Trivalent pan-sarbecovirus mucosal vaccine constructs and methods of making and using same

Abstract

Among the various aspects of the present disclosure is the provision of a coronavirus vaccine and methods of making and using the same. The vaccine composition includes a nucleic acid encoding at least a portion of the genome of an adenovirus; and at least a portion of at least one phylogenetically inferred receptor binding domain (RBD) sequence from a Sarbecovirus clade or an immunogenic portion, variant, mutant, or fragment thereof.

Description

TITLE OF THE INVENTIONTRIVALENT PAN-SARBECOVIRUS MUCOSAL VACCINE CONSTRUCTS AND METHODS OF MAKING AND USING SAMECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Application Serial No. 63 / 653,218 filed on May 29, 2024, and U.S. Provisional Application Serial No. 63 / 659,050 filed on June 12, 2024, which are incorporated herein by reference in their entireties.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under AI168347 awarded by the National Institutes of Health. The government has certain rights in the invention.MATERIAL INCORPORATED-BY-REFERENCE

[0003] The Sequence Listing, which is a part of the present disclosure, includes a computer-readable form comprising nucleotide and / or amino acid sequences of the present invention (file name “021031 -WO_SEQ_LISTING” created on 12 June 2024; 9,435 bytes). The subject matter of the Sequence Listing is incorporated herein by reference in its entirety.FIELD OF THE INVENTION

[0004] The present disclosure generally relates to the field of biotechnology and medicine and, more particularly, to nucleic acid constructs, polypeptides, and vectors that can be used in therapeutic vaccines against multiple Sarbecovirus clades.SUMMARY OF THE INVENTION

[0005] Among the various aspects of the present disclosure is the provision of a coronavirus vaccine and methods of making and using the same.

[0006] In one aspect, a composition is disclosed that includes a nucleic acid molecule comprising a nucleic acid encoding at least a portion of thegenome of an adenovirus and at least a portion of at least one phylogenetically inferred receptor binding domain (RBD) sequence from a Sarbecovirus clade or an immunogenic portion, variant, mutant, or fragment thereof.

[0007] In some aspects, the adenovirus is a Simian adenoviral vector. In another aspect, the Simina adenoviral vector is a Simina Ad36 vector (ChAd). In another aspect, the adenovirus has been modified such that the adenovirus lacks at least the native E1 locus and optionally the E3 or E3B locus. In another aspect, the RBD sequence from the Sarbecovirus clade is selected from a Sarbecovirus clade 1 RBD sequence, a Sarbecovirus clade 2 RBD sequence, a Sarbecovirus clade 3 RBD sequence, and any combination thereof. In another aspect, the RBD sequence comprises an equal ratio of the Sarbecovirus clade 1 RBD sequence, Sarbecovirus clade 2 RBD sequence, and Sarbecovirus clade 3 RBD sequence (Sarbeco RBD Mix).

[0008] In one aspect, a method of preventing or reducing a Sarbecovirus infection is disclosed. The method comprises administering at least one dose of a therapeutically effective amount of a nucleic acid molecule comprising (i) a nucleic acid encoding at least a portion of the genome of an adenovirus and (ii) at least a portion of at least one phylogenetically inferred receptor binding domain (RBD) sequence from a Sarbecovirus clade or an immunogenic portion, variant, mutant, or fragment thereof.

[0009] In some aspects, preventing or reducing the Sarbecovirus infection comprises limiting symptomatic infections, limiting severe disease, reducing hospitalizations, increasing protective immunity, and increasing upper and lower respiratory protection. In another aspect, the adenovirus is a Simian adenoviral vector. In another aspect, the Simina adenoviral vector is a Simina Ad36 vector (ChAd). In another aspect, the adenovirus has been modified such that the adenovirus lacks at least the native E1 locus and optionally the E3 or E3B locus. In another aspect, the RBD sequence from the Sarbecovirus clade is selected from a Sarbecovirus clade 1 RBD sequence, a Sarbecovirus clade 2 RBD sequence, a Sarbecovirus clade 3 RBD sequence, and any combination thereof. In another aspect, administration of the nucleic acid molecule comprises intramuscular (IM) and intranasal (IN) administration. Inanother aspect, administration of the therapeutically effective amount of the nucleic acid molecule comprises administration of a first prime dose and a second booster dose. In another aspect, administration of the first prime dose is selected from IM administration and IN administration. In another aspect, administration of the second booster dose comprises IN administration. In another aspect, the second booster dose is administered 3 weeks after the first prime dose. In yet another aspect, nucleic acid molecule is administered at a dose of 107to 1011viral particles.

[0010] Other objects and features will be in part apparent and in part pointed out hereinafter.DESCRIPTION OF THE DRAWINGS

[0011] Those of skill in the art will understand that the drawings, described below, are for illustrative purposes only. The drawings are not intended to limit the scope of the present teachings in any way.

[0012] FIG. 1A is a phylogenetic tree of 73 Sarbecovirus sequences obtained through GenBank. Maximum likelihood analyses were used to infer the RBD sequence of the most common ancestor for each Sarbecovirus clade (Clade 1 , blue; Clade 2, orange; Clade 3, green) or the overall most common Ancestral Sarbecovirus RBD (gray).

[0013] FIG. 1 B is a schematic showing Sarbeco RBDs incorporated into a replication-deficient ChAd-viral vector. The Sarbeco RBD Mix (red) is a 1 :1 :1 mixture of ChAd Clade 1-, Clade 2-, and Clade 3-RBD vaccines.

[0014] FIG. 1 C is a schematic of the vaccination schedule for immunogenicity testing. Four-week-old female C57BL / 6J mice were administered an IM prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks, at which samples were collected.

[0015] FIG. 1 D is a set of graphs of serum samples analyzed for IgG against Clade 1- (top, left), Clade 2- (top, right), Clade 3- (bottom, left) RBDs, or Wuhan-1 spike by ELISA.

[0016] FIG. 1 E a set of graphs of serum samples analyzed for IgA against Clade 1- (top, left), Clade 2- (top, right), Clade 3- (bottom, left) RBDs, orWuhan-1 spike by ELISA.

[0017] FIG. 1 F a set of graphs showing the neutralization activity of the indicated vaccines against the indicated SARS-CoV-2 and VSV-Sarbecovirus chimeric strains. Dashed line indicates the limit of detection (LoD) of the assay.

[0018] FIG. 2A is a schematic of the vaccination schedule for K18-hACE2 mice. Four-week-old K18-hACE2 mice were administered an IM prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. At day 52 post-prime, animals were inoculated with 103 FFU of SARS- CoV-2 D614G and mice were harvested on day 59.

[0019] FIG. 2B is a graph showing weight loss over time of the K18- hACE2 mice administered the indicated vaccine. Brown-Forsythe and Welch’s ANOVA test of area under the curve (AUC); *p < 0.05, ****p < 0.0001 .

[0020] FIG. 2C is a set of graphs showing viral burden in the indicated tissues (nasal turbinates, viral RNA; nasal wash, viral RNA; lung, viral RNA; lung, infections virus) from mice on day 7 post-inoculation with the indicated vaccine. Kruskal-Wallis ANOVA with Dunn’s post-test; **p < 0.01 , ***p < 0.001 , ****p < 0.0001.

[0021] FIG. 2D is a set of hematoxylin and eosin images of lung sections from naive (right), and SARS-CoV-2D614G infected animals that have been vaccinated with control (middle) or Sarveco RBD Mix (left). Tissues were collected on day 7 post-inoculation. Images show low (top), medium (middle; boxed region from top), or high (bottom; boxed region from middle) magnification. From top to bottom, scale bars indicate 500 pm, 500 pm, and 100 pm, respectively. Images are representative of n = 3 mice per group.

[0022] FIG. 3A is a heatmap showing the induction of Sarbecovirus binding antibody subclasses by control- (left) or Sarbeco RBD-vaccination (right) for lgG1 (top), lgG2b (middle), and lgG2c (bottom). Relative median fluorescence intensity (MFI) compared to baseline, red increased, blue decreased.

[0023] FIG. 3B is a heatmap showing the induction of Sarbecovirus binding antibody subclasses by control- (left) or Sarbeco RBD-vaccination(right) for lgG3 (top), IgM (middle), and IgA (bottom). Relative median fluorescence intensity (MFI) compared to baseline, red increased, blue decreased.

[0024] FIG. 3C is a schematic of the vaccination schedule for K18-hACE2 mice. Four-week-old K18-hACE2 mice were administered an IM prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. Three weeks later, serum was collected and analyzed. At day 52 postprime, animals were challenged IN with 103 PFU of SHC014 or Pangolin / GD and mice were harvested at day 56.

[0025] FIG. 3D is a set of graphs showing the levels of IgG against SHC014 (left) and Pang / GD (right) RBD protein from K18-hACE2 mice three- weeks after administration of the IN Boost as shown in FIG. 3C.

[0026] FIG. 3E is a set of graphs showing weight loss (left) and viral load (right) of K18-hACE2 mice. At day 52 post-prime, animals were challenged IN with 103 PFU of SHC014. At 4 days post-infection (dpi), lungs were collected, and infectious virus was quantified by plaque assay (n=10).

[0027] FIG. 3F is a set of graphs showing weight loss (left) and viral load (right) of K18-hACE2 mice. At day 52 post-prime, animals were challenged IN with 103 PFU of Pang / GD. At 4 days post-infection (dpi), lungs were collected, and infectious virus was quantified by plaque assay (n=10).

[0028] FIG. 3G is a schematic of the vaccination schedule for BALB / c mice. Four-week-old BALB / c mice were administered an IN prime and boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. At three weeks post-boost, serum samples were collected and analyzed. At day 52 post-prime, animals were challenged IN with 103 PFU of SARS- CoV / MA15 and mice were harvested on days 54 and 56.

[0029] FIG. 3H is a graph of IgG levels from the serum of mice three weeks post-boost of the indicated vaccine against SARS-CoV spike.

[0030] FIG. 3I is a graph of the neutralizing activity against VSV-SARS- CoV. Samples were collected from BALB / c mice three weeks post-boost with the indicated vaccine (n=5 mice per group).

[0031] FIG. 3J is a graph showing weight loss of mice administered the indicated vaccine and then at day 52 post-prime, animals were challenged IN with 103 PFU of SARS-CoV / MA15 as shown in FIG. 3G (n=5 mice per group).

[0032] FIG. 3K is a set of graphs showing viral burden in lungs harvested at 2 (left) or 4 (right) days post infection with 103 PFU of SARS-CoV / MA15 as shown in FIG 3G (n=5 mice per group). Kruskal-Wallis ANOVA with Dunn’s post-test: ns, not significant, **p < 0.01 , ***p < 0.001 , ****p < 0.0001. Dashed lines on graphs indicate the LoD.

[0033] FIG. 4A is a schematic of the vaccination schedule for WT C57BL / 6J, CD8a- / -, or FcyR- / - congenic C57BL / 6J mice. Four-week-old mice were administered an IM prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. At day 52 post-prime, animals were challenged with 105 FFU of SARS-CoV-2 B.1 .351 . Then, tissue was harvest 3 or 6 days later, at day 55 and day 58, respectively.

[0034] FIG. 4B is a set of graphs showing viral burden in nasal turbinates (left), nasal wash (middle) and lung (right) of WT and CD8a- / - mice at 3 days (top) or 6 days (bottom) post-infection with 105 FFU of SARS-CoV-2 B.1 .351 . Mice were given a control vaccine (white) or the Sarbeco RBD Mix (red).Kruskal-Wallis ANOVA with Dunn’s post-test: ns, not significant, *p < 0.05; **p < 0.01 ; ***p < 0.001 , ****p < 0.0001 . Dashed lines on graphs indicate the LoD; n = 8-10 per group.

[0035] FIG. 4C is a heatmap showing antigen-specific FcyR binding and in vitro antibody-mediated Fc effector function from the immune sera of control (left) or Sarbeco RBD Mix (right) vaccinated animals. Relative median fluorescence intensity (MFI) compared to baseline, red increased, blue decreased.

[0036] FIG. 4D is a set of graphs showing viral burden in nasal turbinates (left), nasal wash (middle) and lung (right) of WT and FcyR- / - C57BL / 6J mice at 3 days post-infection with 105 FFU of SARS-CoV-2 B.1 .351 . Mice were given a control vaccine (white) or the Sarbeco RBD Mix (red). Kruskal-Wallis ANOVA with Dunn’s post-test: ns, not significant; **p < 0.01 , ****p < 0.0001. Dashed lines on graphs indicate the LoD; n = 9-13 per group.

[0037] FIG. 4E is a schematic of the vaccination schedule for WT C57BL / 6J mice. Four-week-old WT C57BL / 6J mice were administered an IM prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. At the indicated times pre- and post-immunization, some animals received a 250 pg and 10 pg dose of isotype control or anti- CD80 depleting antibody administered IP or IN, respectively. In addition, some animals received a 250 pg and 10 pg dose of anti-CD4 depleting antibody, administered IP or IN, respectively, on days 43 and 47 post-prime. At day 49 post-prime, animals were challenged IN with 105 FFU of SARS-CoV-2 B.1.351 and tissue was harvested on day 55.

[0038] FIG. 4F is a set of graphs showing viral burden in nasal turbinates (left), nasal wash (middle), and lung (right) of mice treated with a control vaccine (white) or the Sarbeco RBD Mix vaccine (red). In addition, mice were administered an isotype control, anti-CD4, anti-CD8, or anti-CD4 / CD8 depleting antibodies. On day 49 mice were inoculated with 105 FFU of SARS- CoV-2 B.1 .351 and tissue was harvested for analysis 6 days post-inoculation (n = 7-15 per group, three experiments).

[0039] FIG. 4G is a set of graphs showing B.1 .351 -specific IgG (left), IgA (middle), and neutralization responses (right) from the serum of control- and Sarbeco RBD Mix-vaccinated groups receiving isotype or anti-CD4 depleting antibody before infection (yellow) and post-infection (blue).

[0040] FIG. 4H is a set of graphs showing B.1 .351 -specific IgG (left), IgA (middle), and neutralization responses (right) from bronchoalveolar lavage fluid (BALF) of control- and Sarbeco RBD Mix-vaccinated groups receiving isotype or anti-CD4 depleting antibody before infection (yellow) and post-infection (blue).

[0041] FIG. 5A is a schematic of the vaccination schedule for K18-hACE2 mice. Eight-week-old K18-hACE2 mice were infected with 104 FFU of SARS- CoV-2 BA.2. Eight weeks later, animals were administered a single IN dose of 1010 viral particles of control or Sarbeco RBD Mix vaccine. Three weeks later, animals were bled for serum analysis. Ten weeks later, animals were challenged with 105 PFU of SHC014 and tissue was harvested 6 days post-inoculation.

