95)56003-3) with several modifications to obtain a recombinant protein labeled with the Avi-tag. The pGEX-6Pl expression plasmid was used because it contains a glutathione S-transferase (GST) tag, which serves as an affinity tag and aids in RhoA solubility. The sequence of human RhoA was modified with an Avi- tag linker required for successful biotinylation. Expression was carried out in LB medium using BL-21 Bir. A E. coli with the capacity for biotinylation under isopropyl P-D-l- thiogalactopyranoside (IPTG) induction. When the optical density at 600 nm (OD600) reached 0.9, IPTG and biotin were added, and the solution was incubated overnight at 18 °C. The purification step was performed on a gravity column with GST-sepharose. The GST-RhoA-Avi- tag product was cleaved overnight at 6 °C on the column using PreScission™ protease.

[0097] The relevant part of the plasmid pGEX-6P- 1 sequence for preparing the recombinant RhoA protein labeled with Avi-tag is shown as SEQ. NO. 2 in Fig. 2A. BAM-HI was used for the 5' end of the plasmid and SAL-I for the 3 ' end in plasmid preparation. gggcccctgggatccatggcagccattcgtaaaaaactggtgattgttggtgatggtgcatgtggtaaaacctgtctgctgattgtttttagcaa agatcagttcccggaagtttatgttccgaccgtgtttgaaaattatgtggccgatattgaagtggatggtaaacaggttgaactggcactgtgg gataccgcaggtcaagaggattatgatcgtctgcgtccgctgagctatcctgataccgatgttattctgatgtgcttcagcattgatagtccgga tagcctggaaaatattccggaaaaatggacaccggaagtgaaacatttttgtccgaatgttccgattattctggtgggcaacaaaaaagatctg cgcaatgatgaacatacccgtcgtgaactggccaaaatgaaacaagaaccggttaaaccggaagagggtcgtgatatggcaaatcgtattg gtgcatttggttatatggaatgtagcgccaaaaccaaagatggtgttcgtgaagtttttgaaatggcaacccgtgcagcactgcaggcacgtc gtggtaaaaagaaaagcgg ttgtctggttctg aaa tta ggt age ggt ggt ggt agt ggt ggt gaa aat etg tat ttt cag age ggt etg aac gat att ttt gag gcc cag aaa att gaa tgg cac gag taa gtc gac teg age ggc (SEQ. NO. 2)

[0098] The planar surface 12 for affinity mass spectrometry was prepared by electrospray deposition of dry ions landing on the surface 12 for 5 minutes using the device described in Example 1, according to the following procedure:

[0099] • Syringe pump 2 flow rate: 1 pl / min • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1500 V

[0100] • Temperature of the tubular evaporation space 10: 50 °C

[0101] • Voltage of the second high-voltage source 11 on the mask 13: -1500 V

[0102] • Pressure at the carrier gas inlet 7: 0.15 MPa

[0103] • Carrier gas: nitrogen

[0104] • Carrier gas temperature: 50 °C

[0105] • Shape of the hole in mask 13 : circle with a diameter of 3 mm. The mask 13 was prepared with an array of positions in the geometry and number of positions required by the experiment, typically 2 or 4 rows with 8 or 12 positions.

[0106] The syringe pump 2 was filled with a neutravidin stock solution (purchased from Thermo Fisher Scientific) at a concentration of 10 pmol / L in 50 mmol / L ammonium bicarbonate. The first high- voltage source 8 was connected to the conductive part 9 of the syringe 4 containing the stock solution, which was connected via capillary tube 5 to the distributor 1. The neutravidin stock solution was delivered by the syringe pump 2 and piston 3 to the distributor 1_, where it was electrosprayed from the micro-spray needle 6 under the influence of high voltage and the flow of pressurized carrier gas from inlet 7, forming a charged aerosol. The generated charged aerosol was introduced into the tubular evaporation space 10 (5 mm diameter, 10 cm length), where it was dried and continued on through the mask 13 connected to the second high-voltage source 11, heading toward the planar surface 12 (a microscope slide with an ITO layer on its surface). After the process was completed, both high-voltage sources 8 and 11 were switched off, the planar surface 12 was removed and washed with water. Using this method, 50 pmol of neutravidin per position was used, forming an affinity molecule layer of neutravidin in a circle with a diameter determined by the mask (3 mm).

[0107] In each position on the planar surface 12 bearing the neutravidin layer, 1 pl of an RhoA solution with Avi-tag, the concentration = 0.5 g / L, was deposited, then incubated in the device described in Example 10 (a humidity chamber) for 60 minutes. After incubation, a rapid wash was performed with a solution containing 20 mM HEPES, 50 mM NaCl, 10 mM MgCh, 1 mM tris(2- carboxyethyl)phosphine (T-CEP), 0.17 mM n-dodecyl-P-D-maltoside, pH 7.5, followed by washing with deionized water. The planar surface 12 was then dried at room temperature. A total of 20 pmol of the RhoA substrate protein was deposited onto the planar surface 12 for mass spectrometry.

[0108] A stool extract in the following buffer: 20 mM HEPES, 100 mM KC1, 10 mM MgCh, 10 mM MnCh, 1 mM T-CEP, 0.17 mM n-dodecyl-P-D-maltoside, with a cocktail of protease inhibitors (cOmplete Mini EDTA free, Pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to obtain the following 10x dilution series: from 500 to 0.05 pg / ml.

[0109] Samples at the respective concentrations according to the dilution series were applied (1 pl) to a position on the planar surface 12 compatible with mass spectrometry, with the RhoA protein labeled with Avi-tag as the substrate, and allowed to incubate in the device described in Example 10 (humidity chamber) for 30 to 60 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, the ITO-layered microscope slide was washed with the already mentioned washing buffer in this example, then rinsed with deionized water.

[0110] In this example, MALDI-TOF mass spectrometry was used as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed three times with the above washing buffer and twice with deionized water. The washed planar surface 12 compatible with mass spectrometry was allowed to dry at room temperature. Each position on the planar surface 12, once dry, was overlaid with a-cyano-4-hydroxycinnamic acid prepared in a saturated solution in 17% by volume formic acid, 33% by volume acetonitrile in LC-MS grade water, and the planar surface 12 compatible with mass spectrometry was inserted into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectrum measurement. The spectrum shown in Fig. 5 was obtained using standard settings. The mass spectrum of the sample with an active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, indicated by the vertical line.

[0111] Example 4: Detection of TcdB by monitoring the glucosylation of RhoA labeled with HA-tag In this example, a RhoA protein labeled with HA-tag was used as a substrate suitable for detecting the enzymatic activity of the TcdB toxin. RhoA was prepared by recombinant expression using the plasmid described below. In this example, an anti-HA-tag antibody was used as the affinity molecule, and RhoA was prepared by recombinant expression with an HA-tag so that binding interactions could be achieved between the immobilized anti-HA-tag affinity molecules on the planar surface 12 and the RhoA protein substrate.

[0112] RhoA labeled with HA-tag was prepared by recombinant expression. The expression of HA-RhoA was based on (doi: 10.1016 / 0076-6879(95)56003-3) with some alterations to obtain a recombinant protein with an HA-tag. The pGEX-6Pl plasmid was used because it contains the GST-tag, which serves as an affinity label and helps RhoA solubility. The sequence of human RhoA was modified with an HA-tag linker. Expression was carried out in LB medium using BL-21 Bir. RE. coli. The purification step was performed on a gravity column with GST-sepharose. The GST-RhoA-HA- tag product was cleaved overnight at 6 °C on the column using PreScission™ protease.

