Composition for increasing stability or expression of exogenous RNA in cells, comprising inhibitor of trim25 expression or activity

Abstract

The present invention relates to a use for increasing the stability or expression of exogenous RNA in cells through inhibition of TRIM25 expression or activity. Since TRIM25 acts as a key negative regulator in LNP RNA delivery, inhibition of TRIM25 expression or activity can greatly increase gene delivery efficiency and is useful in the design and development of therapeutic mRNA vaccines.

Description

Composition for increasing stability or expression of exogenous RNA in a cell comprising an inhibitor of expression or activity of TRIM25

[0001] The present invention relates to the use of increasing the stability or expression of exogenous RNA in a cell by inhibiting TRIM25 expression or activity.

[0002] Exogenous RNA, such as viral RNA and therapeutic mRNA, must interact with cellular factors to enter cells while simultaneously evading cellular defense mechanisms. Therefore, developing effective mRNA therapeutics requires exploiting and overcoming these cellular barriers. Recent advances in mRNA technology have significantly improved gene delivery efficiency, establishing mRNA as a crucial therapeutic tool and reaching billions of people during the COVID-19 pandemic. Therapeutic mRNA is synthesized via in vitro transcription (IVT) and encapsulated in lipid nanoparticles (LNPs) composed of ionic lipids, phospholipids, cholesterol, and polyethylene glycol (PEG)-linked lipids. Within acidified endosomes, the ionic lipids protonate, disrupting the endosomal membrane and releasing the mRNA into the cytoplasm.

[0003] Current clinically used mRNA vaccines have a linear structure, including a 5′ cap, a poly(A) tail, and an N1-methylpseudouridine (m1Ψ) modification, which enhances protein expression. Alternative platforms, such as circular RNA (circRNA) and self-amplifying RNA (saRNA), are also being explored for sustained mRNA vaccine expression. While the m1Ψ modification is advantageous in linear mRNA, it interferes with cis-elements such as the internal ribosome entry site (IRES), making it incompatible with alternative platforms and requiring further research.

[0004] Despite the biological importance and diverse applications of mRNA, our understanding of how exogenous mRNA interacts with cellular mechanisms remains limited. For example, array-based genome functional disruption screening using IVT mRNA has been performed, revealing the importance of membrane trafficking and endosomal maturation [SLAS Discov 25, 605-617]. However, this array screen only used mRNA modified with 5-methoxyuridine (mo5U), limiting scalability. Despite the diverse applications of LNP-mRNA, its regulatory mechanisms remain largely unknown. Therefore, a deeper understanding of the cellular processes that regulate the life cycle of exogenous RNA is crucial for advancing the development of mRNA therapeutics.

[0005] To systematically identify intracellular regulatory factors affecting exogenous mRNA, we performed a genome-wide CRISPR-Cas9 knockout screen. By integrating three genome-wide knockout (KO) screens, we identified cellular proteins critical for LNP mRNA delivery, confirming TRIM25 as a key negative regulator, thereby completing the present invention.

[0006] One aspect is to provide a composition for increasing the stability or expression of intracellular RNA comprising an inhibitor of TRIM25 expression or activity.

[0007] Another aspect is to provide a method for increasing the expression or activity of a target RNA within a cell in vitro.

[0008] Another aspect is to provide a method for screening substances for increasing the stability or expression of RNA within a cell.

[0009] Another aspect is to provide a method for screening chemical modifications of nucleic acids that enhance expression or activity of RNA.

[0010] One aspect provides a composition for increasing the stability or expression of intracellular RNA comprising an inhibitor of TRIM25 expression or activity.

[0011] The term "TRIM25 (Tripartite motif containing 25)" used herein refers to an E3 ubiquitin ligase belonging to the TRIM (Tripartite motif) protein family, which has a tripartite motif consisting of a RING genius structure (RING finger), a B-box domain, and a coiled-coil domain. TRIM25 functions to conjugate ubiquitin to specific target proteins and plays a major role mainly in the innate immune response and antiviral response.

[0012] In one specific example, the composition may further comprise an inhibitor of the expression or activity of a TRIM25 cofactor. Specifically, the composition may further comprise an inhibitor of the expression or activity of an endoribonuclease capable of acting as a TRIM25 cofactor.

[0013] In one specific example, the composition may be administered in combination with an inhibitor of TRIM25 cofactor expression or activity.

[0014] In one specific example, the composition may further comprise one or more expression or activity inhibitors selected from the group consisting of N4BP1, KHNYN, and ZAP.

[0015] In one specific example, the composition may be treated in combination with one or more expression or activity inhibitors selected from the group consisting of N4BP1, KHNYN, and ZAP.

[0016] The term "N4BP1 (NEDD4 Binding Protein 1)" in this specification refers to a protein that binds to NEDD4, an E3 ubiquitin ligase, and is a multifunctional regulatory protein that mainly functions in protein degradation regulation, immune signaling, RNA metabolism, etc.

[0017] The term "KHNYN (KH And NYN Domain Containing)" in this specification refers to a protein containing both a KH (K-homology) domain and a NYN nuclease domain, which is known as an antiviral enzyme protein mainly associated with RNA binding and RNA cleavage activities.

[0018] The term "ZAP (Zinc-finger Antiviral Protein)" used herein refers to an antiviral protein with a zinc-finger structure, which is an innate immune factor that inhibits viral replication by recognizing viral RNA and inducing its degradation.

[0019] The above combination treatment may mean administering the TRIM25 expression or activity inhibitor and the N4BP1, KHNYN and / or ZAP expression or activity inhibitor sequentially, separately, or in any order.

[0020] In one specific example, the RNA may be exogenous RNA. Exogenous RNA refers to RNA derived from outside the cell and introduced into the cell through artificial or natural means, and is generally distinguished from RNA synthesized endogenously within the body. The exogenous RNA may have various biological origins, such as eukaryotic cells, prokaryotic cells, or viruses, and may also include artificially synthesized RNA.

[0021] The composition may increase the stability or expression of exogenous RNA introduced into a cell by inhibiting the expression or activity of TRIM25 within the cell. TRIM25 can induce a cellular immune response to exogenous RNA or induce RNA degradation, and thus the composition may prevent degradation of exogenous RNA and increase the biological efficacy of the RNA by inhibiting the function of TRIM25.

[0022] In one specific example, the exogenous RNA may be an mRNA vaccine. An mRNA vaccine comprises messenger RNA encoded to express a specific antigen, and refers to a vaccine platform that induces an immune response by expressing the antigen protein within a host cell. The composition can increase the stability and protein expression efficiency of the mRNA vaccine.

[0023] In one specific example, the exogenous RNA may be encapsulated in a lipid nanoparticle (LNP) and delivered into the cell. The lipid nanoparticle refers to a nanometer-sized particle composed of lipid molecules used as a carrier for nucleic acid or drug delivery. The lipid nanoparticle may include one or more lipids selected from the group consisting of ionic lipids, phospholipids, cholesterol, and polyethylene glycol (PEG)-linked lipids.

[0024] The lipid nanoparticles may be composed of a single or multiple types of lipid components, and the components may affect the size, charge, stability, and cell permeability of the LNPs depending on their composition ratio and structure. Preferably, the lipid nanoparticles include cationic ionic lipids to electrostatically bind to RNA, thereby enabling efficient capture and delivery of RNA.

[0025] In one specific example, the RNA may be at least one selected from the group consisting of mRNA, circular RNA, dsRNA, shRNA, miRNA, gRNA, saRNA, lncRNA, taRNA, ribozyme, and ncRNA.

[0026] The above TRIM25 expression inhibitor may include, but is not limited to, one or more selected from the group consisting of siRNA, shRNA, oligonucleotide, antisense nucleotide, and sgRNA that specifically bind to the TRIM25 gene.

[0027] The above TRIM25 activity inhibitor may include, but is not limited to, one or more selected from the group consisting of antibodies or antigen-binding fragments thereof that specifically bind to TRIM25 protein, interacting proteins, PROTACs, oligopeptides, ligands, nanoparticles, aptamers, avidity multimers, and peptidomimetics.

[0028] The above N4BP1, KHNYN and / or ZAP expression inhibitor may include, but is not limited to, one or more selected from the group consisting of siRNA, shRNA, oligonucleotide, antisense nucleotide and sgRNA that specifically bind to the N4BP1, KHNYN and / or ZAP genes, respectively.

[0029] The above N4BP1, KHNYN and / or ZAP activity inhibitor may include, but is not limited to, one or more selected from the group consisting of antibodies or antigen-binding fragments thereof, interacting proteins, oligopeptides, ligands, nanoparticles, aptamers, PROTACs, avidity multimers and peptidomimetics that specifically bind to N4BP1, KHNYN and / or ZAP proteins, respectively.

[0030] The composition may be administered orally or parenterally during clinical administration. For example, it may be administered by one or more of various routes, including oral, intravenous, intramuscular, intraarterial, intramedullary, intramedullary, subcutaneous, intraventricular, transdermal, intradermal, rectally, intravaginally, intraperitoneally, intraocularly, subretinal, intravitreal, topical, mucosal, transnasal, buccal, enteral, intravitreal, intratumoral, sublingual (under the tongue), and intranasal.

[0031] The above composition is not particularly limited in its formulation, and may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., as well as external preparations, suppositories, and sterile injectable solutions, according to conventional methods. When formulating the above composition, it may be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants commonly used in the art.

[0032] TRIM25 can act as a negative regulator of exogenous RNA within cells. The composition of the present invention can prevent cells from recognizing exogenous RNA as foreign RNA and degrading it or inducing an immune response by inhibiting the expression or activity of TRIM25. Thus, the composition can induce increased stability of exogenous RNA within cells, increased expression of exogenous RNA within cells, or both. Therefore, the composition of the present invention can be useful for utilizing exogenous RNA as a therapeutic agent. The composition can increase the stability and / or expression of a target intracellular RNA in vitro, in vivo, or ex vivo.

[0033] Another aspect provides a method for increasing the stability or expression of RNA within a cell, comprising treating the subject with an inhibitor of TRIM25 expression or activity.

[0034] Another aspect provides the use of TRIM25 expression or activity inhibitors to increase the stability or expression of intracellular RNA.

[0035]

[0036] Another aspect provides a method for increasing the expression or activity of a target RNA in a cell in vitro. Specifically, the method comprises:

[0037] A step of inhibiting the expression or activity of TRIM25 in cells in vitro; and

[0038] It comprises a step of introducing target RNA into a cell.

[0039] The inhibition of the expression or activity of TRIM25 may include, but is not limited to, any one or more selected from the group consisting of TRIM25 gene knockout, knockdown, conditional gene knockout, genetic modification, and RNA interference.

[0040] In one embodiment, the method may further comprise a step of inhibiting the expression or activity of one or more selected from the group consisting of N4BP1, KHNYN, and ZAP.

[0041] The step of inhibiting the expression or activity of N4BP1, KHNYN and / or ZAP may be performed sequentially, individually, or in any order with the step of inhibiting the expression or activity of TRIM25.

[0042] In one specific example, increasing the expression or activity of the target RNA may increase the production of the target RNA or a polypeptide encoded by the target RNA.

[0043] In one specific example, the target RNA may be an exogenous RNA.

[0044] In one specific example, the target RNA may be encapsulated in a lipid nanoparticle (LNP) and delivered into the cell.

[0045] In one specific example, the RNA may be at least one selected from the group consisting of mRNA, circular RNA, dsRNA, shRNA, miRNA, gRNA, saRNA, lncRNA, taRNA, ribozyme, and ncRNA.

[0046] Another aspect provides a method for screening a substance for increasing the stability or expression of RNA within a cell. Specifically, the method

[0047] A step of treating a candidate substance to cells;

[0048] A step of measuring the intracellular expression or activity of TRIM25 in cells treated with the above candidate substance; and

[0049] It includes a step of selecting a candidate substance that changes the intracellular expression or activity of TRIM25 compared to an untreated control group.

[0050] In one specific example, the selection step may further include a step of determining the candidate substance as a substance for increasing the stability or expression of intracellular RNA when the intracellular expression or activity of TRIM25 is reduced compared to an untreated control group.

[0051] In one specific example, the measurement of the intracellular expression of TRIM25 may be performed by labeling with a label that generates a detectable signal (the label is, for example, chemically (e.g., covalently or non-covalently), recombinantly, or physically bound) or by labeling in a form in which a tag to which the label can be bound is attached, and then measuring a signal generated from the label through a conventional enzymatic reaction, fluorescence, luminescence, and / or radiological detection. The measurement of the signal may be measured by any signal detection means conventionally used to detect or measure it (e.g., a conventional fluorescence microscope, a fluorescence camera, a fluorescence intensity measurement (quantitation) device, etc.).

[0052]

[0053] Another aspect is,

[0054] A step of obtaining an experimental cell in which the expression or activity of the TRIM25 gene or the protein encoded by the gene is suppressed within the cell;

[0055] A step of treating RNA having a candidate chemical modification to experimental cells and normal cells in which TRIM25 expression or activity is suppressed;

[0056] A step of measuring the expression level of RNA having a candidate chemical modification or the activity level of the expressed protein in the above experimental cells and normal cells; and

[0057] A method for screening a chemical modification of a nucleic acid that enhances RNA expression or activity is provided, comprising a step of determining that the chemical modification enhances RNA expression or activity when the expression level of RNA of an experimental cell or the activity level of an expressed protein is equivalent to the expression level of RNA of a normal cell or the activity level of an expressed protein.

[0058] Regarding the inhibition of expression or activity of the above RNA and TRIM25, it is as described above. Specifically, the above RNA may be an exogenous RNA encapsulated in a lipid nanoparticle (LNP) and delivered into the cell.

