PARP-regulated proteogenomic reprogramming to a functionally totipotent human blastomere-like state

Abstract

The present disclosure relates to methods for generating progenitors functionally totipotent blastomere-like stem cells via P ARP -regulated proteomic reprogramming of a PARP- DUX4-NAN0G regulatory axis of conventional human induced pluripotent stem cells (hiPSC) by chemically reverting them to tankyrase / PARP1 inhibitor-regulated naive (TIRN) human stem cells and methods and compositions useful for generating chimeras using such human induced totipotent TIRN stem cells. In certain embodiments, the TIRN stem cells are engineered to express a cell adhesion molecule (e.g., E-Cadherin) or DUX4.

Description

[0001] P ARP-REGULATED PROTEOGENOMIC REPROGRAMMING TO A FUNCTIONALLY TOTIPOTENT HUMAN BLASTOMERE-LIKE STATE

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0003] This invention was made with government support under grant R01EY032113 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS

[0005] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 653,962 filed May 30, 2024, the content of which is incorporated by reference in its entirety, and to which priority is claimed.

[0006] 1. FIELD OF INVENTION

[0007] The present disclosure relates to methods for generating functionally human totipotent blastomere-like stem cells with efficient in vivo embryonic and extra-embryonic differentiation potential, generated via PARP -regulated proteogenomic reprogramming of conventional human induced pluripotent stem cells (hiPSC) to tankyrase / PARPl inhibitor- regulated naive (TIRN) stem cells and methods and compositions useful for generating interspecific human-animal chimeras using such induced totipotent TIRN stem cells.

[0008] 2, BACKGROUND

[0009] PARP1 and TNKS1 / 2 are PARP family enzymes that catalyze post- translational poly-ADP -ribose (PAR)ylation of protein substrates and play formative roles in regulating chromatin structure, transcription, and ubiquitination in not only adult cells, but also during embryonic development. Chemical inhibition of PARylation impairs the homeostasis and progression of preimplantation embryonic development; failure to degrade PAR is embryonic lethal. TNKS1 / 2 activity controls developmental progression of zygotic genome activation (ZGA), and PARP1 regulates histone ubiquitination, DNA methylation, RNA processing, DNA repair during ZGA, cellular reprogramming, pluripotency, trophoblast specification and chromatin plasticity during preimplantation embryogenesis. Although loss of a single PARP protein minimally impairs development (suggesting redundancy of PARP proteins), compound TNKS1 / TNKS2 and PARP1 / PARP2 knockouts, or dominant-negative PARP1 are embryonic lethal.

[0010] Several studies have employed chemical PARP inhibition to expand pluripotency and improve the chimeric contribution of mouse embryonic stem cells (mESC) into embryos, or to improve functional pluripotency. For example, Zimmerlin et al., Development 143:4368-1380, demonstrated that primed, conventional human pluripotent stem cells (hPSC) were chemically reverted to a naive epiblast-like pluripotent state with improved differentiation potential via a two-step chemical reprogramming system that comprised of sequential culture with LIF and five small molecules (i.e., Hedgehog signaling activation, cAMP agonism, GSK3P inhibition, MEK inhibition, and nonspecific TNKS1 / TNKS2 / PARP1 inhibition (XAV939). There has not, however, been a demonstration in the art of any cultured, self-renewing human stem cell with clonal blastomere-like molecular phenotype and actual totipotent functionality in vivo. Furthermore, it has not yet been demonstrated that a stem cell can be epigenetically reprogrammed from one developmental state to a more primitive one by reprogramming its post-translational proteome (i.e., global changes in ADP-ribosylation and ubiquitination) via non-specific PARP inhibition of both tankyrase and PARP1 proteins.

[0011] 3, SUMMARY

[0012] In certain embodiments, the presently disclosed subject matter provides methods for generating functionally totipotent blastomere-like stem cells via a method that reprograms post-translational modifications (i.e., global reprogramming of ADP- ribosylation and ubiquitination sites of hundreds of PARP protein targets in the whole proteome of conventional hiPSCs), comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a non-specific tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of hiPSCs to express a cell adhesion molecule. In certain embodiments, the method comprises contacting a population of hiPSCs with a non-specific tankyrase 1 (TNKS), tankyrase 2 (TNKS2) and PARP1 (Tankyrase / PARPl) inhibitor-containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the method comprises contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the method comprises comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl - inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen- activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the method comprises contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARP 1 inhibitor.

[0013] In certain embodiments, the tankyrase / PARPl inhibitor is selected from: XAV939, IWR-1, G007-LK, JW55, AZ1366, JW 74, NVP-TNKS656 and combinations thereof. In certain embodiments, the GSK3P signaling pathway inhibitor is selected from: 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)-2- pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR 99021), 5-Ethyl-7,8- dimethoxy-lH-pyrrolo[3,4-c]isoquinoline-l,3(2H)-dione (3F8), l-(7-Methoxyquinolin-4- yl)-3-[6-(trifluoromethyl)pyridin-2-yl]urea (A 1070722), N6-[2-[[4-(2,4-Dichlorophenyl)- 5-(lH-imidazol-l-yl)-2-pyrimidinyl]amino]ethyl]-3-nitro-2,6-pyridinediamine (CHIR 98014), lithium chloride (LiCl), 4-benzyl-2-methyl-l, 2, 4-thiadiazolidine-3, 5-dione (TDZD-8), 5-iodo-indirubin-3 '-monoxime (I3'M), N-(4-methoxybenzyl)-N'-(5-nitro-l,3- thiazol-2-yl)urea (AR-A014418) and combinations thereof. In certain embodiments, the MEK signaling pathway inhibitor is selected from: PD032590, CI-1040 (PD184352), cobimetinib (GDC-0973, XL518), Selumetinib (AZD6244), MEK 162, AZD8330, TAK- 733, GDC-0623, Refametinib (RDEA119; BAY 869766), Pimasertib (AS703026), RO4987655 (CH4987655), RO5126766, WX-554, HL-085 and combinations thereof. In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises a protein kinase C (PKC) inhibitor. In certain embodiments, the PKC inhibitor is Go6983.

[0014] In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises a Hedgehog signaling pathway activator. In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises a cAMP agonist. In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises: a) a Hedgehog signaling pathway activator; and b) a cAMP agonist. In certain embodiments, the Hedgehog agonist is purmorphamine. In certain embodiments, the cAMP agonist is forskolin. In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor- containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the tankyrase / PARPl inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: XAV939, IWR-1, G007-LK, JW55, AZ1366, JW 74, NVP- TNKS656 and combinations thereof. In certain embodiments, the GSK3P signaling pathway inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)-2- pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR 99021), 5-Ethyl-7,8- dimethoxy-lH-pyrrolo[3,4-c]isoquinoline-l,3(2H)-dione (3F8), l-(7-Methoxyquinolin-4- yl)-3-[6-(trifluoromethyl)pyridin-2-yl]urea (A 1070722), N6-[2-[[4-(2,4-Dichlorophenyl)- 5-(lH-imidazol-l-yl)-2-pyrimidinyl]amino]ethyl]-3-nitro-2,6-pyridinediamine (CHIR 98014), lithium chloride (LiCl), 4-benzyl-2-methyl-l, 2, 4-thiadiazolidine-3, 5-dione (TDZD-8), 5-iodo-indirubin-3 '-monoxime (I3'M), N-(4-methoxybenzyl)-N'-(5-nitro-l,3- thiazol-2-yl)urea (AR-A014418) and combinations thereof. In certain embodiments, the MEK signaling pathway inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: PD032590, CI-1040 (PD184352), cobimetinib (GDC-0973, XL518), Selumetinib (AZD6244), MEK162, AZD8330, TAK-733, GDC-0623, Refametinib (RDEA119; BAY 869766), Pimasertib (AS703026), RO4987655 (CH4987655), RO5126766, WX-554, HL-085 and combinations thereof. In certain embodiments, the method further comprises culturing the hiPSCs in contact with the second tankyrase / PARPl inhibitor-containing composition for 1 to 10 passages.

[0015] In certain embodiments, the methods further comprise contacting the population of hiPSCs with a non-human embryo to form a chimera. In certain embodiments, the chimera is a human-murine chimera. In certain embodiments, the methods further comprise culturing the population of hiPSCs under conditions for forming an organ. In certain embodiments, the organ is a liver, kidney, heart, brain, eye / retinal, placenta, whole lympho-hematopoietic system, or other organ. In certain embodiments, the method further comprises culturing the population of hiPSCs under conditions for forming an embryo.

[0016] In certain embodiments, the cell adhesion molecule is human or murine. In certain embodiments, the cell adhesion molecule is cross-species adhesion molecule. In certain embodiments, the cross-species adhesion molecule is a human-murine cross-species molecule. In certain embodiments, the cell adhesion molecule is a cadherin. In certain embodiments, the cadherin is E-Cadherin. In certain embodiments, the cadherin is murine E-Cadherin.

[0017] In certain embodiments, the hiPSCs are derived from primed hiPSCs. In certain embodiments, priming of hiPSCs comprises contacting the hiPSCs with a serum replacer-containing media. In certain embodiments, priming the hiPSCs comprises contacting the hiPSCs with a ROCK inhibitor. In certain embodiments, the ROCK inhibitor is Y-27632. In certain embodiments, the population of progenitor cells are generated from a population of HLA-defined hiPSCs. In certain embodiments, the population of HLA- defined hiPSCs comprise human CD34+ cord blood cells.

[0018] In certain embodiments, the method further comprises performing feeder- free (FF) and xeno-free (XF) culture of the hiPSCs to generate a population of these progenitor cells under clinical grade, cGMP-compliant conditions. In certain embodiments, the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitorcontinuing composition comprises culturing the hiPSCs on vitronectin-coated substrates. In certain embodiments, the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition is performed for 1 to 10 passages. In certain embodiments, passages 1-3 of the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition comprise selection of dome-shaped colonies for each subsequent passage. In certain embodiments, the method further comprises culturing the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition for 1 to 10 passages. In certain embodiments, the method further comprises culturing the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition for 1 passage.

[0019] In certain embodiments, the presently disclosed subject matter provides methods for generating a population of functionally totipotent blastomere-like human stem cells comprising contacting a population of conventional human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of hiPSCs to express DUX4. In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor- containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl - inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen- activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4.

[0020] In certain embodiments, the presently disclosed subject matter provides methods for generating a population of progenitor cells, comprising contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs to express a cell adhesion molecule. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl - inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen- activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the iPSCs are derived from somatic cells. In certain embodiments, the iPSCs are derived from a non-human animal. In certain embodiments, the non-human animal is a domestic animal. In certain embodiments, the non- human animal is an endangered species of animal. In certain embodiments, the methods further comprise culturing the population of iPSCs under conditions for forming an organ or differentiated tissues. In certain embodiments, the organ is a liver, kidney, heart, brain, eye / retinal, placenta, whole lympho-hematopoietic organ system, and other organs. In certain embodiments, the cell adhesion molecule is human, murine, porcine, or non-human primate.

[0021] The method of claim 47, wherein the cell adhesion molecule is cross-species adhesion molecule. In certain embodiments, the cross-species adhesion molecule is a human-murine cross-species molecule. In certain embodiments, the cell adhesion molecule is a cadherin. In certain embodiments, the cadherin is E-Cadherin. In certain embodiments, the cadherin is murine E-Cadherin.

[0022] In certain embodiments, the presently disclosed subject matter provides methods for generating a population of progenitor cells, comprising contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs to express DUX4. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs to express DUX4. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor- containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4.

[0023] In certain embodiments, the presently disclosed subject matter provides methods for cloning a non-human species, comprising: a) obtaining a population of nonhuman induced pluripotent stem cells (iPSCs); and b) generating a population of functionally totipotent blastomere-like stem cells, comprising contacting the non-human iPSCs with a tankyrase / PARPl -inhibitor-containing composition comprising: i) leukemia inhibitory factor (LIF); ii) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; iii) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and iv) a tankyrase / PARP 1 inhibitor; and c) transferring the population of functionally totipotent blastomere-like stem cells to an animal uterus. In certain embodiments, the population of functionally totipotent blastomere-like stem cells possesses efficient in vivo embryonic and extra-embryonic differentiation potential. In certain embodiments, the efficient in vivo embryonic and extra-embryonic differential potential is mediated via PARP -regulated proteogenomic reprogramming of a DUX4-NAN0G epigenetic regulatory axis, via tankyrase / PARPl -regulated reprogramming of conventional human induced pluripotent stem cells (hiPSC) to tankyrase / PARPl inhibitor-regulated naive (TIRN) stem cells. In certain embodiments, the non-human iPSCs are produced from somatic cells. In certain embodiments, the somatic cells comprise skin cells, blood cells, or a combination thereof. In certain embodiments, the non-human species is a domestic animal, a pet species, or an endangered animal. In certain embodiments, the non-human species is genetically modified.

[0024] In certain embodiments, the presently disclosed subject matter provides methods for producing extraembryonic tissue, comprising generating a population of functionally totipotent blastomere-like stem cells, comprising contacting iPSCs with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and culturing the population of induced totipotent TIRN stem cells under conditions for forming an organ. In certain embodiments, the organ comprises placental tissues. In certain embodiments, the iPSCs are human iPSCs. In certain embodiments, the iPSCs are non-human iPSCs.

[0025] 4, BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figures 1A-1H depict the activation of human cleavage stage embryonic expression programs in TIRN stem cells. Figure 1A shows Western blot analysis of phosphorylated (p) and total (t) STAT3 and ERK1 / 2 in isogenic primed (P) vs TIRN (T) stem cells. Figure IB shows Volcano plot showing log2 fold change (FC>1.5; p<0.05) RNA expression highlighting only differentially expressed transcriptional regulators between TIRN (red) vs. primed hPSC (n=8 independent cell lines); all other genes are greyed. Figure 1C shows heatmaps of RNA seq data (FPKM) comparing the most significantly expressed (FC>1.5, adjusted p-value <0.05) transcriptional regulators (Lambert et al., 2018) (n=392 genes) in 8 isogenic primed (P) and TIRN (T) hPSC lines expressed during indicated human preimplantation stages. Correlative expression of same genes from human embryo translatome data at indicated stages (FPKM) is shown on the left heatmap as control. Figure ID shows MA plot showing bulk RNA expression in paired T (red) and P (blue) stem cells (n=8). Colored dots show transcription factors with a promoter (±3 kb) bound by the pioneer factor DUX4 with the most significant expression (fold change >1.5, p < 0.05). Figure IE shows MA plot showing expression of transposable elements (TE) in T (red) and P (blue) stem cells (colored dots represent TE with the most significant expression (fold change >1.5, p < 0.05). Figure IF shows Western blot analysis of DUX4 protein expression in control testis (Te), primed (P) and TIRN (T) lysates using antibodies that recognize homodimer or monomer isoforms. Figure 1G shows Crossplot of log2 fold change (FC) of RNA-seq (x- axis; RNA) vs whole proteome (y-axis; PROTEIN) data showing significantly expressed (FC>1.2, q<0.05) proteins in TIRN (T; red, 961 proteins) vs primed (P; blue, 992 proteins) hPSC (n=3-6 replicates for each condition). Figure 1H shows Western blot confirmation of selected proteome findings of core pluripotency (NANOG, OCT3 / 4), 8C-specific (GATA6) trophectoderm-specific (CDX2, TFAP2C) and naive epiblast-specific (DNMT3L, SP5) proteins overexpressed in TIRN cells.

[0027] Figures 2A-2G depict the reinforcement of a totipotent-like expression signature in TIRN stem cells following iDUX4 transgene expression. Figure 2A shows experimental design of 4 conditions to assess the contribution of transgenic inducible DUX4 expression (iDUX4): primed (P, blue), primed + iDUX4 (PD, purple), TIRN (T, red) and TIRN+ iDUX4 (TD, green) cells. Figure 2B shows Euler diagram of number of differentially upregulated genes from primed hPSC (n=3; fold change (FC) >1.5, p<0.05) in PD (purple; n=3), T (red; n=6) and TD (green; n=6) samples. Expression of iDUX4 in primed cells (PD) had a more limited impact than in TIRN cells (TD); TIRN conditions (T) had a strong overlap with TD-expressing cells. Figure 2C shows heatmap of RNA-seq data (regularized log counts) for mean expression in all 4 conditions split by gene expression modules that define the E3 (8C), E4-E5 / early pre-lineage (cleavage-morula) stage and E5 / late-E7 epiblast stages in human embryos. Scaled mean-subtracted normalized count data is summarized as boxplots on right. *; ANOVA p<2e-16. Figure 2D shows heatmap of RNA-seq data (FPKM) for mean expression of transcriptional regulators in all 4 conditions split by gene expression modules that define the 2C-4C, 8C and naive inner cell mass (ICM) stages in human embryos. Scaled normalized count data is quantitated as boxplots, *; ANOVA p<2e-16. Figure 2E shows heatmap of RNA-Seq data (regularized log counts) for mean expression of pioneer factors in all 4 conditions split by transcription factor families for 2C-4C and 8C-morula stages. Although iDUX4 uniquely activated a small of subset of HOX-PRD factors in PD and TD conditions (dashed box), TIRN cells already expressed a broad repertoire of ZGA-Morula-specific pioneer factor genes; these expressions were further enhanced by iDUX4. Figure 2F shows differential expression analysis of proteomics data for 8C and naive ICM proteins in TIRN and TIRN + iDUX4 cells relative to primed control samples. TIRN cells expressed proteins identified in the translatome of early human embryos; that were further enhanced by iDUX4. Figure 2G shows Western blot protein confirmation of selected 8C / morula and naive ICM factors identified in whole proteomics experiments in P / PD / T / TD lysates. Figures 3A-3F depict scRNA-Seq analysis of TIRN cells + / - iDUX4 activation. Figure 3 A shows UMAP plot of scRNA-Seq data for primed (P), TIRN (T) and TIRN+ iDUX4 (TD) cells showed major overlap between T and TD conditions. Figure 3B shows UMAP plot of realigned (GRCh38) human embryo data with annotated E3-E7 stages, as shown. Figure 3C shows UMAP plots showing average expression levels for HOX-PRD, T-BOX and GATA gene families that are overexpressed in TIRN (red) or TIRN+iDUX4 (green) cells. Figure 3D shows Violin plots of single cell average expression levels for differentially expressed E3 / 8C specific pioneer HOX-PRD, GATA, FOX and T-BOX transcription factors families. Figure 3E shows UMAP plots of indicated human embryo stages, P vs T and P vs TD for average expression levels of most differentially T / TD expressed 8C-specific transcription factor genes; (n=l 13), E3 (8C-specific; purple; (n=128 genes), E4-E5 (pre-lineage morula-specific genes; orange; n=134) and E5-E6 (naive ICM- specific genes; maroon; n= 255 genes). Figure 3F shows UMAP plot showing log- normalized corrected counts for selected DUX4 targets GATA6, TPRXL, and TPRX1 in P vs T vs TD stem cells. Concordant bulk RNA-seq expression profiles show read signals at open reading frames for each gene in each condition.

[0028] Figures 4A-4K depict TIRN stem cell contribution of human embryonic and extraembryonic lineages in human-murine chimeras, and derivation of human TSCs with in vivo trophectoderm potential. Figure 4A shows quantitation of human cell contribution from TIRN-injected vs non-injected murine blastocysts in E9.5 and E14.5 human-murine fetal chimeras using human mitochondrial DNA-specific qPCR. Figure 4B shows qRT-PCR quantification of human-specific GAPDH RNA transcript expression in human DNA positive E9.5 human-murine chimeric embryos and non-injected controls. Figure 4C shows Whole mount immunofluorescent imaging of a representative E9.5 human-murine chimeric fetus showing detection of human (human nuclear antigen; HNA+)-expressing cells. Scale bar; 100 pm. Figure 4D shows immunofluorescent staining of HNA+P-Tubulin III (TUJ1)+ human neural cells in forebrain of E9.5 human-murine chimeric embryo. HNA+ cells were also detected sporadically in murine placenta (P). Scale bar; 100 pm. Figure 4E shows representative photomicrographs of HNA+ puromycin-resistant hematopoietic cells expanded and isolated from fetal livers of E12.5-E14.5 human-murine chimeric feti. Figure 4F shows FACS analysis of GFP, human CD34 and human CD45 expression in puromycin- resistant ex vivo hematopoietic explants from human-murine chimeras. Figure 4G shows Western blot analysis of NANOG, CDX2 and GATA3 protein expression in TIRN stem cells and TIRN-derived TSC. Primed hPSC are shown as control. TIRN-hPSC co-express NANOG and low levels CDX2. TIRN-TSC rapidly adopt a NANOG-CDX2+GATA3+ phenotype. Figure 4H shows clonal efficiency of TIRN-TSC derivation during the first passage in TSC conditions. Compared to primed hPSC, TIRN stem cells efficiently produced GATA3+ TSC colonies (1-3%) upon switching to TSC conditions. Figure 41 shows immunofluorescent phenotyping of established TIRN-hE SC -derived TSC. Representative colonies are shown after 8 passages and show uniform expression of CDX2, E-Cadherin, GATA3, ITGA6, CK7 and TEAD4. Figure 4J shows merged phase and fluorescent images of murine 8C embryos injected with tdTomato+ TIRN-derived TSC (arrows) following 4 and 30 hours in KSOM culture. Scale bars; 100 pm. Figure 4K shows phase and fluorescent photomicrographs of representative E7.5 mouse-human chimeras that resulted from injecting 5-10 td-Tomato+ human TSC in murine 8C embryos. Human TSC colonized exclusively the ectopiacental cone without evident engraftment in the murine epiblast (epi).

[0029] Figures 5A-5H depict direct single-cell contribution of TIRN cells to both embryonic and extraembryonic lineages in human-murine blastocyst and fetal chimeras. Figures 5A-5B show immunofluorescent cyto-staining of TIRN stem cells showing simultaneous protein co-expression of NANOG and CDX2 (Figure 5 A) and GATA6 and CDX2 (Figure 5B). Figure 5C show experimental schema for testing direct lineage contribution of pre-lineage TIRN cells with and without a murine E-Cad transgene. Figure 5D show percentage of blastocysts that developed 24 hours following injection of 8C-16C murine embryos with 5-7 Hoechst-labeled TIRN + / - mECad cells with either ICM-only or both ICM and trophectoderm (ICM+TE) engraftments in chimeric blastocysts. Figure 5E show confocal image of a hatching human-murine chimeric blastocyst ~30 hours following injection of TIRN cells into 4C-8C murine embryos showing merged (yellow) immunofluorescence of human HNA+ cells (red) in the ICM and hatching epiblast and CDX2+ in murine trophectoderm (green). Figure 5F show fluorescent detection of TIRN cell-derived tdTomato+ cells (red) in the extraembryonic placenta (left) and embryonic hematopoietic organs (fetal liver, FL; AGM region, arrow)) of a representative El 1.5 human-murine chimeric embryo. Figure 5G show robust fluorescent detection of tdTomato+ cells throughout a human-murine chimeric fetus shows broad contribution to rostral nervous system, thoracic and caudal structures. Figure 5H show quantitation of TIRN cell-derived tdTomato+ cells in chimeric embryos (Em) and placentae (P).

[0030] Figures 6A-6K depict dual inhibition of both TNKS and PARP1 activities in TIRN cells. Figure 6A shows Western blots of PARdU-regulated TNKS protein substrates: TNKS1 / 2, AXIN-1, and ANGIOMOTIN in primed (P) vs isogenic TIRN (T) cells. Figure 6B shows Western blots of total and activated (non-phosphorylated) P-catenin in (P) vs isogenic (T) cells within cytoplasmic (cyto), nuclear (nu) and membrane (mem) fractions. Figure 6C shows Western blots of input control and Afl521 resin pull-down lysates for TNKS1 / 2 protein expression in (P) and (T) cells. Figures 6D-6E show Western blots of lysates from input control and Afl521 macrodomain resin pull-downs in (P) vs (T) undifferentiated (0 hours) cells and at indicated timepoints following meso-endodermal differentiation (24, 48, 96 hours). Blots show total input, and ADP-ribosylated (Afl521 pull-down; dashed line boxes) and probing with anti -P ARP 1 (Figure 6D), and anti -PAR and anti -MAR antibodies (Figure 6E) (Poly- and mono- ADP-ribosylations; PAR, MAR, respectively). PAR, MAR are dramatically suppressed in TIRN cells (red dashed line box) compared to primed controls (blue dashed line box). Figure 6F shows Western blot analysis of DNA damage / oxidative stress responders: TNKS1 / 2, cleaved PARP1, and p53 proteins following oxidative stress conditions (H2O2 treatment) in (P) vs isogenic (T) cells. Figure 6G shows Western blot analysis of TNKS1 / 2, cleaved PARP1, p53 and DNA damage and repair-associated proteins in (P) vs isogenic (T) cells; with or without treatment with the radiomimetic DNA-damaging chemical NCS. Figure 6H shows Western blots of Afl521 resin pulldowns of all ADP-ribosylated proteins in lysates of (P) vs isogenic (T) cells; with or without treatment with NCS. Input controls are shown. PAR, MAR are dramatically suppressed in TIRN cells (red dashed line box) compared to primed controls (blue dashed line box). Blots revealed both ADP-ribosylated and non-ADP-ribosylated full length forms of PARP1, and its cleaved form (*). Notably, TIRN cells were reduced in detectable cleaved PARP1 (* lower band). Figure 61 shows relative TIRN / primed fold changes (FC) in protein expressions of indicated PARP proteins in primed (P; blue) vs TIRN (T; red) stem cells from proteomics data (** p<0.001; n=3 replicates). Figure 6J shows protein expression of PARPs during human early embryogenesis (translatome datasets (Zou et al., 2022) relative to hESC lines. Figure 6K shows heatmap of expression meta-analysis of PARP 1- / - vs WT mESC and (T) vs (P) from RNA-seq data; showing the intersection of human and orthologous mouse genes overexpressed (FC>1.5) in both TIRN and PARP -I- mESC, and correlation to human embryo translatome datasets (Zou et al., 2022).

[0031] Figures 7A-7I depict ChlP-Seq analysis of DUX4-accessible totipotent-like chromatin enhancer regions that co-bind NSO and PARP1. Figure 7A shows (Top) Euler diagram showing number of overlapping shared (purple), gained (red), and lost (blue) NANOG-SOX2-OCT4 (NSO) co-binding sites in TIRN (red) vs primed (blue) cells. (Bottom) Distribution histograms of average signal for PARP1 and DUX4 at co-bound TIRNNSO gained (red line) vs primed NSO lost (blue line) sites (recentered and normalized with DiffBind software, DUX4 signal obtained from hg38 realigned transgenic DUX4 datasets (Hendrickson et al., 2017)); averaged DUX4 signal is also shown at NSO sites within gene bodies (TSS: transcriptional start sites) of genes differentially overexpressed in TIRN cells (red), or primed hPSC (blue). Figure 7B shows scatter plot with averaged log- transformed concentrations (n=2 replicates per factor) at NSO co-bound sites (2552 differentially bound sites with highest confidence (FO2, FDR<0.05) are colored for TIRN gained (red) and primed lost (blue) sites). Pie chart shows percentage distribution of these 2552 sites co-bound by H3K27Ac at <3kb of TSS (proximal enhancer), or >3kb of TSS (distal enhancer). Figures 7C-7D show distribution histograms with averaged, normalized NANOG, SOX2, OCT4, and PARP1 read signals (red), centered on non-overlapping NSO TIRN-gained peaks (FO2, FDR<0.05) vs same locations in primed (blue) samples (Figure 7C). These significant 2552 TIRN-gained NSO sites possessed enriched PARP1 deposition, predominated at proximal and distal H3K27Ac-enriched enhancer regions, and were located at intronic and distal intergenic chromatin (Figure 7D). Figure 7E shows profile plots of averaged DUX4 ChlP-Seq binding scores centered at the 2552 TIRN-gained NSO sites (red) vs control DUX4-ChIP signal (black) (Hendrickson et al., 2017). Data is centered on NSO binding sites identified in adjoining plots. Figure 7F shows heatmaps of RNA-seq data for differentially expressed genes bound within 10 kb of TSS at TIRN-gained NSO-DUX4 regions (FO2, FDR<0.05). Select embryonic transcription factors are indicated. Figure 7G shows line plots with average ChlP-Seq signal for PARP1, H3K4me3, H3K27me3 and H3K27ac at gene bodies with NSO TIRN-gained sites (FO2, FDR<0.05) in TIRN and primed samples. Figure 7H shows dot plot of top enriched motifs (CentriMo) in NSO gained sites (FO2, FDR<0.05) ranked by expression level showing -loglO E-value (adjusted p- value using the binomial test multiplied by the number of identified motifs) with correlative relative expression (log2 fold change) for genes expressed in TIRN (red) and TIRN+iDUX4 (green) cells vs primed controls. Figure 71 shows Integrative Genomics Viewer snapshots of representative TIRN NSOP-associated HOXB cluster RNA-seq and ChlP-Seq tracks showing RNA expression signal in (T), (TD), (PD) and (P) samples and the averaged input- subtracted RPGC-normalized binding of H3K4me3, H3K27ac, NANOG, SOX2, OCT4 and PARP1 in TIRN (red) and primed (blue) samples. Averaged, and genome-aligned DUX4 signal from hg38 realigned DUX4-ChiP data (Hendrickson et al., 2017) is also shown (black). Boxed regions highlight novel TIRN NSOP-co-binding putative enhancer regions (enriched for H3K27Ac and H3K4me3).