[0113] The relevant part of the pGEX-6P-l plasmid sequence for preparing a recombinant RhoA-HA-Tag protein is shown as SEQ. NO. 3 in Fig. 2D. The restriction endonucleases used for plasmid preparation are BAM-HI at the 5' end of the plasmid and SAL-I at the 3' end.

[0114] The amino acid sequence of the HA-tag is: YPYDVPDYA (SEQ NO. 4). It is also shown as SEQ. NO. 4 in Fig. 3C. gggcccctgggatccatggcagccattcgtaaaaaactggtgattgttggtgatggtgcatgtggtaaaacctgtctgctgattgtttttagcaa agatcagttcccggaagtttatgttccgaccgtgtttgaaaattatgtggccgatattgaagtggatggtaaacaggttgaactggcactgtgg gataccgcaggtcaagaggattatgatcgtctgcgtccgctgagctatcctgataccgatgttattctgatgtgcttcagcattgatagtccgga tagcctggaaaatattccggaaaaatggacaccggaagtgaaacatttttgtccgaatgttccgattattctggtgggcaacaaaaaagatctg cgcaatgatgaacatacccgtcgtgaactggccaaaatgaaacaagaaccggttaaaccggaagagggtcgtgatatggcaaatcgtattg gtgcatttggttatatggaatgtagcgccaaaaccaaagatggtgttcgtgaagtttttgaaatggcaacccgtgcagcactgcaggcacgtc gtggtaaaaagaaaagcgg ttgtctggttctg aaa tta ggt age ggt ggt ggt agt ggt ggt gaa aat etg tat ttt cag age tac cca tac gat gtt cca gat tac get taa gtc gac teg age ggc (SEQ. NO. 3)

[0115] Planar surface 12 for affinity mass spectrometry was prepared by electrospray deposition of dry ions landing on the surface for 5 minutes using the device described in Example 1 according to the following procedure:

[0116] • Syringe pump 2 flow rate: 1 pl / min

[0117] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1500 V

[0118] • Temperature of the tubular evaporation space 10: 50 °C

[0119] • Voltage of the second high-voltage source 11 on the mask 13: -1500 V

[0120] • Pressure at carrier gas inlet 7: 0.05 MPa

[0121] • Carrier gas: nitrogen

[0122] • Carrier gas temperature: 50 °C

[0123] • Shape of the hole in mask 13 : circle with a diameter of 3 mm, with an array of positions in the geometry and quantity required by the experiment, typically 2 or 4 rows with 8 or 12 positions.

[0124] The syringe pump 2 was loaded with an anti-HA-tag antibody solution (purchased from Thermo Fisher Scientific) at a concentration of 5 pmol / L in 150 mmol / L ammonium acetate. The first high- voltage source 8 was connected to the conductive part 9 of the syringe 4 holding the stock solution. The syringe was connected by capillary tube 5 to the distributor 1. The anti-HA-tag antibody solution was introduced by the syringe pump 2 into the distributor 1, where, under high voltage and pressurized carrier gas flow from inlet 7, it was electrosprayed from the micro-spray needle 6, forming a charged aerosol. The generated charged aerosol entered the evaporation space 10 (5 mm in diameter, 10 cm in length), where it was dried, continuing through mask 13 toward the planar surface 12 (a microscope slide with an ITO layer). After completion, both high-voltage sources 8 and 11 were switched off, and the planar surface 12 was removed and rinsed with water. Using this method, 25 pmol / position of anti-HA-tag antibody was used. The resulting affinity molecule layer of the anti-HA-tag antibody formed a circle whose diameter was determined by the mask (3 mm).

[0125] On each position of planar surface 12 carrying the layer of anti-HA-tag antibody, 1 pl of the RhoA solution with HA-tag at a concentration of 0.25 g / L was deposited and incubated in a humidity chamber described in Example 10 for 75 minutes. After incubation, a rapid wash was performed with a solution containing 60 mM Tris, 80 mM NaCl, 20 mM MgCh, 1.5 mM T-CEP, 0.1 mM n- dodecyl-P-D-maltoside, pH 7.5, followed by washing with deionized water. The planar surface 12 was then dried at room temperature. The total amount of RhoA substrate protein with HA-tag deposited on planar surface 12 for mass spectrometry was 10 pmol.

[0126] The stool extract in the following buffer: 20 mM Tris, 100 mM KC1, 20 mM NaCl, 5 mM MgCh, 5 mM MnCh, 1.5 mM T-CEP, 0.1 mM n-dodecyl-P-D-maltoside, with a cocktail of protease inhibitors (cOmplete Mini EDTA free, pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to obtain the following 10x dilution series: from 500 to 0.05 pg / ml.

[0127] Samples at the respective concentrations according to the dilution series were deposited in 1 pl volume on each position of planar surface 12 compatible with mass spectrometry containing the immobilized RhoA-HA-tag protein as the substrate and were allowed to incubate in the humidity chamber described in Example 10 for 90 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, planar surface 12 was washed using the washing buffer already mentioned in this example and subsequently washed with deionized water. In this example, MALDI-TOF mass spectrometry was employed as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed four times with the above washing buffer and twice with deionized water. The washed planar surface 12 compatible with mass spectrometry was dried at room temperature. Each position, once dry, was overlaid with a matrix of 2, 5 -dihydroxy acetophenone prepared under the manufacturer’s standard protocol (Bruker), and the planar surface 12 compatible with mass spectrometry was placed into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectroscopy measurement. The spectrum in Fig. 6 was obtained under standard settings. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, as indicated by the vertical line.

[0128] Example 5 : Detection of TcdB by monitoring the glucosylation of RhoA labeled with Flag-tag In this experiment, RhoA labeled with Flag-tag was used as a substrate suitable for detecting the enzymatic activity of the toxin. RhoA was prepared by recombinant expression using the plasmid described below. An anti-Flag-tag antibody was used as the affinity molecule, and RhoA was prepared with a Flag-tag by recombinant expression to achieve binding interactions between the anti-Flag antibody affinity molecules immobilized on the surface and the RhoA protein substrate. RhoA with Flag-tag was prepared by recombinant expression. The expression of Flag-RhoA was based on (doi: 10.1016 / 0076-6879(95)56003-3) with some modifications to obtain a recombinant RhoA protein with a Flag-tag. The pGEX-6Pl expression plasmid was used because it contains the GST tag, which functions as an affinity tag and helps RhoA solubility. The human RhoA sequence was modified by a Flag-tag linker. Expression was conducted in LB medium using BL- 21 Bir. A A. coli. The purification step was carried out on a gravity column with GST-sepharose. The GST-RhoA-Flag-tag product was cleaved overnight at 8 °C on the column with PreScission™ protease.