[0059] The term "chemical modification of nucleic acid" in this specification means that the chemical structure of a nucleic acid (DNA or RNA) such as a base, sugar, or phosphate has been modified, and includes both natural chemical modification and artificial chemical modification.

[0060] If the exogenous RNA exhibits substantially equivalent expression or activity levels in experimental cells in which TRIM25 expression or activity is suppressed and in normal cells, the exogenous RNA can be considered to contain a chemical modification capable of evading TRIM25. Accordingly, the exogenous RNA can be considered to contain a chemical modification that enhances RNA expression or activity.

[0061]

[0062] Another aspect is,

[0063] A step of measuring the binding or interaction of RNA with a candidate chemical modification and TRIM25; and

[0064] A method for screening a chemical modification of a nucleic acid that enhances expression or activity of RNA is provided, comprising a step of determining that the candidate chemical modification is a chemical modification that enhances RNA expression or activity if TRIM25 does not bind or interact with the RNA having the candidate chemical modification.

[0065] Regarding the above RNA, inhibition of TRIM25 expression or activity, and chemical modification of nucleic acids, the same is as described above. Specifically, the RNA may be an exogenous RNA encapsulated in a lipid nanoparticle (LNP) and delivered into cells.

[0066] TRIM25 can act as a negative regulator of exogenous RNA within cells. If RNA with a candidate chemical modification does not bind or interact with TRIM25, the exogenous RNA can be considered to contain a chemical modification that evades TRIM25. If the RNA containing the candidate chemical modification evades TRIM25, the RNA can be prevented from being degraded by the cell or from inducing an immune response. Therefore, in such cases, the exogenous RNA can be considered to contain a chemical modification that enhances RNA expression or activity.

[0067] In one specific example, the measurement of the binding or interaction may be performed at a pH of 7.0 or lower.

[0068]

[0069] The present invention is susceptible to various modifications and embodiments. Specific embodiments are illustrated in the drawings and described in detail in the following detailed description. However, this is not intended to limit the present invention to specific embodiments, but rather to encompass all modifications, equivalents, and alternatives falling within the spirit and technical scope of the present invention. In describing the present invention, detailed descriptions of related known technologies will be omitted if they are deemed to obscure the gist of the present invention.

[0070] TRIM25 acts as a key negative regulator in LNP RNA delivery. Inhibiting TRIM25 expression or activity can significantly increase gene delivery efficiency and is useful for designing and developing therapeutic RNA vaccines.

[0071] Figure 1 is a schematic diagram of whole-genome CRISPR-Cas9 knockout screening.

[0072] Figure 2 is a schematic diagram of mRNA formulated in LNP (LNP-mRNAs).

[0073] Figure 3 shows the results of evaluating GFP expression in EGFP LNP-mRNA treated cells with or without m1Ψ using flow cytometry and signal quantification analysis.

[0074] Figure 4 shows the results of a dot blot analysis showing the IVT mRNA gene expression level after PKR knockdown and the dsRNA byproduct according to its quantification.

[0075] Figure 5 is a graph showing the results of Western blot analysis confirming phosphorylation of PKR and eIF2α, polysome profiling results, IFNB1 mRNA levels, and representative ISG expression levels.

[0076] Figure 6 is a diagram analyzing the distribution of sgRNAs in the GFPLow and GFPHigh groups. A is the read count distribution of individual sgRNAs, B is a scatter plot showing the log2 enrichment of all sgRNAs within the CRISPR library, C is a scatter plot based on FDR rank distinguishing the GFPLow and GFPHigh groups, and D is a heatmap showing the Pearson correlation coefficient for the gene-level log2 enrichment of significant genes (FDR < 0.05) across different conditions.

[0077] Figure 7 shows the results of the CRISPR-KO screen and the major GO term enrichment results of significant genes derived from GFPHigh and GFPLow conditions.

[0078] Figure 8 shows the results of STRING analysis showing the protein-protein interaction network of positive regulators identified through the screen and the GO term enrichment results of the top 10 candidates.

[0079] Figure 9 is a heatmap showing the log2 enrichment of genes involved in HSPG biosynthesis and V-ATPase.

[0080] Figure 10 shows (top) a view showing a decrease in protein production after knocking down a gene related to the HSPG pathway or a V-ATPase subunit gene, and (bottom) the results of measuring the knockdown efficiency using RT-qPCR.

[0081] Figure 11 is a graph showing luciferase expression in HCT116 cells deficient in HSPG biosynthesis factors or V-ATPase subunits.

[0082] Figure 12 shows the results of observing a decrease in protein production using HEK293T and HeLa cells (top) and measuring the knockdown efficiency using RT-qPCR (bottom).

[0083] Figure 13 is a diagram showing the amount of protein produced from EGFP mRNA transfected into HCT116 cells after heparin treatment.

[0084] Figure 14 shows the amount of protein produced from EGFP mRNA transfected into HCT116 cells after treatment with BafA1, Pitstop-2, or Dynole.

[0085] Figure 15 is a graph showing the results of RT-qPCR analysis of intracellular EGFP IVT mRNA levels after heparin or BafA1 treatment.

[0086] Figure 16 is a graph showing the poly(A) length distribution measured by Hire-PAT analysis after heparin or BafA1 treatment.

[0087] Figure 17 is a diagram confirming the luciferase expression level of Fluc mRNA delivered to HCT116 cells via LNP 2.

[0088] Figure 18 shows the FDR ranking-based gene scatter plot (left) and the fold enrichment of sgRNAs targeting TRIM25 (right) under GFPHigh conditions.

[0089] Figure 19 is a graph confirming protein production from unmodified EGFP LNP-mRNA when TRIM25 or WDR77 was knocked down in HCT116 cells.

[0090] Figure 20 shows the results of Western blot analysis of TRIM25 in HCT116 WT or TRIM25 KO-1, KO-2 cells.

[0091] Figure 21 is a graph confirming luciferase expression and GFP expression from Fluc LNP-mRNA in HCT116 WT or TRIM25 KO-1, KO-2 cells.

[0092] Figure 22 is a graph showing relative luciferase expression for m1Ψ and U Fluc LNP-mRNA in HCT116 cell lines.

[0093] Figure 23 is a graph showing the measurement of luciferase expression by Fluc LNP-mRNA in primary mouse BMDM cells and various human cell lines (HeLa, THP-1, Jurkat, HEK293T) (top) and representative ISG expression levels (bottom).

[0094] Figure 24 is a graph measuring luciferase expression from LNP-mRNA (top) and Fluc mRNA-2 or Rluc mRNA (bottom) with the 5′ end in an uncapped, cap0, or cap1 state.

[0095] Figure 25 is a graph showing the distribution of Fluc LNP-mRNA extracted by collecting the polysome profiling and ribosome fractions after transfecting HCT116 WT or TRIM25 KO cells with Fluc LNP-mRNA, measured by RT-qPCR.

[0096] Figure 26 is a graph measuring the intracellular abundance of Fluc LNP-mRNA by RT-qPCR.

[0097] Figure 27 is a graph outlining the pulse-chase experiment after Fluc LNP-mRNA transfection and measuring protein expression levels by luciferase analysis, mRNA abundance by RT-qPCR, and poly(A) length distribution by Hire-PAT analysis.

[0098] Figure 28 is a graph measuring the abundance of LNP-mRNA by RT-qPCR. In order, EGFP mRNA in TRIM25-deficient HCT116 GFP-stable cells or parental cell line, Fluc mRNA in HCT116 TRIM25 KO cells, and Fluc mRNA in GFP-stable cells.

[0099] Figure 29 is a schematic diagram of Fluc circular RNA and the automated electrophoresis results showing its integrity at each experimental step.

[0100] Figure 30 shows the results of measuring the mRNA level of ISG, luciferase expression, and its intracellular abundance by qRT-PCR after transfecting HCT116 WT or TRIM25 KO cells with Fluc circular RNA using LNP.

[0101] Figure 31 shows the results of RT-qPCR measurement of LNP-mRNA-derived luciferase expression, mRNA abundance, and knockdown efficiency of each gene under conditions where exonuclease (XRN1) and exosome components (DIS3, RRP41) were knocked down in HCT116 WT cells.

[0102] Figure 32 shows the results of measuring the expression of LNP-mRNA-derived luciferase, mRNA abundance, and knockdown efficiency of each gene by RT-qPCR under conditions in which endoribonuclease (RNASEL) involved in cytoplasmic innate immune response or RNASET2 / RNASE4 and PLD3 involved in RNA degradation within endosomes were knocked down in HCT116 WT cells.

[0103] Figure 33 shows gene-level enrichment (left) and domain structures (right) of human TRIM25, N4BP1, KHNYN, and ZAP proteins in a CRISPR KO screen using unmodified IVT mRNA.

[0104] Figure 34 is a graph measuring luciferase expression from linear Fluc LNP-mRNA along with KHNYN / ZAP knockdown after N4BP1 siRNA treatment in HCT116 WT or TRIM25 KO cells (top), the results of measuring the efficiency of N4BP1, KHNYN, and ZAP knockdown by RT-qPCR (middle), and the results of measuring the abundance of LNP-mRNA (bottom).

[0105] Figure 35 is a graph showing the results of western blot confirming the knockout of N4BP1 in HCT116 WT or TRIM25 KO cells and measuring luciferase expression from linear Fluc LNP-mRNA along with lentiviral KHNYN / ZAP knockdown.

[0106] Figure 36 is a graph measuring luciferase expression from circular RNA along with KHNYN / ZAP knockdown after N4BP1 siRNA treatment or gene deletion by lentiviral sgRNA in HCT116 WT or TRIM25 KO cells.

[0107] Figure 37 is a graph showing luciferase expression after transfection of Fluc LNP-mRNA with various base modifications under TRIM25 knockdown conditions.

[0108] Figure 38 is a schematic diagram of a TRIM25 RNA immunoprecipitation (RNA-IP) experiment and a graph showing the relative enrichment compared to input as measured by RT-qPCR.

[0109] Figure 39 shows an overview of RNA pulldown experiments performed by immobilizing poly(A)+ UTR-2 RNA bait containing m1Ψ or U onto oligo-dT beads and the results of experiments performed on endogenous or exogenous TRIM25 protein.

[0110] Figure 40 shows the results of in vitro RNA binding experiments, SDS-PAGE analysis, and size exclusion chromatography using purified recombinant human TRIM25 protein and poly(A)+ UTR-2 RNA bait.

[0111] Figure 41 shows the results of RNA pulldown and western blot experiments using UTR-1 RNA as bait.

[0112] Figure 42 is a graph showing the results of a TRIM25 restoration experiment and a western blot analysis of an exogenously expressed TRIM25 variant.

[0113] Figure 43 is a schematic diagram of an in vitro ubiquitination experiment using immunoprecipitated TRIM25 as an E3 ligase and the results of an in vitro ubiquitination experiment comparing TRIM25 WT, 7KA RNA binding mutant, and R54P E3 mutant using Fluc IVT mRNA.

[0114] Figure 44 is a schematic diagram of Fluc LNP-mRNA transfection and TRIM25 knockdown in GFP stable expressing cells, and a graph showing GFP (intracellular mRNA) and luciferase (LNP-mRNA) expression measured by flow cytometry and luciferase analysis, respectively.

[0115] Figures 45, 46, and 47 show the results of confirming luciferase expression, GFP expression, or intracellular abundance after transfection of Fluc mRNA into HCT116 TRIM25 WT or KO-1 cells. Figure 45 shows Fluc mRNA transfection via Lipofectamine, Figure 46 via electroporation, and Figure 47 via LNP-2.

[0116] Figure 48 is a graph showing RNA quality and binding of 30-nt poly(A)+ IVT RNA bait immobilized on oligo-dT beads at a specified pH.

[0117] Figure 49 shows the RNA pulldown experiment performed at the indicated pH using HCT116 WT cell extracts with UTR-1 or UTR-2 as bait and the corresponding western blot results.

[0118] Figure 50 shows the results of an RNA pulldown experiment performed using CALM1 UTR as bait and an in vitro RNA binding experiment using purified TRIM25 protein.

[0119] Figure 51 shows the results of an in vitro RNA binding experiment performed in a potassium phosphate buffer (pH-wise) adjusted at pH intervals of 0.2 using purified TRIM25 protein.

[0120] Figure 52 is a proposed model of the intracellular regulatory mechanism for LNP-mRNA.

[0121] The following examples are provided for more detailed description. However, these examples are provided solely to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0122]

[0123] Example 1. CRISPR-Cas9 screening to identify regulatory factors of LNP-mRNA.

[0124] To explore the regulatory mechanisms of exogenous mRNA, we performed a lentiviral-based genome-wide CRISPR-Cas9 KO screen, targeting 19,114 protein-coding genes, comprising approximately 4 sgRNAs per sgRNA, for a total of 77,441 sgRNAs. The sgRNA library was introduced into HCT116, a human epithelial cell line characterized by a stable diploid karyotype, a rapid and organized endocytosis pathway capable of efficient LNP delivery, and a well-characterized interferon (IFN) response to exogenous nucleic acids. After 7 days of puromycin selection, IVT mRNA encoding EGFP was introduced via LNP (Fig. 1). The introduced mRNA contained a 5′ cap1 structure, a 120-nt poly(A) tail, a synthetic 5′ UTR, and a human alpha-globin-derived 3′ UTR, which are similar to the UTR used in the mRNA-1273 COVID-19 vaccine (Fig. 2). These mRNAs were produced in two forms, one with and one without the m1Ψ modification, to enable analysis of the regulatory mechanism dependent on base modification.

[0125] As a result, as expected, mRNA containing m1Ψ produced more protein than unmodified mRNA (Fig. 3).

