Composition for treating cancerous diseases and screening method thereof

A culture medium from co-cultured CAFs and apoptotic cancer cells addresses the limitations of current anticancer drugs by enhancing M1 TAM markers and reducing M2 TAM markers, effectively inhibiting tumor growth and inducing apoptosis.

WO2025249993A1PCT designated stage Publication Date: 2025-12-04EWHA UNIV IND COLLABORATION FOUND
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/095352
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-29
Filing Date
2025-05-22
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Current anticancer drugs are toxic and induce resistance in cancer cells, lacking the ability to selectively target and eliminate cancer cells, necessitating the development of less toxic and resistant drugs with improved screening methods.

Method used

A pharmaceutical composition comprising a culture medium derived from co-culturing cancer-associated fibroblasts (CAFs) and apoptotic cancer cells, which modulates the expression of tumor-associated macrophage (TAM) markers to inhibit tumor growth and induce apoptosis.

Benefits of technology

The composition enhances the expression of tumor suppressive macrophage (M1 TAM) markers and reduces tumor supportive macrophage (M2 TAM) markers, effectively inhibiting tumor growth and inducing apoptosis in cancer cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025095352_04122025_PF_FP_ABST
    Figure KR2025095352_04122025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for treating cancerous diseases and a method for screening same The composition for treating cancer diseases of the present invention inhibits the survival of M2 macrophages and induces reprogramming from M2 TAM to M1 TAM to inhibit the growth of tumors, thereby treating cancerous diseases. In addition, the screening method of the present invention can easily identify and obtain substances effective for treating cancerous diseases among multiple candidate therapeutic substances, and thus can be advantageously used for developing and identifying novel cancer therapeutic agents.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for treating cancer and screening method thereof

[0001] The present invention relates to a composition for treating cancer and a method for screening the same.

[0002] Cancer is one of the incurable diseases humanity faces, and massive amounts of capital are being invested globally in the development of treatments. In South Korea, it has been the leading cause of death since 1983, with over 100,000 people diagnosed annually and over 60,000 dying. Carcinogens, including smoking, ultraviolet rays, chemicals, food, and other environmental factors, are known to cause cancer. However, the diverse causes make the development of treatments challenging, and the effectiveness of treatments also varies depending on the site of the disease.

[0003] Currently used anticancer drugs include biological agents such as enzyme preparations or vaccines, purely synthetic drugs, and drugs derived from natural products. Among these, anticancer drugs using genes, enzymes, and vaccines are not yet at the practical stage, and anticancer drugs developed through chemotherapy have significant toxicity and have side effects of destroying not only cancer cells but also normal cells because they cannot selectively eliminate only cancer cells. In addition, cancer cells have recently developed resistance to these drugs, making them ineffective in cancer treatment. Therefore, there is an urgent need to develop effective anticancer drugs that are less toxic and do not induce resistance in cancer cells for the treatment and prevention of cancer. Accordingly, the development of a simple method for screening new anticancer drugs is also required.

[0004] Accordingly, the inventors of the present invention completed the present invention by confirming that the expression of tumor-associated macrophage (TAM) markers changed when a culture medium derived from cancer-associated fibroblasts exposed to killed cancer cells was treated.

[0005] The present invention provides a pharmaceutical composition for treating cancer, comprising a culture medium in which cancer-associated fibroblasts (CAFs) and apoptotic cancer cells are co-cultured.

[0006] The present invention provides a method for screening a cancer treatment agent, comprising the steps of: (a) administering a carcinogenic substance or cancer cells to a non-human experimental animal; (b) administering a test substance to the experimental animal; and (c) confirming the expression levels of tumor suppressive macrophage (M1 TAM) markers and tumor supportive macrophage (M2 TAM) markers in cells of the experimental animal.

[0007] To avoid confusion due to overlapping content, the description of redundant content will be omitted below. In other words, the content of the invention is not limited to the content described below, and the content of the invention should be interpreted based on the overall content of the invention.

[0008] Hereinafter, the present invention will be described in detail.

[0009] The present invention provides a pharmaceutical composition for treating cancer, comprising a culture medium in which cancer-associated fibroblasts (CAFs) and apoptotic cancer cells are co-cultured.

[0010] In the present invention, "cancer-associated fibroblast (CAF)" refers to α-SMA (alpha-smooth muscle actin) positive fibroblasts existing inside and / or around a cancer lesion, and the presence of CAF has been confirmed in various cancers such as colon cancer, lung cancer, prostate cancer, breast cancer, stomach cancer, cholangiocarcinoma, and basal cell carcinoma.

[0011] In the present invention, the CAF may be associated with one or more cancers selected from the group consisting of fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, hemangiosarcoma, malignant skin cancer, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, osteosarcoma, lung cancer, gastric cancer, breast cancer, colon cancer, and prostate cancer.

[0012] In the present invention, "apoptotic cancer cells" may be cancer cells induced to apoptosis by irradiating them with light of a specific wavelength. The irradiation of light of the specific wavelength may be ultraviolet ray (UV) irradiation. Specifically, the wavelength may be irradiated for 5 to 30 minutes at a wavelength of 100 to 400 nm. More specifically, the UV irradiation may be irradiated for 20 minutes at a wavelength of 150 to 350 nm or for 10 to 15 minutes at a wavelength of 200 to 300 nm.

[0013] In the present invention, "co-culture" may be achieved by co-culturing CAFs with apoptotic cancer cells. In one embodiment, CAFs may be cultured with apoptotic cancer cells in X-VIVO or serum-free DMEM medium for 20 to 30 hours.

[0014] In the present invention, "culture medium" refers to a culture product obtained through co-culturing CAFs and apoptotic cancer cells. In one embodiment of the present invention, the culture medium may be a liquid medium, a solid medium, or a semi-solid medium. In one embodiment, the culture medium may be a conditioned medium (CM).

[0015] In the present invention, "cancer" refers to a disease in which abnormally transformed cells proliferate rapidly and uncontrollably due to changes in the genes of cells for various reasons. Cancer cells can spread to various parts of the body through the bloodstream and lymphatic system. The cancer disease may be at least one selected from the group consisting of breast cancer, uterine cancer, esophageal cancer, stomach cancer, brain cancer, rectal cancer, colon cancer, lung cancer, skin cancer, ovarian cancer, cervical cancer, blood cancer, pancreatic cancer, prostate cancer, testicular cancer, laryngeal cancer, oral cancer, head and neck cancer, thyroid cancer, liver cancer, bladder cancer, osteosarcoma, lymphoma, and leukemia, and preferably may be lung cancer. The lung cancer may be lung adenocarcinoma or non-small cell lung cancer.

[0016] According to one embodiment of the present invention, a culture medium co-cultured with cancer-associated fibroblasts (CAFs) and apoptotic cancer cells can inhibit tumor growth by increasing the expression level of tumor suppressive macrophage (T1 TAM) markers and decreasing the expression level of tumor supportive macrophage (T2 TAM) markers.

[0017] The above tumor suppressive macrophage (T1 TAM) marker may be at least one selected from the group consisting of CD16 / 32, CD80, H2Ab1, MHCII, iNOS (NOS2), IFNγ, IL12p40, TNFα, and IL-1β, and the tumor supporting macrophage (T2 TAM) marker may be at least one selected from the group consisting of CD163, CD206, Arginase 1 (Arg1), TGFβ1, IL-10, IL-4, and IL-13.

[0018] In addition, according to one embodiment of the present invention, a culture medium in which cancer-associated fibroblasts (CAFs) and apoptotic cancer cells are co-cultured can increase the levels of pro-apoptotic markers including Bax, C-Cas3, and C-PARP, and can decrease the expression levels of anti-apoptotic markers including Mcl-1 and Bcl-xL.

[0019] Specifically, changes in the expression levels of the above markers may be due to the fact that the culture medium co-cultured with cancer-associated fibroblasts (CAFs) and apoptotic cancer cells not only inhibits the survival of M2 macrophages and promotes apoptosis through the WISP-1-STAT1 signaling pathway, but also induces reprogramming from M2 TAMs to TAMs expressing an M1-like phenotype.

[0020] The above WISP-1 is a target protein of the WNT signaling pathway, and WNT signaling plays a role in lung development, regulating both epithelial and mesenchymal development through autocrine and paracrine signals.

[0021] In the present invention, “CD16” is an Fc-gamma receptor, also known as FcγRⅢ, and is found on the surface of NK cells, neutrophils, monocytes, and macrophages.

[0022] In the present invention, “CD32” is an Fc-gamma receptor, also known as FcγRⅡ, and corresponds to a surface receptor glycoprotein belonging to the Ig gene family.

