Methods of treating bladder cancer using an oncolytic virus

Intravesical administration of cretostimogene adenovirus with gemcitabine effectively treats high-risk non-muscle invasive bladder cancer, overcoming BCG-resistant challenges and shortages, providing a safer alternative with reduced side effects.

WO2025251003A1PCT designated stage Publication Date: 2025-12-04CG ONCOLOGY INC
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/031747
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-04-25
Filing Date
2025-05-30
Publication Date
2025-12-04

AI Technical Summary

Technical Problem

Current treatments for non-muscle invasive bladder cancer, particularly BCG-resistant cases, are ineffective for many patients and associated with severe side effects, and there is a lack of alternatives due to BCG shortages and intolerance in certain populations.

Method used

Intravesical administration of an oncolytic adenovirus, such as cretostimogene, combined with gemcitabine, to treat high-risk non-muscle invasive bladder cancer, utilizing a tumor cell-specific promoter and a heterologous gene encoding an immune-related molecule.

Benefits of technology

Provides safe and effective treatment options for BCG-resistant or BCG-naive patients with high-risk NMIBC, reducing recurrence and progression, and addressing the shortage of BCG therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000071_0001
    Figure IMGF000071_0001
  • Figure IMGF000072_0001
    Figure IMGF000072_0001
  • Figure IMGF000083_0001
    Figure IMGF000083_0001
Patent Text Reader

Abstract

The present disclosure provides methods for individuals having bladder cancer comprising intravesically administering to the individual an oncolytic virus, such as cretostimogene grenadenorepvec, optionally in combination with one or more additional therapeutic agents, such as an immune checkpoint modulator or a chemotherapeutic agent. Also provided are pharmaceutical compositions and kits for treating bladder cancer.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS OF TREATING BLADDER CANCER USING AN ONCOLYTIC VIRUSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 654,584, filed on May 31, 2024, U.S. Provisional Application No. 63 / 790,586, filed on April 17, 2025, and U.S. Provisional Application No. 63 / 794,976, filed on April 25, 2025, all of which are hereby incorporated by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (744442001140seqlist.xml; Size: 3,801 bytes; and Date of Creation: May 23, 2025) is herein incorporated by reference in its entirety.FIELD

[0003] The present invention relates to methods of treating bladder cancer using an oncolytic virus, such as cretostimogene grenadenorepvec.BACKGROUND

[0004] The American Cancer Society estimated that there will be over 83,000 new cases of bladder cancer diagnosed in 2024 in the United States. Non-muscle invasive bladder cancer (stages Ta, Tl, or carcinoma in situ) accounts for 70-80% of bladder cancer cases, while muscle invasive disease (stage T2 and above) and metastatic disease make up the remaining 20-30%. Bladder cancers are divided into 2 subtypes based on their distinct cellular growth patterns: papillary tumors and flat tumors. Carcinoma in situ (CIS) is a flat tumor confined to the surface layer of the bladder lumen. Compared to papillary tumors of the Ta and Tl stage, bladder CIS is more difficult to diagnose, and has a high risk of progression to muscle invasive bladder cancer.

[0005] Intravesical Bacillus Calmette-Guerin (BCG) is the standard-of-care treatment for non-muscle invasive bladder cancer (NMIBC). Patients typically receive an induction course consisting of weekly intravesical installations of BCG for 6 weeks, followed by monthly maintenance treatments for 6 to 12 months, with each maintenance course typically consisting of weekly intravesical instillations for 3 weeks. However, about 30-40% of patients classify do not respond to the induction course of BCG treatment and are classified as having BCG-resistant NMIBC (Kodera, et al. (2023) "The management of BacillusCalmette-Guerin (BCG) failure in high-risk non-muscle invasive bladder cancer: A review article." Cureus 15.6). Further, recurrence occurs in over 50% of patients who achieve an initial response (Sylvester et al. Eur Urol 2006; 49: 466), and 20-40% of patients are at risk of disease progression (Kamat et al. J Clin Oncol. 2016;34(16): 1935-44; Roumiguie et al. Eur Urol 2022; 82:34-46). For patients with BCG-resistant NMIBC or recurrent NMIBC after BCG therapy, cystectomy, including partial and radical cystectomy, remains the treatment of choice. However, cystectomy is associated with severe side effects and adversely affects patients’ quality of life (Maibom et al. BMJ Open. 2021 Apr 14;ll(4):e043266; Clements et al. Eur Urol. 2021;81(3), 294-304). Moreover, the risk of recurrence after radical cystectomy for clinically localized bladder cancer is high and stage-dependent. See, for example, Bassi P et al. J. Urol. 1999; 161: 1494-7. In addition to BCG-resistant NMIBC, an ongoing shortage of BCG have left patients having high-risk NMIBC with very few treatment options (Holzbeierlein Jet al. Diagnosis and treatment of non-muscle invasive bladder cancer: AUA / SUO guideline: 2024 amendment. J Urol. 2024). The elderly and patients with renal failure, who are less tolerable to surgery or chemotherapy, pose additional clinical challenges for treatment of high-risk NMIBC.

[0006] Accordingly, there is a need for effective alternatives to BCG therapy for the treatment of bladder cancer, in particular for patients with BCG-resistant disease and patients effected by ongoing BCG shortages.BRIEF SUMMARY

[0007] In some aspects, provided herein are methods of treating high-risk non-muscle invasive bladder cancer (HR-NMIBC) comprising intravesically administering an oncolytic adenovirus to individuals who are BCG-naive and / or have received inadequate BCG treatment. Also provided herein are methods of treating high-risk non-muscle invasive bladder cancer comprising intravesically administering an oncolytic adenovirus to individuals in combination with gemcitabine.

[0008] The present disclosure is based, at least in part, on the discovery that treatment with an oncolytic adenovirus, such as cretostimogene, is safe and effective for individuals with HR-NMIBC who are BCG-naive and / or have received inadequate BCG treatment. The inventors have also discovered that a treatment with an oncolytic adenovirus, such as cretostimogene, in combination with gemcitabine, is safe and effective for individuals with HR-NMIBC. The present disclosure therefore provides efficacious and safe treatment options for patients with otherwise few options due to the nature of high-risk NMIBC and theongoing shortage of BCG.

[0009] Accordingly, in some aspects, described herein is method of treating high-risk nonmuscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic adenovirus to the individual, wherein the oncolytic adenovirus comprises a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule, wherein the individual has had at least one diagnosis of high-risk NMIBC, and wherein, prior to the administration of the oncolytic adenovirus, the individual: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy (e.g., has not received any prior BCG therapy); b) has not received intravesical BCG therapy (e.g., has not received any BCG therapy) within 24 months prior to the most recent diagnosis of high-risk NMIBC; or c) has received a maximum of 1 or 2 doses of BCG (e.g., intravesical BCG) within 24 months prior to the most recent diagnosis of high-risk NMIBC.

[0010] In some aspects, described herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic adenovirus to the individual, wherein the oncolytic adenovirus comprises a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule, wherein the individual has had at least one diagnosis of high-risk NMIBC, and wherein, prior to the administration of the oncolytic adenovirus, the individual has: a) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or carcinoma in situ (CIS) at a first evaluation following the BCG induction course; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or d) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.

[0011] In some aspects, described herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering anoncolytic adenovirus and gemcitabine to the individual, wherein the oncolytic adenovirus comprises a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule, wherein the individual has had at least one diagnosis of high-risk NMIBC, and wherein, prior to the administration of the oncolytic adenovirus, the individual has: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of highgrade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and experienced high-grade Tl disease at the first evaluation following the BCG induction course; d) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation following the BCG induction course; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or g) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of highgrade Ta, Tl, or CIS within 24 months after the final dose of BCG.

[0012] In some embodiments, prior to the administration of the oncolytic adenovirus, the individual has received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or carcinoma in situ (CIS) at a first evaluation following the BCG induction course. In some embodiments, prior to the administration of the oncolytic adenovirus, the individual has received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or Tl disease more than 6 months after and within 24 months after the last dose of BCG. In some embodiments, prior to the administration of the oncolytic adenovirus,the individual has received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG.

[0013] In some embodiments, prior to the administration of the oncolytic adenovirus, the individual has received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG. In some embodiments, the doses of BCG are administered weekly. In some embodiments, the doses of BCG are administered intravesically.

[0014] In some embodiments, the gemcitabine is administered concurrently with the oncolytic adenovirus. In some embodiments, the gemcitabine and oncolytic adenovirus are administered sequentially. In some embodiments, the method comprises intravesical administration of the oncolytic adenovirus followed by intravesical administration of gemcitabine on the same day of treatment. In some embodiments, the method comprises intravesical administration of the oncolytic adenovirus followed immediately by intravesical administration of gemcitabine. In some embodiments, the gemcitabine and the oncolytic adenovirus on different days or different weeks of a treatment course.

[0015] In some embodiments, the method comprises one or more treatment courses each comprising administering the oncolytic adenovirus weekly. In some embodiments, each treatment courses comprises administering the oncolytic adenovirus weekly for about 1 week to about 6 weeks. In some embodiments, the method comprises at least a first induction phase comprising administering the oncolytic adenovirus to the individual once per week for six weeks.

[0016] In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic adenovirus to the individual every three or six months. In some embodiments, the maintenance phase comprises administering the oncolytic adenovirus weekly for three weeks every three or six months. In some embodiments, the start of the first induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic adenovirus is administered to the individual once per week for six weeks on month zero during the first induction phase and is reevaluated at month three or around week 11 following the start of the first induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the startof the first induction phase. In some embodiments, the maintenance phase comprises administering the oncolytic adenovirus once per week for three weeks every three months for nine months and subsequently administering the oncolytic adenovirus once per week for three weeks every six months.

[0017] In some embodiments, the individual receives a second induction phase (e.g., a second induction course) comprising administration of the oncolytic adenovirus once per week for six weeks at month three or around week 13 following the start of the first induction phase. In some embodiments, the maintenance phase comprises administering the oncolytic adenovirus once per week for three weeks every three months for six months and subsequently administering the oncolytic adenovirus once per week for three weeks every six months. In some embodiments, the maintenance phase comprises: (i) administering the oncolytic adenovirus once per week for three weeks every three months for six to nine months, and subsequently (ii) administering the oncolytic adenovirus once per week for three weeks every six months.

[0018] In some embodiments, the gemcitabine is administered in combination with the oncolytic adenovirus, wherein the method comprises at least a first 6-week induction phase comprising administering the oncolytic adenovirus and gemcitabine to the individual on weeks 1, 2, 3, 4, 5, and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering the oncolytic adenovirus and gemcitabine to the individual every three or six months. In some embodiments, the 3-week treatment comprises administering the oncolytic adenovirus and gemcitabine weekly on weeks 1, 2, and 3. In some embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months.

[0019] In some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In some embodiments, the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In some embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase. In some embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.

[0020] In some embodiments, the method comprises at least a first 6-week induction phase comprising: i) administering the oncolytic adenovirus to the individual on weeks 1, 2, 4 and 5; and ii) administering gemcitabine to the individual on weeks 3 and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering the oncolytic adenovirus and gemcitabine to the individual every three or six months. In some embodiments, the 3-week treatment comprises administering the oncolytic adenovirus weekly on weeks 1 and 2 followed by administering gemcitabine in week 3. In some embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months. In some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In some embodiments, the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In some embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase. In some embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.

[0021] In some embodiments, the gemcitabine is administered at a dose of between 0.1 g and 5 g, optionally at a dose of about 1g or about 2g. In some embodiments, the gemcitabine is administered in 50 to 100 mL saline. In some embodiments, the oncolytic adenovirus is administered at a dose of about 1 x 108to about 1 x 1014viral particles. In some embodiments, the oncolytic adenovirus is administered at a dose of about 1 x 1012viral particles.

[0022] In some embodiments, the oncolytic adenovirus is administered in a volume of between about 50 mL and about 100 mL.

[0023] In some embodiments, the method further comprises intravesically administering to the individual a transduction enhancing agent prior to the administration of the oncolytic adenovirus. In some embodiments, the transduction enhancing agent is N-Dodecyl-[3-D- maltoside (DDM).

[0024] In some embodiments, the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic adenovirus. In someembodiments, the oncolytic adenovirus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic adenovirus. In some embodiments, the oncolytic adenovirus is administered directly after the single dose of DDM, without intravesical administration of a saline wash. In some embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic adenovirus. In some embodiments, the method comprises intravesically administering a saline wash before administering a first and second dose of DDM to the individual. In some embodiments, the method comprises intravesically administering a saline wash after administering a first and second dose of DDM to the individual, prior to administering the oncolytic adenovirus. In some embodiments, the DDM is administered at a concentration of about 0.1%. In some embodiments, the DDM is administered at a volume of between about 50 mL and about 100 mL.

[0025] In some embodiments, the individual has carcinoma in situ. In some embodiments, the individual has a concurrent papillary carcinoma of high-grade Ta or T1 stage. In some embodiments, the individual does not have a concurrent papillary carcinoma of high-grade Ta or T1 stage. In some embodiments, the individual has a papillary carcinoma of high-grade Ta or T1 stage. In some embodiments, the individual does not have concurrent carcinoma in situ.

[0026] In some embodiments, the individual has received transurethral resection of bladder tumor (TURBT) prior to administration of the oncolytic adenovirus.