[0126]

[0127] The IVT mRNA was encapsulated in LNPs composed of the same four lipid components (ALC-0315, DSPC, cholesterol, and ALC-0159) used in the BNT162b2 COVID-19 vaccine. The LNP formulation and transfection conditions were optimized to minimize cell-to-cell variation in transfection efficiency, enabling GFP expression-based screening. Since we aimed to identify single-stranded mRNA-specific regulatory factors, we induced dsRNA responses through PKR, OAS, TLR3, RIG-I, and MDA5 to reduce dsRNA byproducts derived from the IVT reaction that could nonspecifically interfere with gene regulation. The IVT DNA template was constructed by PCR using a reverse primer with a 2′-O-methyl group introduced at the terminal and terminal positions to ensure accurate transcription termination.

[0128] As a result, PKR knockdown affected gene expression from IVT mRNA only when large amounts of dsRNA were co-transfected. In LNP experiments, Fluc IVT mRNA was encapsulated in LNPs and transfected in the same manner as in the previous experiments. In Lipofectamine experiments, Fluc mRNA was transcribed from template DNA (PCR product) lacking a terminal 2'-O-methyl group, resulting in increased production of dsRNA byproducts (Fig. 4). Furthermore, as expected, the generated RNA did not induce IFN responses, PKR phosphorylation, or overall translational inhibition (Fig. 5).

[0129]

[0130] Afterwards, cells with the lowest (bottom 2.5%, GFPLow) or highest (top 2.5%, GFPHigh) fluorescence signal were isolated using fluorescence-activated cell analysis (FACS). To extend the correlation analysis, cells meeting the second most stringent criteria (bottom or top 2.55%, designated “2nd GFPLow” or “2nd GFPHigh,” respectively) were also collected. The distribution of sgRNAs in each group was then analyzed through PCR amplification and sequencing. Significant candidate genes were selected using the MAGeCK algorithm.

[0131] As a result, significant hit genes were derived with a false discovery rate (FDR) < 0.05 in both GFPLow and GFPHigh, and no loss of integrity of sgRNA was observed (Fig. 6).

[0132]

[0133] In addition to these IVT mRNA-based screenings, we performed control experiments using a cell line stably expressing GFP (“GFP-stable cell”) to examine differences in regulatory mechanisms between endogenous and exogenous RNAs. EGFP mRNA produced in this cell line is identical to IVT EGFP mRNA, except for additional sequences derived from the polyadenylation signal.

[0134] Control screening of this GFP-stable cell line revealed a specific enrichment of transcription-related genes even without transfection with IVT mRNA, suggesting different requirements for cell-derived mRNA and IVT mRNA (Fig. 7).

[0135]

[0136] Example 2. Confirmation of the roles of HSPG and V-ATPase

[0137] (1) Identification of positive regulatory factor candidates

[0138] Screening using IVT mRNA in Example 1 identified several positive regulatory factor candidates, including genes involved in heparan sulfate proteoglycan (HSPG) biosynthesis, vesicle transport, and V-ATPase components (Fig. 8). These genes were commonly enriched in both unmodified and m1Ψ-modified mRNA screens, suggesting that their roles are independent of RNA modification.

[0139]

[0140] (2) Confirmation of HSPG and exogenous RNA interaction

[0141] Although a previous study [SLAS Discov 25, 605-617] reported that V-ATPase is essential for LNP delivery in a genome-wide screen using mo5U-modified mRNAs in LNPs containing different ionic lipids (MC3) and PEGylated lipids (DMG-PEG 2000), other factors, including proteins involved in HSPG biosynthesis, had not been previously identified. Heparan sulfate is a highly acidic polysaccharide present on the cell surface and in the extracellular matrix that attracts external ligands and promotes their endocytosis. HSPG biosynthesis factors were strongly enriched under two stringent GFPLow conditions (Fig. 9).

[0142]

[0143] For further validation, we knocked down EXT1, EXT2, and NDST1 in HCT116 cells, and then introduced IVT mRNA encoding EGFP or Firefly luciferase (Fluc). Deletion of these factors resulted in a decrease in protein production from both mRNAs, regardless of the presence of base modifications (Figures 10 and 11). This pattern was also replicated in HEK293T and HeLa cells (Figure 12).

[0144]

[0145] Furthermore, when heparin, which competes with HSPGs on the cell surface, was treated, the GFP signal and the percentage of GFP-positive cells decreased in a concentration-dependent manner. When GFP-stable cells were transfected with Fluc mRNA, heparin specifically inhibited luciferase expression without affecting GFP expression. This indicates that HSPG-related factors act specifically on exogenous mRNA (Fig. 13).

[0146]

[0147] (3) Confirmation of interaction between V-ATPase and exogenous RNA

[0148] Next, we confirmed the role of V-ATPase, an ATP-driven proton pump that acidifies the lumen of the endosomes.

[0149] Depletion of V-ATPase subunits decreased protein production from IVT mRNA (EGFP and Fluc) in HCT116, HEK293T, and HeLa cells (Figs. 10 and 11). Furthermore, treatment with Bafilomycin A1 (BafA1), which inhibits V-ATPase, also reduced GFP production from IVT mRNA. Furthermore, when GFP-stable cells were transfected with Fluc mRNA and treated with BafA1, BafA1 selectively inhibited exogenous mRNA, suppressing only luciferase expression without affecting GFP. Furthermore, Pitstop-2 and Dynole, which are endocytic inhibitors targeting clathrin and dynamin I / II, respectively, also suppressed LNP-mRNA expression (Fig. 13).

[0150]

[0151] (4) Confirmation of the roles of HSPG and V-ATPse in the intracellular LNP delivery pathway

[0152] RNA analysis revealed that heparin reduced the intracellular abundance of IVT mRNA, whereas BafA1 increased mRNA levels (Fig. 15). This suggests that heparin inhibits initial uptake by interfering with LNP attachment to the cell surface, whereas BafA1 inhibits endosomal escape, leading to mRNA accumulation within endosomes.

[0153]

[0154] Subsequent analysis using high-resolution poly(A) tail analysis (Hire-PAT) revealed that a significant proportion of transfected mRNAs underwent deadenylation after 24 h of LNP-mRNA treatment, resulting in a poly(A) length distribution of 30–50 nt. This suggests that IVT mRNA entered the cytoplasm and was exposed to deadenylation. When heparin was treated, the overall signal intensity decreased but the poly(A) distribution did not change. This suggests that heparin inhibited mRNA entry but did not affect subsequent steps. In contrast, in the BafA1-treated group, most transfected mRNAs retained the original poly(A) length (~120 nt), indicating that the mRNAs did not reach the cytoplasmic deadenylase. In the control GFP-stable cells, neither heparin nor BafA1 affected GFP mRNA (Fig. 16).

[0155]

[0156] Additionally, experiments were conducted using another type of LNP (“LNP-2”) consisting of the ionic lipid SM-102 used in the mRNA-1273 COVID-19 vaccine and the PEGylated lipid DMG-PEG 2000.

[0157] As a result, both heparin and BafA1 strongly inhibited the expression of LNP-2-mRNA, indicating that HSPG and V-ATPase are essential for the overall LNP-based delivery (Fig. 17).

[0158]

[0159] Example 3. Confirmation of exogenous RNA suppression of TRIM25

[0160] (1) Identification of candidate voice modulators

[0161] This screening identified four negative regulator candidates (GFPHigh, FDR < 0.05), namely TRIM25, WDR77, HNRNPH1, and THOC2. Among them, TRIM25 was the most strongly enriched with the lowest FDR value in the unmodified mRNA screening, but was not enriched in the GFP-stable cells or m1Ψ-modified mRNA screening (Fig. 18). This suggests that TRIM25 selectively represses unmodified IVT mRNA. TRIM25 is an RNA-binding protein and E3 ligase known to have antiviral activity against RNA viruses. TRIM25 is also known to interact with immune sensors such as RIG-I and ZAP, as well as the G3BP protein.

[0162]

[0163] To verify this, considering the characteristics of IVT mRNA that acts in the cytoplasm without going through nuclear history, TRIM25 and WDR77, which are candidates existing in the cytoplasm, were knocked down.

[0164] As a result, depletion of TRIM25 increased GFP expression from unmodified mRNA, while WDR77 knockdown had no significant effect (Fig. 19).

[0165]

[0166] Additionally, two TRIM25 knockout (KO) cell lines (TRIM25 KO-1 and KO-2) were generated using different sgRNAs (Fig. 20). In these KO cells, unmodified mRNA produced more protein than the parental cell line (Fig. 21). Notably, in TRIM25 KO cells, unmodified mRNA produced luciferase at levels comparable to those of m1Ψ-modified mRNA. This demonstrates that TRIM25 is a key repressor of unmodified mRNA (Fig. 22).

[0167]

[0168] (2) Confirmation of TRIM25 activity in each cell

[0169] To investigate the activity of TRIM25 in various cell types, we depleted TRIM25 in HeLa (human epithelial cells), THP-1 (human monocytes), Jurkat (human T lymphocytes), and HEK293T (human embryonic kidney cells). In addition, the same experiment was performed in bone marrow-derived macrophages (mBMDM), a primary cell line derived from mice. Similar to HCT116 cells, TRIM25 depletion significantly increased the expression of intact mRNA in HeLa, THP-1, Jurkat, and mBMDM cells, but not in HEK293T cells. Although the surveillance mechanism mediated by TRIM25 shows some differences depending on the cell type, it was confirmed that this mechanism is universal and evolutionarily conserved (Fig. 23).

[0170]

[0171] (3) Confirmation of TRIM25 activity by RNA molecular characteristics

[0172] To further analyze the specificity of TRIM25, we tested IVT mRNAs with different molecular characteristics.

[0173] First, we compared mRNAs with different cap structures. mRNAs with cap0 (N7-methylguanosine, m7G) and cap1 (m7G plus 2′-O-methylation at the +1 position) exhibited different capping efficiencies, allowing us to analyze the impact of the 5′-terminal structure. As a result, TRIM25 depletion significantly increased luciferase expression regardless of the cap structure, indicating that TRIM25's action is independent of the 5′-terminal structure.

[0174] Additionally, we tested cases with various mRNA sequences. We used a variant of the Fluc-encoding mRNA with altered UTR (Fluc-2) and a Renilla luciferase (Rluc) mRNA with a short poly(A) tail (60 nt). In all cases, luciferase expression was increased in TRIM25 KO cells, demonstrating that TRIM25-mediated repression is independent of mRNA sequence or poly(A) tail length (Fig. 24).

[0175]

[0176] (4) Confirmation of TRIM25 inhibition mechanism

[0177] To understand how TRIM25 represses IVT mRNA, we first analyzed the translational status of these mRNAs using polysome profiling. Polysome profiling is a method for separating mRNAs undergoing translation based on the number of ribosomes bound on a sugar gradient.

[0178] As a result, TRIM25 deletion or base modification did not significantly affect overall polysome distribution, indicating that TRIM25 does not affect global translation. Furthermore, when the amount of IVT mRNA in each gradient fraction was quantified using RT-qPCR, no significant changes were observed due to TRIM25 deletion (Fig. 25). Thus, while the possibility that TRIM25 regulates translation cannot be completely ruled out, this is unlikely to be the primary mechanism of TRIM25 action.

[0179]

[0180] Next, the effect of TRIM25 on RNA amount was analyzed using RT-qPCR.

[0181] As a result, TRIM25-deficient cells showed a dramatic increase in the level of unmodified IVT mRNA. The level of modified mRNA increased only slightly. In contrast, no significant increase was observed when treated with BafA1, which inhibits endosomal escape. This indicates that TRIM25 primarily acts by reducing mRNA levels after mRNA enters the cytoplasm (Fig. 26).

[0182]

[0183] Additionally, a time-course experiment was performed, in which cells were treated with LNP-mRNA for only 2 hours and then washed, followed by tracking changes over time. Even immediately after washing after 2 hours of treatment, luciferase expression and RNA levels of unmodified mRNA were already lower than those of m1Ψ-modified mRNA, and this suppression was alleviated in TRIM25-deficient cells. This indicates that TRIM25 activates a very rapid repression mechanism (Fig. 27). Increases in both EGFP and Fluc mRNA levels were also observed in TRIM25 knockdown or deficient cells. These results suggest that TRIM25 promotes mRNA degradation (Fig. 28).

[0184] Since deadenylation is generally considered a rate-determining step in mRNA degradation, we also analyzed the poly(A) tail length after 2 h of transfection and washing. As a result, TRIM25 deletion did not significantly affect the deadenylation rate, indicating that TRIM25 does not act to accelerate deadenylation (Fig. 27).

[0185]

[0186] Example 4. Identification of N4BP1, KHNYN, and ZAP as TRIM25 cofactors.

[0187] To determine whether TRIM25 induces endonucleolytic cleavage, we performed experiments using circular RNA (circRNA) lacking a 5′ cap and poly(A) tail (Fig. 29). Because m1Ψ interferes with circularization and IRES activity, we constructed a circRNA without the m1Ψ modification.

[0188] As a result, circRNAs did not significantly induce the expression of IFNβ and ISGs. However, under TRIM25-deficient conditions, circRNA-derived luciferase expression was significantly increased. RNA levels were also higher in TRIM25-deficient cells than in the control. In addition, similar to unmodified linear mRNA, circRNAs did not accumulate in cells treated with BafA1 (Fig. 30). These results suggest that TRIM25 represses not only linear mRNA but also circular RNA, and that this process is independent of exonuclease. In fact, no significant derepression effect was observed when XRN1, a 5′→3′ exonuclease, and EXOSC4 (RRP41) and DIS3 (RRP44), 3′→5′ exosome subunits, were knocked down (Fig. 31).