[0023] In the present invention, "CD80" is a B7, type I membrane protein belonging to the Ig gene family, and is known to be involved in regulating T cell activation and B cell activity.

[0024] In the present invention, "H2Ab1" corresponds to a variant of a histone protein encoded by the H2AFB1 gene, and activates various functions including peptide antigen binding activity.

[0025] In the present invention, “MHCⅡ” refers to the major histocompatibility complex found only in professional antigen-presenting cells such as dendritic cells, macrophages, and B cells.

[0026] In the present invention, "iNOS (NOS2)" is a high-output Ca whose expression can be induced in a wide range of cells and tissues by cytokines and other agents. 2+ - Refers to independent NOS (Nitric oxide synthase).

[0027] In the present invention, "IFNγ" is a dimerized soluble cytokine belonging to the type II interferon group, and is known to have a role in activating macrophages to increase phagocytosis, tumor sterilization, and intracellular apoptosis.

[0028] In the present invention, "IL12p40" is a subunit of the IL-12 cytokine family, functions as a chemoattractant for macrophages, and plays a role in promoting the movement of dendritic cells.

[0029] In the present invention, "TNFα" is a member of the tumor necrosis factor (TNF) family, which is mainly secreted by activated macrophages and is known to play an important role in various immune-mediated inflammatory diseases.

[0030] In the present invention, “IL-1β” refers to a cytokine protein encoded by IL1B among the interleukin-1 genes, and is involved in various cell activities such as cell proliferation, differentiation, and apoptosis.

[0031] In the present invention, "CD163" is a high-affinity scavenger receptor for the hemoglobin-haptoglobin complex, and is also a marker for cells of the monocyte / macrophage lineage.

[0032] In the present invention, "CD206" is also called mannose receptor and corresponds to C-type lectin that mainly exists on the surface of macrophages, immature dendritic cells, and liver endothelial cells.

[0033] In the present invention, "Arginase 1 (Arg1)" is a gene encoding arginase, which is known as a marker of M2a macrophages and myeloid-derived suppressor cells (MDSC), which are major mediators of T cell suppression.

[0034] In the present invention, "TGFβ1" is a polypeptide member of the transforming growth factor beta family of cytokines, and is a protein that performs various functions including regulation of cell growth, proliferation, differentiation, and apoptosis.

[0035] In the present invention, "IL-10" is an anti-inflammatory cytokine that plays a role in downregulating the expression of Th1 cytokines, MHCⅡ antigens, and co-stimulatory molecules in macrophages.

[0036] In the present invention, “IL-4” is a cytokine that induces differentiation from naive Th0 cells into Th2 cells, and is an important regulator of humoral immunity and acquired immunity.

[0037] In the present invention, “IL-13” is a protein encoded by the IL13 gene, and is a cytokine secreted from Th2 cells, CD4 cells, mast cells, etc.

[0038] In the present invention, "Bax" is also known as Bcl-2-like protein 4, which forms a heterodimer with Bcl-2 and functions as an apoptosis activator.

[0039] In the present invention, "C-Cas3" refers to Caspase 3, which is cleaved and activated during cell death, and transmits a cell death signal through enzymatic activity toward downstream targets including PARP and other substrates.

[0040] In the present invention, “C-PARP” refers to Poly-ADP-ribose polymerase (PARP) that is cleaved by caspase during caspase-dependent apoptosis.

[0041] In the present invention, "Mcl-1" belongs to the Bcl-2 protein family and plays a role in regulating cell death, cell cycle progression, and mitochondrial homeostasis.

[0042] In the present invention, "Bcl-xL" is a member of the Bcl-2 protein family and prevents the release of mitochondrial contents that induce caspase activation and cell death.

[0043] In the present invention, the term "treatment" refers to any act of improving or beneficially changing the symptoms of a cancer disease by administering a composition according to the present invention.

[0044] The pharmaceutical composition of the present invention may be formulated and provided in an appropriate form. In addition to the active ingredient, the culture medium, the composition may be prepared by including one or more pharmaceutically acceptable carriers.

[0045] The pharmaceutically acceptable carriers include, but are not limited to, those commonly used in the art, such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, the pharmaceutical composition of the present invention may include, but is not limited to, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants, and other pharmaceutically acceptable additives.

[0046] When the pharmaceutical composition of the present invention is formulated as a solid oral preparation, it includes tablets, pills, powders, granules, capsules, etc., and such solid preparations may include at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., and include, but are not limited to, lubricants such as magnesium stearate and talc.

[0047] When the pharmaceutical composition of the present invention is formulated as an oral liquid, it includes a suspension, a solution, an emulsion, a syrup, etc., and includes, but is not limited to, a diluent such as water or liquid paraffin, a wetting agent, a sweetener, a fragrance, a preservative, etc.

[0048] When the pharmaceutical composition of the present invention is formulated for parenteral use, it includes a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized preparation, and a suppository. Non-aqueous solvents and suspensions include, but are not limited to, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Bases for suppositories include, but are not limited to, witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerogelatin.

[0049] The composition may be administered in single or multiple doses in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to prevent or treat a disease at a reasonable benefit / risk ratio applicable to medical prevention or treatment, and the effective dosage level may be determined according to factors including the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and excretion rate, the duration of treatment, drugs combined with or used concurrently with the composition of the present invention used, and other factors well known in the medical field.

[0050] The pharmaceutical composition of the present invention can be administered to mammals such as rats, mice, livestock, and humans by various routes, for example, but not limited to, oral administration, intrathecal, intra-auricular, intraperitoneal or intravenous, intramuscular, subcutaneous, intrauterine, sublingual, or intracerebrovascular injection.

[0051] In addition, the pharmaceutical composition of the present invention can be formulated into a unit dosage form pharmaceutical preparation suitable for administration into the patient's body according to a conventional method in the pharmaceutical field and administered, and the preparation includes an effective dosage amount through one or more administrations. Preferred dosage forms for this purpose are parenteral administration preparations such as injections and infusions. The administration dosage of the pharmaceutical composition may vary depending on the patient's age, weight, sex, dosage form, health condition, and disease severity, and may be administered once or several times a day at regular intervals according to the judgment of a doctor or pharmacist.

[0052] The route and method of administration of the pharmaceutical composition of the present invention may be independent of each other, and are not particularly limited in their method, and any route and method of administration may be followed as long as the pharmaceutical composition can reach the target area.

[0053] The term "administration" in the present invention refers to introducing a given substance into a human or animal by any suitable method. The therapeutic composition according to the present invention may be administered orally or parenterally via any common route, as long as it can reach the target tissue. Furthermore, the therapeutic composition according to the present invention may be administered by any device capable of transporting the active ingredient to target cells.

[0054] The present invention provides a method for screening a cancer treatment agent.

[0055] Specifically, the screening method for a cancer treatment agent according to the present invention comprises the following steps:

[0056] (a) a step of administering a carcinogenic substance or cancer cells to an experimental animal other than a human;

[0057] (b) a step of administering a test substance to the experimental animal; and

[0058] (c) A step of confirming the expression level of tumor suppressive macrophage (M1 TAM) marker and tumor supporting macrophage (M2 TAM) marker in the cells of the above experimental animal.

[0059] The present invention comprises a step of (a) administering a carcinogenic substance or cancer cells to an experimental animal other than a human.

[0060] In the present invention, any substance known to be a carcinogen can be used to produce an animal model that induces cancer. Specifically, arsenic, benzene, beryllium, cadmium, hexavalent chromium compounds, ethylene oxide, nickel, radon, or vinyl chloride can be used to induce cancer. For example, any experimental animal commonly used in the art can be treated with arsenic, benzene, beryllium, cadmium, hexavalent chromium compounds, ethylene oxide, nickel, radon, and / or vinyl chloride, and the animal model itself or cells isolated therefrom in which the disease is induced can be used. The experimental animal model can be, for example, a mouse, hamster, rat, ferret, guinea pig, rabbit, dog, primate, or pig, and more preferably a mouse. The experimental animal excludes humans.

[0061] Additionally, any cancer cell for inducing the above cancer may be administered. For example, the cancer cells may be one or more selected from the group consisting of fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, hemangiosarcoma, malignant skin cancer, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, osteosarcoma, lung cancer, gastric cancer, breast cancer, colon cancer, and prostate cancer. The administration of such cancer cells may be administered in an amount typically known to induce cancer in each experimental animal.

[0062] In the above step (a), the cancer-causing substance or cancer cells may be administered through a route appropriate to their characteristics, for example, through respiration, intramuscular injection, renal injection, intraperitoneal injection, or subcutaneous injection.