[0129] The relevant part of the pGEX-6P-l plasmid sequence for preparing a recombinant RhoA protein labeled with Flag-tag is shown as SEQ. NO. 5 in Fig. 2B. The restriction endonucleases used for plasmid preparation are BAM-HI at the 5' end of the plasmid and SAL-I at the 3' end. The amino acid sequence of the Flag label is shown as SEQ. NO. 6 in Fig. 3 A. gggcccctgggatccatggcagccattcgtaaaaaactggtgattgttggtgatggtgcatgtggtaaaacctgtctgctgattgtttttagcaa agatcagttcccggaagtttatgttccgaccgtgtttgaaaattatgtggccgatattgaagtggatggtaaacaggttgaactggcactgtgg gataccgcaggtcaagaggattatgatcgtctgcgtccgctgagctatcctgataccgatgttattctgatgtgcttcagcattgatagtccgga tagcctggaaaatattccggaaaaatggacaccggaagtgaaacatttttgtccgaatgttccgattattctggtgggcaacaaaaaagatctg cgcaatgatgaacatacccgtcgtgaactggccaaaatgaaacaagaaccggttaaaccggaagagggtcgtgatatggcaaatcgtattg gtgcatttggttatatggaatgtagcgccaaaaccaaagatggtgttcgtgaagtttttgaaatggcaacccgtgcagcactgcaggcacgtc gtggtaaaaagaaaagcgg ttgtctggttctg aaa tta ggt age ggt ggt ggt agt ggt ggt gaa aat etg tat ttt cag age gac tac aaa gac gat gac gac aag taa gtc gac teg age ggc (SEQ. NO. 5)

[0130] DYKDDDDK (SEQ NO. 6) The planar surface 12 suitable for mass spectrometry was prepared by electrospray deposition of dry ions landing on surface 12 over 5 minutes using the device described in Example 1, according to the following procedure:

[0131] • Syringe pump 2 flow rate: 2 pl / min

[0132] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1200

[0133] V

[0134] • Temperature of the tubular evaporation space 10: 60 °C

[0135] • Voltage of the second high-voltage source 11 on the mask: -1200 V

[0136] • Pressure at the carrier gas inlet 7: 0.2 MPa

[0137] • Carrier gas: nitrogen

[0138] • Carrier gas temperature: 60 °C

[0139] • Shape of the hole in mask 13 : circle with a diameter of 3 mm; a mask was prepared with an array of positions in the geometry and quantity required by the experiment, typically 2 or 4 rows with 8 or 12 positions each.

[0140] The syringe pump 2 was loaded with an anti-Flag-tag antibody solution (purchased from Merck) at a concentration of 10 pmol / L in 150 mmol / L ammonium acetate. The first high-voltage source 8 was connected to the conductive part 9 of the syringe 4 containing the stock solution. The syringe was connected by capillary tube 5 to distributor 1. The anti-Flag-tag antibody stock solution was introduced by the syringe pump 2 into distributor 1, where, under high voltage and the flow of pressurized carrier gas from inlet 7, it was electrosprayed from micro-spray needle 6, forming a charged aerosol. The generated charged aerosol was introduced into the tubular evaporation space 10 (5 mm diameter, 10 cm length), where it was dried and continued through mask 13 connected to the second high-voltage source 11 towards planar surface 12 (a microscope slide with an ITO layer on its surface). After the process was finished, both high-voltage sources 8 and 11 were switched off, and planar surface 12 was removed and rinsed with water. Using this method, 100 pmol / position of anti-Flag-tag antibody was deposited, forming an anti-Flag-tag antibody affinity molecule layer in a circle whose diameter was determined by the mask (3 mm).

[0141] On each position of planar surface 12 carrying the anti-Flag-tag antibody layer, 2 pl of the RhoA solution with Flag-tag at a concentration of 0.5 g / L was deposited and incubated in the humidity chamber described in Example 10 for 45 minutes. After incubation, a rapid wash was performed with a solution containing 80 mM Tris, 60 mM NaCl, 15 mM MgCh, 0.5 mM T-CEP, and 0.2 mM n-dodecyl-P-D-maltoside, pH 7.5, followed by washing with deionized water. The planar surface 12 was then dried with compressed air. Atotal of 40 pmol of RhoA substrate protein was deposited onto the planar surface 12 for mass spectrometry.

[0142] The stool extract in the following buffer: 40 mM Tris, 80 mM KC1, 5 mM NaCl, 5 mM MgCh, 4 mM MnCh, 0.5 mM T-CEP, 0.2 mM n-dodecyl-P-D-maltoside, with a cocktail of protease inhibitors (cOmplete Mini EDTAfree, Pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to form the following 10x dilution series: from 500 to 0.05 pg / ml.

[0143] Samples at respective concentrations according to the dilution series were applied to the planar surface 12 compatible with mass spectrometry (2 pl per position) containing the Flag-tag-RhoA substrate and allowed to incubate in the humidity chamber (Example 10) for 120 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, planar surface 12 was washed with the washing buffer previously mentioned in this example and then with deionized water.

[0144] In this example, MALDI-TOF mass spectrometry was used as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed three times in the above washing buffer and three times with deionized water. The washed planar surface 12 compatible with mass spectrometry was dried at room temperature. Each position, once dry, was overlaid with ferulic acid matrix prepared according to the manufacturer’s standard protocol (Merck), and the planar affinity surface was placed into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectrum measurement. The spectrum shown in Fig. 7 was obtained under standard settings. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, indicated by the vertical line.

[0145] Example 6: Detection of TcdB by monitoring the glucosylation of RhoA labeled withMYC-tag

[0146] In this example, a protein RhoA labeled with MYC-tag was used as a substrate for detecting the enzymatic activity of the toxin. RhoA was prepared by recombinant expression using the plasmid described below. A single-domain anti-MYC-tag antibody was used as the affinity molecule, and RhoA was prepared by recombinant expression with MYC-tag to achieve binding interactions between the surface-immobilized single-domain anti-MYC-tag affinity molecules and the RhoA protein substrate.

[0147] RhoA labeled with MYC-tag was prepared by recombinant expression. The expression of RhoA- MYC-tag was based on (doi: 10.1016 / 0076-6879(95)56003-3) with some alterations to obtain a recombinant protein with MYC-tag. The pGEX-6Pl plasmid was used because it contains the GST tag, which serves as an affinity tag and helps RhoA solubility. The human RhoA sequence was modified by a linker with MYC-tag. Expression was carried out in LB medium using BL-21 Bir. AE. coli. The purification step was performed on a gravity column with GST-sepharose. The GST- RhoA-MYC-tag product was cleaved overnight at 5 °C on the column using PreScission™ protease.

[0148] The relevant part of the pGEX-6P-l plasmid sequence for preparing a recombinant RhoA protein labeled with MYC-tag is shown as SEQ. NO. 7 in Fig. 2C. The restriction endonucleases used for the plasmid preparation include B AM-HI at the 5 ' end of the plasmid and SAL-I at the 3 ' end. The amino acid sequence of the MYC tag is shown as SEQ. NO. 8 in Fig. 3B. gggcccctgggatccatggcagccattcgtaaaaaactggtgattgttggtgatggtgcatgtggtaaaacctgtctgctgattgtttttagcaa agatcagttcccggaagtttatgttccgaccgtgtttgaaaattatgtggccgatattgaagtggatggtaaacaggttgaactggcactgtgg gataccgcaggtcaagaggattatgatcgtctgcgtccgctgagctatcctgataccgatgttattctgatgtgcttcagcattgatagtccgga tagcctggaaaatattccggaaaaatggacaccggaagtgaaacatttttgtccgaatgttccgattattctggtgggcaacaaaaaagatctg cgcaatgatgaacatacccgtcgtgaactggccaaaatgaaacaagaaccggttaaaccggaagagggtcgtgatatggcaaatcgtattg gtgcatttggttatatggaatgtagcgccaaaaccaaagatggtgttcgtgaagtttttgaaatggcaacccgtgcagcactgcaggcacgtc gtggtaaaaagaaaagcgg ttgtctggttctg aaa tta ggt age ggt ggt ggt agt ggt ggt gaa aat etg tat ttt cag age gaa caa aaa etc ate tea gaa gag gat etg taa gtc gac teg age ggc (SEQ. NO. 7)