[0042] FIG. 5B is a set of graphs showing viral burden in nasal turbinates (left), nasal wash (middle), and lung (right) of K18-hACE2 mice at 6 days postinfection with 105 PFU of SHC014. Mice were naive (white) or administered BA.2-immune + control (green) or BA.2-immune + Sarveco RBD Mix as described in FIG. 5A. Kruskal-Wallis ANOVA with Dunn’s post-test: ns, not significant, *p < 0.05; **p < 0.01 ; ***p < 0.001 ; n = 7-10 per group. Dashed lines on graphs indicate the LoD.

[0043] FIG. 5C is a schematic of the vaccination schedule for K18-hACE2 mice. Four-week-old K18-hACE2 mice were administered an IM prime and IM booster dose (0.25 pg each) of Pfizer BNT162b separated by three weeks.Three weeks later, a third IM Pfizer BNT162b dose (0.25 pg) or an IN Sarbeco RBD Mix dose of 1010 viral particles was administered. Alternatively, some animals received only a single IN Sarbeco RBD Mix dose at the same timepoint. Serum was collected at three weeks post-final immunization. One week later, animals were challenged with 104 FFU of SARS-CoV-2 EG.5.1 and tissue was harvested 6 days later.

[0044] FIG. 5D is a set of graphs showing viral burden in nasal turbinates (left), nasal wash (middle), and lung (right) of K18-hACE2 mice at 6 days postinfection with 104 FFU of SARS-CoV-2 EG.5.1 . Mice were naive (white) or administered P-P-P (blue), P-P-Sarveco RBD Mix, or 1x Sarbeco RBD Mix (yellow), as described in FIG. 5C. Kruskal-Wallis ANOVA with Dunn’s post-test: ns, not significant, **p < 0.01 , ****p < 0.0001 ; n = 9-10 per group, three experiments. Dashed lines on graphs indicate the LoD.

[0045] FIG. 6A is a graph showing serum IgG binding titers to Wuhan-1 spike protein by ELISA. Six-week-old C57BL / 6J mice were administered 50 pL of PBS or 1010 viral particles of an empty ChAd vector via IM route. Three weeks later, animals were administered 1010 viral particles of ChAd-Sarbeco RBD Mix via IN route. Three weeks later, animals were bled, and the serum collected.

[0046] FIG. 6B is a set of graphs showing hACE2-Fc protein binding. Recombinant hACE2-Fc protein was loaded onto BLI human Fc pins at aconcentration of 10 pg / mL and dipped into the indicated concentrations of Sarbeco Clade 1 (top, left), Clade 2 (top, right), Clade 3 (bottom, left), or ancestral (bottom, right) RBDs. Samples were allowed to associate and dissociate for 120 and 120 s, respectively. Data are from three experiments.

[0047] FIG. 7A is a schematic of the vaccination schedule for K18-hACE2 mice. Four-week-old K18-hACE2 mice were administered an IN prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. At day 52 post-prime, animals were challenged with 103 FFU of SARS- CoV-2 WA1 / 2020 D614G.

[0048] FIG. 7B is a graph showing weight loss in K18-hACE2 mice at given the indicated vaccine. Mice were administered the vaccine and challenged with 103 FFU of SARS-CoV-2 WA1 / 2020 D614G as shown in FIG. 7A.

[0049] FIG. 7C is a set of graphs showing viral burden in nasal turbinates (viral RNA; left, top), nasal wash (viral RNA; right, top), lung (viral RNA; left, bottom) and lung (infectious virus; right, bottom) of K18-hACE2 mice at 7 days post-infection with 103 FFU of SARS-CoV-2 WA1 / 2020 D614G as shown in FIG. 7A. Kruskal-Wallis ANOVA with Dunn’s post-test: *p < 0.05, **p < 0.01 , ***p < 0.001 , ****p < 0.0001 . Dashed lines on graphs indicate the LoD.

[0050] FIG. 7D is a set of hematoxylin and eosin images of lung sections from naive (right) or SARS-CoV-2 WA1 / 2020 D614-infected animals (at 7 dpi) that were vaccinated with control ( middle) or Sarbeco RBD Mix (left). Images show low (top), medium (middle; boxed region from top), or high (bottom; boxed region from middle) magnification. From top to bottom, scale bars indicate 500, 500, and 100 pm, respectively. Images are representative of n = 3 per group. Naive images are identical to those in FIG. 2D and used for comparison.

[0051] FIG. 8A is a heat map cytokine and chemokine protein expression levels in lung homogenates from the indicated groups. Data are presented as Iog2-transformed fold-change over samples from naive mice. Blue, reduction; red, increase.

[0052] FIG. 8B is a set of graphs of cytokine and chemokine protein levelsin the lungs of IM-IN or IN-IN control- or Sarbeco RBD Mix-vaccinated animals at 7 dpi with SARS-CoV-2 WA1 / 2020 D614G. Bars indicate median value; two- tailed Mann-Whitney test with comparison between the control and Sarbeco RBD Mix-vaccinated animals: ns, not significant, *p < 0.05, **p < 0.01 , ***p < 0.001 ). Data are from two experiments (n = 8 per group).

[0053] FIG. 8C is a set of graphs of cytokine and chemokine protein levels in the lungs of IM-IN or IN-IN control- or Sarbeco RBD Mix-vaccinated animals at 7 dpi with SARS-CoV-2 WA1 / 2020 D614G. Bars indicate median value; two- tailed Mann-Whitney test with comparison between the control and Sarbeco RBD Mix-vaccinated animals: ns, not significant, *p < 0.05, **p < 0.01 ). Data are from two experiments (n = 8 per group).

[0054] FIG. 9A is a representative flow cytometry plot of serum antibody binding to the S or RBD proteins of indicated Sarbecovirus strains by multiplex bead binding assay.

[0055] FIG. 9B is a plot of bound serum IgG relative to Sarbecovirus S or RBD protein compared to a bovine serum albumin control for the indicated ChAd vaccines (Clade 1 , Clade 2, Clade 3, Mix, and Control). Data are from two experiments (n = 5 samples / group).

[0056] FIG. 10A is a schematic of the vaccination schedule for C57BL / 6J mice. Six-week-old WT C57BL / 6J mice were administered an IM prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. At 10 days post-boosting, BALF, lung, and spleen were collected.

[0057] FIG. 10B is a graph of IFNy and TNFa expression of WT C57BL / 6J mice. Splenocytes were stimulated for 20 h with a megapool of conserved H2- Kb-restricted Sarbecovirus RBD CD8+ T cell peptides and analyzed by flow cytometry. Data are from two experiments (n = 8-10 per group). Two-tailed Mann-Whitney test; **p < 0.01 .

[0058] FIG. 10C is a set of flow cytometry plots showing the gating scheme for CD8+ IFNy+ TNFa+ splenocytes in FIG. 10B.

[0059] FIG. 10D is a set of flow cytometry plots showing the gating scheme for BALF and lung TRM cells.

[0060] FIG. 10E is a set of graphs showing the quantification of TRM cells in the BALF (left) and lung (right) of control- or Sarbeco RBD-vaccinated mice, two-tailed Mann-Whitney test; **p < 0.01 , ****p < 0.0001 .

[0061] FIG. 10F is a graph showing bound IgG in four-week-old WT or CD8a- / - C57BL / 6J mice which were administered an IM prime and IN boost dose of 1010 viral particles of the indicated vaccine separated by three weeks. Three weeks later, serum was collected and analyzed for levels of IgG against B.1.351 RBD by ELISA (n = 9-13 samples / group). Dashed lines on graphs indicate the LOD.

[0062] FIG. 10G is a set of flow cytometry plots from four-week-old WT C57BL / 6J mice which were administered an IM prime and IN boost of control or Sarbeco RBD Mix vaccine separated by three weeks. At the indicated times pre- and post-immunization (FIG. 4F), some animals received a 250 pg and 10 pg dose of isotype control or anti-CD80 depleting antibody administered IP or IN, respectively. Some animals also received a 250 pg and 10 pg dose of anti- 004 depleting antibody, administered IP or IN, respectively, on days 43 and 47 post-prime. Representative flow plots are shown from two experiments (n = 3 per group).

[0063] FIG. 11A is a graph showing bound IgG from eight-week-old K18- hACE2 mice which were inoculated with 104 FFU of SARS-CoV-2 BA.2. Eight weeks later, animals were administered a single IN dose of 1010 viral particles of the indicated vaccine. Three weeks later, serum samples were collected and analyzed for levels of IgG against SHC014 RBD by ELISA (n = 7-10 per group). Dashed lines on graphs indicate the LoD.

[0064] FIG. 11 B is a graph showing bound IgG from four-week-old K18 hACE2 mice which were administered an IM prime and IM booster dose (0.25 pg each) of Pfizer BNT162b separated by three weeks. Three weeks later, a third IM Pfizer BNT162b dose (0.25 pg) or an IN Sarbeco RBD Mix dose was administered. Alternatively, some animals only received a single IN Sarbeco RBD Mix dose at the same timepoint. At three weeks post-final immunization, serum was collected and analyzed for levels of IgG against EG.5.1 spike by ELISA (n = 5 per group). Dashed lines on graphs indicate the LoD.

[0065] FIG. 11 C is a set of hematoxylin and eosin images of lung sections from naive (right) or SARS-CoV-2 BA.2-infected animals that had been vaccinated with control (middle) or Sarbeco RBD Mix (left) and then infected with SHC014. Tissues were collected at day 6 after SHC014 infection. Images show low (top), medium (middle; boxed region from top), or high (bottom; boxed region from middle) magnification. From top to bottom, scale bars indicate 500, 500, and 100 pm, respectively.DETAILED DESCRIPTION OF THE INVENTION

[0066] The continued emergence of novel SARS-CoV-2 variants and the threat of future zoonoses has spurred the design of vaccines that can induce broad immunity against multiple coronaviruses. The vaccine composition of the present disclosure makes use of computational methods to infer ancestral phylogenetic reconstructions of receptor binding domain (RBD) sequences across multiple Sarbecovirus clades and incorporate them into a multivalent adenoviral-vectored vaccine.

[0067] As described in the examples herein, mice immunized with the disclosed pan-Sarbecovirus vaccine were protected in the upper and lower respiratory tracts against infection by historical and contemporary SARS-CoV-2 strains, SARS-CoV, and pre-emergent SHC014 and Pangolin / GD coronavirus strains. Using genetic and immunological approaches, it was demonstrated that the vaccine-induced protection was conferred principally by CD4+ and CD8+ T cell-mediated anamnestic responses. Prior mRNA vaccination or SARS-CoV-2 respiratory infection did not alter the efficacy of the disclosed mucosally-delivered pan-Sarbecovirus vaccine. These data highlight a phylogenetic approach for antigen and vaccine design against existing and pre-emergent Sarbecoviruses with pandemic potential.

[0068] The pan-Sarbecovirus vaccine were designed using a Simian adenoviral vector, such as the Simian Ad36 vector (ChAd). In some aspects, the ChAd vector can be modified such that the adenovirus lacks the native E1 , E3, or E3B locus. In some aspect, the adenoviral vector is a replicant-deficient ChAd vector.

[0069] The vaccine antigen includes nucleic acid sequences against theRBD of Sarbecovirus. The RBD sequences include ancestral and phylogenetically inferred Sarbecovirus RBD sequences. RBD amino acid sequence reconstructions were inferred at key nodes, each representing one of the three main Sarbecovirus clades (Clade 1 , Clade 2, and Clade 3).

[0070] The ChAd vaccines (nucleic acid molecule composition) can encode the ancestral RBD, Sarbecovirus Clade 1 , Clade 2, or Clade 3 RBDs, or any combination thereof. In some aspects, the ChAd vaccine encodes an equal mixture (1 :1 :1 ) of ChAd-Clade 1 , -Clade 2, and Clade 3 RBDs (Sarbeco RBD Mix).

[0071] Vaccine administration can occur via intramuscular (IM) or intranasal (IN) routes. In some aspects, the vaccine can be administered as a single dose or multiple doses over time. The first (prime) dose and second (booster) dose can be administered IM or IN. In some aspects, the booster dose is administered 3 weeks after the first prime dose. In some aspects, the Sarbeco RBD Mix prime dose may be administered before or after exposure to a Sarbecovirus, such as SARS-CoV-2. In some aspects, the Sarbeco RBD Mix prime and Sarbeco RBD Mix boost dose may be administered before or after exposure to a Sarbecovirus. In some aspects, the Sarbeco RBD Mix may be administered after a different SARS-CoV-2 vaccine, such as Pfizer BNT16b2 mRNA vaccine.

[0072] The ChAd vaccine dose may be from 107 to 1011 viral particles. For example, the ChAd vaccine dose may be 1x107, 1x108, 1x109, 1x1010, or 1x1011 viral particles. In one instance, the Sarbeco RBD Mix vaccine may have 3.33 x 109 viral particles of each Sarbeco RBD-Clade 1 , -Clade 2, and - Clade 3.MOLECULAR ENGINEERING

[0073] The following definitions and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

[0074] The terms "heterologous DNA sequence", "exogenous DNA segment" or "heterologous nucleic acid," as used herein, each refers to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA shuffling or cloning. The terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a DNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides. A "homologous" DNA sequence is a DNA sequence that is naturally associated with a host cell into which it is introduced.

[0075] Expression vector, expression construct, plasmid, or recombinant DNA construct is generally understood to refer to a nucleic acid that has been generated via human intervention, including by recombinant means or direct chemical synthesis, with a series of specified nucleic acid elements that permit transcription or translation of a particular nucleic acid in, for example, a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector can include a nucleic acid to be transcribed operably linked to a promoter.

[0076] A “promoter” is generally understood as a nucleic acid control sequence that directs the transcription of a nucleic acid. An inducible promoter is generally understood as a promoter that mediates the transcription of an operably linked gene in response to a particular stimulus. A promoter can include necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter can optionally include distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription.

[0077] A "transcribable nucleic acid molecule" as used herein refers to any nucleic acid molecule capable of being transcribed into an RNA molecule.Methods are known for introducing constructs into a cell in such a manner that the transcribable nucleic acid molecule is transcribed into a functional mRNA molecule that is translated and therefore expressed as a protein product. Constructs may also be constructed to be capable of expressing antisense RNA molecules, in order to inhibit translation of a specific RNA molecule of interest. For the practice of the present disclosure, conventional compositions and methods for preparing and using constructs and host cells are well known to one skilled in the art (see e.g., Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN-10: 0471250929; Sambrook and Russel (2001 ) Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, 747-754).