[0063] According to the present invention, the substances expressed or activated in vivo in non-cancer and cancer-induced states are different. Therefore, to screen for candidate substances for cancer prevention and treatment, cancer must first be induced.

[0064] The method for screening a cancer treatment agent according to the present invention comprises the step of (b) administering a test substance to the experimental animal.

[0065] In the present invention, "test material" refers to an unknown candidate substance used in screening to determine whether it affects the expression level of a gene or the expression or activity of a protein. The sample includes, but is not limited to, chemicals, nucleotides, antisense RNA, siRNA (small interference RNA), and natural product extracts.

[0066] These test substances can be administered via conventional routes of administration, including oral and parenteral administration. For example, oral administration may be used, and parenteral administration may be selected from, but is not limited to, topical application to the skin, intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.

[0067] The dosage of the test substance can be adjusted to an appropriate level of dosage according to the type and efficacy of the drug and the general knowledge of those skilled in the art.

[0068] The method for screening for cancer according to the present invention comprises the step of (c) confirming the expression level of a tumor suppressive macrophage (M1 TAM) marker and a tumor supporting macrophage (M2 TAM) marker in cells of the experimental animal.

[0069] The method for screening for cancer according to the present invention may include selecting a test substance that (i) increases the expression level of a tumor suppressive macrophage (M1 TAM) marker and (ii) decreases the expression level of a tumor supportive macrophage (T2 TAM) marker in step (c).

[0070] In the present invention, "tumor-associated macrophages (TAMs)" are macrophages that participate in the formation of a tumor microenvironment, and influence tumor angiogenesis, proliferation, metastasis, and immunosuppression by secreting various cytokines, chemokines, and proteolytic enzymes. The tumor-associated macrophages are divided into tumor-suppressive macrophages (M1 TAMs) and tumor-supportive macrophages (M2 TAMs).

[0071] The above tumor suppressive macrophage (M1 TAM) marker may be any one or more selected from the group consisting of CD16 / 32, CD80, H2Ab1, MHCII, iNOS (NOS2), IFNγ, IL12p40, TNFα, and IL-1β, but is not limited thereto.

[0072] The above tumor-supporting macrophage (M2 TAM) marker may be any one or more selected from the group consisting of, but is not limited to, CD163, CD206, Arginase 1 (Arg1), TGFβ1, IL-10, IL-4, and IL-13.

[0073] If at least one of the following markers increases following treatment with the test substance: CD16 / 32, CD80, H2Ab1, MHCII, iNOS (NOS2), IFNγ, IL12p40, TNFα, and IL-1β, the drug may be considered to have therapeutic efficacy against cancer. Furthermore, if the tumor suppressive macrophage (M1 TAM) marker is expressed at a level comparable to that of the positive control, the drug may be considered to have therapeutic efficacy against cancer.

[0074] Meanwhile, if at least one selected from the group consisting of CD163, CD206, Arginase 1 (Arg1), TGFβ1, IL-10, IL-4, and IL-13 decreases following treatment with the test substance, the drug may be judged to have therapeutic efficacy against cancer. In addition, if the tumor-supporting macrophage (M2 TAM) marker is expressed at a level equivalent to that of the positive control, the drug may be judged to have therapeutic efficacy against cancer.

[0075] In the present invention, a control sample means all sample groups for which the expression levels of tumor suppressive macrophage (M1 TAM) markers and tumor supportive macrophage (M2 TAM) markers can be compared and determined according to test substance treatment, including a normal control group and a therapeutic substance control group known for treating cancer.

[0076] The expression levels of the above tumor suppressive macrophage (M1 TAM) marker and tumor supporting macrophage (M2 TAM) marker can be measured by any one selected from the group consisting of, but not limited to, enzyme-linked immunosorbent assay (ELISA), quantitative real-time polymerase chain reaction (qPCR), immunohistochemistry and Western blotting, and flow cytometry.

[0077] The method for screening for cancer according to the present invention may further include the step of (d) confirming (i) an increase in the expression level of a pro-apoptotic marker and (ii) a decrease in the expression level of an anti-apoptotic marker in cells of the experimental animal.

[0078] The pro-apoptotic marker may be at least one selected from the group consisting of Bax, C-Cas3, and C-PARP, and the anti-apoptotic marker may be at least one selected from the group consisting of Mcl-1 and Bcl-xL.

[0079] In the screening method for cancer according to the present invention, the test substance may be a pharmaceutical composition including a culture medium in which cancer-associated fibroblasts (CAFs) and apoptotic cancer cells are co-cultured.

[0080] The present invention comprises the steps of: (a) contacting a test substance with cancer cells;

[0081] (b) a step of confirming the expression level of tumor suppressive macrophage (M1 TAM) marker and tumor supporting macrophage (M2 TAM) marker in cancer cells that have come into contact with the test substance; and

[0082] (c) a method for screening a cancer treatment agent, comprising the step of selecting a test substance having (i) an increased expression level of the tumor suppressive macrophage (M1 TAM) marker and (ii) a decreased expression level of the tumor supportive macrophage (M2 TAM) marker compared to a control sample;

[0083] Any cancer cell can be used as the cancer cell, and any type of cancer cell mentioned above can be equally applied to the present screening method.

[0084] The method for screening a cancer treatment agent of the present invention comprises a step of contacting a test substance with cancer cells. Preferably, the cancer cells include cells from a patient with cancer, animal cells, or tissues thereof.

[0085] Additionally, cells induced with cancer-causing substances can be utilized, and any substance known to be a cancer-causing substance can be utilized. Preferably, the cancer cells can be induced by treatment with arsenic, benzene, beryllium, cadmium, hexavalent chromium compounds, ethylene oxide, nickel, radon, or vinyl chloride. For example, any laboratory animal commonly used in the art can be treated with arsenic, benzene, beryllium, cadmium, hexavalent chromium compounds, ethylene oxide, nickel, radon, or vinyl chloride, and the resulting animal model, or cells isolated therefrom, can be used.

[0086] Contact with the above test substance means all contacts in vitro and in vivo, and includes all contacts in which the test substance is treated on cells in vitro or administered to animals, etc. in vivo.

[0087] The method for screening a cancer treatment agent according to the present invention comprises the steps of: confirming the expression levels of tumor suppressive macrophage (M1 TAM) markers and tumor supportive macrophage (M2 TAM) markers in cancer cells that have come into contact with the test substance; and selecting a test substance in which (i) the expression level of the tumor suppressive macrophage (M1 TAM) marker increases and (ii) the expression level of the tumor supportive macrophage (M2 TAM) marker decreases compared to a control sample.

[0088] Preferably, the expression levels of the tumor suppressive macrophage (M1 TAM) marker and the tumor supporting macrophage (M2 TAM) marker can be measured by any one selected from the group consisting of, but not limited to, enzyme-linked immunosorbent assay (ELISA), quantitative real-time polymerase chain reaction (qPCR), immunohistochemistry, Western blotting, and flow cytometry.

[0089] The composition for treating cancer of the present invention can treat cancer by suppressing the survival of M2 macrophages and inducing reprogramming of M2 TAMs into M1 TAMs, thereby inhibiting tumor growth. Furthermore, the screening method of the present invention can be usefully utilized in the development and identification of novel cancer treatment drugs by easily identifying and obtaining substances effective in treating cancer among a large number of therapeutic candidates.

[0090] Figure 1 is a diagram showing that the total TAM density of a primary tumor is reduced by administration of ApoSQ-CAF CM.

[0091] (a) and (b) Left: Immunofluorescence staining using pan-macrophage markers CD11b (red), F4 / 80 (red), and DAPI (blue) in the central and marginal areas of the primary tumor (scale bar: 100 μm).

[0092] (a) and (b) Right: Quantification of TAM density in the central and marginal regions of primary tumors (**P < 0.01, ***P < 0.001, Kruskal-Wallis test with Dunn's post hoc test, data are presented as mean ± standard error from three mice per group).

[0093] Figure 2 is a diagram showing that the M2 TAM fraction of primary tumors is reduced by administration of ApoSQ-CAF CM.

[0094] (a) to (c) Top: Immunofluorescence staining results using M2 markers Arg1 and CD206, and pan-macrophage markers CD11b (red) and F4 / 80 (red) (scale bar: 100 μm).

[0095] Bottom of (a) to (c): Arg1 + and CD206 + This figure shows the quantification of TAM density and M2 TAM fraction. The M2 TAM fraction is CD11b + or F4 / 80 + The percentage of M1 and M2 TAMs within TAM was determined (**P < 0.05, ***P < 0.001, Kruskal-Wallis test with Dunn's post hoc test).

[0096] Figure 3 is a diagram showing that the M1 TAM fraction of primary tumors increases by administration of ApoSQ-CAF CM.