[0189]

[0190] These results strongly suggest the involvement of endoribonucleases. Additionally, a candidate gene approach was used to eliminate several RNases known to be involved in the cytosolic innate immune response and RNA degradation within endolysosomes. These included the endoribonucleases RNase L, RNase T2, and RNase 4, as well as PLD3, a lysosomal 5′→3′ exonuclease. However, genome-wide screening and knockdown experiments did not confirm their involvement (Fig. 32).

[0191] To identify the RNase involved in TRIM25-mediated mRNA degradation, we revisited the knockout screening data and reviewed genes whose expression was increased but did not meet the statistical criteria. We identified N4BP1 (NEDD4-binding protein 1), an endoribonuclease that ranked seventh in the screening of unmodified IVT mRNA with a log2FC of 0.99 and an FDR of 0.12 (Figure 33). N4BP1 contains a NYN domain (endoribonuclease domain), a KH-like domain (putative RNA-binding domain), and ubiquitin-binding domains, UBA and CoCUN. N4BP1 has a potential paralog, KHNYN, which ranked 4027th in the screening of unmodified mRNA. KHNYN interacts with TRIM25 and ZAP and is known to inhibit HIV-1 replication.

[0192] When N4BP1 or KHNYN was knocked down individually, no significant effect was observed. However, when both genes were knocked down simultaneously, both the protein expression level of the intact mRNA and the RNA level significantly increased. This suggests that they play overlapping roles in this surveillance mechanism. Since both TRIM25 and KHNYN are known to interact with ZAP, ZAP was also knocked down, resulting in a further increase in luciferase expression. In contrast, under TRIM25-deficient conditions, knockdown of N4BP1, KHNYN, and ZAP had no effect (Fig. 34). These results indicate that these factors are critically dependent on TRIM25.

[0193]

[0194] For further validation, N4BP1 knockout cells were generated. Single deletion of N4BP1 resulted in a modest but significant increase in luciferase expression, and the inhibitory effect was further alleviated when KHNYN and ZAP were additionally knocked down with siRNA. In contrast, no effect was observed in TRIM25-deficient cells (Fig. 35). This regulatory effect was much stronger with unmodified mRNA than with modified mRNA.

[0195] Furthermore, circular RNAs (circRNAs) were also derepressed in a TRIM25-dependent manner in N4BP1 / KHNYN / ZAP-depleted cells (Fig. 36). Taken together, these results suggest that N4BP1, KHNYN, and ZAP function redundantly in TRIM25-mediated exogenous RNA surveillance, and their functions are regulated by RNA modification.

[0196]

[0197] Example 5. Confirmation of TRIM25 binding and activation avoidance by modified RNA.

[0198] (1) Confirmation of the influence of base modification on TRIM25-mediated inhibition

[0199] To assess the effect of base modifications on TRIM25-mediated repression, linear mRNAs modified with Ψ (pseudouridine), mo5U (5-methoxyuridine), and m5C (5-methylcytidine) were compared (Fig. 37).

[0200] Similar to the case of m1Ψ variant mRNA, Ψ variant mRNA showed only a minimal increase in expression upon TRIM25 knockdown. This suggests that both m1Ψ and Ψ variant mRNAs evade TRIM25 to some extent, but not completely. In contrast, mo5U and m5C variant mRNAs showed a moderate increase in expression. This suggests that TRIM25 can still target these mRNAs, and that mo5U and m5C variants provide only partial protection from TRIM25.

[0201]

[0202] TRIM25 is known to interact directly with RNA, and TRIM25 mutants defective in RNA binding lack antiviral activity. Therefore, we hypothesized that TRIM25 might differentially recognize unmodified mRNA and regulate it through its interaction with RNA. To verify this, we transfected HCT116 cells with LNP329 mRNA, followed by RNA immunoprecipitation and RT-qPCR (RIP-qPCR) (Figure 38).

[0203] As a result, unlike endogenous noncoding RNA (18S rRNA), protein-coding transcript (GAPDH), or m1Ψ-modified IVT mRNA, unmodified IVT mRNA was strongly enriched in TRIM25 immunoprecipitates. Thus, TRIM25 appears to preferentially interact with exogenous RNA without base modifications.

[0204]

[0205] The RNA-binding specificity of TRIM25 was further demonstrated through pull-down experiments centered on RNA336 (Fig. 39). Single-stranded RNA was constructed by adding a 30-nt poly(A) fragment to the 100-nt sequence at the 3′ UTR of UTR-1 or UTR-2 shown in Fig. 24. This was immobilized on oligo-dT beads and reacted with HCT116 cell lysate.

[0206] Western blot results showed that TRIM25 binds preferentially to unmodified RNA bait over m1Ψ-modified RNA, supporting the specificity of the interaction.

[0207]

[0208] To determine whether TRIM25 directly interacts with RNA, we purified recombinant TRIM25 protein. As a result, unmodified RNA effectively pulled down TRIM25 protein (Figure 40), indicating a direct interaction between TRIM25 and RNA. In contrast, m1Ψ-modified RNA did not significantly precipitate TRIM25, indicating that the m1Ψ modification inhibits TRIM25's interaction with RNA.

[0209]

[0210] (2) Confirmation of the role of the 7K motif in RNA-TRIM25 interaction

[0211] TRIM25 is composed of a RING domain, a B-box, a coiled-coil domain, a positively charged linker, and a PRY / SPRY domain. In addition to the PRY / SPRY domain, a seven-lysine sequence (381KKVSKEEKKSKK392, the "7K motif") within the linker is essential for RNA binding. A mutant in which the lysine residues in this 7K motif are substituted with alanines ("7KA") is known to reduce the affinity of TRIM25 for RNA. In fact, unlike wild-type TRIM25, the 7KA mutant showed little pull-down with RNA bait, implying the importance of the 7K motif in the RNA-TRIM25 interaction (Figure 41).

[0212] Next, rescue experiments were performed by ectopically expressing TRIM25 wild-type or 7KA RNA-binding mutant in TRIM25 knockout (KO) cells (Fig. 42). As a result, wild-type TRIM25 repressed luciferase expressed from unmodified mRNA, whereas the 7KA mutant did not. This suggests the importance of RNA binding in TRIM25-mediated repression. Meanwhile, m1Ψ-modified mRNA was unaffected under any conditions, indicating the specificity of its regulatory action.

[0213]

[0214] (3) Confirmation of the role of E3 ligase activity in TRIM25-mediated inhibition

[0215] In addition to its role as an RNA-binding protein, TRIM25 functions as an E3 ubiquitin ligase. To investigate the role of E3 ligase activity in TRIM25-mediated repression, a mutation (R54P) was introduced at an arginine residue within the RING domain. This mutation is known to impair interaction with the E2 ubiquitin ligase, resulting in loss of E3 ligase activity. In rescue experiments, the R54P mutant failed to repress the expression of unmodified IVT mRNA (Figure 42), indicating that E3 ligase activity contributes to TRIM25-mediated repression.

[0216]

[0217] To determine whether RNA binding enhances the E3 ligase activity of TRIM25, we performed an in vitro ubiquitination experiment. To this end, FLAG-tagged TRIM25, which is expected to co-precipitate with substrate proteins, was immunoprecipitated. E1, E2, and ubiquitin were added to the immunoprecipitate and reacted in the presence or absence of IVT mRNA. The addition of IVT mRNA increased the level of ubiquitinated proteins, indicating that RNA binding induces the ubiquitination ligase activity of TRIM25 (Figure 43). Notably, unmodified mRNA exhibited a stronger effect than m1Ψ-modified mRNA. A similar effect was observed with another type of RNA (EGFP mRNA). An RNA-binding mutant (7KA) showed reduced ubiquitination levels, and a mutant lacking E3 ligase activity (R54P) served as a negative control. In summary, the m1Ψ variant reduces RNA-TRIM25 interaction and E3 ligase activity, thereby helping modified RNAs evade TRIM25-mediated surveillance.

[0218]

[0219] Example 6. Confirmation of TRIM25 Targeting Exogenous RNA Entering Acidified Endosomes

[0220] (1) Confirmation of TRIM25 targeting by LNP delivery RNA

[0221] Although EGFP mRNA expressed in GFP-stabilized cells is nearly identical to IVT EGFP mRNA, TRIM25 was not detected in a control screening using GFP-stabilized cells. Knockdown experiments performed in GFP392 stably expressed cells confirmed that TRIM25 can distinguish between exogenous mRNA and endogenous mRNA exported from the nucleus (Fig. 44).

[0222]

[0223] Based on these results, we investigated whether TRIM25's RNA targeting is influenced by the RNA entry pathway into the cytoplasm. To confirm this, we used Lipofectamine, a cationic lipid-based transfection reagent. Lipofectamine, which maintains a persistent positive charge at physiological pH, is known to transport transfection agents across the plasma membrane and early endosomes.

[0224] As a result, Fluc mRNA delivered via Lipofectamine only slightly increased luciferase expression levels in TRIM25 KO cells. Another mRNA, EGFP mRNA, also showed no significant difference between parental and KO cells when delivered via Lipofectamine. These results indicate that TRIM25 does not effectively target mRNA delivered via cationic lipids (Figure 45).

[0225]

[0226] Next, RNA was introduced into the cytoplasm using electroporation. Electroporation is a method that creates temporary pores in the plasma membrane to allow mRNA to enter the cell. When electroporation was used, deletion or knockdown of TRIM25 did not significantly affect reporter mRNA, indicating that TRIM25 does not inhibit mRNA delivered directly through the plasma membrane (Figure 46). In contrast, when another type of LNP consisting of SM-102 (ionized lipid), DMG-PEG 2000, DSPC, and cholesterol was used, as in mRNA-1273, TRIM25 deficiency strongly affected Fluc expression (Figure 47). These results indicate that TRIM25 can selectively target exogenous mRNA delivered via LNPs.

[0227]

[0228] (2) Confirmation of the pH-sensitive RNA binding properties of TRIM25

[0229] Ionized lipids within LNPs become protonated and positively charged in the acidic environment during endosomal maturation, inducing endosome rupture. Given the high proton gradient (approximately 10- to 100-fold) across the endosomal membrane, rupture of acidified endosomes (pH 5.4-5.8) is expected to release protons and temporarily lower the pH near the rupture site. Therefore, we examined whether the RNA-binding activity of TRIM25 is affected by pH changes. Specifically, IVT RNA was immobilized on oligo-dT beads, and RNA-binding experiments were performed using cell lysates at pH 6.5-8.0.

[0230] As a result, TRIM25 strongly bound to UTR-1 RNA under slightly acidic conditions (pH 6.5), and the binding strength showed a sharp change between pH 6.5 and 7.0. Similar pH sensitivity was also observed in similar RNA pull-down experiments using another RNA (UTR-2) (Figs. 48 and 49).

[0231]

[0232] Additionally, the pH-sensitive RNA-binding properties of TRIM25 were further confirmed by performing RNA-binding experiments in two different buffer conditions after immobilizing biochemically synthesized RNA via biotin-avidin conjugation. Unlike TRIM25, other RNA-binding proteins, such as hnRNPA1 and G3BP1, were hardly affected by pH changes. RNA-binding experiments using purified recombinant TRIM25 protein showed that TRIM25's direct interaction with RNA increased under acidic conditions (Figure 50).

[0233] To more precisely determine the range of pH sensitivity, binding experiments were repeated while varying the pH in 0.2-unit intervals. The RNA-binding affinity of TRIM25 significantly increased between pH 7.2 and pH 7.0, which are physiological cytoplasmic pHs, and further increased at lower pHs. This suggests that even subtle pH changes within cells can induce TRIM25-RNA interactions (Fig. 51). Notably, RNAs with m1Ψ introduced showed lower binding affinity to TRIM25 than unmodified RNA under all experimental conditions. This indicates that the m1Ψ modification inhibits TRIM25 binding even under acidic conditions. These results suggest that proton ions may selectively capture foreign RNAs escaping from acidified endosomes by enhancing the RNA-binding activity of TRIM25 (Fig. 52).

[0234]

[0235]

[0236] Reference example

[0237] Reference Example 1. Plasmid Production

[0238] To construct a human TRIM25 expression plasmid, a sequence containing a single SNP (dbSNP rs205498, a G / A mutation corresponding to the P358L point mutation, found in more than 77% of purified alleles) in the reference coding sequence of TRIM25 (RefSeq NM_005082) was PCR amplified and inserted into the pCK vector with a FLAG tag at the N terminus to construct a plasmid for exogenous expression. For protein purification, the same sequence was subcloned into the pX vector with a His10-eYFP-SUMOstar-Strep tag at the N terminus. Other mutants of TRIM25, such as the 7KA RNA-binding defective mutant and the R54P E3 ligase defective mutant, were constructed by site-directed mutagenesis. For rescue and RNA pulldown experiments, the CMV promoter was replaced with the PGK promoter, and the FLAG tag was removed to ensure stable expression. The list of plasmids used in this study is summarized in Table 1.