[0032] Figures 8A-8G depict PARP1 / TNKS protein substrate expressions and reprogramming of the ubiquitinome in TIRN cells. Figure 8A shows Volcano plots show global proteome expressions of differentially expressed proteins (fold change > 1.2, p < 0.05, dashed lines) in TIRN (red), TIRN + iDUX4 (green) and primed+iDUX4 (purple) vs primed (blue) hPSC. Selected upregulated cleavage stage protein factors are listed. Figure 8B shows Cross plots of log2 fold change (FC) of RNA-seq (x-axis; RNA) vs whole proteome (y-axis; PROTEIN) data showing non-correlated (dashed lines) RNA / protein expressions of known TNKS and PARP substrates (protein FC>1.2, RNA FC < -1.5 or protein FC < -1.2, RNA FC > 1.5) in TIRN, TIRN+iDUX4 and primed+iDUX4 cells relative to primed controls. Representative proteins are indicated. Both TIRN conditions differentially express proteins with non-correlative RNA expression, suggesting post- translational stabilization or degradation mechanisms. Figure 8C shows Crossplot of ubiquitinome sites (x-axis UBQ) vs proteome (y-axis PROTEIN) relative expressions in TIRN (T) vs primed (P) cells show the most differentially ubiquitinated protein sites (dashed lines, FC>1.5). Hyper-ubiquitinated proteins and lysine sites of representative proteins in TIRN cells are indicated. Figure 8D shows Western blot analysis of total ubiquitinated proteins in primed (P) and TIRN (T) lysates. Figure 8E shows Cross plots of log2 fold change (FC) of RNA-seq (x-axis; RNA) vs whole proteome (y-axis; PROTEIN) data showing expression of ubiquitin machinery proteins. Significantly expressed proteins (FC>1.2, p<0.05) are indicated in red (TIRN) and blue (primed). Figure 8F shows Western blot of Afl521 pull-down enriched PAR and ADP-ribosylated PARP1 in primed (P) primed + iDUX4 (PD), TIRN (T) and TIRN + IDUX4 (TD) cells with (dashed box), or without MG132-mediated proteasomal inhibition. PAR levels in TIRN cells augment with MG132 revealed a role of the UPS in their reduced PARylation. Figure 8G shows Western blot of representative proteins in primed (P) and TIRN (T) cells with or without MG132 proteasomal inhibition.

[0033] Figure 9A-9H depict chemical TIRN reprogramming of primed, conventional hPSC. Figure 9A shows summary schematic of the TIRN reversion method using LIF-5i->3i. Figure 9B shows photomicrographs of representative primed (top) vs TIRN (bottom, after 9 passages in LIF5i->3i conditions) hESC (RUES02). Scale bar = 500 pm. Following brief LIF-5i adaptation of primed hPSC and several passages in LIF-3i TIRN medium containing only XAV939, the GSKb inhibitor CHIR99021, and the MEK inhibitor PD0325901, a broad genetic repertoire of independent conventional, bFGF-dependent, primed hESC and hPSC with a monolayer colony morphology become tolerant to bulk single-cell passaging and acquire a typical dome-shape morphology. Figure 9C shows qRT- PCR analysis of kinetics of relative mRNA expression of naive hPSC markers during early passages of LIF5i->LIF-3i TIRN reversion. Gene expression is normalized to ACTB and isogenic primed hPSC controls. Kinetic analysis during LIF5i->LIF-3i TIRN reversion revealed rapid upregulation of mRNA transcripts of human preimplantation naive epiblast- specific genes (e g., DNMT3L, HERV-H, NR5A2, KLF2, and NANOG) in TIRN cells relative to their primed isogenic counterparts. Mean results are shown for three isogenic pairs of genetically independent primed and TIRN-reverted hPSC lines (i.e., H9 hESC; E5C3, 6.2 cord blood-hiPSC) following adaptation in LIF-5i, and 2-3 subsequent passages in LIF-3i. Figure 9D shows flow cytometric detection of changes in cell surface marker profiles of representative primed vs TIRN hESC (H9) and cord blood-hiPSC (E5C3). Profiles show merged flow cytometric expression level events of indicated cell surface proteins in isogenic primed (blue) and TIRN (red) hPSC. TIRN cells expressed higher levels of ICM embryonic markers CD77, keratan sulphate-associated surface antigens (i.e., TRA- 1-60, TRA-1-81), and stage-specific embryonic antigens (i.e., SSEA3, SSEA4), but expressed lower levels of the primed, post-implantation epiblast marker CD24. Figure 9E shows representative Western blot analysis of rapid upregulation of TNKS1 / 2 and phosphorylated STAT3 proteins during the first 3 passages of LIF-5i->LIF-3i TIRN reversion. ACTIN expression was used as control. Figure 9F shows Volcano plot showing log2 fold change (FC) RNA expression between TIRN (red) and primed (blue) hPSC (n=8 independent cell lines; mean data is shown). Colored dots show differentially expressed genes (FC>1.5, p< 0.05; delineated by dashed lines); non-significantly changed genes are greyed out. Highlighted are key pre-lineage blastomere and naive ICM-specific genes expressed in both TIRN cells and human preimplantation embryo cells (e.g., DNMT3L, GSC, EOMES, GATA6, GATA4, NODAL, LEFTY2, GDF3, SP5, DPP A3 (STELLA), BMI1, CRIPTO, NR5A2, and TFAP2C 10 . Notably, NR5A2, TFAP2C, EOMES, GSC, and GATA6 are important regulators of lineage segregation to epiblast, primitive endoderm, and trophectoderm from pre-lineage blastomeres. Figure 9G shows GSEA pathway analysis of differential protein expression between TIRN (red) and primed (blue) hPSC. Figure 9H shows bar plots of log2 FC RNA expression of pioneer factor gene families overexpressed in TIRN (T, red) vs primed (P, blue).

[0034] Figures 10A-10F depict the generation of primed and TIRN stem cell lines with a construct for the ectopic, inducible expression of the ZGA-priming pioneer factor DUX4. Figure 10A shows endogenous DUX4 expression in primed vs TIRN cells. RNA- seq profiles of the endogenous DUX4 locus in primed (P, blue) vs. TIRN (red) cells showing similar, low levels expression of germline DUX4 transcripts. Top schematic indicates that the detected germline DUX4 splice variants from RNA-Seq included exon 1 (the proteincoding ORF), exon 2, and exon 7. Figure 10B shows RT-PCR validation of transgenic (lentiviral) iDUX4 expression following 24 hrs doxycycline inductions in isogenic primed (P), Primed +iDUX4 (PD), TIRN (T), and TIRN +iDUX4 (TD) cells by RT-PCR using transgene-specific primers. Detection of GAPDH RNA was used as control. Figure IOC shows flow cytometry detection of surface expression of the 8C-specificNaPi2b transporter SLC34A2 in primed+iDUX4 (purple) and TIRN+iDUX4 (green) after 24h doxycycline. TIRN cells tolerated up to 24h of iDUX4 induction and resulted in over 2-fold higher fraction of SLC34A2 than isogenic primed cells. Figure 10D shows expression of a large repertoire of 2C-4C, 8C, and pre-lineage morula / ICM genes in TIRN stem cells. Ribo-seq read data (log2 FPKM) from Zou et al for 2C / 4C / 8C / pre-lineage expression kinetics during early human embryo development. Results show representative riboprobe 2C / 4C / 8C / morula factors that were expressed in TIRN cells (green boxes), as well as representative, additional 8C-specific DUX4 targets (red box) that were expressed only after iDUX4-activation in TIRN cells. Figure 10E shows expression of DUX4 targets in TIRN and TIRN +iDUX4 cells. Log2-transformed relative RNA-Seq expression of 8C-morula genes (from k-mean clustering of human embryo data) and DUX4-bound gene targets 2 in primed-iDUX4 (purple), Shown are ratios of TIRN (red) and TIRN+iDUX4 (green) / isogenic primed hPSC control expression. Although TIRN-hPSC already expressed a large repertoire of 8C DUX4 target genes, even in the absence of transgenic iDUX4, a smaller subset of DUX4 target genes (e.g. LEUTX, TPRX1) were activated robustly only after iDUX4. Figure 10F shows real-time qRT-PCR validation of RNA-Seq expression data in Figure 10E of 8C DUX4 targets in primed-iDUX4 (purple), TIRN (red) and TIRN+iDUX4 (green) cells, relative to isogenic primed controls.

[0035] Figures 11A-11F depict that TIRN cells were homogenous, single cell populations co-expressing 2C-4C, 8C, and pre-lineage morula genes: Single-cell RNA-Seq (scRNAseq) analysis of TIRN cells + / - iDUX4 activation. Figure 11A-11B show Violin plots with log-normalized corrected scRNAseq expression levels for core pluripotency factor genes (Figure 11 A), and naive epiblast-specific genes (Figure 1 IB). Figures 11C-1 IE show 2D UMAP plots colored for TIRN (red) vs primed (blue) and TIRN+iDUX4 (green) vs primed (blue) cells (Figure 11C) or showing normalized expression levels of select 2C- 4C-specific genes (Figure 1 ID) and 8C-specific genes (Figure 1 IE). Figure 1 IF shows 3D UMAP plots showing cells from TIRN (red), TIRN+iDUX4 (green) and primed (blue) scRNA-seq analysis from embeddings exported using Seurat and visualized using plotly. 3D UMAP plots and accompanying Violin plots show single cell expressions and corresponding normalized expression levels for select 8C-to-morula-specific genes for either primed (P; blue) and TIRN (T;red) or TIRN+iDUX4 (TD; green) cells.

[0036] Figures 12A-12G depict multilineage contribution of human lineages in murine-human embryonic chimeras following injection of TIRN cells into murine blastocysts. Figure 12A shows experimental design to assess and validate human-murine interspecies chimeras. Figure 12B shows flow cytometry quantification of GFP+ cells in E7.5 human-murine chimeric embryos following injection of GFP+ human TIRN cells or GFP+ control mESC. Merged phase / fluorescence microscopic images of representative E7.5 chimeras are shown. Figure 12C shows summary table of HNA+ characterization and ex vivo expansion of human cells from E12.5 chimeric embryo explants (fetal liver, head) following puromycin selection. Figure 12D shows representative immunofluorescent detection of HNA+ (red) neurofilament (NFM+; green) human cell outgrowths from head explant of E12.5 human-mouse chimeric fetus. Figure 12E shows image of human HNA+ (red) neural outgrowths isolated by puromycin-resi stance culture of E12.5 human-murine chimeric fetal head. Figure 12F shows summary of FACS analysis of GFP, human CD34 and human CD45 expression in ex vivo hematopoietic and neural cell culture explants isolated from human-murine fetal livers and heads, respectively, following puromycin cell culture. Figures 12G-12H shows immunofluorescent staining of in vitro self-renewal of TIRN-TSCs from TIRN vs primed cells at each indicated passage (Figure 12G) and in vitro differentiation toward SDC1+ syncytiotrophoblasts and HLA-G+ extravillous trophoblasts (Figure 12H).

[0037] Figures 13A-13E depict direct contribution of blastomere-like TIRN cells to both embryonic and extra-embryonic tissues in human-murine chimeric blastocysts and feti. Figure 13A shows UMAP plots of log-normalized corrected counts showing simultaneous, homogenous, single-cell expressions for epiblast-specific (NANOG, POU5F1(OCT4), SOX2), primitive endoderm-specific (GATA6, F0XA2, GATA4, SOX17) and trophectoderm-specific (GATA3, CDX2, EOMES) genes in primed (P) vs TIRN (T) cells. Figure 13B-13C show merged live detection of Hoechst-labeled TIRN + / - mECad cells at 4 (Figure 13B) and 24 (Figure 13C) hours following injection of 5-7 TIRN cells into 8C-16C murine embryos demonstrating rapid multi -lineage TE and PE compartment integration at 5-7 sites of murine blastocysts; in an equipotent manner. Figure 13D shows fluorescent detection of tdTomato+ cells (red) in the placenta of El 1.5 humanmurine chimeric fetus with immunofluorescent detection (green) of human specific HLA- G and human placenta lactogen (hPL); following injection of TIRN cells into 8C-16C murine embryos. Figure 13E shows representative example of an abnormally developed El 1.5 human-murine chimeric embryos following injection of tdTomato+ TIRN-hPSC (red) into 8C-16C murine embryos.

[0038] Figures 14A-14G depict ChlP-Seq analysis of TIRN stem cell chromatin. Figures 13A-13D show Euler diagrams with overlap of PARP1 (Figure 14A), NANOG (Figure 14B), SOX2 (Figure 14C), and OCT4 (Figure 14D) binding sites (400 bp regions) in isogenic TIRN (red) vs primed (blue) hESC RUES2. All 400 bp sites were normalized and input-corrected using Diffbind software. Heatmaps show normalized read signals centered at non-overlapping PARP1, NANOG, SOX2 or OCT4 bound peaks with top line plots summarizing average signal for each ChlP-Seq experiments (average of 2 replicates) at TIRN (red line) vs primed (blue line) sites. Genomic distribution of peaks was annotated in the heatmaps using profileplyr. Figure 14E shows scatter plots for averaged (n=2) log- transformed concentrations of NANOG, SOX2 and OCT4 at NANOG, SOX2 and OCT4 sites. Differentially bound sites are indicated for primed (blue) and TIRN (red) samples. Adjacent box plots show the PARP1 concentrations at NANOG, SOX2 and OCT4 sites in TIRN vs. primed cells (differential sites are colored). Figure 14F shows Euler diagram showing the number of overlapping PARP1, NANOG, SOX2, and OCT4 co-binding sites in isogenic TIRN (red) vs primed (blue). Figure 14G shows Volcano plot of RNA-seq differential expression analysis for genes significantly bound by NSO in TIRN cells (gained sites, FO2, FDR<0.05) within lOkb of TSS. Line plots of averaged ChlP-seq signal for NANOG, SOX2, OCT4 and PARP1 centered on NSO sites in TIRN (red) and primed (blue) cells are shown for significantly (i) downregulated (FC<-1.5, adj. p value<0.05) and (ii) upregulated (FO1.5, adj . P value<0.05) genes. Line plots of averaged ChlP-seq signal for PARP1, H3K4me3, H3K27me3 and H3K27me3 at gene bodies that are significantly bound (FO2, FDR<0.05) NSO sites in TIRN (red) and primed (blue) cells are shown for significantly (iii) downregulated (FC<-1.5, adj. p value<0.05) and (iv) upregulated (FO1.5, adj. p value<0.05) genes.

[0039] Figure 15 depicts additional examples of ChlP-Seq read profiles of SC- specific genes atNSOP regulatory sites. Additional Integrative Genomics Viewer snapshots of RNA-seq and ChlP-seq tracks for 8C-specific gene loci for EBF2 and GATA6, showing RNA expression signal in TIRN (T), TIRN+iDUX4 (TD), primed + iDUX4 (PD) and primed (P) samples and the averaged input-subtracted RPGC -normalized binding of H3K4me3, H3K27ac, NANOG, SOX2, OCT4 and PARP1 in TIRN (red) and primed (blue) samples. Averaged, and genome-aligned DUX4 signal from published DUX4-ChiP data is shown (black). Boxed regions highlight novel NSOP-co-binding putative enhancer regions with H3K27Ac and H3K4me3 enrichment.

[0040] Figure 16 shows TNKS I / 2-PARP I / 2 substrate-driven proteomic GSEA pathways in Primed hPSC vs. TIRN and TIRN + iDUX4 stem cells. Summary diagram of GSEA of primed, TIRN, and TIRN+iDUX4 proteome data highlighting known, validated TNKS1 / 2-PARP1 / 2 substrates in each category (annotated from Ayyappan, V. et al).

[0041] Figures 17A-17F depict paired whole proteome and ubiquitinome analyses of Primed, Primed + iDUX4, TIRN, and TIRN + iDUX4 stem cell lines. Figure 17A shows cross-plots of ubiquitinome sites (x-axis) and proteome (y-axis) relative expression in TIRN (T) vs primed (P), TIRN+iDUX4 (TD) vs primed (P), and primed+iDUX4 (PD) vs primed (P) cells showing the most differentially expressed / ubiquitinated proteins (dashed line boxes). Figure 17B shows cross plots of ubiquitinome sites (x-axis) and proteome (y-axis) relative expression in TIRN (T) vs primed (P), TIRN+iDUX4 (TD) vs primed (P), and primed+iDUX4 (PD) vs primed (P) cells highlighting the most differentially expressed / ubiquitinated PARP1 (gold triangles) and TNKS1 / 2 (maroon circles) substrates. Figure 17C shows heatmaps of PARP1 / TNKS substrates in primed (P), TIRN (T) and TIRN+iDUX4 (TD) with annotations for differentially ubiquitinated proteins (p<0.05, FOLS for TIRN in red and TIRN+iDUX4 in green, and FC<-1.5 for primed in blue. Figures 17D-17F show heatmaps of differentially expressed proteins (FO1.2, p<0.05) for ubiquitin coding enzyme machinery (Figure 17D), histone modifiers (Figure 17E), and histones (Figure 17F) in primed (P), TIRN (T) and TIRN+iDUX4 (TD) with annotations for PARP1 / TNKS substrates and differential ubiquitination in TIRN (UBI-T, up=red, down=blue) and TIRN+iDUX4 (UBI-TD, up=green, down=blue).

[0042] Figures 18A-18C demonstrate that TIRN stem cells generated with a cGMP- grade modification of the TIRN method are also totipotent. TIRN and UTIRN totipotent stem cells are generated via a xeno-free / feeder-free cGMP-compliant defined LIF-4i XF / FF TIRN method (see TABLE 1) have similar phenotype with TIRN totipotent stem cells generated with the LIF-5i ->3i / MEF method (i.e. FIGURE 9A). Figure 18A shows the summary schematic of the LIF-4i XF / FF TIRN method (see TABLE 1). Figure 18B showsphotomicrographs of representative primed (top) vs TIRN 4i stem cell cultures (bottom, after 10 passages in either LIF5i->3i or TIRN 4i conditions). Scale bar = 500 mm. Figure 18C shows alkaline phosphatase staining ofLIF-5i ->3i / MEF and LIF-4i XF / FF TIRN stem cells.

[0043] Figures 19A-19D demonstrate that TIRN stem cells generated with a cGMP- grade modification of the TIRN method have a totipotent molecular phenotype. Protein and RNA-Seq expression data from stem cells derived with the LIF-4i XF / FF TIRN method are depicted. Figure 19A shows Western blots of core pluripotency (NANOG, OCT3 / 4, SOX2), and naive epiblast-specific 8C-specific (DNMT3L, TFAP2C) proteins overexpressed in TIRN cells. Figure 19B shows Volcano plot showing log2 fold change (FC) RNA expression between TIRN 4i (red) and primed (blue) hPSC (n=8 independent cell lines; mean data is shown). Colored dots show differentially expressed genes (FC>1.5, p< 0.05; delineated by dashed lines); non-significantly changed genes are greyed out. Highlighted are key pre-lineage 8C blastomere-specific genes expressed in both TIRN cells and human preimplantation embryo cells (e.g., TPRXL, TPRX1, ARGFX, LEUTX, ZSCAN4, H3Y1, CDX2, GATA6, GATA4, etc.). Figure 19C shows heatmaps of RNA seq data (FPKM) comparing the most significantly expressed (FC>1.5, adjusted p-value <0.05) transcriptional regulators (Lambert et al., 2018) (n=392 genes) in 8 isogenic primed (P) and TIRN 4i (T) hPSC lines expressed during indicated human preimplantation stages. Correlative expression of same genes from human embryo Ribo-Seq translatome data at indicated stages (Zou et al., 2022) (FPKM) is shown on the left heatmap as control. Highlighted are key pre-lineage 2C-4C, 8C blastomere, morula, and naive ICM-specific genes over-expressed in both TIRN cells and human preimplantation embryo cells Figure 19D shows real-time qRT-PCR validation of totipotent stage-specific genes that were identified in LIF4i TIRN stem cell RNA-Seq expression data in Figures B, C above, of 8C- and totipotent-specific DUX4 gene targets LIF4i TIRN (red) stem cells, relative to isogenic primed controls (blue). Results show representative 2C / 4C / 8C / morula factors that were over-expressed in LIF4i TIRN cells.

[0044] Figure 20 demonstrates that TIRN stem cells generated with a cGMP -grade modification of the TIRN method express 4-8C totipotent-specific DUX4 gene targets. The Figure shows Integrative Genomics Viewer snapshots of representative TIRN 4i cluster RNA-seq and DUX4 ChlP-Seq tracks; showing RNA expression signal in TIRN 4i vs. isogenic primed hiPSC samples for 4-8C-specific totipotency-specific genes that are known DUX4 gene targets (TRIM49, MBD3L2, HAND1, H3Y1, LEUTX, TPRX1, PRAMEF 12). Averaged, and genome-aligned DUX4 signal from hg38 realigned DUX4-ChiP data (Hendrickson et al., 2017) is also shown (black). Boxed regions show concordant exon locations for each DUX4 gene target.

[0045] 5, DETAILED DESCRIPTION

[0046] The presently disclosed subject matter provides methods for generating populations of functionally totipotent blastomere-like human stem cells with embryonic and extra-embryonic differentiation potential, as well as method and compositions comprising the same in connection with the generation of chimeras. For example, but not by way of limitation, such populations of progenitor cells can be produced via methods comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the methods comprise engineering the population of hiPSCs to express a cell adhesion molecule or DUX4.

[0047] 5.1. Definitions

[0048] The terms used in this specification generally have their ordinary meanings in the art, within the context of this disclosure and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the compositions and methods of the present disclosure and how to make and use them.

[0049] As used herein, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification can mean “one,” but it is also consistent with the meaning of “one or more,” “at least one” and “one or more than one.”

[0050] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s)” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms or words that do not preclude the possibility of additional acts or structures. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0051] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2- fold, of a value.

[0052] As used herein, the terms "comprising," "comprise" or "comprised," and variations thereof, in reference to defined or described elements of an item, composition, apparatus, method, process, system, etc. are meant to be inclusive or open ended, permitting additional elements, thereby indicating that the defined or described item, composition, apparatus, method, process, system, etc. includes those specified elements— or, as appropriate equivalents thereof— and that other elements can be included and still fall within the scope / definition of the defined item, composition, apparatus, method, process, system, etc.

[0053] An "effective amount" as used herein, means an amount which provides a therapeutic or prophylactic benefit.

[0054] As used in this specification and the appended claims, the term "or" is generally employed in its sense including "and / or" unless the content clearly dictates otherwise.

[0055] "Parenteral" administration of an immunogenic composition includes, e.g., subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques.

[0056] The terms "patient" or "individual" or "subject" are used interchangeably herein, and refers to a mammalian subj ect to be treated, with human patients being preferred. In some cases, the methods of the invention find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters, and primates.

[0057] As defined herein, a "therapeutically effective" amount of a compound or agent (i.e., an effective dosage) means an amount sufficient to produce a therapeutically (e.g., clinically) desirable result. The compositions can be administered from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors can influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of the compounds of the invention can include a single treatment or a series of treatments.

[0058] As used herein, the terms "treat," treating," "treatment," and the like refer to reducing or ameliorating a disorder and / or symptoms associated therewith. It will be appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.

[0059] Genes: All genes, gene names, and gene products disclosed herein are intended to correspond to homologs from any species for which the compositions and methods disclosed herein are applicable. It is understood that when a gene or gene product from a particular species is disclosed, this disclosure is intended to be exemplary only, and is not to be interpreted as a limitation unless the context in which it appears clearly indicates. Thus, for example, for the genes or gene products disclosed herein, are intended to encompass homologous and / or orthologous genes and gene products from other species.

[0060] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

[0061] 5.2. Production of Patient-Specific cGMP-Grade Banks of TIRN Stem Cells In one aspect, the subject matter of the present disclosure is directed to chemical PARP inhibition for improving functional pluripotency. Zimmerlin et al (Zimmerlin et al., Development 2016; 143(22): 4368-4380) demonstrated that primed, conventional human pluripotent stem cells (hPSC) were chemically reverted to a naive epiblast-like pluripotent state with improved differentiation potential via a two-step chemical reprogramming system (referred alternatively herein as the “LIF-5i -> LIF-3i reversion method” or the “LIF5i -> LIF-3i TIRN method”), that comprised of sequential culture with LIF and five small molecules (i.e., Hedgehog signaling activation, cAMP agonism, GSK3P inhibition, MEK inhibition, and nonspecific TNKS1 / TNKS2 / PARP1 inhibition (XAV939). Sequential naive reversion with continuous exposure to XAV939 reprogrammed a large repertoire of >25 conventional lineage-primed hPSC to tankyrase / PARPl inhibitor-regulated naive (TIRN) stem cells. TIRN cells possessed high clonal proliferation, phosphorylated-STAT3 signaling, MEK-ERK / bFGF signaling independence, modulation of P-catenin expression, and erasure of lineage-primed gene expression. TIRN cells also maintained normal karyotypes and imprinted CpG patterns, and were devoid of irreversible demethylation defects that were reported in naive reversion systems, and suggested to be secondary to prolonged MEK inhibition. Reversion to TIRN cells eliminated interline variability and significantly enhanced the multi-lineage differentiation performance of isogenic primed hPSC differentiation; without requirement for transitioning back to primed culture conditions to restore differentiation potency.

[0062] The LIF5i -> LIF-3i TIRN method comprises propagation of stem cell cultures using ‘LIF-3i’ medium following LIF-5i adaptation. LIF-3i medium consists of DMEM / F-12 supplemented with 20% KnockOut Serum Replacement (KOSR), 0.1 mM MEM non-essential amino acids (MEM NEAA), ImM L-Glutamine, 0.1 mM P- mercaptoethanol, 20ng / mL recombinant human LIF, 3 pM CHIR99021, IpM PD0325901, and 4 pM XAV939. TIRN cells are first chemically-reverted from isogenic, primed E8 medium-expanded primed hPSC cultures using a single adaptation step in ‘LIF-5i’ medium (i.e., LIF-3i medium supplemented with lOpM Forskolin, 2pM purmorphamine and lOng / mL recombinant human FGF2). Briefly, 4-to-5-day-old primed hPSC E8 cultures are switched to LIF-5i +FGF2 medium for 12-24 hours, enzymatically dissociated (Accutase), and transferred onto irradiated mouse embryonic fibroblast (MEF) feeders in LIF-5i medium for only 3 to 5 days. All subsequent passages utilize LIF-3i (TIRN) medium alone on MEF feeders and passaged as single cells using Accutase.

[0063] In one aspect, the subject matter of the present disclosure is directed to defined feeder-free (FF), xenofree (XF) cGMP-compliant culture medium systems for the production of patient-specific TIRN stem cells. For example, the methods described herein are directed, in certain embodiments, to defined FF / XF cGMP-compliant culture medium systems for CB (or PBSC or BM) pluripotency episomal reprogramming. In certain embodiments, the methods described herein employ FF / XF medium systems that revert conventional XF / FF human induced pluripotent stem cells (hiPSCs) and human embryonic stem cells (hESC) to a naive epiblast-like state, referred alternatively herein as the “LIF-4i FF TIRN system”, the “LIF-4i XF / FF TIRN system”, the “LIF-4i FF method”, the “LIF-4i XF / FF method” and modifications thereof. The LIF-4i FF TIRN system is based on a tankyrase / PARPl inhibitor-based small molecule approach. The method contains a novel recipe of LIF, four proprietary small molecules including a XAV939 (LIF-4i), defined media components, and KnockOut serum replacer (KSOR, e.g., Knockout™ Serum Replacement (Knockout™ SR) from Thermo Fisher), but does not contain growth factors typically required to maintain primed, conventional hiPSC (e.g., bFGF or TGFP).