[0097] (a) to (c) Top: Immunofluorescence staining results using M1 markers iNOS (green) and CD16 / 32 (green), and pan-macrophage markers CD11b (red) and F4 / 80 (red) (scale bar: 100 μm).

[0098] (a) to (c) below: iNOS + and CD16 / 32 + This figure shows the quantification of TAM density and M1 TAM fraction. The M1 TAM fraction is CD11b + or F4 / 80 +The percentage of M1 and M2 TAMs within TAM was determined (**P < 0.05, ***P < 0.001, Kruskal-Wallis test with Dunn's post hoc test).

[0099] Figure 4 is a diagram confirming that the cell death promotion effect is mediated by WISP-1.

[0100] Left of (a) to (c): Immunofluorescence staining results using C-Cas3 (red), an apoptosis marker, CD206 (green), an M2 TAM marker, CD16 / 32 (green), an M1 TAM marker, CD11b (red), a pan-macrophage marker, and DAPI (blue) (scale bar: 100 μm).

[0101] Right side of (a) to (c): CD206 + , CD16 / 32 + or CD11b + C-Cas3 in TAM + This is a diagram showing the quantification of cell fraction. (**P < 0.01, ***P < 0.001, Kruskal-Wallis test with Dunn's post hoc test).

[0102] Figure 5 is a diagram confirming that reprogramming from M2 TAM to M1 TAM is induced by administration of ApoSQ-CAF CM.

[0103] (a) CD11b isolated from primary tumor +A heatmap showing the differences in expression of genes related to M1 and M2 markers expressed in TAMs (left, red indicates high expression, blue indicates low expression) and a graph showing the relative expression of some genes from the PCR array analysis for macrophage polarization markers (right). Log2 fold change values ​​are based on CAF CM versus ApoSQ-CAF CM (NS, not significant; **P < 0.01, ***P < 0.001, two-tailed Student's t-test.).

[0104] (b) CD11b isolated from primary tumor + The relative mRNA levels of M2 markers (Arg1, CD206, CD163, IL-4, IL-10, TGF-β1) and M1 markers (TNFα, CD80, H2Ab1, NOS2, IFNγ, and IL-12 p40) in TAMs were confirmed by qRT-PCR (NS, not significant; *P < 0.05, **P < 0.01, ***P < 0.001, Analysis of variance with Tukey's post hoc test.).

[0105] (c) CD11b isolated from primary tumor + This figure shows the results of immunoblotting of Arg1, CD206, iNOS, and CD16 / 32 in TAM.

[0106] (d, e) CD11b isolated from primary tumors + M2 TAM (CD163) in TAM + and CD206 + ) and M1 TAM (CD16 + and CD80 + ) is the result of flow cytometry analysis (**P < 0.01, two-tailed Student's t-test). The right side shows the mean fluorescence intensity (MFI) value.

[0107] (f) Top is CD11b + This is a representative flow cytometry chart for TAM, and the bottom shows the percentage of TAM (CD163 + / MHCII + (TAM ratio).

[0108] (gj) (g) M2 macrophages, (h) regulatory T cells (Tregs), (i) M1 macrophages, (j) CD8 T, respectively + Flow cytometric analysis of cell populations. Lymphomononuclear cells were stained with CD45, CD11b, CD3, CD4, CD8, FoxP3, MHCII, and Ly6C antibodies, and the absolute numbers of each cell type were calculated by flow cytometry (NS, not significant; **P < 0.01, ***P < 0.001, two-tailed Student's t-test.).

[0109] (aj) All data were repeated three times per condition, and cells from one to three mice were used for each repeated experiment.

[0110] (k, l) Confocal images of primary tumors stained with anti-phospho-STAT1 (red), anti-CD206 antibody (green), anti-CD16 / 32 antibody (green), and DAPI (blue) (scale bar: 100 μm), and CD206 + or CD16 / 32 + Phosphorylated STAT1 in cells + The figure shows the quantification of cells (right side of k, left side of l, respectively) (NS, not significant; ***P < 0.001, Analysis of variance with Tukey's post hoc test.).

[0111] Figure 6 is a diagram showing polarization into M1 and M2 macrophages.

[0112] (a) and (b) Schematic diagram showing polarization of M1 and M2 macrophages from THP-1 cells and mouse BMDM.

[0113] (c) and (d) are diagrams showing the results of immunoblotting using M2 markers (CD163, CD206, and Arginase1 (Arg1)) and M1 markers (MHCII, iNOS, and IL12p40) on M1 and M2 macrophages (M2) derived from THP-1 cells and BMDM.

[0114] (e) and (f) are diagrams showing the results of immunofluorescence staining for the M1 marker CD86 and the M2 marker CD163.

[0115] Figure 7 is a diagram confirming in vitro that the apoptosis of M2 macrophages increases by CM administration of CAFs exposed to killed cancer cells.

[0116] (a) and (b) Cell viability of M1 and M2 macrophages derived from THP-1 cells and BMDMs is shown.

[0117] (c) and (d) Left: Diagram showing the results of flow cytometry analysis after annexin V-FITC and PI staining.

[0118] Right side of (c) and (d): Cell death is quantified as the sum of the percentages of early and late stages of cell death (**P < 0.01, ***P < 0.001, two-tailed Student's t-test).

[0119] (e) A diagram showing the results of immunoblotting using Bax, Mcl-1, Bcl-xL, C-Cas3, C-PARP, and β-actin in THP-1-derived M2 macrophages.

[0120] (f) A diagram showing the cell viability of THP-1-derived M1 and M2 macrophages when treated with serum-free medium, CFA CM, ApoA (killed A549 cells)-CAF CM, or NecA-CAF CM.

[0121] (g) Left: A diagram showing the results of flow cytometry analysis after annexin V-FITC and PI staining.

[0122] (g) Right: A graph showing the quantification of cell death as the sum of the percentages of early and late stages of cell death (**P < 0.01, ***P < 0.001, two-tailed Student's t-test).

[0123] Figure 8 is a diagram confirming in vitro that reprogramming from M2 TAM to M1 TAM is induced by CM administration of CAF exposed to killed cancer cells.

[0124] (a) and (b) Relative mRNA levels of M1 markers (NOS2, MHCII, and IL12p40) and M2 markers (TGFβ1, IL10, and IL4) in THP-1 and BMDM-derived M2 macrophages were determined by qRT-PCR.

[0125] (c) This diagram shows the results of ELISA using TNF-α, IL-1β, IL-4, and IL-13 in M2 macrophages derived from THP-1.

[0126] (d) and (e) CD16 among M2 macrophages derived from THP-1 and BMDM + and CD206 + This diagram shows the results of flow cytometry analysis on cells.

[0127] (*P < 0.05, **P < 0.01, ***P < 0.001, two-tailed Student's t-test)

[0128] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0129] Experimental Example 1. Reagents

[0130] Mouse rWISP-1 (1680-WS) and human rWISP-1 (1627-WS) were purchased from R&D Systems (Minneapolis, MN, USA). Neutralizing mouse WISP-1 antibody (MAB1680) and IgG (MAB0061) were purchased from R&D Systems (Minneapolis, MN, USA).

[0131] Experimental Example 2. CAF Isolation and Cell Culture

[0132] Magnetic activated cell sorting (MACS) using Thy1, a fibroblast-specific marker, was used to identify Kras-mutant (Kras) LA1 ) CAFs were isolated from mouse lung tumors. The isolated CAFs were cultured in α-MEM medium supplemented with 10% FBS, penicillin / streptomycin (100 U / 100 μg), 2 mM L-glutamine, and 1 mM sodium pyruvate. For immortalization, CAFs were stably transfected with the TERT plasmid (pCDH-3xFLAG-TERT; Addgene 51 plasmid #51631) using Lipofector-EXT (AptaBio). Primary cells used in the experiment were passaged less than 6 times, and human cell lines were obtained from the American Type Culture Collection (ATCC). 344SQ cells and various human cancer cell lines were cultured in RPMI 1640 medium (HyClone) supplemented with 10% FBS and penicillin / streptomycin (100 U / 100 μg). TM ) were cultured and maintained.

[0133] Experimental Example 3. Induction of Cell Death

[0134] Cancer epithelial cell lines were irradiated with 254 nm of UV light for 15 minutes and then cultured for 2 hours at 37°C in 5% CO2. Light microscopy of Wright-Giemsa-stained samples revealed that most irradiated cells were apoptotic. Furthermore, lysed (necrotic) cancer cells were obtained through multiple freeze-thaw cycles. Apoptosis and necrosis were confirmed by flow cytometric analysis using a FACSCalibur system (BD Biosciences) after staining with annexin V-FITC / propidium iodide (BD Biosciences).