[0078] The “transcription start site” or "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1 . With respect to this site, all other sequences of the gene and its controlling regions can be numbered. Downstream sequences (i.e. , further protein-encoding sequences in the 3' direction) can be denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.

[0079] "Operably linked" or "functionally linked" refers preferably to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the other. For example, a regulatory DNA sequence is said to be "operably linked to" or "associated with" a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects the expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation. The two nucleic acid molecules may be part of a single contiguous nucleic acid molecule and may be adjacent. For example, a promoter is operably linked to a gene of interest if the promoter regulates or mediates transcription of the geneof interest in a cell.

[0080] A "construct" is generally understood as any recombinant nucleic acid molecule such as a plasmid, cosmid, virus, autonomously replicating nucleic acid molecule, phage, or linear or circular single-stranded or doublestranded DNA or RNA nucleic acid molecule, derived from any source, capable of genomic integration or autonomous replication, comprising a nucleic acid molecule where one or more nucleic acid molecule has been operably linked.

[0081] A construct of the present disclosure can contain a promoter operably linked to a transcribable nucleic acid molecule operably linked to a 3' transcription termination nucleic acid molecule. In addition, constructs can include but are not limited to additional regulatory nucleic acid molecules from, e.g., the 3'-untranslated region (3' UTR). Constructs can include but are not limited to the 5' untranslated regions (5' UTR) of an mRNA nucleic acid molecule which can play an important role in translation initiation and can also be a genetic component in an expression construct. These additional upstream and downstream regulatory nucleic acid molecules may be derived from a source that is native or heterologous with respect to the other elements present on the promoter construct.

[0082] The term "transformation" refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. Host cells containing the transformed nucleic acid fragments are referred to as "transgenic" cells, and organisms comprising transgenic cells are referred to as "transgenic organisms".

[0083] "Transformed," "transgenic," and "recombinant" refer to a host cell or organism such as a bacterium, cyanobacterium, animal, or plant into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome as generally known in the art and disclosed (Sambrook 1989; Innis 1995; Gelfand 1995; Innis & Gelfand 1999). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially mismatched primers, and the like. The term "untransformed" refers to normal cells that have notbeen through the transformation process.

[0084] "Wild-type" refers to a virus or organism found in nature without any known mutation.

[0085] Design, generation, and testing of the variant nucleotides, and their encoded polypeptides, having the above-required percent identities and retaining a required activity of the expressed protein is within the skill of the art. For example, directed evolution and rapid isolation of mutants can be according to methods described in references including, but not limited to, Link et al. (2007) Nature Reviews 5(9), 680-688; Sanger et al. (1991 ) Gene 97(1 ), 119-123; Ghadessy et al. (2001 ) Proc Natl Acad Sci USA 98(8) 4552-4557. Thus, one skilled in the art could generate a large number of nucleotide and / or polypeptide variants having, for example, at least 95-99% identity to the reference sequence described herein and screen such for desired phenotypes according to methods routine in the art.

[0086] Nucleotide and / or amino acid sequence identity percent (%) is understood as the percentage of nucleotide or amino acid residues that are identical with nucleotide or amino acid residues in a candidate sequence in comparison to a reference sequence when the two sequences are aligned. To determine percent identity, sequences are aligned and if necessary, gaps are introduced to achieve the maximum percent sequence identity. Sequence alignment procedures to determine percent identity are well known to those of skill in the art. Often publicly available computer software such as BLAST, BLAST2, ALIGN2, or Megalign (DNASTAR) software is used to align sequences. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. When sequences are aligned, the percent sequence identity of a given sequence A to, with, or against a given sequence B (which can alternatively be phrased as a given sequence A that has or comprises a certain percent sequence identity to, with, or against a given sequence B) can be calculated as percent sequence identity = X / Y100, where X is the number of residues scored as identical matches by the sequence alignment program's or algorithm'salignment of A and B and Y is the total number of residues in B. If the length of sequence A is not equal to the length of sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A. For example, the percent identity can be at least 80% or about 80%, about 81 %, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%.

[0087] Substitution refers to the replacement of one amino acid with another amino acid in a protein or the replacement of one nucleotide with another in DNA or RNA. Insertion refers to the insertion of one or more amino acids in a protein or the insertion of one or more nucleotides with another in DNA or RNA. Deletion refers to the deletion of one or more amino acids in a protein or the deletion of one or more nucleotides with another in DNA or RNA. Generally, substitutions, insertions, or deletions can be made at any position so long as the required activity is retained.

[0088] Generally, conservative substitutions can be made at any position so long as the required activity is retained. So-called conservative exchanges can be carried out in which the amino acid that is replaced has a similar property as the original amino acid, for example the exchange of Glu by Asp, Gin by Asn, Vai by lie, Leu by lie, and Ser by Thr. For example, amino acids with similar properties can be Aliphatic amino acids (e.g., Glycine, Alanine, Valine, Leucine, Isoleucine); Hydroxyl or sulfur / selenium-containing amino acids (e.g., Serine, Cysteine, Selenocysteine, Threonine, Methionine); Cyclic amino acids (e.g., Proline); Aromatic amino acids (e.g., Phenylalanine, Tyrosine, Tryptophan); Basic amino acids (e.g., Histidine, Lysine, Arginine); or Acidic and their Amide (e.g., Aspartate, Glutamate, Asparagine, Glutamine). Deletion is the replacement of an amino acid by a direct bond. Positions for deletions include the termini of a polypeptide and linkages between individual protein domains. Insertions are introductions of amino acids into the polypeptide chain, a direct bond formally being replaced by one or more amino acids. An amino acid sequence can be modulated with the help of art-known computer simulation programs that can produce a polypeptide with, for example, improved activity or altered regulation. On the basis of theseartificially generated polypeptide sequences, a corresponding nucleic acid molecule coding for such a modulated polypeptide can be synthesized in vitro using the specific codon usage of the desired host cell.

[0089] “Highly stringent hybridization conditions” are defined as hybridization at 65 °C in a 6 X SSC buffer (i.e. , 0.9 M sodium chloride and 0.09 M sodium citrate). Given these conditions, a determination can be made as to whether a given set of sequences will hybridize by calculating the melting temperature (Tm) of a DNA duplex between the two sequences. If a particular duplex has a melting temperature lower than 65°C in the salt conditions of a 6 X SSC, then the two sequences will not hybridize. On the other hand, if the melting temperature is above 65 °C in the same salt conditions, then the sequences will hybridize. In general, the melting temperature for any hybridized DNA:DNA sequence can be determined using the following formula: Tm = 81.5 °C + 16.6(log10[Na+]) + 0.41 (fraction G / C content) - 0.63(% formamide) - (600 / I). Furthermore, the Tm of a DNA:DNA hybrid is decreased by 1 -1.5°C for every 1% decrease in nucleotide identity (see e.g., Sambrook and Russel, 2006).

[0090] Host cells can be transformed using a variety of standard techniques known to the art (see e.g., Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN-10: 0471250929; Sambrook and Russel (2001 ) Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, 747-754). Such techniques include, but are not limited to, viral infection, calcium phosphate transfection, liposome-mediated transfection, microprojectile-mediated delivery, receptor-mediated uptake, cell fusion, electroporation, and the like. The transfected cells can be selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated into the host cell genome.| Conservative Substitutions! |

[0091] Exemplary nucleic acids which may be introduced to a host cell include, for example, DNA sequences or genes from another species, or even genes or sequences which originate with or are present in the same species, but are incorporated into recipient cells by genetic engineering methods. The term “exogenous” is also intended to refer to genes that are not normally present in the cell being transformed, or perhaps simply not present in the form, structure, etc., as found in the transforming DNA segment or gene, or genes which are normally present and that one desires to express in a manner that differs from the natural expression pattern, e.g., to over-express. Thus, the term “exogenous” gene or DNA is intended to refer to any gene or DNA segment that is introduced into a recipient cell, regardless of whether a similar gene may already be present in such a cell. The type of DNA included in the exogenous DNA can include DNA that is already present in the cell, DNA from another individual of the same type of organism, DNA from a different organism, or DNA generated externally, such as a DNA sequence containing an antisense message of a gene, or a DNA sequence encoding a synthetic or modified version of a gene.

[0092] Host strains developed according to the approaches described herein can be evaluated by a number of means known in the art (see e.g., Studier (2005) Protein Expr Purif. 41 (1 ), 207-234; Gellissen, ed. (2005) Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10: 3527310363; Baneyx (2004) Protein Expression Technologies, Taylor & Francis, ISBN-10: 0954523253).FORMULATION

[0093] The agents and compositions described herein can be formulated in any conventional manner using one or more pharmaceutically acceptable carriers or excipients as described in, for example, Remington’s Pharmaceutical Sciences (A.R. Gennaro, Ed.), 21st edition, ISBN: 0781746736(2005), incorporated herein by reference in its entirety. Such formulations will contain a therapeutically effective amount of a biologically active agent described herein, which can be in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject.

[0094] The term "formulation" refers to preparing a drug in a form suitable for administration to a subject, such as a human. Thus, a "formulation" can include pharmaceutically acceptable excipients, including diluents or carriers.

[0095] The term "pharmaceutically acceptable" as used herein can describe substances or components that do not cause unacceptable losses of pharmacological activity or unacceptable adverse side effects. Examples of pharmaceutically acceptable ingredients can be those having monographs in United States Pharmacopeia (USP 29) and National Formulary (NF 24), United States Pharmacopeial Convention, Inc, Rockville, Maryland, 2005 ("USP / NF"), or a more recent edition, and the components listed in the continuously updated Inactive Ingredient Search online database of the FDA. Other useful components that are not described in the USP / NF, etc. may also be used.

[0096] The term “pharmaceutically acceptable excipient,” as used herein, can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic, or absorption-delaying agents. The use of such media and agents for pharmaceutically active substances is well known in the art (see generally Remington’s Pharmaceutical Sciences (A.R. Gennaro, Ed.), 21st edition, ISBN: 0781746736 (2005)). Except insofar as any conventional media or agent is incompatible with an active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0097] A "stable" formulation or composition can refer to a composition having sufficient stability to allow storage at a convenient temperature, such as between about 0 °C and about 60 °C, for a commercially reasonable period of time, such as at least about one day, at least about one week, at least about one month, at least about three months, at least about six months, at least about one year, or at least about two years.

[0098] The formulation should suit the mode of administration. The agents of use with the current disclosure can be formulated by known methods for administration to a subject using several routes which include, but are not limited to, parenteral, pulmonary, oral, topical, intradermal, intratumoral, intranasal, inhalation (e.g., in an aerosol), implanted, intramuscular, intraperitoneal, intravenous, intrathecal, intracranial, intracerebroventricular, subcutaneous, intranasal, epidural, intrathecal, ophthalmic, transdermal, buccal, and rectal. The individual agents may also be administered in combination with one or more additional agents or together with other biologically active or biologically inert agents. Such biologically active or inert agents may be in fluid or mechanical communication with the agent(s) or attached to the agent(s) by ionic, covalent, Van der Waals, hydrophobic, hydrophilic, or other physical forces.

[0099] Controlled-release (or sustained-release) preparations may be formulated to extend the activity of the agent(s) and reduce dosage frequency. Controlled-release preparations can also be used to affect the time of onset of action or other characteristics, such as blood levels of the agent, and consequently affect the occurrence of side effects. Controlled-release preparations may be designed to initially release an amount of an agent(s) that produces the desired therapeutic effect, and gradually and continually release other amounts of the agent to maintain the level of therapeutic effect over an extended period of time. In order to maintain a near-constant level of an agent in the body, the agent can be released from the dosage form at a rate that will replace the amount of the agent being metabolized or excreted from the body. The controlled release of an agent may be stimulated by various inducers, e.g., change in pH, change in temperature, enzymes, water, or other physiological conditions or molecules.

[0100] Agents or compositions described herein can also be used in combination with other therapeutic modalities, as described further below. Thus, in addition to the therapies described herein, one may also provide to the subject other therapies known to be efficacious for the treatment of the disease, disorder, or condition.THERAPEUTIC METHODS

[0101] Also provided is a process of treating, preventing, reducing, or reversing a coronavirus (e.g., SARS-CoV-2 or mutants thereof) infection in a subject in need of administration of a therapeutically effective amount of a composition comprising an adenovirus vaccine.

[0102] In some configurations, a composition of the present teachings can be used prophylactically i.e. , as a vaccine. The vaccine can be a primary vaccine against COVID-19 / SARS-CoV-2 or can be administered as a booster to an individual who has received a different primary vaccine.

[0103] In some configurations, a composition of the present teachings can be used therapeutically, e.g., to an individual who has already been infected with SARS-CoV-2 but is not showing an immune response, or whose immune response has waned.

[0104] Methods described herein are generally performed on a subject in need thereof. A subject in need of the therapeutic methods described herein can be a subject having, diagnosed with, suspected of having, or at risk for developing a coronavirus infection. A determination of the need for treatment will typically be assessed by a history, physical exam, or diagnostic tests consistent with the disease or condition at issue. Diagnosis of the various conditions treatable by the methods described herein is within the skill of the art. The subject can be an animal subject, including a mammal, such as horses, cows, dogs, cats, sheep, pigs, mice, rats, monkeys, hamsters, guinea pigs, and humans or chickens. For example, the subject can be a human subject.

[0105] Generally, a safe and effective amount of an adenovirus vaccine is, for example, an amount that would cause the desired therapeutic effect in a subject while minimizing undesired side effects. In various embodiments, an effective amount of an adenovirus vaccine described herein can substantially inhibit a coronavirus infection, slow the progress of a coronavirus infection, or limit the development of a coronavirus infection.

[0106] According to the methods described herein, administration can be parenteral, pulmonary, oral, topical, intradermal, intramuscular, intraperitoneal,intravenous, intratumoral, intrathecal, intracranial, intracerebroventricular, subcutaneous, intranasal, epidural, ophthalmic, buccal, or rectal administration.

[0107] When used in the treatments described herein, a therapeutically effective amount of an adenovirus vaccine can be employed in pure form or, where such forms exist, in pharmaceutically acceptable salt form and with or without a pharmaceutically acceptable excipient. For example, the compounds of the present disclosure can be administered, at a reasonable benefit / risk ratio applicable to any medical treatment, in a sufficient amount to substantially inhibit a coronavirus infection, slow the progress of a coronavirus infection, or limit the development of a coronavirus infection.

[0108] The amount of a composition described herein that can be combined with a pharmaceutically acceptable carrier to produce a single dosage form will vary depending upon the subject or host treated and the particular mode of administration. It will be appreciated by those skilled in the art that the unit content of agent contained in an individual dose of each dosage form need not in itself constitute a therapeutically effective amount, as the necessary therapeutically effective amount could be reached by administration of a number of individual doses.

