Compositions and methods for regulating expression of nuclear factor erythroid 2-related factor 2 (NRF2)

Antisense oligonucleotides targeting NRF2 pre-mRNA transcripts modulate splicing to produce constitutively active NRF2 proteins, addressing the limitations of current agents by enhancing specificity and reducing toxicity in treating NRF2-associated diseases.

WO2025250611A1PCT designated stage Publication Date: 2025-12-04RIBOWAY THERAPEUTICS INC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/031159
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-29
Filing Date
2025-05-28
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Existing small molecule and peptide-based agents for modulating NRF2 activation lack target specificity and potency, leading to off-target side effects and toxicity in treating diseases associated with oxidative stress and inflammation.

Method used

Development of antisense oligonucleotides that target NRF2 pre-mRNA transcripts to modulate splicing, producing NRF2 mRNA isoforms that encode constitutively active NRF2 proteins resistant to KEAP1 inhibition, using specific sequences and modifications to enhance specificity and efficacy.

Benefits of technology

The antisense oligonucleotides effectively regulate NRF2 expression and activity, reducing off-target effects and enhancing therapeutic outcomes for diseases such as CNS, autoimmune, respiratory, cardiovascular, and metabolic diseases by inducing NRF2 proteins that are not inhibited by KEAP1.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000021_0001
    Figure IMGF000021_0001
  • Figure IMGF000022_0001
    Figure IMGF000022_0001
  • Figure IMGF000023_0001
    Figure IMGF000023_0001
Patent Text Reader

Abstract

Antisense oligonucleotides for modulating NRF2 splicing and / or expression, and methods of use (e.g., for treating an NRF2-associated disease) are described.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] COMPOSITIONS AND METHODS FOR REGULATING EXPRESSION OF NUCLEAR FACTOR ERYTHROID 2-RELATED FACTOR 2 (NRF2)

[0002] RELATED APPLICATIONS

[0003] This Application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 653214, filed on May 29, 2024, the entire contents of which are incorporated herein by reference.

[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0005] The contents of the electronic sequence listing (L094870001WO00-SEQ-ZJG.xml; Size: 3,802,563 bytes; and Date of Creation: May 28, 2025) are herein incorporated by reference in its entirety.

[0006] FIELD

[0007] The invention relates to compositions (e.g., antisense oligonucleotides) for modulating splicing, expression, and / or activity of nuclear factor erythroid 2-related factor 2 (NRF2).

[0008] BACKGROUND

[0009] Nuclear factor erythroid 2-related factor 2 (NRF2) is a key transcription factor in the regulation of oxidative stress, cell cycle homeostasis, cytoprotection, and innate immunity. NRF2 is primarily found in the cytoplasm, where it interacts with Kelch-like Ech-associated protein 1 (KEAP1). Under normal conditions, KEAP1 inhibits the transcriptional activity of NRF2 via ubiquitination and proteasomal degradation. The classical activation pathway of NRF2 is caused by oxidative stress, which initiates a conformational change that destabilizes the KEAP1-NRF2 interaction and allows excess NRF2 to accumulate in the nucleus and induce the expression of cytoprotective genes. Due to its role in oxidative stress regulation, aberrant NRF2 expression has been associated with a number of diseases including central nervous system diseases, autoimmune diseases, respiratory diseases, cardiovascular diseases, and metabolic diseases. SUMMARY

[0010] Activation of NRF2 is crucial for cell survival under stress due to its versatile cytoprotective functions including antioxidant, detoxication, anti-inflammatory, metabolic and maintenance of protein homeostasis. As a transcription factor, it controls a range of targets involved in iron metabolism, NADPH production, glutathione & Thioredoxin metabolism, multidrug resistance-associated proteins, and so on. Through its transcriptional targets, NRF2 activation orchestrates a comprehensive and long-lasting protection that allows adaptation and survival under diverse forms of cellular and organismal stress. Activation of NRF2 is found to benefit a range of diseases including central nervous system (CNS) diseases, autoimmune diseases, respiratory diseases, cardiovascular diseases, and metabolic diseases managing oxidative stress and inflammation, and maintaining cellular homeostasis. Take neurodegenerative diseases as example, NRF2 activation and / or overexpression can address the hallmark pathologies such as increased oxidative stress, chronic inflammation, and protein misfolding.

[0011] Small molecule and / or peptide-based agents that seek to modulate NRF2 and the NRF2- KEAP1 pathway have been developed and are being explored as therapeutic agents for various diseases. However, such agents lack target specificity and potency, and often lead to off-target side effects and toxicity. The present disclosure, in some aspects, provide novel strategies that directly and specifically target NRF2 for modulating NRF2 expression and / or activity. The compositions and methods described herein modulate NRF2 pre-mRNA splicing, leading to NRF2 mRNA isoforms that encode functionally active NRF2 protein that is not subject to interaction with and inhibition by KEAP1.

[0012] Accordingly, aspects of this disclosure provide an antisense oligonucleotide that targets a Nuclear Factor Erythroid 2-related Factor 2 (NRF2) RNA pre-mRNA transcript, wherein the antisense oligonucleotide modulates splicing of the NRF2 RNA pre-mRNA transcript, optionally wherein the splicing modulation results in an NRF2 mRNA isoform that encodes a constitutively active form of the protein. In some embodiments, the NRF2 mRNA isoform encodes an NRF2 protein that does not interact with Kelch-like Ech-associated protein 1 (KEAP1). In some embodiments, the NRF2 mRNA isoform encodes an NRF2 protein that has N-terminal partially deleted (e.g., an NRF2 protein that lacks the entire of part of the NEH2 domain).

[0013] In some embodiments, the antisense oligonucleotide comprises a region of complementary to a human NRF2 pre-mRNA transcript comprising a nucleobase sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the antisense oligonucleotide comprises a region of complementarity to an NRF2 target sequence comprising a splicing regulatory element selected from: a splicing donor site, a splicing acceptor site, a branch point sequence, an exonic splicing enhancer, an exonic splicing silencer, an intronic splicing enhancer, and / or an intronic splicing silencer.

[0014] In some embodiments, the antisense oligonucleotide is 15-35 nucleotides in length, optionally wherein the antisense oligonucleotide is 16-25 nucleotides in length.

[0015] In some embodiments, the region of complementarity is at least 8 nucleotides in length, optionally wherein the region of complementarity is at least 12 nucleotides in length.

[0016] In some embodiments, the antisense oligonucleotide comprises a region of complementarity of at least 8 nucleotides to an NRF2 target sequence as set forth in SEQ ID NO: 37-1968. In some embodiments, the antisense oligonucleotide comprises at least 8 consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, optionally wherein the antisense oligonucleotide comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T).

[0017] In some embodiments, the antisense oligonucleotide comprises one or more modified nucleosides and / or one or more modified internucleoside linkages. In some embodiments, the one or more modified nucleosides comprise 2’-modified nucleosides selected from: a 2'-O- methyl nucleoside, a 2'-fluoro nucleoside, a 2'-O-methoxyethyl (MOE) nucleoside, a 2'-O- aminopropyl (2'-O-AP) nucleoside, a 2'-O-dimethylaminoethyl (2'-O-DMAOE) nucleoside, a 2'- O-dimethylaminopropyl (2'-O-DMAP) nucleoside, a 2'-O-dimethylaminoethyloxyethyl (2'-O- DMAEOE) nucleoside, a 2'-O-N-methylacetamido (2'-0-NMA) nucleoside, and 2', 4'- bridged nucleosides, and combinations thereof, optionally wherein the 2', 4'- bridged nucleosides are selected from a locked nucleic acid (LNA), an ethyl-constrained nucleotide, a 2'-(S)-constrained ethyl (S-cEt) nucleotide, a constrained MOE, a 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC), an alpha-L-locked nucleic acid, a tricyclo-DNA, and combinations thereof. In some embodiments, the one or more modified nucleosides comprise 2’-M0E nucleosides. In some embodiments, the one or more modified internucleoside linkages are selected from: a phosphorothioate internucleoside linkage, a phosphonoacetate (PACE) intemucleoside linkage, a thiophosphonoacetate (thioPACE) intemucleoside linkage, an amide internucleoside linkage, a triazole intemucleoside linkage, a phosphonate intemucleoside linkage, a phosphotriester intemucleoside linkage, and combinations thereof, optionally wherein the one or more modified intemucleoside linkages comprise phosphorothioate intemucleoside linkages. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO). In some aspects, this disclosure provides a composition comprising an antisense oligonucleotide described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0018] In some aspects, this disclosure provides a method of modulating NRF2 splicing and / or producing a constitutively active NRF2 in a cell, comprising contacting the cell with an antisense oligonucleotide disclosed herein or a composition disclosed herein. In some embodiments, the cell is in vitro. In some embodiments, the cell is in vivo. In some embodiments, the cell is a cell of the central nervous system (CNS) or a liver cell.

[0019] In some aspects, this disclosure provides a method of modulating NRF2 splicing and / or producing a constitutively active NRF2 in a subject in need thereof, comprising administering to the subject an antisense oligonucleotide disclosed herein or a composition disclosed herein. In some embodiments, the splicing modulation activates NRF2. In some embodiments, the splicing modulation produces a constitutively active NRF2 protein.

[0020] In some aspects, this disclosure provides a method of treating a NRF2-associated disease, comprising administering to a subject in need thereof an antisense oligonucleotide disclosed herein or a composition disclosed herein. In some embodiments, the NRF2 associated disease is a CNS disease or a liver disease.

[0021] In some embodiments, the subject is human. In some embodiments, the administration is parenteral.

[0022] DETAILED DESCRIPTION

[0023] Generally, nomenclatures used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Certain methods and techniques provided herein are generally performed according to methods well- known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as otherwise described herein. The nomenclatures, laboratory procedures and techniques of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, delivery, and treatment of patients.

[0024] Any of the methods for gene therapy available in the art can be used in the methods provided herein. For general reviews of the methods of gene therapy, see Goldspiel et al. (1993) Clin. Pharmacy 12:488-505; Wu and Wu (1991) Biotherapy 3:87-95; Tolstoshev (1993) Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan (1993) Science 260:926- 932; Morgan and Anderson (1993) Ann. Rev. Biochem. 62: 191-217; and May (1993) TIBTECH 11(5): 155-215. Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley &Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). Detailed description of various methods of gene therapy are disclosed in US Patent Publication No. US20050042664.

[0025] Definitions

[0026] In order that the present disclosure may be more readily understood, certain terms are first defined. Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and / or” unless stated otherwise. The use of the term “including”, as well as other forms of the term, is not limiting.

[0027] In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also part of this disclosure.

[0028] As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly dictates otherwise. “And” as used herein is interchangeably used with “or” unless expressly stated otherwise. The terms “comprising, “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value recited or falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited.

[0029] The term “about” or “approximately,” as applied to one or more values provided herein, refers to a value that is similar to a stated reference value. In some embodiments, the term “about” or “approximately” refers to a range of values that fall within and include 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context. In some embodiments, “about” or “approximately” can be understood as about 2 standard deviations from the mean. In some embodiments, “about” or “approximately” means up to and including +10% (e.g., ±10%, +9%, +8%, ±7%, +6%, +5%, ±4%, ±3%, ±2%, +1%, or less). In some embodiments, “about” or “approximately” means +5%. When “about” or “approximately” is present before a series of numbers or a range, it is understood that it can modify each of the numbers in the series or range.