[0135] Experimental Example 4. CAF Culture and CAF Conditioned Medium (CM) Preparation

[0136] CAF 3 X 10 5 cells / ml and incubated overnight at 37°C under 5% CO2 conditions, and then stimulated with serum-starvation for 24 h with X-VIVO 10 medium (04-380Q). For this, culture medium was replaced with 9 × 10 dead or necrotic cancer cells 5 cells / ml) was replaced with X-VIVO 10 medium containing 100 μg / ml of target cancer epithelial cells. After 20 hours, the supernatant was harvested by centrifugation and the target cancer epithelial cells (5 X 10 3 cells / ml) was used as CM for stimulation. The CM was stored at -80°C for in vivo experiments.

[0137] Experimental Example 5. Neutralization of WISP-1 in CM

[0138] CAF CM were incubated with 10 μg / ml mouse anti-WISP-1 neutralizing antibody (R&D Systems) or 10 μg / ml IgG isotype control (R&D Systems) for 2 h. The anti-WISP-1 antibody neutralizing effect was tested by WISP-1 ELISA before use.

[0139] Experimental Example 6. Mouse Experiment

[0140] The experiment was conducted with approval of the experimental protocol (EWHA MEDIACUC 22-015-3) from the Animal Care Committee of the Ewha Womans University Medical Research Institute, and the mice were managed and handled in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH).

[0141] 344SQ cells, a lung adenocarcinoma cell line (1 X 10 in 100 μl of PBS per mouse) 6 (Cells) were injected subcutaneously into the right posterior flank of syngeneic (129 / Sv) mice. Starting 2 days later, CM derived from CAFs (100 μl per mouse) was injected intratumorally three times a week. Additionally, CM with or without neutralizing mouse anti-WISP-1 Ab (10 μg / ml) or isotype IgG was administered on the same schedule. Tumor growth in the mice was monitored daily, and the mice were sacrificed 6 weeks after injection. Autopsies were then performed to examine the diameter and weight of the subcutaneous tumor masses.

[0142] Experimental Example 7. CD11b in Primary Tumors + Separation of TAM

[0143] The autopsied tumors were lysed in RPMI 1640 medium containing 1X collagenase / hyaluronidase with 4 U / mL DNase I. The cell suspension was filtered through 70 μm and 40 μm sterile nylon mesh and incubated with red blood cell lysis buffer. After pulse centrifugation, the supernatant was collected for isolation of macrophages and CD11b + TAMs were isolated using CD11b MicroBeads (Miltenyi Biotec). Isolated TAMs were cultured in DMEM medium containing 20% ​​FBS, 2 mM L-glutamine, 2 mM sodium pyruvate, 55 μM 2-mercaptoethanol, and 1% penicillin-streptomycin. Individual cells were isolated from randomly selected mouse primary tumors, and isolated individual cell groups were identified using qRT-PCR.

[0144] Experimental Example 8. Immunofluorescence staining

[0145] Macrophages (10) grown on glass coverslips until confluent 6 / well) were fixed in 4% paraformaldehyde for 8 minutes at room temperature. For staining paraffin-embedded tumor samples, formalin fixation was performed for 30 minutes at room temperature, and the samples were washed three times for 5 minutes each with IF-Wash buffer (PBS containing 0.05% NaN3, 0.1% BSA, 0.2% Triton X-100, and 0.05% Tween-20) and permeabilized with 0.5% Triton X-100 (Sigma-Aldrich) in PBS for 5 minutes at room temperature. For immunohistochemistry and immunocytochemistry, BSA (5%) in PBS with or without IgG blocking reagent was used. After 1 hour, the target protein was captured with the primary antibody during an 18-hour incubation at 4°C, and the captured protein was visualized with fluorescence-conjugated IgG in a darkroom for 1 hour. After staining, the slides were mounted with VECTASHIELD mounting medium containing DAPI (Vector Laboratories) and imaged using a confocal microscope (LSM5 PASCAL). Information on the antibodies used is shown in Table 1 below.

[0146] AntigenVendorCat.NoSourceSpecies cross-reactivityApplicationDilutionArg1NovusNB100-59740GH, M, RIHC1:100Cell signaling93668RbH, M, RIB1:1000BaxCell signaling2772RbH, M, RIB1:1000Bcl-xLCell signaling2764RbH, M, RIB1:1000Bcl-2Cell signaling3498RbH, MIB1:1000C-Cas3Cell Signaling9661RbH, M, R, MkIB1:1000IHC1:100CD11bNB110-89474NovusRbH, M, R, B, C, Pm, RMIHC1:100MA1-80091InvitrogenRH,M,RIHC1:200CD16 / 32Abcamab223200RbMIHC1:200NBP1-27946NovusRMIHC1:100CD163Abcamab182422RbH, M, RIB1:1000CD206Abcamab64693RbH, M, RIHC1:200InvitrogenMA5-16871RMIHC1:200Cell signaling24595RbH, M, RIB1:1000CD326BD552370RMIHC1:100CD86GeneTexGTX-34569MH, M, RICC1: 200C-PARPCell signaling5625RbH, MIB1:1000F4 / 80Cell signaling70076RbMIHC1:100Abcamab16911RH, MIHC1:100IL12P40abcamab106270RbH, M, RIB1:1000iNOSInvitrogenPA1-036RbH, M, RIHC1:200InvitrogenPA1-036RbH, M, RIB1:1000Integrin ανCell signaling60869RbH, M, RIB1:1000Invitrogen14-0512-85RbH, MNeutralizing5ug / mlIntegrin α5Abcamab150361RbH, M,RIHC1:200Cell signaling98204RbH, M, RIB1:1000InvitrogenPA5-79529RbH, MNeutralizing5ug / mlIntegrin β3Invitrogen11-0611-82HmM, RIHC1:100Cell signaling13166RbH, M, RIB1:1000InvitrogenMA1-35264MHNeutralizing5ug / mlIntegrin β5Cell signaling3629RbH, M, RIB1:1000Invitrogen14-0497-82MH, MNeutralizing5ug / mlMcl-1Cell signaling5453RbH, MIB1:1000MHCIIInvitrogenPA5-116876RbH, M, RIB1:1000p-STAT-1Cell signaling7649RbH, M, RIB1:1000Santa cruzsc-7988GH, MICC1:200IHC1:200p21Santa cruzsc-6246MH, M, RIB1:1000ICC1:200p53Cell signaling2524MH, M, R, Hm, MkIB1:1000p-p53Cell signaling9284RbH, M, R, MkIB1:1000STAT-1Cell signaling9172RbH, M, RIB1:1000α-tubulinAbClonAbC-2001MH, M, RIB1:3000β-actinSanta cruzsc-69879MBroad speciesIB1:1000Goat IgG(Alexa 488)Thermo fisherscientificA11055DNot applicableICC1:1000IgGR&D SystemsMAB005RH, MNeutralizing5ug / mlIgGInvitrogen08-6599MH,MNeutralizing5ug / mlIgGSanta cruzsc-2027RbBroad speciesNeutralizing5ug / mlMouse IgG(Alexa 568)Thermo fisherscientificA11061RbNot applicableICC1:1000Mouse IgG(HRP)GeneTexGTX213111GNot applicableIB1:5000Mouse IgG(HRP)GeneTexGTX213111GNot applicableIB1:5000Rabbit IgG(Alexa 488)Thermo fisherscientificA11008GNot applicableICC1:1000Rabbit IgG(HRP)GeneTexGTX213110GNot applicableIB1:5000Rabbit IgG (HRP)GeneTexGTX213110GNot applicable applicableIB1:5000,

[0147] Experimental Example 9. Immunoblotting Analysis

[0148] Standard Western blot was performed using whole cell extracts, and the information on the antibodies used is shown in Table 1 above. Whole cell extracts were CD11b +were prepared from TAM, THP-1, or BMDM-derived M1 and M2 macrophages. Cells were harvested, washed with cold phosphate-buffered saline (PBS), and lysed in radioimmunoprecipitation assay buffer (10 mM Tris (pH 7.2), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1.0% Triton X-100, and 5 mM EDTA) supplemented with protease inhibitors for 30 min on ice. Equal amounts of protein were then resolved on SDS-PAGE gels (#161-0158, Bio-Rad Laboratories) and transferred to nitrocellulose membranes (10600001, GE Healthcare Life Science) using a wet transfer system (Bio-Rad Laboratories). The membranes were blocked with 5% bovine serum albumin (BSA)-TBST or 5% milk-TBST for 1 h, incubated with labeled primary antibodies overnight, and then incubated with labeled secondary antibodies for 1 h at 37°C. The Odyssey image analysis system (Licor Biosciences) was used for quantification.