[0239]

[0240] 이름종류Human CRISPR Knockout Pooled Library (Brunello)Cas9 / sgRNA-expressing pooled library (Addgene #73179)pMD2.GLentiviral packaging vector (Addgene #12259)psPAX2Lentiviral packaging vector (Addgene #12260)pHR-mCMV-Moderna 5'UTR-EGFP-Moderna 3'UTR-SV40PASGFP-stable cell line generation (derived from Addgene #60954)pSpCas9(BB)-2A-GFP-TRIM25 sgRNA-1TRIM25 knockout cell line generation (derived from Addgene #48138 PX458)pSpCas9(BB)-2A-GFP-TRIM25 sgRNA-2TRIM25 knockout cell line generation (derived from Addgene #48138 PX458)lentiCRISPR v2_sgCtrlControl for pooled N4BP1 knockout experiment (derived from Addgene #52961)lentiCRISPR v2_sgN4BP1Pooled N4BP1 knockout experiment (derived from Addgene #52961)pmirGLO-3XmiR-1IVT template PCR backbone (도 24의 Fluc mRNA-2 및 Rluc mRNA)pmirGLO-Moderna 5'UTR-EGFP-Moderna 3'UTRIVT template PCR backbone (for EGFP in screening and validation experiments)pmirGLO-Moderna 5'UTR-Fluc-Moderna 3'UTRIVT template PCR backbone (for Fluc in validationexperiments)circRNA-synIRES-R25-FlucIVT template PCR backbone (for Fluc circRNA, derived from Addgene #188116 with NanoLuc CDS)pX-CMV-His10-eYFP-SUMOstar-Strep-3C-TRIM25Purification of recombinant TRIM25pCK-PGK-EGFPKnockout-rescue, Biotinylated RNA pulldown experimentpCK-PGK-TRIM25Knockout-rescue, Biotinylated RNA pulldown experimentpCK-PGK-TRIM25 7KAKnockout-rescue, Biotinylated RNA pulldown experiment-pCK-PGK254-PKKnockout-rescue experimentpCK-CMV-FLAG-TRIM25FLAG-pulldown in vitro ubiquitination experimentpCK-CMV-FLAG-TRIM25 R54PFLAG-pulldown in vitro ubiquitination experiment

[0241]

[0242] 참조예 2. 세포 배양 및 세포주의 구축

[0243] (1) HCT116 야생형 모세포주

[0244] HCT116 wild-type parental cell line and cell lines derived from it were cultured in McCoy's 5A medium (Welgene, LM 005-01) supplemented with 9.1% fetal bovine serum (FBS) (Welgene, S001-01). HEK293T, lenti-X HEK293T, HeLa, and MEF cells were cultured in DMEM (Welgene, LM 001-05) containing 9.1% FBS, and suspended HEK293E were cultured in DMEM (Welgene, LM001-170) containing 5% FBS and 50 μg / mL G418 sulfate (Gibco, 10131-027). THP-1 cells were cultured in RPMI 1640 (Welgene, LM 011-03) supplemented with 9.1% FBS and 0.05 mM β-mercaptoethanol (Thermo Scientific, 35602BID), and Jurkat cells were cultured in the same RPMI 1640 medium supplemented with 9.1% FBS. All cell lines were confirmed to be mycoplasma-negative.

[0245]

[0246] (2) Mouse-derived bone marrow macrophages (mBMDMs)

[0247] For the culture of mouse-derived bone marrow macrophages (mBMDMs), bone marrow cells were isolated from the femurs and tibias of 6-week-old wild-type female C57BL / 6J mice. Cells were cultured in DMEM containing 10% heat-inactivated FBS (Biowest, S1620), 1% nonessential amino acids (Thermo Scientific, 11140-050), 1% penicillin / streptomycin (Thermo Scientific, 15070-063), and 20% L929 conditioned medium as a source of M-CSF. L929 conditioned medium was prepared using L929 cells (ATCC, CCL-1) according to the Bowdish Lab (McMaster University) protocol and cultured in IMDM medium (Thermo Scientific, 12440053) supplemented with 10% FBS and 1% penicillin / streptomycin. On days 3 and 5, 10 mL of fresh medium containing M-CSF was added, and on day 6, cells were gently scraped and harvested. In all subsequent experiments, antibiotic-free medium was used.

[0248]

[0249] (3) HCT116 GFP-stable cell line

[0250] To establish the HCT116 GFP-stable cell line, a plasmid containing the EGFP coding sequence including the minimal CMV promoter, the 5′ and 3′ untranslated regions (UTRs) of the in vitro-transcribed RNA used for CRISPR screening, and the downstream SV40 poly(A) signal was constructed using a lentiviral backbone vector (Addgene #60954). Lentivirus was produced by cotransfecting lenti-X HEK293T cells with the plasmids containing the lentiviral packaging plasmid, and the produced virus was filtered through a 0.45 μm filter (Millipore, SLHVR33RS). The harvested lentivirus was then used to infect the HCT116 parental cell line together with 8 μg / mL polybrene (Millipore, TR-1003-G). GFP-positive cells were selected using flow cytometry (FACS) and isolated as single cells. After expansion of the clones, the single clone with the most uniform GFP fluorescence was used in subsequent experiments.

[0251]

[0252] (4) HCT116 TRIM25 knockout cell line

[0253] The HCT116 TRIM25 knockout cell line was constructed by subcloning sgRNAs targeting the canonical TRIM25 mRNA isoform (RefSeq NM_005082.4) into a Cas9 expression backbone plasmid (Addgene #48148). Two independent sgRNAs were selected from the Brunello human CRISPR knockout pooled library (Addgene #73179): an sgRNA targeting exon 3 (sgTRIM25-1, used in the TRIM25 KO-1 clone in this study; GCAGCTACAACAAGAATACA, SEQ ID NO: 165), and an sgRNA targeting exon 7 (sgTRIM25-2, used in the TRIM25 KO-2 clone; TGTTCCGGGGCTCCAAACGT, SEQ ID NO: 166). HCT116 wild-type parental cells were cotransfected with plasmids expressing Cas9 and sgRNA, and single cells were isolated by limiting dilution. TRIM25 deletion was confirmed by Sanger sequencing and Western blotting.

[0254]

[0255] (5) HCT116 pooled N4BP1 knockout cell line

[0256] The HCT116 pooled N4BP1 knockout cell line was generated via lentiviral infection. Lentiviral vectors expressing Cas9 and a non-targeting control sgRNA or an N4BP1-targeting sgRNA were cloned (Addgene #52961). The sgRNA sequences used were as follows: sgCtrl-1 (CTATATTGTCGCGCAGTGGA, SEQ ID NO: 1), sgCtrl-2 (CTCCCTGCCGGCCGGGTTAG, SEQ ID NO: 2), sgN4BP1-1 (AGAAAGAGAATGTTACCCCA, SEQ ID NO: 3), and sgN4BP1-2 (TTACACAGAATGCTGCCACA, SEQ ID NO: 4). These sgRNAs were selected from the Brunello human CRISPR knockout pooled library (Addgene #73179). CRISPR lentiviruses were generated and harvested by transfecting lentiviral packaging plasmids (Addgene #12259, pMD2.G and #12260, psPAX2) and each CRISPR lentiviral backbone plasmid into lenti-X HEK293T cells. Each generated lentivirus was used to infect HCT116 wild-type or TRIM25-deficient cells for 1 day under conditions containing 8 μg / mL polybrene, and the medium was replaced with fresh medium the following day. Infected cells were selected for 5 days under 1 μg / mL puromycin, and N4BP1 deletion was verified by Western blotting.

[0257]

[0258] Reference Example 3. In vitro transcription (IVT)

[0259] (1) IVT template design

[0260] For in vitro transcription (IVT) of mRNAs mimicking eukaryotic mRNAs, the coding sequences (CDSs) of the reporter genes used in this study (Enhanced green fluorescent protein, EGFP; Firefly luciferase, Fluc; Renilla luciferase, Rluc) were subcloned into mRNA production plasmids flanked by 5′ and 3′ untranslated regions (UTRs). The standard EGFP sequence was used as the open reading frame including the initiation codon, and for Fluc / Rluc, the sequence derived from the pmirGLO-3XmiR-1 dual luciferase plasmid (backbone plasmid from Promega) used in a previous study was used. The UTR composition followed the combination reported in a previous study by Moderna [Cell 168, 1114-1125.e10] in CRISPR screening and validation experiments. The 5′ UTR is the original 41-nucleotide synthetic sequence of Moderna COVID-19 mRNA vaccine (mRNA-1273) (GenBank: OR134578.1), which includes the Kozak sequence, and the 3′ UTR uses a sequence derived from human alpha-globin mRNA. For Fluc mRNA-2 and Rluc mRNA used in Figure 24, the UTR configuration was changed based on the sequence predicted to be expressed in the pmirGLO-3XmiR-1 dual luciferase vector.

[0261]

[0262] (2) IVT mRNA synthesis and modification

[0263] The IVT template was generated by PCR amplification using a forward primer containing the T7 promoter sequence and a reverse primer containing a poly(T) sequence. These primers were designed to target the 5′ and 3′ UTRs of interest, respectively, and the 5′-terminal two nucleotides of the reverse primer were 2′-O-methylated to increase the accuracy of transcription termination and prevent byproduct formation. When generating the non-optimal RNA used in Figure 4, a reverse primer without 2′-O-methylation was used. The PCR-amplified IVT DNA template was subjected to agarose gel electrophoresis, gel-extracted (Qiagen, 28704), and further oligo-purified (Zymo Research, D4061) to synthesize IVT mRNA using the mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen, AM1344).

[0264] mRNA capping and polyadenylation were performed concurrently with transcription. Representative cap1 analogs (CleanCap AG (3′-OMe), TriLink, N-7413) were used for capping. Experiments comparing differences in cap structure (Fig. 24) used first-generation cap0 analogs (mCAP, TriLink, N-7001) and later-developed cap0 analogs (ARCA, TriLink, N-7003). To increase the insertion rate of cap1 analogs, a modified design was applied using a forward primer starting with A instead of G at the +1 position in the PCR for IVT templates, and the conditions were applied to the mRNA synthesis used in the following figures: Fig. 4, Fig. 17, Fig. 23, Fig. 24, Fig. 26, Fig. 27, Fig. 31, Fig. 32, Fig. 34, Fig. 35, Fig. 43, Fig. 45, Fig. 46, Fig. 47. The poly(A) tail of the mRNA was generated by transcribing the poly(T) sequence inserted into the template, and a fixed length of 120 nt was used for most IVT mRNAs, while a length of 60 nt was used for Fluc mRNA in Fig. 4 and Rluc mRNA in Fig. 24.

[0265]

[0266] (3) Synthesis of base-modified mRNA and circRNA

[0267] To synthesize the base-modified mRNA used in Figure 37, each NTP in the IVT reaction was completely replaced with the desired modified NTP. The modified NTPs used were as follows:

[0268] N1-methylpseudoUTP (TriLink, N-1081), pseudoUTP (TriLink, N-1019), 5-methoxyUTP (TriLink, N-1093), 5-methylCTP (TriLink, N-1014).

[0269] After transcription, the DNA template was removed with RNase-free DNase (Takara, 2270A), and the generated mRNA was purified according to the RNA purification protocol using Qiagen's RNeasy Mini Kit (74106), with additional on-column DNase treatment (Qiagen, 79254). To minimize NTP residues and maximize RNA purity, the purified RNA was further purified using RNA cleanup.

[0270] For the circular RNAs (circRNAs) used in Figures 29, 30, and 36, IVT templates were generated by PCR from a plasmid containing the Fluc sequence. This template was derived from circRNA-synIRES-R25-NanoLuc (Addgene #188116), and in this study, the NanoLuc CDS was replaced with the Fluc CDS. IVT template generation and circRNA synthesis were performed according to previously reported methods [Nat. Biotechnol. 41, 262-272 and Nat. Commun. 9, 2629] with slight modifications. Briefly, circRNAs were transcribed in vitro using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, E2040S), and the DNA template was removed by DNase treatment after transcription. RNA circularization was promoted by adding 2 mM GTP and incubating at 55°C for 15 min. Circular RNA was purified by column chromatography, then treated with RNase R (Abm, E049) at 37°C for 15 min to remove linear RNA, followed by another column chromatography purification. Finally, circRNA was further purified by agarose gel electrophoresis using the Zymoclean Gel RNA Recovery Kit (Zymo Research, R1011).

[0271] For m6A-modified circRNAs, N6-methylATP (TriLink, N-1013) and ATP were mixed in the specified ratio in the IVT reaction.

[0272]

[0273] (4) Final quality analysis

[0274] The integrity of the final IVT RNA was assessed using an automated electrophoresis device (Agilent TapeStation, RNA ScreenTape analysis), and RNA concentration was quantified spectrophotometrically prior to LNP formulation. The sequences of the plasmids and PCR primers used for constructing the IVT templates used in this study, as well as the CDS and UTR sequences of the IVT mRNA, are listed in Tables 1 and 2.

[0275]

[0276] 가가이름유류서엄번벨IVT mRNA template PCRT7-Moderna 5'UTR FForward primer with T7 promoter5T7-AG Moderna 5'UTR FForward primer with T7 promoter (Figure 4, Figure 17, Figure 23, Figure 24, Figure 26, Figure 27, Figure 31, Figure 32, Figure 34, Figure 35, Figure 43, Figure 45, Figure 46, Figure 47)6T7-AG Fluc 5'UTR-2 FForward primer with T7 promoter (Figure 24)7T7-AG Rluc 5'UTR-3 FForward primer with T7 promoter (Figure 24)8T120-Moderna 3'UTR RReverse primer with T120 stretch and 2'-O-Methylation (mU) on terminal dinucleotides9T60-Moderna 3'UTR RReverse primer with T60 stretch and 2'-O-Methylation (mU) on terminal dinucleotides (Figure 4) 10T60-Moderna 3'UTR R (no 2'OMe)Reverse primer with T60 stretch without modification (Figure 4) 11T120-Fluc 3'UTR-2 RReverse primer with T120 stretch and 2'-O-Methylation (mU) on terminal dinucleotides (Figure 24) 12T60-Rluc 3'UTR-3 RReverse primer with T60 stretch and 2'-O-Methylation (mU) on terminal dinucleotides (Figure 24) 13circRNA FForward primer to amplify circRNA IVT template with T7 promoter (Chen et al., Nature Biotechnology, 2023)14circRNA RReverse primer to amplify circRNA IVT template (Chen et al., Nature Biotechnology, 2023)15IVT mRNA CDSEGFPEnhanced Green Fluorescent Protein coding region16FlucFirefly luciferase coding region1 mRNA UTRs5'UTR-1 (Moderna 5'UTR)Moderna 5'UTR (Synthetic) with additional 5' T7 promoter sequence and 3' Kozak sequence (Richner et al., Cell, 2017.)193'UTR-1 (Moderna 3'UTR)Moderna 3'UTR-UTR (Human et al.Richner-UTR) al., Cell, 2017.)205'UTR-25'UTR (Synthetic) with additional 5' T7 promoter sequence and 3' Kozak sequence (도 24의 Fluc mRNA-2)213'UTR-23'UTR (Synthetic) (도 Fluc의 24 mRNA-2)225'UTR-35'UTR (Synthetic) with additional 5' T7 promoter sequence and 3' Kozak sequence (도 24의 Rluc mRNA)233'UTR-33'UTR (Synthetic) (도 24의 Rluc mRNA)24.