[0030] The term “administering” or “administration of,” as used herein, means to provide an agent, e.g., antisense oligonucleotide to a subject. In some embodiments, “administering” or “administration of ” means to provide an antisense oligonucleotide to a subject in a manner that is physiologically and / or pharmacologically useful (e.g., to treat a condition in the subject). Nonlimiting examples of routes of administration include intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal routes, or intracerebroventricular routes. In some embodiments, the route of administration is intrathecal, or intracerebroventricular routes. In some embodiments, the route of administration is intrathecal. In some embodiments, the route of administration is intracerebroventricular. In some embodiments, the route of administration is subcutaneous.

[0031] The term “antisense oligonucleotide (ASO),” as used herein, refers to a single-stranded oligonucleotide which comprises a region of complementarity capable of hybridizing with a part, for example, a target region of a target sequence (e.g., gene sequence, pre-mRNA sequence, or mRNA sequence), and which can modulate the processing of the transcription product of a target gene and / or the expression (e.g., mRNA and / or protein level) of the target gene. In some embodiments, a target region of a target sequence can have a length of at least 8 nucleosides, for example, a length of 8, 9, 10, 11, 12, 13, 14, 15, or more nucleosides.

[0032] In some embodiments, an antisense oligonucleotide disclosed herein modulates splicing of an NRF2 pre-mRNA. For example, in some embodiments, an antisense oligonucleotide disclosed herein induces skipping of one or more (e.g., 1, 2, 3, or 4) exons in an NRF2 pre- mRNA. In some embodiments, an exon whose splicing is modulated by an antisense oligonucleotide described herein may be partially or entirely skipped. In some embodiments, the splicing modulation results in an NRF2 mRNA isoform that is constitutively active. In some embodiments, the NRF2 mRNA isoform encodes an NRF2 protein that does not interact with Kelch-like Ech-associated protein 1 (KEAP1). In some embodiments, the NRF2 mRNA isoform encodes an NRF2 protein that has its N-terminus partially deleted (e.g., an NRF2 protein that lacks the entire of part of the NEH2 domain).

[0033] The term “at least” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides or nucleosides in a nucleic acid molecule must be an integer. For example, “at least 19 nucleosides of a 21 -nucleotide nucleic acid molecule” means that 19, 20, or 21 nucleosides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

[0034] The term “biological activity” means any biological property of a molecule, whether present naturally in vivo, or provided or enabled by recombinant means. Biological activities include, but are not limited to, binding to a receptor, inducing cell proliferation, inhibiting cell growth, inducing other cytokines, inducing apoptosis, and enzymatic activity.

[0035] The term “branch point” or “branch site,” as used herein, refers to a nucleic acid sequence motif within an intron of a gene or pre-mRNA that is involved in splicing of pre- mRNA into mRNA (i.e., removing introns from the pre-mRNA), and can be referred to as a splicing feature. A branch point is typically located 18 to 40 nucleotides from the 3’ end of an intron, and contains an adenine but is otherwise relatively unrestricted in sequence. Common sequence motifs for branch points are YNYYRAY, YTRAC, and YNYTRAY, where Y is a pyrimidine, N is any nucleotide, R is any purine, and A is adenine. During splicing, the pre- mRNA is cleaved at the 5’ end of the intron, which then attaches to the branch point region downstream through transesterification bonding between guanines and adenines from the 5’ end and the branch point, respectively, to form a looped lariat structure.

[0036] The term “contiguous” or “consecutive” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

[0037] The term “complementary,” as used herein, refers to the capacity for base pairing between two nucleobases or two nucleobase sequences. In particular, complementary is a term that characterizes an extent of hydrogen bond pairing that brings about binding between two nucleobases or two nucleobase sequences. For example, if a base at one position of a nucleobase sequence (e.g., of an antisense oligonucleotide described herein) is capable of hydrogen bonding with a base at the corresponding position of another nucleobase sequence (e.g., target gene sequence, pre-mRNA sequence, or mRNA sequence), then the bases are considered to be complementary to each other at that position. The nucleic acid molecules (e.g., antisense oligonucleotide) whose nucleobase sequence is complementary may comprise one or more modified nucleosides and modified internucleoside linkages. The nucleic acid molecules (e.g., antisense oligonucleotide and target sequence) whose nucleobase sequence is complementary may also comprise nucleobase analogous that result in bases at certain positions not being complementary, but the nucleobase sequences of the two molecules must be sufficiently complementary over the entire length to result in a desired biological activity (e.g., modulation of gene expression).

[0038] Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs (e.g., Wobble base pairs and Hoogsteen base pairs) and may include natural or modified nucleosides or nucleoside mimics. For example, in some embodiments, for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil-type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as 3 -nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U or T.

[0039] Complementarity is independent of modifications in the sugar of a nucleoside. For example, 2’ -modified A, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.

[0040] The term “perfectly complementary” or “fully complementary” means that all (100%) of the nucleobases, nucleosides, or nucleotides in a contiguous sequence of a first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of nucleobases, nucleosides, or nucleotides in a contiguous sequence of second nucleotide sequence (e.g., a target sequence such as an NRF2 pre-mRNA or mRNA). The contiguous sequence may comprise all or a part of a first or second nucleotide sequence. The term “partially complementary” means that in a hybridized pair of nucleobase, nucleosides, or nucleotide sequences, at least 70%, but not all, of the bases in a contiguous sequence of a first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of bases in a contiguous sequence of a second nucleotide sequence (e.g., a target sequence such as an NRF2 pre-mRNA or mRNA). The term “sufficiently complementary” or “substantially complementary” means that in a hybridized pair of nucleobase, nucleosides, or nucleotide sequences, at least 85%, but not all, of the bases in a contiguous sequence of a first nucleotide sequence (e.g., an antisense oligonucleotide) will hybridize with the same number of bases in a contiguous sequence of a second nucleotide sequence (e.g., a target sequence such as an NRF2 pre-mRNA). The terms “complementary,” “fully complementary,” “partially complementary,” and “suffi ci ently / sub stand ally complementary” herein are used with respect to the nucleobase, nucleosides, or nucleotide matching between an antisense oligonucleotide and a target sequence (e.g., an NRF2 pre-mRNA).

[0041] The term “control” or “reference,” when referring to a substance, means a composition used as a standard or a point of comparison against which other test results are measured. In some embodiments, a “control” or “reference” is a composition known to not contain analyte (“negative control”) or to contain analyte (“positive control”). A positive control can comprise a known concentration of analyte. “Control,” and “positive control,” may be used to refer to a composition comprising a known concentration of analyte. A “positive control” can be used to establish assay performance characteristics and is a useful indicator of the integrity of reagents (e.g., analytes). In some embodiments, an appropriate “control” or “reference” is where only one element is changed in order to determine the effect of the one element. In some embodiments, a control is a level of a target gene (e.g., in a cell or in a subject) before treatment (e.g., with an antisense oligonucleotide described herein).

[0042] The term “control” or “reference” also means a baseline level of a measurement depending upon the context, in which the term is used. A baseline level of a measurement is a standard or a point of comparison against which the measurement is compared. In some embodiments, a “control” or a “reference” refers to a level of a measurement for certain biological activity or substance in a cell, a tissue, an organ, or a subject, e.g., the expression level of a gene, copy number of mRNA for such gene, or level of protein encoded by such gene, without treatment of the cell, the tissue, the organ, or the subject, with an agent, e.g., antisense oligonucleotide. In some embodiments, a “control” or a “reference” refers to a level of an average measurement for a certain biological activity or substance in a cell, a tissue, an organ, or a subject, e.g., certain enzyme activity of the liver, among a group of healthy subjects, e.g., the general population within in certain geographic or demographic limits or any other limits that may be appropriate for the study of certain disease or disorder, that does not have certain disease or disorder, e.g., liver disease.

[0043] The term “reference” may also be used in “reference sequence.” The term “reference sequence” refers to a sequence, e.g., a nucleic acid sequence or an amino acid sequence, used as a basis for sequence comparison. In certain embodiments, a reference sequence is an RNA sequence, e.g., human NRF2 pre-mRNA sequence or mRNA sequence, upon which the design of the antisense oligonucleotide is based.

[0044] The term “cross-reactive” means the ability of a binding molecule (e.g., an antisense oligonucleotide) to bind a target molecule (e.g., gene sequence, pre-mRNA sequence, or mRNA sequence) other than that against which it was designed or generated. For example, the binding molecule is capable of specifically binding to more than one target molecule of a similar type or class (e.g., mRNA variants or mRNA homologous from closely related species) with similar affinity. Generally, a binding molecule will bind its target molecule with an appropriately high affinity but can bind to the same target molecule of another species or display a low affinity for non-target molecules. In some embodiments, an antisense oligonucleotide that is cross-reactive against human and non-human primate NRF2 comprises a region of complementarity to human and non-human primate NRF2 gene sequence, pre-mRNA sequence, or mRNA sequence. Individual binding molecules are generally selected to meet two criteria: (1) tissue staining appropriate for the known expression of the target or (2) similar staining pattern between human and toxicology species (mouse and cynomolgus monkey) tissues from the same organ. These and other methods of assessing cross-reactivity are known to one skilled in the art.

[0045] The term “effective amount” or “therapeutically effective amount,” as used herein, refers to that amount of an antisense oligonucleotide to produce a molecular (e.g., exon skipping or isoform switching), biological, pharmacological, therapeutic (e.g., treatment of an NRF2 associated disease in a subject), or preventive result. The amount administered will likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can, in some instances, be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can, in some instances, be smaller than the optimum.

[0046] The term “exonic splicing enhancer (ESE),” as used herein, refers to a nucleic acid sequence motif within an exon of a gene, pre-mRNA, or mRNA that directs or enhances splicing of pre-mRNA into mRNA, e.g., as described in Blencowe et al., Trends Biochem Sci 25, 106- 10. (2000), incorporated herein by reference. ESEs can be referred to as splicing features. ESEs may direct or enhance splicing, for example, to remove one or more introns and / or one or more exons from a gene transcript. ESE motifs are typically 6-8 nucleobases in length. SR proteins (e.g., proteins encoded by the gene SRSF1, SRSF2, SRSF3, SRSF4, SRSF5, SRSF6, SRSF7, SRSF8, SRSF9, SRSF10, SRSF11, SRSF12, TRA2A or TRA2B) bind to ESEs through their RNA recognition motif region to facilitate splicing. ESE motifs can be identified through a number of methods, including those described in Cartegni et al., Nucleic Acids Research, 2003, Vol. 31, No. 13, 3568-3571, incorporated herein by reference.

[0047] The terms “hybridize” and “hybridization” refer to the pairing of complementary compounds (e.g., an antisense oligonucleotide and its target nucleic acid). While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Wobble, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.

[0048] The term “intemucleoside linkage,” as used herein, means a covalent linkage between adjacent nucleosides in an oligonucleotide (e.g., antisense oligonucleotide described herein). An internucleoside linkage may be a natural phosphodiester internucleoside linkage, or may be a modified (non-natural) internucleoside linkage.