[0109] Toxicity and therapeutic efficacy of compositions described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals for determining the LD50 (the dose lethal to 50% of the population) and the ED50, (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index that can be expressed as the ratio LD50 / ED50, where larger therapeutic indices are generally understood in the art to be optimal.

[0110] The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the seventy of the disorder; activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration; the route of administration; the rate of excretion of the composition employed; the duration of the treatment; drugs used in combination or coincidental with the specificcompound employed; and like factors well known in the medical arts (see e.g., Koda-Kimble et al. (2004) Applied Therapeutics: The Clinical Use of Drugs, Lippincott Williams & Wilkins, ISBN 0781748453; Winter (2003) Basic Clinical Pharmacokinetics, 4th ed., Lippincott Williams & Wilkins, ISBN 0781741475; Sharqel (2004) Applied Biopharmaceutics & Pharmacokinetics, McGraw- Hill / Appleton & Lange, ISBN 0071375503). For example, it is well within the skill of the art to start doses of the composition at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose may be divided into multiple doses for purposes of administration. Consequently, single-dose compositions may contain such amounts or submultiples thereof to make up the daily dose. It will be understood, however, that the total daily usage of the compounds and compositions of the present disclosure will be decided by an attending physician within the scope of sound medical judgment.

[0111] Again, each of the states, diseases, disorders, and conditions, described herein, as well as others, can benefit from compositions and methods described herein. Generally, treating a state, disease, disorder, or condition includes preventing, reversing, or delaying the appearance of clinical symptoms in a mammal that may be afflicted with or predisposed to the state, disease, disorder, or condition but does not yet experience or display clinical or subclinical symptoms thereof. Treating can also include inhibiting the state, disease, disorder, or condition, e.g., arresting or reducing the development of the disease or at least one clinical or subclinical symptom thereof. Furthermore, treating can include relieving the disease, e.g., causing regression of the state, disease, disorder, or condition or at least one of its clinical or subclinical symptoms. A benefit to a subject to be treated can be either statistically significant or at least perceptible to the subject or to a physician.

[0112] Administration of an adenovirus vaccine can occur as a single event or over a time course of treatment. For example, an adenovirus vaccine can be administered daily, weekly, bi-weekly, or monthly. For treatment of acute conditions, the time course of treatment will usually be at least severaldays. Certain conditions could extend treatment from several days to several weeks. For example, treatment could extend over one week, two weeks, or three weeks. For more chronic conditions, treatment could extend from several weeks to several months or even a year or more.

[0113] Treatment in accordance with the methods described herein can be performed prior to, concurrent with, or after conventional treatment modalities for a coronavirus infection.

[0114] An adenovirus vaccine can be administered simultaneously or sequentially with another agent, such as an antiviral, an antibiotic, an antiinflammatory, or another agent. For example, an adenovirus vaccine can be administered simultaneously with another agent, such as an antiviral, an antibiotic, or an anti-inflammatory. Simultaneous administration can occur through the administration of separate compositions, each containing one or more of an adenovirus vaccine, an antiviral, an antibiotic, an anti-inflammatory, or another agent. Simultaneous administration can occur through the administration of one composition containing two or more of an adenovirus vaccine, an antiviral, an antibiotic, an anti-inflammatory, or another agent. An adenovirus vaccine can be administered sequentially with an antiviral, an antibiotic, an anti-inflammatory, or another agent. For example, an adenovirus vaccine can be administered before or after administration of an antiviral, an antibiotic, an anti-inflammatory, or another agent.ADMINISTRATION

[0115] Agents and compositions described herein can be administered according to methods described herein in a variety of means known to the art. The agents and composition can be used therapeutically either as exogenous materials or as endogenous materials. Exogenous agents are those produced or manufactured outside of the body and administered to the body. Endogenous agents are those produced or manufactured inside the body by some type of device (biologic or other) for delivery within or to other organs in the body.

[0116] As discussed above, administration can be parenteral, pulmonary, oral, topical, intradermal, intratumoral, intranasal, inhalation (e.g., in anaerosol), implanted, intramuscular, intraperitoneal, intravenous, intrathecal, intracranial, intracerebroventricular, subcutaneous, intranasal, epidural, intrathecal, ophthalmic, transdermal, buccal, and rectal.

[0117] Agents and compositions described herein can be administered in a variety of methods well-known in the arts. Administration can include, for example, methods involving oral ingestion, direct injection (e.g., systemic or stereotactic), implantation of cells engineered to secrete the factor of interest, drug-releasing biomaterials, polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, implantable matrix devices, mini-osmotic pumps, implantable pumps, injectable gels and hydrogels, liposomes, micelles (e.g., up to 30 pm), nanospheres (e.g., less than 1 pm), microspheres (e.g., 1-100 pm), reservoir devices, a combination of any of the above, or other suitable delivery vehicles to provide the desired release profile in varying proportions. Other methods of controlled-release delivery of agents or compositions will be known to the skilled artisan and are within the scope of the present disclosure.

[0118] Delivery systems may include, for example, an infusion pump which may be used to administer the agent or composition in a manner similar to that used for delivering insulin or chemotherapy to specific organs or tumors. Typically, using such a system, an agent or composition can be administered in combination with a biodegradable, biocompatible polymeric implant that releases the agent over a controlled period of time at a selected site. Examples of polymeric materials include polyanhydrides, polyorthoesters, polyglycolic acid, polylactic acid, polyethylene vinyl acetate, and copolymers and combinations thereof. In addition, a controlled release system can be placed in proximity of a therapeutic target, thus requiring only a fraction of a systemic dosage.

[0119] Agents can be encapsulated and administered in a variety of carrier delivery systems. Examples of carrier delivery systems include microspheres, hydrogels, polymeric implants, smart polymeric carriers, and liposomes (see generally, Uchegbu and Schatzlein, eds. (2006) Polymers in Drug Delivery, CRC, ISBN-10: 0849325331 ). Carrier-based systems formolecular or biomolecular agent delivery can: provide for intracellular delivery; tailor biomolecule / agent release rates; increase the proportion of biomolecule that reaches its site of action; improve the transport of the drug to its site of action; allow colocalized deposition with other agents or excipients; improve the stability of the agent in vivo; prolong the residence time of the agent at its site of action by reducing clearance; decrease the nonspecific delivery of the agent to nontarget tissues; decrease irritation caused by the agent; decrease toxicity due to high initial doses of the agent; alter the immunogenicity of the agent; decrease dosage frequency, improve the taste of the product; or improve the shelf life of the product.SCREENING

[0120] Also provided are methods for screening vaccine candidates or therapeutics.

[0121] The subject methods find use in the screening of a variety of different candidate molecules (e.g., potentially therapeutic candidate molecules). Candidate substances for screening according to the methods described herein include, but are not limited to, fractions of tissues or cells, nucleic acids, polypeptides, siRNAs, antisense molecules, aptamers, ribozymes, triple helix compounds, antibodies, and small (e.g., less than about 2000 mw, or less than about 1000 mw, or less than about 800 mw) organic molecules or inorganic molecules including but not limited to salts or metals.

[0122] Candidate molecules encompass numerous chemical classes, for example, organic molecules, such as small organic compounds having a molecular weight of more than 50 and less than about 2,500 Daltons.Candidate molecules can comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl, or carboxyl group, and usually at least two of the functional chemical groups. The candidate molecules can comprise cyclical carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted with one or more of the above functional groups.

[0123] A candidate molecule can be a compound in a library database of compounds. One of skill in the art will be generally familiar with, for example,numerous databases for commercially available compounds for screening (see e.g., ZINC database, LICSF, with 2.7 million compounds over 12 distinct subsets of molecules; Irwin and Shoichet (2005) J Chem Inf Model 45, 177- 182). One of skill in the art will also be familiar with a variety of search engines to identify commercial sources or desirable compounds and classes of compounds for further testing (see e.g., ZINC database; eMolecules.com; and electronic libraries of commercial compounds provided by vendors, for example, ChemBridge, Princeton BioMolecular, Ambinter SARL, Enamine, ASDI, Life Chemicals, etc.).

[0124] Candidate molecules for screening according to the methods described herein include both lead-like compounds and drug-like compounds. A lead-like compound is generally understood to have a relatively smaller scaffold-like structure (e.g., molecular weight of about 150 to about 350 kD) with relatively fewer features (e.g., less than about 3 hydrogen donors and / or less than about 6 hydrogen acceptors; hydrophobicity character xlogP of about -2 to about 4) (see e.g., Angewante (1999) Chemie Int. ed. Engl. 24, 3943- 3948). In contrast, a drug-like compound is generally understood to have a relatively larger scaffold (e.g., molecular weight of about 150 to about 500 kD) with relatively more numerous features (e.g., less than about 10 hydrogen acceptors and / or less than about 8 rotatable bonds; hydrophobicity character xlogP of less than about 5) (see e.g., Lipinski (2000) J. Pharm. Tox. Methods 44, 235-249). Initial screening can be performed with lead-like compounds.

[0125] When designing a lead from spatial orientation data, it can be useful to understand that certain molecular structures are characterized as being “drug-like”. Such characterization can be based on a set of empirically recognized qualities derived by comparing similarities across the breadth of known drugs within the pharmacopeia. While it is not required for drugs to meet all, or even any, of these characterizations, it is far more likely for a drug candidate to meet with clinical success if it is drug-like.

[0126] Several of these “drug-like” characteristics have been summarized into the four rules of Lipinski (generally known as the “rules of fives” because of the prevalence of the number 5 among them). While these rules generallyrelate to oral absorption and are used to predict the bioavailability of compounds during lead optimization, they can serve as effective guidelines for constructing a lead molecule during rational drug design efforts such as may be accomplished by using the methods of the present disclosure.

[0127] The four “rules of five” state that a candidate drug-like compound should have at least three of the following characteristics: (i) a weight less than 500 Daltons; (ii) a log of P less than 5; (iii) no more than 5 hydrogen bond donors (expressed as the sum of OH and NH groups); and (iv) no more than 10 hydrogen bond acceptors (the sum of N and 0 atoms). Also, drug-like molecules typically have a span (breadth) of between about 8A to about 15A.KITS

[0128] Also provided are kits. Such kits can include an agent or composition described herein and, in certain embodiments, instructions for administration. Such kits can facilitate the performance of the methods described herein. When supplied as a kit, the different components of the composition can be packaged in separate containers and admixed immediately before use. Components include, but are not limited to an adenoviral vector, an immunogenic composition comprising the adenoviral vector, or a cell line producing the viral vector. Such packaging of the components separately can, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the composition. The pack may, for example, comprise metal or plastic foil such as a blister pack. Such packaging of the components separately can also, in certain instances, permit long-term storage without losing the activity of the components.

[0129] Kits may also include reagents in separate containers such as, for example, sterile water or saline to be added to a lyophilized active component packaged separately. For example, sealed glass ampules may contain a lyophilized component and in a separate ampule, sterile water, sterile saline each of which has been packaged under a neutral non-reacting gas, such as nitrogen. Ampules may consist of any suitable material, such as glass, organic polymers, such as polycarbonate, polystyrene, ceramic, metal or any other material typically employed to hold reagents. Other examples of suitablecontainers include bottles that may be fabricated from similar substances as ampules, and envelopes that may consist of foil-lined interiors, such as aluminum or an alloy. Other containers include test tubes, vials, flasks, bottles, syringes, and the like. Containers may have a sterile access port, such as a bottle having a stopper that can be pierced by a hypodermic injection needle. Other containers may have two compartments that are separated by a readily removable membrane that upon removal permits the components to mix. Removable membranes may be glass, plastic, rubber, and the like.

[0130] In certain embodiments, kits can be supplied with instructional materials. Instructions may be printed on paper or other substrate, and / or may be supplied as an electronic-readable medium or video. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an Internet website specified by the manufacturer or distributor of the kit.

[0131] Compositions and methods described herein utilizing molecular biology protocols can be according to a variety of standard techniques known to the art (see e.g., Sambrook and Russel (2006) Condensed Protocols from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed., Current Protocols, ISBN-10: 0471250929;Sambrook and Russel (2001 ) Molecular Cloning: A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10: 0879695773; Elhai, J. and Wolk, C. P. 1988. Methods in Enzymology 167, 747-754; Studier (2005) Protein Expr Purif. 41 (1 ), 207-234; Gellissen, ed. (2005) Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10: 3527310363; Baneyx (2004) Protein Expression Technologies, Taylor & Francis, ISBN-10: 0954523253).

[0132] Definitions and methods described herein are provided to better define the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

[0133] In some embodiments, numbers expressing quantities ofingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments of the present disclosure are to be understood as being modified in some instances by the term “about.” In some embodiments, the term “about” is used to indicate that a value includes the standard deviation of the mean for the device or method being employed to determine the value. In some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the present disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values presented in some embodiments of the present disclosure may contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. The recitation of discrete values is understood to include ranges between each value.

[0134] In some embodiments, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment (especially in the context of certain of the following claims) can be construed to cover both the singular and the plural, unless specifically noted otherwise. In some embodiments, the term “or” as used herein, including the claims, is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive.

[0135] The terms “comprise,” “have” and “include” are open-ended linking verbs. Any forms or tenses of one or more of these verbs, such as “comprises,” “comprising,” “has,” “having,” “includes” and “including,” are also open-ended. For example, any method that “comprises,” “has” or “includes” one or moresteps is not limited to possessing only those one or more steps and can also cover other unlisted steps. Similarly, any composition or device that “comprises,” “has” or “includes” one or more features is not limited to possessing only those one or more features and can cover other unlisted features.

[0136] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the present disclosure and does not pose a limitation on the scope of the present disclosure otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the present disclosure.

[0137] Groupings of alternative elements or embodiments of the present disclosure disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0138] All publications, patents, patent applications, and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, or other reference was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference herein shall not be construed as an admission that such is prior art to the present disclosure.