[0027] In some embodiments, the bladder cancer has been completely resected by TURBT prior to administration of the oncolytic adenovirus. In some embodiments, the bladder cancer is recurrent after complete resection of one or more prior bladder tumors by TURBT.

[0028] In some embodiments, the oncolytic adenovirus preferentially replicates in a cancer cell. In some embodiments, the cancer cell is defective in the Rb pathway. In some embodiments, the tumor cell-specific promoter is an E2F-1 promoter. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:1.

[0029] In some embodiments, the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTa[3. In some embodiments, the immune-related molecule is GM-CSF.

[0030] In some embodiments, the heterologous gene is operably linked to a viral promoter. In some embodiments, the viral gene essential for replication of the oncolytic adenovirus isselected from the group consisting of E1A, E1B, and E4. In some embodiments, the heterologous gene is operably linked to an El promoter or an E3 promoter. In some embodiments, the oncolytic adenovirus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In some embodiments, the oncolytic adenovirus is cretostimogene.

[0031] In some embodiments, the individual is human.

[0032] In some aspects, provided here in is a kit for treating high-risk non-muscle invasive bladder cancer (HR-NMIBC) in an individual, the kit comprising: a) an oncolytic adenovirus; b) gemcitabine; and c) a device for intravesically administering the oncolytic adenovirus, gemcitabine, or both the oncolytic adenovirus and gemcitabine; wherein the oncolytic adenovirus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule.

[0033] In some embodiments, the oncolytic adenovirus preferentially replicates in a cancer cell. In some embodiments, the cancer cell is defective in the Rb pathway. In some embodiments, the tumor cell-specific promoter is an E2F-1 promoter. In some embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the immune-related molecule is selected from the group consisting of GM- CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTa . In some embodiments, the immune-related molecule is GM-CSF.

[0034] In some embodiments, the heterologous gene is operably linked to a viral promoter. In some embodiments, the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of E1A, E1B, and E4. In some embodiments, the heterologous gene is operably linked to an El promoter or an E3 promoter.

[0035] In some embodiments, the oncolytic adenovirus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In some embodiments, the oncolytic adenovirus is cretostimogene.

[0036] In some embodiments, the kit comprises a dosage unit of gemcitabine in an amount of between 0.1 g and 5 g, optionally around 1 g or around 2 g. In some embodiments, the kitcomprises a dosage unit of the oncolytic adenovirus in an amount of between about 1 x 108and about 1 x 1014viral particles, optionally around 1 x 1012viral particles.BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The present application can be understood by reference to the following description taken in conjunction with the accompanying figures.

[0038] FIG. 1 is a schematic diagram of cretostimogene grenadenorepvec (also referred to as cretostimogene or CG0070) and wild type adenovirus type 5. Cretostimogene is based on adenovirus serotype 5, but the endogenous El a promoter and E3 19kD coding region have been replaced by the human E2F-1 promoter and a cDNA coding region of human GM-CSF, respectively.

[0039] FIG. 2A depicts a flow chart showing administration of a clinical trial evaluating cretostimogene monotherapy (Mono) and combination therapy with one or more additional therapeutic agents (IO, such as an immune checkpoint modulator or chemotherapeutic agent) based on a determination of urinary genomic disease burden (GDB) and an associated risk status of low, intermediate (int), or high for the individual being treated.

[0040] FIG. 2B depicts a flow chart showing administration of a clinical trial evaluating cretostimogene monotherapy (Mono creto) and combination therapy with one or more additional therapeutic agents (X, such as an immune checkpoint modulator or chemotherapeutic agent) based on a determination of urinary genomic disease burden (GDB) and an associated minimum residutal disease (MRD) status of positive (+) or negative (-) for the individual being treated.

[0041] FIG. 3 depicts a chart showing the criteria for the patient groups of the Phase 2 clinical trial described in Example 3, including BCG-naive, BCG-unresponsive, and BCG- exposed patient groups.

[0042] FIG. 4 depicts a chart summarizing the cohorts evaluated in the Phase 2 clinical trial described in Example 3. The number of patients depicted in each cohort is an estimate of patients to be recruited for the trial.

[0043] FIG. 5A depicts the treatment schedule to be used for Cohort A (all arms), Cohort B (all arms), and Arm 1 of Cohort CX of the Phase 2 clinical trial described in Example 3. Each instillation is represented by a line topped with a circle. In Cohort A and B, each instillation corresponds to an instillation of DDM followed by an instillation of cretostimogene. In Cohort CX, Arm 1, each instillation correspond to an instillation of DDM, followed by an instillation of cretostimogene, followed by an instillation of gemcitabine.

[0044] FIG. 5B depicts the treatment schedule to be used for Arm 2 of Cohort CX of the Phase 2 clinical trial described in Example 3. Instillations of cretostimogene are represented by a line topped with a circle and correspond to an instillation of DDM followed by an instillation of cretostimogene. Instillations of gemcitabine are represented by a line topped with a diamond and correspond to an instillation of gemcitabine only.

[0045] FIGS. 6A-6B depict results from genomic disease burden (GDB) analysis of patients in the BOND-003 trial. FIG. 6A depicts results from patients prior to the first administration of cretostimogene. FIG. 6B depicts results from patients 6-months after the first administration of cretostimogene. Each column in the bar chart corresponds to a single patient. In the bar chart, single-nucleotide variants (SNV) and insertions / deletions (InDei) are collectively shown in blue; copy number variants (CNV) are shown in orange; and aneuploidy is shown in red. Genomic disease burden (GDB) for each patient is shown below the bar chart, with low to high GDB shown in a gradient from black, to purple, to red, to yellow. Minimum residual disease (MRD) status for each patient is shown below GDB, with white indicating MRD-negative and red indicating MRD-positive patients.

[0046] FIGS. 7A-7B depict results from GDB analysis of patients in the CORE-001 trial. FIG. 7A depicts results from patients prior to the first administration of cretostimogene. FIG. 7B depicts results from patients 6-months after the first administration of cretostimogene. Each column in the bar chart corresponds to a single patient. In the bar chart, single- nucleotide variants (SNV) and insertions / deletions (InDei) are collectively shown in blue; copy number variants (CNV) are shown in orange; and aneuploidy is shown in red. Genomic disease burden (GDB) for each patient is shown below the bar chart, with low to high GDB shown in a gradient from black, to purple, to red, to yellow. Minimum residual disease (MRD) status for each patient is shown below GDB, with white indicating MRD-negative and red indicating MRD-positive patients.

[0047] FIG. 8 depicts the fraction of patients with bladder cancer evaluated using Uro Amp® in the BOND-003 and CORE-001 trials that were found to have variants in bladder-cancer-associated genes at baseline prior to the initiation of treatment. Single- nucleotide variants (SNV) and insertions / deletions (InDei) are shown as blue dots; copy number variants (CNV) are shown as orange dots; and aneuploidy is shown as a red dot.

[0048] FIG. 9 depicts a graph showing the probability of high-grade recurrence-free survival (RFS) over time in MRD-negative and MRD-positive patients in the BOND-003 trial who have been treated with cretostimogene and achieved a complete response at or around month 3. The graph represents a 12-month RFS Kaplan-Meier model, predicted based on theUroAmp® molecular signature (MRD profile) obtained at the Week 13 assessment. MRD- negative patients are shown in blue, and MRD-positive patients are shown in red.

[0049] FIG. 10 depicts the maximum variant allele frequency (VAF) analyzed over about 12 months (49 weeks) in patients in the BOND-003 trial that have been stratified according to their response to cretostimogene therapy. “All CR” refers to patients that received a weekly x6 induction course of cretostimogene administration and achieved a complete response (CR) at three months (week 13) and did not receive a second induction course. All patients in the “All CR” group maintained complete response (CR) throughout the 12-month period shown. “NR to CR” refers to patients that initially received a weekly x6 induction course of cretostimogene administration, were not responsive, and subsequently received a second weekly x6 induction course at three months (week 13), and then achieved CR by the six- month (week 25) evaluation. The “NR to CR” group then maintained CR throughout to the 12-month timepoint depicted in the figure. “CR to NR” refers to patients that received a single weekly x6 induction course of cretostimogene administration, achieved CR at three months (week 13), and then experienced disease recurrence within 12 months (by week 49) from the first dose of cretostimogene “All NR” refers to patients that that received at least one weekly x6 induction course of cretostimogene, did not achieve CR at any point in the study, and discontinued the study after three months (week 13).

[0050] FIG. 11 depicts a Kaplan-Meier estimate for high-grade recurrence-free survival based on the first 24 patients evaluated in Cohort P of the BOND-003 trial.DETAILED DESCRIPTION

[0051] The following description is presented to enable a person of ordinary skill in the art to make and use the various embodiments. Descriptions of specific devices, techniques, and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those of ordinary skill in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Thus, the various embodiments are not intended to be limited to the examples described herein and shown, but are to be accorded the scope consistent with the claims.I. Definitions

[0052] Terms are used herein as generally used in the art, unless otherwise defined as follows.

[0053] “Non-muscle invasive bladder cancer (NMIBC)” refers to bladder cancer where the cancer cells / tumors are confined to the bladder wall and are not present muscle surrounding the bladder. NMIBC includes papillary carcinomas of Ta and T1 stage, carcinoma in situ (CIS), and combinations thereof. “High-risk NMIBC” refers to bladder cancer comprising high-grade papillary carcinomas of Ta and T1 stage, carcinoma in situ (CIS), or a combination thereof.

[0054] “Papillary carcinoma” refers to bladder tumors that grow in slender, finger-like projections from the inner surface of the bladder toward the hollow center. Papillary tumors often grow toward the center of the bladder without growing into the deeper bladder layers. These tumors are called non-invasive papillary cancers. Very low-grade (slow growing), non- invasive papillary cancer is sometimes called papillary urothelial neoplasm of low-malignant potential (PUNLMP).

[0055] “Ta” stage papillary carcinoma, also referred to as “Ta disease,” refers to papillary carcinoma that is found on the surface of the inner lining of the bladder. Cancer cells are grouped together and can often be easily removed. The cancer has not invaded the muscle or connective tissue of the bladder wall. Ta papillary carcinoma is also referred to as noninvasive papillary urothelial carcinoma, or Stage Oa bladder cancer.

[0056] “Tl” stage papillary carcinoma, also referred to as “T1 disease,” refers to papillary carcinoma that has grown through the inner lining of the bladder into the lamina propria. It has not spread to the thick layer of muscle in the bladder wall or to lymph nodes or other organs. In some embodiments, the carcinoma has invaded subepithelial connective tissue.

[0057] As used herein, “bladder carcinoma in situ,” “bladder CIS,” and “carcinoma in situ of the bladder” are used interchangeably to refer to the clinical stage of bladder cancer characterized by a flat (i.e., non-papillary) lesion comprising of cytologically malignant cells which may involve either full or partial thickness of the urothelium.

[0058] As used herein, “low-grade tumor” refers to a well-differentiated tumor, and “ “high-grade tumor” refers to a poorly-differentiated tumor, as determined by a pathologist. A high-grade tumor is often faster-growing, more likely to spread, more likely to recur after treatment, and cells look more abnormal compared to a low-grade tumor. In some embodiments, tumor grading is as described in Humphrey PA, et al. The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs-Part B: Prostate and Bladder Tumours. Eur Urol. 2016 Jul;70(l): 106-119.

[0059] As used herein, “treatment” or “treating” is an approach for obtaining beneficial or desired results including clinical results. For purposes of this invention, beneficial or desiredclinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms resulting from the bladder cancer, diminishing the extent of the bladder cancer, stabilizing the bladder cancer (e.g., preventing or delaying the worsening of the bladder cancer), preventing or delaying the spread (e.g., metastasis) of the bladder cancer, preventing or delaying the recurrence of the bladder cancer, reducing recurrence rate of the bladder cancer, delay or slowing the progression of the bladder cancer, ameliorating the bladder cancer state, providing a remission (partial or total) of the bladder cancer, decreasing the dose of one or more other medications required to treat the bladder cancer, delaying the progression of the bladder cancer, increasing the quality of life, and / or prolonging survival. Also encompassed by "treatment" is a reduction of pathological consequence of bladder cancer. The methods of the invention contemplate any one or more of these aspects of treatment.

[0060] “Prior therapy” used herein refers to a therapeutic regime that is different from and was instituted prior to the methods described herein comprising intravesical administration of the oncolytic virus.

[0061] As used herein, “BCG-naive” refers to an individual who has not received prior intravesical therapy with Bacillus Calmette-Guerin (BCG) for the treatment of bladder cancer (also known as “completely BCG-naive”), or who has not received prior intravesical BCG therapy within the past 24 months (e.g., within the last 24 months prior to their current pathological diagnosis), or has received a maximum of 1 or 2 doses of BCG therapy within the past 24 months (e.g, within the last 24 months prior to their current pathological diagnosis).

[0062] “Adjuvant setting” refers to a clinical setting in which an individual has had a history of bladder cancer, and generally (but not necessarily) been responsive to therapy, which includes, but is not limited to, surgery (e.g., transurethral resection of bladder tumor (“TURBT”), partial cystectomy, or radical cystectomy), radiotherapy, and chemotherapy. Treatment or administration in the “adjuvant setting” refers to a subsequent mode of treatment.