[0149] EQKLISEEDL (SEQ. NO. 8)

[0150] The planar surface 12 for affinity mass spectrometry was prepared by the electrospray deposition of dry ions landing on the surface 12 for 5 minutes using the device described in Example 1, according to the following procedure:

[0151] • Syringe pump 2 flow rate: 1 pl / min

[0152] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1500 V

[0153] • Temperature of the tubular evaporation space 10: 50 °C

[0154] • Voltage of the second high-voltage source 11 on the mask 13: -1500 V

[0155] • Pressure at carrier gas inlet 7: 0.1 MPa

[0156] • Carrier gas: nitrogen

[0157] • Carrier gas temperature: 50 °C

[0158] • Shape of the hole in mask 13 : circle with a diameter of 3 mm, with an array of positions in the geometry and number of positions required by the experiment, typically 2 or 4 rows with 8 or 12 positions. The syringe pump 2 was filled with a single-domain anti-MYC-tag antibody solution (purchased from Thermo Fisher Scientific) at a concentration of 2 pmol / L in an aqueous solution of 5 mmol / L ammonium acetate, 30% by volume acetonitrile. The first high-voltage source 8 was connected to the conductive part 9 of the syringe 4 with the stock solution. The syringe was connected by capillary tube 5 to the distributor 1. In this case, the distributor 1 was connected to the conductive part 9. The single-domain anti-MYC-tag antibody solution was introduced by the syringe pump 2 and piston 3 into the distributor 1, where, under high voltage and a stream of pressurized carrier gas from inlet 7, it was electrosprayed from the micro-spray needle 6, forming a charged aerosol. The generated charged aerosol passed into the tubular evaporation space 10 (5 mm diameter, 10 cm length), where it was dried and then passed through mask 13 connected to the second high- voltage source 11 towards planar surface 12 (a microscope slide with an ITO layer on its surface). After the procedure was completed, both high-voltage sources 8 and 11 were switched off, the planar surface 12 was removed and washed with water. Using this method, 25 pmol / position of single-domain anti-MYC-tag antibody was used, forming a layer of the anti-MYC-tag antibody affinity molecule in a circle whose diameter was determined by the mask (3 mm).

[0159] On each position of the planar surface 12 with the single-domain anti-MYC-tag antibody layer, 1 pl of RhoA solution with MYC-tag at a concentration of 0.5 g / L was applied and incubated in the device described in Example 10 for 60 minutes. After incubation, a rapid wash was performed with a solution containing 60 mM MOPS, 80 mM NaCl, 20 mM MgCh, 1.5 mM T-CEP, 0.1 mM n- dodecyl-P-D-maltoside, pH 7.5, followed by washing with deionized water. The planar surface 12 was then dried at room temperature. A total of 10 pmol of RhoA-MYC-tag substrate protein was deposited on the planar surface 12 for mass spectrometry.

[0160] The stool extract in the following buffer: 50 mM MOPS, 100 mM KC1, 20 mM NaCl, 5 mM MgCh, 5 mM MnCh, 1.5 mM T-CEP, 0.5 mM T-CEP, 1 mM n-dodecyl-P-D-maltoside, with a cocktail of protease inhibitors (cOmplete Mini EDTA free, Pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was enriched with recombinant TcdB to yield a 10x dilution series from 500 to 0.05 pg / ml.

[0161] Samples at the respective concentrations according to the dilution series were applied (1 pl per position) to the planar surface 12 compatible with mass spectrometry with RhoA-MYC-tag protein as the substrate and allowed to incubate in the device described in Example 10 for 60 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, the planar surface 12 was washed with the washing buffer already mentioned in this example, followed by deionized water. In this example, MALDI-TOF mass spectrometry was employed as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed three times with the above washing buffer and twice with deionized water. The washed planar surface 12 compatible with mass spectrometry was allowed to dry at room temperature. Each position, once dried, was overlaid with 2, 5 -dihydroxy acetophenone matrix prepared under the manufacturer’s standard protocol (Bruker), and the planar surface 12 was inserted into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectrum measurement. The spectrum in Fig. 8 was obtained under standard settings. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, indicated by the vertical line.

[0162] Example 7: Detection ofTcdB by monitoring the glucosylation ofRhoA labeled with Spot-tag In this example, the RhoA protein labeled with Spot-tag was used as a substrate suitable for detecting the enzymatic activity of the toxin. RhoA was prepared by recombinant expression using the plasmid described below. A single-domain anti-Spot-tag antibody was used as the affinity molecule, and RhoA with a Spot-tag was prepared by recombinant expression, thereby achieving binding interactions between the single-domain anti-Spot-tag affinity molecules immobilized on the surface and the RhoA-Spot-tag protein substrate.

[0163] RhoA with Spot-tag was prepared by recombinant expression. The expression of RhoA-Spot-tag was based on (doi: 10.1016 / 0076-6879(95)56003-3) with some modifications to obtain a recombinant protein with the Spot-tag. The pGEX-6Pl plasmid was used because it contains GST- tag, which acts as an affinity label and helps RhoA solubility. The human RhoA sequence was modified by a Spot-tag linker. Expression was conducted in LB medium using BL-21 Bir. AE coli. The purification step was performed on a gravity column with GST-sepharose. The GST- RhoA-Spot-tag product was cleaved overnight at 10 °C on the column using PreScission™ protease.

[0164] The relevant part of the pGEX-6P-l plasmid sequence for preparing the recombinant protein RhoA labeled with Spot-tag is shown as SEQ. NO. 9 in Fig. 2E. The restriction endonucleases used for preparing the plasmid are BAM-HI at the 5 ' end and SAL-I at the 3 ' end. The Amino acid sequence of the Spot-tag is shown as SEQ. NO. 1 in Fig. 3D. gggcccctgggatccatggcagccattcgtaaaaaactggtgattgttggtgatggtgcatgtggtaaaacctgtctgctgattgtttttagcaa agatcagttcccggaagtttatgttccgaccgtgtttgaaaattatgtggccgatattgaagtggatggtaaacaggttgaactggcactgtgg gataccgcaggtcaagaggattatgatcgtctgcgtccgctgagctatcctgataccgatgttattctgatgtgcttcagcattgatagtccgga tagcctggaaaatattccggaaaaatggacaccggaagtgaaacatttttgtccgaatgttccgattattctggtgggcaacaaaaaagatctg cgcaatgatgaacatacccgtcgtgaactggccaaaatgaaacaagaaccggttaaaccggaagagggtcgtgatatggcaaatcgtattg gtgcatttggttatatggaatgtagcgccaaaaccaaagatggtgttcgtgaagtttttgaaatggcaacccgtgcagcactgcaggcacgtc gtggtaaaaagaaaagcgg ttgtctggttctg aaa tta ggt age ggt ggt ggt agt ggt ggt gaa aat etg tat ttt cag age ccg gat ege gtg ege gca gtc tet cac tgg age age taa gtc gac teg age ggc (SEQ. NO. 9)

[0165] PDRVRAVSHWSS (SEQ. NO. 1)

[0166] The planar surface 12 for affinity mass spectrometry was prepared by electrospray deposition of dried ions impinging on surface 12 for 5 minutes using the device described in Example 1, as follows:

[0167] • Syringe pump 2 flow rate: 1 pl / min

[0168] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1500

[0169] V

[0170] • Temperature of the tubular evaporation space 10: 50 °C

[0171] • Voltage of the second high-voltage source 11 on the mask 13: -1500 V

[0172] • Pressure at the carrier gas inlet 7: 0.3 MPa

[0173] • Carrier gas: nitrogen

[0174] • Carrier gas temperature: 50 °C

[0175] • Shape of the hole in mask 13 : circle with a diameter of 3 mm; a mask with an array of positions in the geometry and number of positions required by the experiment was prepared, typically 2 or 4 rows with 8 or 12 positions.