[0049] The term “modified intemucleoside linkage” refers to a linkage between two nucleosides (e.g., in an oligonucleotide) that is not the natural phosphodiester linkage. Modified internucleoside that may be used in an antisense oligonucleotide disclosed herein include, but are not limited to, phosphorothioates, phosphorodiamidates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, phosphonoacetates (PACE), thiophosphonoacetates (thioPACE), phosphonates, methyl and other alkyl phosphonates comprising 3 ’alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, mesyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, boranophosphates, amides, triazoles, and short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 ’-5’ to 5 ’-3’ or 2’ -5’ to 5 ’-2’; see US patent nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; and 5,625,050. In some embodiments, in any one of the antisense oligonucleotides disclosed herein, all of the internucleoside linkages are stereorandom.

[0050] The term, “nucleoside,” as used herein, refers to a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety. The term “nucleoside” encompasses a natural nucleoside and chemically modified nucleosides (e.g., with modifications in the base and / or sugar moiety).

[0051] The term “nucleotide,” as used herein, refers to a compound comprising a nucleoside linked to a phosphate group. As used herein, “linked nucleosides” may or may not be linked by phosphate linkages and thus includes, but is not limited to “linked nucleotides.” As used herein, “linked nucleosides” are nucleosides that are connected in a continuous sequence (i.e., no additional nucleosides are present between those that are linked). The term “nucleotide” encompasses a natural nucleotide and chemically modified nucleotides (e.g., with modifications in the base, sugar moiety, and / or phosphate group).

[0052] The term “nucleobase,” as used herein, refers to nitrogen-containing compounds that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the compound is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). The term “nucleobase” encompasses 5’-methylated bases (e.g., 5’-methyl cytosine or 5’-methyl guanine).

[0053] The term “nucleoside modification” or “modified nucleoside” means a nucleoside that has one or more modifications to the nucleoside, including modifications to the nucleobase moiety and / or the sugar moiety. Any of the modified chemistries or formats of nucleosides described herein can be combined with each other. Non-limiting examples of modified nucleosides includes 2’-fluoro (2’-F), 2’-O-methyl (2’-0-Me), 2’-O-methoxyethyl (2’-M0E), 2’-O-aminopropyl (2’-0-AP), 2’-O-dimethylaminoethyl (2’-0-DMA0E), 2’-O- dimethylaminopropyl (2’-0-DMAP), 2’-O-dimethylaminoethyloxyethyl (2’-0-DMAE0E), or 2’-O-N-methylacetamido (2’-0-NMA), locked nucleic acid (LNA, methylene-bridged nucleic acid), unlocked nucleic acid (UNA), ethylene-bridged nucleic acid (ENA), and (S)-constrained ethyl-bridged nucleic acid (cEt) modified nucleosides. Further non-limiting examples of modified nucleosides include a conformationally restricted nucleoside, an abasic nucleoside, a 2’-amino-modified nucleoside, a morpholino nucleoside, a phosphoramidate, a non-natural base comprising nucleoside, a tetrahydropyran modified nucleoside, a 1,5-anhydrohexitol modified nucleoside (HNA), a cyclohexenyl modified nucleoside (CeNA), a nucleoside comprising a phosphorothioate group, a nucleoside comprising a methylphosphonate group, a nucleoside comprising a 5 ’-phosphate, a nucleoside comprising a 5 ’-phosphate mimic, a thermally destabilizing nucleoside, a glycol modified nucleoside (GNA).

[0054] The term “2’-modified nucleoside” refers to a nucleoside having a sugar moiety modified at the 2’ position, meaning the sugar moiety comprises at least one 2 ’-substituent group other than H or OH. In some embodiments, a 2’ -modified nucleoside is a 2’ -4’ bridged nucleoside. Non-limiting examples of 2’-modified nucleosides include: 2’-O-methoxyethyl (2’- MOE), 2’-O-Methyl (2’-0-Me), 2’-fluoro (2’-F), 2’-deoxy, 2’-O-aminopropyl (2’-0-AP), 2’-O- dimethylaminoethyl (2’-0-DMA0E), 2’-O-dimethylaminopropyl (2’-0-DMAP), 2’-O- dimethylaminoethyloxyethyl (2’-0-DMAE0E), or 2’-O-N-methylacetamido (2’-0-NMA) modified nucleosides, and 2’ -4’ bridged nucleosides such as locked nucleic acid (LNA), an ethyl-constrained nucleotide, a 2'-(S)-constrained ethyl (S-cEt) nucleotide, a constrained MOE, a 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC), an alpha-L-locked nucleic acid, and a tricyclo-DNA. In some embodiments, any one of the 2’ -modified nucleosides described herein are high-affinity modified nucleosides and a modified antisense oligonucleotide has increased affinity to target sequences, relative to an unmodified antisense oligonucleotide. The term “modified oligonucleotide” or “modified antisense oligonucleotide” refers to oligonucleotides or antisense oligonucleotides that comprise one or more modified nucleosides and / or one or more modified intemucleoside linkages. In some embodiments, a “modified oligonucleotide” or “modified antisense oligonucleotide” comprises a mix of modified nucleosides and unmodified nucleosides and / or a mix of modified intemucleoside linkages and unmodified modified intemucleoside linkages. In some embodiments, each nucleoside of a modified oligonucleotide” or “modified antisense oligonucleotide” is a modified nucleoside, and / or each intemucleoside linkage of a modified oligonucleotide” or “modified antisense oligonucleotide” is a modified intemucleoside linkage.

[0055] The term “nuclear factor erythroid 2-related factor 2” or “NRF2” (also known as NFE2L2) refers to a protein found primarily in the cytoplasm that belongs to the cap ‘n’ collar (CNC) subfamily of basic leucine zipper (bZIP) transcription factors, and functional fragments or variants thereof. Cytoplasmic NRF2 is sequestered and targeted for proteasomal degradation by Kelch-like ECH-associated protein 1 (KEAP1), the major negative regulator of NRF2, under normal conditions. Activation of NRF2 by oxidative stress results in the detachment of NRF2 from KEAP1, which allows excess NRF2 to translocate into the nucleus where it heterodimerizes with small musculoaponeurotic fibrosarcoma proteins (sMafs) and subsequently binds to antioxidant response elements (AREs), inducing expression of cytoprotective genes. NRF2 contains seven conserved domains that are referred to as NRF2-ECH homology (NEH) domains. Of these seven domains, the N-terminal NEH2 domain is a redox-sensitive degron that contains two highly conserved 29DLG31 and 79ETGE82 motifs to which KEAP1 binds. The cytoprotective proteins encoded by NRF2-target genes are essential for protection against a variety of oxidative insults (e.g., protein misfolding, metal ions dyshomeostasis, mitochondrial dysfunction, glial cells proliferation and activation) and cell survival under stress. NRF2 activation can address multiple aspects of disease pathology including increased reactive oxygen species, altered proteostasis, and prolonged inflammation. Modulation of NRF2 can impact a range of diseases. NRF2, the KEAP1-NRF2 pathway, their cytoprotective functions, and their role in the initiation and development of disease are described in the art (see, e.g., He et al., In J Mol Sci. 21(13): 4777; Ngo et al., Antioxidants (Basel). 11(12): 2345; Lin et al., Front Oncol. 13: 1184079; Baird et al., Mol Cell Biol. 40(13): e00099-20; Wu et al., Annual Review of Cancer Biology. 4:413-435; Dinkova-Kostova et al., Trends in Pharmacological Sciences. 44(3): 137-149). The term “phosphorodiamidate Morpholino oligomer (PMO),” as used herein, refers to a type of oligomer molecule containing DNA bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. Morpholinos block access of other molecules to small (~25 base) specific sequences of the base-pairing surfaces of ribonucleic acid (RNA). Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Then, 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties).

[0056] The term “region of complementarity,” as used herein, refers to a nucleobase sequence, e.g., of an antisense oligonucleotide, that is sufficiently complementary to a cognate nucleobase sequence, e.g., of a target nucleic acid, such that the two nucleobase sequences are capable of annealing to one another under physiological conditions (e.g., in a cell). In some embodiments, a region of complementarity is fully complementary (e.g., 100% complementarity) to a cognate nucleobase sequence of target nucleic acid. In some embodiments, a region of complementarity is partially complementary to a cognate nucleobase sequence of target nucleic acid (e.g., at least 80%, 90%, 95% or 99% complementarity). In some embodiments, a region of complementarity contains 1, 2, 3, 4, or 5 mismatches compared with a cognate nucleobase sequence of a target nucleic acid.

[0057] The term “sequence identity,” as used herein, refers to the extent that sequences are identical (independent of chemical modification) on a nucleobase-by- nucleobase basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a “percentage of sequence identity” may be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Vai, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software

[0058] Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., Nucl. Acids Res. 25:3389, 1997.

[0059] The terms “increase,” “enhance,” or “up-regulate,” when referring to expression of a given gene (e.g., NRF2), in some embodiments, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein or protein subunit translated from the mRNA in a cell, group of cells, tissue, organ, or subject in which the gene is transcribed, is increased when the cell, group of cells, tissue, organ, or subject is treated with an antisense oligonucleotide described herein as compared to a control or reference cell, group of cells, tissue, organ or a subject, e.g., a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated. In some embodiments, the terms mean the expression of an isoform (e.g., mRNA isoform or protein isoform) of a given gene (e.g., NRF2) is expressed, or whose expression is increased, in a cell, group of cells, tissue, organ, or subject treated with an antisense oligonucleotide described herein, while a control or reference cell, group of cells, tissue, organ or a subject, e.g., a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated does not express the isoform and / or in which the isoform is not detectable. In some embodiments, when a cell, group of cells, tissue, organ, or subject is treated with an antisense oligonucleotide described herein, expression of a target gene (e.g., NRF2) or an isoform (e.g., NRF2 mRNA or protein isoform) is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least two fold, at least five fold, at least 10 fold, or more relative to a control, e.g., baseline level of gene expression prior to treatment.

[0060] The terms “increase,” “enhance,” or “up-regulate,” when referring to activity of a given gene (e.g., NRF2), in some embodiments, mean that the activity of the gene, the signaling of a signaling pathway that relies on the activity of the gene or gene product (e.g., protein), and / or the expression and / or activity of downstream genes activated by the gene or gene product (e.g., protein) is increased in a cell, group of cells, tissue, organ, or subject, when the cell, group of cells, tissue, organ, or subject is treated with an antisense oligonucleotide described herein as compared to a control or reference cell, group of cells, tissue, organ or a subject, e.g., a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated. In some embodiments, when a cell, group of cells, tissue, organ, or subject is treated with an antisense oligonucleotide described herein, activity of a target gene (e.g., NRF2) or an isoform (e.g., NRF2 mRNA or protein isoform) is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least two fold, at least five fold, at least 10 fold, or more relative to a control, e.g., baseline level of gene expression prior to treatment.