[0139] Having described the present disclosure in detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing from the scope of the present disclosure defined in the appended claims. Furthermore, it should be appreciated that all examplesin the present disclosure are provided as non-limiting examples.EXAMPLES

[0140] The following non-limiting examples are provided to further illustrate the present disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent approaches the inventors have found function well in the practice of the present disclosure, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present disclosure.EXAMPLE 1: TRIVALENT MUCOSAL VACCINE ENCODING PHYLOGENETICALLY INFERRED RBD SEQUENCES CONFERS PAN-SARBECOVIRUS PROTECTION IN MICE

[0141] The development and validate of a pan-Sarbecovirus vaccine is disclosed. The continued emergence of novel SARS-CoV-2 variants and the threat of future zoonoses has spurred the design of vaccines that can induce broad immunity against multiple coronaviruses. Here, we use computational methods to infer ancestral phylogenetic reconstructions of receptor binding domain (RBD) sequences across multiple Sarbecovirus clades and incorporate them into a multivalent adenoviral-vectored vaccine. Mice immunized with this pan-Sarbecovirus vaccine are protected in the upper and lower respiratory tracts against infection by historical and contemporary SARS-CoV-2 strains, SARS-CoV, and pre-emergent SHC014 and Pangolin / GD coronavirus strains. Using genetic and immunological approaches, we demonstrate that vaccine- induced protection is conferred principally by CD4+ and CD8+ T cell-mediated anamnestic responses. Importantly, prior mRNA vaccination or SARS-CoV-2 respiratory infection does not alter the efficacy of our mucosally-delivered pan- Sarbecovirus vaccine. These data demonstrate a phylogenetic approach for antigen and vaccine design against existing and pre-emergent Sarbecoviruses with pandemic potential.INTRODUCTION

[0142] SARS-CoV-2 vaccines have been instrumental in controlling the impact of the pandemic by limiting symptomatic infections, severe disease, hospitalizations, and deaths. However, selective pressures have driven antigenic drift, resulting in immune escape and sequential cycles of variant emergence. Developing safe and effective vaccines against pathogens with considerable antigenic variation is challenging, as has been observed with influenza A virus. Indeed, the emergence of SARS-CoV-2 Omicron lineage strains, which encode numerous antibody escape mutations in the spike attachment glycoprotein, has resulted in decreased vaccine efficacy and increased breakthrough infections. To combat this, variant-matched boosters were deployed, although their efficacy against subsequent SARS-CoV-2 variants decreases over time. Thus, an ideal SARS-CoV-2 vaccine would be highly effective, durable, and resistant to variant escape.

[0143] More broadly active countermeasures against coronaviruses (CoV) may be needed in anticipation of possible future zoonosis events.Sarbecoviruses, which are one subgenus within the Betacoronavirus genus, include SARS-CoV and SARS-CoV-2, as well as other CoVs that circulate in bat and other mammalian reservoirs throughout Asia, Africa, and Europe. The Sarbecovirus spike protein, which facilitates viral attachment and cell entry, is comprised of two subunits, S1 and S2. Within the S1 subunit, the receptor binding domain (RBD) mediates attachment to host cell receptors. Although Sarbecovirus RBD sequences show considerable genetic diversity, many, including SARS-CoV and SARS-CoV-2, use human ACE2 (hACE2) as a receptor to enter host cells. Moreover, several pre-emergent Sarbecoviruses, such as WIV1 , Pangolin / GD, and SHC014 replicate efficiently in human primary airway epithelial cells; thus, the concern for additional Sarbecovirus emergence is high.

[0144] In response to the SARS-CoV-2 pandemic, numerous vaccine platforms were explored, including those utilizing viral vectors to induce antigen expression. Previously, we described the generation of a replication-deficient simian adenovirus serotype 36 vectored-vaccine (ChAd) that encodes a prefusion stabilized Wuhan-1 or BA.5 spike proteins and conferred protection against SARS-CoV-2 in mice, hamsters, and non-human primates throughinduction of systemic and mucosal IgA, IgG, and T cell responses. Here, to combat SARS-CoV-2 variants as well as future CoV zoonoses, we designed and tested a pan-Sarbecovirus ChAd vectored vaccine comprised of phylogenetically inferred RBD sequences from the three main Sarbecovirus clades. This vaccine induced broadly reactive antibody and T cell responses and conferred protection against multiple Sarbecoviruses in mice.RESULTS

[0145] Vaccine design and immunogenicity of ChAd-RBD ancestral reconstructions. To generate vaccine antigens that induce protective immunity across Sarbecoviruses, we performed evolutionary analyses using 73 Sarbecovirus sequences recovered from virus isolates or field samples (FIG.IA). We focused antigen design on the RBD given its importance in virus entry and prior reports of induction of cross-reactive responses with RBD-only nanoparticle-based Sarbecovirus vaccines. RBD amino acid sequence reconstructions were inferred at key nodes, each representing one of the three main Sarbecovirus clades, as well as the overall most ancestral Sarbecovirus sequence. The RBD sequences for each reconstruction (Clades 1 , 2, 3, and ancestral RBD) were cloned into our replication-deficient ChAd vector (FIG.I B). Previously, we demonstrated this vaccine platform induces protection against SARS-CoV-2 after a single intramuscular (IM) dose and mucosal boosting promotes greater control in respiratory tissues. Therefore, we immunized wild-type C57BL / 6J mice with an IM prime and intranasal (IN) boost separated by three weeks with ChAd vaccines encoding individual ancestral RBDs or an equal mixture of ChAd-Clade 1 , -Clade 2, and -Clade 3 RBDs (Sarbeco RBD Mix) (FIG. 1 C). Three weeks post-boost, we collected serum for analysis. Each vaccine elicited high levels of serum IgG (FIG. 1 D) and IgA (FIG. 1 E) that bound to homologous and heterologous Sarbecovirus antigens including Wuhan-1 spike and Clade 1-, 2-, and 3-RBD proteins. Pre-exposure with the ChAd vector minimally affected the magnitude of Sarbeco RBD- specific responses (FIG. 6A).

[0146] We next evaluated the serum neutralizing activity generated by each Sarbeco RBD vaccine using an authentic SARS-CoV-2 D614G strain andseveral VSV-Sarbecovirus chimeras including VSV-SARS-CoV, VSV-RaTG13, and VSV-Pang / GD (FIG. 1 F). Unexpectedly, low levels of inhibitory activity (geometric mean titer (GMT) < 1 / 100) were detected in sera against all VSV chimeric viruses tested compared to the control ChAd-SARS-CoV-2 spike vaccine immune sera, which efficiently neutralized the homologous WA1 / 2020 D614G virus. While these results indicate the vaccines encoding ancestral Sarbecovirus RBDs are immunogenic, the sequence variation of the inferred RBDs may be too divergent to elicit potently neutralizing responses against RBDs of the heterologous viruses we tested. This hypothesis is supported by the observation that ancestral and Clade 3 RBD proteins fail to bind hACE2 in solution (FIG. 6B). Moreover, while the Clade 1 and Clade 2 RBD proteins retained hACE2 binding capacity, the affinities were 73- and 478-fold lower than those reported for SARS-CoV (5 nM) and SARS-CoV-2 (1 .2 nM), respectively.

[0147] In vivo protection against SARS-CoV-2 variant-mediated clinical disease and viral burden. We evaluated the efficacy of each RBD vaccine by immunizing and challenging K18-hACE2 mice. To evaluate the requirement of the systemic IM priming dose for protection, we administered an IM-IN or IN-IN prime-boost series separated by three weeks followed by heterologous challenge with SARS-CoV-2 WA1 / 2020 D614G (FIG. 2A, FIG. 7A). For IM-IN administered groups, protection from infection-induced weight loss was conferred by all vaccines except the Clade 1 RBD or control vaccine (FIG. 2B). Nonetheless, immunization with Clade 1 RBD, Clade 2 RBD, or the trivalent Sarbeco RBD Mix reduced viral RNA levels in all respiratory tissues collected (nasal wash, nasal turbinates, and lung) compared to the control group, and all RBD vaccines prevented recovery of infectious virus from the lungs at 7 days post-infection (dpi) (FIG. 2C). For IN-IN administered groups, protection from weight loss and reduction in viral RNA levels were conferred by immunization with the Clade 2 RBD or the trivalent Sarbeco RBD Mix (FIG. 7B, FIG. 7C).

[0148] As independent metrics of protection, we analyzed lung sections for pathology (FIG. 2D, FIG. 7D) and lung homogenates for cytokines and chemokines at 7 dpi in Sarbeco RBD Mix-and control vaccinated animals (FIG. 8B, FIG. 8C). For both IM-IN and IN-IN immunization strategies, lungs fromcontrol-vaccinated, but not Sarbeco RBD Mix-vaccinated or naive animals, showed evidence of pneumonia with immune cell infiltration, alveolar consolidation, and edema. The levels of SARS-CoV-2 D614G-induced inflammatory cytokines and chemokines including IFN-y, IL-6, CXCL10, CCL2, and CCL3 also were reduced in IM-IN and IN-IN Sarbeco RBD Mix-vaccinated animals compared to control-vaccinated animals. Thus, while varying levels of clinical and virological protection against WA1 / 2020 D614G challenge were observed for the individual ChAd-Sarbeco RBD vaccines after IM-IN or IN-IN administration, the outcome appeared best in animals immunized using the IM- IN scheme with the Sarbeco RBD Mix vaccine. Based on these results, we prioritized the trivalent Sarbeco RBD Mix vaccine candidate in many of the subsequent experiments.

[0149] ChAd-Sarbeco RBD Mix vaccine induces pan-Sarbecovirus immunity. To evaluate the breadth of the antibody response elicited by Sarbeco RBD Mix vaccination, we first utilized a systems serology approach. C57BL / 6J mice were immunized with an IM-IN prime-boost series separated by three weeks followed by serum collection at three weeks post-boost. Sarbeco RBD Mix vaccination induced high levels of lgG1 and lgG3 subclasses and intermediate levels of lgG2b, lgG2c, and IgA that bound the RBDs of all tested Sarbecoviruses, including SARS-CoV-2 variants, SARS-CoV, and RaTG13, but not the spike protein of MERS-CoV, a distantly related Merbecovirus (FIG. 3A, FIG. 3B). Using a complementary approach, we conjugated ten different Sarbecovirus RBD or spike proteins representing all three Sarbecovirus clades to beads of varying fluorescence intensities prior to incubation with Clade 1-, Clade 2-, Clade 3-RBD-, Sarbeco RBD Mix-, or control-vaccinated immune serum (FIG. 9A). Immune serum from all Sarbeco RBD vaccination groups bound spike and RBD antigens from each Sarbecovirus clade (FIG. 9B).

[0150] Next, we determined whether the Sarbeco RBD Mix vaccine could protect against two pre-emergent Sarbecoviruses, SHC014 and Pangolin / GD. Although these CoVs are not known to have caused human infections, they replicate efficiently in human cells using hACE2 as an entry receptor. K18- hACE2 mice were administered a prime-boost series separated by three weeks (FIG. 3C). Three weeks after the booster dose, serum was collected foranalysis. Vaccination with the Sarbeco RBD Mix elicited high levels (GMT, 1 / 105-106) of serum IgG against both SHC014 and Pangolin / GD (FIG. 3D). One month after boosting, mice were inoculated with 105 plaque-forming units (PFU) of SHC014 or Pangolin / GD virus. Although only modest weight loss in control-vaccinated animals was measured in these models, weight loss was not observed in the Sarbeco RBD Mix-vaccinated cohorts for either virus (FIG. 3E, FIG. 3F). High titers (108-1010 PFU / mL) of both viruses were recovered from the lungs of control-vaccinated animals. In contrast, infectious virus was absent in the lungs of SHC014-infected (0 of 10) and infrequently detected in Pangolin / GD-infected (1 of 10) mice that received the Sarbeco RBD Mix vaccine.

[0151] We extended our evaluation of Sarbecovirus protection breadth and the requirement for the IM prime dose by challenging IN-IN immunized animals with SARS-CoV. We utilized a mouse-adapted SARS-CoV llrbani strain (SARS-CoV / MA15), which causes lethal infection in mice. Animals were immunized with an IN-IN prime-boost series of the different Clade 1-, 2-, and 3- RBD vaccines separated by three weeks (FIG. 3G). All Sarbecovirus RBD vaccines elicited high levels of serum IgG (FIG. 3H, FIG. 9B) against SARS- CoV spike protein, with little to no neutralizing activity (FIG. 3I). Nonetheless, upon challenge with a lethal dose of a SARS-CoV / MA15, weight loss was observed only in control-vaccinated animals (FIG. 3J). At 2 dpi, minimal or no infectious virus was recovered from the lungs of Clade 1-, Clade 2-RBD, or Sarbeco RBD Mix vaccinated animals (FIG. 3K). Breakthrough infection was observed in 4 of 5 animals in the Clade 3-RBD-vaccinated group. However, by 4 dpi, only the lungs from control-vaccinated animals had detectable infectious virus. Together, these data suggest that vaccination with the Sarbeco RBD vaccines, especially the trivalent Sarbeco RBD Mix, induces broadly protective immunity against Sarbecoviruses.

[0152] T cells contribute to protection induced by Sarbeco RBD Mix vaccination. Given the low levels of serum neutralizing activity in vaccinated animals, we hypothesized that protection might be conferred by cross-reactive T cells and / or Fc-effector functions of cross-reactive, but non-neutralizing antibodies. To address the first possibility, we evaluated the capacity ofSarbeco RBD Mix vaccination to generate functional and tissue-specific T cell responses. We first generated an H2-Kb-restricted CD8+ T cell peptide pool consisting of 135 unique 9-mer sequences that were conserved in one or more of the three phylogenetically inferred Sarbeco RBDs. To test the capacity of this peptide pool to restimulate vaccine-elicited T cells, we immunized C57BL / 6J mice with an IM-IN prime-boost series separated by three weeks and collected spleens at ten days after boosting (FIG. 10A). Ex vivo stimulation of splenocytes from Sarbeco RBD-vaccinated mice with the peptide pool induced (46-fold, p < 0.0001 ) more CD8+ IFNy+ TNFa+ T cells than splenocytes from control-vaccinated mice (FIG. 10B, FIG. 10C). Analogously, in bronchioalveolar lavage fluid (BALF) and lung tissues, we detected greater numbers (39- and 73-fold, p = 0.0079 and p < 0.0001 , respectively) of CD8+ CD69+ CD103+ tissue-resident memory T cells (TRM) in Sarbeco RBD Mix- vaccinated mice than in control-vaccinated mice (FIG. 10D, FIG. 10E).