[0064] The LIF-4i FF TIRN system involves a modified version of the classic murine 2i naive reversion cocktail to human pluripotent stem cells. For example, but not limitation, the self-renewal of hPSC (which cannot expand in 2i alone) is stabilized in LIF- 2i by supplementing this cocktail with the tankyrase / PARPl inhibitor XAV939. Although the mechanisms of action of XAV939 in hPSC are likely complex and synergistic with 2i, it likely includes at a minimum, an important stabilization and augmentation of hPSC selfrenewal via WNT signaling pathways.

[0065] Furthermore, although the promiscuous PARP inhibitor XAV939 has been widely employed as a small molecule WNT inhibitor when used alone, another method, the LIF-3i method, accentuated several other studies that also demonstrated that when used simultaneously with GSK-3b inhibition, XAV939 induced a stabilization of AXIN isoforms that enhanced self-renewal of both conventional human pluripotent stem cells and murine EpiSC. The mechanism of action was shown to be XAV939 synergizing with GSK-3b inhibition, to paradoxically augment canonical WNT signaling by reinforcing the stability of the active isoform of P-catenin in both cytoplasmic and nuclear subcellular compartments. However, unlike previous studies, Zimmerlin et al.. Development 2016; 143(22): 4368-4380, exploited dual use of GSK-3b / tankyrase / PARPl co-inhibition along with simultaneous (PD0325901) MEK inhibition to stably revert a wide repertoire of conventional hPSC to a naive epiblast-like state without requirement for exogeneous FGF2. In that study, initial culture in LIF-5i (including forskolin and purmorphamine) followed by LIF-3i culture reverted hPSC (TIRN-hPSC) re-activated naive epiblast-like STAT3 signaling, and possessed naive epiblast-like globally hypomethylated genomes, but without hypomethylated genomic imprinting aberrations. TIRN-hPSC were functionally competent for multi-lineage differentiation without need for an additional ‘capacitation’ step or reculture back to primed state (i.e., ‘re-priming’). Moreover, these studies not only validated the functional pluripotency of reverted TIRN-hPSC in multi-lineage directed differentiation assays, but also revealed that TIRN-hPSC possessed significantly improved differentiation efficiencies relative to their isogenic primed, conventional hPSC counterparts.

[0066] The LIF-4i FF TIRN reversion method described herein is reproducible in a broad variety of independent FF hESC and transgene-free, non-integrated FF hiPSC lines. The method requires minimal training with basic cell culture skill and has been employed to revert >20 independent hESC and hiPSC lines from a broad array of donors. Furthermore, the LIF-4i FF TIRN system supports robust bulk clonal expansion efficiencies throughout all the steps between lineage-primed conventional hPSC culture all the way to completed naive-like hPSC reversion (i.e., adaptation, transition and expansion for 7-10 passages in LIF-4i FF alone). The stability of this culture system does not depend on the presence of feeders and allows complete FF / XF expansion of TIRN-hPSC.

[0067] TABLE 1, below, outlines a two-step LIF-4i XF / FF TIRN method developed following extensive media analysis of the LIF-3i / MEF protocol. The LIF-4i FF chemical naive reversion method employs the classical leukemia inhibitory factor (LIF), GSK30, and MEK / ERK inhibition cocktail (LIF-2i), supplemented with only the tankyrase / PARPl inhibitor XAV939 in a novel completely FF protocol. To stabilize TIRN- hPSC without feeders, the substrate and media composition were modified from the original LIF-3i / MEF method, and a 4th inhibitor (i.e., Go6983) targeting protein kinase C (LIF-4i FF medium) was introduced, which had been shown to reinforce pluripotency in human primed and rodent ESC. This mechanism is independent from STAT3 activation and MEK / GSK3P inhibition and antagonizes lineage commitment. This inhibitor has previously been introduced into other human naive culture systems to minimize spontaneous differentiation.

[0068] TABLE 1 - LIF-4i XF / FF TIRN Method

[0069]

[0070] In certain embodiments, the preparation of 500mL LIF-4i media can comprise the steps of:

[0071] Weighing of 2.5g BSA and transfer in a bottle. Gently adding 210mL DMEM-F12 and 210mL Neurobasal without making an emulsion with BSA.

[0072] Adding 50mL KSR, 5mL lOOmM L-Glutamine, 5mL 100X NEAA, lOmL ITS-X supplement, 5mL B27 supplement, 2.5mL N2 supplements.

[0073] Adding lOOpL human LIF (lOOpg / mL stock), 15pL CHIR99021 (lOOmM stock in DMSO), lOpL PD0325901 (lOOmM stock in DMSO), 20pL XAV939 (lOOmM stock in DMSO), 20pL Go6983 (50mM stock in DMSO).

[0074] Warming up the medium at 37°C until all DMSO and BSA are resuspended and sterile filter.

[0075] In certain embodiments, the present disclosure is directed to methods for generating a population of therapeutic progenitor cells under clinical grade, cGMP- compliant conditions, comprising: (a) contacting a population of hiPSCs with a tankyrase / PARPl -inhibitor-containing composition comprising: (i) leukemia inhibitory factor; (ii) a GSK3P signaling pathway inhibitor; (iii) a MEK signaling pathway inhibitor; (iv) a non-specific tankyrase / PARPl inhibitor; and (v) a PKC inhibitor; (b) performing FF and XF culture of the hiPSCs to generate a population of therapeutic progenitor cells under clinical grade, cGMP-compliant conditions. In certain embodiments, the tankyrase / PARPl inhibitor is selected from: XAV939, IWR-1, G007-LK, JW55, AZ1366, JW 74, NVP- TNKS656 and combinations thereof. In certain embodiments, the GSK3P signaling pathway inhibitor is selected from: 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)- 2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR 99021), 5-Ethyl-7,8- dimethoxy-lH-pyrrolo[3,4-c]isoquinoline-l,3(2H)-dione (3F8), l-(7-Methoxyquinolin-4- yl)-3-[6-(trifluoromethyl)pyridin-2-yl]urea (A 1070722), N6-[2-[[4-(2,4-Dichlorophenyl)- 5-(lH-imidazol-l-yl)-2-pyrimidinyl]amino]ethyl]-3-nitro-2,6-pyridinediamine (CHIR 98014), lithium chloride (LiCl), 4-benzyl-2-methyl-l, 2, 4-thiadiazolidine-3, 5-dione (TDZD-8), 5-iodo-indirubin-3 '-monoxime (I3'M), N-(4-methoxybenzyl)-N'-(5-nitro-l,3- thiazol-2-yl)urea (AR-A014418) and combinations thereof. In certain embodiments, the MEK signaling pathway inhibitor is selected from: PD032590, CI-1040 (PD184352), cobimetinib (GDC-0973, XL518), Selumetinib (AZD6244), MEK 162, AZD8330, TAK- 733, GDC-0623, Refametinib (RDEA119; BAY 869766), Pimasertib (AS703026), RO4987655 (CH4987655), RO5126766, WX-554, HL-085 and combinations thereof. In certain embodiments, the PKC inhibitor is Go6983.

[0076] In certain embodiments, the present disclosure is directed to methods for generating a population of therapeutic progenitor cells under clinical grade, cGMP- compliant conditions, wherein the hiPSCs used to generate the therapeutic progenitor cells are derived from primed hiPSCs. In certain embodiments, the priming of hiPSCs comprises contacting the hiPSCs with a serum replacer-containing media. In certain embodiments, the priming hiPSCs comprises contacting the hiPSCs with a ROCK inhibitor. In certain embodiments, the ROCK inhibitor is Y-27632.

[0077] In certain embodiments, the present disclosure is directed to methods for generating a population of therapeutic progenitor cells under clinical grade, cGMP- compliant conditions, wherein the population of therapeutic progenitor cells are generated from a population of HLA-defined hiPSCs. In certain embodiments, the population of HLA- defined hiPSCs comprise human CD34+ cord blood cells.

[0078] In certain embodiments, the present disclosure is directed to methods for generating a population of therapeutic progenitor cells under clinical grade, cGMP- compliant conditions comprising a FF and XF culture of the hiPSCs to generate a population of therapeutic progenitor cells under clinical grade, cGMP-compliant conditions, wherein the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitor- continuing composition is comprises culture of the hiPSCs on vitronectin-coated substrates. In certain embodiments, the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition for 1 to 10 passages. In certain embodiments, passages 1-3 of the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition comprise selection of dome-shaped colonies for each subsequent passage.

[0079] In certain embodiments, the modified LIF-4i method provides a completely defined XF / FF culture system for the derivation and long-term cry opreservation and storage (TABLE 2) of clinical-grade TIRN stem cells, e.g., from HLA-typed CB or PBSC donors.

[0080] TABLE 2 - Cryopreservation and Storage

[0081] 5.3 Production of cGMP-Grade Banks of “Universal” UTIRN Stem Cells

[0082] In another aspect, the present disclosure relates to the production of cGMP- grade banks of clinical grade “universal” UTIRN totipotent stem cells. UTIRN reversion can be used to revert either established or commercially available transgene-free FF conventional, primed hiPSC. With this method, established conventional, primed hESC / hiPSC (or CB-hiPSC derived entirely with FF / XF episomal CB reprogramming) that are cultured in FF E8 medium can be rapidly reverted in bulk with LIF-4i to an FF naive-like state. FF TIRN stem cells or UTIRN totipotent stem cells are cultured on vitronectin-coated vessels in physiological (5%) O2, and can be cryopreserved, or used directly for differentiation without further manipulation. In addition to enhanced functionality, UTIRN-hPSC possess multiple advantages over conventional hPSC culture, and over other LIF-3i / MEF naive reversion systems. These advantages include, in certain embodiments, ease of single cell passaging in a defined, reproducible FF system that uses pre-screened, high-quality commercially-available components. As outlined herein, episomally-reprogrammed FF / XF cGMP-compliant HLA-defined CB-derived UTIRN stem cell lines from start to finish have been established. The same methods can be employed with clinical grade CD34+ PBSC or BM, among other cell types.

[0083] Multiple other culture systems have also been reported to promote conventional hPSC to similar naive-like pluripotent states. Although these hPSC culture systems have also relied on utilization of classical mouse naive 2i conditions, in most cases these single-cell passaging methods also required additional chemical modulation for stabilizing an inherently unstable / metastable human naive state. Unlike the TIRN system, most of these other methods demonstrated impaired functional pluripotency following differentiation and / or acquired abnormal epigenomic imprints or karyotypes. Although the emergence of abnormal karyotypes within conventional primed hPSC cultures is already well documented, prolonged, enzymatic single-cell passaging methods that are routinely employed in most naive reversion methods, have also been shown to potentiate the generation of abnormal chromosomal configurations; more sensitive techniques (e.g., copy number variations, single nucleotide polymorphism) may reveal additional alterations.

[0084] In contrast, UTIRN-hPSC lines not only possessed normal karyotypes at low-medium passages (e.g., p5-pl5), as well as at high passage numbers (e.g., >p30) following LIF-4i FF TIRN culture, but also improved genomic stability (as assessed by DSB DNA repair studies). Using the sensitive allele-specific Infmium methylation array platform, it was also previously demonstrated that CpG methylation marks at imprinted loci of a wide repertoire of LIF -3 i / MEF -reverted hPSC lines (following 4-7 passages in LIF-3i) were found to be grossly normal in structure. Since abnormal genomic imprints and karyotypes may ultimately impair functional capacity of hPSC, prerequisite guidelines were outlined in this protocol that encourage researchers to validate hPSC cultures before and after naive reversion, using this method as well as others.

[0085] In certain embodiments, the LIF-4i FF TIRN methods described herein can improve functional pluripotency across germ layers in a large repertoire of hESC and non- transgenic hiPSC lines. Unlike other naive reversion protocols, the methods described herein do not require a re-priming step for subsequent differentiation of TIRN-hPSC (i.e., converting TIRN-hPSC back to conventional primed conditions prior to their use in directed differentiation assays). In certain embodiments, the LIF-4i FF-reverted TIRN- hPSC displayed significantly more efficient differentiation capacities than their isogenic conventional hPSC counterparts in both teratoma assays and directed differentiation protocols of lineages of all three germ layers. Due to assay-dependent and interline variations in functional testing of conventional hPSC, lineage-specific differentiation should be evaluated using independent directed differentiation protocols and hPSC derived from multiple genetic backgrounds. Using careful experimental design, a broad array of hPSC lines can be expected to significantly improve their multi-lineage differentiation efficiencies compared to their isogenic conventional counterparts following 4-10 passages in LIF-4i TIRN conditions.

[0086] For example, but not by way of limitation, the methods and compositions described herein have been used to generate and functionally validate pre-clinical naive vascular progenitors (N-VP) from a test bank of representative UTIRN stem cell lines derived in cGMP-compliant conditions from HLA-defined CD34+ CB as a pilot for future Phase I / I I clinical trials.

[0087] In summary, the TIRN reversion method rapidly and clonally expands the numbers of hPSC, improves their downstream differentiation efficiency, increases lineage- committed progenitor cell numbers following differentiation, and decreases interline variability of conventional, lineage-primed hPSC lines. UTIRN-hPSC with improved functionality can also have wide impact as contributing functional tissues to a developing embryo. For example, stable UTIRN-hESC could be employed for developing transplantable human organs and adult stem cells in developing interspecies human-animal chimeras, or for generating humanized gene-targeted animal models of disease.

[0088] In another aspect, the present disclosure relates to TIRN cells engineered to express cell adhesion molecules, which exhibit increased totipotent-like capacity. Totipotency requires that a single cell can give rise to an entire conceptus, including embryonic lineages, e.g., ICM, and extraembryonic lineages, e.g., trophectoderm. TIRN cells exhibit totipotent-like capabilities since they contribute to both embryonic and extraembryonic lineages: human TIRN cells injected into 8-cell murine embryos contribute to murine blastocyst ICM or trophectoderm implantations and ultimately give rise to both embryonic and placental lineages in vivo. Modifying human TIRN to express cell adhesion molecules, e.g., murine E-Cadherin (mECad), improved human cell integration into murine organs. Cell adhesion molecules, e.g., cadherins, integrins, and laminins, regulate the cell-cell signaling during development. Inappropriate speciesspecific communication of developmental cues from cell-cell adhesion signaling barriers (e.g., between disparate mouse / pig species with humans) likely impairs efficient interspecific fetal development. Divergence between human-murine embryonic development may misdirect post-implantation morphogenesis or produce antagonism in determining appropriate ontogenetic size and shape of organs in the host animal. Genetic engineering of totipotent stem cells to express species-specific adhesion molecules (e.g., mouse, pig, or sheep) will improve the development of human tissues within these disparate species. Thus, TIRN cells can be engineered to express cell adhesion molecules from human, murine, porcine, or cross-species origin, e.g., a human-murine or human- porcine cross-species cell adhesion molecule. Non-limiting examples of cell adhesion molecules include cadherins, proto-cadherins, alpha- and beta- family integrins, laminins, tenascins, contactins, ephrins, and claudins.

[0089] In another aspect, the present disclosure relates to TIRN cells engineered to express DUX4, which exhibit the molecular signature of complete human totipotent 4-8 cell (4C-8C) embryos. TIRN cells expressing DUX4 exhibit totipotent-like capacity for contributing to both embryonic and extra-embryonic (e.g., placenta, trophectoderm) tissues.

[0090] In another aspect, the present disclosure relates to the application of TIRN cells for regenerative medicine. TIRN cells can be used to generate organs or tissues which can be provided to a subject in need thereof, for example, tissue damage or disease, organ damage or disease, or organ failure. TIRN cells used to produce tissue or organs can be derived from reprogrammed somatic cells. TIRN cell-derived tissue or organs can be used for disease modeling or drug discovery.

[0091] 5.4 Production of “Universal” UTIRN-iPSCs from non-human sources

[0092] In another aspect, the present disclosure relates to the application of functionally totipotent blastomere-like TIRN stem cells which are derived from non-human sources. Non-human TIRN cells can be produced, e.g., from reprogrammed non-human somatic cells (e.g., pig, mouse, non-human primates, and endangered species of animals). Non-human TIRN cell-derived tissue or organs can be used for disease modeling or drug discovery.

[0093] In another aspect, the present disclosure relates to the application of functionally totipotent blastomere-like TIRN stem cells with efficient embryonic and extra- embryonic differentiation for cloning non-human animals. Induced totipotent TIRN cells produced from non-human somatic cells, e.g., skin, blood cells, transferred to an animal uterus undergo embryonic development to form a cloned animal. In certain embodiments, such cloning can be performed starting with a single totipotent animal stem cell, e.g., starting from a non-human animal iPSC, which is reprogramed via the TIRN methods described herein.

[0094] In certain embodiments, clones can be produced using domestic animals (e.g., for meat production), for the cloning of endangered animal species (e.g., for conservation or animal models of disease), or for cloning of various pet species (e.g., dogs and cats). In certain embodiments, the non-human animals are genetically modified.

[0095] 6. Exemplary Embodiments

[0096] In certain embodiments, the presently disclosed subject matter provides methods for generating a population of functionally totipotent blastomere-like TIRN cells, comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a non-specific tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of hiPSCs to express a cell adhesion molecule. In certain embodiments, the population of functionally totipotent blastomere-like stem cells possesses efficient in vivo embryonic and extra-embryonic differentiation potential. In certain embodiments, the efficient in vivo embryonic and extra- embryonic differential potential is mediated via PARP -regulated proteogenomic reprogramming of a DUX4-NAN0G epigenetic regulatory axis, via tankyrase / PARPl - regulated reprogramming of conventional human induced pluripotent stem cells (hiPSC) to tankyrase / PARPl inhibitor-regulated naive (TIRN) stem cells. In certain embodiments, the method comprises contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the method comprises contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl - inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the method comprises comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the method comprises contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl - inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the totipotent TIRN stem cells are derived from primed, conventional hiPSCs. In certain embodiments, the primed, conventional hiPSCs are derived from somatic cells.

[0097] In certain embodiments, the tankyrase / PARPl inhibitor is selected from: XAV939, IWR-1, G007-LK, JW55, AZ1366, JW 74, NVP-TNKS656 and combinations thereof. In certain embodiments, the GSK3P signaling pathway inhibitor is selected from: 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)-2- pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR 99021), 5-Ethyl-7,8- dimethoxy-lH-pyrrolo[3,4-c]isoquinoline-l,3(2H)-dione (3F8), l-(7-Methoxyquinolin-4- yl)-3-[6-(trifluoromethyl)pyridin-2-yl]urea (A 1070722), N6-[2-[[4-(2,4-Dichlorophenyl)- 5-(lH-imidazol-l-yl)-2-pyrimidinyl]amino]ethyl]-3-nitro-2,6-pyridinediamine (CHIR 98014), lithium chloride (LiCl), 4-benzyl-2-methyl-l, 2, 4-thiadiazolidine-3, 5-dione (TDZD-8), 5-iodo-indirubin-3 '-monoxime (I3'M), N-(4-methoxybenzyl)-N'-(5-nitro-l,3- thiazol-2-yl)urea (AR-A014418) and combinations thereof. In certain embodiments, the MEK signaling pathway inhibitor is selected from: PD032590, CI-1040 (PD184352), cobimetinib (GDC-0973, XL518), Selumetinib (AZD6244), MEK 162, AZD8330, TAK- 733, GDC-0623, Refametinib (RDEA119; BAY 869766), Pimasertib (AS703026), RO4987655 (CH4987655), RO5126766, WX-554, HL-085 and combinations thereof. In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises a protein kinase C (PKC) inhibitor. In certain embodiments, the PKC inhibitor is Go6983.

[0098] In certain embodiments, the methods further comprise contacting the population of hiPSCs with a non-human embryo to form a chimera. In certain embodiments, the chimera is a human-murine chimera.

[0099] In certain embodiments, the methods further comprise culturing the population of hiPSCs under conditions for forming an organ. In certain embodiments, the organ is a liver, kidney, heart, brain, eye / retinal, placenta, or an entire lympho-hematopoietic organ system. In certain embodiments, the method further comprises culturing the population of hiPSCs under conditions for forming a cloned embryo.

[0100] In certain embodiments, the cell adhesion molecule is human or murine. In certain embodiments, the cell adhesion molecule is a cross-species adhesion molecule. In certain embodiments, the cross-species adhesion molecule is a human-murine or human- porcine cross-species molecule. In certain embodiments, the cell adhesion molecule is selected from the group consisting of cadherins, proto-cadherins, alpha- and beta- family integrins, laminins, tenascins, contactins, ephrins, and claudins. In certain embodiments, the cell adhesion molecule is a cadherin. In certain embodiments, the cadherin is E-Cadherin. In certain embodiments, the cadherin is murine E-Cadherin. In certain embodiments, the cadherin is a human E-Cadherin. In certain embodiments, the cadherin is a human-murine cross-species E-Cadherin.

[0101] In certain embodiments, the hiPSCs are derived from primed, conventional hiPSCs. In certain embodiments, priming of hiPSCs comprises contacting the hiPSCs with a serum replacer-containing media. In certain embodiments, priming the hiPSCs comprises contacting the hiPSCs with a ROCK inhibitor. In certain embodiments, the ROCK inhibitor is Y-27632. In certain embodiments, the population of progenitor cells are generated from a population of HLA-defined hiPSCs. In certain embodiments, the population of HLA- defined hiPSCs comprise human CD34+ cord blood cells.

[0102] In certain embodiments, the method further comprises performing feeder- free (FF) and xeno-free (XF) culture of the hiPSCs to generate a population of these progenitor cells under clinical grade, cGMP-compliant conditions. In certain embodiments, the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitorcontinuing composition comprises culturing the hiPSCs on vitronectin-coated substrates. In certain embodiments, the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition is performed for 1 to 10 passages. In certain embodiments, passages 1-3 of the FF and XF culture of the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition comprise selection of dome-shaped colonies for each subsequent passage. In certain embodiments, the method further comprises culturing the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition for 1 to 10 passages. In certain embodiments, the method further comprises culturing the hiPSCs in contact with the tankyrase / PARPl inhibitor-containing composition for 1 passage.

[0103] In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises a Hedgehog signaling pathway activator. In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises a cAMP agonist. In certain embodiments, the tankyrase / PARPl -inhibitor-containing composition further comprises: a) a Hedgehog signaling pathway activator; and b) a cAMP agonist. In certain embodiments, the Hedgehog agonist is purmorphamine. In certain embodiments, the cAMP agonist is forskolin. In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor- containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the method further comprises contacting the population of hiPSCs with a second tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the tankyrase / PARPl inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: XAV939, IWR-1, G007-LK, JW55, AZ1366, JW 74, NVP- TNKS656 and combinations thereof. In certain embodiments, the GSK3P signaling pathway inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)-2- pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR 99021), 5-Ethyl-7,8- dimethoxy-lH-pyrrolo[3,4-c]isoquinoline-l,3(2H)-dione (3F8), l-(7-Methoxyquinolin-4- yl)-3-[6-(trifluoromethyl)37xpressi-2-yl]urea (A 1070722), N6-[2-[[4-(2,4-

[0104] Dichlorophenyl)-5-(lH-imidazol-l-yl)-2-pyrimidinyl]amino]ethyl]-3-nitro-2,6- pyridinediamine (CHIR 98014), lithium chloride (LiCl), 4-benzyl-2-methyl- 1,2,4- thiadiazolidine-3, 5-dione (TDZD-8), 5-iodo-indirubin-3 '-monoxime (13 'M), N-(4- methoxybenzyl)-N'-(5-nitro-l,3-thiazol-2-yl)urea (AR-A014418) and combinations thereof. In certain embodiments, the MEK signaling pathway inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: PD032590, CI-1040 (PD 184352), cobimetinib (GDC-0973, XL518), Selumetinib (AZD6244), MEK 162, AZD8330, TAK-733, GDC-0623, Refametinib (RDEA119; BAY 869766), Pimasertib (AS703026), RO4987655 (CH4987655), RO5126766, WX-554, HL-085 and combinations thereof. In certain embodiments, the method further comprises culturing the hiPSCs in contact with the second tankyrase / PARPl inhibitor-containing composition for 1 to 10 passages.

[0105] In certain embodiments, the presently disclosed subject matter provides methods for generating a population of progenitor cells comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor- containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of hiPSCs to express DUX4. In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl - inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4.

[0106] In certain embodiments, the presently disclosed subject matter provides methods for generating a population of progenitor cells, comprising contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs to express a cell adhesion molecule. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl - inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen- activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the iPSCs are derived from somatic cells. In certain embodiments, the iPSCs are derived from a non-human animal. In certain embodiments, the non-human animal is a domestic animal. In certain embodiments, the non- human animal is an endangered animal. In certain embodiments, the methods further comprise culturing the population of iPSCs under conditions for forming an organ. In certain embodiments, the organ is a liver, kidney, heart, brain, eye / retinal, placenta, or an entire lympho-hematopoietic organ system. In certain embodiments, the cell adhesion molecule is human or murine.

[0107] In certain embodiments, the cell adhesion molecule is cross-species adhesion molecule. In certain embodiments, the cross-species adhesion molecule is a human-murine cross-species molecule. In certain embodiments, the cell adhesion molecule is a cadherin. In certain embodiments, the cadherin is E-Cadherin. In certain embodiments, the cadherin is murine E-Cadherin.

[0108] In certain embodiments, the presently disclosed subject matter provides methods for generating a population of progenitor cells, comprising contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs to express DUX4. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs to express DUX4. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising leukemia inhibitory factor (LIF). In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF) and b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; and c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor. In certain embodiments, the methods comprise contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl -inhibitor- containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor. In certain embodiments, the population of hiPSCs are engineered to express human DUX4 or murine DUX4.

[0109] In certain embodiments, the presently disclosed subject matter provides methods for cloning a non-human species, comprising: a) obtaining a population of nonhuman induced pluripotent stem cells (iPSCs); and b) generating a population of functionally totipotent blastomere-like stem cells, comprising contacting the non-human iPSCs with a tankyrase / PARPl -inhibitor-containing composition comprising: i) leukemia inhibitory factor (LIF); ii) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; iii) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and iv) a tankyrase / PARP 1 inhibitor; and c) transferring the population of functionally totipotent blastomere-like stem cells to an animal uterus. In certain embodiments, the population of functionally totipotent blastomere-like stem cells possesses efficient in vivo embryonic and extra-embryonic differentiation potential. In certain embodiments, the efficient in vivo embryonic and extra-embryonic differential potential is mediated via PARP -regulated proteogenomic reprogramming of a DUX4-NAN0G epigenetic regulatory axis, via tankyrase / PARPl -regulated reprogramming of conventional human induced pluripotent stem cells (hiPSC) to tankyrase / PARPl inhibitor-regulated naive (TIRN) stem cells. In certain embodiments, the non-human iPSCs are produced from somatic cells. In certain embodiments, the somatic cells comprise skin cells, blood cells, or a combination thereof. In certain embodiments, the non-human species is a domestic animal, a pet species, or an endangered animal. In certain embodiments, the non-human species is genetically modified.

[0110] In certain embodiments, the presently disclosed subject matter provides methods for producing extraembryonic tissue, comprising generating a population of functionally totipotent blastomere-like stem cells, comprising contacting iPSCs with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and culturing the population of induced totipotent TIRN stem cells under conditions for forming an organ. In certain embodiments, the organ comprises placental tissues. In certain embodiments, the iPSCs are human iPSCs. In certain embodiments, the iPSCs are non-human iPSCs.

[0111] 7. EXAMPLES

[0112] The following examples are merely illustrative of the presently disclosed subject matter and should not be considered as limitations in any way.

[0113] Example 1: Proteogenomic Reprogramming to a Functional Human Totipotent Stem Cell State via a PARP-DUX4 Regulatory Axis

[0114] PARP1 and TNKS1 / 2 are PARP family enzymes that catalyze post- translational poly-ADP -ribose (PAR)ylation of protein substrates and play formative roles in regulating chromatin structure, transcription, and ubiquitination in not only adult cells, but also during embryonic development. Chemical inhibition of PARylation impairs the homeostasis and progression of preimplantation embryonic development; failure to degrade PAR is embryonic lethal. TNKS1 / 2 activity controls developmental progression of zygotic genome activation (ZGA), and PARP1 regulates histone ubiquitination, DNA methylation, RNA processing, DNA repair during ZGA, cellular reprogramming, pluripotency, trophoblast specification and chromatin plasticity during preimplantation embryogenesis. Although loss of a single PARP protein minimally impairs development (suggesting redundancy of PARP proteins), compound TNKS1 / TNKS2 and PARP1 / PARP2 knockouts, or dominant-negative PARP1 are embryonic lethal.