[0061] The term “splice acceptor site” or “splice acceptor,” as used herein, refers to a nucleic acid sequence motif at the 3’ end of an intron or across an intron / exon junction of a gene or pre- mRNA that is involved in splicing of pre-mRNA into mRNA (i.e., removing introns from the pre-mRNA), and can be referred to as a splicing feature. A splice acceptor site includes a terminal AG sequence at the 3’ end of an intron, which is typically preceded (5’-ward) by a region high in pyrimidines (C / U). Upstream from the splice acceptor site is the branch point. Formation of a lariat loop intermediate structure by a transesterification reaction between the branch point and the splice donor site releases a 3’-OH of the 5’ exon, which subsequently reacts with the first nucleotide of the 3’ exon, thereby joining the exons and releasing the intron lariat. The AG sequence at the 3’ end of the intron in the splice acceptor site is known to be critical for proper splicing, as changing one of these nucleotides results in inhibition of splicing. Rarely, alternative splice acceptor sites have an AC at the 3’ end of the intron, instead of the more common AG. A common splice acceptor site motif has a sequence of or similar to [Y-rich region]-NCAGG or YxNYAGG (SEQ ID NO: 3901), in which Y represents a pyrimidine, N represents any nucleotide, and x is a number from 4 to 20. The cut site follows the AG, which represent the 3 ’-terminal nucleotides of the excised intron.

[0062] The term “splice donor site” or “splice donor,” as used herein, refers to a nucleic acid sequence motif at the 5’ end of an intron or across an exon / intron junction of a gene or pre- mRNA that is involved in splicing of pre-mRNA into mRNA (i.e., removing introns from the pre-mRNA), and can be referred to as a splicing feature. A splice donor site includes a terminal GU sequence at the 5’ end of the intron, within a larger and fairly unconstrained sequence. During splicing, the 2’ -OH of a nucleotide within the branch point initiates a transesterification reaction via a nucleophilic attack on the 5’ G of the intron within the splice donor site. The G is thereby cleaved from the pre-mRNA and bonds instead to the branch point nucleotide, forming a loop lariat structure. The 3’ nucleotide of the upstream exon subsequently binds the splice acceptor sitejoining the exons and excising the intron. A typical splice donor site has a sequence of or similar to GGGURAGU or AGGURNG, in which R represents a purine and N represents any nucleotide. The cut site precedes the first GU (i.e., GG / GURAGU or AG / GURNG), which represent the 5’-terminal nucleotides of the excised intron.

[0063] The term “subject,” as used herein, refers to a mammal. In some embodiments, a subject is non-human primate, or rodent. In some embodiments, a subject is a human. In some embodiments, a subject is a patient, e.g., a human patient that has or is suspected of having a disease. In some embodiments, the subject is a human patient who has or is suspected of having an NRF2-associated disease. In some embodiments, the NRF2-associated disease and / or a disease associated with NRF2 dysfunction in a subject is a CNS disease or a liver disease.

[0064] The term “specificity” means the ability to inhibit the target RNA without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (FACS).

[0065] The term “symptom” as used herein, refers to any manifestation or indication of an underlying disease. A symptom can be any biochemical, cellular, genetic, histological, and / or physiological observation, measurement, and / or test result in a subject that deviate from those of a control or reference.

[0066] The term “target sequence,” as used herein, refers to a nucleoside sequence whose expression or activity is to be modulated. In some embodiments, the target sequence is a contiguous portion of the nucleoside sequence of a gene, a cDNA, a pre-mRNA, or an mRNA molecule formed during the transcription of a target gene, e.g., an NRF2 gene, an unprocessed NRF2 pre-mRNA transcript, or a mature NRF2 mRNA transcript. In some embodiments, a target sequence disclosed herein is in an NRF2 pre-mRNA. In some embodiments, a target sequence disclosed herein is in an NRF2 mRNA.

[0067] The term “treat,” “treatment,” as used herein, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease (e.g., NRF2-associated disease (e.g., a disease associated with abnormal NRF2 expression) or a disease associated with NRF2 dysfunction) in a subject. As used herein, “treat” and treatment” may include the prevention, management, prophylactic treatment, and / or inhibition of the number, severity, and / or frequency of one or more symptoms of a disease (e.g., NRF2-associated disease in a subject.

[0068] The term “variant” means a molecule (e.g., nucleic acid or polypeptide) that differs from a given molecule (e.g., a reference nucleic acid or polypeptide) in sequence (nucleic acid or amino acid respectively) by the addition (e.g., insertion), deletion, or conservative substitution of nucleic acids or amino acids, respectively, but that retains the biological activity of the given molecule. Changes in the reference nucleic acid sequence of the variant may be silent. That is, they may not alter the amino acid sequence encoded by the nucleic acid. Alternatively, changes in the nucleoside sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleoside changes may result in amino acid substitutions, additions, deletions, fusions, and truncations in the polypeptide encoded by the reference sequence. The term “variant” encompasses fragments of a variant unless otherwise defined. A variant may be 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, or 75% identical to the reference sequence. The degree of homology (percent identity) between a native and a variant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web (e.g., BLASTn with default settings).

[0069] Definitions of specific functional groups and chemical terms are described in more detail below. The chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito, 1999; Smith and March, March ’s Advanced Organic Chemistry, 5thEdition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rdEdition, Cambridge University Press, Cambridge, 1987.

[0070] It is also to be understood that compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space are termed “isomers”. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers”.

[0071] Stereoisomers that are not mirror images of one another are termed “diastereomers” and those that are non-superimposable mirror images of each other are termed “enantiomers”. When a compound has an asymmetric center, for example, it is bonded to four different groups, a pair of enantiomers is possible. An enantiomer can be characterized by the absolute configuration of its asymmetric center and is described by the R- and S-sequencing rules of Cahn and Prelog, or by the manner in which the molecule rotates the plane of polarized light and designated as dextrorotatory or levorotatory (i.e., as (+) or (-)-isomers respectively). A chiral compound can exist as either individual enantiomer or as a mixture thereof. A mixture containing equal proportions of the enantiomers is called a “racemic mixture”.

[0072] The term “NRF2” includes human (Homo sapiens) NRF2, the amino acid and nucleotide sequences of which may be found in, for example, GenBank Accession No. Gene ID: 4780, and NCBI Accession Nos. NC_000002.12: 177230303..177264727 complement (Reference GRCh38.pl4 Primary Assembly) (SEQ ID NO: 1), NC_060926.1 : 177712539..177746971 complement (Alternate T2T-CHM13v2.0) (SEQ ID NO: 2), NM_001145412.3 (SEQ ID NO: 3), NP_001138884.1 (also NP_001300829.1; NP_001300830.1) (SEQ ID NO: 4),

[0073] NM_001145413.3 (SEQ ID NO: 5), NP_001138885.1 (SEQ ID NO: 6), NM_001313900.1 (SEQ ID NO: 7), NM_001313901.1 (SEQ ID NO: 8), NM_001313902.2 (SEQ ID NO: 9), NP_001300831.1 (SEQ ID NO: 10), NM_001313903.2 (SEQ ID NO: 11), NP_001300832.1 (SEQ ID NO: 12), NM_001313904.1 (SEQ ID NO: 13), NP_001300833.1 (SEQ ID NO: 14), NM_006164.5 (SEQ ID NO: 15), and NP_006155.2 (SEQ ID NO: 16). The term “NRF2” also includes cynomolgus monkey Macaca fascicularis) NRF2, the amino acid and nucleotide sequences of which may be found in, for example, GenBank Accession No. GI: 102138754 and NCBI Accession Nos. NC_052266.1 : 62037289..62193033 complement (Reference MFA1912RKSv2 Primary Assembly) (SEQ ID NO: 17), XM_045367312.1 (SEQ ID NO: 18), XP_045223247.1 (XP_015287886.2; XP_005573630.2; XP_015287887.2) (SEQ ID NO: 19), XM_0 15432400.2 (SEQ ID NO: 20), XM_005573572.3 (SEQ ID NO: 21), XP_005573629.2 (SEQ ID NO: 22), XM_005573573.3 (SEQ ID NO: 23), and XM_015432401.2 (SEQ ID NO: 24). The term “NRF2” also includes rhesus monkey (Macaca mulatto) NRF2, the amino acid and nucleotide sequences of which may be found in, for example, GenBank Accession No. Gene ID: 707606 and NCBI Accession Nos. NC_041765.1 : 64326140..64382891 complement (Reference Mmul_10 Primary Assembly) (SEQ ID NO: 25), NM_001257607.1 (SEQ ID NO: 26), NP_001244536.1 (SEQ ID NO: 27), XM_015110369.2 (SEQ ID NO: 28), XP_014965855.2 (XP_014965854.2; XP_028686376.1) (SEQ ID NO: 29), XM_015110368.2 (SEQ ID NO: 30), , and XM_028830543.1 (SEQ ID NO: 31). The term “NRF2” also includes mouse (Mus miisciiliis) NRF2, the amino acid and nucleotide sequences of which may be found in, for example, GenBank Accession No. Gene ID: 18024 and NCBI Accession Nos.

[0074] NC_000068.8: 75505860..75535007 complement (Reference GRCm39 C57BL / 6J) (SEQ ID NO: 32), NM_001399226.1 (SEQ ID NO: 33), NP_001386155.1 (SEQ ID NO: 34), NM_010902.5 (SEQ ID NO: 35), and NP_035032.1 (SEQ ID NO: 36). Additional examples of NRF2 RNA sequences are readily available using, e.g., GenBank, UniProt, and OMIM, and the Macaca genome project web site and the Mouse genome project website. Exemplary NRF2 nucleotide and amino acid sequences may also be found in Table 1, SEQ ID NOs: 1-36.

[0075] Further information on NRF2 can be found, for example, at ncbi.nlm.nih.gov / gene / 4780. The entire contents of each of the foregoing Accession numbers and the Gene database numbers are incorporated herein by reference as of the date of filing this application.

[0076] Table 1 below summarizes exemplary amino acid sequences of NRF2 proteins and DNA sequences of NRF2 genes of human, cynomolgus monkey, rhesus monkey, and mouse. Table 1 : Exemplary DNA and Amino Acid Sequences of NRF2

[0077] * Nucleotide sequences in Table 1 are shown as DNA. One skilled in the art would understand that the nucleotide sequences can also represent RNA (e.g., mRNA or pre-mRNA sequences) with each thymine base replaced with an uracil base.

[0078] As used herein, the term “NRF2-associated disease,” is a disease or disorder that is caused by, or associated with, abnormal NRF2 expression and / or activity. The term “NRF2- associated disease” includes a disease, disorder or condition that would benefit from modulating NRF2 expression and / or activity (e.g., in a cell or in a subject). In some embodiments, the NRF2 associated disease is a CNS disease or a liver disease.