[0063] “Neoadjuvant setting” refers to a clinical setting in which the method is carried out before the primary / definitive therapy.

[0064] The term “individual,” “subject,” and “patient” are used interchangeably herein to describe a mammal, including humans. An individual includes, but is not limited to, human, bovine, horse, feline, canine, rodent, or primate. In some embodiments, the individual is human. In some embodiments, an individual suffers from bladder cancer. In someembodiments, the individual is in need of treatment.

[0065] As used herein, “delaying” the development of bladder cancer means to defer, hinder, slow, retard, stabilize, and / or postpone development of the bladder cancer. This delay can be of varying lengths of time, depending on the history of the disease and / or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. A method that “delays” development of bladder cancer is a method that reduces probability of disease development in a given time frame and / or reduces the extent of the bladder cancer in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a statistically significant number of subjects. Bladder cancer development can be detectable using standard methods, including, but not limited to, urinary cytology, urethra-cystoscopy (UCS), computed tomography (CT Scan, e.g., helical spiral CT scan), endoscopic ultrasound (EUS), endoscopic retrograde cholangiopancreatography (ERCP), laparoscopy, or biopsy (e.g., percutaneous needle biopsy or fine needle aspiration). Development may also refer to bladder cancer progression that may be initially undetectable and includes recurrence.

[0066] As used herein, by “combination therapy” is meant that a first agent be administered in conjunction with another agent. “In conjunction with” refers to administration of one treatment modality in addition to another treatment modality. As such, “in conjunction with” refers to administration of one treatment modality before, during, or after delivery of the other treatment modality to the individual.

[0067] As used herein, “monotherapy” refers to administration of a single therapeutic agent, such as the oncolytic virus, which is not in conjunction with another treatment modality, such as an immune checkpoint modulator. A monotherapy with the oncolytic virus can be administered with a pretreatment composition, such as a transduction enhancing agent (e.g., N-Dodecyl-P-D-maltoside [DDM]), which is not considered as a different treatment modality for the purpose of this invention.

[0068] As used herein, "specific", "specificity", or "selective" or "selectivity" as used when describing a compound as an inhibitor, means that the compound preferably interacts with (e.g., binds to, modulates, and inhibits) a particular target (e.g., a protein and an enzyme) than a non-target.

[0069] The term “effective amount” used herein refers to an amount of an agent (such as the oncolytic virus described herein) or composition sufficient to treat a specified disorder, condition or disease such as ameliorate, palliate, lessen, and / or delay one or more of itssymptoms. In reference to cancer, an effective amount comprises an amount sufficient to cause a tumor to shrink and / or to decrease the growth rate of the tumor (such as to suppress tumor growth) or to prevent or delay other unwanted cell proliferation in cancer. In some embodiments, an effective amount is an amount sufficient to delay development of bladder cancer. In some embodiments, an effective amount is an amount sufficient to prevent or delay recurrence. In some embodiments, an effective amount is an amount sufficient to reduce recurrence rate in the individual. In some embodiments, the effective amount is an amount sufficient to inhibit tumor metastasis in the individual. An effective amount can be administered in one or more administrations. The effective amount of the agent or composition may: (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit, retard, slow to some extent and preferably stop cancer cell infiltration into peripheral organs; (iv) inhibit (i.e. , slow to some extent and preferably stop) tumor metastasis; (v) inhibit tumor growth; (vi) prevent occurrence and / or recurrence of tumor; (vii) delay occurrence and / or recurrence of tumor; (viii) reduce recurrence rate of tumor, and / or (ix) relieve to some extent one or more of the symptoms associated with the cancer. As is understood in the art, an “effective amount” may be in one or more doses, i.e., a single dose or multiple doses may be required to achieve the desired treatment endpoint.

[0070] The term “simultaneous administration,” as used herein, means that a first therapy and second therapy in a combination therapy are administered at the same time. When the first and second therapies are administered simultaneously, the first and second therapies may be contained in the same composition (e.g., a composition comprising both a first and second therapy) or in separate compositions (e.g., a first therapy is contained in one composition and a second therapy is contained in another composition).

[0071] As used herein, the term “sequential administration” or “in sequence” means that the first therapy and second therapy in a combination therapy are administered with a time separation, for example, of more than about 1 minute, such as more than about any of 5, 10, 15, 20, 30, 40, 50, 60, or more minutes. In some cases, the term “sequential administration” means that the first therapy and second therapy in a combination therapy are administered with a time separation of more than about 1 day, such as more than about any of 1 day to 1 week, 2 weeks, 3 weeks, 4 weeks, 8 weeks, 12 weeks, or more weeks. Either the first therapy or the second therapy may be administered first. The first and second therapies are contained in separate compositions, which may be contained in the same or different packages or kits.

[0072] The term “administered immediately prior to” means that the first therapy is administered no more than about 15 minutes, such as no more than about any of 10, 5 or 1minutes before administration of the second therapy. The term “administered immediately after” means that the first therapy is administered no more than about 15 minutes, such as no more than about any of 15, 10 or 1 minutes after administration of the second therapy.

[0073] As used herein, by “pharmaceutically acceptable” or “pharmacologically compatible” is meant a material that is not biologically or otherwise undesirable, e.g., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. Pharmaceutically acceptable carriers or excipients have preferably met the required standards of toxicological and manufacturing testing and / or are included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug administration.

[0074] An “adverse event” or “AE” as used herein refers to any untoward medical occurrence in an individual receiving a marketed pharmaceutical product or in an individual who is participating on a clinical trial who is receiving an investigational or non- investigational pharmaceutical agent. The AE does not necessarily have a causal relationship with the individual’s treatment. Therefore, an AE can be any unfavorable and unintended sign, symptom, or disease temporally associated with the use of a medicinal product, whether or not considered to be related to the medicinal product. An AE includes but is not limited to: an exacerbation of a pre-existing illness; an increase in frequency or intensity of a preexisting episodic event or condition; a condition detected or diagnosed after study drug administration even though it may have been present prior to the start of the study; and continuously persistent disease or symptoms that were present at baseline and worsen following the start of the study. An AE generally does not include: medical or surgical procedures (e.g., surgery, endoscopy, tooth extraction, or transfusion); however, the condition that leads to the procedure is an adverse event; pre-existing diseases, conditions, or laboratory abnormalities present or detected at the start of the study that do not worsen; hospitalizations or procedures that are done for elective purposes not related to an untoward medical occurrence (e.g., hospitalizations for cosmetic or elective surgery or social / convenience admissions); the disease being studied or signs / symptoms associated with the disease unless more severe than expected for the individual's condition; and overdose of study drug without any clinical signs or symptoms.

[0075] A “serious adverse event” or (SAE) as used herein refers to any untoward medical occurrence at any dose including, but not limited to, that: a) is fatal; b) is life-threatening (defined as an immediate risk of death from the event as it occurred); c) results in persistentor significant disability or incapacity; d) requires in-patient hospitalization or prolongs an existing hospitalization (exception: Hospitalization for elective treatment of a pre-existing condition that did not worsen during the study is not considered an adverse event. Complications that occur during hospitalization are AEs and if a complication prolongs hospitalization, then the event is serious); e) is a congenital anomaly / birth defect in the offspring of an individual who received medication; or 1) conditions not included in the above definitions that may j eopardize the individual or may require intervention to prevent one of the outcomes listed above unless clearly related to the individual’s underlying disease. “Lack of efficacy” (progressive disease) is not considered an AE or SAE. The signs and symptoms or clinical sequelae resulting from lack of efficacy should be reported if they fulfill the AE or SAE definitions.

[0076] The following definitions may be used to evaluate response based on target lesions: “complete response” or “CR” refers to disappearance of all target lesions; “partial response” or “PR” refers to at least a 30% decrease in the sum of the longest diameters (SLD) of target lesions, taking as reference the baseline SLD; “stable disease” or “SD” refers to neither sufficient shrinkage of target lesions to qualify for PR, nor sufficient increase to qualify for PD, taking as reference the nadir SLD since the treatment started; and “progressive disease” or “PD” refers to at least a 20% increase in the SLD of target lesions, taking as reference the nadir SLD recorded since the treatment started, or, the presence of one or more new lesions.

[0077] The following definitions of response assessments may be used to evaluate a nontarget lesion: “complete response” or “CR” refers to disappearance of all non-target lesions; “stable disease” or “SD” refers to the persistence of one or more non-target lesions not qualifying for CR or PD; and “progressive disease” or “PD” refers to the “unequivocal progression” of existing non-target lesion(s) or appearance of one or more new lesion(s) is considered progressive disease (if PD for the individual is to be assessed for a time point based solely on the progression of non-target lesion(s), then additional criteria are required to be fulfilled.

[0078] “Progression free survival” (PFS) indicates the length of time during and after treatment that the cancer does not grow. Progression-free survival includes the amount of time individuals have experienced a complete response or a partial response, as well as the amount of time individuals have experienced stable disease.

[0079] “Cystectomy free survival” (CFS) indicates the length of time during and after treatment that a cystectomy is not required for the patient as determined by the physician.

[0080] “High-grade event-free-survival (HG EFS)” refers to the duration from the firsttreatment on study during which a patient does not experience high-grade recurrence or persistence of NMIBC, disease progression, radical cystectomy, or death from any cause.

[0081] “Bladder cancer-specific survival” indicates the length of time from the time of first treatment to the time of death due to bladder cancer.

[0082] "Predicting" or "prediction" is used herein to refer to the likelihood that an individual is likely to respond either favorably or unfavorably to a treatment regimen.

[0083] As used herein, "at the time of starting treatment" or "baseline" refers to the time period at or prior to the first exposure to the treatment.

[0084] As used herein, "sample" refers to a composition which contains a molecule which is to be characterized and / or identified, for example, based on physical, biochemical, chemical, physiological, and / or genetic characteristics.

[0085] It is understood that embodiments of the invention described herein include “consisting” and / or “consisting essentially of” embodiments.

[0086] Reference to "about" a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to "about X" includes description of "X".

[0087] As used herein, reference to "not" a value or parameter generally means and describes "other than" a value or parameter. For example, the method is not used to treat cancer of type X means the method is used to treat cancer of types other than X.

[0088] The term “about X-Y” used herein has the same meaning as “about X to about Y.”

[0089] As used herein and in the appended claims, the singular forms "a," "or," and "the" include plural referents unless the context clearly dictates otherwise.II. Methods of treating Bladder Cancer

[0090] The present disclosure relates to treatment of bladder cancer in an individual (such as human individual) by intravesical administration of an oncolytic virus. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule. In some embodiments, the oncolytic virus is administered in combination with one or more additional therapeutic agents, such as an immune-checkpoint modulator or a chemotherapeutic agent (e.g, gemcitabine).

[0091] Any of the methods described herein may be useful for inhibiting growth of abladder tumor, inhibiting metastasis of a bladder tumor, prolonging survival (such as disease- free survival, progression-free survival, recurrence-free survival, cystectomy-free survival, or high-grade event-free survival) of an individual having bladder cancer, causing disease remission in an individual having bladder cancer, preventing disease progression of an individual having bladder cancer, and / or improving quality of life of an individual having bladder cancer. In some embodiments, the method is bladder-preserving or bladder-sparing. In some embodiments, the bladder-preserving or bladder-sparing method is useful for improving the quality of life of the individual.Patient Populations

[0092] In some embodiments of the methods described herein, the individual has particular stage of bladder cancer. The methods described herein can be used to treat a variety of bladder cancer conditions. For example, the methods described herein can be used to treat a variety of bladder cancer stages. In some embodiments, the bladder cancer is muscle invasive (e.g., stage T2, T3 or T4 tumors). In some embodiments, the bladder cancer is non-muscle invasive (e.g., stage Ta, Tl, Cis, Cis with Ta and / or T1 tumors, in the absence of stage T2, T3 or T4 tumors). In addition, the methods described herein can be used to treat a variety of bladder cancer grades. The grade of a bladder cancer tumor describes the microscopic appearance of cells from the tumor relative to normal bladder cells, particularly with respect to cell division. In some embodiments, the bladder cancer is graded using a numbered grading system. In certain embodiments, the bladder cancer comprises a bladder tumor of grade 1, in which the tumor cells appear mostly well-differentiated, are slow-growing and unlikely to spread. In certain embodiments, the bladder cancer comprises a bladder tumor of grade 2, in which the tumor cells appear somewhat differentiated and are growing faster than grade 1 cells. In certain embodiments, the bladder cancer comprises a bladder tumor of grade 3, in which the tumor cells appear mostly undifferentiated and are growing faster than grade 2 cells. In some embodiments, the bladder cancer is graded using a binary high or low grading system. In some embodiments, the bladder cancer is a low-grade bladder cancer, in which the cancer cells are slow-growing and are less likely to spread. In some embodiments, the bladder cancer is a high-grade bladder cancer, the cancer cells grow more quickly and are more likely to spread. Bladder cancer comprising CIS is classified as high-grade.

[0093] In some embodiments of the methods described herein, the individual has carcinoma in situ. In some embodiments, the individual has carcinoma in situ without aconcurrent Ta or T1 stage tumor. In some embodiments, the individual has carcinoma in situ and at least one concurrent Ta or T1 stage tumor. In some embodiments, the individual has a Ta or T1 stage tumor. In some embodiments, the individual has a Ta or T1 stage tumor without concurrent carcinoma in situ. In some embodiments, the individual has a Ta or T1 stage tumor and concurrent carcinoma in situ.