[0115] PARP1 and TNKS1 / 2 both possess catalytic and non-catalytic activities via multifunctional protein domains. For example, PARP1 not only ADP-ribosylates SOX2 during cellular reprogramming and pluripotency, but also binds chromatin at its non- catalytic DNA-binding domain to facilitate the pioneer activities of SOX2. TNKS 1 / 2 proteins similarly mediate non-PAR-catalytic activities such as DNA repair regulation and pexophagy / autophagy. Furthermore, the catalytic activities of TNKS and PARP1 deeply impact homeostasis of the proteome (proteostasis) during embryogenesis, via extensive networks of post-translational PAR-dependent ubiquitination (PARdU). PARdU impacts the longevity and stability of histones and transcription factors via the ubiquitin-proteasome system (UPS), thus indirectly regulating developmental progression, ZGA, and pluripotency. For example, protein stability of the WNT signaling ligand Axinl is regulated by TNKSl / 2-mediated PARylation of E3 ligase RNF146, which ubiquitinates Axinl for subsequent UPS degradation. Direct control of the stability and assembly of the proteasome 26S subunit itself by TNKS ADP-ribosylation has also been suggested. Beyond the UPS, post-translational, UPS-independent ubiquitination structurally regulates chromatin / hi stone architecture, and transcription factor DNA binding (including of the core pluripotency factors NANOG, OCT4 and SOX2). Indeed, the ubiquitin machinery itself (e.g., ubiquitin ligases and deubiquitinases (DUBs)) which write and erase the proteome’ s ‘ubiquitin code’ during embryonic development, are regulated by PARP1 -mediated PARylation.

[0116] Several studies have employed chemical PARP inhibition to expand pluripotency and improve the chimeric contribution of mouse embryonic stem cells (mESC) into embryos, or to improve functional pluripotency. Zimmerlin et al., Development 143:4368-1380, demonstrated that primed, conventional human pluripotent stem cells (hPSC) were chemically reverted to anaivee epiblast-like pluripotent state with improved differentiation potential via a two-step chemical reprogramming system (‘LIF-5i -> LIF-3i’; Figure 9A), that comprised of sequential culture with LIF and five small molecules (i.e., Hedgehog signaling activation, cAMP agonism, GSK3P inhibition, MEK inhibition, and nonspecific TNKS 1 / TNKS2 / P ARP 1 inhibition (XAV939). Sequential naive reversion with continuous exposure to XAV939 reprogrammed a large repertoire of >25 conventional lineage-primed hPSC to tankyrase / PARPl inhibitor-regulated naive (TIRN) stem cells. TIRN cells possessed high clonal proliferation, phosphorylated-STAT3 signaling, MEK- ERK / bFGF signaling independence, modulation of P-catenin expression, and erasure of lineage-primed gene expression. TIRN cells also maintained normal karyotypes and imprinted CpG patterns, and were devoid of irreversible demethylation defects that were reported in naive reversion systems, and suggested to be secondary to prolonged MEK inhibition. Reversion to TIRN cells eliminated interline variability and significantly enhanced the multi-lineage differentiation performance of isogenic primed hPSC differentiation; without requirement for transitioning back to primed culture conditions to restore differentiation potency. Although XAV939 is a TNKS inhibitor of the canonical WNT pathway (e.g., via TNKS-mediated PARdU of Axinl), it is a promiscuous small molecule that inhibits in vitro PARylation activities of not only TNKS1 and TNKS2 (IC50 -5.2-94.6 nM), but also PARP1 and PARP2 (IC50 -26.9-169 nM). Thus, XAV939 is expected to inhibit both PARP1 and TNKS 1 / 2 at the supra-micromolar concentrations used by Zimmerlin et al; with potential impact on broad biological processes dependent on ADP- ribosylation.

[0117] The present disclosure demonstrates that XAV939-treated TIRN stem cells were globally inhibited in both TNKS and PARP1 PARylating activities. TNKS 1 / 2 protein levels were increased while PARP1 protein levels decreased in TIRN cells; potentially defining a novel functional PARP protein equilibrium. PAR-deficient TIRN cells underwent a global ubiquitinome reprogramming that was driven by hundreds of PARP 1 and TNKS 1 / 2 targets; including core factors NANOG and SOX2, and epigenetic modifiers. Unexpectedly, XAV939-mediated TIRN reprogramming activated simultaneous, single-cell coexpressions of ZGA-priming (e.g., TPRXL) and DUX4 gene targets, as well as a panoply of PARP 1 -regulated lineage-specifying transcriptional factors. TIRN cells possessed totipotent-like functionality including efficient capacity to contribute differentiated human cells into both embryonic and extraembryonic tissues of human-murine chimeras, and efficient generation of trophoblast stem cells (TSC) with in vivo placental potency. TIRN cells underwent a genome-wide epigenetic reprogramming driven by reduction and redistribution of PARP1 chromatin co-binding to core pluripotency factors NANOG / SOX2 / OCT4 (NSO) at gained promoter, intragenic, and distal enhancer sites of 8C- and morula-associated genes (e.g., EBF2, H0XB2, GATA6). A cohort of gained NSO and PARP1 (NSOP) co-binding enhancer sites were identified near transcriptionally active, as well as distal regions of DUX4-accessible chromatin. Remarkably, these gained NSOP- DUX4 co-binding sites were further enriched in co-binding motifs for hundreds of the same embryonic and extraembryonic lineage-determining pioneer factors that were concurrently co-expressed in TIRN cells, demonstrating the discovery of candidate totipotencyregulating chromatin regions.

[0118] Methods

[0119] Conventional, primed (E8) and TIRN (LIF-3i) cultures of hESC and hiPSC. All hESC and hiPSC lines used in these studies were maintained and expanded either in conventional Essential 8 (E8) medium or chemically reverted with the LIF5i -> LIF-3i TIRN method (Figure 9A). Conventional, primed cultures were propagated using an in-house E8 medium formulation consisting of DMEM / F-12 supplemented with 2.5 mM L-Glutamine, 15 mM HEPES and 14 mM sodium bicarbonate, 50-100 ng / mL recombinant human FGF- basic, 2 ng / mL recombinant human TGF-pi, 64 pg / mL L-ascorbic acid-2-phosphate magnesium, 14 ng / mL sodium selenite, 10.7 pg / mL recombinant human transferrin, and 20 pg / mL recombinant human insulin. Primed hPSC were cultured in E8 on Vitronectin XF matrix-coated tissue culture-treated 6-well plates and passaged every 5-6 days by non- enzymatic reagents, i.e., Versene solution or Phosphate-Buffer-Saline (PBS)-based enzyme- free cell dissociation buffer. TIRN-reverted stem cell cultures were stably propagated following LIF-5i adaptation using ‘LIF-3i’ medium, which consists of DMEM / F-12 supplemented with 20% KnockOut Serum Replacement (KOSR), 0.1 mM MEM non- essential amino acids (MEM NEAA), 1 mM L-Glutamine, 0.1 mM P-mercaptoethanol, 20 ng / mL recombinant human LIF, 3 pM CHIR99021, 1 pM PD0325901, and 4 pM XAV939. TIRN cells were first chemically-reverted from isogenic, primed E8 medium-expanded primed hPSC cultures using a single adaptation step in ‘LIF-5i’ medium (i.e., LIF-3i medium supplemented with 10 pM Forskolin, 2 pM purmorphamine and 10 ng / mL recombinant human FGF2). Briefly, 4-to-5 -day-old primed hPSC E8 cultures were switched to LIF-5i +FGF2 medium for 12-24 hours, enzymatically dissociated (Accutase), and transferred onto irradiated mouse embryonic fibroblast (MEF) feeders in LIF-5i medium for only 3 to 5 days. All subsequent passages were grown in LIF-3i (TIRN) medium alone on MEF feeders and passaged as single cells using Accutase. Isogenic E8 (primed) vs LIF-3i (TIRN) cultures were maintained in parallel passage number for simultaneous phenotypic characterization, as previously described. Parallel isogenic hPSC samples were prepared for all downstream analytical analyses, following at least 5-7 passages in TIRN conditions, by collecting cells using a 1 : 1 Versene / Accutase mixture (5 min at 37°C) and passing through a 100 pm cell strainer. All hPSC samples used in analytical RNA / genomic / protein studies were first quality-verified for >90-95% cellular viability (Trypan blue) before sample collections and were also verified by flow cytometry for undifferentiated cell identity (e.g., >95% TRA-1-81+SSEA4+ expression).

[0120] Transgenic stem cell lines. The pCW57.1-DUX4-CA lentivector plasmid was purchased from Addgene (#99281); packaged and purified lentiviral particles were produced by SignaGen Laboratories. pCW57.1-DUX4-CA lentiviral particles were transduced into primed RUES2. The CMV-Luciferase-EFla-copGFP-T2A-Puro BLIV 2.0 Lentivector (SBI, BLIV513VA-1) was transduced into primed RUES1. A PiggyBac transposable vector expressing murine E-cadherin with mCherry fusion (Addgene 71366) was created by using the Gateway recombination system and pAC 150-PBLHL-4xHS-EF 1 a- DEST (Addgene 48234) destination vector and was integrated into primed RUES2. The LV- EFla-tdTOMATO-IRES-NEO (SignaGen Laboratory, SL100201) tdTomato was transduced into primed RUES2 and RUES2-mEcadherin transduced lines. Stable transfectants were selected by supplementing E8 medium with 0.5 pg / mL puromycin or 100 pg / mL hygromycin continuously. Stable clones were validated and selected based on GFP / tdTomato expression by fluorescent microscopic and flow cytometric analysis.

[0121] Flow Cytometry and Immunofluorescence of hPSC. Sample Preparation. Primed and TIRN hPSC were collected with Versene / Accutase (1 : 1) to diminish MEF feeder carryover in the LIF-3i condition. Cells were washed once with PBS, filtered through a 70 pm cell strainer to discriminate against doublets and counted with the Countess cell counter. For each staining, single cell suspensions (<lxl06cells in 100 pL) were incubated for 20 min on ice with directly conjugated mouse monoclonal anti-human antibodies or the appropriate isotype controls. Stained cells were washed with 3mL PBS and filtered through a 40pm cell strainer prior to acquisition using a FACSCalibur flow cytometer and the BD CellQuest Pro analytical software or a Beckman Coulter Cytoflex flow cytometer. The FlowJo analysis software (Tree Star vlO) was used for offline data analysis and Figure preparation. Cell debris and aggregates were excluded from the analysis based on their light scatter profile.

[0122] Surface marker expressions flow cytometry, hPSC were re-suspended into solution using Enzyme-Free Cell Dissociation Buffer. Cells were washed in PBS and 100,000-cell aliquots were incubated for 20 minutes on ice with directly conjugated antibodies or matching isotype controls. Antibodies included mouse monoclonal antihuman CD24-PE, CD77-FITC, CD90-PE, HLA-ABC-APC, SSEA4-APC, TRA-1-81-PE, and TRA- 1-81 -Alexa Fluor 647. Stained cells were washed using PBS and filtered through a 40 pm cell strainer prior to acquisition using a FACSCalibur flow cytometer and the BD CellQuest Pro analytical software. The FlowJo analysis software (Tree Star) was used for offline data analysis and Figure preparation. Cell debris and aggregates were excluded from the analysis based on their light scatter profile.

[0123] Immunofluorescence staining on chamber slides and culture plates. Isogenic hPSC cultures and TIRN-derived TSC were passaged at 30,000 cells per cm2and expanded for 4-6 days in 8-well Lab-Tek II chamber slides in their respective media onto Vitronectin- XF matrix (primed E8), over a mouse feeder monolayer (TIRN LIF-3i / MEF) or 0.1% gelatin (TSC). For embryo explant cultures, see embryo culture explant section for culture plate and sample preparation. Cells were washed with PBS, fixed using 2% formaldehyde solution in PBS for 15 minutes at 4°C, washed with PBS and maintained in sterile PBS at 4°C until immunostaining. All samples were incubated for one hour in blocking solution (either PBS, 5% goat serum and 0.05% Tween 20 or TBS, 0.1% Triton X-100, 5% goat serum). All antibody dilutions were performed in their corresponding blocking solution to reduce non-specific binding. Cells were incubated overnight at 4°C in humid chambers with primary unconjugated antibodies. The next day, the slides were washed 3 times for 5 minutes (IX Dako Wash buffer or TBS-T) and incubated for 1 hour at room temperature with the diluted Alexa488, Alexa555 or Alexa647 highly cross-adsorbed secondary antibody corresponding to the primary antibody host species. Cells were washed 3 times. For dual-antibody staining, samples were incubated with a second primary antibody that was either directly conjugated or raised from a distinct species (i.e., rabbit vs. mouse) for 2 hours at room temperature, wells were washed 3 times for 5 minutes in Dako wash buffer, and, if the second primary antibody was unconjugated, incubated for 1 hour at room temperature with a diluted highly cross-adsorbed secondary antibody corresponding to the second primary antibody host species. Cell nuclei were stained with 10 pg / mL 4', 6- diamidino-2-phenylindole (DAP I) for 5-10 minutes at room temperature. Cells were washed 3 times with PBS, the wells were separated from the slide, and the slides were mounted with a coverslip using Prolong Gold or Glass Antifade Reagent. The mounting reagent was left to cure overnight at room temperature in the dark. Immunostains were imaged with a Nikon Eclipse TE 2000-U or using a Zeiss LSM 510 Meta Confocal Microscope. Isotype controls for mouse and rabbit IgG replaced corresponding primary antibodies at matching concentrations as negative controls and were imaged using identical settings.

[0124] Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR). Isogeni c primed and TIRN hPSC were simultaneously prepared and collected with Versene- Accutase, as described above. Additionally, primed and TIRN RUES02 cells expressing transgenic DUX4 were prepared after 24 hours supplementation with doxycycline. Total RNA was extracted from snap-frozen cell pellets using the RNeasy Mini Kit according to the manufacturer’s protocol. DNase digestion was performed in-column to eliminate genomic DNA. Total RNA concentration and purity were measured using a NanoDrop spectrophotometer. For each sample, 2 pg of RNA was reverse transcribed with the SuperScript VILO cDNA Synthesis Kit according to the manufacturer’s protocol and a MasterCycler EPGradient thermocycler. Diluted cDNA samples (either 1 : 10 or 1 :20 in nuclease-free water) were admixed either with TaqMan gene expression assays and TaqMan Fast Advanced Master Mix or with relevant primers and Power SYBR Green Master Mix for quantitative real-time PCR amplification using the ViAA7 Real Time PCR System. Relative gene expression was calculated using the AACt method, using ACTB expression assay primed samples as controls.

[0125] For time-course molecular analyses, feeder-dependent hPSC cultures were MEF-depleted by pre-plating onto gelatin-coated plates for 1 hour at 37°C as previously described. Samples were sequentially and simultaneously collected from 3 representative hPSC lines in primed conditions (10 ng / mL FGF2), after adaptation for 24 hours in LIF-5i, atlhe 1st passage in LIF-5i (pl) and atlhe 3rdor 4th passages in LIF-3i (p>3). Total RNA was isolated from snap-frozen samples using the RNeasy Mini Kit following the manufacturer’s instructions and quantified using a Nanodrop spectrophotometer. Genomic DNA was eliminated by in-column DNase digestion. Reverse transcription of RNA (1 pg / sample) was accomplished using the SuperScript VILO cDNA Synthesis Kit and a MasterCycler EPgradient. For real-time PCR amplification, diluted (1 :20) cDNA samples were admixed to the TaqMan Fast Advanced Master Mix and the following Taqman gene expression assays: DNMT3L (Hs01081364_ml), GAPDH (Hs99999905_ml), KLF2 (Hs00360439_gl), NANOG (Hs02387400_gl), and NR5A2 (Hs00187067_ml). For analysis of HERV-H expression, diluted (1 :50) cDNA samples were amplified using the Power SYBR Green Master Mix and the following primers: GAPDH forward GGTCATCCATGACAACTTTGG and reverse ACAGTCTTCTGGGTGGCAGT, HERV- H pol forward CGCCCTTCTTCCCAATCCAA and reverse GCCAAGGAGGGAGTAGAGGT. Samples were amplified in technical triplicates and real-time fluorescence detection was achieved using a ViAA7 Real Time PCR System. Relative quantification of gene expression for each time point was normalized to GAPDH and isogenetically compared to starting primed samples using the AACt method.

[0126] Non-Quantitative RT-PCR. Collection and freezing of cell pellets, RNA extraction, DNase digestion, and total RNA quantification were performed, as described above. Briefly, 2 pg of total RNA was reverse transcribed using the SuperScript VILO cDNA Synthesis Kit according to the manufacturer’s protocol. Thermo-cycling was performed in a MasterCycler EPGradient. For the PCR amplification of the DUX4 Transgene and GAPDH, 1 pL of 1 : 10 diluted cDNA was mixed with Platinum Taq DNA Polymerase, 10X PCR Buffer - MgCh, 50 mM MgCh (Invitrogen), lOmM dNTPs, forward and reverse primers, and nuclease-free water. The MasterCycler EPGradient was used to amplify each mixture for 35 PCR cycles at an annealing temperature of 55°C. Amplified DNA was mixed with 6X loading dye, and 10 pL of this product was loaded into each lane of a 1.5% agarose gel.

[0127] Western blotting. Whole Lysate Western Blotting. Cells were collected from parallel primed (E8 medium) and TIRN (LIF-3i / MEF) using Versene / Accutase (1 : 1 mixture) solution. Cells were washed in PBS pH 7.4 and pelleted. Cell pellets were lysed using lx RIPA buffer, ImM EDTA, lx Protease Inhibitor, and quantified using the Pierce bicinchoninic acid (BCA) assay kit. For each sample, 25 pg of protein was loaded on a NuPage Bis-Tris, 4-12%, 1.5mm precast gel for electrophoretic separation according to manufacturer’s protocols. The gel was transferred to a PVDF membrane using the iBlot2 / iBlot3 systems. Samples were blocked in Tris-buffered saline (TBS), 5% non-fat dry milk, 0.1% Tween-20 (TBS-T) for 1 hour and incubated overnight at 4°C with primary antibody using gentle agitation. Membranes were rinsed 3 times in TBS-T, incubated for 1 hour at room temperature with either horseradish peroxidase (HRP)-linked goat anti-rabbit secondary antibody or HRP -linked horse anti-mouse secondary antibody for rabbit and mouse sourced antibodies, respectively, then rinsed 3 times. The membranes were developed using the Pierce ECL Western Blotting Substrate. Chemiluminescence detection was imaged using an Amersham Imager 600. Equal protein loading was verified for each membrane using a control antibody (e.g., anti-Actin).

[0128] Subcellular Fraction Western Blotting. Parallel isogenic hPSC were expanded in primed (E8) and TIRN (LIF-3i) culture systems and isolated using Enzyme- Free Cell Dissociation Buffer. After one wash in PBS, cell pellets were snap frozen in liquid nitrogen and stored at -80°C until analysis. Whole cell lysates were prepared using RIPA buffer, ImM EDTA, lx Protease Inhibitor for 15 minutes on ice. For histones, PRC1 and PRC2 proteins, lysis buffer was supplemented with 10U of benzonase nuclease and 4°C, 30 min gentle continuous agitation. Protein fractions were isolated using the Subcellular Protein Fractionation Kit for Cultured Cells according to the manufacturer’s protocol. The protein content was quantified using the Pierce BCA assay method. For each assay, 25 pg of total protein were loaded into a pre-cast NuPAGE 4-12% Bis-Tris gel. Protein separation was performed by electrophoresis (100V, 2 hours) using the Novex Mini Cell electrophoresis system. Proteins were transferred onto nitrocellulose membranes using iBlot2 NC Mini stacks and the iBlot2 blotting system. Alternatively, proteins >150kDa (i.e., DNMT1) were slowly (60V, 2 hours) transferred at 4°C, onto PVDF membranes using the Mini PROTEAN Tetra Cell system. Membranes were first incubated for 1 hour at ambient temperature in blocking solution consisting of Tris Buffer Saline (TBS), 0.1% Tween-20 (TBST), 5% nonfat dry milk to block unspecific antibody binding. Membranes were washed 3 times in TBST and then incubated overnight at 4°C with primary antibodies that were diluted in blocking buffer (mouse primary antibodies) or in TBST, 5% BSA (rabbit primary antibodies). Membranes were washed 3 times with TBST and incubated for 1 hour at room temperature with horseradish peroxidase (HRP)-conjugated secondary anti-mouse or antirabbit antibodies (1 : 1000 in blocking buffer). After 3 washes in TBST, samples were exposed to Pierce ECL Substrate or Amersham ECL Substrate for chemiluminescent detection of proteins. For all Western blotting experiments, detection of actin and / or HSP90 was performed to control for equal loading of proteins. Membrane exposure and chemiluminescence detection were achieved using an Amersham Imager 600 (Amersham).

[0129] AF1521 PAR Resin Pulldown Western Blotting. Cells were collected and pelleted as previously described. For AF1521 pulldown, cell pellets were lysed in a buffer containing 50 mM Tris, pH 8, 200 mMNaCl, 1 mMEDTA, 1% Triton X-100, 10% glycerol, 1 mM DTT, 0.5% deoxy cholate, and lx protease inhibitor and quantified using the Pierce bicinchoninic acid (BCA) assay kit. For each sample (1 mg of protein), the ADP ribosylated fraction was separated the Afl521 Macrodomain Affinity resin set following the manufacturer protocol. The Afl521 pulldown product (20 pL per sample) was directly used for Western blot analysis as described above.

[0130] DNA damage response (DDR) and H2O2 oxidative stress assay Western Blotting. To evaluate DNA damage, responses, isogenic primed and TIRN hPSC were cultured in their respective medium supplemented with 100 ng / mL of the radiomimetic agent neocarzinostatin (NCS) for 6 hours. Untreated hPSC were analyzed in parallel as controls. AF1521 pulldown and western blot analysis were performed as described above. To evaluate oxidative stress response, isogenic primed and TIRN hPSC were cultured in their respective medium supplemented with 100 pM hydrogen peroxide solution for 24 hours. Untreated hPSC were analyzed in parallel as controls. Western blot analysis was performed as described above.

[0131] Proteasome Inhibitor MG-132 Western Blotting. To evaluate proteasomal activity, isogenic primed and TIRN hPSC were cultured in their respective medium supplemented with 62.5 nM proteasome inhibitor MG-132 for 24 hours, as previously described for hESC. Control hPSC were analyzed simultaneously as controls. Western blot analysis was performed as described above.

[0132] Mesodermal differentiation for PAR / PARP1 kinetics. Differentiation of primed vs TIRN stem cells was performed using a modified protocol based on the STEMdiff APEL-Li medium system. APEL-2Li medium was supplemented with Activin A (25 ng / mL), VEGF (50 ng / mL), BMP4 (30 ng / mL), and CHIR99021 (1.5 pM) for the first 2 days, and then APEL-Li that was supplemented with VEGF (50 ng / mL) and SB431542 (10 pM). Samples were collected using Accutase and immediately transferred in appropriate lysis buffer for Western blotting and Afl521 pull-down at 24hours, 48 hours and 96 hours.

[0133] Trophectoderm Stem Cell Differentiation. TSC were derived from TIRN stem cells using a modified published protocol. TSC medium consisted of DMEM / F-12 supplemented with 2.5mM L-Glutamine, 15 mM HEPES and 14 mM sodium bicarbonate, 0.1 mM P-mercaptoethanol, 0.2% embryonic stem-cell grade FBS, 0.3% bovine serum albumin, 1% ITS-X supplement, L-ascorbic acid (1.5 pg / mL), EGF (50 ng / mL), CHIR99021 (2 pM), A83-01 (0.5 pM), SB431542 (1 pM), valproic acid (0.8 mM), Y27632 (2.5 pM), FGF10 (50 ng / mL), HGF (50 ng / mL) and Noggin (20 ng / mL). TSC medium was changed every 2-3 days and TSC were passaged about once a week using Trypsin-EDTA. Samples were collected using Trypsin-EDTA and immediately transferred in lysis buffer (western blot) after 1 week (TSC passage 0; pO) and subsequent passages, or alternatively TSC were transferred for 1 passage onto 0.1% gelatin-coated 8-well Nunc Labtek II chamber slides (100,000 cells per slide) for immunostaining (fixation for 15 minutes using 2% formaldehyde in PBS).

[0134] Injection of TIRN cells into murine 8C-16C embryos and blastocyst embryos and processing of human-murine chimeric feti. Generation of human-murine fetal chimeras. Chimeric experiments employed either GFP+ RUES1, tdTomato+ RUES2 or tdTomato+mCherry+ RUES2 expressing constitutively murine E-Cadherin). Prior to all interspecies chimera experiments, RUES1 and RUES2 cells were transitioned from E8 to LIF-3i for 4 to 7 passages. Puromycin was omitted the last passage before injection to ensure optimal viability of hPSC reporter clones. Expression of fluorescent proteins was verified and documented by photomicrographs using an epi-fluorescence microscope (Nikon Eclipse TE 2000-U). In addition, for some experiments, non-transduced RUES2 cells were prelabeled with the live stain Hoechst 33342 (1 :2000 in TIRN medium, 10 minutes). TIRN- hPSC were gently dissociated using PBS-based enzyme-free cell dissociation buffer and maintained in DMEM / F-12, 20% KOSR O.lmM MEM non-essential amino acids, ImM L- Glutamine, 0. ImM P-mercaptoethanol, 20 ng / mL recombinant human LIF prior to injection. Uniform expression of fluorescent proteins was validated by flow cytometry analysis using a FACSCalibur flow cytometer. Embryo injections were performed by the Transgenic Core Laboratory at Johns Hopkins, Baltimore, MD. For most experiments, E2.5 (4 to 16 cells) or E3.5 C57BL / 6J host embryos were collected by flushing uterine horns of super-ovulated females the day of injection. 5-7 stem cells were injected under the zona pellucida in the inner space of noncompacted 8-16-cell embryos or into the blastocoel cavity of blastocysts. Pseudopregnant ICR females were picked in estrus and mated with vasectomized males the day before (E0.5 pseudopregnant) or 2 days before (E2.5 pseudopregnant) embryo transfer. 5-7 stem cells were microinjected into host mouse embryos in a drop of KSOM under mineral oil. Injected embryos were maintained in KSOM prior to transfer into foster mothers. ~10 embryos were transferred into the oviduct (E0.5 foster recipient) or the uterine horn (E2.5 foster recipient) of pseudopregnant females. Fetuses were recovered at E9.5, El 1.5, E12.5 or E14.5 from the uterine horns of the foster mothers. For each implantation site, fetuses were separated from the uterine wall using surgical forceps and iris scissors. Fetal and placenta / decidua tissues were gently dissected within a stem cell workstation and live fluorescence was documented for transgenic hPSC (Nikon Eclipse TE 2000-U).

[0135] Immunostaining of human-murine chimeric preimplantation embryos. Preimplantation murine embryos injected with human TIRN stem cells were maintained in KSOM drops under oil and fixed using 1% formaldehyde in PBS for 10 min at 4°C. For immunofluorescent staining, embryos were carefully manipulated using stripper tips within a stem cell workstation cabinet under microscope. All staining procedures were similar to protocols detailed for Labtek chamber slides above, but with reduced volume. For each wash / incubation step, embryos were transferred between 50-100 pL drops under oil in a 30 mm dish or directly onto 2-well Lab-Tek coverslips. After immunostaining, embryos were mounted with a coverslip using Prolong Glass Antifade Reagent and imaged using confocal microscopy at the Wilmer Eye Institute Imaging Core Facility, Baltimore, MD.

[0136] Whole-mount 3D-imaging of immunostained human-murine chimeric embryos. For whole-mount 3D imaging, isolated embryos were individually placed into 1.5 mL Eppendorf tubes for fixation and staining. Embryos were rinsed in PBS, 5% goat serum, and fixed with freshly prepared PBS, 2% formaldehyde (1-2 mL per embryo for 20 minutes in ice).

[0137] Embryos were dehydrated on ice with 50% methanol / PBS for 10 minutes, followed by incubation in 100% methanol for 10 minutes. While embryos were in 100% methanol, they were transferred to chamber slides for imaging. The methanol was gently removed from the well without disturbing the embryo, and a 1 : 1 BABB (one part benzyl alcohol with two parts benzyl benzoate) / methanol mixture was added. This solution was gently discarded and the 1 : 1 BABB / methanol mixture was reapplied for two more washes before switching to 100% BABB solution. The BABB solution was also repeatedly replaced until the embryo was clear and ready for image analysis.