[0079] NRF2 Antisense Oligonucleotides

[0080] Some aspects of the present disclosure provide antisense oligonucleotides that modulates NRF2 splicing and / or expression. In some embodiments, an antisense oligonucleotide disclosed herein comprises sequences complementary to an NRF2 sequence (e.g., NRF2 gene sequence, pre-mRNA sequence, or mRNA sequence). In some embodiments, an antisense oligonucleotide disclosed herein is designed for splicing modulation of an NRF2 pre-mRNA (e.g., to inhibit the inclusion of part or all of one or more exons in NRF2 pre-mRNA and / or to induce skipping of one or more exons in NRF2 pre-mRNA). In some embodiments, an antisense oligonucleotide disclosed herein is designed for modulation of NRF2 gene expression (e.g., RNA expression and / or protein expression) and / or function. In some embodiments, an antisense oligonucleotide disclosed herein is designed for splicing modulation of NRF2 pre-mRNA, leading to the expression of an NRF2 mRNA isoform that encodes a functionally active NRF2 protein that is constitutively active (e.g., not subject to interaction with and inhibition by KEAP1). In some embodiments, an antisense oligonucleotide described herein modulates splicing of an NRF2 pre-mRNA, leading to an NRF2 mRNA isoform encodes an NRF2 protein that does not interact with Kelch-like Ech-associated protein 1 (KEAP1). In some embodiments, the NRF2 mRNA isoform encodes an NRF2 protein that has its N-terminus partially deleted (e.g., an NRF2 protein that lacks the entire of part of the NEH2 domain). The NEH2 domain of the NRF2 protein is comprised of amino acids 1-98 of a wild type human NRF2 protein (e.g., as set forth in SEQ ID NO: 16, the longest NRF2 protein isoform encoded by NRF2 mRNA as set for in NM_006164.5 (SEQ ID NO: 15)). Exons 1, 2, 3, and 4 of the NRF2 mRNA contain coding sequences for the NEH2 domain. As such, in some embodiments, an antisense oligonucleotide described herein modulate splicing of exons 1, 2, 3, and 4 of the NRF2 mRNA. As such, in some embodiments, an antisense oligonucleotide described herein induces skipping of one or more (e.g., 1, 2, 3, or 4) exons 1, 2, 3, and 4 of the NRF2 mRNA.

[0081] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to an NRF2 pre-mRNA transcript or mRNA transcript (e.g., as set forth in any one of SEQ ID NOs: 1-3, 5, 7-9, 11, 13, 15, 17-18, 20-21, 23-24, 25-26, 28, 30-33, and 35).

[0082] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a human NRF2 pre-mRNA transcript (e.g., as set forth in SEQ ID NO: 1 or SEQ ID NO: 2).

[0083] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a human NRF2 mRNA transcript (e.g., as set forth in any one of SEQ ID NOs: 3, 5, 7-9, 11, 13, and 15).

[0084] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1-196, 30457-30504, 31389-31478, 32145-32336, or 32720-34420 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 197-30456, 30505- 31388, 31479-32144, 32337-32719, or 34421-34425 of SEQ ID NO: 1.

[0085] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1-196, 30457-30723, 32145-32336, 32720-34420of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 197-30456, 30724-32144, 32337-32719, or 34421-34425 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1-196, 30457-30723, 31389-31478, 32145-32336, 32720-34420 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 197-30456, 30724- 31388, 31479-32144, 32337-32719, or 34421-34425 of SEQ ID NO: 1.

[0086] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 597-1199, 30457-30723, 31389-31478, 32145-32336, or 32720-34425 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1200-30456, 30724- 31388, 31479-32144, or 32337-32719 of SEQ ID NO:

[0087] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 597-1291, 30457-30723, 31389-31478, 32145-32336, or 32720-34425 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1292-30456, 30724- 31388, 31479-32144, or 32337-32719 of SEQ ID NO: 1.

[0088] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 597-1325, 30457-30652, 31389-31478, 32145-32336, or 32720-34425 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1326-30456, 30653- 31388, 31479-32144, or 32337-32719 of SEQ ID NO: 1.

[0089] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 597-1325, 30457-30723, 31389-31478, 32166-32336, or 32720-34425 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1326-30456, 30724- 31388, 31479-32165, 32337-32719 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 597-1325, 30457-30723, 31389-31478, 32145-32336, or 32720-34425 of SEQ ID NO: 1. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region corresponds to nucleotide positions 1326-30456, 30724- 31388, 31479-32144, or 32337-32719 of SEQ ID NO: 1.

[0090] In some embodiments, an antisense oligonucleotide described herein modulates splicing of an NRF2 pre-mRNA. In some embodiments, an antisense oligonucleotide described herein induces skipping of one or more (e.g., 1, 2, 3, or 4) exons in an NRF2 pre-mRNA. Without wishing to be bound by theory, in some instances, an antisense oligonucleotide that hybridizes to targeting regions the contains sites where the spliceosome or proteins associated with the spliceosome would normally bind and causes exons to be skipped.

[0091] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region comprises one or more splicing-regulatory elements (e.g., an exon-intron junction, a splicing donor site, a splicing acceptor site, a branch point sequence, an exonic splicing enhancer, an exonic splicing silencer, an intronic splicing enhancer, and / or an intronic splicing silencer).

[0092] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region comprises one or more splicing-regulatory elements (e.g., an exon-intron junction, a splicing donor site, a splicing acceptor site, a branch point sequence, an exonic splicing enhancer, an exonic splicing silencer, an intronic splicing enhancer, and / or an intronic splicing silencer) that modulates the splicing of one or more (e.g., 1, 2, 3, or 4) of exons 1-4 of a human NRF2 pre-mRNA. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region comprises one or more splicing-regulatory elements (e.g., an exon-intron junction, a splicing donor site, a splicing acceptor site, a branch point sequence, an exonic splicing enhancer, an exonic splicing silencer, an intronic splicing enhancer, and / or an intronic splicing silencer) that modulates the splicing of all of exons 1-4 of a human NRF2 pre- mRNA.

[0093] In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region comprises one or more splicing-regulatory elements (e.g., an exon-intron junction, a splicing donor site, a splicing acceptor site, a branch point sequence, an exonic splicing enhancer, an exonic splicing silencer, an intronic splicing enhancer, and / or an intronic splicing silencer) that induces skipping of one or more (e.g., 1, 2, 3, or 4) of exons 1-4 of a human NRF2 pre-mRNA. In some embodiments, an antisense oligonucleotide disclosed herein comprises a region of complementarity to a target region in a human NRF2 pre-mRNA transcript, wherein the target region comprises one or more splicing-regulatory elements (e.g., an exon-intron junction, a splicing donor site, a splicing acceptor site, a branch point sequence, an exonic splicing enhancer, an exonic splicing silencer, an intronic splicing enhancer, and / or an intronic splicing silencer) that induces skipping of all of exons 1-4 of a human NRF2 pre-mRNA.

[0094] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 1 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0095] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to the junction between intron 1 and exon 2 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1). In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 1 and a region of complementarity to exon 2 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0096] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to exon 2 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0097] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to the junction between exon 2 and intron 2 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1). In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to exon 2 and a region of complementarity to intron 2 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0098] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 2 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0099] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to the junction between intron 2 and exon 3 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1). In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 2 and a region of complementarity to exon 3 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0100] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to exon 3 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0101] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to the junction between exon 3 and intron 4 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1). In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to exon 3 and a region of complementarity to intron 3 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0102] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 3 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0103] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to the junction between intron 3 and exon 4 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1). In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 3 and a region of complementarity to exon 4 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0104] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to exon 4 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0105] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 4 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0106] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to the junction between intron 4 and exon 5 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1). In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to intron 4 and a region of complementarity to exon 5 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0107] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementarity to exon 5 of an NRF2 pre-mRNA (e.g., as set forth in SEQ ID NO: 1).

[0108] In some embodiments, an antisense oligonucleotide described herein is 12-50 nucleosides in length. For example, in some embodiments, an antisense oligonucleotide described herein is 12-50, 12-45, 12-40, 12-35, 12-30, 12-25, 12-20, 12-15, 15-50, 15-45, 15-40, 15-35, 15-30, 15-25, 15-20, 20-5-, 20-45, 20-40, 20-35, 20-30, 20-25, 25-50, 25-45, 25-40, 25- 35, 25-30, 30-50, 30-45, 30-40, 30-35, 35-50, 35-45, 35-40, 40-50, 40-45, or 45-50 nucleosides in length. In some embodiments, an antisense oligonucleotide described herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleosides in length. In some embodiments, an antisense oligonucleotide described herein is 15-35 nucleosides in length. In some embodiments, an antisense oligonucleotide described herein is 16-25 nucleosides in length. In some embodiments, an antisense oligonucleotide described herein is 16, 17, 18, 19, 20, 21, 22, or 23 nucleosides in length. In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length. In some embodiments, an antisense oligonucleotide described herein is 16 nucleosides in length.

[0109] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementary of at least 8 (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least

[0110] 21, at least 22, at least 23, at least 24, at least 25) nucleosides in length to an NRF2target sequence. In some embodiments, an antisense oligonucleotide described herein comprises a region of complementary of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides in length. In some embodiments, an antisense oligonucleotide described herein comprises a region of complementary that is fully complementary (e.g., 100% complementarity) to an NRF2target sequence. In some embodiments, a region of complementary need not be 100% complementary to that of its target to be specifically hybridizable or specific for an NRF2 target sequence. In some embodiments, the region of complementarity is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to an NRF2 target sequence. In some embodiments, the region of complementarity comprises a nucleoside sequence that contains no more than 1, 2, 3, 4, or 5 base mismatches compared to the complementary portion of an NRF2target sequence. In some embodiments, the region of complementarity comprises a nucleoside sequence that has up to 3 mismatches over 15 nucleosides, or up to 2 mismatches over 10 nucleosides.

[0111] In some embodiments, an antisense oligonucleotide described herein is 12-50 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleosides in length and comprises a region of complementary of at least 8 (e.g., at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25) nucleosides in length to an NRF2 target sequence. In some embodiments, an antisense oligonucleotide described herein is 15-35 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35) nucleosides in length and comprises a region of complementary of at least 12 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,

[0112] 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35) nucleosides in length to an NRF2 target sequence. In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises a region of complementary of at least 12 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20) nucleosides in length to an NRF2 target sequence. In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises a region of complementary of 20 nucleosides in length to an NRF2 target sequence. In some embodiments, an antisense oligonucleotide described herein is 16 nucleosides in length and comprises a region of complementary of at least 12 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20) nucleosides in length to an NRF2 target sequence. In some embodiments, an antisense oligonucleotide described herein is 16 nucleosides in length and comprises a region of complementary of 16 nucleosides in length to an NRF2 target sequence.

[0113] In some embodiments, an antisense oligonucleotide described herein targets an NRF2 sequence at or near a position corresponding to a position provided in Tables 2 or 3. In some embodiments, an antisense oligonucleotide described herein comprises a region of complementary to an NRF2 target sequence at or near a position in an NRF2 sequence corresponding to a position provided in Tables 2 or 3. “Near” a position, as used herein, means within 10 (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1) nucleosides upstream (5’ end) or downstream (3’ end) of the position.