[0176] The syringe pump 2 was charged with a single-domain anti-Spot-tag antibody solution (purchased from Thermo Fisher Scientific) at a concentration of 10 pmol / L in 50 mmol / L ammonium bicarbonate. The first high-voltage source 8 was connected to the conductive part 9 of the syringe 4 containing the stock solution. The syringe was connected by capillary tube 5 to distributor 1. The above solution of the single-domain anti-Spot-tag antibody was introduced by the syringe pump 2 and piston 3 into distributor 1, where, under high voltage and the flow of carrier gas from inlet 7, it was electrosprayed from micro-spray needle 6, generating a charged aerosol. The charged aerosol entered to the tubular evaporation space 10 (5 mm diameter, 10 cm length), where it was dried and further passed through mask 13 connected to the second high-voltage source 11 toward planar surface 12 (a microscope slide with an ITO layer on its surface). After completion of the process, both high-voltage sources 8 and 11 were switched off, the planar surface 12 was removed and washed with water. By this method, 25 pmol / position of single-domain anti-Spot-tag antibody was used, and the resulting layer of the single-domain anti-Spot-tag antibody affinity molecule had a circular shape defined by the mask diameter (3 mm).

[0177] On each position of the planar surface 12 with the single-domain anti-Spot-tag antibody layer, 1 pl of the RhoA solution with Spot-tag at 0.5 g / L was applied, then incubated in the device according to Example 10 for 50 minutes. Following incubation, a rapid wash was performed with a solution containing 50 mM HEPES, 40 mM NaCl, 10 mM MgCh, 1.5 mM T-CEP, 0.15 mM n- dodecyl-P-D-maltoside, pH 7.5, and then washed with deionized water. The planar surface 12 was dried by air flow. A total of 20 pmol of the substrate protein was deposited on the planar surface 12 for mass spectrometry.

[0178] The stool extract in the following buffer: 50 mM HEPES, 80 mM KC1, 20 mM NaCl, 15 mM MgCh, 25 mM MnCh, 1 mM T-CEP, 0.25 mM n-dodecyl-P-D-maltoside, with a mixture of protease inhibitors (cOmplete Mini EDTA free, Pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to produce the following 10x dilution series: 500 to 0.05 pg / ml.

[0179] Samples at the respective concentrations according to the dilution series were applied (1 pl per position) to the planar surface 12 compatible with mass spectrometry with RhoA-Spot-tag protein as the substrate, then allowed to incubate in the device described in Example 10 for 30 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, the planar surface 12 was washed with the washing buffer already mentioned in this example and then with deionized water.

[0180] In this example, MALDI-TOF mass spectrometry was used as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed twice with the above described washing buffer and twice with deionized water. The washed planar surface 12 compatible with mass spectrometry was dried at room temperature. Each position, once dry, was overlaid with a mixture of matrix stock solutions of 2,5- dihydroxyacetophenone and a-cyano-4-hydroxycinnamic acid matrix in a 1 : 1 ratio, prepared by the manufacturer’s standard protocol (Bruker). The planar surface 12 was placed into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectrum measurement. The spectrum in Fig. 9 was obtained under standard settings. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, indicated by the vertical line.

[0181] Example 8: Detection ofTcdB by monitoring the glucosylation ofRhoA labeled with C-tag In this example, a RhoA protein labeled with C-tag was used as a substrate suitable for detecting the enzymatic activity of the toxin. RhoA was prepared by recombinant expression using the plasmid described below. A single-domain camelid anti-C-tag antibody was used as the affinity molecule, and RhoA labeled with C-tag was prepared via recombinant expression to achieve binding interactions between the single-domain camelid anti-C-tag affinity molecules immobilized on the surface and the RhoA-C-tag protein substrate.

[0182] RhoA labeled with C-tag was prepared by recombinant expression. The expression of RhoA-C- tag was based on (doi: 10.1016 / 0076-6879(95)56003-3) with some modifications to produce a recombinant protein with a C-tag. The pGEX-6Pl plasmid was used because it contains GST-tag, which acts as an affinity label and aids RhoA solubility. The human RhoA sequence was modified with a C-tag linker. Expression was performed in LB medium using BL-21 Bir. A E coli. The purification step was performed using a gravity column of GST-Sepharose. The GST-RhoA-C-tag product was cleaved overnight at 6 °C on the column by PreScission™ protease.

[0183] The relevant portion of the pGEX-6P-l plasmid sequence for preparing the recombinant RhoA protein labeled with C-tag is shown as SEQ. NO. 10 in Fig. 2F. The restriction endonucleas enzymes used for plasmid preparation are BAM-HI at the 5' end and SAL-I at the 3' end of the plasmid. gggcccctgggatccatggcagccattcgtaaaaaactggtgattgttggtgatggtgcatgtggtaaaacctgtctgctgattgtttttagcaa agatcagttcccggaagtttatgttccgaccgtgtttgaaaattatgtggccgatattgaagtggatggtaaacaggttgaactggcactgtgg gataccgcaggtcaagaggattatgatcgtctgcgtccgctgagctatcctgataccgatgttattctgatgtgcttcagcattgatagtccgga tagcctggaaaatattccggaaaaatggacaccggaagtgaaacatttttgtccgaatgttccgattattctggtgggcaacaaaaaagatctg cgcaatgatgaacatacccgtcgtgaactggccaaaatgaaacaagaaccggttaaaccggaagagggtcgtgatatggcaaatcgtattg gtgcatttggttatatggaatgtagcgccaaaaccaaagatggtgttcgtgaagtttttgaaatggcaacccgtgcagcactgcaggcacgtc gtggtaaaaagaaaagcgg ttgtctggttctg aaa tta ggt age ggt ggt ggt agt ggt ggt gaa aat etg tat ttt cag age gaa ccg gaa geg taa gtc gac teg age ggc (SEQ. NO. 10)

[0184] The planar surface 12 for affinity mass spectrometry was prepared by electrospray deposition of dry ions landing on surface 12 for 5 minutes using the device as described in Example 1, according to the following procedure:

[0185] • Syringe pump 2 flow rate: 1 pl / min

[0186] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1700 V

[0187] • Temperature of the tubular evaporation space 10: 55 °C • Voltage of the second high-voltage source 11 on mask 13: -1700 V

[0188] • Pressure at carrier gas inlet 7: 0.1 MPa

[0189] • Carrier gas: nitrogen

[0190] • Carrier gas temperature: 55 °C

[0191] • Shape of the hole in mask 13 : circle with a diameter of 3 mm; a mask with an array of positions required by the experiment was prepared, typically 2 or 4 rows with 8 or 12 positions each.