[0138] Human cells were detected directly with anti-human nuclear antigen (HNA) with or without anti-P-tubulin III antibody (clone TUJ1) co-staining to co-localize the neural system. Briefly, embryos were permeabilized with 0.1% Triton-X-100 in TBS solution (TBS-T), 5% goat serum for 1 hour on ice. All primary and secondary antibody were diluted in blocking solution and incubated overnight at 4°C with at least 3 one-hour washes in TBST-T between each incubation with gentle agitation. After the final wash in TBS-T, embryos were incubated for 30 min with DAPI (1 :500) and washed again in TBS-T.

[0139] Cryosections. For immunofluorescent staining of embryo / placenta cryosections, embryos or placentae were fixed in PBS, 2% formaldehyde for 15-35 min depending on the stage and size of embryos and washed in PBS. Embryos were incubated in 30% sucrose solution prior to cryopreservation in Tissue-Tek O.C.T compound solution after immersion in 2-Methylbutane chilled with dried ice. Frozen embedded tissues were sectioned 8 pm cryosections using cryostat at the Wilmer Eye Institute Imaging Core Facility. Tissue sections were stained using the protocol above. Embryos were imaged using confocal microscopy.

[0140] Detection of human chimerism by genomic DNA PCR and RT-PCR. Feti and placentae were carefully dissected out from the uterine wall at E9.5, E12.5 or E14.5 and individually transferred into sterile Eppendorf tubes. Tissues were centrifuged at 500g, supernatant was discarded, and samples were snap-frozen in liquid nitrogen and stored at - 80°C. DNA / RNA samples were isolated using the ZR-Duet DNA / RNA Miniprep kit according to manufacturer’s recommendation. Tissues were resuspended in DNA / RNA lysis buffer and homogenized using single-use RNase-free, DNase-free micro-pestle tips and a Bel-Art micro-tube homogenizer. DNA and RNA samples were purified using ZymoSpin columns, eluted in DNase / RNase-free water and quantified using a Nanodrop spectrophotometer.

[0141] For genomic DNA analysis, the detection of human DNA was performed using a sensitive mitochondrial DNA detection assay according to published methods. For each sample and assay, 25 ng DNA were amplified in triplicates in 384-well plates using the Power SYBR green master mix and a ViAA7 Real Time PCR System with a set of primers that amplify a human specific mitochondrial fragment. A second set of primers was used to amplify a specific ultra-conserved non-coding element (UNCE) as an invariant endogenous control to correct for sample-to-sample variations and errors. Relative quantification was determined by the AACt method. Non-injected embryos were amplified in parallel and the frequency of human cells was estimated using genomic DNA standard curves created using human-mouse serial dilutions of hPSC and mouse cells genetically matched to the tested samples.

[0142] For detection of human RNA transcripts in human-murine chimeric feti, 2 pg of total RNA that were isolated from all samples of cross-species fetuses and placentae were retro-transcribed using the superscript IV VILO master mix. For real-time PCR amplification, diluted (1 :20) cDNA samples were admixed to the TaqMan Fast Advanced Master Mix and Taqman gene expression assays. Each sample was simultaneously amplified in triplicates using human specific (GAPDH: Hs99999905_ml, ACTB: Hs99999903_ml) and human-mouse non-specific (GAPDH: Hs02758991_gl ACTB Hs03023880_gl) primer-probe sets. All samples that displayed human genomic DNA above non-injected control embryos were cross-validated for mRNA analysis and the frequency of human cells was estimated using mRNA / cDNA standard curves that were created using human-mouse serial dilutions of hPSC and mouse cells genetically matched to the tested samples. Real time fluorescence detection was performed using a ViAA7 Real Time PCR System.

[0143] For all genomic DNA and mRNA experiments, each individual 384 well plate included a minimum of 3 stage-matched non-injected control mouse embryos and a 12-14 point serial dilution of human-mouse cells to create standard curves for each individual plate and eliminate experimental variations.

[0144] In vitro expansion of puromycin resistance transgene-expressing human hematopoietic and neural cells from human-murine chimeric feti. For in vitro expansion of puromycin-resistant hematopoietic lineages, E12.5 and E14.5 embryo fetal livers were separated, gently pipetted to disaggregate, and plated onto human fibronectin-coated plates (10 pg / mL / well) in endothelial growth medium 2 (EGM2). After cultures were established in EGM2, the medium was switched to StemSpan SFEM supplemented with 50 ng / mL Flt3 - ligand, 50 ng / mL TPO, 50 ng / mL c-kit ligand (SCF), 20 ng / mL IL2, 20 ng / mL IL6, 50 ng / mL GCSF, 3 units / mL EPO and 0.5 ug / mL puromycin. Medium was replaced every 2-3 days and analyzed 6 weeks after ex vivo culture by flow cytometry (GFP, human CD34, hHLA) and immunofluorescence (HNA) according to the protocols described above. For in vitro expansion of puromycin-resistant neural lineages, heads of chimeric E12.5 embryos were minced, digested in 0.05% Trypsin and plated on Matrigel- coated plated with PSC neural induction medium (NIM). After adherent cells reached 60- 70% confluency, NIM was supplemented with 0.5 ug / mL puromycin. Cells were passaged every 7-10 days with continuous puromycin throughout 6-week ex -vivo expansion. Puromycin concentration was increased to 1 mg / mL once the explants were established to further select human cells. Occasionally, retinal pigmented epithelial (RPE) cells were observed within neural cultures (not shown).

[0145] Human cell identity was validated by immunofluorescence to detect HNA and NFM according to the protocol described above.

[0146] Flow cytometric analysis of human-murine chimeric fetal cells. Single cell preparations of E7.5 embryos and hematopoietic explants for direct flow cytometric analysis of GFP expression were prepared using either 0.05% trypsin-EDTA or Accutase for 5 min at 37°C.

[0147] Bioinformatics. The NIH and ArrayExpress accession numbers of the data that was analyzed herein include: GSE141639 (bulk RNA-seq of primed and TIRN hPSC) 3, E-MTAB-3929 (scRNA-Seq of human embryos; Petropoulos et al, 2016), GSE197265 (Ribo-seq and RNA-seq of human embryos; Zou et al, 2022), GSE74111 (RNA-seq of ParplKO mESC (Liu and Kraus, 2017), GSE95515 (DUX4 ChlP-seq in hiPSC; Hendrickson et al, 2017). Annotations for transcription factors (Lambert et al, 2018), for PARP1 and TNKS substrates (Ayyappan et al, 2021, Li et al, 2017, Nie et al, 2020, Bhardwaj et al, 2017) were compiled from published datasets.

[0148] Bulk RNA-Sequencing Studies. Isogenic hPSC samples were prepared as described above, washed in PBS and cell pellets (1-2 million cells) were snap-frozen. mRNA isolation was conducted and strand specific mRNA libraries were prepared. Briefly, mRNA poly-A selection and RNA library were prepared using NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina. Stranded mRNA libraries were sequenced on an Illumina Novaseq 6000 instrument using 50bp paired-end dual indexed reads. Raw data in Figure 1 was published with NIH Gene Expression Omnibus accession number GSE141639 and was realigned to hg38. Reads were aligned to GRCH38 using STAR (version 2.7.10a) Python software. An index for the hg38 genome was prepared using the Homo_sapiens.GRCh38.dna.primary assembly. fa fastq file and the human hg38 Ensembl v!09 annotation gtf file (Homo_sapiens.GRCh38.109.gtf). Read alignment was executed using STAR with the following options: -outSAMtype B M Unsorted SortedByCoordinate -quantMode TranscriptomeS AM GeneCounts. Summarized experiment objects were created using the R packages ‘Rsamtools’, ‘GenomicFeatures’ and ‘GenomicAlignments’ : summarizeOverlaps (features=exonsByGene, reads=bamfiles, mode=“Union”, singleEnd=FALSE, ignore. strand=FALSE, fragments=TRUE). Differential expression analysis was executed using the R package DESeq2. Ensembl IDs were converted to gene symbols using the AnnotationHub package and current Ensb.Hsapiens objects (e.g., vl 10). Transcription factors annotations were obtained from a published database, k-mean clustering was performed of RNA-seq data of human preimplantation embryos using average FPKM counts 1 and the ‘pheatmap’ R package (kmeans k =6). A preZGA gene cluster was defined as the combined gene selection identifying 1C, 2C and 4C samples, as well as 8C, ICM and hESC clusters specific to the corresponding cell-staged embryos. Volcano plots were created using the R package ‘enhanced Volcano’. Scatter plots and MA plots were generated using ‘ggplot2’. Euler diagrams were generated using the ‘eulerr’ R package. For heatmaps, a matrix of mean-subtracted regularized log counts was generated using ‘DESeq2’. Batch effects were removed using the package Timma’ removeBatchEffect command and heatmaps were constructed using the ‘Complex Heatmap’ R package. Differential expression of transposable elements was executed using the TEtranscripts Python package -ing — sort-Pos — forma-BAM —mode multi and the GRCh38_rmsk_TE.gtf and hg38_rmsk_TE.gtf gtf files.

[0149] Parpl KO mESC RNA-Seq data was obtained from NTH Gene Expression Omnibus accession number GSE74111. Reads were aligned to GRCm39 using the STAR software similarly to the human data. An index was prepared using the Mus_musculus.GRCm39.dna.primary assembly. fa fastq file and the mouse GRCm39 Ensembl vl l l annotation gtf file (Mus_musculus.GRCm39.11 l.gtf). A count matrix was directly constructed using STAR read counts. A matrix of mean-subtracted regularized log counts was generated using ‘DESeq2’. Orthologous human genes were annotated using BioMart.

[0150] Single cell RNA sequencing. For single cell RNA-seq studies, 10X Chromium barcoding, library construction and sequencing (Single ’ell 3' v3) were performed. Concurrent RUES02 cultures in E8 (primed) and LIF-3i (TIRN; TIRN +iDUX4 after 24 hours supplementation with 2 pg / mL doxycycline) were gently collected using a mixture 1 : 1 Versene / Accutase and pass through a 70 pm cell strainer. Viable cells were enriched using the MACS Dead Cell Removal Kit and prepared in PBS, 0.4% BSA. Cell quality check (cell viability >95%, cell diameter) was verified before preparing libraries. A low sequencing depth MiSeq run was used to assess quality control (Q30 Bases >96%). 10X libraries were sequenced on an Illumina Novaseq 6000 instrument (28x8x91 run configuration).

[0151] A custom hg38 reference genome was built using the Cell Ranger Linux software to align sequenced reads to a more inclusive up-to-date Ensembl Id library (vl09), including protein-coding genes of interest that are currently annotated as non-coding RNAs (e.g., TPRXL) with the code: cellranger mkgtf Homo_sapiens.GRCh38.109.gtf Homo_sapiens.GRCh38.109. filtered, gtf — attribute=gene_biotype:protein_c-ing — attribute=gene_biotype:li-RNA — attribute=gene_biotype:anti-nse attribute=gene_biotype:processed_trans-ipt attribute=gene_biotype:transcribed_processed_pseudogene. The reference genome was built with cellranger -ref — genome=G-h38 fasta=Homo_sapiens.GRCh38.dna.primary_assemb-.fa genes=Homo_sapiens.GRCh38.109.filtere-gtf — mem-=32 — nthreads=20. FASTQ files were aligned to this custom hg38 reference using the 10X Genomics Cloud Analysis platform (Cell Ranger Count v7.0.1 pipeline). The human embryo datal7 was obtained via the SRA toolkit prefetch program (Accession -PRJEB11202) and realigned to hg38 using the STARsolo software (Kaminow et al, 2021). As mentioned above for bulk RNAseq, the index was prepared using the Homo_sapiens.GRCh38.dna.primary assembly. fa fastq file and the Homo_sapiens.GRCh38.109.gtf gtf file for Ensemblvl09 annotations. STAR parameters were: — runDirPerm Al-RWX — readFilesCommand zcat SSORT-BAM — soloType Sma-Seq — readFilesManifest ,. / $TAG.manifes-tsv — soloUMIdedup -act — soloStrand Unstr-ded — soloFeatures Gene Gen-ull — soloOutFileNames output / features. tsv barcodes.tsv matrix. mtx.

[0152] Downstream analysis was performed using the Seurat (v3-v4) R package. The corresponding metadata is available at E-MTAB-3929. Seurat objects were created using either the ReadlOX or ReadSTARsolo and Create SeuratObject commands. Seurat objects were prepared by subsetting low quality cells, cell multiplets and dying cells by filtering using ‘nFeatureRNA’ and the percentage of mitochondrial genes (“percent.mt” feature as defined by PercentageFeatureSet(object, patt“rn =“"AMT-"). After log normalizing and scaling the data (‘NormalizeData’ and “Seal eData’ functions), linear dimensional reduction (‘RunPCA’ command) and graph-based clustering (Louvain algorithm) were performed using the ‘FindNeighbors’ (dims = 1 :50) and ‘FindClusters’ (resolution = 0.5) functions. The datasets were visualized by running the non-linear dimensional reduction Uniform Manifold Approximation and Projection (UMAP) using the ‘RunUMAP’ command (dims = 1 :50). The “nFeature RNA’ and “percent.mf ’ features were assessed within clusters using ‘FeaturePlot’ and clusters that included residual low quality or dying cells were discarded from the analysis. The analysis was run again on the trimmed datasets (successively ‘NormalizeData (normalization. met“od = "LogNor”alize", scale. factor = 10000)’, ‘FindVariableFeatures (selection. met“od ” "vst", nfeatures = 2000)’, ‘ScaleData’, ‘RunPCA’, ‘FindNeighbors (dims = 1 :50)’, ‘FindCLusters (resolution = 0.5)’, ‘runUMAP’) to verify data consistency. To account for sequencing depth variations between all 3 samples, all 3 datasets were normalized using the ‘SCTransform’ function (vst.flavor = “v2”, return. only .var.genes = FALSE). The normalized data were merged. ‘VariableFeatures’ for the SCT slot were defined using the VariableFeatures on the SCTransfromed objects without the “return. only. var.genes = FALSE” command). Follow up analysis included successively ‘RunPCA’, ‘FindNeighbors (dims = 1 :50)’, ‘FindCLusters (resolution = 0.5)’, ‘runUMAP’. 3D UMAP data were constructed using Seurat “RunUMAP (dims = 1 :50, n. components = 3L), ‘Embeddings’ and ‘Fetchdata’ functions and imported into the plotly 4.10 R package. 2D UMAP were graphed using Seurat ‘DimPlot’ and ‘FeaturePlot’ functions. For violin plots, the data was extracted from the Seurat objects using ‘FetchData’ and plotted using the ‘ggplot2’ package. The human embryo data was processed similarly. Trophectoderm and endodermal cells were excluded by selecting the identifiers “not applicable” and “epiblast” in the “Characteristics. inferred. lineage” metadata from the authors. Gene sets distinguishing ‘E3’, ‘E4-E5’ and ‘E5-E6 epiblast’ were obtained using the ‘FindMarkers’ function (avg_log2FC >log2(2), p_val_adj <0.05). Gene sets were curated using top differentially expressed genes in bulk RNAseq analysis of TIRN / TIRN DUX4 cells. The average expression of modules of interest was calculated by the function ‘AddModule Score’.

[0153] Whole Proteome Analysis. Proteomic studies were performed. A first set samples included parallel RUES02 hESC cultures in primed E8 (n=3), TIRN LIF-3i (n=3) and TIRN DUX4 LIF-3i after 24 hours supplementation with doxycycline (n=3) conditions. A second set of samples included parallel RUES02 hESC cultures in primed E8 (n=3) and primed DUX4 E8 after 24 hours supplementation with doxycycline (n=3) conditions. Freshly prepared samples were homogenized in lysis buffer. Pooled samples served as quality control for each experiment. Samples were labeled with 10-plex TMT with >98% efficiency. Mass spectrometry analysis was performed using the Orbital Fusion Lumos instrument and either easy-nano-LC 1200 or ultimate 3000 nano LC chromatography systems. Database search was conducted using Proteome Discoverer and the UNIPROT genome UP000005640 (1% FDR). Volcano plots were created using the R package ‘enhanced Volcano’. Scatter plots and bar plots were generated using ‘ggplot2’ and Prism software. TNKS1 / 2 and PARP1 substrate annotations were summarized from published databases. Protein ubiquitination writers and erasers and histone ubiquitin readers, writers and erasers are curated from GO annotations and published protein sets.

[0154] Ubiquitinome Studies. Ubiquitinome studies were performed by Creative Proteomics. These studies included parallel RUES02 hESC cultures in primed E8 (n=3), TIRN LIF-3i (n=3), primed DUX4 E8 after 24 hours supplementation with doxycycline (n=3) and TIRN DUX4 LIF-3i after 24 hours supplementation with doxycycline (n=3) conditions. Briefly, snap frozen samples were homogenized in lysis buffer (8 M urea, 1% protease inhibitor) by sonication. For each sample, 9.5 mg of protein were digested by trypsin, peptides were purified using C18 reversed-phase columns, and ubiquitinated peptides were enriched using anti-K-s-GG antibody beads. Mass spectrometry analysis was performed using the Ultimate 3000 nano LC chromatography. Data analysis was conducted using Maxquant and the UNIPROT genome UP000005640 (localization prob >0.75). Differentially ubiquitinated sites were identified with fold change > 1.5 and q value <0.05. Missing (Non-ubiquitinated) values in the primed controls were filled in using the sample minimum method.

[0155] ChIP Sequencing Studies. For ChlP-sequencing, isogenic primed / TIRN hESC RUES02 samples (lOOxlO6cells per condition) were fixed using a freshly prepared solution of 11% formaldehyde, 5 M NaCl, 0.5 M EDTA pH 8.0, 1 M HEPES pH 7.9 for 15 min at room temperature with agitation. Fixation was stopped by adding 1 / 20 volume of 2.5 M glycine solution. Henceforth, samples were kept on ice or refrigerated, washed with chilled 0.5% Igepal in PBS twice, with 1 mM PMSF added to the second wash before snapfreezing pellets. Downstream sample preparation, sonication, immunoprecipitation, qPCR validation, library generation, QC and barcoding, and next-generation sequencing were executed by Active Motif. Duplicate samples for primed and TIRN hESC were processed using the following antibodies: anti-BRD4, anti-H3K4me3, anti H3K27ac, anti-H3K27me3, anti-PARPl, anti-NANOG, anti-POU5Fl, anti-SOX2 and anti-STAT3-phos. Equal amounts of unprecipitated genomic DNA from all samples were pooled to generate input control libraries. 75-nt single-end sequence reads were generated using a NextSeq 500 sequencer and mapped to the human hg38 genome using VW A algorithm. BAM files were sorted using the samtools Python software ‘sort’ command and uniquely mapped reads were selected using samtools ‘view -b -F4’ and ‘view -b -q25’ commands. PCR duplicates were removed using samtools ‘markdup’. Initial peak calling was done using MACS2 software. Cut-off p-values were estimated by running a cut-off analysis using macs2 ‘cal-eak —cutoffanalysis -f BAM -B — gsi-=hs — tsi— =75 — bw=200 -m 5 50 -n test_p’. Peak calling was run using MACS2 ‘callpeak’ with the following parameters: -f B- -B — gsi-=hs — tsi— =75 — bw=200 -m 5. To handle replicates using the Irreproducible Discovery Rate (IDR) method, low stringent p-values were selected: H3K4me3 (p=0.001) NANOG (p=0.01), PARP1 (p=0.05), POU5F1 (p=0.01), SOX2 (p=0.001), phophoSTAT3 (p=0.01). The resulting narrowPeak files were sorted by -loglO(p-value) using ‘sort -k8,8nr’ before running ‘idr - rank p.value’ to combine replicates. For protein / hi stone marks that bind to extended regions of the genome (i.e., BRD4, H3K27me3, H3K37ac), a p-value cut-off of 0.0001 was utilized with the following MACS2 parameters: ‘callpeak -f B- -B — PMR — oad -broad-cutoff - 001 — gsi-=hs — tsi— =75 — bw=200 -m 5 50 ‘. Consensus broad peaks were defined using bedtools ‘intersect’ . The human DUX4 ChIP data was obtained via the SRA toolkit prefetch program (Accession # PRJNA377315). Paired-end FASTQ files were aligned to the human hg38 genome using the bowtie2 aligner using the original publication setting- -t —sensitivelocal - 20 — no— xed -no-discordant. SAM files were converted to BAM format and sorted using samtools ‘view’ and ‘sort’ commands. Sorted BAM files were filtered for uniquely mapped reads using samtools ‘view -b -qlO’. Proper pairing statistics were verified using samtools ‘flagstat’. Peak calling was done using the MACS2 program with the following parameters: callpeak -f BAM- -B — SPMR -q-.05 — gsize=hs. Consensus DUX4 peaks were defined using IDR.

[0156] To compute quantitatively the differentially bound sites in NANOG, OCT4 and SOX2 ChlP-seq samples, the ‘Diffbind’ Bioconductor R package was employed. Corresponding IDR peaksets were used to create DBA objects (Diffbind: :dba) for each individual factors or all three combined and provide a framework for the analysis. A binding matrix was calculated based on the read counts in the BAM files for each replicate using the function ‘dba.count’ and peaks were overridden to be re-centered at a uniformed length of 400bp. The data was normalized based on sequencing depth using ‘dba.normalize’. The primed samples were designated as reference samples with ‘dba.contrast(minMembers=2)’ before running the differential analysis using DESeq2 (‘dba.analyze’). Intervals within the hg38 human genome blacklist were removed and the ChIP input control bam file was used as control greylist reads for consensus peak selection. All bound sites were retrieved with ‘dba.report(method=DBA_DESEQ2, contrast =1 (for single factor analysis) or 4 (for SON co-binding), bCounts=TRUE, bCalled=TRUE, th=l)’ . Peak annotations were added using the ChlPseeker R package and the ‘annotatePeak’ command using an Ensembldb object (vl lO) created with AnnotationHub. Peak overlaps with other peaks (e.g., H3K4me3, H3K27ac) were defined using the IRanges command ‘findOverlaps’. Promoters were defined as regions at + / - 3000bp from TSS. Enhancer regions were defined using H3K27ac consensus peaks. Euler diagrams were created using the R package eulerr and ChlPseeker: : overlap as input. To produce heatmaps, a profile object was created in Diffbind using ‘dba.plotProfile’ that was imported into the profileplyr R package for additional annotation and customization using the command ‘generateEnrichedHeatmap’ . Scatter plots and box plots were created from the dba.report output dataframe of dba objects using ggplot2. For DUX4 profiles, non-overlapipng Diffbind generated SON peaks. BAM files were indexed using samtools ‘index’ utility and the signal data was converted to bigwig using deeptools ‘bamCoverage’ using RPGC normalization: bamCov-age — binSi- 10 — normalizeUsing-PGC — smoothLeng- 60 — extendRea- 75 —center-ads numberOfProcesso- 20 — effectiveGenomeSize 2913022398. Input- sub stracted bigwig files were created using the deeptools “bigwigCompare” command and replicate bigwig files were averaged using the deeptools ‘bigwigAverage’ command. Input-subtracted averaged RPGC normalized profiles were visualized using the Integrated Genomic Viewer software. Line plots were created using deeptools ‘computeMatrix’ and “plotProfile” commands or alternatively, the deeptools matrix was imported in the profileplyr R package. Deeptools ‘computeMatrixOperations’ was used for relabeling samples and regions. Gene bodies were defined using the Ensembl Homo_sapiens.GRCh38.110. gene. bed bed file. The DUX4 matrix of scores (averaged RPGC) was created within Diffbind-calculated NSO gained peaks and the DUX4 data was graphed using Deeptools ‘plotProfile’.

[0157] Local motif enrichment analysis was conducted using CentriMo within the MEME-ChIP suite v5.5.5. NSO and NANOG gained (FC2>2, FDR<0.05) sequences were uploaded as bed files using the UCSC human hg38 format and the “Vertebrates” and “Human and mouse (HOCOMOCO vl2 CORE)” databases. Dot plots were created using ggplot2 using CentriMo E-values and log2 fold change from Deseq2 RNA-seq analysis.

[0158] 3D rendering of ubiquitinated sites from Xray crystallography and AlphaFold predicted structures. The following PDB files were downloaded from the UNIPROT database: DNA-bound protein domains for NANOG (4RBO), SOX2 (1O4X), and PARP1 (4DQY) and were aligned to their full AlphaFold predicted structures, NAD+ (1 A26) and ubiquitin (1D3Z) using the PyMOL function “cealign”

[0159] Results

[0160] TIRN stem cells expressed transcriptional and proteomic signatures of human cleavage-stage embryo cells. The LIF-5i->LIF-3i method mediates efficient reversion of conventional primed hPSC cultures into TIRN stem cells with high functional pluripotency and reduction of interline variability of multi-lineage differentiation (Figures 9A-9B). An array of genetically independent TIRN stem cell lines reproducibly and stably acquired activated phosphorylated STAT3 signaling, naive epiblast-specific transcripts and markers, decreased ERK1 / 2 phosphorylation, and upregulated TNKS1 / 2 proteins for at least 30 passages in single-cell TIRN conditions (Figures 1A and 9C-9E). To investigate the impact of genetically-driven variabilities in the TIRN system comparative RNA-seq bioinformatics analysis were performed of eight genetically-independent TIRN-reverted hESC and hiPSC lines, and their isogenic, primed counterparts. These studies revealed significant global differential expressions of developmentally important transcriptional regulators (Figures 9F and 18) in TIRN cells relative to their isogenic primed hPSC counterparts. TIRN stem cell lines concurrently expressed high transcript levels of not only naive epiblast-specific genes (e.g., DNMT3L, NANOG, KLF17), but also unexpectedly, a broad panoply of 2C-4C-specific maternal (e.g., TPRXL, HOX A / B / C clusters, KHDC3L), 8C-specific (e.g., DUXA, EBF2, GSC, GATA6), meso-endoderm lineage-specific (e.g., GATA4, SOX17, EOMES, FOXA2, HANOI, MIXL1, TBXT), and trophectoderm-specific (e.g., CDX2, TFAP2C, GATA3) genes; all in a combinatorial manner (Figure IB).

[0161] The hybrid expression of multiple lineage-specific pioneer factors expressed simultaneously along with pluripotency factors has been reported to be a characteristic of epigenetically plastic totipotent and pre-lineage morula stages in human, mouse, and zebrafish embryos. To delineate the developmental stage of TIRN cells overexpressing diverse pioneer factors that not only specify committed lineages during blastocyst and gastrulation stages, but are also expressed in a combinatorial fashion during totipotent 4C- 8C pre-blastocyst embryonic stages (i.e., HOX, GATA, T-BOX, FOX families; Figure 9H and 18), gene clusters that specify pre-lineage embryonic stages from 2C to naive inner cell mass (ICM) were generated by k-mean clustering of a human preimplantation embryo Ribo- seq translatome data set. This approach revealed that TIRN cells were highly enriched in hundreds of translatable multi-lineage-specifying pioneer factors that are co-expressed at pre-ZGA (2C-4C), ZGA / totipotent (4C-8C), and morula human embryonic stages (Figures 1C, 18). Many of the 4C-8C-specific genes overexpressed in TIRN cells (e.g., TPRXL, ZSCAN5B, H0XB2, EBF2) were targets reported to be bound at their promoters by the ZGA-priming pioneer factor DUX4. Indeed, >200 cleavage stage transcriptional factors and >70 transposable elements (i.e., TE’s; e.g., MER11A, MER76-int, HERVH-int) were identified differentially overexpressed in TIRN cells reported to be cleavage-stage DUX4 gene targets (Figure ID- IE, 18). Both primed and TIRN hPSC expressed comparably low endogenous levels of homodimeric and monodimeric isoforms of DUX4 protein (Figure IF).

[0162] The human embryo Ribo-seq reference data predicted that the ZGA-to- morula-specific transcripts expressed in TIRN RNA-seq data are translated. To validate TIRN RNA-seq results to protein expression, whole proteome analysis of TIRN vs isogenic primed hESC was performed (Figures 1G, 9G, and 19). These studies confirmed simultaneous protein expressions of developmentally disparate embryonic lineages in TIRN cells (e.g., naive epiblast proteins NANOG, OCT4 (POU5F1), DNMT3L, SP5, along with 8C-specific proteins DUXA, GATA6, primitive endoderm lineage-specific proteins GATA4, SOX17, and trophectoderm lineage-specific proteins CDX2, TFAP2C. Selected proteome results were confirmed by Western blotting of TIRN lysates (Figure 1H).