[0094] In some embodiments of the methods described herein, the individual has nonmuscle invasive bladder cancer (NMIBC). In some embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has intermediate-risk NMIBC. In some embodiments, the individual has low-risk NMIBC. In some embodiments, the individual has high-risk, intermediate-risk, or low-risk NMIBC as determined according to the TNM staging system by the American Joint Committee on Cancer (AJCC) guidelines. In certain embodiments, the individual has high-risk NMIBC comprising a) CIS; b) two or more grade 2 stage T1 tumors; c) one or more grade 3 stage Ta and / or T1 tumors; or d) any combination of (a), (b), and (c). In some embodiments, the individual has high-risk, intermediate-risk, or low-risk NMIBC as determined according to American Urological Association (AU A) guidelines for NMIBC (https: / / www.auanet.org / guidelines-and-quality / guidelines / bladder- cancer-non-muscle-invasive-guideline). In certain embodiments, the individual has high-risk NMIBC comprising a) one or more high-grade T1 tumors; b) any recurrent high-grade Ta tumors; c) a high-grade Ta tumor greater than 3 cm or multi-focal high-grade Ta tumors; d) any carcinoma in situ; e) one or more high-grade NMIBC tumors wherein the individual has failed BCG treatment; I any variant histology; g) any lymphovascular invasion; and / or h) any high-grade prostatic urethral involvement.

[0095] In some embodiments, the bladder cancer is transitional cell carcinoma or urothelial carcinoma (such as metastatic urothelial carcinoma), including, but not limited to, papillary tumors and flat carcinomas. In some embodiments, the bladder cancer is metastatic urothelial carcinoma. In some embodiments, the bladder cancer is urothelial carcinoma of the bladder. In some embodiments, the bladder cancer is urothelial carcinoma of the ureter. In some embodiments, the bladder cancer is urothelial carcinoma of the urethra. In some embodiments, the bladder cancer is urothelial carcinoma of the renal pelvis.

[0096] In some embodiments, the bladder cancer is squamous cell carcinoma. In some embodiments, the bladder cancer is non-squamous cell carcinoma. In some embodiments, the bladder cancer is adenocarcinoma. In some embodiments, the bladder cancer is small cell carcinoma.

[0097] In some embodiments, the bladder cancer is early stage bladder cancer, non-metastatic bladder cancer, non-invasive bladder cancer, non-muscle-invasive bladder cancer, primary bladder cancer, advanced bladder cancer, locally advanced bladder cancer (such as unresectable locally advanced bladder cancer), metastatic bladder cancer, or bladder cancer in remission. In some embodiments, the bladder cancer is localized resectable, localized unresectable, or unresectable. In some embodiments, the bladder cancer is a high grade, non- muscle-invasive cancer that has been refractory to standard intra-bladder infusion (intravesical) therapy.

[0098] The methods provided herein can be used to treat an individual (e.g., human) who has been diagnosed with or is suspected of having bladder cancer. In some embodiments, the individual has undergone a tumor resection. In some embodiments, the individual has refused surgery. In some embodiments, the individual is medically inoperable. In some embodiments, the individual is at a clinical stage of Ta, Tis, Tl, T2, T3a, T3b, or T4 bladder cancer. In some embodiments, the individual is at a clinical stage of carcinoma in situ (CIS, also known as Tis), Ta, or Tl.

[0099] In some embodiments, the individual has been previously treated for bladder cancer with intravesical Bacillus Calmette-Guerin (BCG). In some embodiments, the individual has bladder cancer in remission, progressive bladder cancer, or recurrent bladder cancer. In some embodiments, the individual is resistant to treatment of bladder cancer with intravesical BCG. In some embodiments, the individual is initially responsive to treatment of bladder cancer with intravesical BCG but has progressed after treatment.

[0100] In some embodiments, the individual has recurrent bladder cancer (such as a bladder cancer at the clinical stage of Ta, Tis, Tl, T2, T3a, T3b, or T4) after intravesical BCG (such as prior standard therapy, for example treatment with BCG). For example, the individual may be initially responsive to the treatment with intravesical BCG, but develops bladder cancer after about any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 24, 36, 48, or 60 months upon the cessation of the intravesical BCG therapy.

[0101] In some embodiments, the prior therapy is radiation therapy (e.g., with or without chemotherapy). In some embodiments, the radiation therapy is in combination with chemotherapy. In some embodiments, the prior therapy is radiation therapy to the whole body. In some embodiments, the prior therapy is radiation therapy to only tumor sites. In some embodiments, the prior therapy is radiation therapy to tissues having the tumor. In some embodiments, the prior therapy is radiation therapy to only the site of the tumor selected for local administration of the oncolytic virus. In some embodiments, the prior therapy is radiation therapy to only a tissue having the tumor selected for local administration of theoncolytic virus. In some embodiments, the dose of the radiation therapy is insufficient to treat the tumor cells. For example, a suitable dosage of the radiation therapy is about any one of 1 Gy, 5 Gy, 10 Gy, 15 Gy, 20 Gy, 25 Gy, 30 Gy, 35 Gy, 40 Gy, 45 Gy, 50 Gy, 55 Gy, 60 Gy, 65 Gy, 70 Gy, 75 Gy, 80 Gy, 90 Gy or 100 Gy. In some embodiments, the dose of the radiation therapy is no more than about any one of 1 Gy, 5 Gy, 10 Gy, 15 Gy, 20 Gy, 25 Gy, 30 Gy, 35 Gy, 40 Gy, 45 Gy, 50 Gy, 55 Gy, 60 Gy, 65 Gy, 70 Gy, 75 Gy, 80 Gy, 90 Gy or 100 Gy. In some embodiments, the dose of the radiation therapy is any one of about 1 Gy to about 5 Gy, about 5 Gy to about 10 Gy, about 10 Gy to about 15 Gy, about 15 Gy to about 20 Gy, about 20 Gy to about 25 Gy, about 25 Gy to about 30 Gy, about 30 Gy to about 35 Gy, about 5 Gy to about 15 Gy, about 10 Gy to about 20 Gy, about 20 Gy to about 30 Gy, about 30 Gy to about 40 Gy, about 40 Gy to about 50 Gy, about 50 Gy to about 60 Gy, about 60 Gy to about 70 Gy, about 70 Gy to about 80 Gy, about 80 Gy to about 100 Gy, about 10 Gy to about 30 Gy, about 20 Gy to about 40 Gy, about IGy to about 25 Gy, about 25 Gy to about 50 Gy, about 30 Gy to about 60 Gy, about 60 Gy to about 80 Gy, or about 10 Gy to about 60 Gy. The suitable dosage of the radiation therapy may also depend on the type, stage and location of the tumor.

[0102] In some embodiments, the radiation therapy is administered in more than one fraction, such as about any one of 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 16, 18, 20 or more fractions. In some embodiments, the radiation therapy fractions are administered over the course of about any one of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks or more. In some embodiments, the radiation therapy fractions are administered over the course of any one of about 1 day to about 5 days, about 1 week to about 2 weeks, about 2 weeks to about 3 weeks, about 3 weeks to about 4 weeks, about 4 weeks to about 5 weeks, about 5 weeks to about 6 weeks, about 6 weeks to about 7 weeks, about 2 weeks to about 4 weeks, about 4 weeks to about 6 weeks, or about 1 week to about 6 weeks. In some embodiments, the radiation therapy is administered about two fractions per day. In some embodiments, each fraction of the radiation therapy is about 1.8 Gy to about 2 Gy per day, five days a week, for an adult, or about 1.5 Gy to about 1.8 Gy per day, five days a week for a child. In some embodiments, each fraction of the radiation therapy is about any one of 1 Gy, 1.5 Gy, 2 Gy, 2.5 Gy, 5 Gy, 10 Gy, 15 Gy, 20 Gy, 30 Gy, 40 Gy, 50 Gy or more. In some embodiments, each fraction of the radiation therapy is any one of about 1 Gy to about 1.5 Gy, about 1.5 Gy to about 2 Gy, about 1 Gy to about 2.5 Gy, about 2.5 Gy to about 5 Gy, about 5 Gy to about 10 Gy, about 10 Gy to about 15 Gy, about 15 Gy to about 20 Gy, about 20 Gy to about 30 Gy, about 25 Gy to about 50 Gy, about 1 Gyto about 10 Gy, or about 2 Gy to about 20 Gy. In some embodiments, the radiation therapy is administered in a single fraction.

[0103] Any of the known methods of radiation therapy may be used in the present invention, including, but not limited to external beam radiation therapy (EBRT or XRT), tele therapy, brachytherapy, sealed source radiation therapy, systemic radioisotope therapy (RIT), unsealed source radiation therapy, intraoperative radiation therapy (IORT), targeted intraoperative radiation therapy (TARGIT), intensity-modulated radiation therapy (IMRT), volumetric modulated arc therapy (VMAT), particle therapy, and auger therapy.

[0104] In some embodiments, the prior therapy comprises administration of a therapeutic agent. In some embodiments, the dosage of the therapeutic agent is sufficient to treat the tumor. In some embodiments, the dosage of the therapeutic agent is insufficient to treat the tumor. In some embodiments, the therapeutic agent is any one or combination of chemotherapeutic agents known in the art, for example, cyclophosphamide. In some embodiments, the therapeutic agent is any one or combination of agents targeting or blocking a cellular signaling pathway known in the art, for example, a BRAF inhibitor. In some embodiments, the therapeutic agent is any one or combination of cell therapies known in the art, for example, TIL cells, CAR / T cells, and / or TCR / T cells. In some embodiments, the therapeutic agent is an agent that increases the level of cytokines involved an immunogenic pathway. Any of the immune-related molecules described herein may be used as the therapeutic agent, including, but are not limited to, cytokines such as IL6, IL8 and IL 18 (these cytokines can either have pro and / or anti-inflammatory actions, or some may promote new blood vessels formation and tumor growth), chemokines (such as CCL21 that can promote tumor spread by increase of lymphatic structures), growth factors (such as FLT3L), heat shock proteins, small molecule kinase inhibitors (such as JAK2 inhibitor), IAP inhibitors, STING activators (such as CDN), PRRago (such as CpG ODN (oligodeoxynucleotides), Imiquimod, or Poly I:C), TLR stimulators (such as GS-9620, AED- 1419, CYT-003-QbG10, AVE-0675, or PF-7909), and RLR stimulators (such as RIG-I, Mda5, or LGP2 stimulators). In some embodiments, the therapeutic agent is an agent that causes dysfunction or damage to a structural component of a tumor. Exemplary agents include, but are not limited to, anti-VEGF antibody, a hyaluronidase, and n-dodecyl-|3- maltoside. In some embodiments, the therapeutic agent induces immune cells, such as dendritic cells, B cells, and T cells (such as follicular T helper cells). Any of the therapeutic agent / s described herein, e.g. chemotherapeutic agents, agents targeting or blocking cellsignaling pathways, cytokines, chemokines, cell therapies, etc., can be administered locally (e.g, intravesically) or systemically (e.g. through intravenous administration) to the tumor site, either singly or in combination.

[0105] In some embodiments, the prior standard therapy is treatment with intravesical Bacillus Calmette-Guerin (BCG). Accordingly, in some embodiments of the methods described herein, the individual has been previously treated intravesically with BCG therapy. In some embodiments, the individual was responsive to BCG therapy (e.g, experienced complete response (CR) after BCG therapy). In certain embodiments, the individual experienced reduced bladder cancer symptoms, reduced size or number of bladder tumors, or an absence of bladder tumors after intravesical BCG therapy. In other embodiments, the individual was unresponsive to BCG therapy (e.g, had persistent bladder cancer after BCG therapy).

[0106] In some embodiments of the methods described herein, the individual was previously treated with intravesical BCG therapy and was unresponsive to BCG therapy. In some embodiments, the individual has previously received a BCG induction course and had persistent or recurrent bladder cancer subsequent to the BCG induction course. In some embodiments, the individual has previously received a BCG induction course and at least one BCG maintenance course and had persistent or recurrent bladder cancer subsequent to the BCG maintenance course. In some embodiments, the BCG induction course comprises weekly intravesical instillation of BCG once per week for six weeks. In certain embodiments, the individual received at least 5 of the 6 doses of the BCG induction course. In some embodiments, the individual has previously received a BCG induction course beginning at month 0 of a treatment regimen and had persistent bladder cancer at month 3 of the treatment regimen. In some embodiments, the BCG maintenance course comprises weekly intravesical instillation of BCG once per week for three weeks. In certain embodiments, the individual received at least two of the three weekly intravesical instillations in a standard 3-week BCG maintenance course. In some embodiments, the individual had a prior diagnosis of high-grade NMIBC (e.g, CIS, high-grade Ta, and / or high-grade Tl) prior to receiving BCG therapy. In some embodiments, the individual had persistent or recurrent high-grade NMIBC after receiving BCG therapy. In certain embodiments, the patient had recurrent CIS with or without concurrent Ta or Tl bladder cancer within 12 months of the final dose of adequate BCG therapy (e.g, at least 5 of 6 doses of a BCG induction course and at least 2 of 3 doses of a BCG maintenance course). In certain embodiments, the patient had recurrent papillary-only high-grade Ta or Tl bladder cancer within six months of the final dose of adequate BCGtherapy (e.g, at least 5 of 6 doses of a BCG induction course and at least 2 of 3 doses of a BCG maintenance course). In certain embodiments, the individual has previously received a BCG induction course beginning at month 0 of a treatment regimen and had persistent highgrade T1 bladder cancer at month 3 of the treatment regimen. According to the American Urological Association (AU A) guidelines forNMIBC (https: / / www.auanet.org / guidelines- and-quality / guidelines / bladder-cancer-non-muscle-invasive-guideline), a standard BCG induction course is 6 weekly intravesical instillations of BCG, and standard BCG maintenance course is 3 weekly intravesical instillations of BCG. Also according to the AUA guidelines for NMIBC, in some instances, an individual may be treated with a second induction course ( / .£., a reinduction course) of BCG.