[0149] Experimental Example 10. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

[0150] Total RNA was extracted from cancer cells using TRIzol reagent (RNAiso plus reagent, Takara Bio Inc.), and cDNA was synthesized using AccuPower RT PreMix (Bioneer) according to the manufacturer's protocol. SYBR Green-based quantitative real-time polymerase chain reaction (qRT-PCR) was performed using QuantStudio TM3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) was used. mRNA levels were normalized to hypoxanthine guanine phospho-ribosyl transferase HPRT mRNA and expressed as fold change in expression relative to the control. The primer sequences used to amplify the target genes are shown in Table 2.

[0151] Target geneForward (5'→3')Reverse (5'→ 3')HumanIl4CCGTAACAGACATCTTTGCTGCC (SEQ ID NO: 1)GAGTGTCCTTCTCATGGTGGCT (SEQ ID NO: 2)MouseIl4ATCATCGGCATTTTGAACGAGGTC (SEQ ID NO: 3)ACCTTGGAAGCCCTACAGACGA (SEQ ID NO: 4)CGAGCTCACTCTCTGTGGTG (SEQ ID NO: 5)TGAACGAGGTCACAGGAGAA (SEQ ID NO: 6)HumanTgfβ1TACCTGAACCCGTGTTGCTCTC (SEQ ID NO: 7)GTTGCTGAGGTATCGCCAGGAA (SEQ ID NO: 8)MouseTgfβ1TGGAGCAACATGTGGAACTC (SEQ ID NO: 9)TGCCGTACAACTCCAGTGAC (SEQ ID NO: 10) HumanIl10TCTCCGAGATGCCTTCAGCAGA (SEQ ID NO: 11)TCAGACAAGGCTTGGCAACCCA (SEQ ID NO: 12) MouseIl10CGGGAAGACAATAACTGCACCC (SEQ ID NO: 13)CGGTTAGCAGTATGTTGTCCAGC (SEQ ID NO: 14)GCTCTTACTGACTGGCATGAG (SEQ ID NO: 15)CGCAGCTCTAGGAGCATGTG (SEQ ID NO: 16) HumanIl12p40GACATTCTGCGTTCAGGTCCAG (SEQ ID NO: 17)CATTTTTGCGGCAGATGACCGTG (SEQ ID NO: 18) MouseIl12p40TTGAACTGGCGTTGGAAGCACG (SEQ ID NO: 19)CCACCTGTGAGTTCTTCAAAGGC (SEQ ID NO: 20) HumanNos2GCTCTACACCTCCAATGTGACC (SEQ ID NO: 21)CTGCCGAGATTTGAGCCTCATG(SEQ ID NO: 22)MouseNos2GAGACAGGGAAGTCTGAAGCAC(SEQ ID NO: 23)CCAGCAGTAGTTGCTCCTCTTC(SEQ ID NO: 24)GACATTACGACCCCTCCCAC(SEQ ID NO: 25)GCACATGCAAGGAAGGGAAC(SEQ ID NO: 26)HumanMhcIIGAGCAAGATGCTGAGTGGAGTC(SEQ ID NO: 27)CTGTTGGCTGAAGTCCAGAGTG(SEQ ID NO:28)MouseMhcIIGGACCTGAAAGTCACCGACATC(SEQ ID NO: 29)GCTTGAGGTAGGCAGCACAGTT(SEQ ID NO: 30)MouseArg1GTGGGGAAAGCCAATGAAG(SEQ ID NO: 31)GCTTCCAACTGCCAGACTGT(SEQ ID NO: 32)MouseCd206CTAACTGGGGTGCTGACGAG(SEQ ID NO: 33)GGCAGTTGAGGAGGTTCAGT(SEQ ID NO: 34)MouseCd163GGCTAGACGAAGTCATCTGCAC(SEQ ID NO: 35)CTTCGTTGGTCAGCCTCAGAGA(SEQ ID NO: 36)MouseTnfαCCCCAAAGGGATGAGAAGTT(SEQ ID NO: 37)CACTTGGTGGTTTGCTACGA(SEQ ID NO: 38) MouseCd80CCTCAAGTTTCCATGTCCAAGGC (SEQ ID NO: 39) GAGGAGAGATTGTAACGGCAAGG (SEQ ID NO: 40) MouseH2Ab1GTGTGCAGACACAACTACGAGG (SEQ ID NO: 41) CTGTCACTGAGCAGACCAGAGT (SEQ ID NO: 42) MouseIfngCAGCAACAGCAAGGCGAAAAAGG (SEQ ID NO: 43) TTTTCCGCTTCCTGAGGCTGGAT (SEQ ID NO: 44) HprtCAGACTGAAGAGCTACTGTAATG (SEQ ID NO: 45) CCAGTGTCAATTATATCTTCAAC (SEQ ID NO: 46)

[0152] Experimental Example 11. Polarization in THP-1 cells and BMDM

[0153] THP-1 cells were maintained in RPMI 1640 medium containing 10% FBS at 37°C under humidified conditions with 5% CO2. THP-1 cell-derived M1 or M2 macrophages were generated as a macrophage model. Specifically, THP-1 cells were primed with 150 ng / ml PMA for 6 h to produce nonpolarized macrophages. To generate M1 macrophages, nonpolarized macrophages were stimulated with 20 ng / ml IFNγ and 100 ng / ml LPS for 48 h. To generate M2 macrophages, nonpolarized macrophages were further stimulated with 20 ng / ml IL-4 and 20 ng / ml IL-13 for 48 h. Cells were then harvested for immunoblotting analysis or fixed for immunofluorescence staining of the indicated markers. Additionally, BMDMs isolated from the tibia and femur of C57BL / 6 mice were cultured with L929 complement DMEM for 7 days and then polarized into M1 and M2 type macrophages.

[0154] Experimental Example 12. Cell Survival Analysis

[0155] Macrophages (3.5 X 10 4 ) were plated in 96-well plates containing RPMI-1640 medium and cultured in X-VIVO 10 medium for 6 hours. CM or rWISP-1 was added to each group and incubated under 5% CO2, 37°C conditions for 2–4 days. Afterwards, cell counting kit-8 (CCK-8) solution was added to the wells and incubated for 30 minutes. The absorbance was measured at 450 nm using a microplate reader.

[0156] Experimental Example 13. Transient transfection

[0157] CAFs or macrophages were transfected with WISP1 (Bioneer), STAT1 (Bioneer), or control siRNA (SN-1003 AccuTarget) at a final concentration of 50 nM using transfection reagent (Lipofectamin RNAi MAX; Invitrogen, Carlsbad, CA). TM Negative Control) were transiently transfected with siRNA targeting the siRNA. After overnight transfection, cells were cultured in appropriate media for 24 h and stimulated with ApoSQ cells. The siRNA sequences used are as follows (gene: sense, antisense):

[0158] - Stat1: 5'-CUGAAUCAAGACUGA-3' (SEQ ID NO: 47), 5'-UCAGUUGAUCCAG-3' (SEQ ID NO: 48)

[0159] - WISP-1: 5'-GGAAUCCUACAGAUACU-3' (SEQ ID NO: 49), 5'-AAAGAUCCUGAUCCU-3' (SEQ ID NO: 50), 5'-AAAUCCUGAUCCU-3' (SEQ ID NO: 51)

[0160] Experimental Example 14. Cell Death Analysis

[0161] Apoptosis was detected using an annexin V-FITC / propidium iodide (PI) staining kit (BD Biosciences, San Jose, CA, USA) according to the manufacturer's instructions. After harvesting, macrophages were resuspended in 500 μl of binding buffer, and 100 μl of the suspension was stained with 5 μl of FITC-conjugated annexin V and 5 μl of PI for 15 min at room temperature in the dark. FITC-conjugated annexin V-positive cells were then detected by flow cytometry (ACEA NovoCyte, San Diego, CA, USA) using 400 μl of binding buffer, and data were analyzed using NovoExpress software 1.5.

[0162] Experimental Example 15. Flow cytometric analysis

[0163] For FACS-based flow cytometry analysis, NovoCyte (Agilent, Santa Clara, CA, USA) was used. All cell suspensions (1x10 6 CD11b + TAM and M2 macrophages were placed in 500 μl buffer (PBS + 2% FBS) and incubated for 60 min with fluorophore-conjugated anti-mouse antibodies using the manufacturer's recommended concentration. All antibodies used are listed in Table 3 below. Data acquisition was performed on NovoCyte (Agilent, Santa Clara, CA, USA), and NovoExpress Software 1.5 was used for analysis.