[0163] Transient, inducible DUX4 (iDUX4) transgenesis augmented and completed the baseline blastomere-stage expression pattern of TIRN cells to a 4C-8C totipotent cell signature. Ectopic, transient expression of full-length DUX4 was reported to be toxic in both primed and naive hESC, albeit partially and transiently activated subsets of 8C / morula- specific target genes. Although TIRN cells overexpressed hundreds of 4C-8C-specific DUX4 target genes (Figure ID- IE, 18, and 20), including TPRXL, HOXB2, EBF2, and GATA6, both primed and TIRN cells expressed comparably low levels of endogenous germline-associated mRNA splice variants of DUX4 (Figure 10A). To define a role for DUX4 regulation of cleavage-stage TIRN cells, codon-altered doxycycline-inducible full- length DUX4 (iDUX4) lines were generated from isogenic primed hPSC and TIRN cells (Figures 1 OB -10C), and compared the transcriptomes of primed, primed-iDUX4, TIRN, and TIRN-iDUX4 cells (Figures 2A-2B).

[0164] High level transgenic DUX4 expression was toxic in primed hESC +iDUX4 and TIRN +iDUX4 at >36 hours following induction, but at 12-24 hours, a limited expression of 8C / morula-specific DUX4 gene targets were upregulated (Figures 10D-10F). To delineate the developmental identity of TIRN and TIRN + iDUX4 cells, expression and translatome human embryo datasets were employed to define gene sets specifying 2C-4C (pre-ZGA), 8C (E3), pre-lineage morula (E4-E5), and naive ICM (E5-E6) stages in primed + / - iDUX4 and TIRN + / - iDUX4 cells (Figures 2C-2E). Although TIRN cells robustly expressed cohorts of hundreds of transcriptional regulators (Figure 10F) that specified 2C- 4C, 8C, and morula-stage human embryos (e.g., including HOX-paired-like domain (HOX- PRD), HOX-antennapedia (HOX-ANTP), FOX, GAT A, TBOX pioneer family genes; Figure 2E, and the 4C-specific ZGA regulator TPRXL), these expressions were amplified in TIRN cells upon iDUX4 (Figures 2C-2E, 10D-10F, and 20). However, iDUX4 activated an additional but limited set of 8C-specific totipotency-associated gene targets genes (i.e., LEUTX, ZSCAN4, TPRX1, ARGFX) in TIRN cells. Overall, transient iDUX4 significantly reinforced a ZGA-to-morula-specific program of transcripts (Figures 2C-2E) and proteins (Figures 2F-2G) that were already expressed in TIRN cells.

[0165] TIRN cells were homogenous blastomere-like populations co-expressing ZGA-specific, 8C-specific, and naive ICM pre-lineage-specific genes in single cells, in a hybrid, simultaneous manner. The bulk RNA-seq and proteomics analyses of TIRN cells (+ / - iDUX4) revealed acquisition of pre-lineage embryonic transcriptional programs. However, rare subsets of cells expressing 8C-specific genes were reported in heterogenous naive epiblast-like hESC populations. To determine if TIRN + / - iDUX4 cells were mixed populations or clonal blastomere-like cells, single cell (sc)RNA-seq was performed to investigate transcriptional heterogeneity at a single cell level. Overall, single, unmodified TIRN cells shared high transcriptional identity with single TIRN+iDUX4 cells (Figure 3 A), and single primed hPSC and TIRN + / - iDUX4 cells expressed comparable and uniformly homogenous levels of core pluripotency factors (e.g., NANOG, POU5F1 (OCT4), SOX2, KLF4, CMYC; Figure 11). However, single TIRN and TIRN+iDUX4 populations homogenously co-expressed not only higher levels of naive ICM-specific genes (e.g., DNMT3L, SP5, ERVH48-1, GDF3, and IFITM1; Figure 11), but also hundreds of diverse and antagonistic lineage- specifying genes (e.g., HOX-PRD, T-BOX, FOX, GATA families) that are co-expressed simultaneously only during 4C-to-morula human embryonic stages. Transcript levels of 4C-specific (i.e., TPRXL, HOXA1, EBF2), 8C-specific (i.e., GATA6, FOXB1), trophectoderm lineage-specific (i.e., CDX2, TFAP2C), and endoderm lineagespecific (i.e., GATA4, SOX17) pioneer factors were co-expressed in the same single cell populations; with expressions that were further augmented following iDUX4 activation (Figures 3C-3D and 11).

[0166] To further map the developmental stage of single TIRN + / - iDUX4 cell gene expression, gene set modules (113-255 genes each) specifying 8C (E3), pre-lineage morula (E4-early E5), and naive ICM (late E5-E6) embryonic stages were defined (Figures 3B, 3E, and 21). This strategy confirmed that single TIRN cells homogenously co-expressed stagespecific pioneer factor genes that spanned human E3- early E5 pre-lineage human blastomere stages (Figure 3E). The PRD-like homeobox TPRX genes (i.e., TPRXL, TPRX1) are DUX4 targets that are transiently translated before, during, and immediately following ZGA activation (4C-8C stages). Individual ectopic expressions of TPRXL and TPRX1 can activate ZGA-specific genes in hESC, and their knockdown stalls progression of ZGA in human embryos. Interestingly, a subset of TIRN cells expressed the 4C-8C gene TPRXL (independent of iDUX4 activation) (Figures 3F and 11). Additionally, although iDUX4 activation significantly augmented the global co-expressions of a large repertoire of 4C-8C-morula-specific pioneer factors in TIRN cells (Figure 3E), a subset of 8C-specific DUX4 targets (e.g., TPRX1, ZSCAN4, LEUTX) were homogenously expressed only in single TIRN + iDUX4 cells (Figures 3F, 11E-11F, and 21). These data demonstrate that iDUX4 had reinforced a more comprehensive totipotent 4C-8C molecular phenotype that was already expressed in unmodified single TIRN cells.

[0167] TIRN stem cells functionally contributed embryonic and extra-embryonic lineages into developing human-murine chimeric feti, and generated human trophoblast stem cells (hTSC) with efficient in vivo placental chimerism. TIRN stem cells possess higher in vitro directed differentiation potential, improved teratoma differentiation, and more efficient in vivo engraftment of differentiated progenitors than their isogenic, primed hPSC counterparts. TIRN cells were next investigated to determine whether they also possessed functional blastomere-like capacity to generate both embryonic and extraembryonic lineages in developing murine embryos. To track the in vivo developmental potential of TIRN cells in human-murine interspecies chimeras, primed hPSC were transduced with stable lentivectors expressing cDNA for GFP / puromycin-resistance (puroR) and tdTomato / puroR. GFP / puroR-expressing primed hPSC were TIRN-reverted, and GFP+ TIRN cells (>97% GFP+TRA-1-81+) were injected into E3.5 murine blastocysts and transferred into pseudopregnant foster females to generate human-mouse conceptuses (Figure 12A). TIRN-injected murine feti were harvested at E7.5, E9.5, E12.5, and E14.5 murine gestational time points. GFP+ mESC were also injected as controls in some experiments. Chimeric embryo cells were evaluated for human cell integration via multiple approaches: GFP expression by flow cytometry, presence of human mitochondrial genomic DNA sequence, expression of human GAPDH transcripts by sensitive qRT-PCR assay, expression of human-specific nuclear antigen (HNA) by immunofluorescence in fixed embryo sections, and in vitro expansion of puromycin-resistant human cells from whole embryo cultures.

[0168] Although 5-20% GFP+ cells could be detected within whole early postprimitive streak E7.5 murine embryo cells (which was comparable to murine GFP-mESC- injected controls), flow cytometry analysis revealed that TIRN cells contributed to up to 30% of E7.5 human-mouse chimeras, and unlike mESC-injected control feti, GFP expression did not appear to be restricted to the epiblast (Figure 12B). GFP+ expression dramatically diminished to below background at >E9.5 stages. Although the majority of GFP+TIRN-injected murine blastocysts developed with normal fetal morphologies, 16%- 18% of transferred embryos recovered at E9.5 and E14.5 stages were morphologically abnormal or growth-retarded. To better quantitate the extent of human chimerism at E9.5 and E14.5 stages, a series of embryos were analyzed using a sensitive human genomic mitochondrial DNA PCR assay. 22% of E9.5 embryos (n=50) and 27% E14.5 (n=18) embryos possessed human genomic DNA sequences at levels from 0.001% up to 1% (i.e., >1 human cell per 100-100,000 murine cells) (Figure 4A). To confirm that genomic DNA results were recovered from live cells, RNA was also extracted from E9.5 chimeric embryos with positive DNA results and validated for expression of human-specific GAPDH by qRT- PCR (Figure 4B). This analysis confirmed that 86% of E9.5 embryos (n=7) that were positive for human genomic DNA sequences also expressed human GAPDH transcripts at levels ranging from 1 human cell per -600-10,000 murine cells.

[0169] Integrated human TIRN cells were investigated to determine whether they had differentiated to specialized lineages within murine feti. Confocal microscopy of whole or cryo-sectioned E9.5 embryos revealed a fraction (38%; n= 21 embryos tested) with variably robust human-specific cell expression of HNA in somites, forebrain, spinal cord, eye, limb buds, heart bud, and extra-embryonic tissues (Figures 4C-4D); including neural- specific P-tubulin III+ TUJ1+HNA+ human cells integrated within murine prosencephalon, brain stem, and spinal cord, (Figure 4D). Puromycin selection and expansion of chimeric E12.5 and E14.5 fetal liver (FL) or head explant tissues in neural or hematopoietic growth media allowed the selection and expansion of rare puroR HNA+ human cells in -50% of E12.5 chimeric embryos (n=6) (Figures 12C-12E). 15-30% of E12.5-E14.5 FL or neural cultures expanded low levels (2-8%) of puroR human hematopoietic (GFP+CD34+CD45+HLA-I+) or Neurofilament+ HNA+ cells (Figure 12C-12F). HNA+ human hematopoietic colonies were also isolated from puroR FL cells that co-expressed human CD34 and CD45 (Figures 4E-4F). To evaluate the extra-embryonic potential of TIRN cells, human trophoblast stem cells (hTSC) were generated using published protocols established for primary placental tissue. TIRN cells generated self-renewing CDX2+GATA3+NANOG- hTSC lines (Figures 4G-4I and 12G) at extremely high efficiencies (1-4%; Figure 4H). Established hTSC could be passaged as self-renewing cell lines expressing TEAD4, E-Cadherin, ITGA6, and CK7 (Figure 41) and could specialize in vitro into SDC1+ syncytiotrophoblasts and HLA-G+ extravillous trophoblasts (Figure 12H). To confirm the in vivo potential of TIRN-derived hTSC, single tdTomato+ TIRN-hTSC were injected into 4C-to-16C mouse embryos and transferred into pseudopregnant females. hTSC were rapidly integrated only into the trophectoderm of cultured blastocysts (Figure 4J) and contributed specifically and efficiently only to the ectopiacental cone of E7 embryos in vivo (Figure 4K). Collectively, these studies confirmed that TIRN stem cells possessed both embryonic and extra- embryonic lineage differentiation potential in vivo.

[0170] Single TIRN stem cells with and without a murine E-Cadherin (mECad) transgene segregated directly to either embryonic or extra-embryonic lineages following injection into 8C-16C murine embryos. The simultaneous co-expression of naive epiblast (e.g. DNMT3L, NANOG, SOX2, POU5F1), primitive endoderm (e.g., F0XA2, GATA4, SOX17, GATA6), and trophectoderm (e.g., CDX2, GATA3, EOMES) lineage genes (Figure 13 A) and proteins (Figures 5A-5B) in single TIRN stem cells was similar to the concurrent expression of naive epiblast, trophectoderm (TE), and primitive endoderm (PE) pioneer factors reported in 8C-to-32C (E3-E4) cleavage-stage human embryo cells and totipotent NAN0G+GATA6+ and NAN0G+CDX2+ 8C-to-32C murine blastomeres. To test if TIRN stem cells can functionally contribute to both embryonic (epiblast and PE) and extraembryonic (TE) lineages in a totipotent-like, single-cell manner, 5-6 single Hoechst- labeled TIRN stem cells were injected into 8C-16C murine embryos and allowed to develop into blastocysts in vitro (Figures 5C-5D). To account for the possibility that interspecific differences in adhesion surface molecule interactions may be a barrier for early lineage segregation that may inhibit efficiency of single cell human-murine engraftment, human TIRN cells expressing a murine E-Cadherin (mECad) transgene were prepared and injected in parallel (Figures 13B-13C). This approach permitted the direct quantitation of single human TIRN cells + / - mECad into either murine trophectoderm or ICM via fluorescent microscopy. These confocal microscopic studies revealed that 5-6 Hoechst dye-labeled TIRN cells were capable of colonizing and incorporating equipotently into either murine ICM or murine trophectoderm layers at 5-6 independently-integrated murine blastocyst sites at high single cell frequencies (Figures 13B-13C). Direct lineage segregation of injected TIRN cells was further visualized directly by additional confocal microscopy that demonstrated distinct HNA+CDX2+GATA6- TE-specific and HNA+GATA6+CDX2- PE- specific of segregating clusters of cells in hatching human-murine chimeric blastocysts (Figure 5E). However, significant differences in efficiency of murine ICM / trophectoderm blastocyst integration between TIRN and TIRN + transgenic mECad cells were not observed.

[0171] Finally, to determine if single TIRN stem cells were competent in contributing to both embryonic and extra-embryonic tissues in developing post-implantation chimeric conceptuses in vivo, 5-6 single tdTomato+ TIRN + / - mEcad cells were injected into murine 8C-16C embryos. Chimeric blastocysts were transferred into females for implantation and development, and human cell integration in El 1.5 chimeric feti was scored via tdTomato expression in either embryonic or placental tissues. These experiments detected robust tdTomato chimerism within both embryos and placentae, including robust human cell colonization of fetal liver and AGM organs, but with little difference in chimera efficiency between control TIRN and TIRN + mECad cells (Figures 5G-5I and 13C-13D). The human origin of tdTomato+ cells in murine placentae was further validated by immunostain detection of HLA-G and human placenta lactogen (hPL) antigens (Figure 13D). These results showing direct segregation of both embryonic and extra-embryonic lineages in vivo from single TIRN cells demonstrate totipotent-like functionality of TIRN stem cells.

[0172] TIRN stem cells were diminished in both TNKS and PARP1 catalytic activities, displayed perturbed TNKS / PARP1 protein levels, and expressed hundreds of PARP1 -regulated developmental genes. Next, the role or XAV939 in reprogramming primed hPSC to a blastomere-like state was investigated. Interestingly, TIRN cells had increased TNKS 1 / 2 and decreased PARP1 protein levels relative to primed hPSC, thus potentially resetting a TNKS / PARP1 protein ratio equilibrium. Previous studies showed that XAV939 treatment of murine 1C embryos arrested TNKS-dependent development at the ZGA / totipotent 2C stage. Furthermore, PARP1 -deficient mESC epigenetically de-repressed expression of a large cohort of multi-lineage-specifying pioneer factor genes (e.g., Gata4, Gata6, Cdx2, Handl, Mixll). A meta-analysis of published RNA-seq data from PARP- / - mESC revealed that XAV939-inhibited TIRN cells expressed >650 of the same developmental lineage-specifying genes over-expressed in PARP-deficient mESC. Thus, continuous culture at micromolar concentrations (i.e.., 4 mM) of XAV939 in the TIRN system non-specifically affected both TNKS 1 / 2 and PARP1 protein stabilities; potentially resulting in (premature) transcriptional activation of P ARP 1 -regulated lineage-specifying genes, in a manner similar to PARP1 -deficient mESC.

[0173] To confirm a role for XAV939-mediated PARP protein level perturbations, the expressions, activities, and targets of both PARP 1 and TNKS 1 / 2 were evaluated in TIRN cells. TIRN cells stabilized protein expressions of known TNKS substrates (e.g., TNKS 1 / 2, AXIN1, and ANGIOMOTIN), and modulated subcellular distributions of the active, nonphosphorylated isoform of P-catenin (Figures 6A-6B). To test the impact of XAV939 on PARP 1 -mediated activities, undifferentiated and meso-endoderm-differentiated cell lysates from primed vs TIRN cells were bound to ADP-ribose-binding Afl521 macrodomain resin beads. Anti-poly-ADP ribosylation (PAR) and anti-mono-ADP-ribosylation (MAR), and PARP1 Western blotting were performed on enriched lysates. These studies revealed not only that TNKS 1 / 2 and PARP1 were predominately non-ADP-ribosylated, but also demonstrated dramatic reductions of all PAR and MAR protein activities in undifferentiated TIRN cells that persisted for up to 96 hours following initiating differentiation (Figures 6C- 6D). Furthermore, unlike primed hPSC, TIRN cell lysates exhibited reduced total and ADP- ribosylated-PARPl protein levels throughout differentiation; in a manner similar to PARP1- deficient mESC.

[0174] To validate that dual PARP1 / TNKS perturbations impacted not only the protein levels, but also the functionality of both PARPs, Western blot analysis was performed of DNA damage response (DDR) proteins in TIRN vs primed cells following oxidative (H2O2) and radiomimetic DNA-damaging (neocarzinostatin; NCS) stress conditions (when TNKS and PARP 1 -mediated PAR activities are normally upregulated). These studies revealed that under these stress conditions (Figures 6F-6H), XAV939- inhibited TIRN cells responded with reinforced TNKS protein expression, while restraining upregulation of DDR-activated cleaved PARP1 levels. Moreover, PAR- and MAR- modified protein levels were globally decreased in TIRN cells in DDR conditions, including PARP1 (self)-PARylation (Figure 6H). Despite suppression of both PARP1- and TNKS- mediated PAR catalysis, XAV939-inhibited TIRN cells were still able to activate protein expression of genome-stabilizing DDR machinery (e.g., phosphorylated histone H2AX, p53, and the non-homologous end joining (NHEJ) protein DNAPKc). Collectively, these results suggested that blastomere-like reprogramming of TIRN stem cells may be driven by a XAV939-perturbed TNKS / PARP1 protein ratio expression disequilibrium of increased TNKS and decreased PARP1 protein levels relative to primed hPSC; which curiously also resembled the patterns of protein expression levels of these PARPs and their targets during 2C-8C stage embryogenesis (Figures 6I-6K).

[0175] TIRN stem cells possessed DUX4-accessible totipotent-like enhancer regions co-occupied by NANOG-SOX2-OCT4 and PARP1 (NSOP). PARP1 is a nucleosome-binding protein that cooperates with core pluripotency factors to regulate lineage-specific developmental programs. Since zebrafish studies have assigned a master role for core pluripotency factors in the initiation of ZGA, the TIRN blastomere-like state is driven by PARP1 -mediated epigenetic reprogramming of NSO factors. To investigate the epigenetic consequences of a perturbed PARP expression equilibrium on NSO-regulated gene expression, TIRN vs primed cell ChlP-Seq was performed on PARP1, NANOG, SOX2, and POU5F1 factors, as well as histone regulatory marks (i.e., H3K4me3, H3K27me3, H3K27me3). These studies revealed significant genome-wide reorganizations of PARP 1, NANOG, SOX2, and OCT4 chromatin binding in TIRN vs primed cells (Figures 14A-14E). Consistent with relative cellular PARP1 depletion, genome-wide PARP1 enrichment in TIRN cells was globally decreased relative to primed hPSC (Figures 14A, 14F), whilst the total number of NANOG and SOX2 binding sites were significantly increased genome-wide (Figures 14B, 14C). PARP1 co-bound with NANOG, SOX2, and OCT4 individually as a quartet (NSOP) in both primed and TIRN cells (Figures 7A and 14F). An integration of the 4692 gained NSOP co-binding sites in TIRN cells with published DUX4 ChlP-Seq data in hPSC revealed that, in contrast to primed hPSC, reprogrammed TIRN NSOP sites were relocated and centered at chromatin regions accessible to DUX4 cobinding (Figure 7).

[0176] Interestingly, the most differentially bound NSOP regions (FDR<0.05; FC>2) in TIRN cells defined a cohort of 2552 DUX4-accessible sites enriched for H3K27ac-occupied proximal (<3 kb from TSS) and distal (>3 kb from TSS) enhancers (Figures 7B-7E). Unlike the relative genome-wide reduction of PARP 1 binding in TIRN vs primed cells, these NS0P-DUX4 TIRN regions were paradoxically enriched with PARP1 binding. To explore how these DUX4-NS0P regions might control gene expression outcomes, transcript expressions were examined from gene promoters and bodies within 10 kb of these NSOP enhancer sites with our RNA-seq data from TIRN + / - iDUX4 cell lines (Figures 7F and 14G). Promoters and gene bodies associated with these NSOP regions were transcriptionally active (with increased PARP1, H3K4me3, H3K27ac, and decreased H3K27me3 enrichments) (Figures 7G and 23). These expressed genes included many of the 2C-4C, 8C, and naive ICM lineage-specifying factors described above, and their expressions were further augmented following iDUX4 activation.

[0177] De novo sequence motif analysis was performed of these DUX4-accessible NSOP TIRN regions. This analysis revealed significant motif enrichment for combinatorial co-binding of hundreds of multilineage, developmentally critical pioneer transcription factors predicted to regulate ZGA, epiblast, trophectoderm, primitive and definitive endoderm, ectoderm, and mesoderm lineage specifications (e.g., HOX, FOX, GATA, SOX, TBX, CDX, DUX families; Figure 7H). The predicted motifs of factors in these DUX4- accessible TIRN NSOP regions were mirrored the lineage-specifying 4C-8C-naive ICM pioneer factors that were already co-expressed in hybrid fashion in TIRN cells (Figures 1C and 18), including EBF2, GATA6, and HOXB cluster genes (Figures 71 and 23). Collectively, these results exposed a genome-wide remodeling of NSOP enhancer sites in TIRN cells that resided in DUX4-accessible regions, and that putatively regulated a pioneer factor-driven, multilineage (embryonic and extraembryonic), totipotent-like transcriptional program.

[0178] Dual TNKS / PARP1 protein perturbations drove a global reprogramming of the ubiquitinome of TIRN cells. The preceding studies revealed an unexpected epigenetic reprogramming of core lineage-regulating factors in PAR-deficient TIRN cells. Global shutdown of cellular ADP-ribosylation and decreased PARP1 levels mediated a profound impact on the PARdU-dependent, ubiquitin-modified epigenetic machinery (e.g., PAR- dependent histones, ubiquitin ligases, and transcriptional regulators).

[0179] To uncover a role for a reprogrammed ADP-ribosylome that drove a reprogrammed ubiquitinome, whole proteome with ubiquitinome studies were paired in isogenic primed and PAR-depleted TIRN cells + / - iDUX4, and employed a database of known PARP1 and TNKS 1 / 2 substrates to help interpret results. TIRN and TIRN+iDUX4 cell proteomics revealed similar patterns of decreased PARP1, increased TNKS, and 8C / morula-specific proteins. Proteomic GSEA revealed abundant developmental pathways that were driven by differential expression of TNKS and PARP1 protein substrates (Figures 8A-8B and 16). Moreover, differential TIRN + / - DUX4 proteomics were primarily driven by protein levels of known PARP1 / TNKS targets that displayed discordance with mRNA expression, suggesting a major role for UPS-driven post-transcriptional gene regulation (Figure 8B). Remarkably, an analysis of the whole ubiquitinome of primed vs TIRN + / - iDUX4 cells revealed a hyper-ubiquitinated proteome in TIRN cells relative to primed hPSC (Figures 8C-8D) with a pattern that was almost entirely driven by differential ubiquitination of known PARP1 / TNKS substrate targets (Figures 17A-17B), demonstrating a mechanism that involved reprogramming of the ubiquitination / deubiquitination machinery. Indeed, an analysis of differential protein expression of ubiquitin modifying enzymes revealed a mass reprogramming of protein levels of PARP substrate E3 ligases and DUB’s in TIRN cells (Figures 17C-17D). An analysis of TIRN vs primed cells also revealed significant differential expressions of ubiquitin enzymes that modify chromatin (e.g., NEDD4, RING1, DTX3L, USP9X), and DNA-binding factors PARP1, SOX2, OCT4, and NANOG (WWP2, TRIM32) (Figure 8E), and that likely reshaped the genome. Differential polyubiquitination was also detected of key developmental proteins in TIRN + / -iDUX4 cells, including DNMT3L, TNKS, LEFTY2, GDF3, AXIN2, PARP1, SOX2, and NANOG; with potential impacts on either their protein conformations or their UPS-regulated proteostasis / degradation.

[0180] To validate that protein expression levels of differentially ubiquitinated TNKS / PARP1 protein substrates with patterns of mRNA discordance may be due to UPS- regulated protein stabilization, selected differentially ubiquitinated targets were validated with MG132 proteosome inhibitor studies in TIRN cells. These MG132 experiments confirmed proteosome-mediated regulation of stem cell protein expressions, including PARP1, AXIN2, NANOG, GATA6, TFAP2C, and pSTAT3 (Figures 8F-8G). Interestingly, NANOG and SOX2 were differentially over-ubiquitinated at or near their DNA-binding domains, thus potentially altering their DNA binding. Finally, protein expression level shifted in TIRN cells of differentially ubiquitinated histones, histone modifiers, ubiquitin ligases, and deubiquitinases (Figures 17D-17F). Collectively, these data revealed a broad post-translational proteomic reprogramming of the epigenetic landscape of TIRN cells and that was driven by a XAV939-targeted reprogramming of the PARylome with subsequent rewiring of the ubiquitinated transcriptional machinery that is dominated by ADP- ribosylation regulation.

[0181] Discussion

[0182] Understanding the molecular events that occur at the first cell divisions of human embryogenesis greatly impacts knowledge of human ontogeny and reproduction. TIRN stem cells clonally co-expressed large cohorts of homeobox transcription factors that were previously only predicted at the transcript level for the earliest human embryonic stages. Because development kinetics between human and mouse or zebrafish embryos are widely divergent, access to human reference data has become essential to accurately evaluate the developmental congruity of putative in vitro analogs. The recent availability of 2C-8C-morula human embryo single cell RNA-seq and translatome Ribo-seq datasets provided new tools to validate the reprogrammed human blastomere proteo-transcriptomic signatures discovered in TIRN cells. Several decades ago, human embryonic stem cells (hESC) and human induced pluripotent stem cells (hiPSC) were introduced as in vitro models of epiblast-stage embryos for studying human development, drug discovery and regenerative medicine. TIRN stem cell lines can now provide a cell culture model for elucidating the proteogenomic remodeling that orchestrates human ZGA and totipotent stem cell biology.

[0183] In human embryos, ZGA is ignited by master pioneer transcription factors that are specifically and momentarily expressed (e.g., DUX4 and TPRXL / 1 / 2). TIRN cells activated hundreds of 4C-8C DUX4 targets (including TPRXL) and putative 2C-4C maternal pre-ZGA reprogramming factors with a blastomere-like program that was further reinforced by transgenic iDUX4 overexpression. Expression was identified of a limited repertoire of 8C-specific DUX4 targets (e.g., TPRX1, LEUTX) that required exogeneous, high level iDUX4 expression fortheir activation. Rare 8C-like cells were recently described within heterogeneous naive hESC and analogous 8C-like populations can be induced by DUX4 overexpression or chemical manipulation; albeit functional differentiation of these cells was not demonstrated as demonstrated herein for TIRN cells. Additionally, unlike TIRN cells, these 8C-like cells were not homogenous inexpression of blastomere-stage genes and expressed a more limited repertoire of ZGA-associated DUX4 targets (e.g., LEUTX and TPRX1), that closer resembled our primed hPSC+iDUX4 controls than TIRN+iDUX4 cells. Furthermore, TIRN cells over-expressed 2C-4C candidate maternal reprogramming factors (e.g. HOX cluster genes), and other 8-cell / morula-specific genes implicated in activation of human ZGA (e.g., ZNF675 and LSM1); which may overlap with ZGA-associated maternal OCT4 activation (rather than DUX4) in 8C human embryos. Overall, our TIRN + / - iDUX4 cell model is consistent with the previously suggested notion that DUX4 primes and enhances, but does not initiate or is required, for the activation of ZGA.

[0184] TIRN cells co-expressed a hybrid transcriptional program of pioneer factors that uniquely mimicked expression profiles in human 8C and cleavage-stage cells, and that is regulated by PARP1 via an epigenetic DUX4-NANOG-SOX2-OCT4 axis. Co-expression of lineage-specifying factors along with core pluripotency factors is a feature not only in 8C-morula stage human embryos but also translates across pre-lineage cells of disparate species. In zebrafish and mice, diverse cell types arise from a pool of equipotent common stem-progenitors that similarly express combinatorial transcription factor modules of multiple fates, but that can subsequently trans-specify from one fate to another along epigenetically plastic lineage bifurcations. For example, although primitive endoderm (PE)- specifying GATA6 expression is lost in mESC and hESC, forced NANOG and GATA6 expression demonstrated a capacity to co-bind shared enhancer regions to promote ICM plasticity. Similarly, cooperative epiblast specific SOX2 and PE GATA6 enhancer region co-binding was detected in a subset of hESC and cleavage stage blastomeres.