[0153] To determine the requirement of CD8+ T cells for protection, we compared viral burden in immunized congenic wild-type (WT) and CD8a- / - C57BL / 6J mice. To perform challenge studies in C57BL / 6J mice lacking hACE2 expression, we used the SARS-CoV-2 B.1 .351 (Beta) variant that has a naturally occurring mouse-adapting spike substitution (N501Y). Because slightly greater protection against SARS-CoV-2 D614G was conferred by IM-IN than IN-IN administration (compare FIG. 2B, FIG. 2C, and FIG. 7B, FIG. 7C), we immunized WT or CD8a- / - C57BL / 6J mice using an IM-IN prime-boost series. Serum was collected three weeks after boosting, and all animals were challenged ten days later with B.1.351 (FIG. 4A). Differences in animal genotype had no effect on serum IgG levels against Wuhan-1 spike (FIG. 10F). At 3- and 6-days post-challenge with B.1.351 , WT mice that received the Sarbeco RBD Mix had reduced viral burden in the upper and lower respiratory tracts (FIG. 4B). In comparison, the levels of protection for Sarbeco RBD Mix- vaccinated CD8a- / - mice varied by tissue and time post-infection. At 3 dpi, viral RNA levels in the nasal turbinates and nasal washes of Sarbeco RBD Mix- vaccinated WT mice were less than in control-vaccinated animals. Protection by the Sarbeco RBD Mix vaccine trended lower in CD8a- / - mice (nasal turbinate: 23-fold, p = 0.1116; nasal wash: 6.5-fold, p = 0.1176) withoutattaining statistical significance. However, at 6 dpi, protection in the upper respiratory tract of Sarbeco RBD Mix-vaccinated CD8a- / - mice was significantly diminished compared to similarly immunized WT mice. At both 3 and 6 dpi, Sarbeco RBD Mix-vaccinated CD8a- / - mice showed reduced viral RNA levels in the lungs compared to control-vaccinated CD8a- / - mice, with levels similar to Sarbeco RBD Mix-vaccinated WT mice. These data suggest that antigen-specific CD8+ T cells elicited by Sarbeco RBD Mix vaccination contribute more to the control of upper respiratory tract infection by SARS- CoV-2 B.1.351 in C57BL / 6 mice.

[0154] Given that CD8+ T cells appeared dispensable for vaccine-induced protection in the lung, we evaluated the contributions of Fc effector functions of antibodies. Systems serology analyses of control- or Sarbeco RBD Mix- immune sera demonstrated binding to FcyRllb, FcyRI 11, and FcyRIV when sera were incubated with Sarbecovirus RBD- but not MERS-CoV spike- or influenza HA-coated control beads (FIG. 4C). We observed in vitro antibody-dependent complement deposition (ADCD) and to a lesser extent, antibody-dependent cellular phagocytosis (ADCP) and antibody-dependent neutrophil-mediated phagocytosis (ADNP) of beads coated with Sarbecovirus RBD proteins. To further define the contribution of Fc-FcyR effector functions to vaccine- mediated protection in vivo, we immunized WT or FcyR- / - (common y chain- / -) C57BL / 6J mice with an IM-IN prime-boost series of control or Sarbeco RBD Mix vaccines followed by challenge with SARS-CoV-2 B.1 .351 . Unexpectedly, FcyRs were dispensable for vaccine-mediated protection in the nasal washes and the lungs, and although viral RNA levels in the nasal turbinates of FcyR-Z- mice trended higher than in WT mice (1 .8-fold), a statistical difference was not observed (FIG. 4D).

[0155] Considering the results in FcyR- / - mice, we hypothesized that other T cell functions might contribute to Sarbeco RBD Mix-mediated lung protection, including CD4+ T cell-mediated B cell help during an anamnestic response. To test this idea, we immunized WT C57BL / 6J mice with an IM-IN prime-boost series (FIG. 4E). We administered a CD4 depleting antibody on days -6 and -2 prior to inoculation with SARS-CoV-2 B.1.351 (FIG. 10G) to remove CD4+ Tcells after B and T cell memory responses were generated. In some cohorts, we also administered a CD80-depleting antibody via IP and IN routes prior to and after each vaccine dose to eliminate CD8+ T cells; we hypothesized it might be necessary to deplete CD8+ T cells to reveal a CD4+ T cell-dependent phenotype.

[0156] Sarbeco RBD Mix-induced protection against infection was not altered by depletion of CD4+ T cells alone in the nasal turbinates and nasal washes or depletion of CD8+ T cells alone in the nasal washes and lungs. However, depletion of CD4+ T cells, and especially both CD4+ and CD8+ T cells, resulted in a loss of protection in the lung, with viral burden levels equivalent to those observed in control-vaccinated animals (FIG. 4F). Similarly, depletion of CD8+ T cells alone or CD4+ and CD8+ T cells resulted in a loss of virological protection in the nasal turbinates. To characterize the anamnestic responses elicited in the isotype and CD4+ T cell depletion cohorts upon infection, we analyzed IgG, IgA, and neutralizing antibody levels in serum before and six days after B.1 .351 infection (FIG. 4G) and in the bronchoalveolar lavage fluid (BALF) at 6 dpi only (FIG. 4H). Serum IgG responses were boosted against B.1 .351 spike in all groups at 6 dpi with the exception of the anti-CD4 treated Sarbeco RBD Mix group. The serum antispike IgG induced in the anti-CD4 treated and control-vaccinated group likely represents a primary extrafollicular response to infection. B.1 .351 -reactive serum IgA and neutralizing antibodies were induced at 6 dpi only in the isotype-treated Sarbeco RBD Mix-vaccinated cohort. In the BALF, B.1.351 - specific IgG, IgA, and neutralizing activity were present in the Sarbeco RBD Mix-vaccinated animals receiving isotype, but not anti-CD4 depleting antibody. Collectively, our experiments in mice suggest that the virological protection conferred by the Sarbeco RBD Mix vaccine is principally mediated by CD8+ T cells in the upper respiratory tract and anamnestic CD4+ T cell responses in the lung.

[0157] Mucosal boosting with Sarbeco RBD Mix enhances protection in antigen-experienced animals. Considering a majority of humans have been infected with at least one strain of SARS-CoV-2, we evaluated how infection- induced immunity affects the efficacy of the Sarbeco RBD Mix vaccine. SinceSARS-CoV-2 Omicron variants are naturally attenuated in mice and do not result in lethal infections, we inoculated K18-hACE2 mice with SARS-CoV-2 BA.2 and kept another cohort naive (FIG. 5A). Eight weeks later, we administered a single IN dose of either control or Sarbeco RBD Mix vaccine, and three weeks later, we evaluated the levels of serum IgG against SHC014 (FIG. 11A); we chose SHC014 because this Sarbecovirus can use hACE2 as a receptor, replicate in human airway epithelial cells, and represents a threat for future emergence. Analysis of sera from BA.2 immune and control vaccinated mice showed limited antibody cross-reactivity to SHC014 RBD compared to sera from BA.2 immune and Sarbeco RBD Mix-vaccinated mice. At 21 weeks post-BA.2 exposure (11 weeks after the Sarbeco RBD Mix IN booster), animals were challenged with SHC014. At 6 dpi, in the nasal turbinates and nasal washes, similar reductions in viral burden were observed in BA.2-exposed animals receiving either the control or Sarbeco RBD Mix vaccine compared to naive animals (FIG. 5B). However, in contrast to the naive or BA.2-immune mice that received a control booster, SHC014 RNA levels in the lungs of BA.2 immune mice receiving the Sarbeco RBD Mix booster dose were reduced to the limit of detection in most (6 of 8) animals. Lung sections from BA.2 immune, Sarbeco RBD Mix-vaccinated mice at 6 dpi did not show lung inflammation, in contrast to BA.2-immune, control-boosted animals, which showed focal pneumonitis and alveolar space consolidation (FIG. 11 C). Thus, the immunity elicited by natural SARS-CoV-2 infection did not prevent boosting with Sarbeco RBD Mix, as enhanced protection against infection and lung injury by a distantly related Sarbecovirus was still observed.

[0158] To assess the possible effect of antigen experience by a SARS- CoV-2 vaccine on protection mediated by Sarbeco RBD Mix, we administered IM prime and booster doses of Pfizer BNT162b2 mRNA vaccine spaced three weeks apart to K18-hACE2 mice (FIG. 5C). Three weeks later, we boosted mice with an additional dose of Pfizer BNT162b2 delivered IM or the Sarbeco RBD Mix delivered IN. As additional controls, we administered to naive mice a primary dose of Sarbeco RBD Mix via IN route, whereas another group was kept naive. We evaluated the levels of serum IgG against SARS-CoV-2 EG.5.1 , which we chose as the challenge strain because it models a scenariowhere individuals receive multiple doses of a historical mRNA vaccine prior to heterologous SARS-CoV-2 infection. High levels of SARS-CoV-2 EG.5.1 - reactive antibodies were elicited by three doses of Pfizer BNT162b or two doses of Pfizer BNT162b with a Sarbeco RBD Mix booster, but not by a single dose of the Sarbeco RBD Mix (FIG. 11 B). Upon challenge, mice that received three doses of BNT162b2 had EG.5.1 viral RNA levels in upper respiratory tract tissues that were equivalent to the control-vaccinated group (FIG. 5D). In contrast, animals receiving two doses of BNT162b2 followed by a single IN Sarbeco RBD Mix booster dose showed virological protection against EG.5.1 in both the upper and low respiratory tracts, at levels equivalent to the single IN Sarbeco RBD Mix dose; thus, prior antigen exposure via mRNA vaccination did not adversely affect the efficacy of Sarbeco RBD Mix vaccine. Altogether, in the context of pre-existing immunity, our data suggest that mucosal antigen exposure confers optimal protection of both the upper and lower respiratory tracts against subsequent heterologous Sarbecovirus infections.DISCUSSION

[0159] In this study, we designed pan-Sarbecovirus vaccine candidates using phylogenetically inferred RBD sequences and delivered these immunogens using an established adenoviral vector platform. This genetically informed approach allowed for the design of a vaccine candidate that could address the complex diversity of Sarbecoviruses, which is particularly apparent within the spike protein. An advantage of the adenoviral-vectored platform is its effectiveness as a mucosal vaccine, which results in immune responses at barrier sites to infection. A 1 :1 :1 trivalent combination of ChAd vectors encoding Sarbeco Clade 1-, Clade 2-, or Clade 3-RBDs exhibited superior protection in vivo, although individual Clade-specific RBD and ancestral RBD vaccines also conferred varying degrees of protective immunity.

[0160] While experiments in knockout mice or with cell-depleting antibodies suggested that protection was principally mediated by T cells, the mechanism differed depending on the tissue compartment within the respiratory tract. Loss of CD8+ T cells in C57BL / 6J mice infected with B.1 .351 diminished Sarbeco RBD Mix vaccine-mediated protection in the upperrespiratory tract, whereas CD8+ T cells appeared dispensable for protection in the lung. These results contrast with recent observations, wherein ChAd BA.5 spike vaccine required CD8+ T cells to confer protection in the lung against XBB.1.5 challenge. In our experiment, we infected C57BL / 6J mice using a B.1.351 SARS-CoV-2 variant strain naturally encoding an N501Y spike substitution that allows infection of congenic CD8a- / - and WT C57BL / 6J mice. The prior study used the more susceptible K18-hACE2 mice and depleted CD8+ T cells with an anti-CD8a monoclonal antibody. We hypothesize that in the K18-hACE2 model, ectopic hACE2 expression in epithelial cells results in greater SARS-CoV-2 replication in the lung, which likely requires multiple immune modalities, including effector CD8+ T cells, for infection control and clearance. In contrast, in conventional C57BL / 6J mice, B.1.351 infection in the lung is more restricted to the cells adjacent to the airways and disease is less severe, such that CD8+ T cells are not required for protection. Rather, anamnestic B cell responses, which require CD4+ T cells, are likely necessary for protection in the lungs of WT C57BL / 6J mice.

[0161] Despite the high levels of cross-reactive antibodies elicited in the serum of Sarbeco RBD Mix-vaccinated animals, little neutralizing activity was observed against heterologous Sarbecovirus strains, a phenomenon seen with other pan-Sarbecovirus vaccine candidates. The epitopes in RBD that are recognized by potently neutralizing antibodies are the most variable and susceptible to amino acid variation, thus rendering many antibodies as virus strain- or type-specific, or in this case, ancestral or clade RBD-specific. Improvement in neutralizing responses may require inclusion of the entire ancestrally reconstructed spikes that contain the more conserved Sarbeco S2 domains, or glycan masking of non-neutralizing or poorly conserved epitopes. Alternately, chimeric spikes or mosaic RBD immunogens have been used to generate broadly neutralizing responses against Sarbecoviruses. Whether these approaches elicit multiclade, cross-reactive B cells remains unclear due to the overlap between the vaccine antigens and the strains used to evaluate neutralization.

[0162] A relatively small contribution was observed for Fc-effector functions in the context of Sarbeco RBD Mix vaccination and B.1 .351challenge that was principally restricted to the nasal turbinates. This result was unexpected given the requirement of Fc-effector functions for vaccine- mediated protection against lung infection by multiple Sarbecovirus strains. However, in one of those studies, the protective phenotype corresponded to S2-specific lgG2a antibody binding to FcyRIV, which the trivalent Sarbeco RBD Mix vaccine cannot induce. At present, it remains unclear whether the relatively small contributions of Fc-FcyR interactions to protection in the context of Sarbeco RBD Mix vaccination is a product of the vaccine design (no S2 antigen), the routes of vaccination used, or the bias of the IgG subclasses induced.

[0163] Mucosal vaccination can induce immunity at the initial sites of respiratory virus infection. Previous characterization of the ChAd-SARS-CoV-2 vaccine demonstrated that mucosal and systemic IgA, IgG, and T cell immunity all contribute to respiratory tract protection in animal models and humans. Indeed, mucosal boosting of Pfizer BNT162b prime-boosted animals with an IN dose of ChAd Sarbeco RBD Mix enhanced upper respiratory tract protection against SARS-CoV-2 EG.5.1 compared to three intramuscular doses of BNT162b. Even a single IN dose of Sarbeco RBD Mix conferred similar levels of protection in the upper respiratory tract as the two-dose Pfizer group boosted IN with Sarbeco RBD Mix. These results suggest that historical mRNA vaccines delivered by intramuscular route do not adversely affect immune responses in the upper respiratory tract and highlight the potential utility of mucosal boosters. In addition, while a more detailed antibody repertoire analysis is required, these results suggest that boosting at a heterologous site might be a strategy for limiting the effects of B cell imprinting. One caveat to adenoviral vector vaccination is the possible emergence of vector immunity over multiple rounds of boosting. In mice, we did not observe decreased serum antibody responses against Sarbecoviruses in the context of two ChAd doses.EXPERIMENTAL MODELS AND METHODS

[0164] Viruses. The SARS-CoV-2 WA1 / 2020 D614G virus was produced by introducing the mutation into an infectious clone of WA1 / 2020. The B.1.351 , BA.2, and EG.5.1 isolates were isolated from infected individuals. Viruses werepropagated on Vero-TMPRSS2 cells and subjected to deep sequencing to confirm the presence of expected substitutions. Viral titer was determined by focus-forming assay (FFA). SHC014 (provided by Dr. Ralph Baric, University of North Carolina), Pangolin / GD (provided by Dr. Ralph Baric, University of North Carolina) and SARS-CoV / MA15 were grown and titered by plaque assay on Vero E6 cells.