[0164] AntigenVendorCat.NoSourceCloneDilutionCD16BD Bioscience335035MouseNKP15(IVD)1:500CD206eBioscience12-2061-82MouseMR6F31:100CD163eBioscience12-1631-82MouseTNKUPJ1:100MHCIIeBioscience25-5321-82MouseM5 / 114.15.21:100

[0165]

[0166] Experimental Example 16. ELISA

[0167] TNF-α, IL-1β, IL-4, and IL-13 in macrophage cultures were measured using ELISA kits (R&D Systems) according to the manufacturer's instructions.

[0168] Experimental Example 17. Statistics

[0169] Pairwise comparisons were performed using the two-tailed Student's t-test, and multiple comparisons were performed using the Kruskal-Wallis test followed by Dunn's post hoc test. A P value less than 0.05 was considered statistically significant, and all data were analyzed using Prism 5 software (GraphPad Software Inc., San Diego, CA, USA).

[0170] Example 1. Changes in the density and fraction of TAMs following ApoSQ-CM administration

[0171] Immunocompetent syngeneic (129 / Sν) mice were administered intratumorally three times weekly with CAF CM (CM of CAFs) or ApoSQ-CAF CM (CM of CAFs exposed to killed 344SQ cells) starting 2 days after 344SQ administration. In addition, prior to administration of the CM, the CMs were pre-incubated for 2 h with a neutralizing antibody against WISP-1 or an IgG isotype control antibody.

[0172] (1) Change in total TAM density

[0173] Immunofluorescence staining using total TAM markers (CD11b and F4 / 80) revealed that administration of ApoSQ-CAF CM significantly reduced total TAM density in both the central and marginal regions of primary tumors compared to administration of CAF CM (Fig. 1). On the other hand, administration of WISP-1 immunodepleted ApoSQ-CAF CM did not change total TAM density, but administration of CM pre-incubated with IgG isotype control antibody showed an effect similar to that of administration of ApoSQ-CAF CM.

[0174] That is, the reduction in total TAM density in primary tumors by administration of ApoSQ-CAF CM is achieved through the action of WISP-1.

[0175] (2) Change in TAM fraction

[0176] To determine how administration of ApoSQ-CAF CM changes the subtype distribution of TAMs in primary tumors, immunofluorescence staining was performed using M2 markers (Arg1 and CD206) and M1 markers (iNOS and CD16 / 32). As a result, it was confirmed that the M2 TAM fraction significantly decreased after administration of ApoSQ-CAF CM (Fig. 2), whereas the M1 TAM fraction increased (Fig. 3). On the other hand, when WISP-1 immunodepleted ApoSQ-CAF CM was administered, the changes in the M1 and M2 TAM fractions were reversed, whereas when CM pre-incubated with an IgG isotype control antibody was administered, the same changes as when ApoSQ-CAF CM was administered.

[0177] Additionally, apoptosis of M2 TAMs (Cleaved Caspase-3) was induced by ApoSQ-CAF CM. + (C-Cas3 + ) / CD11b + ) increases, while apoptosis of M1 TAM (C-Cas3 + / CD16 / 32 + ) was confirmed to have little effect on total TAM apoptosis (Cleaved Caspase-3) in primary tumors (Figs. 4a and 4b). In addition, total TAM apoptosis (Cleaved Caspase-3) in primary tumors + (C-Cas3 + ) / CD11b +) was significantly increased by administration of ApoSQ-CAF CM (Fig. 4c). On the other hand, when WISP-1 immunodepleted ApoSQ-CAF CM was administered, the apoptosis of M2 TAM and total TAM was not increased. On the other hand, when CM pre-incubated with IgG isotype control antibody was administered, the same apoptosis increase pattern as when ApoSQ-CAF CM was administered. In other words, according to the above experimental results, the tumor growth inhibitory effect of ApoSQ-CAF CM is mediated by WISP-1.

[0178] Example 2. Induction of reprogramming from M2 TAM to M1 TAM by ApoSQ-CM administration.

[0179] (1) Changes in expression levels of M2 and M1 markers

[0180] CD11b isolated from primary tumors +The mRNA levels of M2 and M1 markers in TAM were analyzed using RT-qPCR arrays, respectively. As a result, nine M2-related genes were downregulated more than twofold when ApoSQ-CAF CM was administered compared to the CAF CM group (Fig. 5a). Conversely, seven M1-related genes, including Cd32, Ifng, Cd16, Tnf, Nos2, Socs3, and Cd80, were upregulated more than twofold in the ApoSQ-CAF CM group compared to the CAF CM group. To confirm these mRNA expression changes, qRT-PCR analysis of M2- and M1-specific markers and cytokines was also performed. As a result, when ApoSQ-CAF CM was administered, the mRNA levels of M2 markers (Arg1, CD206, CD163, IL-4, IL-10, and TGFβ1) significantly decreased, whereas the mRNA levels of M1 markers (TNFα, CD80, H2Ab1, NOS2, IFNγ, and IL12p40) increased (Fig. 5b). In addition, immunoblotting results showed that, similar to the change in mRNA levels, the protein levels of M2 markers (Arg1 and CD206) decreased with ApoSQ-CAF CM administration, whereas the protein levels of M1 markers (iNOS and CD16 / 32) increased (Fig. 5c). Meanwhile, when WISP-1 immunodepleted ApoSQ-CAF CM was administered, these changes in expression levels were reversed, and when CM pre-incubated with IgG isotype control antibody was administered, the same appearance as when ApoSQ-CAF CM was administered was observed.

[0181] Additionally, CD11b isolated from primary tumors + Flow cytometry analysis was performed using M2 and M1 markers in TAM. As a result, administration of ApoSQ-CAF CM resulted in an increase in M2 TAM (CD11b + CD163 in TAM + or CD206 +) significantly reduced the proportion of TAMs expressing an M1-like phenotype (CD11b + CD16 in TAM + or CD80 + ) significantly increased the ratio (Figures 5d and 5e).

[0182] In addition, CD11b isolated from primary tumors + Flow cytometric analysis using M2 and M1 markers on TAMs revealed that CD163 + / MHCII + The proportion of TAMs was significantly reduced (Fig. 5f). In addition, flow cytometric analysis was performed on lymphomonocytes stained with CD45, CD11b, CD3, CD4, CD8, FoxP3, MHCII, and Ly6C antibodies. The numbers of (g) M2 macrophages and (h) regulatory T cells (Tregs) were significantly reduced, whereas (i) M1 macrophages and (j) CD8 + The number of T cells showed a tendency to increase significantly (Figures 5g to 5j).

[0183] Therefore, it was confirmed that the expression of M2 markers decreased while the expression of M1 markers increased by administration of ApoSQ-CAF CM, a substance that inhibits tumor growth.

[0184] (2) Role of STAT1 in reprogramming from M2 TAM to M1 TAM

[0185] Immunofluorescence staining was performed on primary tumor tissues and analysis results showed that M2 TAM (pSTAT1) was increased after ApoSQ-CAF administration + / CD206 + ) showed enhanced phosphorylated STAT1 (Fig. 5k), but M1 TAM (pSTAT1 + / CD16 / 32 + ) this effect was not observed (Fig. 5l).

[0186] That is, the above experimental results confirmed that ApoSQ-CAF CM induced reprogramming from M2 TAM to TAM expressing an M1-like phenotype through the WISP-1-STAT1 signaling pathway.

[0187] Example 3. Inhibition of M2 TAM survival and induction of transformation from M2 TAM to M1 TAM by ApoSQ-CM administration (in vitro)

[0188] (1) Changes in survival and death of M1 and M2 macrophages

[0189] For in vitro studies, THP-1 cells and primary mouse bone marrow-derived macrophages (BMDMs) were polarized into M1 and M2 macrophages to mimic TAMs (Figures 6a and 6b). Successful polarization into M1 and M2 macrophages was confirmed by immunoblotting using M2 markers (CD163, CD206, and Arg1) and M1 markers (MHCII, iNOS, and IL12p40) (Figures 6c and 6d). Furthermore, confocal microscopy analysis also revealed CD86 + M1 and CD163 + Polarization was confirmed using the M2 marker (Figs. 6e and 6f).

[0190] Polarized M1 and M2 macrophages from THP-1 cells and BMDMs were treated with CM for 4 days under serum-free starvation, and cell viability was analyzed using the CCK-8 assay. Regardless of whether CAF CM was exposed to apoptotic 344SQ cells (ApoSQ) or necrotic 344SQ cells (NecSQ), M1 macrophage viability on days 2 and 4 was not affected. However, treatment with ApoSQ-CAF CM decreased M2 macrophage viability on days 2 and 4 (Figs. 7a and 7b).