[0192] The syringe pump 2 was filled with an anti-C-tag antibody solution (purchased from Thermo Fisher Scientific) at a concentration of 25 mmol / L ammonium bicarbonate. The first high-voltage source 8 was connected to the conductive part 9 of syringe 4 containing the stock solution. The syringe 4 was connected via capillary tube 5 to the distributor E The anti-C-tag antibody solution was introduced by syringe pump 2 into distributor 1, where, under high voltage and the flow of pressurized carrier gas from inlet 7, it was electrosprayed from the micro-spray needle 6, thus forming a charged aerosol. The formed charged aerosol was passed through the tubular evaporation space 10 (5 mm diameter, 10 cm length), where it was dried and continued through mask 13 connected to the second high-voltage source 11 toward the planar surface 12 (a microscope slide with an ITO layer). After completion of the process, both high-voltage sources 8 and 11 were switched off, the planar surface 12 was removed and washed with water. By this method, 25 pmol / position of anti-C-tag antibody was used, forming a layer of the anti-C-tag antibody affinity molecule shaped in a circle determined by the mask diameter (3 mm).

[0193] On each position of the planar surface 12 with the anti-C-tag antibody layer, 1 pl of RhoA solution with C-tag at a concentration of 0.5 g / L was deposited, and then incubated in the device described in Example 10 for 40 minutes. After incubation, a rapid wash was performed with a solution containing 50 mM TAPSO, 60 mM NaCl, 20 mM MgCh, 1.5 mM T-CEP, 0.1 mM n-dodecyl-P- D-maltoside, pH 7.5, followed by washing with deionized water. The planar surface 12 was dried at room temperature. A total of 50 pmol of substrate protein was deposited on the planar surface 12 for mass spectrometry.

[0194] The stool extract in the following buffer: 70 mM TAPSO, 100 mM KC1, 20 mM NaCl, 5 mM MgCh, 5 mM MnCh, 1.5 mM T-CEP, 0.5 mM, 1 mM n-dodecyl-P-D-maltoside, with a cocktail of protease inhibitors (cOmplete Mini EDTA free, Pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to prepare a 10x dilution series: from 500 to 0.05 pg / ml.

[0195] Samples at the respective concentrations according to the dilution series were applied (1 pl per position) to the affinity surface 12 compatible with mass spectrometry bearing RhoA labeled with C-tag as the substrate and left to incubate in the device described in Example 10 for 120 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, the planar surface 12 was washed with the washing buffer previously mentioned in this example and then with deionized water.

[0196] In this example, MALDI-TOF mass spectrometry was used as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed four times with the above washing buffer and twice with deionized water. The washed planar surface 12 compatible with mass spectrometry was dried at room temperature. Each position, once dried, was overlaid with a 2, 5 -dihydroxy acetophenone matrix prepared according to the manufacturer’s standard protocol (Bruker), and the planar surface 12 was placed into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectrum analysis. The spectrum shown in Fig. 10 was obtained with standard settings. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, indicated by the vertical line.

[0197] Example 9: Detection of TcdB by monitoring the glucosylation ofRhoA labeled with His-tag

[0198] In this example, a protein RhoA labeled with His-tag (commercially available from Abeam) was used as a substrate for detecting toxin enzymatic activity. An anti-His-tag antibody was used as the affinity molecule to achieve binding interactions between the anti-His-tag antibody affinity molecules immobilized on the surface and the RhoA-His-tag protein substrate. The amino acid sequence of the His-tag is shown as SEQ. NO. 11 in Fig. 3E.

[0199] HHHHHH (SEQ. NO. 11).

[0200] The planar surface 12 for affinity mass spectrometry was prepared by the electrospray deposition of dry ions impinging on surface 12 over 10 minutes using the apparatus described in Example 1, according to the following instructions:

[0201] • Syringe pump 2 flow rate: 1 pl / min

[0202] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of the syringe 4: 1500 V

[0203] • Temperature of the tubular evaporation space 10: 50 °C

[0204] • Voltage of the second high-voltage source 11 on the mask: -1500 V

[0205] • Pressure at carrier gas inlet 7: 1 MPa

[0206] • Carrier gas: nitrogen

[0207] • Carrier gas temperature: 50 °C • Shape of the hole in mask 13 : circle with a diameter of 3 mm, with an array of positions in the geometry and number of positions needed by the experiment, typically 2 or 4 rows, each with 8 or 12 positions.

[0208] The syringe pump 2 was loaded with an anti-His-tag antibody solution (Bio-Rad) at a concentration of 5 pmol / L in 50 mmol / L ammonium acetate. The first high-voltage source 8 was connected to the conductive part 9 of the syringe 4 containing the stock solution. The syringe 4 was connected by capillary tube 5 to the distributor 1. The anti-His-tag antibody solution was introduced via syringe pump 2 into distributor 1, where, under high voltage and pressurized carrier gas from inlet 7, it was electrosprayed from micro-spray needle 6, thus forming a charged aerosol. The thereby formed charged aerosol was passed through the tubular evaporation space 10 (5 mm diameter, 10 cm length), where it was dried and subsequently passed through the mask 13 connected to the second high-voltage source 11 in the direction of the stainless-steel MALDI planar surface 12. After completion of the process, both high-voltage sources 8 and 11 were turned off, and the planar surface 12 was removed and rinsed with water. In this method, 480 pmol of anti-His-tag antibody was used, and the layer of the anti-His-tag antibody affinity molecule formed a circle whose diameter was determined by the mask (3 mm).

[0209] On each position of the planar surface 12 containing the anti-His-tag antibody layer, 1 pl of RhoA solution with His-tag at a concentration of 0.5 g / L was applied and incubated in the device described in Example 10 for 65 minutes. After incubation, a rapid wash was performed with a solution containing 50 mM triethanolamine hydrochloride, 15 mM MgCh, 0.15 mM n-dodecyl-P- D-maltoside, pH 7.5, followed by rinsing with deionized water. The planar surface 12 was then dried at room temperature. Another 1 pl of the same RhoA solution with His-tag was applied again, washed, and left to dry at room temperature. Atotal of 30 pmol of RhoA-His-tag substrate protein was deposited on the planar surface 12 for mass spectrometry.

[0210] The stool extract in the following reaction buffer: 70 mM triethanolamine hydrochloride, 20 mM MgCh, 15 mM GDP, 3 mM UDP-a-D-glucose, 0.15 mM n-dodecyl-P-D-maltoside, with a cocktail of protease inhibitors (cOmplete Mini EDTA free, Pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to make a 10x dilution series from 500 to 0.05 pg / ml.

[0211] Samples at the respective concentrations according to the dilution series were applied (1 pl per position) onto the planar surface 12 compatible with mass spectrometry containing the RhoA protein labeled with His-tag as the substrate and allowed to incubate in the device described in Example 10 for 60 to 120 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, the planar surface 12 was washed with the aforementioned washing buffer in this example, then rinsed with deionized water.