[0107] In some embodiments of the methods described herein, the individual was previously treated with adequate intravesical BCG therapy, responded to BCG therapy, and subsequently experienced a delayed relapse of bladder cancer. In some embodiments, the individual has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced a delayed relapse of bladder cancer. In some embodiments, the individual has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced recurrence of a papillary carcinoma of Ta or T1 (e.g, one or more high grade Ta or T1 stage tumors) stage at least 6 months (e.g, at least 6, 9, 12, 18, 24, 30, or 36 months) after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In certain embodiments, the recurrence of the papillary carcinoma of Ta or T1 stage (e.g, one or more high grade Ta or T1 stage tumors) occurred between 6 and 9 months, between 6 and 12 months, between 6 and 18 months, between 6 and 24 months, between 6 and 30 months, between 6 and 36 months, between 9 and 12 months, between 9 and 18 months, between 9 and 24 months, between 9 and 30 months, between 9 and 36 months, between 12 and 18 months, between 12 and 24 months, between 12 and 30 months, between 12 and 36 months, between 18 and 24 months, between 18 and 30 months, between 18 and 36 months, between 24 and 30 months, between 24 and 36 months, or between 30 and 36 months, after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In certain embodiments, the recurrence of the papillary carcinoma of Ta or T1 stage (e.g, one or more high grade Ta or T1 stage tumors) occurred between 6 and 24 months after the BCG induction course (e.g, after thefirst administration of the BCG induction course) or after diagnosis. In some embodiments, the individual has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced recurrence of carcinoma in situ at least 12 months (e.g, at least 12, 18, 24, 30, or 36 months) after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In certain embodiments, the recurrence of the carcinoma in situ occurs between 12 and 18 months, between 12 and 24 months, between 12 and 30 months, between 12 and 36 months, between 18 and 24 months, between 18 and 30 months, between 18 and 36 months, between 24 and 30 months, between 24 and 36 months, or between 30 and 36 months, after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In certain embodiments, the recurrence of the carcinoma in situ occurs between 12 and 24 after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In some embodiments, the BCG maintenance course comprises 3 weekly intravesical instillations of BCG. In certain embodiments, the individual has received at least 2 of the 3 weekly intravesical instillations of a BCG maintenance course. In some embodiments, the BCG induction course comprises weekly intravesical instillation of BCG once per week for five or six weeks. In certain embodiments, the individual received at least 5 of the 6 doses of the standard 6-week BCG induction course. In some embodiments, the individual has previously received a BCG induction course beginning at month 0 of a treatment regimen and had persistent bladder cancer at month 3 of the treatment regimen.

[0108] In some embodiments of the methods described herein, the individual was previously treated with inadequate intravesical BCG therapy, responded to the BCG therapy, and subsequently experienced a delayed relapse of bladder cancer. In some embodiments, the individual has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof (e.g, at least 6, 9, 12, 18, 24, 30, or 36 months) after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In certain embodiments, the recurrence of the papillary carcinoma of Ta or T1 stage (e.g, one or more high grade Ta or T1 stage tumors), carcinoma in situ, or combination thereof occurred between 6 and 9 months, between 6 and 12 months, between 6 and 18 months, between 6 and 24 months, between 6 and 30 months, between 6 and 36 months, between 9 and 12 months, between 9 and 18 months, between 9 and 24 months,between 9 and 30 months, between 9 and 36 months, between 12 and 18 months, between 12 and 24 months, between 12 and 30 months, between 12 and 36 months, between 18 and 24 months, between 18 and 30 months, between 18 and 36 months, between 24 and 30 months, between 24 and 36 months, or between 30 and 36 months, after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In certain embodiments, the recurrence of the papillary carcinoma of Ta or T1 stage (e.g, one or more high grade Ta or T1 stage tumors), carcinoma in situ, or combination thereof occurred between about 6 months and about 24 months after the BCG induction course (e.g, after the first administration of the BCG induction course) or after diagnosis. In some embodiments, the BCG induction course comprises weekly intravesical instillation of BCG once per week for five or six weeks. In some embodiments, the individual received at least 1, 2, or 3 but not all 6 of the doses of the standard 6-week BCG induction course. In certain embodiments, the individual received at least 5 of the 6 doses of the standard 6-week BCG induction course. In certain embodiments, the individual received at least 3 of the 6 doses of the standard 6-week BCG induction course. In some variations, the individual received 3, 4, 5, or 6 of the 6 doses of the standard 6-week BCG induction course. In some embodiments, the individual has previously received a BCG induction course beginning at month 0 of a treatment regimen and had persistent bladder cancer at month 3 of the treatment regimen. In some embodiments, the individual did not receive a BCG maintenance course due to a shortage of BCG (e.g, a localized or global shortage of BCG).

[0109] Accordingly, in some embodiments, provided herein is a method of treating bladder cancer in an individual comprising intravesically administering an oncolytic virus to the individual, wherein the individual: a) has not received prior intravesical Bacillus Calmette- Guerin (BCG) therapy; b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or c) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 3 weekly intravesicalinstillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolyticvirus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0110] In some embodiments, provided herein is a method of treating bladder cancer (e.g. , high-risk NMIBC) in an individual comprising intravesically administering an oncolytic virus to the individual, wherein the individual: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy; b) has received at least one diagnosis of high-risk NMIBC and has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC; c) has received at least one diagnosis of high-risk NMIBC and has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC; d) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3- month evaluation) following the BCG induction course; g) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; h) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; i) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or j) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g. , a human E2F-1promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus. In some embodiments, the method comprises intravesically administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In other embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolytic virus. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). [OHl] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic virus to the individual, wherein the individual: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy; b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6months after the BCG induction course; or c) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 3 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F- 1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phasecomprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0112] In some embodiments, provided herein is a method of treating high-risk NMIBC in an individual comprising intravesically administering an oncolytic virus to the individual, wherein the individual: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy; b) has received at least one diagnosis of high-risk NMIBC and has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC; c) has received at least one diagnosis of high-risk NMIBC and has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC; d) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; g) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; h) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; i) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or j) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune- related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus. In some embodiments, the method comprises intravesically administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In other embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolytic virus. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0113] In some embodiments, provided herein is a method of treating high-risk NMIBC in an individual comprising intravesically administering cretostimogene to the individual, wherein the individual: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy; b) has received at least one diagnosis of high-risk NMIBC and has not receivedintravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC; c) has received at least one diagnosis of high-risk NMIBC and has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC; d) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; g) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; h) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; i) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or j) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of highgrade Ta, Tl, or CIS within 24 months after the final dose of BCG.. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering cretostimogene. In some embodiments, the method comprises intravesically administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In other embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of cretostimogene. In certain embodiments, the method does not comprise administering a saline bladder wash before or after theadministration of the DDM and before the administration of cretostimogene. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In some embodiments, the method comprises an induction phase comprising administering cretostimogene to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering cretostimogene to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0114] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic virus to the individual, wherein the individual a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy, b) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC, or c) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolyticvirus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the method comprises intravesically administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In other embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolytic virus. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is as described in Example 3, Cohort A.

[0115] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in a BCG-naive individual, the method comprising intravesically administering to the individual an oncolytic virus. In some embodiments, the BCG-naive individual has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy, also known as complete BCG-naive. In other embodiments, the BCG-naive individual has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC. In yet other embodiments, the BCG-naive individual has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC. In some embodiments, the oncolytic virus comprises a viralvector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the method comprises intravesically administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In other embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolytic virus. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks.In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is as described in Example 3, Cohort A.

[0116] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in a BCG-naive individual having carcinoma in situ (CIS), the method comprising intravesically administering cretostimogene to the individual, wherein the BCG-naive individual has had at least one diagnosis of high-risk NMIBC and: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy, b) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC, or c) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC. In some embodiments, the individual has concurrent high-trade Ta or T1 bladder cancer. In other embodiments, the individual does not have a concurrent high-trade Ta or T1 bladder cancer. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the cretostimogene (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering cretostimogene, wherein the cretostimogene is administered directly after the second dose of DDM (e.g., without intravesical administration of a saline wash after the second dose of DDM and before administration of the cretostimogene). In some embodiments, the method comprises intravesically administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In other embodiments, the method comprises intravesically administering asingle dose of DDM to the individual prior to each administration of the cretostimogene. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the cretostimogene. In some embodiments, the method comprises an induction phase comprising administering the cretostimogene to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the cretostimogene to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is as described in Example 3, Cohort A, Arm 1 or Arm 2.

[0117] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in a BCG-naive individual having carcinoma in situ (CIS), the method comprising intravesically administering cretostimogene to the individual, wherein the BCG-naive individual has had at least one diagnosis of high-risk NMIBC and a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy, b) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC, or c) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC; and wherein the method comprises intravesically administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In some embodiments, the individual has concurrent high-trade Ta or T1 bladder cancer. In other embodiments, the individual does not have a concurrent high-trade Ta or T1 bladder cancer. In some embodiments, the method comprises an induction phase comprising administering the cretostimogene to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the cretostimogene to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is as described in Example 3, Cohort A, Arm 1.

[0118] In some embodiments, provided herein is a method of treating high-risk non-muscleinvasive bladder cancer (NMIBC) in a BCG-naive individual having carcinoma in situ (CIS), the method comprising intravesically administering cretostimogene to the individual, wherein the BCG-naive individual has had at least one diagnosis of high-risk NMIBC and: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy, b) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC, or c) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC; and wherein the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the cretostimogene. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the cretostimogene. In some embodiments, the individual has concurrent high-trade Ta or T1 bladder cancer. In other embodiments, the individual does not have a concurrent high-trade Ta or T1 bladder cancer. In some embodiments, the method comprises an induction phase comprising administering the cretostimogene to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the cretostimogene to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is as described in Example 3, Cohort A, Arm 2.

[0119] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in a BCG-naive individual having high-grade Ta or T1 bladder cancer without concurrent carcinoma in situ (CIS), the method comprising intravesically administering cretostimogene to the individual, wherein the BCG-naive individual has had at least one diagnosis of high-risk NMIBC and: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy, b) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC, or c) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the cretostimogene. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the cretostimogene. In some embodiments, the method comprises an induction phasecomprising administering the cretostimogene to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the cretostimogene to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is as described in Example 3, Cohort A, Arm 3.

[0120] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual that has received prior BCG therapy, the method comprising intravesically administering to the individual an oncolytic virus. In some embodiments, the individual a) is BCG-resistant (e.g, experienced persistent or recurrent high-grade Ta or CIS following an BCG induction course); b) is experiencing delayed relapse after inadequate BCG (e.g, has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course); or c) is experiencing delayed relapse after adequate BCG (e.g, has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course). In other embodiments, the individual a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of highgrade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; g) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3- month evaluation) following the BCG induction course; c) received at least 5 of 6 doses of aBCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; or d) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or j) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 3 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the individual has non-muscle invasive bladdercancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0121] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual that has received prior BCG therapy, the method comprising intravesically administering to the individual an oncolytic virus. In some embodiments, the individual was treated with a BCG induction course and experienced persistent or recurrent bladder cancer after the induction course. In certain embodiments, the individual was identified as having persistent or recurrent high-grade Ta or CIS at an evaluation at month three, where month 0 begins at the start of the BCG induction course. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, andintravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0122] In some embodiments, provided herein is a method of treating high-risk NMIBC in an individual having carcinoma in situ (CIS) and / or high-grade Ta or T1 stage bladder cancer that has received prior BCG therapy, the method comprising intravesically administering cretostimogene to the individual, wherein the individual: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; I) received at least 5 of 6doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; g) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; c) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; or d) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or j) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolytic virus. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is according to Example 3, Cohort B.

[0123] In some embodiments, provided herein is a method of treating high-risk NMIBC in individual having carcinoma in situ (CIS) that has received prior BCG therapy, the method comprising intravesically administering cretostimogene to the individual, wherein the individual: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and experienced high-grade Tl disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; g) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; c) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; or d) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or j) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the individual has concurrent high-grade Ta or Tl stage bladder cancer. In some embodiments, the individual does not have concurrent high-grade Ta or Tl stage bladder cancer. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolyticvirus. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is according to Example 3, Cohort B, Arm 1.

[0124] In some embodiments, provided herein is a method of treating high-risk NMIBC in a individual having high-grade Ta or T1 stage bladder cancer without carcinoma in situ (CIS) that has received prior BCG therapy, the method comprising intravesically administering cretostimogene to the individual, wherein the individual: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; g) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; c) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; or d) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or j) received 3 to 6 doses of a BCG induction course and no BCGreinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolytic virus. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is according to Example 3, Cohort B, Arm 2.