[0114] As used herein, the “position” of a target sequence is represented by the “position” of the first nucleoside of the target sequence in a reference sequence. For example, for the NRF2 target sequences provided in Table 2, the reference sequence used is human NRF2 mRNA transcript and its corresponding cDNA sequence as set forth in NM_006164.5 (the reference sequence). The “position” for each target sequence provided in Table 2 refers to the position of the first nucleoside of a target sequence in SEQ ID NO: 15 (NM 006164.5). For example, the first G of the target sequence as set forth in SEQ ID NO: 995 is the 429thnucleoside of SEQ ID NO: 15 (NM_006164.5). For the purposes of the present disclosure, when referring to antisense oligonucleotides that target an NRF2 sequence at or near a position (e.g., position 429), such antisense oligonucleotide encompasses antisense oligonucleotides that target an NRF2 sequence at or near the position in the reference sequence (SEQ ID NO: 15; NM 006164.5), and antisense oligonucleotides that target at or near a position in another NRF2 sequence (e.g., gene sequence, pre-mRNA sequence, or a variant or a homologue of human NRF2 mRNA, e.g., a splicing variant or a mRNA from a closely related species, such as a cynomolgus monkey) that corresponds to the position in the reference sequence. To identify a position in another NRF2 sequence that corresponds to a certain position in the reference sequence (SEQ ID NO: 15; NM_006164.5), such other NRF2 sequences can be aligned to the reference sequence and the position of a nucleoside corresponding the nucleoside in the reference sequence (SEQ ID NO: 15; NM_006164.5) can be determined. For example, the nucleosides at positions 429-448 of SEQ ID NO: 15 (NM 006164.5; upper sequence) are aligned to the nucleosides at positions 962-981 of the human NRF2 variant 2 sequence SEQ ID NO: 3 (NM_001145412.3; lower sequence) as follows:

[0115] GTTACAACTAGATGAAGAGA (SEQ ID NO: 3902)

[0116] I I I I I I I I I I I I I I I I I I I I

[0117] GTTACAACTAGATGAAGAGA (SEQ ID NO: 3902)

[0118] In the example above, when referring to antisense oligonucleotides that target an NRF2 sequence at or near position 429, the present disclosure encompasses antisense oligonucleotides that target at or near position 429 of NM_006164.5 (SEQ ID NO: 15) and antisense oligonucleotides that target at or near position 962 of NM 001145412.3 (SEQ ID NO: 3). In the present disclosure, unless otherwise indicated, the position of a nucleoside on another sequence is designated as the position of the corresponding nucleoside on the reference sequence. For example, in the exemplary alignment above, the first “G” of NM_006164.5 (SEQ ID NO: 15) is designated as position 429 although it is the 962ndnucleoside in NM_001145412.3 (SEQ ID NO: 15). In determining the position of a nucleoside of another sequence in relation to a reference sequence, the other sequence and the reference sequence are optimally aligned over the window of comparison, which comprises sufficient number of nucleosides for the alignment. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al., Nucl. Acids Res. 25:3389, 1997.

[0119] One or more insertions in another NRF2 sequence (e.g., gene sequence, pre-mRNA sequence, or a variant or a homologue of human NRF2 mRNA, e.g., a splicing variant or a mRNA from a closely related species, such as a cynomolgus monkey) relative to the reference sequence (SEQ ID NO: 15; NM_006164.5) are represented as position “N-M,” wherein N represents the corresponding position immediately before the insertions in the reference sequence, and M represents the position of the nucleoside within the one or more insertions. For example, in the following alignment between an area of the sequence set forth in SEQ ID NO: 15 (NM_006164.5; upper sequence) and the sequence set forth in SEQ ID NO: 3 (NM_001145412.3; lower sequence),

[0120] CCA - GCAGGACATGG (SEQ ID NO: 3903) I I I I I I I I I

[0121] CTGTCAAGGGACATGG (SEQ ID NO: 3904)

[0122] The insertions TC in SEQ ID NO: 3 (NM_001145412.3) follows the position 249 (bolded A in the alignment above) in SEQ ID NO: 15 (NM_006164.5). Accordingly, the positions of insertions TC are designated as 249 -1 and 249 -2, respectively.

[0123] One or more deletions or mismatches in another NRF2 sequence (e.g., gene sequence, pre-mRNA sequence, or a variant or a homologue of human NRF2 mRNA, e.g., a splicing variant or a mRNA from a closely related species, such as a cynomolgus monkey) relative to the reference sequence (SEQ ID NO: 15; NM_006164.5) may result in the lack of a “corresponding position.” In these instances, as long as the deletions / mismatches (e.g., no more than 5, 4, 3, 2, 1 mismatches) are within a stretch of sequences of sufficient length (e.g., at least 20, 25, 30, 35, or 40 nucleosides) that aligned between the two sequences, the mismatched positions are represented as the position in the reference sequence that directly aligned even if the nucleoside in the reference is different.

[0124] The position for the deletion in the other sequence is “skipped.” For example, the last 17 nucleotides of the SEQ ID NO: 15 (NM 006164.5; upper sequence) are aligned to the nucleoside 654 - 670 of the human NRF2 mRNA variant 4 sequence SEQ ID NO: 7 (NM_001313900.1; lower sequence) as follows:

[0125] CAGGACATGGATTTGATTGA (SEQ ID NO: 3905)

[0126] I I I I I I I I I I I I I I I I I

[0127] - GACATGGATTTGATTGA (SEQ ID NO: 3906)

[0128] The bolded G at position 256 of SEQ ID NO: 15 (NM 006164.5) aligns with the bolded G at position 654 of SEQ ID NO: 7 (NM_001313900.1). When referring to antisense oligonucleotides that target an NRF2sequence at or near position 256, the present disclosure encompasses antisense oligonucleotides that target at or near position 256 of NM 006164.5 (SEQ ID NO: 15) and antisense oligonucleotides that target at or near position 654 of NM_001313900.1 (SEQ ID NO: 7).

[0129] It is to be understood that, for the purposes of the present disclosure, an antisense oligonucleotide comprising nucleobase sequences (e.g., nucleobase sequences of the antisense oligonucleotide) of the antisense oligonucleotides listed in Table 2 encompasses antisense oligonucleotides comprising such nucleobase sequences and comprising no chemical modifications (e.g., modified nucleosides and / or modified internucleoside linkages), and an antisense oligonucleotides comprising such nucleobase sequences and comprising chemical modifications (e.g., one or more modified nucleosides and / or one or more modified internucleoside linkages), and encompasses such modified or unmodified antisense oligonucleotides unconjugated or conjugated to a targeting moiety.

[0130] In some embodiments, any one of the antisense oligonucleotides provided herein (e.g., in Table 2) may comprise one or more chemical modifications including, e.g., one or more modified nucleosides and / or one or more modified nucleosides and / or modified internucleoside linkages.

[0131] In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, or more) modified nucleosides and / or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified internucleoside linkages. In some embodiments, a modified nucleoside comprises a modification at the 2’ position of the sugar (referred to herein as a “2’-modified nucleoside”). In some embodiments, a 2’ -modified nucleoside is a not bicyclic (referred to herein as “non- bicyclic 2’-modified nucleoside”). In some embodiments, a 2’-modified nucleoside comprises a modification at the 2’ position and 4’ position of the sugar creating a bridged structure (referred to herein as a “2’ -4’ bridged nucleoside”). In some embodiments, the one or more modified nucleosides comprise a non-bicyclic 2’-modified nucleoside, a 2’-4’ bridged nucleoside, or combinations thereof. In some embodiments, all modified nucleosides in an antisense oligonucleotide are 2’ -modified nucleosides (e.g., any one of the 2’ -modified nucleosides known in the art or described herein). In some embodiments, the non-bicyclic 2’ -modified nucleoside is a 2’-O-methoxyethyl (2’-M0E) modified nucleoside, a 2’-O-Methyl (2’-O-Me) nucleoside, or a 2’-fluoro (2’-F) modified nucleoside, and / or the 2’-4’ bridged nucleoside is a locked nucleic acid (LNA, 2’-4’ methylene bridge), an ethylene-bridged nucleic acid (ENA, 2’-4’ ethylene bridge) or an constrained ethyl nucleic acid (cEt, 2’ -4’ ethylene bridge). In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more 2’ -MOE modified nucleosides. In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more LNAs. In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more 2’ -MOE modified nucleosides and one or more LNAs. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’ -MOE modified nucleoside.

[0132] In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified internucleoside linkages. In some embodiments, each intemucleoside linkage of the antisense oligonucleotide is a modified internucleoside linkage. Non limiting examples of internucleoside linkages include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3 ’alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, mesyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate intemucleoside linkages. In some embodiments, each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, the antisense oligonucleotide comprises a mix of phosphodiester linkages and phosphorothioate linkages. In some embodiments, the antisense oligonucleotide comprises one or more phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).

[0133] The present disclosure, in some aspects, provide antisense oligonucleotides that target an NRF2 pre-mRNA transcript and modulates splicing of the NRF2 pre-mRNA transcript.

[0134] Nonlimiting examples of NRF2 target sequences and antisense oligonucleotides that modulate splicing of NRF2 pre-mRNA are provided in Table 2. The “Start Position” in Table 2 refers to the start position of the NRF2 target sequence in SEQ ID NO: 1 (NCBI Accession No.

[0135] NC_000002.12: 177230303..177264727 complement). The NRF2 target sequences (SEQ ID NOs: 37-1968 in Table 2) and antisense oligonucleotide sequences (SEQ ID NOs: 1969-3900 in Table 2) are presented as RNA sequences (containing U’s). It is to be understood that any one or more of the uracil base (U) in any one of the target sequences and antisense oligonucleotide sequences provided in Table 2 may independently and optionally be replaced with thymine bases (T). Table 2. Non-limiting examples of antisense oligonucleotides that modulate splicing of

[0136] NRF2 pre-mRNA*

[0137] * Lower case letters in the target sequences indicate intron sequences, upper case letters in target sequences indicate exon sequences. Lower case letters in the antisense oligonucleotide sequences indicate that the antisense oligonucleotide or the portion of an antisense oligonucleotide hybridizes with an intron sequence, upper case letters in the antisense oligonucleotide sequences indicate that the antisense oligonucleotide or the portion of an antisense oligonucleotide hybridizes with an exon sequence.

[0138] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementary to an NRF2 target sequence as set forth in any one of SEQ ID NOs: 37-1968. In some embodiments, an antisense oligonucleotide described herein is 16-25 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises a region of complementary of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleosides in length to an NRF2 target sequence as set forth in any one of SEQ ID NOs: 37-1968. In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises a region of complementary of 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length to an NRF2 target sequence as set forth in any one of SEQ ID NOs: 37-1968.

[0139] In some embodiments, an antisense oligonucleotide described herein comprises at least 8 consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T). In some embodiments, an antisense oligonucleotide described herein is 16-25 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T). In some embodiments, an antisense oligonucleotide described herein is 20-25 (e.g., 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T). In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T).

[0140] In some embodiments, any one of the antisense oligonucleotides that modulates splicing of NRE2 splicing as provided herein (e.g., in Table 2) may comprise one or more chemical modifications including, e.g., one or more modified nucleosides and / or one or more modified nucleosides and / or modified internucleoside linkages.