[0191] Furthermore, flow cytometric analysis after annexin V-FITC and PI staining revealed that CAF CM did not affect the apoptosis of M1 macrophages, regardless of whether they were exposed to ApoSQ or NecSQ. In contrast, treatment with ApoSQ-CAF CM increased the apoptosis of M2 macrophages (Figs. 7c and 7d).

[0192] Meanwhile, when THP-1-derived M2 macrophages were treated with ApoSQ-CAF CM, the expression levels of pro-apoptotic biomarkers, including Bax, C-Cas3, and C-PARP, increased, but the expression levels of anti-apoptotic biomarkers, Mcl-1 and Bcl-xL, decreased (Fig. 7e).

[0193] Similarly, treatment with ApoA (dead A549 cells)-CAF CM decreased the viability and increased apoptosis of THP-1-derived M2 macrophages, but did not change the viability or apoptosis of M1 macrophages (Figs. 7f and 7g).

[0194] (2) Reprogramming from M2 TAM to M1 TAM

[0195] When THP-1 or BMDM-derived M2 macrophages were treated with ApoSQ-CAF CM, the mRNA levels of M1 markers (NOS2, MHCII, and IL12p40) increased, while the mRNA levels of M2 markers (TGFβ1, IL10, and IL4) decreased. However, when the M2 macrophages were treated with CAF CM and NecSQ-CAF CM, no changes in the expression of the markers were observed (Figs. 8a and 8b).

[0196] Similarly, treatment of THP-1-derived M2 macrophages with ApoSQ-CAF CM enhanced the levels of M1 cytokines, including TNFα and IL-1β, whereas suppressed the levels of M2 cytokines, including IL-4 and IL-13 (Fig. 8c). In addition, flow cytometry analysis showed that treatment of THP-1-derived M2 macrophages or BMDM-derived M2 macrophages with ApoSQ-CAF CM decreased the surface expression of the CD206 M2 marker and increased the surface expression of the CD16 M1 marker compared to treatment with CAF CM or NecSQ-CAF CM (Figs. 8d and 8e).

[0197] Therefore, similar to the in vivo results, we confirmed that the survival of M2 macrophages was inhibited by ApoSQ-CAF CM in vitro and that M2 macrophages were reprogrammed into macrophages expressing an M1-like phenotype.

[0198] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering the technical spirit or essential characteristics of the present invention. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A pharmaceutical composition for treating cancer, comprising a culture medium in which cancer-associated fibroblasts (CAFs) and apoptotic cancer cells are co-cultured.

2. A pharmaceutical composition according to claim 1, wherein the cancer-related fibroblasts are associated with at least one cancer selected from the group consisting of fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, hemangiosarcoma, malignant skin cancer, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, osteosarcoma, lung cancer, stomach cancer, breast cancer, colon cancer, and prostate cancer.

3. A pharmaceutical composition according to claim 1, wherein the killed cancer cells are killed by ultraviolet ray (UV) irradiation.

4. A pharmaceutical composition according to claim 1, wherein the cancer disease is at least one selected from the group consisting of breast cancer, uterine cancer, esophageal cancer, stomach cancer, brain cancer, rectal cancer, colon cancer, lung cancer, skin cancer, ovarian cancer, cervical cancer, blood cancer, pancreatic cancer, prostate cancer, testicular cancer, laryngeal cancer, oral cancer, head and neck cancer, thyroid cancer, liver cancer, bladder cancer, osteosarcoma, lymphoma, and leukemia.

5. In the first paragraph, the pharmaceutical composition (i) increases the expression level of a tumor suppressive macrophage (M1 TAM) marker, and (ii) decreases the expression level of a tumor supportive macrophage (T2 TAM) marker.

6. In the fifth paragraph, the tumor suppressive macrophage (T1 TAM) marker is at least one selected from the group consisting of CD16 / 32, CD80, H2Ab1, MHCII, iNOS (NOS2), IFNγ, IL12p40, TNFα, and IL-1β, and the tumor supportive macrophage (T2 TAM) marker is at least one selected from the group consisting of CD163, CD206, Arginase 1 (Arg1), TGFβ1, IL-10, IL-4, and IL-13. A pharmaceutical composition.

7. A pharmaceutical composition according to claim 1, wherein the pharmaceutical composition (i) increases the expression level of a pro-apoptotic marker and (ii) decreases the expression level of an anti-apoptotic marker.

8. A pharmaceutical composition according to claim 7, wherein the pro-apoptotic marker is at least one selected from the group consisting of Bax, C-Cas3, and C-PARP, and the anti-apoptotic marker is at least one selected from the group consisting of Mcl-1 and Bcl-xL. 9.(a) A step of administering a carcinogenic substance or cancer cells to an experimental animal other than a human; (b) a step of administering a test substance to the experimental animal; and (c) A method for screening a cancer treatment agent, comprising: a step of confirming the expression level of a tumor suppressive macrophage (M1 TAM) marker and a tumor supportive macrophage (M2 TAM) marker in cells of the experimental animal; 10. A method for screening a cancer treatment agent in claim 9, wherein the cancer cells of step (a) are at least one cancer cell selected from the group consisting of fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, hemangiosarcoma, malignant skin cancer, lymphangiosarcoma, synovial sarcoma, chondrosarcoma, osteosarcoma, lung cancer, stomach cancer, breast cancer, colon cancer, and prostate cancer.

11. A method for screening a cancer treatment agent in claim 9, wherein the experimental animal in step (a) is a mouse.

12. A method for screening a cancer treatment agent in paragraph 9, wherein the test substance administration in step (b) is oral or parenteral administration.

13. A method for screening a cancer treatment agent in claim 9, wherein in step (c), the tumor suppressive macrophage (T1 TAM) marker is at least one selected from the group consisting of CD16 / 32, CD80, H2Ab1, MHCII, iNOS (NOS2), IFNγ, IL12p40, TNFα, and IL-1β, and the tumor supportive macrophage (T2 TAM) marker is at least one selected from the group consisting of CD163, CD206, Arginase 1 (Arg1), TGFβ1, IL-10, IL-4, and IL-13.

14. A method for screening a cancer treatment agent in the 9th paragraph, wherein in step (c), a test substance is selected that (i) increases the expression level of a tumor suppressive macrophage (M1 TAM) marker and (ii) decreases the expression level of a tumor supportive macrophage (T2 TAM) marker.

15. A method for screening a cancer treatment agent in claim 9, wherein the cancer disease is at least one selected from the group consisting of breast cancer, uterine cancer, esophageal cancer, stomach cancer, brain cancer, rectal cancer, colon cancer, lung cancer, skin cancer, ovarian cancer, cervical cancer, blood cancer, pancreatic cancer, prostate cancer, testicular cancer, laryngeal cancer, oral cancer, head and neck cancer, thyroid cancer, liver cancer, bladder cancer, osteosarcoma, lymphoma, and leukemia.

16. A method for screening a cancer treatment agent, further comprising the step of confirming (i) an increase in the expression level of a pro-apoptotic marker and (ii) a decrease in the expression level of an anti-apoptotic marker in cells of the experimental animal, in accordance with paragraph 9.

17. A method for screening a cancer treatment agent in claim 16, wherein the pro-apoptotic marker is at least one selected from the group consisting of Bax, C-Cas3, and C-PARP, and the anti-apoptotic marker is at least one selected from the group consisting of Mcl-1 and Bcl-xL.

18. A method for screening a cancer treatment agent in claim 9, wherein the test substance is a pharmaceutical composition containing a culture medium in which cancer-associated fibroblasts (CAFs) and apoptotic cancer cells are co-cultured. 19.(a) Step of contacting the test substance with cancer cells; (b) a step of confirming the expression level of tumor suppressive macrophage (M1 TAM) marker and tumor supporting macrophage (M2 TAM) marker in cancer cells that have come into contact with the test substance; and (c) A method for screening a cancer treatment agent, comprising the step of selecting a test substance in which (i) the expression level of the tumor suppressive macrophage (M1 TAM) marker increases and (ii) the expression level of the tumor supportive macrophage (M2 TAM) marker decreases compared to a control sample.

Citation Information

Patent Citations

  • The composition for inhibiting cancer metastasis using apoptotic cells

    KR1020170092095A

  • apparatus of making spheroid chaosnet PUF pattern and method of making pattern using the same

    KR1020240141523A

  • Pharmaceutical composition for preventing or treating arthritis comprising enzyme hydrolyzed extracts of Acanthopnax sessiliflorus, Acanthopnax sessiliflorus, or Alnus sibirica as an active ingredient

    KR1020250057543A

  • Antenna and electronic device including the same

    KR102762826B1

  • KR20230046190A