[0212] In this example, MALDI-TOF mass spectrometry was used as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed three times with the above washing buffer and twice with deionized water. The washed planar surface 12 compatible with mass spectrometry was dried at room temperature. Each position, once dried, was overlaid with a sinapinic acid matrix prepared according to the manufacturer’s standard protocol (Bruker), and the planar surface 12 compatible with mass spectrometry was placed into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectrum measurement. The spectrum shown in Fig. 11 was obtained under standard settings. The mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose, indicated by the vertical line.

[0213] Example 10: A device (humidity chamber) used to prevent droplet drying during incubation

[0214] A device used to prevent droplet drying during incubation, employed in steps b) and / or c) of the claimed method, is shown in Fig. 12. The device comprises a Petri dish, in the center of which a Petri dish insert is placed. The middle part 14 of the Petri dish insert is configured to hold the planar surface 12 suitable for mass spectrometry during incubation. The middle part 14 of the Petri dish insert is connected to the side walls 16 of the Petri dish insert, which are further connected to two side reservoirs 15. The planar surface 12 suitable for mass spectrometry is placed on the middle part 14 of the Petri dish insert from the side walls 16 of the Petri dish insert for incubation in step b) and / or c) of the claimed method. The side reservoirs 15, which are connected via the side walls 16 of the Petri dish insert to the middle part 14 of the Petri dish insert, are configured to hold a mixture of liquid and moist tissues, which prevents evaporation of the sample during incubation.

[0215] Example 11 : Detection of TcdB by monitoring the glucosylation of recombinantly prepared RhoA labeled with Avi-tag directly from stool - the effect of the presence of protease inhibitors

[0216] In this example, an Avi -tag-lab eled RhoA protein was used in the same manner as in Example 2 as a substrate suitable for detecting toxin enzymatic activity. Neutravidin was used as the affinity molecule immobilized on the planar surface compatible with mass spectrometry, and Avi-tag- labeled RhoA was prepared by recombinant expression to achieve binding interactions between neutravidin immobilized on the surface and the RhoA protein substrate. RhoA labeled with Avi-tag was prepared by recombinant expression based on (Self et al. doi: 10.1016 / 0076-6879(95)56003-3) with some modifications to generate a recombinant protein labeled with Avi-tag. The pGEX-6Pl expression plasmid was used because it contains the glutathione S-transferase (GST) tag, which serves as an affinity label and aids RhoA solubility. The sequence of human RhoA was modified by the Avi-tag linker, which is essential for successful biotinylation. The expression was carried out in LB medium using BL-21 Bir. A£ coli capable of biotinylation under isopropyl P-D-l-thiogalactopyranoside (IPTG) induction. When the optical density at 600 nm (OD600) reached 0.9, IPTG and biotin were added, and the solution was incubated overnight at 18 °C. A purification step was performed with a gravity column on GST- sepharose. The GST-RhoA-Avi-tag product was cleaved overnight at 6 °C on the column using PreScission™ protease.

[0217] The relevant portion of the pGEX-6P-l plasmid sequence for preparing Avi -tag-lab eled RhoA protein is shown as SEQ. NO. 2 in Fig. 2A and in Example 3 (as in Example 3, BAM-HI was used as the restriction enzyme for the 5' end and SAL-I for the 3' end of the plasmid).

[0218] The planar surface 12 for affinity mass spectrometry was prepared by the electrospray deposition of dry ions landing on surface 12 for 5 minutes using the device described in Example 1, according to the following procedure:

[0219] • Syringe pump 2 flow rate: 1 pl / min

[0220] • Voltage of the first high-voltage source 8 applied to the conductive part 9 of syringe 4: 1500 V

[0221] • Temperature of the tubular evaporation space 10: 50 °C

[0222] • Voltage of the second high-voltage source 11 on mask 13: -1500 V

[0223] • Pressure at the carrier gas inlet 7: 0.15 MPa

[0224] • Carrier gas: nitrogen

[0225] • Carrier gas temperature: 50 °C

[0226] • Shape of the hole in mask 13 : circle with a diameter of 3 mm. The mask 13 was prepared with an array of positions in the geometry and number of positions needed for the experiment, usually 2 or 4 rows with 8 or 12 positions.

[0227] The syringe pump 2 was loaded with a neutravidin stock solution (purchased from Thermo Fisher Scientific) at 10 pmol / L in 50 mmol / L ammonium bicarbonate. The first high-voltage source 8 was connected to the conductive part 9 of syringe 4 holding the stock solution, which was connected by capillary tube 5 to the distributor 1. The neutravidin stock solution was pumped by the syringe pump 2 and piston 3 into the distributor 1_, where, under high voltage and carrier gas flow from inlet 7, it was electrosprayed through micro-spray needle 6 in the form of a charged aerosol. The formed charged aerosol was dried in the tubular evaporation space 10 (5 mm diameter, 10 cm length) and subsequently passed through the mask 13 connected to the second high-voltage source 11 toward the planar surface 12 (a microscope slide with an ITO layer). After completion of the process, both high-voltage sources 8 and 11 were turned off, and the planar surface 12 was removed and washed with water. In this manner, 50 pmol / position of neutravidin was applied, creating an affinity molecule layer of neutravidin shaped like a circle of diameter set by the mask (3 mm).

[0228] On each position of the planar surface 12 with the neutravidin layer, 1 pl of RhoA solution with Avi-tag at 0.5 g / L concentration was applied and incubated in the device described in Example 10 (humidity chamber) for 60 minutes. After incubation, a rapid wash was performed with a solution containing 20 mM HEPES, 50 mM NaCl, 10 mM MgCh, 1 mM T-CEP, 0.17 mM n-dodecyl-P-D- maltoside, pH 7.5, followed by washing with deionized water. The planar surface 12 was then dried at room temperature. A total of 20 pmol of RhoA substrate protein was deposited on the planar surface 12 for mass spectrometry.

[0229] The stool extract in the following buffer: 20 mM HEPES, 100 mM KC1, 10 mM MgCh, 10 mM MnCh, 1 mM T-CEP, 0.17 mM n-dodecyl-P-D-maltoside, with a mixture of protease inhibitors (cOmplete Mini EDTA free, Pepstatin, E-64, chymostatin, phosphoramidon, bestatin) at pH 7.5 was supplemented with recombinant TcdB to form the following 10x dilution series: from 500 to 0.05 pg / ml.

[0230] At the same time, the stool sample was also diluted in the same buffer but without using protease inhibitors (20 mM HEPES, 100 mM KC1, 10 mM MgCh, 10 mM MnCh, 1 mM T-CEP, 0.17 mM n-dodecyl-P-D-maltoside, pH 7.5) and supplemented with recombinant TcdB to a final concentration of 500 pg / ml.

[0231] Samples at respective concentrations according to the dilution series were deposited in 1 pl volume onto each position of the planar surface 12 compatible with mass spectrometry, with RhoA labeled with Avi-tag as the substrate, and left to incubate in the device described in Example 10 (humidity chamber) for 30 to 60 minutes at room temperature. UDP-a-D-glucose was used as the modification compound. After incubation, the ITO-layered microscope slide was washed with the washing buffer mentioned above and then with deionized water.