[0141] In some embodiments, an antisense oligonucleotide that modulates splicing of NRF2 splicing disclosed herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, or more) modified nucleosides and / or one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified internucleoside linkages. In some embodiments, a modified nucleoside comprises a modification at the 2’ position of the sugar (referred to herein as a “2’-modified nucleoside”). In some embodiments, a 2’ -modified nucleoside is a not bicyclic (referred to herein as “non-bicyclic 2’-modified nucleoside”). In some embodiments, a 2’-modified nucleoside comprises a modification at the 2’ position and 4’ position of the sugar creating a bridged structure (referred to herein as a “2’-4’ bridged nucleoside”). In some embodiments, the one or more modified nucleosides comprise a non-bicyclic 2’-modified nucleoside, a 2’-4’ bridged nucleoside, or combinations thereof. In some embodiments, all modified nucleosides in an antisense oligonucleotide are 2’-modified nucleosides (e.g., any one of the 2’-modified nucleosides known in the art or described herein). In some embodiments, the non-bicyclic 2’- modified nucleoside is a 2’-O-methoxyethyl (2’-M0E) modified nucleoside, a 2’-O-Methyl (2’- O-Me) nucleoside, or a 2’ -fluoro (2’-F) modified nucleoside, and / or the 2’ -4’ bridged nucleoside is a locked nucleic acid (LNA, 2’-4’ methylene bridge), an ethylene-bridged nucleic acid (ENA, 2’-4’ ethylene bridge) or an constrained ethyl nucleic acid (cEt, 2’-4’ ethylene bridge). In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more 2’-M0E modified nucleosides. In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more LNAs. In some embodiments, an antisense oligonucleotide disclosed herein comprises one or more 2’ -MOE modified nucleosides and one or more LNAs. In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-M0E modified nucleoside.

[0142] In some embodiments, an antisense oligonucleotide that modulates splicing of NRE2 splicing disclosed herein comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified internucleoside linkages. In some embodiments, each intemucleoside linkage of the antisense oligonucleotide is a modified internucleoside linkage. Non limiting examples of internucleoside linkages include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3 ’alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 ’-amino phosphoramidate and aminoalkylphosphoramidates, mesyl phosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. In some embodiments, the antisense oligonucleotide comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) phosphorothioate internucleoside linkages. In some embodiments, each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate linkage. In some embodiments, the antisense oligonucleotide comprises a mix of phosphodiester linkages and phosphorothioate linkages. In some embodiments, the antisense oligonucleotide comprises one or more phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).

[0143] In some embodiments, an antisense oligonucleotide described herein comprises a region of complementary to an NRF2 target sequence as set forth in any one of SEQ ID NOs: 37-1968, wherein the antisense oligonucleotide further comprises one or more modified nucleosides and / or one or more modified nucleosides (e.g., 2’ -modified nucleosides such as those known in the art or provided herein) and / or modified intemucleoside linkages (e.g., phosphorothioate internucleoside linkages). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-modified nucleoside (e.g., 2’-M0E modified nucleoside) and / or each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate intemucleoside linkages.

[0144] In some embodiments, an antisense oligonucleotide described herein is 16-25 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises a region of complementary of at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleosides in length to an NRF2 target sequence as set forth in any one of SEQ ID NOs: 37-1968, wherein the antisense oligonucleotide further comprises one or more modified nucleosides and / or one or more modified nucleosides (e.g., 2’-modified nucleosides such as those known in the art or provided herein) and / or modified intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-modified nucleoside (e.g., 2’-M0E modified nucleoside) and / or each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate intemucleoside linkages.

[0145] In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises a region of complementary of 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length to an NRF2 target sequence as set forth in any one of SEQ ID NOs: 37- 1968, wherein the antisense oligonucleotide further comprises one or more modified nucleosides and / or one or more modified nucleosides (e.g., 2’ -modified nucleosides such as those known in the art or provided herein) and / or modified intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-modified nucleoside (e.g., 2’-M0E modified nucleoside) and / or each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate intemucleoside linkages.

[0146] In some embodiments, an antisense oligonucleotide described herein comprises at least 8 consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more modified nucleosides and / or one or more modified nucleosides (e.g., 2’-modified nucleosides such as those known in the art or provided herein) and / or modified intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-modified nucleoside (e.g., 2’-M0E modified nucleoside) and / or each internucleoside linkage of the antisense oligonucleotide is a phosphorothioate internucleoside linkages.

[0147] In some embodiments, an antisense oligonucleotide described herein is 16-25 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more modified nucleosides and / or one or more modified nucleosides (e.g., 2’-modified nucleosides such as those known in the art or provided herein) and / or modified intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’- modified nucleoside (e.g., 2’ -MOE modified nucleoside) and / or each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate intemucleoside linkages.

[0148] In some embodiments, an antisense oligonucleotide described herein is 20-25 (e.g., 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more modified nucleosides and / or one or more modified nucleosides (e.g., 2’-modified nucleosides such as those known in the art or provided herein) and / or modified intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’- modified nucleoside (e.g., 2’ -MOE modified nucleoside) and / or each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate intemucleoside linkages.

[0149] In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more modified nucleosides and / or one or more modified nucleosides (e.g., 2’-modified nucleosides such as those known in the art or provided herein) and / or modified intemucleoside linkages (e.g., phosphorothioate intemucleoside linkages). In some embodiments, each nucleoside of the antisense oligonucleotide is a 2’-modified nucleoside (e.g., 2’-M0E modified nucleoside) and / or each intemucleoside linkage of the antisense oligonucleotide is a phosphorothioate intemucleoside linkages.

[0150] In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises a region of complementary of 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length to an NRF2target sequence as set forth in any one of SEQ ID NOs: 37- 1968, wherein the antisense oligonucleotide further comprises one or more phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate Morpholino oligomer (PMO).

[0151] In some embodiments, an antisense oligonucleotide described herein comprises at least 8 consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate Morpholino oligomer (PMO).

[0152] In some embodiments, an antisense oligonucleotide described herein is 16-25 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises at least 8 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate Morpholino oligomer (PMO).

[0153] In some embodiments, an antisense oligonucleotide described herein is 20-25 (e.g., 20, 21, 22, 23, 24, or 25) nucleosides in length and comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate Morpholino oligomer (PMO).

[0154] In some embodiments, an antisense oligonucleotide described herein is 20 nucleosides in length and comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) of the antisense oligonucleotide may independently and optionally be thymine bases (T), wherein the antisense oligonucleotide further comprises one or more phosphorodiamidate morpholinos. In some embodiments, the antisense oligonucleotide is a phosphorodiamidate Morpholino oligomer (PMO).

[0155] In some embodiments, any one or more of the uracil bases (U’s) in any one of the target sequences and antisense oligonucleotides provided herein (e.g., the target sequences and antisense oligonucleotides sequences provided in Table 2) may independently and optionally be thymine bases (T’s). In some embodiments, any one or more of the thymine bases (T’s) in any one of the target sequences and antisense oligonucleotides provided herein (e.g., the target sequences and antisense oligonucleotides sequences provided in Table 2) may independently and optionally be uracil bases (U’s).

[0156] In some embodiments, in an antisense oligonucleotide disclosed herein (e.g., the antisense oligonucleotides sequences provided in Table 2), each cytosine of the oligonucleotide is a 5-methyl-cytosine. In some embodiments, each cytosine of the oligonucleotide is not a 5- methyl-cytosine. In some embodiments, one or more of the cytosines of the oligonucleotide is a 5-methyl-cytosine.

[0157] In some embodiments, in an antisense oligonucleotide disclosed herein (e.g., the antisense oligonucleotides sequences provided in Table 2), each uracil of the oligonucleotide is a 5-methyl-uracil. In some embodiments, each uracil of the oligonucleotide is not a 5-methyl- uracil. In some embodiments, one or more of the uracils of the oligonucleotide is a 5-methyl- uracil.

[0158] In some embodiments, any one of the antisense oligonucleotides described herein (e.g., the antisense oligonucleotides sequences provided in Table 2) is conjugated (e.g., covalently linked) to another chemical moiety (e.g., a targeting moiety for, e.g., improved delivery, cellular uptake and distribution). In some embodiments, any one of the antisense oligonucleotides described herein is conjugated (e.g., covalently linked) to a targeting moiety via a linker. Any of the linkers described herein may be used.

[0159] Any suitable targeting moiety may be conjugated (e.g., covalently linked) to any one of the antisense oligonucleotides described herein. Non-limiting examples of targeting moieties include carbohydrates (e.g., monosaccharides (such as GalNAc)), di saccharides, trisaccharides, tetrasaccharides, polysaccharides), folate, mannose-6P, clusters of sugars such as GalNAc cluster, mannose cluster, galactose cluster, an aptamer, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, asialoglycoprotein receptor ligands, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands.

[0160] Salts

[0161] The term "salts" as used herein conforms to its generally known meaning, i.e. an ionic assembly of anions and cations. In some embodiments, the antisense oligonucleotide may be in the form of a pharmaceutically acceptable salt. In some embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, magnesium, and ammonium salts. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt is a magnesium salt. In some embodiments, the pharmaceutically acceptable salt is an ammonium salt. In some embodiments the ammonium salt is represented by the formula: N(R)s, wherein each R is H or an alkyl having from 1 to 6 carbon atoms.

[0162] Pharmaceutical Compositions

[0163] Pharmaceutical compositions comprising one or more antisense oligonucleotides, either alone or in combination with prophylactic agents, therapeutic agents, and / or pharmaceutically acceptable carriers are provided. The pharmaceutical compositions comprising antisense oligonucleotides provided herein are for use in, but not limited to, diagnosing, detecting, or monitoring a disease, in preventing, treating, managing, or ameliorating a disease or one or more symptoms thereof, and / or in research. In some embodiments, a pharmaceutical composition may further comprise any other suitable therapeutic agent for treatment of a subject, e.g., a human subject having an NRF2-associated disease (e.g., a CNS disease or a liver disease). In some embodiments, the other therapeutic agents may enhance or supplement the effectiveness of the complexes disclosed herein.

[0164] An aspect of the disclosure includes pharmaceutical compositions comprising any one of the antisense oligonucleotides disclosed herein. In some embodiments, the pharmaceutical composition comprises any one of the antisense oligonucleotides disclosed herein and a pharmaceutically acceptable carrier. The pharmaceutical compositions disclosed herein are formulated for administration to a subject. In some embodiments, formulations as disclosed herein comprise an excipient. In some embodiments, an excipient confers to a composition improved stability, improved absorption, improved solubility and / or (e.g., and) therapeutic enhancement of the active ingredient. In some embodiments, an excipient is a pH modifier (e.g., sodium citrate, sodium phosphate, a tris base, or sodium hydroxide), a vehicle (e.g., a buffered solution, petrolatum, dimethyl sulfoxide, or mineral oil), a tonicity agent (e.g., sodium chloride, calcium chloride, magnesium chloride, potassium chloride, dextrose or sucrose or D-mannitol), a solubilizing agent (e.g., polysorbate, cyclodextrin), a binder, a disintegrant or a lubricant. Any one of the disclosed antisense oligonucleotides, when added to pharmaceutically acceptable excipients, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions disclosed herein can be packaged in pre-filled syringes or vials. In some embodiments, such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In some embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.