[0277]

[0278] 참조예 4. Dot blot 분석

[0279] Dot blot analysis was performed according to the method presented in [Mol. Ther. Nucleic Acids 15, 26-35]. Fluc IVT mRNAs produced according to terminal 2′-O-methylation were diluted to final concentrations of 8, 40, and 200 ng / μL, and 5 μL (total volume: 40, 200, and 1000 ng) at each concentration was spotted onto a positively charged nylon membrane (Sigma, GERPN203B). As a positive control, dsRNA ladder (NEB, N0363S) was diluted to 0.8, 4, and 20 ng / μL, and 5 μL (total volume: 4, 20, and 100 ng) was spotted in the same manner. After sample application, the membrane was dried at 60°C for 20 min, and RNA was immobilized on the membrane using UV-C (12 mJ / cm², irradiation twice). The membrane was then blocked in 5% skim milk solution, and dsRNA was detected by chemiluminescence using α-dsRNA J2 monoclonal antibody (English and Scientific Consulting Kft, 1:1000) and HRP-conjugated secondary antibody.

[0280]

[0281] Reference Example 5. Lipid nanoparticle (LNP) formulation and transfection

[0282] The LNP formulation was based on a previous report [Sci. Adv. 7, eabf4398] with some modifications to suit the mRNA formulation. First, LNPs were dissolved in the organic phase, and the target IVT mRNA was dissolved in the aqueous phase, and mixed in a volume ratio of 1:3. The LNP used in this study mimicked the composition of the BNT162b2 COVID-19 mRNA vaccine developed by Pfizer-BioNTech [Nature 595, 572-577 and Int. J. Pharm. 601, 120586] and contained the following four lipid components: ionizable lipid (ALC-0315; Echelon Biosciences, N-1020), phospholipid (DSPC; Avanti, 850365), cholesterol (Sigma, C8667), and PEG-linked lipid (ALC-0159; Echelon Biosciences, N-2010).

[0283] Before mRNA formulation, lipids were dissolved in ethanol (Sigma, E7023) at a molar ratio of 46.3:9.4:42.7:1.6 to prepare a lipid master mix. The purified mRNA was diluted in 10 mM citric acid buffer (Sigma, 854), pH 3, and the lipid master mix was added at a ratio of aqueous phase:organic phase = 3:1.

[0284] To mimic the LNP composition (LNP-2) of the mRNA-1273 COVID-19 vaccine in Figure 47, SM-102 (MedChemExpress, HY-134541) was used as the ionizable lipid, and DMG-PEG 2000 (Avanti, 880151P) was used as the PEGylated lipid. The formulated LNP-mRNA mixture was diluted with PBS, and the encapsulation efficiency was measured using the Quant-iT RiboGreen RNA Assay (Invitrogen, R11491) prior to transfection. Based on the measured encapsulation efficiency, 10-50 ng of LNP-mRNA per cell was transfected in a 12-well plate, and flow cytometry confirmed a transfection efficiency of greater than 95% and a uniform expression level. Up- or down-scaling was performed proportionally depending on the experimental scale and cell type.

[0285]

[0286] Reference Example 6. Whole-genome CRISPR-Cas9 knockout screening

[0287] For genome-wide CRISPR-Cas9 knockout screening, the Brunello human CRISPR knockout pooled library (Addgene #73179) was used in this study. The library contains 77,441 sgRNAs (approximately four independent sgRNAs per gene) targeting 19,114 protein-coding genes, plus 1,000 non-targeting sgRNAs for normalization. Screening was performed in two biological replicates. Plasmids containing Cas9 and the sgRNA library were amplified according to a previously reported method [Cell 186, 3291-3306 / e21], and the integrity of the sgRNAs was verified by next-generation sequencing (NGS) before screening. CRISPR lentiviruses were produced and harvested from lenti-X HEK293T cells, and the multiplicity of infection (MOI) was calculated by measuring cell viability under various concentrations of puromycin.

[0288] For knockout, HCT116 cells were seeded in fresh medium containing 8 μg / mL polybrene and pooled CRISPR lentivirus at a limited MOI (approximately 0.3) to generate single-particle infected cells with only one gene silenced per cell. After 1 day of infection, the medium was replaced with fresh medium, and on day 2, the cells were passaged and selected in medium containing 1 μg / mL puromycin for 7 days. To ensure at least 300-fold coverage of the CRISPR library, 3 × 10 7 More than 10 cells were maintained. Afterwards, 1 μg of unmodified or N1-methylpseudouridinated EGFP mRNA was formulated into LNPs, and 1.6 × 10 per plate 7 Transfected cells were transfected into 4 plates per replicate (total 6.4 × 10 7To ensure sufficient sgRNA coverage, cells were prepared (more than 10 cells). One day after LNP-mRNA treatment to the pooled knockout cells, cells were detached by trypsinization and seeded at 1.2-1.5 × 10 in PBS containing 3% FBS. 7 After resuspending at a concentration of 10 cells / mL, the cells were passed through a 35 μm cell strainer and subjected to FACS analysis using a BD FACS Aria III (BD Biosciences). Cells in the highest GFP fluorescence intensity (top 0-2.5% and 2.5-5% ranges) or the lowest GFP fluorescence intensity (bottom 0-2.5% and 2.5-5% ranges) were isolated, and 6.25 × 10 5 Sorting was performed until 2.5 × 10 cells were collected. As an unsorted control, 2.5 × 10 7 A minimum of 300-fold coverage was achieved by securing living cells. In the screening of GFP-stable cell lines, only CRISPR infection was performed on HCT116 GFP-stable cells, and LNP delivery of EGFP mRNA was omitted.

[0289] After cell separation, genomic DNA (gDNA) from sorted and unsorted control cells was extracted using the MasterPure Complete DNA and RNA Purification Kit (Lucigen, MC85200) according to the manufacturer's protocol. Subsequently, a two-step PCR reaction was performed to prepare a sequencing library using Herculase II Fusion DNA polymerase (Agilent, 600677) in the same manner as previously reported [Nature 542, 197-202 and Science. 370(6523):eabc9546]. For the unsorted control, 6.6 μg of gDNA was used per 100 μL reaction, and a total of 24 PCR reactions were performed to ensure 300-fold coverage. For the sorted upper and lower GFP fluorescent cells, all extracted gDNA was divided into two 100 μL reactions, and PCR was performed twice. In the first amplification, 18 cycles of PCR were performed using universal forward and reverse primers. Subsequently, 5 μL of the merged PCR reaction mixture was used as a template for a 50 μL second PCR using barcoded indexing primers, with 8–10 extension cycles. The PCR products were purified using Agencourt AMPure XP (Beckman Coulter Life Sciences, A63880), and the quality of the sequencing library was confirmed by automated electrophoresis using an Agilent TapeStation (DNA ScreenTape). After quantification using the NEBNext Library Quant Kit for Illumina (NEB, E7630L), sequencing was performed on the Illumina NovaSeq 6000 platform. Information on the primer sequences used is shown in Table 3.

[0290]

[0291] 이름종류서열번호PCR1_FCRISPR screen 1st PCR25PCR1_RCRISPR screen 1st PCR26P7-A01CRISPR screen 2nd PCR barcoded reverse primer27P7-A02CRISPR screen 2nd PCR barcoded reverse primer28P7-A03CRISPR screen 2nd PCR barcoded reverse primer29P7-A04CRISPR screen 2nd PCR barcoded reverse primer30P7-A05CRISPR screen 2nd PCR barcoded reverse primer31P7-A06CRISPR screen 2nd PCR barcoded reverse primer32P7-A07CRISPR screen 2nd PCR barcoded reverse primer33P7-A08CRISPR screen 2nd PCR barcoded reverse primer34P7-A09CRISPR screen 2nd PCR barcoded reverse primer35P7-A10CRISPR screen 2nd PCR barcoded reverse primer36P7-A11CRISPR screen 2nd PCR barcoded reverse primer37P7-A12CRISPR screen 2nd PCR barcoded reverse primer38P7-B01CRISPR screen 2nd PCR barcoded reverse primer39P7-B02CRISPR screen 2nd PCR barcoded reverse primer40P7-B03CRISPR screen 2nd PCR barcoded reverse primer41P7-B04CRISPR screen 2nd PCR barcoded reverse primer42P7-B05CRISPR screen 2nd PCR barcoded reverse primer43P7-B06CRISPR screen 2nd PCRbarcoded reverse primer44P5 0 nt staggerCRISPR screen 2nd PCR forward primer for pooling45P5 1 nt staggerCRISPR screen 2nd PCR forward primer for pooling46P5 2 nt staggerCRISPR screen 2nd PCR forward primer for pooling47P5 3 nt staggerCRISPR screen 2nd PCR forward primer for pooling48P5 4 nt staggerCRISPR screen 2nd PCR forward primer for pooling49P5 6 nt staggerCRISPR screen 2nd PCR forward primer for pooling50P5 8 nt staggerCRISPR screen 2nd PCR forward primer for pooling51

[0292] For sequencing data processing, 20 nt sgRNA sequences per read were extracted from the demultiplexed FASTQ files and aligned to the sgRNA reference sequence constructed by Addgene based on CRISPR library information using Bowtie 2 under unique alignment and no mismatch tolerance conditions. The uniquely aligned reads were counted, resulting in a total of 3 × 10 7 More than 100 sequencing reads were obtained, achieving at least 300-fold sgRNA coverage.

[0293] After normalizing the read counts for each sgRNA using the RPM (Rows Per Million) method, analysis was performed using the MAGeCK statistical analysis tool (v0.5.9.4). Significantly enriched sgRNAs compared to the non-aligned control in each alignment condition were identified based on the distribution of off-target sgRNAs within the CRISPR library. The MAGeCK output results for each condition and the list of essential gene-targeting sgRNAs to verify the validity of the screening were organized using gene-level statistics.

[0294]

[0295] Reference Example 7. Lipofectamine-based transfection and inhibitor treatment

[0296] mRNA transfection using Lipofectamine MessengerMAX (Invitrogen, LMRNA015) was performed by treating cells with IVT mRNA at various concentrations for 1 day using Lipofectamine MessengerMAX (Invitrogen, LMRNA015) according to the manufacturer's instructions. For rescue experiments, RNA pulldown, and in vitro ubiquitination experiments requiring exogenous expression of TRIM25, the TRIM25 expression plasmid was delivered to cells using FuGENE HD transfection reagent (Promega, E2312) according to the manufacturer's instructions.

[0297] For individual gene knockdown, cells were treated with 50 nM siRNA using Lipofectamine RNAiMAX reagent (Invitrogen, 13778075) according to the manufacturer's instructions for 2 days. To achieve high knockdown efficiency in Jurkat cells and mBMDM, siRNA was introduced via electroporation, as described in the Electroporation section below. The siRNAs used in this study were either ON-TARGETplus SMARTpool siRNA (Dharmacon) or individually designed siRNAs using Invitrogen Block-iT RNAi Designer (Invitrogen). ON-TARGETplus Non-targeting Control (Dharmacon) or AccuTarget Negative Control siRNA (Bioneer) served as negative controls. The sequences of the siRNAs used are presented in Table 4.