[0165] Cells. Vero E6 cells (CRL-1586, ATCC), Vero CCL81 (ATCC), and BSRT7 / 5 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (Omega Scientific) and 100 U / mL penicillin-streptomycin (P / S) (Invitrogen). Vero cells expressing TMPRSS2 or hACE2-TMPRSS2 (a gift of A. Creanga and B.Graham, National Institutes of Health (NIH)) were maintained as Vero E6 cells, with the addition of 5 pg / mL blasticidin (Vero-TMPRSS2) or 10 pg / mL of puromycin (Vero-hACE2-TMPRSS2). MA104 cells were maintained in Medium 199 (Gibco) with 10% FBS. All Vero and MA104 cell lines were maintained at 37°C in the presence of 5% CO2. Freestyle 293F cells (Thermo Fisher Scientific) were maintained in Expi293 Medium at 37°C in the presence of 8% CO2.

[0166] Proteins. For recombinant SARS-CoV-2 Wuhan-1 spike protein (residues 1-1213, GenBank: MN908947.3) production, the corresponding DNA sequence was cloned into a pCAGGS mammalian expression vector containing a C-terminal Twin-Strep-tag. The spike protein was prefusion stabilized via two proline substitutions (K986P, V987P), a disrupted S1 / S2 furin cleavage site, and a C-terminal foldon trimerization motif (YIPEAPRDGQAYVRKDGEWVLLSTFL, SEQ ID NO:1 ). Protein was produced in Freestyle 293F cells and purified from culture supernatants on day 5 posttransfection using StrepTrap HP affinity column (Cytiva).

[0167] For ELISAs, inferred Sarbecovirus clade 1 , 2, 3, ancestral, SARS- CoV-2 B.1.351 (GenBank: QUT64557.1 ), RaTG13 (QHR63300), SHC014 (KC881005), Rs4081 (KY417143), Pang17 (QIA48632), RmYN02 (GISAID: EPI_ISL_412977), Rf1 (DQ412042), and WIV1 (KF367457) RBD sequences were cloned into the pVRC expression vector upstream of a HRV 3C proteasecleavage site followed by a C-terminal 8x histidine tag; the tissue plasminogen activator (tPA) signal peptide was used for all RBD constructs. Proteins were produced by transiently transfecting Expi293F cells using polyethyleneimine and proteins were recovered on day 4 post-transfection after purification by cobalt-charged resin chromatography (Takara Bio) prior to HRV 3C (Thermo- Fisher)-mediated removal of the his-tag. All proteins were further purified over a Superdex 200 Increase 10 / 300 GL (Cytiva). Protein purity was assessed by SDS-PAGE analysis.

[0168] For multiplexed antigen binding assays, full-length SARS-CoV-2 B.1.351 , RaTG13, SHC014, Rs4081 , Pang17, RmYN02, Rf 1 , and WIV1 spike gene sequences were cloned downstream of the SARS-CoV-2 B.1.351 signal peptide sequence (MFVFLVLLPLVSS, SEQ ID NO:2) followed by a C-terminal Twin-Strep-tag (WSHPQFEK, SEQ ID NO:3) and Avi-tag sequences (GLNDIFEAQKIEWHE, SEQ ID NO:4) separated by a linker sequence (GSGGGS, SEQ ID NO:5). For B.1 .351 , the S1 / S2 cleavage site was disrupted by deleting residues P681-R685. In all cases, S6P prefusion-stabilizing mutations were incorporated when conserved (all substitutions except the SARS-CoV-2 A942 corresponding residue for Rs4081 , Rf1 , and WIV1 ).Expi293F cells were transiently transfected using Expifectamine reagent, and proteins were recovered from culture supernatants on day 5 using StrepTrap HP affinity columns (Cytiva). To biotinylate Avi-tagged spikes, the S-Avitag substrates were diluted to 40 pM and incubated for 1 h at 30°C with 15 pg / ml of BirA enzyme (Avidity) in 0.05 M bicine buffer at pH 8.3 supplemented with 10 mM ATP, 10 mM magnesium acetate and 50 pM biotin. The protein was concentrated and buffer exchanged with PBS using a 100 kDa Amicon Ultra centrifugal filter (EMD Millipore). Bovine serum albumin was biotinylated using the EZ-Link Micro NHS-PEG4-Biotinylation Kit (Thermo Fisher), and excess biotin was removed using 7-kDa Zeba desalting columns (Pierce). SARS-CoV- 2 Wuhan-1 (Cat. no. 40592-V27H-B) and XBB.1.16 (SPD-C82Q4) RBD Avi- tagged, biotinylated proteins were purchased from Sino Biological and Aero Biosystems, respectively.

[0169] For hACE2 protein production, DNA fragments encoding hACE2 residues 1-615 were synthesized and cloned into pFM1.2 with a C-terminalHRV 3C protease cleavage site (LEVLFQGP, SEQ ID NO:6) and a human lgG1 Fc region. Plasmids were transiently transfected into Expi293F cells and cell culture supernatants were collected on day 4 post-transfection. Secreted hACE2-Fc protein was purified by protein A chromatography (GoldBio).

[0170] Mice. Animal studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (Assurance number A3381 -01 ). Virus inoculations were performed under anesthesia that was induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering.

[0171] K18-hACE2 transgenic mice (#034860) and wild-typeC57BL / 6J mice (#000664) were purchased from Jackson Laboratories and wild-type BALB / c mice (#028) were purchased from Charles River Laboratories. CD8 a-chain- / - and FcyR- / - mice were bred and maintained on a C57BL / 6J background in-house and were originally obtained from collaborators (H. W. Virgin, Washington University) or commercial (Taconic Biosciences; cat. no. 583) sources, respectively. All animals were housed in a pathogen-free animal facility at Washington University in St. Louis. Viral infections were performed via intranasal inoculation with the indicated quantity of virus. In some experiments, mice were monitored daily for weight loss.

[0172] Ancestral sequence reconstruction. All non-SARS-CoV-2 spike glycoprotein sequences were collected from the ViPR database (https: / / www.jcvi.org / research / virus-pathogen-resource-vipr). In addition, a representative subset of SARS-CoV-2 sequences was selected to include the original Wuhan-Hu-1 isolate and representatives from several SARS-CoV variants of concern. Sequences were aligned using MAFFT (with --globalpair-- maxiterate 1000 settings) and phylogenetic analysis was performed using RAxML with a WAG model of evolution and 100 bootstraps.

[0173] The MEGA7 program was used with a maximum likelihood algorithm (WAG model) to infer sequences for the nodes labeled “AncestralSarbeco”, “Clade 1”, “Clade 2”, and “Clade 3” RBD in FIG. 1A. Reviewing the results, we found that the inferred amino acid residues for several positions were relatively uncertain, especially in the amino-terminal half of the Sarbeco ancestral and Clade 2 ancestor sequences (43 positions and 53 positions in which the most likely residue has a probability of < 0.60, respectively), due to the relatively sparse sequence availability of evolutionary intermediate isolates. For all positions, the amino acid residue with the highest probability was used to construct full-length spike protein sequences from which the RBD of each was used to generate the vaccine constructs.

[0174] Recovery of ChAd-Sarbeco RBD vaccines. Generation of the ChAd replication-incompetent vector (simian Ad36) was constructed to express a mouse codon-optimized sequence corresponding to each of the inferred RBD reconstructions for Sarbecovirus Clades 1-3 or the overall ancestral RBD sequence. The ChAd-Sarbeco RBD and ChAd-empty vectors were rescued by transfection and were scaled up in HEK-293 cells (ATCC, CRL-1573). Vectorcontaining cell lysates were purified by CsCI density gradient ultracentrifugation, and viral particle concentrations were determined by spectrophotometry at 260 nm.

[0175] Recovery of chimeric VSV. Chimeric VSV viruses expressing spike proteins corresponding to the SARS-CoV-2 Wuhan-1 virus, variant strain B.1.351 , or other coronaviruses including Pang / GD, SARS-CoV, or RaTG13 were produced. The spike genes: SARS-CoV-2 (Wuhan-1 , GenBank MN908947.3; B.1.351 , GenBank 0X008568.1 ; Pangolin / GD (GenBank MT799524.1 ), SARS-CoV (GenBank JN854286.1 ), and RaTG13 (GenBank MN996532.1 ) were synthesized (Integrated DNA Technologies) and inserted into an infectious molecular clone of VSV. Modifications to the cytoplasmic tail (21 amino acid deletion) of the spike genes were used to promote secretion. Other VSV N, P, L and G expression plasmids were used to facilitate recovery. Briefly, BSRT7 / 5 cells were inoculated with vaccinia virus vTF7-3 and subsequently transfected with T7-expression plasmids encoding VSV N, P, L, and G, and an antigenomic copy of the viral genome. Cell culture supernatants were collected at 56-72 h, clarified by centrifugation at 1 ,000 x g for 5 min, and filtered through a 0.22 p m filter. Virus was plaque-purified on Vero CCL81cells in the presence of 25 pg / mL of cytosine arabinoside (Sigma-Aldrich). Viral stocks were amplified on MA104 cells at an MOI of 0.01 in Medium 199 containing 2% FBS and 20 mM HEPES pH 7.7 (Millipore Sigma) at 34°C. Viral supernatants were harvested upon extensive cytopathic effect and clarified by centrifugation at 1 ,000 x g for 5 min.

[0176] Biolayer interferometry. Biolayer interferometry (BLI) was used to quantify the binding capacity of inferred Clade 1 , 2, 3, or ancestral RBD proteins to hACE2-Fc. 10 pg / mL of hACE2-Fc was immobilized onto protein A biosensors (GatorBio #160001 ) for 3 min. After a 30 sec wash, the pins were submerged in running buffer (10 mM HEPES, 150 mM NaCI, 3 mM EDTA, 0.05% P20 surfactant, and 1 % BSA) containing Sarbeco RBDs ranging from 5.86 nM to 1500 nM, followed by a dissociation step in running buffer alone. The BLI signal was recorded and analyzed on a GatorPlus BLI instrument (GatorBio), with kinetic affinity constants estimated using a 1 :1 model.

[0177] Neutralization assay. Focus reduction neutralization tests (FRNTs) were performed. Briefly, serial dilutions of serum were incubated with 100 FFU of indicated authentic or chimeric viruses for 1 h at 37°C. Immune complexes were added to Vero-TMPRSS2 cell monolayers and incubated for 1 h at 37°C prior to the addition of 1 % (w / v) methylcellulose in MEM. Following incubation for 30 h at 37°C (SARS-CoV-2 D614G and VSV chimeras) or 72 h (EG.5.1 authentic virus) cells were fixed with 4% paraformaldehyde (PFA), permeabilized and stained for viral antigen with SARS2-02, -09, -11 , -31 , -38, -49, -57, -62, and -71 ) of anti-S murine antibodies (including cross- reactive monoclonal antibodies to SARS-CoV) and HRP-conjugated goat antimouse IgG (Sigma-Aldrich, A8924, RRID: AB_258426) in PBS supplemented with 0.1 % saponin and 0.1 % BSA. SARS-CoV-2-infected cell foci were visualized using TrueBlue Peroxidase Substrate (KPL) and quantitated on an ImmunoSpot microanalyzer (Cellular Technologies). Serum end-point dilutions were calculated using Prism Software (GraphPad Prism 10).

[0178] Measurement of viral RNA. On the indicated day post-infection, mice were euthanized, and organs were collected. Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche LifeScience) in 1 mL of DMEM medium supplemented with 2% heat inactivated FBS. Tissue homogenates were clarified by centrifugation at approximately 10,000 x g for 5 min and stored at -80 °C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Fisher Scientific) on the Kingfisher Flex extraction robot (Thermo Fisher Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (Thermo Fisher Scientific). Reverse transcription was carried out at 48 °C for 15 min followed by 2 min at 95 °C. Amplification was accomplished over 50 cycles as follows: 95 °C for 15 s and 60 °C for 1 min. Copies of SARS-CoV-2 or SHC014 N gene RNA in samples were determined using a previously published assay or modified form, respectively. For each, a TaqMan assay was designed to target a highly conserved region of the N gene SARS-CoV-2 strains: Forward primer: ATGCTGCAATCGTGCTACAA, SEQ ID NO:7; Reverse primer: GACTGCCGCCTCTGCTC, SEQ ID NO:8; Probe: / 56- FAM / TCAAGGAAC / ZEN / AACATTGCCAA / 3IABkFQ / and SHC014: Forward primer: TTGGCACCCGCAATCCTAATA, SEQ ID NO:9; Reverse primer: GACTGCCGCCTCTGCTC, SEQ ID NO: 10; Probe: / 56- FAM / TCAAGGAAC / ZEN / AACATTGCCAA / 3IABkFQ / . For both, the respective N region was included in an RNA standard to allow for copy number determination down to 10 copies per reaction. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.

[0179] Virus plaque assay. Vero-TMPRSS2-hACE2 (SARS-CoV-2) or Vero E6 (SHC014, SARS-CoV / MA15, and Pangolin / GD) cells were seeded at a density of 1 x 105 cells per well in 24-well tissue culture plates. The following day, medium was removed and replaced with 200 pL of homogenate to be titrated diluted serially in DMEM supplemented with 2% FBS. One hour later, 1 mL of methylcellulose overlay was added. Plates were incubated for 72 h, then fixed with 4% paraformaldehyde (final concentration) in PBS for 20 min. Plates were stained with 0.05% (w / v) crystal violet in 20% methanol and washed twice with distilled, deionized water prior to plaque enumeration.

[0180] ELISA. The indicated recombinant proteins were coated onto 96-well Maxisorp plates (ThermoFisher) at a concentration of 2 pg / mL in 50 mM Na2CO3 pH 9.6 overnight at 4 °C. Upon coating buffer removal, plateswere washed with PBS + 0.05% Tween-20 (PBST) and blocked with PBS + 2% BSA (blocking buffer) for 2 h at 37 °C. Blocking buffer was removed from each plate and sera that were serially diluted in blocking buffer were added. For IgG detection, plates were incubated for 1 h at room temperature (RT) and then washed 3 times with PBST, followed by the addition of 50 pL of 1 : 1000 anti-mouse IgG-HRP (Sigma-Aldrich, Cat. #A5278) diluted in blocking buffer. For IgA detection, plates were incubated overnight at 4 °C and then washed 3 times with PBST, followed by the addition of 50 pL of 1 : 1000 anti-mouse IgA (Southern Biotech, Cat. #1040-05) diluted in blocking buffer. Following a 1 h incubation of detection antibodies at RT, plates were washed 3 times with PBST and developed by adding 100 pL of 1-Step Ultra TMB-ELISA (ThermoFisher, Cat. #34028) to each well. Reactions were stopped by adding 50 pL of 2 M H2SO4. Optical density (OD) measurements were taken at 450 nm using a microplate reader (Biotek). The endpoint serum dilution was calculated with curve fit analysis of the OD values for each serum dilution series using a cut-off value set to the mean plus two times the standard deviation of the background signal.