[0165] In some embodiments, the delivery vehicle can be used to deliver an antisense oligonucleotide to a cell or tissue. A delivery vehicle is a compound that improves delivery of an antisense oligonucleotide to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), an anti-transferrin peptides, an antitransferrin antibodies, a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine. In some embodiments, any one of the antisense oligonucleotides or pharmaceutical compositions disclosed herein can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, peptides, antibodies, virus vectors (e.g., AAV vector), or other delivery systems available in the art.

[0166] In some embodiments, a pharmaceutical composition is formulated to be compatible with its intended route of administration. Non-limiting examples of routes of administration include intravenous, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, intrathecal, or intracerebroventricular routes. In some embodiments, the route of administration is intrathecal, or intracerebroventricular routes. In some embodiments, the route of administration is subcutaneous.

[0167] Kits

[0168] An aspect of the disclosure includes kits comprising any one of the antisense oligonucleotides disclosed herein or a pharmaceutical composition disclosed herein. In some embodiments, the kit is for treating an NRF2-associated disease disclosed herein (e.g., a CNS disease or a liver disease). In some embodiments, the kit further comprises an additional agent disclosed herein.

[0169] Methods

[0170] Some aspects of the present disclosure provide methods of modulating NRF2 splicing and / or expression (e.g., mRNA level and / or protein level) in a cell. In some embodiments, a method described herein produces a constitutively active NRF2 protein in a cell. In some embodiments, the method comprises contacting the cell with any one of the antisense oligonucleotides disclosed herein or any one of the pharmaceutical compositions disclosed herein, thereby modulating NRF2 splicing and / or expression (e.g., mRNA expression and / or protein expression) and / or producing a constitutively active NRF2 protein in a cell. In some embodiments, modulating NRF2 splicing and / or expression (e.g., mRNA level and / or protein level) to produce a constitutively active NRF2 protein in a cell comprises contacting the cell with any one of the antisense oligonucleotides disclosed herein or any one of the pharmaceutical compositions disclosed herein. In some embodiments, the cell is in vivo (e.g., in a subject). In some embodiments, the cell is a cell of the central nervous system (CNS). In some embodiments, the cell is a nerve cell (e.g., any type of neuron). In some embodiments, the cell is a liver cell.

[0171] The disclosure also provides methods for modulating NRF2 splicing and / or expression (e.g., mRNA level and / or protein level) in a subject. In some embodiments, a method described herein produces a constitutively active NRF2 protein in a subject. In some embodiments, the method comprises administering to the subject any one of the antisense oligonucleotides disclosed herein or any one of the pharmaceutical compositions disclosed herein. The constitutively active NRF2 expression level (e.g., mRNA level and / or protein level) in the subject increases in a cell, group of cells, tissue, blood, and / or other fluid of the subject. In some embodiments, the above-described methods further comprise determining the constitutively active NRF2 expression (e.g., mRNA level and / or protein level) in a sample(s) from the subject (e.g., NRF2 level in a blood or serum sample(s)). The level of NRF2 in a sample may be measured by general methods known in the art.

[0172] In some embodiments, in any one of the methods disclosed herein, a subject is nonhuman primate, or rodent. In some embodiments, a subject is a human. In some embodiments, a subject is a patient, e.g., a human patient that has or is suspected of having a disease. In some embodiments, the subject is a human patient who has or is suspected of having an NRF2- associated disease in the subject. In some embodiments, the NRF2-associated disease is a CNS disease. In some embodiments, the disease is a liver disease.

[0173] An aspect of the disclosure includes a method of treating a subject having an NRF2- associated disease (e.g., a disease associated with abnormal NRF2 expression and / or function). In some embodiments, the method comprises administering to the subject any one of the antisense oligonucleotides disclosed herein, or a pharmaceutical composition disclosed herein. In some embodiments the method results in treating the subject having the NRF2-associated disease (e.g., a disease associated with abnormal NRF2 expression and / or function). In some embodiments, the NRF2 associated disease is a CNS disease or a liver disease.

[0174] Some aspects of the present disclosure provide methods of treating an NRF2-associated disease (e.g., CNS disease or liver disease) in a subject comprises administering to the subject the antisense oligonucleotides that modulates NRF2 splicing and / or expression (e.g., antisense oligonucleotides that modify alternative splicing of NRF2 pre-mRNA, or antisense oligonucleotide that induces exon skipping of NRF2 pre-mRNA) disclosed herein or any one of the pharmaceutical compositions disclosed herein. In some embodiments, a method described herein that modulates NRF2 splicing modifies the NEH2 domain. In some embodiments, a method described herein that modulates NRF2 splicing results in the modification of the KEAP1 binding domain in NRF2 (e.g., an NRF2 protein that lacks partial or entire NEH2 domain). In some embodiments, the modification of the KEAP1 binding domain results in a functionally active NRF2 isoform. In some embodiments, the functionally active NRF2 isoform exhibits reduced binding affinity to KEAP1, relative to a wild-type NRF2 isoform (e.g., any one of SEQ ID NOs: 3, 5, 7-9, 11, 13, 15, 18, 20-21, 23-24, 26, 28, 30-31, 33, or 35).

[0175] Having now described some embodiments in detail, practice of the invention will be more fully understood from the following examples, which are presented herein for illustration only and should not be construed as limiting the invention in any way.

[0176] EQUIVALENTS

[0177] The disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting of the disclosure. Scope of the disclosure is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are therefore intended to be embraced herein.

Claims

CLAIMSWhat is claimed is:

1. An antisense oligonucleotide that targets a Nuclear Factor Erythroid 2-related Factor 2 (NRF2) RNA pre-mRNA transcript, wherein the antisense oligonucleotide modulates splicing of the NRF2 RNA pre-mRNA transcript, optionally wherein the splicing modulation results in an NRF2 mRNA isoform that is constitutively active.

2. The antisense oligonucleotide of claim 1, wherein the NRF2 mRNA isoform encodes an NRF2 protein that does not interact with Kelch-like Ech-associated protein 1 (KEAP1), optionally wherein the NRF2 mRNA isoform encodes an NRF2 protein that is has N-terminus partially deleted.

3. The antisense oligonucleotide of claim 1 or claim 2, wherein the antisense oligonucleotide comprises a region of complementarity to a human NRF2 pre-mRNA transcript comprising a nucleobase sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, optionally wherein the antisense oligonucleotide comprises a region of complementarity to an NRF2 target sequence comprising a splicing regulatory element selected from: a splicing donor site, a splicing acceptor site, a branch point sequence, an exonic splicing enhancer, an exonic splicing silencer, an intronic splicing enhancer, and / or an intronic splicing silencer.

4. The antisense oligonucleotide of any one of claims 1-3, wherein the antisense oligonucleotide is 15-35 nucleotides in length, optionally wherein the antisense oligonucleotide is 16-25 nucleotides in length.

5. The antisense oligonucleotide of claim 3 or claim 4, wherein the region of complementarity is at least 8 nucleotides in length, optionally wherein the region of complementarity is at least 12 nucleotides in length.

6. The antisense oligonucleotide of claim 3 or claim 4, wherein the antisense oligonucleotide comprises a region of complementarity of at least 8 nucleotides to an NRF2 target sequence as set forth in SEQ ID NO: 37-1968.

7. The antisense oligonucleotide of claim 6, wherein the antisense oligonucleotide comprises at least 8 consecutive nucleobases of any one of SEQ ID NOs: 1969-3900, optionallywherein the antisense oligonucleotide comprises the nucleobase sequence of any one of SEQ ID NOs: 1969-3900, wherein any one or more of the uracil bases (U) the antisense oligonucleotide may independently and optionally be thymine bases (T).

8. The antisense oligonucleotide of any one of claims 1-7, wherein the antisense oligonucleotide comprises one or more modified nucleosides and / or one or more modified internucleoside linkages.

9. The antisense oligonucleotide of claim 8, wherein the one or more modified nucleosides comprise 2’-modified nucleosides selected from: a 2'-O-methyl nucleoside, a 2'-fluoro nucleoside, a 2'-O-methoxyethyl (MOE) nucleoside, a 2'-O-aminopropyl (2'-O-AP) nucleoside, a 2'-O-dimethylaminoethyl (2'-O-DMAOE) nucleoside, a 2'-O-dimethylaminopropyl (2'-O- DMAP) nucleoside, a 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE) nucleoside, a 2'-O-N- methylacetamido (2'-0-NMA) nucleoside, and 2', 4'- bridged nucleosides, and combinations thereof, optionally wherein the 2', 4'- bridged nucleosides are selected from a locked nucleic acid (LNA), an ethyl-constrained nucleotide, a 2'-(S)-constrained ethyl (S-cEt) nucleotide, a constrained MOE, a 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNANC), an alpha-L- locked nucleic acid, a tricyclo-DNA, and combinations thereof.

10. The antisense oligonucleotide of claim 8 or claim 9, wherein the one or more modified nucleosides comprise 2’ -MOE nucleosides.

11. The antisense oligonucleotide of any one of claims 8-10, wherein the one or more modified internucleoside linkages are selected from: a phosphorothioate internucleoside linkage, a phosphonoacetate (PACE) internucleoside linkage, a thiophosphonoacetate (thioPACE) internucleoside linkage, an amide internucleoside linkage, a triazole internucleoside linkage, a phosphonate internucleoside linkage, a phosphotriester internucleoside linkage, and combinations thereof, optionally wherein the one or more modified internucleoside linkages comprise phosphorothioate intemucleoside linkages.

12. The antisense oligonucleotide of claim 8, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO).

13. A composition comprising the antisense oligonucleotide of any one of claims 1-12.

14. The composition of claim 13, further comprising a pharmaceutically acceptable carrier.

15. A method of modulating NRF2 splicing and / or producing a constitutively active NRF2 in a cell, comprising contacting the cell with the antisense oligonucleotide of any one of claims 1- 12 or the composition of claim 13 or claim 14.

16. The method of claim 15, wherein the cell is in vitro.

17. The method of claim 16, wherein the cell is in vivo.

18. The method of any one of claims 15-17, wherein the cell is a cell of the central nervous system (CNS) or a liver cell.

19. A method of modulating NRF2 splicing and / or producing a constitutively active NRF2 in a subject in need thereof, comprising administering to the subject the antisense oligonucleotide of any one of claims 1-12 or the composition of claim 13 or claim 14.

20. The method of any one of claims 15-19, wherein the splicing modulation produces a constitutively active NRF2.

21. A method of treating an NRF2 associated disease, comprising administering to a subject in need thereof the antisense oligonucleotide of any one of claims 1-12 or the composition of claim 13 or claim 14.

22. The method of claim 21, wherein the NRF2 associated disease is a CNS disease.

23. The method of claim 21, wherein the NRF2 associated disease is a liver disease.

24. The method of any one of claims 19-23, wherein the subject is human.

25. The method of any one of claims 19-24, wherein the administration is parenteral.

Citation Information

Patent Citations

  • Treatment of nuclear factor (erythroid-derived 2)-like 2 (NRF2) related diseases by inhibition of natural antisense transcript to NRF2

    US20170145411A1

  • Methods for diagnosing and treating cancer by means of the expression status and mutational status of NRF2 and downstream target genes of said gene

    US20220090205A1