[0298]

[0299] 이름종류Catalog ID 또는 서열번호sihEIF2AK2 (PKR)Gene specific siRNAL-003527-00sihTLR3Gene specific siRNAL-007745-00sihTLR7Gene specific siRNAL-004714-00sihTLR8Gene specific siRNAL-004715-00sihDDX58 (RIG-I)Gene specific siRNAL-012511-00sihIFIH1 (MDA5)Gene specific siRNAL-013041-00sihOAS1Gene specific siRNAL-011344-00sihOASLGene specific siRNAL-012617-00sihEXT1-1Gene specific siRNA52sihEXT1-4Gene specific siRNA53sihEXT1-8Gene specific siRNA54sihEXT2-1Gene specific siRNA55sihEXT2-6Gene specific siRNA56sihNDST1-3Gene specific siRNA57sihNDST1-6Gene specific siRNA58sihNDST1-10Gene specific siRNA59sihATP6AP1-2Gene specific siRNA60sihATP6AP1-7Gene specific siRNA61sihATP6AP1-9Gene specific siRNA62sihATP6V1B2-1Gene specific siRNA63sihATP6V1B2-5Gene specific siRNA64sihATP6V1B2-9Gene specific siRNA65sihTRIM25Gene specific siRNAL-006585-00simTrim25Gene specific siRNAL-065539-01sihWDR77Gene specific siRNAL-006895-00siXRN1-1Gene specific siRNA66siXRN1-2Gene specific siRNA67siXRN1-3Gene specificsiRNA68siDIS3-1Gene specific siRNA69siDIS3-2Gene specific siRNA70siDIS3-3Gene specific siRNA71siEXOSC4-1 (RRP41)Gene specific siRNA72siEXOSC4-2 (RRP41)Gene specific siRNA73sihRNASET2Gene specific siRNAL-009282-02sihRNASE4-4Gene specific siRNA74sihRNASE4-10Gene specific siRNA75sihPLD3-2Gene specific siRNA76sihPLD3-7Gene specific siRNA77sihRNASELGene specific siRNAL-005032-01sihN4BP1-4Gene specific siRNA78sihN4BP1-10Gene specific siRNA79sihKHNYN-2Gene specific siRNA80sihKHNYN-7Gene specific siRNA81sihZC3HAV1-1 (ZAP)Gene specific siRNA82sihZC3HAV1-2 (ZAP)Gene specific siRNA83sihG3BP1-1Gene specific siRNA84sihG3BP1-2Gene specific siRNA85sihG3BP2-1Gene specific siRNA86sihG3BP2-2Gene specific siRNA87

[0300]

[0301] For orthogonal loss-of-function experiments, HCT116 wild-type or GFP-stable cell lines were transfected with LNP-formulated mRNA, followed by treatment with inhibitors of intracellular positive regulator candidates for 1 day. In a concentration-dependent experiment using EGFP mRNA, HCT116 wild-type cells were treated with six concentrations of heparin (0, 0.1, 0.2, 0.5, 2, and 10 μg / mL) or Bafilomycin A1 (0, 0.1, 0.2, 0.3, 0.5, and 1 nM). The following conditions were used in experiments transfecting Fluc mRNA into GFP-stable cells: 0.2 μg / mL heparin (Sigma, H3393), 0.2 nM Bafilomycin A1 (Sigma, 19-148), 20 nM Pitstop-2 (Sigma, SML1169), and 50 nM Dynole (Abcam, ab120463).

[0302]

[0303] Reference Example 8. Electroporation

[0304] Electroporation was performed using the Neon NxT System (Invitrogen, MPK5000) according to the manufacturer's instructions. For the IVT mRNA transfection experiment in Figure 46, HCT116 cells were trypsinized and washed with DPBS. The cells were then seeded at 5 × 10 6Cells were resuspended in 50 μL of R buffer (Invitrogen, MPK1096) at a concentration of 100 cells / mL, and 100 ng of Fluc IVT mRNA was added and mixed well. Ten μL of the cell-RNA mixture was used per pulse, and a total of 40 μL was processed per sample through four pulses. Electroporation was performed under the following conditions: 1530 V, 20 ms, 1 pulse / 10 μL. Immediately after electroporation, cells were immediately transferred to 1 mL of pre-warmed McCoy's medium in a 12-well plate.

[0305] In the TRIM25 knockdown experiment in Jurkat or mBMDM in Figure 23, cells were washed with DPBS and then 2 × 10 7 cells / mL(Jurkat), 1.2×10 7 Cells were resuspended in T buffer (Invitrogen, MPK10096) at a concentration of 10 cells / mL (mBMDM). mBMDM were collected by gentle scraping before resuspension. siRNA was then added to a final concentration of 1 μM and mixed well. The cell-siRNA mixture was used for electroporation at 100 μL aliquots under the following conditions: Jurkat: 1350 V, 10 ms, 3 pulses; mBMDM: 1500 V, 20 ms, 1 pulse.

[0306] Immediately after electroporation, Jurkat cells were seeded in 1.9 mL of RPMI 1640 medium in 6-well plates, and mBMDM cells were seeded in 2 × 10 cells in 12-well plates. 5 Each cell was aliquoted and transferred to 1 mL of L929-conditioned DMEM, and 1 mL of DMEM was added 2 hours later. The following day, mRNA was transfected into the siRNA-transfected cells via LNP.

[0307]

[0308] Reference Example 9. Flow cytometry

[0309] GFP fluorescence in live cells, including GFP-stable cells and wild-type cells transfected with EGFP mRNA, was measured using a BD Accuri C6 Plus Flow Cytometer (BD Biosciences). Similar to FACS separation, cells were trypsinized, resuspended, and filtered through a tube containing a 35 μm cell strainer cap. The filtered cells were injected into the analyzer, and GFP fluorescence in live cells was measured in the appropriate fluorescence channel (FITC-A).

[0310]

[0311] Reference Example 10. Luciferase assay

[0312] Luciferase assays were performed by lysing cells with 1X passive lysis buffer and measuring luminescence using the Dual-Luciferase Reporter 1000 Assay System (Promega, E1910) according to the manufacturer's instructions. In LNP-mRNA experiments, mRNA expressing Fluc or Rluc was transfected. Luciferase Assay Reagent II (LAR II) was used for measuring firefly luciferase activity, and LAR II and Stop & Glo Reagent were used together for measuring renilla luciferase activity.

[0313]

[0314] Reference Example 11. Quantitative real-time PCR (RT-qPCR)

[0315] Total RNA was extracted using the RNeasy Mini Kit (Qiagen, 74106) and treated with on-column RNase-free DNase (Qiagen, 79254). Reverse transcription was then performed using Superscript IV (Invitrogen, 18090200) with random hexamer primers. Quantitative PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, A25778). Information on the primer sequences used is shown in Table 5.

[0316]

[0317] 이름종류서열번호EXT1_FGene-specific forward qPCR primer88EXT1_RGene-specific reverse qPCR primer89EXT2_FGene-specific forward qPCR primer90EXT2_RGene-specific reverse qPCR primer91NDST1_FGene-specific forward qPCR primer92NDST1_RGene-specific reverse qPCR primer93ATP6AP1_FGene-specific forward qPCR primer94ATP6AP1_RGene-specific reverse qPCR primer95ATP6V1B2_FGene-specific forward qPCR primer96ATP6V1B2_RGene-specific reverse qPCR primer97TRIM25_FGene-specific forward qPCR primer98TRIM25_RGene-specific reverse qPCR primer99PKR_FGene-specific reverse qPCR primer100PKR_RGene-specific reverse qPCR primer101XRN1_FGene-specific reverse qPCR primer102XRN1_RGene-specific reverse qPCR primer103DIS3_FGene-specific reverse qPCR primer104DIS3_RGene-specific reverse qPCR primer105RRP41_FGene-specific reverse qPCR primer106RRP41_RGene-specific reverse qPCR primer107RNASEL_FGene-specific reverse qPCR primer108RNASEL_RGene-specific reverse qPCR primer109RNASET2_FGene-specific reverse qPCRprimer110RNASET2_RGene-specific reverse qPCR primer111RNASE4_FGene-specific reverse qPCR primer112RNASE4_RGene-specific reverse qPCR primer113PLD3_FGene-specific reverse qPCR primer114PLD3_RGene-specific reverse qPCR primer115N4BP1_FGene-specific reverse qPCR primer116N4BP1_RGene-specific reverse qPCR primer117KHNYN_FGene-specific reverse qPCR primer118KHNYN_RGene-specific reverse qPCR primer119ZC3HAV1_F (ZAP)Gene-specific reverse qPCR primer120ZC3HAV1_R (ZAP)Gene-specific reverse qPCR primer121DDX58_F (RIG-I)Gene-specific reverse qPCR primer122DDX58_R (RIG-I)Gene-specific reverse qPCR primer123IFIH1_F (MDA5)Gene-specific reverse qPCR primer124IFIH1_R (MDA5)Gene-specific reverse qPCR primer125G3BP1_FGene-specific reverse qPCR primer126G3BP1_RGene-specific reverse qPCR primer127G3BP2_FGene-specific reverse qPCR primer128G3BP2_RGene-specific reverse qPCR primer129IFNA2_FGene-specific reverse qPCR primer130IFNA2_RGene-specific reverse qPCR primer131IFNB1_FGene-specific reverse qPCRprimer132IFNB1_RGene-specific reverse qPCR primer133ISG15_FGene-specific reverse qPCR primer134ISG15_RGene-specific reverse qPCR primer135IFIT1_FGene-specific reverse qPCR primer136IFIT1_RGene-specific reverse qPCR primer137ISG54_FGene-specific reverse qPCR primer138ISG54_RGene-specific reverse qPCR primer139IL1A_FGene-specific reverse qPCR primer140IL1A_RGene-specific reverse qPCR primer141EGFP_FGene-specific forward qPCR primer142EGFP_RGene-specific reverse qPCR primer143Fluc_FGene-specific forward qPCR primer144Fluc_RGene-specific reverse qPCR primer145GAPDH_FGene-specific forward qPCR primer146GAPDH_RGene-specific reverse qPCR primer147mIfnb1_FGene-specific reverse qPCR primer (mouse)148mIfnb1_RGene-specific reverse qPCR primer (mouse)149mTrim25_FGene-specific reverse qPCR primer (mouse)150mTrim25_RGene-specific reverse qPCR primer (mouse)151mGapdh_FGene-specific reverse qPCR primer (mouse)152mGapdh_RGene-specific reverse qPCR primer (mouse)153

[0318]

[0319] Reference Example 12. High-resolution poly(A) tail analysis (Hire-PAT)

[0320] Hire-PAT analysis and signal processing of capillary electrophoresis data were performed as follows. First, total RNA was subjected to G / I tailing, followed by reverse transcription using a universal primer. For fluorescent signal detection, PCR amplification was performed using a 6-FAM-labeled universal reverse primer and a gene-specific forward primer. The primer sequences used are presented in Table 6.

[0321]

[0322] Name Type Sequence Number RA3R-C10T2Reverse transcription primer1545-6FAM-RA3RUniversal reverse PCR primer with fluorescence155EGFPGene-specific forward PCR primer156FlucGene-specific forward PCR primer157

[0323]

[0324] Reference Example 13. Western Blotting

[0325] Cells were lysed with 0.5% NP-40 lysis buffer (20 mM Tris-HCl pH 7.5, 100 mM KCl, 0.2 mM EDTA, 0.5% NP-40) containing protease inhibitor (Millipore, 535140) and phosphatase inhibitor cocktail (AG Scientific, P-1518) or 1X passive lysis buffer (Promega, E1910), and the protein concentration of the lysate was measured using the BCA assay (Pierce, 23227).

[0326] Protein samples were loaded onto 8–16% Novex Tris-Glycine protein gels (Invitrogen, XP08162BOX) along with Thermo Scientific protein marker (26616), and then transferred to PVDF membranes (Millipore) activated with methanol. The transferred membranes were blocked with 5% skim milk or BSA-supplemented PBS-T solution, and immunoblotted with primary antibodies and HRP-conjugated secondary antibodies. Chemiluminescence was performed using SuperSignal West Pico or Femto reagents (Thermo Scientific, 34580 or 34095), and signals were detected with a ChemiDoc XRS+ System (Bio-Rad).

[0327] Primary antibodies used were as follows: α-TRIM25 (Abcam, ab167154, 1:1000), α-Fluc (Invitrogen, PA5-32209, 1:1000), α-RIG-I (Cell Signaling, 3743S, 1:1000), α-eIF2α (Cell Signaling, 5324S, 1:1000), α-phospho-eIF2α (Cell Signaling, 3398S, 1:1000), α-PKR (Cell Signaling, 12297S, 1:1000), α-phospho-PKR (Thermo Scientific, MA5-38282, 1:500), α-Ubiquitin (Abcam, ab7254, 1:2000), α-hnRNPA1 (Santa Cruz, sc-32301, 1:1000), α-α-Tubulin (Abcam, ab52866, 1:1000), α-GAPDH (Santa Cruz, sc-32233, 1:1000).

[0328]

[0329] Reference Example 14. Polysome profiling

[0330] Polysome profiling was performed as follows. A 10–50% sucrose gradient solution (Acros Organics, AC419760050) containing 100 μg / mL cycloheximide (CHX) (Sigma, C4859) was prepared using Gradient Master (Biocomp, B108-2). Prior to profiling, LNP-formulated mRNA was treated for 1 day in TRIM25 knockdown or knockout HCT116 cells. Cells were collected with cold PBS containing 100 μg / mL CHX before harvesting, and then lysed with polysome-extraction buffer (PEB: 50 mM Tris-HCl pH 7.5, 100 mM KCl, 5 mM MgCl₂, 0.5 mM TCEP, 0.5% NP-40) containing CHX, protease inhibitor, phosphatase inhibitor, and RNase inhibitor (Ambion, AM2696).

[0331] The obtained lysate was carefully layered onto a sucrose gradient and centrifuged at 36,000 rpm for 2 h using an ultracentrifuge (Beckman Coulter Ultracentrifuge Optima XE, SW41Ti rotor). The fractionated samples were then analyzed using a Bio-Rad EM-1 Econo UV detector, and 1 mL of each sample was collected using Bio-Rad 7318303 and subjected to RT-qPCR analysis.

[0332] For RT-qPCR, RNA was extracted from 125 μL (1 / 8 total volume) collected from each fraction using the Direct-zol RNA Miniprep Kit (Zymo Research, R2052). 1 ng of spike-in RNA was added for quantification. The extracted RNA was treated with on-column DNase, reverse-transcribed, and quantitative PCR was performed to calculate the percentage of RNA (%RNA portion) in each fraction.