[0181] Animal experiments. For CD4+ (anti-mouse CD4, clone GK1.5; BioXCell #BE0003-1 ) and / or CD8+ (anti-mouse CD80, clone Lyt 3.2; BioXCell #BE0223) T cell depletion experiments, the treatment schedule is outlined in FIG. 4E. Briefly, four-week-old female mice were administered 250 pg IP and 10 pg IN of the indicated monoclonal antibody at specified timepoints. For convalescent BA.2 experiments, a 104 FFU dose of BA.2 was administered IN. For Sarbeco RBD vaccination experiments, 1010 viral particles of the indicated vaccine or 3.33 x 109 viral particles each of Sarbeco RBD-Clade 1 , -Clade 2, and -Clade 3 were administered. For all IN procedures, animals were anesthetized with ketamine and xylazine. To discriminate between circulating and extravascular immune cells, 2 pg of anti-mouse CD45-BV605 (clone 30- F11 , BioLegend) was administered intravenously to anesthetized mice, which were sacrificed three minutes later. For BALF collection, animals anesthetized with ketamine and xylazine were placed in the supine position and a plastic catheter was inserted into the trachea. Fluid was collected by administering 1 mL of PBS followed by aspiration. Cells were pelleted by centrifugation at 600x g for 5 min and resuspended in cold FACS wash. Lungs from immunized mice were collected, placed on ice in DMEM supplemented to contain 10% FBS, minced with scissors, passed through 70-pm cell strainers, and the cell suspensions were digested in HBSS containing 25 pg / ml DNase I (Roche, 11284932001 ) and 50 pg / ml Liberase (Roche, 5401119001 ) for 30 min at 37 °C. Subsequently, following hypotonic erythrocyte lysis, single cells were separated by passage through 70-pm cell strainers for a second time.

[0182] Flow cytometry. Single cell suspensions of the harvested tissues were plated in 96-well V-bottom plates and pelleted by centrifugation at 500 x g for 5 min at 4 °C. Prior to surface staining, pelleted cells were resuspended in 50 pl of FACS buffer containing FcyR antibody (clone 93, BioLegend) and Fixable Viability Dye eFluor 506 and incubated for 15 min at 4 °C.Subsequently, cells were washed twice with FACS buffer and resuspended in 50 pl of FACS buffer containing a cocktail of fluorophore-labeled monoclonal antibodies dependent upon experimental staining scheme including, CD45- Pacific Blue (clone 104, BioLegend), CD4-Alexa Fluor 700 (clone RM4-4, Biolegend), CD4-PE (clone RM4-4, BioLegend), CD8a-FITC (clone 53-6.7, BioLegend), CD8a-PerCP / Cyanine 5.5 (clone 53-6.7, BioLegend), CD69-APC- Cy7 (clone H1.2F3, BioLegend), and CD103-APC (clone 2E7, Biolegend). Cells were stained for 45 min at 4 °C, washed twice with FACS buffer, and fixed with 2% paraformaldehyde for 20 min prior to data acquisition. Data were acquired on an Aurora (Cytek) spectral flow cytometer and analyzed with FlowJo v10 software.

[0183] Ex vivo T cell restimulation. The CD8 peptide megapool was designed based on the Sarbeco RBD sequences and a specific T cell prediction using NetMHCpan 4.1 algorithm implemented by the lEDB’s analysis resource. Class I, 9-mer peptide sequences were considered binders to a corresponding allele using a percentile score < 2 as a threshold, as previously reported. The peptide set includes the historical WA1 / 2020 peptide and its homologous variants conserved in one to three of the Sarbeco clades predicted for H-2-IAb and H-2 Db / Kb for a total of 135 unique peptides. Peptides were then synthetized by TC Peptide Lab (San Diego) and sequentially lyophilized to generate the peptide pool as previously described.The resulting lyopcake was resuspended in DMSO at a concentration of 1 mg / mL as stock concentration.

[0184] Splenocytes from IM-IN vaccinated mice were incubated in culture with the Sarbeco RBD peptide pool at a final concentration of 1 pg / mL for 20 h at 37°C in RPMI supplemented to contain 10% FBS, 1 % HEPES, 1% penicillin / streptomycin, and 5 pg / mL brefeldin A (BioLegend, 420601 ). To stop stimulation, cells were transferred to 96-well V-bottom plates and washed twice with cold FACS wash. Cells were surface stained as detailed above followed by fixation and permeabilization with the Foxp3 / Transcription Factor Staining Buffer Set (eBiosciences, 00-5523) following the manufacturer’s instructions. Subsequently, intracellular staining was performed with anti-IFN-y Alexa 647 (BD Biosciences, clone XMG1.2) anti-TNFa PE-Cy7 (BioLegend, clone MP6- XT22). Data were acquired on an Aurora (Cytek) spectral flow cytometer and analyzed with FlowJo v10 software.

[0185] Multiplexed bead binding assay. Recombinant biotinylated spike and RBD proteins from Wuhan-1 , B.1 .351 , RaTG13, SHC014, Rs4081 , Pangl 7, RmYN02, Rf1 , WIV1 , and XBB.1 .16 or BSA detailed above were incubated with different fluorescence intensity peaks of the SPHERO Streptavidin fluorescent yellow particles (Spherotech, Cat. #SVFA-2552-6K and SVFB-2552-6K) at 10 ng per pg beads for 30 min at room temperature on an end-over-end mixer. Free biotin (Avidity, Cat. #BIO200) was added to the beads at 5 pM and incubated for 15 min at room temperature. Beads of different intensity and loaded with different proteins were then pooled and washed with PBS supplemented with 2% FBS, 2 mM EDTA, and 0.1% sodium azide (FACS buffer), mixed with 1 :100 diluted serum samples and incubated for 30 min at RT. Beads were washed twice with FACS buffer and stained with a mixture of anti-mouse IgG Alexa Fluor™ 647 (ThermoFisher, Cat. #A-21235, 1 :1000) 30 min at room temperature in dark. After two washes with FACS buffer, beads were resuspended in FACS buffer and samples were analyzed on a Cytek Aurora flow cytometer. Population gating and analysis of fluorescence intensity were performed with FlowJo software (BD Biosciences). The average geometric mean fluorescence intensity of no-serum control wells was defined as the background signal. Background subtracted fluorescenceintensity of samples was divided by naive control sera binding values to obtain the fold-change over control.

[0186] Antibody isotype and Fc-receptor binding profiling. Serum samples were analyzed using a custom Luminex assay to quantify the levels of antigenspecific antibody subclasses and FcyR binding profiles. Briefly, antigens were coupled to magnetic Luminex microspheres (Luminex Corp) by carbodiimide- NHS ester coupling (Thermo Fisher). The antigen-coupled microspheres were blocked for 30 min and washed with 1X assay buffer (1X PBS pH = 7.4, 0.1 % BSA, and 0.05% Tween-20) for a total of three washes. Microspheres were then incubated with heat-inactivated serum samples (56°C for 1 h) at an appropriate sample dilution (1 :100-1 :400 for antibody isotyping and 1 : 1 ,000 for all low-affinity FcyRs) overnight in 384-well plates with continuous shaking (Greiner Bio-One). Unbound antibodies were washed away using the magnetic 384-well HydroSpeed Plate Washer (Tecan) using 1 x assay buffer for a total of three washes. Secondary antibodies (Southern Biotech; PE-coupled anti-lgG1 , lgG2b, lgG2c, lgG3, IgM, and IgA) were added at a 1 :500 dilution in 1X assay buffer and incubated for 1 h at room temperature with continuous shaking. Unbound complexes were washed away using the magnetic 384-well Hydrospeed Plate Washer for a total of three washes. Beads were resuspended in 40 pl of QSOL buffer (Sartorius) and then run on the iQue Screener PLUS (Intellicyt) using a customized gating strategy for each bead region. Median fluorescence intensity was calculated for all samples, which were run in technical replicates.

[0187] For FcyR binding, sera were incubated with antigen-coated microspheres and washed as described above. Custom synthesized FcyRs (FcyR lib, FcyR III, and FcyR IV; Duke Protein Production facility) were biotinylated and then bound to PE-streptavidin. The labeled FcyRs were then diluted in 1X assay buffer and incubated with the microspheres for 1 h at room temperature with continuous shaking. Unbound complexes were washed as indicated above. Beads were resuspended in 40 pl of QSOL buffer and then run on the iQue Screen PLUS (Intellicyt). Results were analyzed using Intellicyt ForeCyt (v8.1 ).

[0188] All antigens and FcyRs were equilibrated in 1 x PBS using Zeba- Spin desalting and size exclusion chromatography columns (Thermo Fisher) before bead coupling. Dilution curves for each antibody isotype and subclass and FcyRs were performed for each antigen to ensure reported values were within the linear range of detection. Binding for antigens was calculated as the fold-increase relative to naive levels, which arbitrarily were set to 1 .

[0189] Antibody-dependent complement deposition (ADCD). Complement deposition in response to binding of antigens was determined through a multiplexed assay similar to the antibody binding array. After the formation of pre-immune complexes on microspheres, guinea pig C3 was added to the wells and incubated at 37°C for 50 min. Reactions were stopped through the addition of 15 mM EDTA. Relative amounts of C3 deposition were quantified through the addition of anti-C3-FITC.

[0190] Antibody-dependent cellular phagocytosis (ADCP). Murine monocyte cell line J774A.1 (ATCC) was maintained in DMEM supplemented with 10 % FBS and 1X Pen / Strep solution. 96-well plates were seeded at concentration of 25,000 cells / well. Pre-immune complexes were formed via the incubation of heat-inactivated serum samples with antigens coupled to fluorescent neutravidin microspheres at a 1 :50 dilution for 2 h at 37°C.Complexes were washed 3 times with 1X assay buffer and then incubated with the cells overnight at 37°C at 5% CO2. Cells were trypsonized and fixed with 4% paraformaldehyde and washed 3 times with 1X PBS to remove nonopsonized material. Phagocytosis was quantified on the iQue Screener PLUS (Intellicyt) by gating for fluorescent cells. Antibody-dependent neutrophil phagocytosis (ADNP) was done similarly with the exception that the uptake step was done for 2 h at 37°C and 5% CO2 instead of overnight. ADNP was quantified by the fluorescence of the gated neutrophils.

[0191] Histopathology. Animals were euthanized before harvest and fixation of tissues. Briefly, lungs were inflated with approximately 1.2 mL of 4% paraformaldehyde using a 3 mL syringe and catheter inserted into the trachea. Tissues were allowed to fix for 24 h at room temperature, embedded in paraffin, and sections were stained with hematoxylin and eosin. Slides werescanned using a Hamamatsu NanoZoomer slide scanning system, and the images were viewed using NDP view software (ver.1 .2.46).

[0192] Cytokine and chemokine measurements. Lung homogenates were incubated with Triton-X-100 (1 % final concentration) for 1 h at room temperature to inactivate SARS-CoV-2. Homogenates were analyzed for cytokines and chemokines by Eve Technologies Corporation (Calgary, AB, Canada) using their Mouse Cytokine Array / Chemokine Array 31-Plex (MD31 ) platform.

[0193] Statistical Analysis. All statistical tests were performed using Prism v10.0. Statistical significance was determined using a one-way ANOVA when comparing three or more groups. When comparing two groups, a two-tailed Mann-Whitney test was performed. Weight loss statistical significance was determined using Brown-Forsythe and Welch’s ANOVA tests of AUC. The number of independent experiments performed is indicated in the figure description.

Claims

CLAIMSWhat is claimed is:1 . A composition comprising a nucleic acid molecule comprising: a nucleic acid encoding at least a portion of the genome of an adenovirus; and at least a portion of at least one phylogenetically inferred receptor binding domain (RBD) sequence from a Sarbecovirus clade or an immunogenic portion, variant, mutant, or fragment thereof.

2. The composition of claim 1 , wherein the adenovirus is a Simian adenoviral vector.

3. The composition of claim 2, wherein the Simina adenoviral vector is a Simian Ad36 vector (ChAd).

4. The composition of claim 1 , wherein the adenovirus has been modified such that the adenovirus lacks at least the native E1 locus and optionally the E3 or E3B locus.

5. The composition of claim 1 , wherein the RBD sequence from the Sarbecovirus clade is selected from a Sarbecovirus clade 1 RBD sequence, a Sarbecovirus clade 2 RBD sequence, a Sarbecovirus clade 3 RBD sequence, and any combination thereof.

6. The composition of claim 5, wherein the RBD sequence comprises an equal ratio of the Sarbecovirus clade 1 RBD sequence, Sarbecovirus clade 2 RBD sequence, and Sarbecovirus clade 3 RBD sequence (Sarbeco RBD Mix).

7. A method of preventing or reducing a Sarbecovirus infection, the method comprising administering at least one dose of a therapeutically effective amount of a nucleic acid molecule comprising: a nucleic acid encoding at least a portion of the genome of an adenovirus; and at least a portion of at least one phylogenetically inferred receptor binding domain (RBD) sequence from a Sarbecovirus clade or an immunogenic portion, variant, mutant, or fragment thereof.

8. The method of claim 7, wherein preventing or reducing the Sarbecovirus infection comprises limiting symptomatic infections, limiting severe disease, reducing hospitalizations, increasing protective immunity, and increasing upper and lower respiratory protection.

9. The method of claim 7, wherein the adenovirus is a Simian adenoviral vector.

10. The method of claim 9, wherein the Simina adenoviral vector is a Simian Ad36 vector (ChAd).11 .The method of claim 7, wherein the adenovirus has been modified such that the adenovirus lacks at least the native E1 locus and optionally the E3 or E3B locus.

12. The method of claim 7, wherein the Sarbecovirus is selected from a Sarbecovirus clade 1 RBD sequence, a Sarbecovirus clade 2 RBD sequence, a Sarbecovirus clade 3 RBD sequence, and any combination thereof.

13. The method of claim 7, wherein administration of the nucleic acid molecule comprises intramuscular (IM) and intranasal (IN) administration.

14. The method of claim 7, wherein administration of the therapeutically effective amount of the nucleic acid molecule comprises administration of a first prime dose and a second booster dose.

15. The method of claim 14, wherein administration of the first prime dose is selected from IM administration and IN administration.

16. The method of claim 14, wherein administration of the second booster dose comprises IN administration.

17. The method of claim 14, wherein the second booster dose is administered 3 weeks after the first prime dose.

18. The method of claim 7, wherein the nucleic acid molecule is administered at the dose of 107to 1011viral particles.

Images