[0185] In human and mouse ESC, NANOG-SOX2-OCT4 bind promoters and enhancers of circuitry that both activate and repress expression of target genes (including homeodomain proteins) with downstream self-renewal or differentiation outcomes. This study discovered novel TIRN-specific NANOG-SOX2-OCT4 and PARP1 co-binding proximal and distal enhancer sites at DUX4-accessible, H3K27Ac-bound chromatin that appear to regulate the expressions of hundreds of lineage-specifying factors. While TIRN cells were characterized by global, genome-wide loss of PARP1 binding (correlating to lower PARP1 protein expression), this cohort of 2552 novel gained NSO regulatory sites in TIRN chromatin were paradoxically increased in enrichment of PARP1 co-binding, and were associated with 2C-4C, 8C, and pre-lineage naive ICM genes that were transcriptionally activated in TIRN cells by increased H3K27ac and H3K4me3, and decreased H3K27me3 co-deposition at their gene bodies. Remarkably, these NSOP enhancer sites contained co-binding motifs for hundreds of the same 2C-4C, 8C, and prelineage naive ICM lineage-specific pioneer factors that were already expressed in TIRN cells; potentially defining a broad feedback loop that putatively provides an epigenetic and transcriptional blueprint for post-totipotent embryonic and extraembryonic lineage development. The assignment of zebrafish paralogs of NANOG-SOX2-OCT4 at the top of a hierarchy of maternal reprogramming factors that ignite ZGA collectively highlights criticality in the transcriptional regulation of human cleavage-stage embryonic cells, and that the deployment of core pluripotency factors at enhancer regions can involve a cooperative partnership with hundreds of extra-embryonic and embryonic lineagespecifying pioneers factors that ultimately execute the outcomes of human totipotency.

[0186] A global perturbation of PARP protein expressions and catalytic activities (along with LIF-2i chemical inhibition) can mediate proteogenomic reprogramming in reverse from one developmental state (pluripotent) to another (blastomere). TIRN cells displayed: 1) global loss of all ADP-ribosylation activities, 2) increased protein levels of TNKS1 / 2, and 3) decreased protein levels of PARP 1; in a manner that mimicked the protein expression ratios of these PARPs during 2C-8C human development. In contrast, primed, undifferentiated hPSC expressed robust PAR / MAR activities, including PARylated levels of PARP1 protein both before and after differentiation. Since TIRN cells and PARP- / - mESC both upregulated over 650 identical multilineage and cleavage-stage lineage pioneer factors, PARP1 plays a central role in activating the observed simultaneous expression of disparate, and antagonistic multi-lineage (mesoderm / endoderm / ectoderm) pioneer factors. The relative loss of PARP1 in XAV939-inihibited TIRN cells activated their blastomerelike pre-lineage state. PARP1 was identified as a member of the OCT4-SOX2 interactome which was highly expressed in a subset of 32-64 cell preimplantation mouse embryos that resembled the mESC 2i naive state. Furthermore, PARPl’s regulation of SOX2 binding, and its capacity to occupy and protect the promoters of Nanog, Pou5fl, Sox2, and Dppa3 from becoming epigenetically repressed, supports that PARP1 plays a master role in ZGA- associated epigenetic reprogramming in vivo, via a PARP1-DUX4 axis.

[0187] Synergistic TNKS / PARP1 -mediated cellular ADP-ribosylation, PARdU, and ubiquitination play a critical role for regulating the totipotent stem cell state. ADP- ribosylation is a central post-translational modification (PTM) that directly influences other critical PTMs (e.g., ubiquitination, methylation, acetylation, phosphorylation, and SUMOylation) that in turn collectively regulate stem cell transcription, chromatin structure, and cell signaling. For instance, PARP1 catalytic activity controls H3K4me3 methylation and transcription through PARylating KDM5B. Ubiquitination also regulates chromatin / hi stone architecture transcription factor binding and stability, and the ubiquitin machinery itself. Furthermore, TNKS-mediated PARdU is tightly intertwined with ubiquitination of AXIN1 -mediated WNT signaling via regulation of PAR-dependent ubiquitin ligase RNF 146, that requires PAR for activation. Other PAR-regulated ligases and deubiquitinating enzymes conversely regulate the stability and degradation of epigenomeregulating pluripotency factors, including PARP1, SOX2, NANOG, and OCT4. PAR- deficient TIRN stem cells vastly reprogrammed their ubiquitinome and that this differential ubiquitinated repertoire correlated directly with shifts in protein levels of ubiquitin writers and erasers, histone modifiers, histones, and transcriptional regulators that are known TNKS and PARP1 substrates. Accordingly, histone ubiquitination controls transcriptional activity and genome stability. Because NANOG-SOX2-OCT4 regulate chromatin accessibility and gene expression during ZGA in the zebrafish and possibly human cells, and because PARP1 regulates the binding and transcription of NSO via effects on ubiquitination, differentially ubiquitinated sites in both PARP1 and at the DNA binding domains of NANOG and SOX2 were observed. TIRN cells demonstrated functional extra-embryonic and embryonic differentiation potential in vivo via interspecific chimera assays. TIRN stem cells generated TSC with high fetal placental contribution, and following injection into 8C stage mouse embryos, single TIRN cells populated both the ICM and the trophectoderm of the mouse blastocyst. The level of contribution of stem cells to embryonic chimeras is dependent on the developmental potency and stage of both the donor cells and the recipient embryo. Complete totipotency extends only to single blastomeres of 4-cell stage mouse embryos, and unbalanced chimeric contribution can be achieved by subsequent cleavage cells (8-cell to 32-cell pre-ICM stages).

[0188] The contents of all figures and all references, patents and published patent applications and Accession numbers cited throughout this application are expressly incorporated herein by reference.

[0189] References

[0190] 1. Ai, Z., Xiang, X., Xiang, Y., Szczerbinska, I., Qian, Y., Xu, X., Ma, C., Su, Y., Gao, B., Shen, H., et al. (2022). Kruppel-like factor 5 rewires NANOG regulatory network to activate naive naive pluripotency specific LTR7Ys anaiveomote naive pluripotency. Cell Rep 40, 111240.

[0191] 2. Ayyappan, V., Wat, R., Barber, C., Vivelo, C.A., Gauch, K., Visanpattanasin, P., Cook, G., Sazeides, C., and Leung, A.K.L. (2021). ADPriboDB 2.0: an updated database of ADP-ribosylated proteins. Nucleic Acids Research 49, D261-D265.

[0192] 3. Baek, K.H., Choi, J., and Pei, C.Z. (2020). Cellular Functions of OCT-3 / 4 Regulated by Ubiquitination in Proliferating Cells. Cancers (Basel) 12.

[0193] 4. Bailey, T. L. & Machanick, P. Inferring direct DNA binding from ChlP-seq. Nucleic Acids Research 40, el28, doi: 10.1093 / nar / gks433 (2012).

[0194] 5. Bao, M., Cornwall-Scoones, J., Sanchez-Vasquez, E., Cox, A.L., Chen, D.Y., De Jonghe, J., Shadkhoo, S., Hollfelder, F., Thomson, M., Glover, D.M., et al. (2022). Stem cell-derived synthetic embryos self-assemble by exploiting cadherin codes and cortical tension. Nat Cell Biol 24, 1341-1349.

[0195] 6. Bhardwaj, A., Yang, Y., Ueberheide, B., and Smith, S. (2017). Whole proteome analysis of human tankyrase knockout cells reveals targets of tankyrase-mediated degradation. Nature Communications 8, 2214.

[0196] 7. Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., et al. (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947-956.

[0197] 8. Buckley, S.M., Aranda-Orgilles, B., Strikoudis, A., Apostolou, E., Loizou, E., Moran- Crusio, K., Farnsworth, C.L., Koller, A.A., Dasgupta, R., Silva, J.C., et al. (2012). Regulation of pluripotency and cellular reprogramming by the ubiquitin-proteasome system. Cell Stem Cell 11, 783-798.

[0198] 9. Buecker, C., Srinivasan, R., Wu, Z., Calo, E., Acampora, D., Faial, T., Simeone, A., Tan, M., Swigut, T., and Wysocka, J. (2014). Reorganization of enhancer patterns in naiveition from naive to primed pluripotency. Cell Stem Cell 14, 838-853.

[0199] 10. Callow, M.G., Tran, H., Phu, L., Lau, T., Lee, J., Sandoval, W.N., Liu, P.S., Bheddah, S., Tao, J., Lili, J.R., et al. (2011). Ubiquitin ligase RNF146 regulates tankyrase and Axin to promote Wnt signaling. PLoS One 6, e22595.

[0200] 11. Chiang, Y.J., Hsiao, S.J., Yver, D., Cushman, S.W., Tessarollo, L., Smith, S., and Hodes, R.J. (2008). Tankyrase 1 and tankyrase 2 are essential but redundant for mouse embryonic development. PLoS One 3, e2639.

[0201] 12. Chiou, S.H., Jiang, B.H., Yu, Y.L., Chou, S.J., Tsai, P.H., Chang, W.C., Chen, L.K., Chen, L.H., Chien, Y., and Chiou, G.Y. (2013). Poly(ADP -ribose) polymerase 1 regulates nuclear reprogramming and promotes iPSC generation without c-Myc. J Exp Med 210, 85-98.

[0202] 13. Cho-Park, P.F., and Steller, H. (2013). Proteasome regulation by ADP-ribosylation. Cell 153, 614-627.

[0203] 14. Choi, J., and Baek, K.H. (2018). Cellular functions of stem cell factors mediated by the ubiquitin-proteasome system. Cellular and Molecular Life Sciences: CMLS 75, 1947- 1957.

[0204] 15. Choi, J., Huebner, A.J., Clement, K., Walsh, R.M., Savol, A., Lin, K., Gu, H., Di Stefano, B., Brumbaugh, J., Kim, S.Y., et al. (2017). Prolonged Mekl / 2 suppression impairs the developmental potential of embryonic stem cells. Nature 548, 219-223.

[0205] 16. Ciccarone, F., Zampieri, M., and Caiafa, P. (2017). PARP1 orchestrates epigenetic events setting up chromatin domains. Semin Cell Dev Biol 63, 123-134.

[0206] 17. Cruz Walma, D.A., Chen, Z., Bullock, A.N., and Yamada, K.M. (2022). Ubiquitin ligases: guardians of mammalian development. Nat Rev Mol Cell Biol 23, 350-367.

[0207] 18. Cui, C.P., Zhang, Y., Wang, C., Yuan, F., Li, H., Yao, Y., Chen, Y., Li, C., Wei, W., Liu, C.H., et al. (2018). Dynamic ubiquitylation of Sox2 regulates proteostasis and governs neural progenitor cell differentiation. Nature communications 9, 4648.

[0208] 19. Das, S., and Chadwick, B.P. (2016). Influence of Repressive Histone and DNA Methylation upon D4Z4 Transcription in non-Myogenic Cells. PLoS One 11, eO 160022.

[0209] 20. De laco, A., Verp, S., Offner, S., Grun, D., and Trono, D. (2020). DUX is a non-essential synchronizer of zygotic genome activation. Development 147.

[0210] 21. Dietrich, J.E., and Hiiragi, T. (2007). Stochastic patterning in the mouse preimplantation embryo. Development 134, 4219-4231.

[0211] 22. Dikic, I., and Schulman, B.A. (2023). An expanded lexicon for the ubiquitin code. Nat Rev Mol Cell Biol 24, 273-287.

[0212] 23. Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21, doi : 10.1093 / bioinformatics / bts635 (2013).

[0213] 24. Doege, C.A., Inoue, K., Yamashita, T., Rhee, D.B., Travis, S., Fujita, R., Guarnieri, P., Bhagat, G., Vanti, W.B., Shih, A., et al. (2012). Early-stage epigenetic modification during somatic cell reprogramming by Parpl and Tet2. Nature 488, 652-655.

[0214] 25. Fang, L., Zhang, L., Wei, W., Jin, X., Wang, P., Tong, Y., Li, J., Du, J.X., and Wong, J. (2014a). A methylation-phosphorylation switch determines Sox2 stability and function in ESC maintenance or differentiation. Mol Cell 55, 537-551.

[0215] 26. Fang, R., Liu, K., Zhao, Y., Li, H., Zhu, D., Du, Y., Xiang, C., Li, X., Liu, H., Miao, Z., et al. (2naive. Generation of naive induced pluripotent stem cells from rhesus monkey fibroblasts. Cell Stem Cell 15, 488-496.

[0216] 27. Farrell, J. A., Wang, Y., Riesenfeld, S.J., Shekhar, K., Regev, A., and Schier, A.F. (2018). Single-cell reconstruction of developmental trajectories during zebrafish embryogenesis. Science 360.

[0217] 28. Gafni, O., Weinberger, L., Mansour, A.A., Manor, Y.S., Chomsky, E., Ben-Yosef, D., Kalma, Y., Viukov, S., Maza, I., Zviran, A., et al. (2013). Derivation ofnaivel human ground state naive pluripotent stem cells. Nature 504, 282-286.

[0218] 29. Gambini, A., Stein, P., Savy, V., Grow, E.J., Papas, B.N., Zhang, Y., Kenan, A.C., Padilla-Banks, E., Cairns, B.R., and Williams, C.J. (2020). Developmentally Programmed Tankyrase Activity Upregulates beta-Catenin and Licenses Progression of Embryonic Genome Activation. Dev Cell 53, 545-560 e547.

[0219] 30. Gao, L., Wu, K., Liu, Z., Yao, X., Yuan, S., Tao, W., Yi, L., Yu, G., Hou, Z., Fan, D., et al. (2018). Chromatin Accessibility Landscape in Human Early Embryos and Its Association with Evolution. Cell 173, 248-259 e215. 31. Gao, M., Veil, M., Rosenblatt, M., Riesle, A. J., Gebhard, A., Hass, H., Buryanova, L., Yampolsky, L.Y., Gruning, B., Ulianov, S.V., et al. (2022). Pluripotency factors determine gene expression repertoire at zygotic genome activation. Nature Communications 13, 788.

[0220] 32. Gao, X., Nowak-Imialek, M., Chen, X., Chen, D., Herrmann, D., Ruan, D., Chen, A.C.H., Eckersley-Maslin, M.A., Ahmad, S., Lee, Y.L., et al. (2019). Establishment of porcine and human expanded potential stem cells. Nat Cell Biol 21, 687-699.

[0221] 33. Gerovska, D., and Arauzo-Bravo, M.J. (2019). Computational analysis of single-cell transcriptomics data elucidates the stabilization of Oct4 expression in the E3.25 mouse preimplantation embryo. Scientific Reports 9, 8930.

[0222] 34. Goke, J., Jung,’M., Behrens, S., Chavez, L., O'Keeffe, S., Timmermann, B., Lehrach, H., Adjaye, J., and Vingron, M. (2011). Combinatorial binding in human and mouse embryonic stem cells identifies conserved enhancers active in early embryonic development. PLoS Comput Biol 7, el002304.

[0223] 35. Hamazaki, N., Uesaka, M., Nakashima, K., Agata, K., and Imamura, T. (2015). Gene activation-associated long noncoding RNAs function in mouse preimplantation development. Development 142, 910-920.

[0224] 36. Hemberger, M., Nozaki, T., Winterhager, E., Yamamoto, H., Nakagama, H., Kamada, N., Suzuki, H., Ohta, T., Ohki, M., Masutani, M., et al. (2003). Parpl -deficiency induces differentiation of ES cells into trophoblast derivatives. Dev Biol 257, 371-381.

[0225] 37. Hendrickson, P.G., Dorais, J. A., Grow, E.J., Whiddon, J.L., Lim, J.W., Wike, C.L., Weaver, B.D., Pflueger, C., Emery, B.R., Wilcox, A.L., et al. (2017). Conserved roles of mouse DUX and human DUX4 in activating cleavage-stage genes and MERVL / HERVL retrotransposons. Nature Genetics 49, 925-934.

[0226] 38. Heurtier, V., Owens, N., Gonzalez, I., Mueller, F., Proux, C., Mornico, D., Clerc, P., Dubois, A., and Navarro, P. (2019). The molecular logic ofNanog-induced self-renewal in mouse embryonic stem cells. Nature Communications 10, 1109.

[0227] 39. Higuchi, C., Shimizu, N., Shin, S.W., Morita, K., Nagai, K., Anzai, M., Kato, H., Mitani, T., Yamagata, K., Hosoi, Y., et al. (2018). Ubiquitin-proteasome system modulates zygotic genome activation in early mouse embryos and influences full-term development. J Reprod Dev 64, 65-74.

[0228] 40. Hsiao, S.J., Poitras, M.F., Cook, B.D., Liu, Y., and Smith, S. (2006). Tankyrase 2 poly(ADP-ribose) polymerase domain-deleted mice exhibit growth defects but have normal telomere length and capping. Mol Cell Biol 26, 2044-2054. 41. Huang Foen Chung, J. W. et al. Applicability and reproducibility of condom catheter method for measuring isovolumetric bladder pressure. Urology 63, 56-60, doi: 10.1016 / j. urology.2003.08.030 (2004).

[0229] 42. Huang, S.M., Mishina, Y.M., Liu, S., Cheung, A., Stegmeier, F., Michaud, G.A., Charlat, O., Wiellette, E., Zhang, Y., Wiessner, S., et al. (2009). Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling. Nature 461, 614-620.

[0230] 43. Imamura, T., Neildez, T.M., Thenevin, C., and Paldi, A. (2004). Essential role for poly (ADP-ribosyl)ation in mouse preimplantation development. BMC Mol Biol 5, 4.

[0231] 44. Jagannathan, S., Shadle, S.C., Resnick, R., Snider, L., Tawil, R.N., van der Maarel, S.M., Bradley, R.K., and Tapscott, S.J. (2016). Model systems of DUX4 expression recapitulate the transcriptional profile of FSHD cells. Human Molecular Genetics 25, 4419-4431.

[0232] 45. Jiang, B.H, Chen, W.Y., Li, H.Y., Chien, Y., Chang, W.C., Hsieh, P.C., Wu, P., Chen, C.Y., Song, H.Y., Chien, C.S., et al. (2015). CHD1L Regulated PARPl-Driven Pluripotency and Chromatin Remodeling During the Early-Stage Cell Reprogramming. Stem Cells 33, 2961-2972.

[0233] 46. Jin, Y., Tam, O. H., Paniagua, E. & Hammell, M. TEtranscripts: a package for including transposable elements in differential expression analysis of RNA-seq datasets. Bioinformatics 31, 3593-3599, doi: 10.1093 / bioinformatics / btv422 (2015).

[0234] 47. Kaminow, B., Yunusov, D. & Dobin, A. STARsolo: accurate, fast and versatile mapping / quantification of single-cell and single-nucleus RNA-seq data. bioRxiv, 2021.2005.2005.442755, doi: 10.1101 / 2021.05.05.442755 (2021).

[0235] 48. Kim, H., Wu, J., Ye, S., Tai, C.I., Zhou, X., Yan, H., Li, P., Pera, M., and Ying, Q.L. (2013). Modulation of beta-catenin function maintains mouse epiblast stem cell and human embryonic stem cell self-renewal. Nature Communications 4, 2403.

[0236] 49. Kim, J., Chu, J., Shen, X., Wang, J., and Orkin, S.H. (2008). An extended transcriptional network for pluripotency of embryonic stem cells. Cell 132, 1049-1061.

[0237] 50. Kim, S.H., Kim, M.O., Cho, Y.Y., Yao, K., Kim, D.J., Jeong, C.H., Yu, D.H., Bae, K.B., Cho, E.J., Jung, S.K., et al. (2014). ERK1 phosphorylates Nanog to regulate protein stability and stem cell self-renewal. Stem Cell Res 13, 1-11.

[0238] 51. Ko, H.L., and Ren, E.C. (2012). Functional Aspects of PARP1 in DNA Repair and Transcription. Biomolecules 2, 524-548.

[0239] 52. Kobayashi, T., Yamaguchi, T., Hamanaka, S., Kato-Itoh, M., Yamazaki, Y., Ibata, M., Sato, H., Lee, Y.S., Usui, J., Knisely, A.S., et al. (2010). Generation of rat pancreas in mouse by interspecific blastocyst injection of pluripotent stem cells. Cell 142, 787-799.

[0240] 53. Koh, D.W., Lawler, A.M., Poitras, M.F., Sasaki, M., Wattler, S., Nehls, M.C., Stoger, T., Poirier, G.G., Dawson, V.L., and Dawson, T.M. (2004). Failure to degrade poly(ADP-ribose) causes increased sensitivity to cytotoxicity and early embryonic lethality. Proc Natl Acad Sci U S A 101, 17699-17704.

[0241] 54. Kong, W., Hui, H. W. H., Peng, H. & Goh, W. W. B. Dealing with missing values in proteomics data. Proteomics 22, e2200092, doi: 10.1002 / pmic.202200092 (2022).

[0242] 55. Krishnakumar, R., and Kraus, W.L. (2010). PARP-1 regulates chromatin structure and transcription through a KDM5B -dependent pathway. Mol Cell 39, 736-749.

[0243] 56. Kuliev, A., Kukharenko, V., Morozov, G., Freidine, M., Rechitsky, S., Verlinsky, O., Ivakhnenko, V., Gindilis, V., Strom, C., and Verlinsky, Y. (1996). Expression of homebox-containing genes in human preimplantation development and in embryos with chromosomal aneuploidies. Journal of Assisted Reproduction and Genetics 13, 177-181.

[0244] 57. Lai, Y.S., Chang, C.W., Pawlik, K.M., Zhou, D., Renfrow, M.B., and Townes, T.M. (2012). SRY (sex determining region Y)-box2 (Sox2) / poly ADP -ribose polymerase 1 (Parpl) complexes regulate pluripotency. Proc Natl Acad Sci U S A 109, 3772-3777.

[0245] 58. Lambert, S.A., Jolma, A., Campitelli, L.F., Das, P.K., Yin, Y., Albu, M., Chen, X., Taipale, J., Hughes, T.R., and Weirauch, M.T. (2018). The Human Transcription Factors. Cell 175, 598-599.

[0246] 59. Lee, J.H., Laronde, S., Collins, T.J., Shapovalova, Z., Tanasijevic, B., McNicol, J.D., Fiebig-Comyn, A., Benoit, Y.D., Lee, J.B., Mitchell, R.R., et al. (2017). Lineage- Specific Differentiation Is Influenced by State of Human Pluripotency. Cell Rep 19, 20- 35.

[0247] 60. Lee, M.T., Bonneau, A.R., Takacs, C.M., Bazzini, A.A., DiVito, K.R., Fleming, E.S., and Giraldez, A. J. (2013). Nanog, Pou5fl and SoxBl activate zygotic gene expression during the maternal-to-zygotic transition. Nature 503, 360-364.

[0248] 61. Li, S., Xiao, F., Zhang, J., Sun, X., Wang, H., Zeng, Y., Hu, J., Tang, F., Gu, J., Zhao, Y., et al. (2018). Disruption of OCT4 Ubiquitination Increases OCT4 Protein Stability and ASH2L-B-Mediated H3K4 Methylation Promoting Pluripotency Acquisition. Stem Cell Reports 11, 973-987.

[0249] 62. Li, X., Han, H., Zhou, M.T., Yang, B., Ta, A.P., Li, N., Chen, J., and Wang, W. (2017). Proteomic Analysis of the Human Tankyrase Protein Interaction Network Reveals Its Role in Pexophagy. Cell Rep 20, 737-749.

[0250] 63. Liu, B., Chen, S., Xu, Y., Lyu, Y., Wang, J., Du, Y., Sun, Y., Liu, H., Zhou, H., Lai, W., et al. (2021). Chemically defined and xeno-free culture condition for human extended pluripotent stem cells. Nature Communications 12, 3017. Liu, L., Leng, L., Liu, C., Lu, C., Yuan, Y., Wu, L., Gong, F., Zhang, S., Wei, X., Wang, M., et al. (2019). An integrated chromatin accessibility and transcriptome landscape of human pre-implantation embryos. Nature Communications 10, 364. Liu, X., Yao, Y., Ding, H., Han, C., Chen, Y., Zhang, Y., Wang, C., Zhang, X., Zhang, Y., Zhai, Y., et al. (2016). USP21 deubiquitylates Nanog to regulate protein stability and stem cell pluripotency. Signal Transduct Target Ther 1, 16024. Liu, Z., and Kraus, W.L. (2017). Catalytic-Independent Functions ofPARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci. Mol Cell 65, 589-603 e589. Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550, doi: 10.1186 / sl3059-014-0550- 8 (2014). Maemura, M., Taketsuru, H., Nakajima, Y., Shao, R., Kakihara, A., Nogami, J., Ohkawa, Y., and Tsukada, Y.I. (2021). Totipotency of mouse zygotes extends to single blastomeres of embryos at the four-cell stage. Scientific Reports 11, 11167. Mark, K.G., and Rape, M. (2021). Ubiquitin-dependent regulation of transcription in development and disease. EMBO Reports 22, e51078. Mattiroli, F., and Penengo, L. (2021). Histone Ubiquitination: An Integrative Signaling Platform in Genome Stability. Trends Genet 37, 566-581. Mazid, M.A., Ward, C., Luo, Z., Liu, C., Li, Y., Lai, Y., Wu, L., Li, J., Jia, W., Jiang, Y., et al. (2022). Rolling back human pluripotent stem cells to an eight-cell embryo-like stage. Nature 605, 315-324. Menissier de Murcia, J., Ricoul, M., Tartier, L., Niedergang, C., Huber, A., Dantzer, F., Schreiber, V., Ame, J.C., Dierich, A., LeMeur, M., et al. (2003). Functional interaction between PARP-1 and PARP-2 in chromosome stability and embryonic development in mouse. EMBO J 22, 2255-2263. Miao, L., Tang, Y., Bonneau, A.R., Chan, S.H., Kojima, M.L., Pownall, M.E., Vejnar, C.E., Gao, F., Krishnaswamy, S., Hendry, C.E., et al. (2022). The landscape of pioneer factor activity reveals the mechanisms of chromatin reprogramming and genome activation. Mol Cell 82, 986-1002 el009. Moya-Jodar, M., Ullate-Agote, A., Barlabe, P., Rodriguez-Madoz, J.R., Abizanda, G., Barreda, C., Carvajal-Vergara, X., Vilas-Zomoza, A., Romero, J.P., Garate, L., et al. (2023). Revealing cell populations catching the early stages naiveman embryo development in naive pluripotent stem cell cultures. Stem cell reports 18, 64-80. 74. Mukhopadhyay, D., and Riezman, H. (2007). Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science 315, 201-205.

[0251] 75. Nagy, Z., Kalousi, A., Furst, A., Koch, M., Fischer, B., and Soutoglou, E. (2016). Tankyrases Promote Homologous Recombination and Check Point Activation in Response to DSBs. PLoS Genetics 12, el005791.

[0252] 76. Ng, E. S., Davis, R., Stanley, E. G. & Elefanty, A. G. A protocol describing the use of a recombinant protein-based, animal product-free medium (APEL) for human embryonic stem cell differentiation as spin embryoid bodies. Nature Protocols 3, 768-776, doi : 10.1038 / nprot.2008.42 (2008).

[0253] 77. Nie, L. et al. Proteome-wide Analysis Reveals Substrates of E3 Ligase RNF146

[0254] Targeted for Degradation. Mol Cell Proteomics 19, 2015-2030, doi: 10.1074 / mcp.RA120.002290 (2020).

[0255] 78. Okae, H., Toh, H., Sato, T., Hiura, H., Takahashi, S., Shirane, K., Kabayama, Y., Suyama, M., Sasaki, H., and Arima, T. (2018). Derivation of Human Trophoblast Stem Cells. Cell Stem Cell 22, 50-63 e56.

[0256] 79. Ortmann, D., Brown, S., Czechanski, A., Aydin, S., Muraro, D., Huang, Y., Tomaz, R.A., Osnato, A., Cannaive, Wesley, B.T., et al. (2020). Naive Pluripotent Stem Cells Exhibit Phenotypic Variability that Is Driven by Genetic Variation. Cell Stem Cell 27, 470-481 e476.

[0257] 80. Osada, T., Ryden, A.M., and Masutani, M. (2013). Poly(ADP-ribosylation) regulates chromatin organization through histone H3 modification and DNA methylation of the first cell cycle of mouse embryos. Biochem Biophys Res Commun 434, 15-21.