[0125] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic virus to the individual, wherein the individual has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or Tl stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM- CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein theendogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g., without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0126] In some embodiments, provided herein is a method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic virus to the individual, wherein the individual has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequentlyexperienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 3 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F- 1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein). In certain embodiments, the additional therapeutic agent is administered based on a determination of GDB (e.g, a GDB value associated with intermediate or high risk) in a urine sample from the subject as described herein. In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virusto the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0127] In some embodiments of the methods described herein, the individual is a human individual. In some embodiments, the individual being treated for bladder cancer has been identified as having one or more of the conditions described herein. Identification of the conditions as described herein by a skilled physician is routine in the art (e.g., via blood tests, X-rays, ultrasound, CT scans, PET scans, PET / CT scans, MRI scans, PET / MRI scans, nuclear medicine radioisotope scans, endoscopy, biopsy, angiography, CT-angiography, etc.) and may also be suspected by the individual or others, for example, due to tumor growth, hemorrhage, ulceration, pain, enlarged lymph nodes, cough, j aundice, swelling, weight loss, cachexia, sweating, anemia, paraneoplastic phenomena, thrombosis, etc. In some embodiments, the individual is selected for any one of the treatment methods described herein based on any one or more of a number of risk factors and / or diagnostic approaches appreciated by the skilled artisan, including, but not limited to, genetic profiling, family history, medical history (e.g., appearance of related conditions and viral infection history), lifestyle or habits.Oncolytic virus

[0128] The methods and compositions described herein are related to oncolytic viruses, for example, oncolytic adenovirus. The oncolytic virus may be a naturally occurring virus, or a genetically modified virus, for example an attenuated virus, and / or a virus with additional favorable features (e.g., preferential replication in cancer cells, or encoding an immune- related molecule).

[0129] Exemplary viruses that are suitable for use in the present invention include, but are not limited to, adenovirus, for example, H101 (ONCOCRINE®), CG-TG-102 (Ad5 / 3-D24- GM-CSF), and cretostimogene grenadenorepvec (also referred to as cretostimogene or CG0070); herpes simplex virus, for example, Talimogene laherparapvec (T-VEC) and HSV- 1716 (SEPREHVIR®); reovirus, for example, REOLYSIN®; vaccinia virus, for example, JX- 594; Seneca valley virus, for example, NTX-010 and SVV-001; Newcastle disease virus, for example, NDV-NS1 and GL-ONC1; polio virus, for example, PVS-RIPO; measles virus, for example, MV-NIS; coxsackie virus, for example, CAVATAK™; vesicular stomatitis virus; maraba and rhabdoviruses; parvovirus and mumps virus.

[0130] In some embodiments, the oncolytic virus is a wild type oncolytic virus. In some embodiments, the oncolytic virus is genetically modified. In some embodiments, the oncolytic virus is attenuated (for example through multiple passages, inactivation or genetic modification). In some embodiments, the oncolytic virus is replication competent. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell, such as a cancer cell defective in the Rb pathway.

[0131] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus. In some embodiments, the tumor-specific promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1 as shown below. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of E1A, E1B, and E4.

[0132] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor-selective promoter operably linked to a viral gene essential for replication of the oncolytic virus. In some embodiments, the tumor-selective promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1 as shown below. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4.

[0133] In some embodiments, the oncolytic virus a viral vector comprising a tumor cellspecific promoter operably linked to a viral gene essential for replication of the oncolytic virus. In some embodiments, the oncolytic virus comprises a tumor-selective promoter. In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the tumor selective promoter allows preferential replication of the oncolytic virus in tumor cells. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell, such as a cancer cell defective in the Rb pathway. In some embodiments, the oncolytic virus is selected from the group consisting of adenovirus, herpes simplex virus, vaccinia virus, mumps virus, Newcastle disease virus, polio virus, measles virus, Seneca valley virus, coxsackie virus, reovirus, vesicular stomatitis virus, maraba and rhabdovirus, and parvovirus. In some embodiments, the tumor-specific promoteris an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4.

[0134] In some embodiments, the oncolytic virus further comprises an immune-related molecule (such as cytokine, chemokine, or PRRago (i.e. , pathogen recognition receptor agonist)). In some embodiments, the immune-related molecule is not an immune checkpoint modulator. In some embodiments, the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL- 12, interferon (such as Type 1, Type 2 or Type 3 interferon, e g., interferon y), CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTap. In some embodiments, the immune-related molecule is selected from the group consisting of STING (i.e., stimulator of interferon genes) activators (such as CDN, i.e., cyclic dinucleotides), PRRago (such as CpG, Imiquimod, or Poly I:C), TLR stimulators (such as GS-9620, AED- 1419, CYT-003-QbG10, AVE-0675, or PF-7909), and RLR stimulators (such as RIG-I, Mda5, or LGP2 stimulators). In some embodiments, the immune-related molecule induces dendritic cells, T cells, B cells, and / or T follicular helper cells.

[0135] In some embodiments, the immune-related molecule is expressed by the oncolytic virus. For example, the oncolytic virus may comprise a nucleic acid encoding the immune- related molecule, and the nucleic acid can be in the viral vector or on a separate vector. In some embodiments, the oncolytic virus is a virus comprising a viral vector, and wherein the viral vector comprises the nucleic acid encoding the immune-related molecule. In some embodiments, the nucleic acid encoding the immune-related molecule is operably linked to a viral promoter, such as an El promoter, or an E3 promoter.

[0136] In some embodiments, the immune-related molecule enhances an immune response in the individual. Immune-related molecules may include, but are not limited to, a cytokine, a chemokine, a stem cell growth factor, a lymphotoxin, an hematopoietic factor, a colony stimulating factor (CSF), erythropoietin, thrombopoietin, tumor necrosis factor-alpha (TNF), TNF-beta , granulocyte-colony stimulating factor (G-CSF), granulocyte macrophage-colony stimulating factor (GM-CSF), interferon-alpha, interferon-beta, interferon-gamma, interferon- lambda, stem cell growth factor designated "SI factor", human growth hormone, N- methionyl human growth hormone, bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prorelaxin, follicle stimulating hormone (FSH), thyroidstimulating hormone (TSH), luteinizing hormone (LH), hepatic growth factor, prostaglandin, fibroblast growth factor, prolactin, placental lactogen, OB protein, mullerian-inhibiting substance, mouse gonadotropin-associated peptide, inhibin, activin, vascular endothelial growth factor, integrin, NGF-beta , platelet-growth factor, TGF-alpha , TGF-beta , insulinlike growth factor-I, insulin-like growth factor-II, macrophage-CSF (M-CSF), IL-1, IL- la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, IL-25, LIF, FLT-3, angiostatin, thrombospondin, endostatin, lymphotoxin, thalidomide, lenalidomide, or pomalidomide.

[0137] In some embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the endogenous El a promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In some embodiments, a polyadenylation signal (PA) is inserted 5’ of the E2F-1 promoter. In some embodiments, the nucleic acid encoding human GM-CSF is operably linked to the E3 promoter. In some embodiments, the vector backbone of the adenovirus serotype 5 further comprises E2, E4, late protein regions or inverted terminal repeats (ITRs) identical to the wildtype adenovirus serotype 5 genome. In some embodiments, the oncolytic virus has the genomic structure as shown in Figure 1. In some embodiments, the oncolytic virus is conditionally replicating. In some embodiments, the oncolytic virus preferentially replicates in cancer cells. In some embodiments, the cancer cells are Rb pathway-defective cancer cells. In some embodiments, the oncolytic virus is cretostimogene.

[0138] In some embodiments, the oncolytic virus is an oncolytic adenovirus comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule. In some embodiments, the immune-related molecule is GM-CSF and the heterologous gene encoding the GM-CSF is operably linked to an El promoter or an E3 promoter. In some embodiments, the tumor cell-specific promoter is an E2F-1 promoter (e.g, an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1) and the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of E1A, E1B, and E4. In certain embodiments, the immune-related molecule is GM-CSF and the heterologous gene encoding the GM-CSF is operably linked to an El promoter or an E3 promoter, and the tumor cell-specific promoter is an E2F-1 promoter (e.g, an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1) and the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of E1A, E1B, and E4. In some embodiments, the oncolytic adenovirus is an adenovirus serotype5. In certain embodiments, the endogenous El a promoter of the native adenovirus serotype 5 is replaced by the human E2F-1 promoter. In certain embodiments, the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the endogenous El a promoter of the native adenovirus serotype 5 is replaced by the human E2F-1 promoter and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF.

[0139] Thus, in some embodiments, there is provided a method of treating bladder cancer in an individual, comprising intravesically administering to the individual an effective amount of an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine, for example, GM-CSF). In some embodiments, the tumor-specific promoter is a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the method further comprises administering to the individual a transduction enhancing agent (such as DDM) prior to the administration of the adenovirus. In some embodiments, the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic virus. In certain embodiments, the oncolytic virus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash. In some embodiments, the method comprises intravesically administering a saline wash after only the first DDM wash. In some embodiments, the oncolytic virus is administered directly after the second dose of DDM, without intravesical administration of a saline wash after the second dose of DDM and administration of the oncolytic virus. In some embodiments, the adenovirus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (such as about IxlO12viral particles). In some embodiments, the adenovirus is administered weekly. In some embodiments, the IR- NMIBC comprises a tumor of low-grade Ta stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low-grade tumor of Ta stage or high-grade tumor of Ta stage having a diameter of 3 cm or smaller. In some embodiments, the IR- NMIBC comprises a single tumor of low grade Ta stage having a diameter of greater than 3 cm. In some embodiments, the IR-NMIBC comprises two or more low-grade tumors of Ta stage. In some embodiments, the IR-NMIBC comprises a primary and solitary high-grade tumor of Ta stage having a diameter of less than 3 cm. In some embodiments, the IR-NMIBC comprises a low-grade tumor of T1 stage.

[0140] SEQ ID NO: 1 (E2F-1 promoter)

[0141] gggcccaaaattagcaagtgaccacgtggttctgaagccagtggcctaaggaccacccttgcagaaccgtggtctcctt gtcacagtctaggcagcctctggcttagcctctgtttctttcataacctttctcagcgcctgctctgggccagaccagtgttgggaggagt cgctactgagctcctagattggcaggggaggcagatggagaaaaggagtgtgtgtggtcagcattggagcagaggcagcagtggg caatagaggaagtgagtaaatccttgggagggctccctagaagtgatgtgttttctttttttgttttagagacaggatctcgctctgtcgccc aggctggtgtgcagtggcatgatcatagctcactgcagcctcgacttctcgggctcaagcaatcctcccacctcagcctcccaagtagc tgggactacgggcacacgccaccatgcctggctaatttttgtattttttgtagagatgggtcttcaccatgttgatcaggctggtctcgaac tcctgggctcatgcgatccaccccgccagctgattacagggattccggtggtgagccaccgcgcccagacgccacttcatcgtattgt aaacgtctgttacctttctgttcccctgtctactggactgtgagctccttagggccacgaattgaggatggggcacagagcaagctctcc aaacgtttgttgaatgagtgagggaatgaatgagttcaagcagatgctatacgttggctgttggagattttggctaaaatgggacttgcag gaaagcccgacgtccccctcgccatttccaggcaccgctcttcagcttgggctctgggtgagcgggatagggctgggtgcaggatta ggataatgtcatgggtgaggcaagttgaggatggaagaggtggctgatggctgggctgtggaactgatgatcctgaaaagaagagg ggacagtctctggaaatctaagctgaggctgttgggggctacaggttgagggtcacgtgcagaagagaggctctgttctgaacctgca ctatagaaaggtcagtgggatgcgggagcgtcggggcggggcggggcctatgttcccgtgtccccacgcctccagcaggggacgc ccgggctgggggcggggagtcagaccgcgcctggtaccatccggacaaagcctgcgcgcgccccgccccgccattggccgtacc gccccgcgccgccgccccatcccgcccctcgccgccgggtccggcgcgttaaagccaataggaaccgccgccgttgttcccgtca cggacggggcagccaattgtggcggcgctcggcggctcgtggctctttcgcggcaaaaaggatttggcgcgtaaaagtggccggg actttgcaggcagcggcggccgggggcggagcgggatcgagccctcgccgaggcctgccgccatgggcccgcgccgccgccg ccgcctgtcacccgggccgcgcgggccgtgagcgtcatg

[0142] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine) operably linked to a viral promoter. In some embodiments, the tumor-specific promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of E1A, E1B, and E4. In some embodiments, the viral promoter operably linked to the nucleic acid encoding the immune-related molecule is the E3 promoter. In some embodiments, the immune-related molecule is GM-CSF.

[0143] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-selective promoter operably linked to a viral gene essential for replication of the oncolytic virus and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine) operably linked to a viral promoter. In some embodiments, the tumor-selective promoter is an E2F-1 promoter, such as a human E2F-1promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of E1A, E1B, and E4. In some embodiments, the viral promoter operably linked to the nucleic acid encoding the immune-related molecule is the E3 promoter. In some embodiments, the immune-related molecule is GM-CSF.

[0144] In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine, for example, GM-CSF). In some embodiments, the tumor-specific promoter is a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1.