[0333]

[0334] Reference Example 15. RNA Immunoprecipitation Analysis (RIP)

[0335] RNA immunoprecipitation (RIP) was performed as follows. Normal rabbit IgG (Cell Signaling, 2792S) or a monoclonal rabbit antibody specific for TRIM25 (Abcam, ab167154) was conjugated to protein A sepharose beads (GE Healthcare, 17-5138-01) pretreated with salmon sperm DNA (Invitrogen, 15632011). In RIP experiments, HCT116 cells were transfected with LNP formulations containing Fluc mRNA containing m1Ψ or U and cultured for 1 day. Cells were then lysed in 0.2% NP-40 RIP buffer containing protease inhibitors, phosphatase inhibitors, and RNase inhibitors. The lysates were incubated with antibody-conjugated beads at 4°C for 2 h and then washed five times. In the final washing step, some beads were reserved for Western blotting to confirm TRIM25 immunoprecipitation, while the coprecipitated RNA and input samples from the remaining beads were extracted using TRIzol. For quantification, 1 ng of spike-in RNA was added. The extracted RNA was reverse-transcribed and quantified by RT-qPCR, and the relative enrichment compared to the input was calculated based on the spike-in-normalized RNA level.

[0336]

[0337] Reference Example 16. Recombinant TRIM25 tablets

[0338] Recombinant TRIM25 protein with a His10-eYFP-SUMOstar-Strep tag attached to its N-terminus was heterologously expressed in suspension-cultured HEK293E cells. Cells were cultured at a density of approximately 7 × 10 5Transient transfection was performed at a density of 10 cells / mL, and 0.15 mg of plasmid DNA and 1.5 mg of linear polyethylenimine (PEI) were mixed in the presence of 1% DMSO for 0.5 L of culture. After transfection, cells were cultured at 33 °C for 72 h.

[0339] All purification procedures were performed at 4 °C. Cells were harvested by centrifugation at 2,000 g for 10 min, washed with cold phosphate-buffered saline (PBS), and resuspended in buffer A (50 mM HEPES, pH 8.0, 300 mM NaCl, 2 mM β-mercaptoethanol (BME)). 10% glycerol, EDTA-free protease inhibitor (Thermo Fisher Scientific, A32955), 20 μg / mL micrococcal nuclease, and 5 mM CaCl₂ were added. Cells were lysed by sonication and centrifuged at 35,000 g for 30 min. The supernatant was loaded onto Ni-NTA Superflow resin (Qiagen, 1018142), washed with buffer A containing 20 mM imidazole (Sigma-Aldrich, I202), and eluted with buffer A containing 200 mM imidazole. The mixture was then incubated overnight with SUMOstar protease (LifeSensors, 4110) and Benzonase nuclease (Sigma-Aldrich, E1014). The sample was then loaded onto Strep-Tactin Superflow resin (IBA Lifesciences, 4-4030-025), washed with buffer A, and eluted with buffer A containing 50 mM biotin (IBA Lifesciences, 2-1016-005). The eluted protein was filtered through a 0.22 μm membrane filter to remove aggregates, and then buffer exchange was performed using a HiPrep 26 / 10 Desalting column (GE Healthcare, 17-5087-01). The final purified TRIM25 protein was equilibrated in a buffer containing 5 mM Tris-HCl pH 7.0, 150 mM NaCl, and 0.5 mM TCEP, rapidly frozen in liquid nitrogen, and stored at -80 °C.

[0340]

[0341] Reference Example 17. Poly(A)+ or Biotin-Labeled RNA Pulldown / Binding Assay

[0342] RNA pulldown experiments were performed as follows. Briefly, 94-nt long UTR1 or UTR2 RNAs with a 30-nt poly(A) at the 3′ end were synthesized through T7 polymerase-based in vitro transcription, resulting in a total RNA length of 130 nt, consisting of a 6-nt T7 promoter sequence at the 5′ end, the UTR body (94 nt), and a 30-nt poly(A) at the 3′ end. Poly(A)+ IVT RNA bait was bound to Oligo d(T)25 magnetic beads (NEB, S1419S) by incubation at 25 °C and 1,400 rpm in a thermomixer for 1 h, followed by overnight rotation at 4 °C. For biotin-labeled RNA experiments, 20-nt CALM1 UTR RNA (Dharmacon) with biotin attached to the terminal was synthesized and bound to Streptavidin magnetic beads (Thermo Scientific, 88816) by rotation overnight at 4 °C. In all experiments, Tris-HCl-based RNA pulldown buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 5% glycerol, 0.5 mM TCEP, 1% Triton X-100) was used, except that in Figure 51, potassium phosphate buffer was used instead of Tris-HCl for pH adjustment. Protease inhibitors, phosphatase inhibitors, and RNase inhibitors were added to all buffers according to the designated pH conditions before the experiment. Information on the sequences of the RNA baits used is shown in Table 7.

[0343]

[0344] Category Name Type Sequence Number RNA bait IVT template PCRT7-UTR1_FForward primer with T7 promoter158T30-UTR1_RReverse primer with T30 stretch for oligo-dT bead conjugation159T7-UTR2_FForward primer with T7 promoter160T30-UTR2_RReverse primer with T30 stretch for oligo-dT bead conjugation161RNA pulldownUTR1-A30162UTR2-A30163CALM1-3'UTR-BiotinBiotinylated unmodified oligo164

[0345]

[0346] Next, cell lysates dissolved in RNA pulldown buffer at the indicated pH were reacted with RNA-bound beads at 4 °C for 2 hours. The beads were then washed five times and transferred to new protein low-binding tubes (Eppendorf, Z666505) to minimize contamination in the final wash step. The precipitated protein samples were eluted with sample buffer (Bio-Rad, 161-0747) containing 50 mM TCEP (Thermo Scientific, 77720) and analyzed by western blotting. For endogenous TRIM25 analysis, HCT116 wild-type or TRIM25 knockout cells were used, and for exogenous TRIM25 analysis, TRIM25 knockout cells were transfected with GFP, TRIM25 wild-type, or TRIM25 7KA RNA-binding mutant expression plasmids and then lysed.

[0347] In experiments with recombinant TRIM25 protein, purified protein was reacted with RNA-bound beads in a thermomixer at 4 °C and 600 rpm for 1 hour. For experiments to determine pH-dependent RNA binding affinity, the reaction was limited to 10 minutes at 4 °C in Figure 50 and 2 minutes at 25 °C in Figure 51. After the reaction, the protein-bound beads were washed three times and resuspended in sample buffer (Bio-Rad, 161-0747) containing 50 mM TCEP (Thermo Scientific, 77720). SDS-PAGE was then performed, and the samples were stained with InstantBlue Coomassie Protein Stain (Abcam, ab119211) for analysis.

[0348]

[0349] Reference Example 18. In vitro ubiquitination assay

[0350] For in vitro ubiquitination experiments, FLAG-tagged TRIM25 wild-type, 7KA, or R54P mutant proteins were exogenously expressed in HCT116 TRIM25 knockout cells. Two days after plasmid transfection, cells were lysed and FLAG-tagged TRIM25 proteins were pulled down by reaction with α-FLAG M2 magnetic beads (Millipore, M8823).

[0351] The amount of protein was measured by BSA-based quantification on SDS-PAGE gels, and beads corresponding to 4.5 pmol per protein were used for the in vitro ubiquitination reaction. The reaction was performed in a final volume of 50 μL of in vitro ubiquitination buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM MgCl₂, 2 mM ATP, 0.5 mM TCEP) containing the following components: E1 enzyme: UBE1 125 ng (UBPBio, B1101), E2 enzyme: 6XHis-UbE2D3 250 ng (UBPBio, C1601), ubiquitin: 500 ng (UBPBio, E1100), m1Ψ or U IVT RNA: 5 pmol

[0352] The mixture was shaken at 1,300 rpm in a thermomixer and incubated at 37 °C for 30 min. The reaction was terminated by adding sample buffer containing 50 mM TCEP and heating, and then analyzed by Western blotting using α-TRIM25 and α-Ubiquitin antibodies.

[0353]

[0354] Reference Example 19. Imaging

[0355] For imaging experiments to observe endogenous G3BP1 and TRIM25, HCT116 wild-type cells were seeded on 18-mm diameter microscope coverslips (Marienfeld, HSU-0111580) one day before LNP transfection. The following day, Fluc mRNA containing m1Ψ or U was formulated into LNPs and transfected for 6 h at two concentrations. The low concentration was 10 ng / mL, which is the standard condition for this study, and the high concentration was 500 ng / mL, which is 50 times the standard condition.

[0356] As negative controls, cells were treated with PBS or LNP alone in the same volume as that used for LNP-mRNA transfection. As a stress condition control that induces G3BP focus formation, cells were treated with 0.5 mM sodium arsenite (NaAsO₂) (Sigma, S7400) for 45 min or transfected with 2 μg / mL of poly(I:C) for 12 h using Lipofectamine RNAiMAX.

[0357] After the indicated treatments were completed, cells were washed once with PBS and fixed with 4% methanol-free paraformaldehyde (EMS, 15714) in PBS for 30 min. The fixed cells were washed three times with PBS and then permeabilized with PBS containing 0.5% Triton X-100 (Promega, H5141) for 7 min. Each permeabilized sample was washed with PBS containing 0.1% Tween-20 (PBS-T) and blocked with PBS containing 1% BSA for 1 h. Then, the primary antibody, α-G3BP1 (BD Bioscience, 611127, 1:200) or α-TRIM25 (Abcam, ab167154, 1:1000), was reacted overnight at 4 °C. After antibody reaction, the coverslips were washed six times with PBS-T and stained with Alexa Fluor fluorescent secondary antibodies corresponding to the corresponding antibodies: Alexa Fluor 488 (α-Mouse, Invitrogen, A-21202, 1:400) for α-G3BP1 and Alexa Fluor 594 (α-Rabbit, Invitrogen, A-21207, 1:400) for α-TRIM25. After secondary antibody reaction, the coverslips were washed six times with PBS-T, and the nuclei were stained with DAPI (VECTASHIELD® Antifade Mounting Medium with DAPI, Vector Laboratories, H-1200). Fluorescent signals were observed with a Nikon Eclipse Ti2 microscope on samples mounted on microscope slides (Marienfeld, 1000612), and images were analyzed using ImageJ (v1.54g).

[0358]

[0359] Reference Example 20. Gene Ontology (GO) enrichment analysis

[0360] We used g:Profiler (v1.0.0) to perform gene ontology enrichment analysis on candidate genes with significant FDR < 0.05. To assess the known biological functions and subcellular localization of candidate genes, we analyzed them based on GO:BP (Biological Process) and GO:CC (Cellular Components) categories.

[0361]

[0362] Reference Example 21. Protein-protein interaction network analysis

[0363] Protein-protein interaction network analysis of candidate genes for key positive regulators of LNP-mRNA was performed using STRING (v12.0). The connection lines between nodes in the network represent the strength of the interaction evidence calculated by the STRING software and were visualized with default settings. Reliable candidate genes under the GFPLow condition were defined as those that met both of the following two criteria: (1) FDR < 0.05 under the most stringent condition and (2) genes in the top 1% of pairwise binning conditions (e.g., genes with FDR < 0.05 at 0-2.5% GFPLow and in the top 1% at 2.5-5% GFPLow). High-confidence candidate genes selected under four GFPLow conditions ([m1Ψ 0-2.5% and 2.5-5%], [U 0-2.5% and 2.5-5%]) were used as inputs for STRING analysis to construct protein interaction networks.

[0364]

[0365] The foregoing description of the present invention is provided for illustrative purposes only. Those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

1. A composition for increasing the stability or expression of intracellular RNA, comprising an inhibitor of TRIM25 (Tripartite motif containing 25) expression or activity.

2. A composition according to claim 1, further comprising at least one expression or activity inhibitor selected from the group consisting of N4BP1, KHNYN, and ZAP.

3. A composition according to claim 1, wherein the composition is treated in combination with one or more expression or activity inhibitors selected from the group consisting of N4BP1, KHNYN, and ZAP.

4. A composition according to claim 1, wherein the RNA is exogenous RNA.

5. A composition according to claim 4, wherein the exogenous RNA is delivered encapsulated in a lipid nanoparticle (LNP).

6. A composition according to claim 1, wherein the RNA is at least one selected from the group consisting of mRNA, circular RNA, dsRNA, shRNA, miRNA, gRNA, saRNA, lncRNA, taRNA, ribozyme, and ncRNA.

7. A composition according to claim 1, wherein the TRIM25 expression inhibitor comprises at least one selected from the group consisting of siRNA, shRNA, oligonucleotide, antisense nucleotide, and sgRNA that specifically bind to the TRIM25 gene or mRNA.

8. A composition according to claim 1, wherein the TRIM25 activity inhibitor comprises at least one selected from the group consisting of an antibody or an antigen-binding fragment thereof that specifically binds to the TRIM25 protein, an interacting protein, a PROTAC, an oligopeptide, a ligand, nanoparticles, an aptamer, an avidity multimer, and peptidomimetics.

9. A step of inhibiting the expression or activity of TRIM25 in cells in vitro; and Step of introducing target RNA into cells A method for increasing the expression or activity of a target RNA in a cell in vitro comprising:

10. A method according to claim 9, wherein the inhibition of TRIM25 expression or activity comprises at least one selected from the group consisting of TRIM25 gene knockout, knockdown, conditional gene knockout, genetic modification, and RNA interference.

11. A method according to claim 9, comprising a step of further inhibiting the expression or activity of at least one selected from the group consisting of N4BP1, KHNYN, and ZAP.

12. A method according to claim 9, wherein increasing the expression or activity of the target RNA increases the production of the target RNA or a polypeptide encoded by the target RNA.

13. A step of measuring the binding or interaction between RNA having a candidate chemical modification and TRIM25; and A step of determining that the candidate chemical modification is a chemical modification that promotes RNA expression or activity when TRIM25 does not bind or interact with the RNA having the candidate chemical modification. A method for screening chemical modifications of nucleic acids that enhance expression or activity of RNA, including:

14. A method according to claim 13, wherein the measurement of the binding or interaction is performed at a pH of 7.0 or lower.

Images