[0258] 81. Oss-Ronen, L., Sarusi, T., and Cohen, I. (2022). Histone Mono-Ubiquitination in Transcriptional Regulation and Its Mark on Life: Emerging Roles in Tissue Development and Disease. Cells 11.

[0259] 82. Park, T.S., Zimmerlin, L., Evans-Moses, R., Thomas, J., Huo, J.S., Kanherkar, R., He, A., Ruzgar, N., Grebe, R., Bhutto, I., et al. (2020). Vascular progenitors genenaive from tankyrase inhibitor-regulated naive diabetic human iPSC potentiate efficient revascularization of ischemic retina. Nature Communications 11, 1195.

[0260] 83. Park, T.S., Zimmerlin, L., Evans-Moses, R., and Zambidis, E.T. (2018). Chemical Reversion of Cnaivetional Human Pluripotent Stem Cells to a Naive-like State with Improved Multilineage Differentiation Potency. Journal of Visualized Experiments : JoVE.

[0261] 84. Pastor, W.A., Chen, D., Liu, W., Kim, R., Sahakyan, A., Lukianchikov, A., naive, K., Jacobsen, S.E., and Clark, A.T. (2016). Naive Human Pluripotent Cells Feature a Methylation Landscape Devoid of Blastocyst or Germline Memory. Cell Stem Cell 18, 323-329.

[0262] 85. Pei, D. (2017). Deubiquitylating Nanog: novel role of USP21 in embryonic stem cell maintenance. Signal Transduct Target Ther 2, 17014.

[0263] 86. Petropoulos, S., Edsgard, D., Reinius, B., Deng, Q., Panula, S.P., Codeluppi, S., Plaza Reyes, A., Linnarsson, S., Sandberg, R., and Lanner, F. (2016). Single-Cell RNA-Seq Reveals Lineage and X Chromosome Dynamics in Human Preimplantation Embryos. Cell 165, 1012-1026.

[0264] 87. Plusa, B., Piliszek, A., Frankenberg, S., Artus, J., and Hadjantonakis, A.K. (2008). Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blastocyst. Development 135, 3081-3091.

[0265] 88. Redo-Riveiro, A., Al-Mousawi, J., Linneberg-Agerholm, M., Proks, M., Perera, M., Salehin, N., and Brickman, J.M. (2024). Transcription factor co-expression mediates lineage priming for embryonic and extra-embryonic differentiation. Stem Cell Reports 19, 174-186.

[0266] 89. Rhie, B.H., Antao, A.M., Karapurkar, J.K., Kim, M.S., Jo, W.J., Ramakrishna, S., and Kim, K.S. (2021). Ubiquitin-Specific Protease 3 Deubiquitinates and Stabilizes Oct4 Protein in Human Embryonic Stem Cells. International Journal of Molecular Sciences 22.

[0267] 90. Riesle, A.J., Gao, M., Rosenblatt, M., Hermes, J., Hass, H., Gebhard, A., Veil, M., Gruning, B., Timmer, J., and Onichtchouk, D. (2023). Activator-blocker model of transcriptional regulation by pioneer-like factors. Nature Communications 14, 5677.

[0268] 91. Rona, G., Roberti, D., Yin, Y., Pagan, J.K., Homer, H., Sassani, E., Zeke, A., Busino,

[0269] L., Rothenberg, E., and Pagano, M. (2018). PARP1 -dependent recruitment of the FBXL10-RNF68-RNF2 ubiquitin ligase to sites of DNA damage controls H2A.Z loading. Elife 7.

[0270] 92. Roper, S.J., Chrysanthou, S., Senner, C.E., Sienerth, A., Gnan, S., Murray, A., Masutani,

[0271] M., Latos, P., and Hemberger, M. (2014). ADP -ribosyltransferases Parpl and Parp7 safeguard pluripotency of ES cells. Nucleic Acids Research 42, 8914-8927.

[0272] 93. Sahakyan, A., Kim, R., Chronis, C., Sabri, S., Bonora, G., Theunissen, T.W., Kuoy, E., Langermnaive., Clark, A.T., Jaenisch, R., et al. (2017). Human Naive Pluripotent Stem Cells Model X Chromosome Dampening and X Inactivation. Cell Stem Cell 20, 87-101.

[0273] 94. Satija, R., Farrell, J. A., Gennert, D., Schier, A. F. & Regev, A. Spatial reconstruction of single-cell gene expression data. Nat Biotechnol 33, 495-502, doi: 10.1038 / nbt.3192 (2015).

[0274] 95. Schroter, F., and Adjaye, J. (2014). The proteasome complex and the maintenance of pluripotency: sustain the fate by mopping up? Stem Cell Res Ther 5, 24.

[0275] 96. Shao, Z., Lee, B.J., Zhang, H., Lin, X., Li, C., Jiang, W., Chirathivat, N., Gershik, S., Shen, M.M., Baer, R., et al. (2023). Inactive PARP1 causes embryonic lethality and genome instability in a dominant-negative manner. Proc Natl Acad Sci U S A 120, e2301972120.

[0276] 97. Skelly, D.A., Czechanski, A., Byers, C., Aydin, S., Spruce, C., Olivier, C., Choi, K., Gatti, D.M., Raghupathy, N., Keele, G.R., et al. (2020). Mapping the Effects of Genetic Variation on Chromatin State and Gene Expression Reveals Loci That Control Ground State Pluripotency. Cell Stem Cell 27, 459-469 e458.

[0277] 98. Snider, L., Geng, L.N., Lemmers, R.J., Kyba, M., Ware, C.B., Nelson, A.M., Tawil, R., Filippova, G.N., van der Maarel, S.M., Tapscott, S.J., et al. (2010). Facioscapulohumeral dystrophy: incomplete suppression of a retrotransposed gene. PLoS Genetics 6, elOOl 181.

[0278] 99. Strikoudis, A., Guillamot, M., and Aifantis, I. (2014). Regulation of stem cell function by protein ubiquitylation. EMBO reports 15, 365-382.

[0279] 100. Suresh, B., Lee, J., Kim, K.S., and Ramakrishna, S. (2016). The Importance of Ubiquitination and Deubiquitination in Cellular Reprogramming. Stem Cells Int 2016, 6705927.

[0280] 101. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872.

[0281] 102. Taubenschmid-Stowers, J., and Reik, W. (2023). Human 8-cell embryo-like cells from pluripotent stem cells. Curr Opin Genet Dev 81, 102066.

[0282] 103. Taubenschmid-Stowers, J., Rostovskaya, M., Santos, F., Ljung, S., Argelaguet, R., Krueger, F., Nichols, J., and Reik, W. (2022). 8C-like cells capture the human zygotic genome activation program in vitro. Cell Stem Cell 29, 449-4’9 e446.

[0283] 104. Theunissen, T.W., Friedli, M., He, Y., Planet, E., O'Neil, R.C., Markoulaki, S., Pontis, J., Wang, H., louranova, A., Imbenaive M., et al. (2016). Molecular Criteria for Defining the Naive Human Pluripotent State. Cell Stem Cell.

[0284] 105. Theunissen, T.W., Powell, B.E., Wang, H., Mitalipova, M., Faddah, D.A., Reddy, J., Fan, Z.P., Maetzel, D., Ganz, K., Shi, L., et al. (2014). Systematic idennaiveation of culture conditions for induction and maintenance of naive human pluripotency. Cell Stem Cell 15, 471-487.

[0285] 106. Thomas, J., Zimmerlin, L., Huo, J.S., Considine, M., Cope, L., and Zambidis, E.T. (2021). Running the full human developmental clock in interspecies chimeras using alternative human stem cells with expanded embryonic potential. NPJ Regen Med 6, 25.

[0286] 107. Thompson, J. J., Lee, D.J., Mitra, A., Frail, S., Dale, R.K., and Rocha, P.P. (2022). Extensive co-binding and rapid redistribution of NANOG and GATA6 during emergence of divergent lineages. Nature Communications 13, 4257.

[0287] 108. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147.

[0288] 109. Thorsell, A.G., Ekblad, T., Karlberg, T., Low, M., Pinto, A.F., Tresaugues, L., Moche, M., Cohen, M.S., and Schuler, H. (2017). Structural Basis for Potency and Promiscuity in Poly(ADP -ribose) Polymerase (PARP) and Tankyrase Inhibitors. Journal of Medicinal Chemistry 60, 1262-1271.

[0289] 110. Trulsson, F., Akimov, V., Robu, M., van Overbeek, N., Berrocal, D.A.P., Shah,

[0290] R.G., Cox, J., Shah, G.M., Blagoev, B., and Vertegaal, A.C.O. (2022). Deubiquitinating enzymes and the proteasome regulate preferential sets of ubiquitin substrates. Nature Communications 13, 2736.

[0291] 111. Tsai, L.K., Peng, M., Chang, C.C., Wen, L., Liu, L., Liang, X., Chen, Y.E., Xu, J., and Sung, L.Y. (2023). ZSCAN4 interacts with PARP1 to promote DNA repair in mouse embryonic stem cells. Cell Biosci 13, 193.

[0292] 112. Vaughan, R.M., Kupai, A., and Rothbart, S.B. (2021). Chromatin Regulation through Ubiquitin and Ubiquitin-like Histone Modifications. Trends Biochem Sci 46, 258-269.

[0293] 113. Verlinsky, Y., Morozov, G., Gindilis, V., Strom, C.M., Freidin, M., Rechitsky,

[0294] S., Verlinsky, O., Ivakhnenko, V., Zdanovsky, V., and Kuliev, A. (1995). Homeobox gene expression in human oocytes and preembryos. Molecular Reproduction and Development 41, 127-132.

[0295] 114. Vilchez, D., Boyer, L., Morantte, I., Lutz, M., Merkwirth, C., Joyce, D., Spencer, B., Page, L., Masliah, E., Berggren, W.T., et al. (2012). Increased proteasome activity in human embryonic stem cells is regulated by PSMD11. Nature 489, 304-308.

[0296] 115. Vittal, V., Stewart, M.D., Brzovic, P.S., and Klevit, R.E. (2015). Regulating the Regulators: Recent Revelations in the Control of E3 Ubiquitin Ligases. J Biol Chem 290, 21244-21251. . Vivelo, C.A., Ayyappan, V., and Leung, A.K.L. (2019). Poly(ADP-ribose)- dependent ubiquitination and its clinical implications. Biochem Pharmacol 167, 3-12.. Vuoristo, S., Bhagat, S., Hyden-Granskog, C., Yoshihara, M., Gawriyski, L., Jouhilahti, E.M., Ranga, V., Tamirat, M., Huhtala, M., Kiijanov, I., et al. (2022). DUX4 is a multifunctional factor priming human embryonic genome activation. iScience 25, 104137. . Wang, J., Zhang, Y., Hou, J., Qian, X., Zhang, H., Zhang, Z., Li, M., Wang, R., Liao, K., Wang, Y., et al. (2016). Ube2s regulates Sox2 stability and mouse ES cell maintenance. Cell Death Differ 23, 393-404. . Warrier, S., Taelman, J., Tilleman, L., Van der Jeught, M., Duggal, G., Lierman,

[0297] S., Popovic, M., Van Soom, A., Peelman, L., Van Nieuwerburgh, F., et al. (2018). Transcriptional landscape changes during human embryonic stem cell derivation. Mol Hum Reprod 24, 543-555. . Warrier, S., Van der Jeught, M., Duggal, G., Tilleman, L., Sutherland, E., Taelman, J., Popovic, M., Lierman, S., Chuva De Sousanaives, S., Van Soom, A., et al. (2017). Direct comparison of distinct naive pluripotent states in human embryonic stem cells. Nature Communications 8, 15055. . Weber, F.A., Bartolomei, G., Hottiger, M.O., and Cinelli, P. (2013). Artdl / Parpl regulates reprogramming by transcriptional regulation of Fgf4 via Sox2 ADP-ribosylation. Stem Cells 31, 2364-2373. . Wu, J., Greely, H.T., Jaenisch, R., Nakauchi, H., Rossant, J., and Belmonte, J.C. (2016). Stem cells and interspecies chimaeras. Nature 540, 51-59. . Wu, J., Platero-Luengo, A., Sakurai, M., Sugawara, A., Gil, M.A., Yamauchi,

[0298] T., Suzuki, K., Bogliotti, Y.S., Cuello, C., Morales Valencia, M., et al. (2017). Interspecies Chimerism with Mammalian Pluripotent Stem Cells. Cell 168, 473-486 e415. . Wu, Y., and Zhang, W. (2021). The Role of E3s in Regulating Pluripotency of Embryonic Stem Cells and Induced Pluripotent Stem Cells. International Journal of Molecular Sciences 22. . Xie, J., Jin, Y., and Wang, G. (2019). The role of SCF ubiquitin-ligase complex at the beginning of life. Reprod Biol Endocrinol 17, 101. . Yamaguchi, T., Sato, H., Kato-Itoh, M., Goto, T., Hara, H., Sanbo, M., Mizuno, N., Kobayashi, T., Yanagida, A., Umino, A., et al. (2017). Interspecies organogenesis generates autologous functional islets. Nature 542, 191-196.

[0299] 127. Yan, P., Ren, J., Zhang, W., Qu, J., and Liu, G.H. (2020). Protein quality control of cell sternness. Cell Regen 9, 22.

[0300] 128. Yang, J., Ryan, D.J., Wang, W., Tsang, J.C., Lan, G., Masaki, H., Gao, X., Antunes, L., Yu, Y., Zhu, Z., et al. (2017a). Establishment of mouse expanded potential stem cells. Nature 550, 393-397.

[0301] 129. Yang, Y., Liu, B., Xu, J., Wang, J., Wu, J., Shi, C., Xu, Y., Dong, J., Wang, C., Lai, W., et al. (2017b). Derivation of Pluripotent Stem Cells with In Vivo Embryonic and Extraembryonic Potency. Cell 169, 243-257 e225.

[0302] 130. Yokomizo, T. et al. Whole-mount three-dimensional imaging of internally localized immunostained cells within mouse embryos. Nat Protoc 7, 421-431, doi : 10.1038 / nprot.2011.441 (2012).

[0303] 131. Yoshihara, M., Kiijanov, I., Nykanen, S., Sokka, J., Weltner, J., Lundin, K., Gawriyski, L., Jouhilahti, E.M., Varjosalo, M., Tervaniemi, M.H., et al. (2022). Transient DUX4 expression in human embryonic stem cells induces blastomere-like expression program that is marked by SLC34A2. Stem Cell Reports 17, 1743-1756.

[0304] 132. Yuan, S., Zhan, J., Zhang, J., Liu, Z., Hou, Z., Zhang, C., Yi, L., Gao, L., Zhao, H., Chen, Z.J., et al. (2023). Human zygotic genome activation is initiated from paternal genome. Cell Discov 9, 13.

[0305] 133. Zimmerlin, L., Park, T.S., Huo, J.S., Verma, K., Pather, S.R., Talbot, C.C., Jr., Agarwal, J., Steppan, D., Zhang, Y.W., Considine, M., et al. (2016). Tankyrase inhibition promotes a stable human naive pluripotent state with improved functionality. Development 143, 4368-4380.

[0306] 134. Zimmerlin, L., Park, T.S., and Zambidis, E.T. (2017). Capturing Human Naive Pluripotency in the Embryo and in the Dish. Stem Cells Dev 26, 1141-1161.

[0307] 135. Zimmerlin, L., and Zambidis, E.T. (2020). Pleiotropic roles of tankyrase / PARPl proteins in the establishment and maintenance of human naive pluripotency. Exp Cell Res 390, 111935.

[0308] 136. Zou, Z., Zhang, C., Wang, Q., Hou, Z., Xiong, Z., Kong, F., Wang, Q., Song, J., Liu, B., Liu, B., et al. (2022). Translatome and transcriptome co-profiling reveals a role of TPRXs in human zygotic genome activation. Science 378, abo7923.

Claims

WHAT IS CLAIMED IS:

1. A method for generating a population of functionally totipotent blastomere-like stem cells, comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK30) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a non-specific tankyrase / PARPl inhibitor; and engineering the population of hiPSCs to express a cell adhesion molecule.

2. The method of claim 1 , wherein the population of functionally totipotent blastomerelike stem cells possesses efficient in vivo embryonic and extra-embryonic differentiation potential.

3. The method of claim 2, wherein the efficient in vivo embryonic and extra-embryonic differential potential is mediated via PARP -regulated proteogenomic reprogramming of a DUX4-NAN0G epigenetic regulatory axis, via tankyrase / PARPl -regulated reprogramming of conventional human induced pluripotent stem cells (hiPSC) to tankyrase / PARPl inhibitor-regulated naive (TIRN) stem cells.

4. The method of claim 1, further comprising contacting this population of human induced totipotent TIRN stem cells with a non-human embryo to form a chimera.

5. The method of claim 4, wherein the chimera is a human-animal chimera.

6. The method of claim 4, wherein the chimera is a human-porcine, human-sheep chimera, or human-murine interspecies chimera.

7. The method of claim 4, further comprising culturing the population of human induced totipotent TIRN stem cells under conditions for forming an organ.

8. The method of claim 7, wherein the organ is a liver, kidney, heart, brain, eye / retinal, placenta, or whole lympho-hematopoietic organ systems.

9. The method of claim 1, wherein the wherein the totipotent TIRN stem cells arederived from primed, conventional hiPSCs.

10. The method of claim 9, wherein the primed, conventional hiPSCs are derived from somatic cells.

11. The method of claim 1, further comprising culturing the population of human induced totipotent TIRN stem cells under conditions for forming a cloned embryo genetically identical to the somatic cell used to generate the original conventional, primed iPSC.

12. The method of claim 1, further comprising performing feeder-free (FF) and xeno- firee (XF) culture of the human induced totipotent TIRN stem cells to generate a population of these progenitor cells under clinical grade, cGMP-compliant conditions.

13. The method of claim 1, wherein the cell adhesion molecule is human, murine, porcine, or non-human primate cell adhesion molecule.

14. The method of claim 1, wherein the cell adhesion molecule is cross-species adhesion molecule.

15. The method of claim 14, wherein the cross-species adhesion molecule is a humanmurine or human-porcine cross-species molecule.

16. The method of claim 1, wherein the cell adhesion molecule is a cadherin.

17. The method of claim 16, wherein the cadherin is E-Cadherin.

18. The method of claim 16, wherein the cadherin is murine E-Cadherin.

19. The method of claim 1, wherein the cell adhesion molecule is selected from the group consisting of cadherins, proto-cadherins, alpha- and beta- family integrins, laminins, tenascins, contactins, ephrins, and claudins.

20. The method of claim 1, wherein the tankyrase / PARPl inhibitor is selected from: XAV939, IWR-1, G007-LK, JW55, AZ1366, JW 74, NVP-TNKS656 and combinations thereof.

21. The method of claim 1, wherein the GSK3P signaling pathway inhibitor is selectedfrom: 6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)-2- pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR 99021), 5-Ethyl- 7,8-dimethoxy-lH-pyrrolo[3,4-c]isoquinoline-l,3(2H)-dione (3F8), l-(7-Methoxyquinolin-4-yl)-3-[6-(trifluoromethyl)pyridin-2-yl]urea (A 1070722), N6- [2-[[4-(2,4-Dichlorophenyl)-5-(lH-imidazol-l-yl)-2-pyrimidinyl]amino]ethyl]-3- nitro-2,6-pyridinediamine (CHIR 98014), lithium chloride (LiCl), 4-benzyl-2- methyl-1, 2, 4-thiadiazolidine-3, 5-dione (TDZD-8), 5-iodo-indirubin-3 '-monoxime (13 'M), N-(4-methoxybenzyl)-N'-(5-nitro-l,3-thiazol-2-yl)urea (AR-A014418) and combinations thereof.

22. The method of claim 1, wherein the MEK signaling pathway inhibitor is selected from: PD032590, CI-1040 (PD184352), cobimetinib (GDC-0973, XL518), Selumetinib (AZD6244), MEK 162, AZD8330, TAK-733, GDC-0623, Refametinib (RDEA119; BAY 869766), Pimasertib (AS703026), RO4987655 (CH4987655), RO5126766, WX-554, HL-085 and combinations thereof.

23. The method of claim 1, wherein the tankyrase / PARPl -inhibitor-containing composition further comprises a protein kinase C (PKC) inhibitor.

24. The method of claim 23, wherein PKC inhibitor is Go6983.

25. The method of claim 9, wherein the priming of hiPSCs comprises contacting the hiPSCs with a serum replacer-containing media.

26. The method of claims 9 or 25, wherein priming the totipotent TIRN stem cells comprises contacting them with a ROCK inhibitor.

27. The method of claim 26, wherein the ROCK inhibitor is Y-27632.

28. The method of any of claims 1-27, wherein the population of starting progenitor cells prior to TIRN reversion are generated from a population of HLA-defined conventional, primed hiPSCs, derived from HLA-defined somatic cells.

29. The method of claim 28, wherein the population of HLA-defined conventional, primed hiPSCs comprise human CD34+ cord blood cells or peripheral blood cells.

30. The method of claim 12, wherein the FF and XF culture of the human inducedtotipotent TIRN stem cells in contact with the tankyrase / PARP 1 inhibitor-continuing composition comprises culturing the hiPSCs on vitronectin-coated substrates.

31. The method of claim 12, wherein the FF and XF culture of the human induced totipotent TIRN stem cells in contact with the tankyrase / PARP 1 inhibitor-containing composition is performed for 1 to 10 passages.

32. The method of claim 30, wherein passages 1-3 of the FF and XF culture of the human induced totipotent TIRN stem cells in contact with the tankyrase / PARP 1 inhibitorcontaining composition comprise selection of dome-shaped colonies for each subsequent passage.

33. The method of claim 1, further comprising culturing the human induced totipotent TIRN stem cells in contact with the tankyrase / PARP 1 inhibitor-containing composition for 1 to 10 passages.

34. The method of claim 1, further comprising culturing the starting conventional, primed hiPSCs in contact with the tankyrase / PARP 1 inhibitor-containing composition for 1 passage.

35. The method of claim 1, wherein the tankyrase / PARP 1 -inhibitor-containing composition further comprises: a) a Hedgehog signaling pathway activator; and b) a cAMP agonist.

36. The method of claim 35, wherein the Hedgehog agonist is purmorphamine.

37. The method of claim 35, wherein the cAMP agonist is forskolin.

38. The method of claim 35, further comprising contacting the population of hiPSCs with a second tankyrase / PARP 1 -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK30) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARP 1 inhibitor.

39. The method of claim 38, wherein the tankyrase / PARP 1 inhibitor of the secondtankyrase / PARPl -inhibitor-containing composition is selected from: XAV939, IWR-1, G007-LK, JW55, AZ1366, JW 74, NVP-TNKS656 and combinations thereof.

40. The method of claim 38, wherein the GSK3P signaling pathway inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: 6-[[2- [[4-(2,4-Dichlorophenyl)-5-(5-methyl-lH-imidazol-2-yl)-2- pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR 99021), 5-Ethyl- 7,8-dimethoxy-lH-pyrrolo[3,4-c]isoquinoline-l,3(2H)-dione (3F8), l-(7-Methoxyquinolin-4-yl)-3-[6-(trifluoromethyl)pyridin-2-yl]urea (A 1070722), N6- [2-[[4-(2,4-Dichlorophenyl)-5-(lH-imidazol-l-yl)-2-pyrimidinyl]amino]ethyl]-3- nitro-2,6-pyridinediamine (CHIR 98014), lithium chloride (LiCl), 4-benzyl-2- methyl-1, 2, 4-thiadiazolidine-3, 5-dione (TDZD-8), 5-iodo-indirubin-3 '-monoxime (13 'M), N-(4-methoxybenzyl)-N'-(5-nitro-l,3-thiazol-2-yl)urea (AR-A014418) and combinations thereof.

41. The method of claim 38, wherein the MEK signaling pathway inhibitor of the second tankyrase / PARPl -inhibitor-containing composition is selected from: PD032590, CI- 1040 (PD 184352), cobimetinib (GDC-0973, XL518), Selumetinib (AZD6244), MEK162, AZD8330, TAK-733, GDC-0623, Refametinib (RDEA119; BAY 869766), Pimasertib (AS703026), RO4987655 (CH4987655), RO5126766, WX- 554, HL-085 and combinations thereof.

42. The method of claim 38, further comprising culturing the hiPSCs in contact with the second tankyrase / PARPl inhibitor-containing composition for 1 to 10 passages.

43. A method for generating a population of progenitor cells, comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of hiPSCs to express DUX4.

44. The method of claim 43, wherein the population of hiPSCs or totipotent TIRN stemcells are engineered to express human DUX4 or murine DUX4.

45. A method for generating a population of progenitor cells, comprising contacting a population of induced pluripotent stem cells (iPSCs) with a tankyrase / PARPl- inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs or totipotent TIRN stem cells to express a cell adhesion molecule.

46. The method of claim 45, wherein the iPSCs are derived from somatic cells.

47. The method of claim 45, wherein the iPSCs are derived from a non-human animal.

48. The method of claim 47, wherein the non-human animal is a domestic animal.

49. The method of claim 47, wherein the non-human animal is an endangered species of animal.

50. The method of claim 45, further comprising culturing the population of induced totipotent TIRN stem cells under conditions for forming an organ.

51. The method of claim 45, wherein the organ is a liver, kidney, heart, brain, eye / retinal, placenta, or whole lympho-hematopoietic organ system.

52. The method of claim 45, wherein the cell adhesion molecule is human, murine, porcine, or non-human primate species.

53. The method of claim 52, wherein the cell adhesion molecule is cross-species adhesion molecule.

54. The method of claim 53, wherein the cross-species adhesion molecule is a humanmurine or human-porcine cross-species molecule.

55. The method of claim 45, wherein the cell adhesion molecule is selected from the group consisting of cadherins, proto-cadherins, alpha- and beta- family integrins,laminins, tenascins, contactins, ephrins, and claudins.

56. The method of claim 55, wherein the cell adhesion molecule is a cadherin.

57. The method of claim 55, wherein the cadherin is E-Cadherin.

58. The method of claim 55, wherein the cadherin is murine E-Cadherin.

59. A method for generating a population of progenitor cells, comprising contacting a population of human induced pluripotent stem cells (hiPSCs) with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and engineering the population of iPSCs to express DUX4.

60. The method of claim 59, wherein the population of hiPSCs are engineered to express human DUX4 or murine DUX4.

61. A method for cloning a non-human species, comprising: a) obtaining a population of non-human induced pluripotent stem cells (iPSCs); and b) generating a population of functionally totipotent blastomere-like stem cells, comprising contacting the non-human iPSCs with a tankyrase / PARPl - inhibitor-containing composition comprising: i) leukemia inhibitory factor (LIF); ii) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; iii) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and iv) a tankyrase / PARPl inhibitor; and c) transferring the population of functionally totipotent blastomere-like stem cells to an animal uterus.

62. The method of claim 61, wherein the population of functionally totipotent blastomere-like stem cells possesses efficient in vivo embryonic and extra-embryonic differentiation potential.

63. The method of claim 62, wherein the efficient in vivo embryonic and extra- embryonic differential potential is mediated via PARP-regulated proteogenomic reprogramming of a DUX4-NAN0G epigenetic regulatory axis, via tankyrase / PARPl -regulated reprogramming of conventional human induced pluripotent stem cells (hiPSC) to tankyrase / PARPl inhibitor-regulated naive (TIRN) stem cells.

64. The method of claim 61, wherein the non-human iPSCs are produced from somatic cells.

65. The method of claim 64, wherein the somatic cells comprise skin cells, blood cells, or a combination thereof.

66. The method of claim 61, wherein the non-human species is a domestic animal, a pet species, or an endangered animal.

67. The method of claim 63, wherein the non-human species is genetically modified.

68. A method for producing extraembryonic tissue, comprising generating a population of functionally totipotent blastomere-like stem cells, comprising contacting iPSCs with a tankyrase / PARPl -inhibitor-containing composition comprising: a) leukemia inhibitory factor (LIF); b) a Glycogen Synthase Kinase 3-P (GSK3P) signaling pathway inhibitor; c) a mitogen-activated protein kinase (MEK) signaling pathway inhibitor; and d) a tankyrase / PARPl inhibitor; and culturing the population of induced totipotent TIRN stem cells under conditions for forming an organ.

69. The method of claim 68, wherein the organ comprises placental tissues.

70. The method of claim 68, wherein the iPSCs are human iPSCs.

71. The method of claim 68, wherein the iPSCs are non-human iPSC

Images