[0145] In some embodiments, the oncolytic virus is cretostimogene, an exemplary adenovirus serotype 5 which has an E2F promoter at the Ela gene and a GM-CSF expression at the E3 gene.

[0146] Cretostimogene (also known as CG0070 or cretostimogene grenadenorepvec) is a conditionally replicating oncolytic adenovirus (serotype 5) designed to preferentially replicate in and kill Rb pathway-defective cancer cells. This vector is transcriptionally regulated by a promoter (e.g., E2F-1 promoter) that is up-regulated in Rb-pathway-detective tumor cells. In approximately 85% of all cancers, one or more genes of the Rb pathway, such as the tumor suppressor Rb gene, are mutated. In addition to its restricted propagation, cretostimogene also encodes the human cytokine GM-CSF, which is expressed selectively in the infected tumor cells to stimulate immune responses against uninfected distant (such as metastases) and local tumor foci.

[0147] The genomic structure of the oncolytic adenoviral vector cretostimogene is shown schematically in FIG. 1. Products of the adenoviral early El A gene are essential for efficient expression of other regions of the adenoviral genome. Cretostimogene has been engineered to express the E1A gene under control of the human E2F-1 promoter, which provides tumor specificity to the El A gene product. To protect from transcriptional read-through activating El A expression, a polyadenylation signal (PA) was inserted 5' of the E2F-1 promoter. Cretostimogene includes the entire wild type E3 region except for the 19kD-coding region. A direct comparison of E3 -containing to E3-deleted oncolytic adenovirus vectors showed superiority of E3-containing vectors in tumor spread and efficacy. In place of the 19kD gene, cretostimogene carries the cDNA for human GM-CSF under the control of the endogenous E3 promoter (E3P). Since the E3 promoter is in turn activated by El A, both viral replicationand GM-CSF expression are ultimately under the control of the E2F-1 promoter. The rest of the viral vector backbone, including the E2, E4, late protein regions and inverted terminal repeats (ITRs), is identical to the wild type Ad5 genome.

[0148] Cretostimogene is manufactured in a human cancer cell line and released from infected cells by detergent lysis. Cretostimogene is purified from the lysate by chromatography, and then formulated in 5% sucrose, 10 mM Tris, 0.05% polysorbate-80, 1 % glycine, 1 mM magnesium chloride, pH 7.8.

[0149] Cretostimogene is supplied as a sterile, slightly opalescent, frozen liquid in stoppered glass vials. The particle concentration per mL (vp / mL) is stated on the Certificate of Analysis for each lot of cretostimogene.

[0150] Cretostimogene has additional potential anti -tumor activity in that it carries the cDNA for human GM-CSF, a key cytokine for generating long-lasting anti-tumor immunity. Thus, cretostimogene is a selectively replicating oncolytic vector with the potential for attacking the tumor by two mechanisms: direct cytotoxicity as a replicating vector and induction of a host immune response. In vitro and in vivo studies have been conducted to characterize the tumor selectivity and anti-tumor activity and safety of cretostimogene. See, for example, U.S. Patent No. 11,596,660, which incorporated herein by reference in its entirety.

[0151] As used herein, the terms “cretostimogene grenadenorepvec,” “cretostimogene,” and “CG0070” are used interchangeably.Combination Therapy

[0152] In some aspects, provided herein are methods of treating bladder cancer in an individual, comprising intravesical administration of an effective amount of oncolytic virus in combination with administration of an effective amount of additional therapeutic agent. In some embodiments, the additional therapeutic agent comprises a chemotherapeutic agent. In some embodiments, the additional therapeutic agent comprises an immune checkpoint modulator.

[0153] In some embodiments, the oncolytic virus and the additional therapeutic agent are administered sequentially, i.e., the oncolytic virus is administered before or after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered prior to the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered no more than about any of 15 minutes, 30minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, or 24 hours prior to the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered about days or weeks (such as about any of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or more) prior to the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered no more than about any of 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, or 24 hours after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered about days or weeks (such as about any of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or more) after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus and the additional therapeutic agent are administered with one immediately after another (e.g., within 5 minutes or less between the two administrations). For example, in some embodiments, the oncolytic virus is administered immediately before the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered immediately after the administration of the additional therapeutic agent.

[0154] In some embodiments, the oncolytic virus and the additional therapeutic agent are administered simultaneously. In some embodiments, the oncolytic virus and the additional therapeutic agent are administered simultaneously via separate compositions. In some embodiments, the oncolytic virus and the additional therapeutic agent are administered simultaneously via the same composition. In some embodiments, the oncolytic virus and the additional therapeutic agent are both administered intravesically via the same composition.

[0155] Exemplary routes of administration of additional therapeutic agents (e.g., immune checkpoint modulators and chemotherapeutic agents) include, but are not limited to, intratumoral, intravesical, intramuscular, intraperitoneal, intravenous, intra-arterial, intracranial, intrapleural, subcutaneous, and epidermal routes, or be delivered into lymph glands, body spaces, organs or tissues known to contain such live cancer cells. In some embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered locally to the site of the tumor or to the tissue having the tumor. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered by direct injection of the agent(s) into the tumor. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered by direct injection of the agent(s) to asite close to the tumor cells. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered intravesically. In some embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered systemically. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered intravenously.

[0156] In some embodiments, the method comprises administration of a single additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g. an immune checkpoint inhibitor). In some embodiments, the immune checkpoint inhibitor is selected from the immune checkpoint inhibitors listed in Table 1, wherein the immune checkpoint inhibitor is administered with the same route of administration, and / or dose, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1. In some embodiments, the immune checkpoint inhibitor is selected from the immune checkpoint inhibitors listed in Table 1, wherein the immune checkpoint inhibitor is administered with the different route of administration, and / or dose, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1. In some embodiments, the immune checkpoint inhibitor is not a molecule selected from Table 1.

[0157] In some embodiments, the method comprises administration of at least two (such as any of 2, 3, 4, 5, 6, or more) additional therapeutic agents (e.g, immune checkpoint modulators and / or chemotherapeutic agents). In some embodiments, all or part of the at least two additional therapeutic agents are administered simultaneously, such as in a single composition. In some embodiments, all or part of the at least two additional therapeutic agents are administered sequentially. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising an immune checkpoint inhibitor, a chemotherapeutic agent, or both. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising two or more (such as any of 2, 3, 4, 5, 6, or more) immune checkpoint inhibitors. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising two or more (such as any of 2, 3, 4, 5, 6, or more) chemotherapeutic agents. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising any number (such as any of 1, 2, 3, 4, 5, 6, or more) of immune checkpoint inhibitors and any number (such as any of 2, 3, 4, 5,6, or more) of chemotherapeutic agents. In some embodiments, the at least two additional therapeutic agents comprise one or more immune checkpoint inhibitors selected from Table 1 and / or one or more chemotherapeutic agents described herein. In some embodiments, the at least two additional therapeutic agents are each independently administered systemically (e.g, intravenously) or locally (e.g, intravesically). For example, in some embodiments, the method comprises systemic (e.g, intravenous) administration of an immune checkpoint modulator, local (e.g, intravesical) administration of an immune checkpoint modulator, systemic (e.g, intravenous) administration of a chemotherapeutic agent, local (e.g, intravesical) administration of a chemotherapeutic agent, or any combination thereof. In certain embodiments, the method comprises intravenous administration of an immune checkpoint modulator and intravesical administration of a chemotherapeutic agent. In some embodiments, the at least two additional therapeutic agents (e.g, immune checkpoint modulators and / or chemotherapeutic agents) are administered sequentially. In other embodiments, the at least two additional therapeutic agents (e.g, immune checkpoint modulators and / or chemotherapeutic agents) are administered simultaneously. In certain embodiments, the at least two additional therapeutic agents are administered simultaneously via separate compositions. In certain embodiments, the at least two different therapeutic agents are administered simultaneously via the same composition.

[0158] The administration of the additional therapeutic agents (e.g, immune checkpoint modulators and / or chemotherapeutic agents) can be of any sequence, including simultaneous systemic administration of the first additional therapeutic agent and local administration of the second additional therapeutic agent, and sequential administration of the additional therapeutic agents, among which at least one additional therapeutic agent is administered systemically, for example, first administering the second additional therapeutic agent locally (such as intravesically) to the site of the tumor followed by systemic (such as intravenous) administration of the first additional therapeutic agent, or first administering the first additional therapeutic agent systemically (such as intravenously) followed by local (such as intratumoral) administration of the second additional therapeutic agent. Additional therapeutic agents administered simultaneously via the same administration route may be administered as a single composition. For example, the additional therapeutic agents can be admixed prior to (such as immediately prior to, e.g., within less than about 10, 5, or 1 minutes before) the administration of the single composition.

[0159] In some embodiments, provided herein is a method of treating bladder cancer (e.g. , high-risk NMIBC) comprising intravesically administering an oncolytic virus describedherein and intravesically administering one or more additional therapeutic agents described herein. In some embodiments, the additional therapeutic agent is administered concurrently with the oncolytic virus. In some embodiments, the additional therapeutic agent and the oncolytic virus are administered sequentially.

[0160] In some embodiments, the method comprises intravesical administration of the oncolytic virus followed by intravesical administration of the additional therapeutic agent on the same day of treatment. In some embodiments, the method comprises intravesical administration of the oncolytic virus followed immediately by intravesical administration of the additional therapeutic agent. In some embodiments, wherein the method comprises at least a first 6-week induction phase comprising administering the oncolytic virus and additional therapeutic agent to the individual on weeks 1, 2, 3, 4, 5, and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering the oncolytic virus and additional therapeutic agent to the individual every three or six months. In certain embodiments, the 3-week treatment comprises administering the oncolytic virus and additional therapeutic agent weekly on weeks 1, 2, and 3. In certain embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months. In in some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In certain the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In other embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.

[0161] In some embodiments, the additional therapeutic agent and the oncolytic virus are administered on different days or different weeks of a treatment course. In some embodiments the method comprises at least a first 6-week induction phase comprising: i) administering the oncolytic virus to the individual on weeks 1, 2, 4 and 5; and ii) administering additional therapeutic agent to the individual on weeks 3 and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering theoncolytic virus and additional therapeutic agent to the individual every three or six months. In certain embodiments, the 3-week treatment comprises administering the oncolytic virus weekly on weeks 1 and 2 followed by administering additional therapeutic agent in week 3. In some embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months. In some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6- week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In other embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.Immune Checkpoint Modulators

[0162] In some embodiments, the methods described herein comprise administration of an immune checkpoint modulator in combination with intravesical administration of an oncolytic virus. Immune checkpoint modulators of particular interest in the present invention include immune-stimulating agents and immune checkpoint inhibitors. As used herein, the term "immune checkpoint inhibitors," "checkpoint inhibitors," and the like refers to compounds that inhibit the activity of control mechanisms of the immune system. Immune system checkpoints, or immune checkpoints, are inhibitory pathways in the immune system that generally act to maintain self-tolerance or modulate the duration and amplitude of physiological immune responses to minimize collateral tissue damage. Checkpoint inhibitors can inhibit an immune system checkpoint by stimulating the activity of a stimulatory checkpoint molecule, or inhibiting the activity of an inhibitory checkpoint molecule in the pathway. Stimulatory checkpoint molecules are molecules, such as proteins, that stimulate or positively regulate the immune system. Inhibitory checkpoint molecules are molecules, such as proteins, that inhibit or negatively regulate the immune system. Immune system checkpoint molecules include, but are not limited to, cytotoxic T-lymphocyte antigen 4 (CTLA-4), programmed cell death 1 protein (PD-1), programmed cell death 1 ligand 1 (PD-LI), programmed cell death 1 ligand 2 (PD-L2), lymphocyte activation gene 3 (LAG3), B7-1, B7-H3, B7-H4, T cell membrane protein 3 (TIM3), B- and T-lymphocyte attenuator (BTLA), V-domain immunoglobulin (Ig)-containing suppressor of T-cell activation (VISTA), Killercell immunoglobulin-like receptor (KIR), and A2A adenosine receptor (A2aR). As such, checkpoint inhibitors include antagonists of CTLA-4, PD-1, PD-L1, PD-L2, LAG3, B7-1, B7-H3, B7-H4, BTLA, VISTA, KIR, A2aR, or TIM3. For example, antibodies that bind to CTLA-4, PD-1, PD-L1, PD-L2, LAG3, B7-1, B7-H3, B7-H4, BTLA, VISTA, KIR, A2aR, or TIM3 and antagonize their function are checkpoint inhibitors. Moreover, any molecule (e.g., peptide, nucleic acid, small molecule, etc.) that inhibits the inhibitory function of an immune system checkpoint is a checkpoint inhibitor.