[0232] In this example, MALDI-TOF was used as the detection technique. The planar surface 12 compatible with mass spectrometry, with the incubation reaction completed, was washed three times in the above washing buffer and twice with deionized water. The washed planar surface 12 compatible with mass spectrometry was dried at room temperature. Each position on planar surface 12, once dried, was overlaid with a-cyano-4-hydroxy cinnamic acid prepared in a saturated solution in 17% by volume formic acid, 33% by volume acetonitrile in LC-MS grade water, and the planar surface 12 compatible with mass spectrometry was placed into the MALDI TOF mass spectrometer ion source for desorption, ionization, and mass spectrum measurement. When protease inhibitors were used, a spectrum identical to Fig. 5 was obtained under standard settings (the mass spectrum of the sample with active toxin shows a shift on the x-axis (m / z) by the molar mass of glucose). For the sample not treated with protease inhibitors, no signal was detected either near m / z 12534 (the native TcdB with a tag) nor in the region shifted by the molar mass of glucose. This indicates that the substrate protein for the toxin was degraded.

[0233] List of Reference Numbers:

[0234] 1 - distributor

[0235] 2 - pump

[0236] 3 - piston

[0237] 4 - syringe

[0238] 5 - tube

[0239] 6 - micro- spray nozzle

[0240] 7 - carrier gas inlet

[0241] 8 - first high-voltage source

[0242] 9 - conductive part

[0243] 10 - evaporation space

[0244] 11 - second high-voltage source

[0245] 12 - planar surface suitable for mass spectrometry

[0246] 13 - mask

[0247] 14 - middle part of Petri dish insert

[0248] 15 - side reservoir

[0249] 16 - side walls of Petri dish insert

Claims

CLAIMS1. A method for detecting the activity of a toxin produced by bacteria of Peptostreptococcaceae or Clostridiaceae families using mass spectrometry, characterized in that it comprises the following steps: a) providing a planar surface (12) suitable for mass spectrometry measurement, with attached affinity molecules; b) incubating the planar surface (12) from step a) with a substrate of the toxin to be detected, to bind the substrate to the affinity molecules; c) subsequently, incubating the planar surface (12) from step b) with a sample in which the active toxin is to be detected, in the presence of a modification compound, for a time sufficient for the substrate to react with the modification compound in the presence of the active toxin, if present in the sample, to form a modified substrate if the active toxin is present in the sample; d) removing the remnants of the sample; e) subjecting the (modified) substrate on the planar surface (12) to matrix-assisted laser desorption / ionization, ionizing it and subsequently measuring the mass spectrum of the (modified) substrate; f) analyzing the measured mass spectrum, wherein if the measured mass spectrum corresponds to the non-modified substrate, the active toxin is not present, and if the measured mass spectrum corresponds to the modified substrate or a mixture of the modified and non-modified substrate, then the active toxin is present in the sample.

2. The method according to claim 1, characterized in that step a) of providing the planar surface(12) suitable for mass spectrometry measurement with affinity molecules attached to the planar surface (12) is carried out via soft landing of the affinity molecule ions onto the planar surface (12) for mass spectrometry by means of a device for ambient ion soft landing, which comprises a pump (2) connected to a reservoir for the stock solution of the affinity molecule, wherein said reservoir is provided with an outlet, which is provided with an electrically conductive portion (9) connected to a first high-voltage source (8), wherein the electrically conductive portion (9) of the reservoir is connected to a distributor (1), preferably via a tube (5), and the distributor (1) is further connected to a carrier gas supply (7) and to a micro-spray nozzle (6) adapted to spray the solution of the affinity molecule in the form of droplets through an evaporation space (10) and optionally a mask(13) onto the planar surface (12) suitable for mass spectrometry, wherein the mask (13) or the planar surface (12) for mass spectrometry is connected to a second high-voltage source (11);wherein at first, the stock solution of the affinity molecule is converted into an aerosol using the micro-spray nozzle (6), the carrier gas, and the high-voltage source (8); said aerosol is then dried by passing through the evaporation space (10) and optionally the mask (13), so that at least one beam of the desolvated affinity molecule ions lands on the planar surface (12) suitable for mass spectrometry, wherein the mask (13) or the planar surface (12) for mass spectrometry is connected to the second high-voltage source (11), and wherein after landing, the beam of desolvated affinity molecule ions reacts with the surface (12) for mass spectrometry, wherein the ions are discharged and the affinity molecules are immobilized on the surface (12) in their molecular form.

3. The method according to claim 2, characterized in that the carrier gas and the affinity molecule stock solution are supplied to the nozzle (6) under a pressure in the range of from 0.05 to 0.5 MPa and / or the voltage in the first and second high-voltage sources (8, 11) is in the range of from 200 to 8000 V and / or the temperature in the evaporation space (10) is in the range of from 30 to 80 °C.

4. The method according to any one of the preceding claims 1 to 3, characterized in that the affinity molecule is a protein molecule, preferably selected from the group comprising streptavidin, avidin, neutravidin, anti-HA-tag antibody, anti-Spot-tag antibody, anti-Spot-tag single-domain antibody, anti-C-tag single-domain camelid antibody, anti-MYC-tag antibody, anti- MYC-tag single-domain antibody, anti-Flag-tag antibody, anti-His-tag antibody, and anti-PE-His- tag antibody.

5. The method according to any one of the preceding claims 1 to 4, characterized in that the substrate of the toxin to be detected is selected from the group comprising Rho, Rac, Rap, and Cdc42 proteins, preferably the substrate of the toxin is Rho, Rac, Rap, or Cdc42 prepared using the pGEX expression plasmid.

6. The method according to any one of the preceding claims 1 to 5, characterized in that step b) of binding the substrate of the toxin to be detected to the affinity molecules attached to the planar surface (12) is carried out by applying a solution of the substrate, preferably labeled with a tag compatible with the affinity molecule, to the planar surface (12) with the attached affinitymolecules from step a), followed by incubation for a time sufficient for the substrate to bind to the affinity molecules; preferably, the substrate tag, if present, is selected from the group comprising Avi-tag, Flag-tag, MYC-tag, HA-tag, Spot-tag, C-tag, Strep-tag, His-tag, and PE-His-tag.

7. The method according to any one of the preceding claims 1 to 6, characterized in that the sample in which the active toxin is to be detected in step c) is a stool extract.

8. The method according to any one of the preceding claims 1 to 7, characterized in that the modification compound is UDP-a-D-glucose.

9. The method according to any one of the preceding claims 1 to 8, characterized in that the planar surface (12) suitable for mass spectrometry measurement is selected from the group comprising a microscope slide provided on its surface with an ITO layer, a surface compatible with MALDI mass spectrometers routinely used for the identification of microorganisms in clinical laboratories, a DESI surface, a MALDI plate, and a MALDI chip.

10. The method according to any one of the preceding claims 1 to 9, characterized in that step c) of incubating the planar surface (12) from step b) with the sample in which the active toxin is to be detected is performed in the presence of a mixture of protease inhibitors, preferably selected from the group comprising serine protease inhibitors, cysteine protease inhibitors, and metalloprotease inhibitors.

11. The method according to any one of the preceding claims 1 to 10, characterized in that step c) of incubating the planar surface (12) from step b) with the sample in which the active toxin is to be detected, in the presence of the modification compound, is carried out in a reaction buffer, preferably selected from Good’s buffers, more preferably from HEPES buffer, Tris buffer, MOPS buffer, glycylglycine buffer, and TAPSO buffer, wherein the time sufficient for the substrate to react with the active toxin is at most 4 hours, preferably 0.5 to 2.5 hours, more preferably 1 to 2 hours; preferably at a temperature in the range of from 30 to 40 °C.

Images