[0163] In some embodiments, the immune checkpoint modulator is an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is a natural or engineered ligand of an inhibitory immune checkpoint molecule, including, for example, ligands of CTLA-4 (e.g., B7.1, B7.2), ligands of TIM3 (e.g., Galectin-9), ligands of A2a Receptor (e.g., adenosine, Regadenoson), ligands of LAG3 (e.g., MHC class I or MHC class II molecules), ligands of BTLA (e.g., HVEM, B7-H4), ligands of KIR (e.g., MHC class I or MHC class II molecules), ligands of PD-1 (e.g., PD-L1, PD-L2), ligands of IDO (e.g., NKTR-218, Indoximod, NLG919), ligands of CD47 (e.g., SIRP-alpha receptor), ligands of GITR, and ligands of CSF1R. In some embodiments, the immune checkpoint inhibitor is an antibody that targets an inhibitory immune checkpoint protein. In some embodiments, the immune checkpoint inhibitor is an antibody selected from the group consisting of anti-CTLA-4 (e.g., Ipilimumab, Tremelimumab, KAHR-102), anti-TIM3 (e.g., F38-2E2, ENUM005), anti- LAG3 (e.g., BMS-986016, IMP701, IMP321, C9B7W), anti-KIR (e.g., Lirilumab, IPH2101, IPH4102), anti-PD-1 (e.g., Nivolumab, Pidilizumab, Pembrolizumab, BMS-936559, atezolizumab, Lambrolizumab, MK-3475, AMP -224, AMP-514, STI-Al l 10, TSR-042), anti- PD-L1 (e.g., KY-1003 (EP20120194977), MCLA-145, atezolizumab, BMS-936559, MEDI- 4736, MSB0010718C, AUR-012, STI-A1010, PCT / US2001 / 020964, MPDL3280A, AMP- 224, Dapirolizumab pegol (CDP-7657), MEDI-4920), anti-CD73 (e.g., AR-42 (OSU- HDAC42,HDAC-42,AR42,AR 42,OSU-HDAC 42, OSU-HD AC-42, NSC D736012, HD AC- 42, HDAC 42,HDAC42,NSCD736012,NSC-D736012), MEDI-9447), anti-B7-H3 (e.g., MGA271, DS-5573a, 8H9), anti-CD47 (e.g., CC-90002, TTI-621, VLST-007), anti-BTLA, anti-VISTA, anti-A2aR, anti-B7-l, anti-B7-H4, anti-CD52 (such as alemtuzumab), anti-IL- 10, anti-IL-35, anti-TGF-[3 (such as Fresolumimab), anti-CSFIR (e.g., FPA008), anti- NKG2A (e.g., monalizumab), anti -MIC A (e.g., IPH43), anti-GITR (e.g., TRX518), and anti-CD39. In some embodiments, the antibody is an antagonistic antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, VHH (nanobody), and other antigen-binding subsequences of the full length antibody. In some embodiments, the antibody is a human, humanized, or chimeric antibody. In some embodiments, the antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other functional variants or derivatives thereof.

[0164] The immune checkpoint inhibitor can be of any one of the molecular modalities known in the art, including, but not limited to, aptamer, mRNA, siRNA, microRNA, shRNA, peptide, antibody, anticalin, spherical nucleic acid, TALEN, Zinc Finger Nuclease, CRISPR / Cas9, and small molecule.

[0165] The immune checkpoint inhibitors can be used singly or in combination. For example, any number (such as any of 1, 2, 3, 4, 5, 6, or more) of immune checkpoint inhibitors can be used simultaneously or sequentially. Sequential administration of immune checkpoint inhibitors can be separated by hours, days or weeks. The administration route(s) for two or more immune checkpoint inhibitors can be the same or different. For example, one immune checkpoint inhibitors can be administered locally (e.g, intravesically or intratumorally), and a second immune checkpoint inhibitors can be administered systemically (e.g, intravenously); two immune checkpoint inhibitors can both be administered locally (e.g, intravesically or intratumorally); or two immune checkpoint inhibitors can both be administered systemically (e.g, intravenously). In some embodiments, two or more immune checkpoint inhibitors are administered simultaneously in the same composition. In some embodiments, two or more immune checkpoint inhibitors are administered simultaneously in separate compositions.

[0166] Exemplary immune checkpoint molecules and inhibitors thereof are discussed below. It is understood that other suitable immune checkpoint molecules and immune checkpoint inhibitors known in the art are also within the scope of the present application.PD-1

[0167] In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1. In some embodiments, the inhibitor of PD-1 is an anti-PD-1 antibody. Any of the anti -PD-1 antibodies known in the art may be used in the present invention, including, but not limited to, nivolumab, pembrolizumab, pidilizumab, BMS-936559, and atezolizumab,lambrolizumab, MK-3475, AMP-224, AMP-514, STI-Al l 10, and TSR-042. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the anti-PD-1 antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full-length anti-PD-1 antibody. In some embodiments, the anti-PD-1 antibody is a human, humanized, or chimeric antibody. In some embodiments, the anti-PD-1 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other variants or derivatives thereof. In some embodiments, the inhibitor of PD-1 is a natural or engineered ligand of PD-1, such as PD-L1 or PD-L2. In some embodiments, the inhibitor of PD-1 is an inhibitor of the interaction between PD-1 and its ligand, for example, an inhibitor of PD-1 / PD-L1 interaction or an inhibitor of PD-1 / PD-L2 interaction. In some embodiments, the inhibitor of PD-1 is an inhibitor of a PD-1 ligand, such as an inhibitor of PD-L1 (e.g., anti-PD-Ll antibody) or an inhibitor of PD-L2 (e.g., anti-PD-L2 antibody). Any of the inhibitors of interaction between PD-1 and its ligand may be used in the present invention, see, for example, U.S. Patent No. US7709214, US7432059, US7722868, US8217149, US8383796, and US9102725. In some embodiments, the inhibitor of PD-1 is an Fc fusion protein comprising a PD-1 ligand, such as an Fc-fusion of PD-L2 (e.g., AMP-224). In certain embodiments, the inhibitor of PD-1 is pembrolizumab or nivolumab.

[0168] PD-1 is a part of the B7 / CD28 family of co-stimulatory molecules that regulate T- cell activation and tolerance, and thus antagonistic anti-PD-1 antibodies can be useful for overcoming tolerance. PD-1 has been defined as a receptor for B7-4. B7-4 can inhibit immune cell activation upon binding to an inhibitory receptor on an immune cell. Engagement of the PD-1 / PD-L1 pathway results in inhibition of T-cell effector function, cytokine secretion and proliferation. (Tumis et al., Oncolmmunology 1(7): 1172-1174, 2012). High levels of PD-1 are associated with exhausted or chronically stimulated T cells. Moreover, increased PD-1 expression correlates with reduced survival in cancer patients.

[0169] Agents for down modulating PD-1, B7-4, and the interaction between B7-4 and PD- 1 inhibitory signal in an immune cell resulting in enhancement of the immune response. Exemplary anti-PD-1 antibodies are provided in Table 1. Any of the anti-PD-1 antibodies known in the art may be used in the present invention, for example, see US Patent Nos. US7101550, US5698520, US6808710, US7029674, US7794710, US7892540, US8008449, US8088905, US8163503, US8168757, US8354509, US8460927, US8609089, US8747833, US8779105, US8900587, US8952136, US8981063, US8993731, US9062112, US9067999,US9073994, US9084776, US9102728, and US7488802; and U.S. Patent Publication Nos. US20020055139, US20140044738. One exemplary anti-PD-1 antibody, nivolumab (sold under the trade name Opdivo®), is a human monoclonal antibody to PD-1 that is FDA approved for the treatment of unresectable or metastatic melanoma, squamous non-small cell lung cancer, and urothelial carcinoma. Another exemplary anti-PD-1 antibody, pembrolizumab (sold under the trade name Keytruda®), is a humanized (from mouse) monoclonal antibody to PD-1 that is FDA approved for the treatment of a variety of cancer types, including high-risk, non-muscle invasive bladder cancer and advanced bladder cancer.PD-L1 / PD-L2

[0170] In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1 ligand (e.g., PD-L1 and / or PD-L2). In some embodiments, the inhibitor of PD-1 ligand is an anti-PD-Ll antibody. In some embodiments, the inhibitor of PD-1 ligand is an anti-PD-L2 antibody. Exemplary anti-PD-Ll antibodies include, but are not limited to, KY-1003, MCLA-145, RG7446 (also known as atezolizumab), BMS935559 (also known as MDX- 1105), MPDL3280A, MEDI4736, Avelumab (also known as MSB0010718C), and STI- A1010. In some embodiments, the anti-PD-Ll or anti-PD-L2 is a monoclonal antibody or a polyclonal antibody. In some embodiments, the anti-PD-Ll or anti-PD-L2 is an antigenbinding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, VHH (nanobody) and other antigen-binding subsequences of the full-length anti-PD-Ll or anti-PD- L2 antibody. In some embodiments, the anti-PD-Ll or anti-PD-L2 antibody is a human, humanized, or chimeric antibody. In some embodiments, the anti-PD-Ll or anti-PD-L2 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other variants or derivatives thereof. In some embodiments, the inhibitor of PD-1 ligand is an inhibitor (e.g., peptide, protein or small molecule) of both PD-L1 and PD-L2. Exemplary inhibitors of both PD-L1 and PD-L2 include, but are not limited to, AUR-012, and AMP -224. In some embodiments, the inhibitor of PD-L1 and the inhibitor of PD-L2 can be used interchangeably in any of the methods of treatment described herein.

[0171] PD-L1 (Programmed cell death-ligand 1) is also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1). PD-L1 serves as a ligand for PD-1 to play a major role in suppressing the immune system during particular events such as pregnancy, tissue allographs, autoimmune disease and other disease states such as hepatitis and cancer. The formation of PD-1 receptor / PD-Ll ligand complex transmits an inhibitory signal whichreduces the proliferation of CD8+ T cells at the lymph nodes.

[0172] Any of the known anti-PD-Ll antibodies may be used in the present invention, see, for example, U.S. Patent Nos. US7943743, US7722868, US8217149, US8383796, US8552154, and US9102725; and U.S. Patent Application Publication Nos. US20140341917, and US20150203580; and International Patent Application No. PCT / US2001 / 020964. For example, anti-PD-Ll antibodies that are in clinical development include BMS935559 (also known as MDX-1105), MPDL3280A, MEDI4736, Avelumab (also known as MSB0010718C), KY-1003, MCLA-145, RG7446 (also known as atezolizumab), and STI -Al 010.

[0173] PD-L2 (Programmed cell death 1 ligand 2) is also known as B7-DC. PD-L2 serves as a ligand for PD-1. Under certain circumstances, PD-L2 and its inhibitor can be used as a substitute for PD-L1 and its inhibitor respectively.CTLA-4

[0174] In some embodiments, the immune checkpoint inhibitor is an inhibitor of CTLA-4. In some embodiments, the inhibitor of CTLA-4 is an anti-CTLA-4 antibody. Any of the anti- CTLA-4 antibodies that are known in the art may be used in the present invention, including, but not limited to, Ipilimumab, Tremelimumab, and KAHR-102. In some embodiments, the anti-CTLA-4 antibody is YERVOY® (Ipilimumab). In some embodiments, the anti-CTLA-4 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the anti- CTLA-4 antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, VHH (nanobody) and other antigen-binding subsequences of the full length anti-CTLA-4 antibody. In some embodiments, the anti-CTLA-4 antibody is a human, humanized, or chimeric antibody. In some embodiments, the anti-CTLA-4 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other functional variants or derivatives thereof. In some embodiments, the inhibitor of CTLA-4 is an engineered lipocalin protein specifically recognizing CTLA-4 (such as an anticalin molecule that specifically binds to CTLA-4). In some embodiments, the inhibitor of CTLA-4 is a natural or engineered ligand of CTLA-4, such as B7.1 or B7.2.

[0175] CTLA-4 is an immune checkpoint molecule, which is up-regulated on activated T- cells. An anti-CTLA-4 mAh can block the interaction of CTLA-4 with CD80 / 86 and switch off the mechanism of immune suppression and enable continuous stimulation of T-cells by DCs. Examples of anti-CTLA-4 antibodies are Ipilimumab (see U.S. Patent Nos. 6,984,720,7,452,535, 7,605,238, 8,017,114 and 8,142,778), Tremilimumab (see U.S. Patent No. 6,68,736, 7,109,003, 7,132,281, 7,411,057, 7,807,797, 7,824,679 and 8,143,379) and other anti-CTLA-4 antibodies, including single chain antibodies (e.g., see U.S. Patent Nos. 5,811,097, 6051,227 and 7,229,628, and US Patent Publication No. US20110044953).

[0176] Two IgG mAb directed against CTLA-4, Ipilimumab and Tremelimumab, have been tested in clinical trials for a number of indications. Ipilimumab is approved by the FDA for the treatment of melanoma, e.g., for late stage melanoma patients. The complete prescribing information is fully described in the packaging insert of YERVOY® (Bristol Meyers). YERVOY® (Ipilimumab) comes in 50mg single use vials.

[0177] Anticalins are engineered proteins that are able to recognize and bind specific targets with high affinity. They are antibody mimetics, but they are not structurally related to antibodies. Instead, they are derived from human lipocalins, which are a family of naturally binding proteins. Anticalins are being used in lieu of monoclonal antibodies, but are about eight times smaller than monoclonal antibodies with a size of about 180 amino acids and a mass of about 20 kDa. Anticalins have been described in U.S. Patent No. 7,250, 297.Anticalins that bind CTLA-4 with high affinity and specificity have been developed, which are described in, for example, International Patent Application Publication No.W02012072806. Any of the CTLA-4-binding anticalins may be used in the present application. In some embodiments, the CTLA-4 binding anticalin is PRS-010 (Piers AG).

[0178] Table 1 below summarizes examples of commercially available immune checkpoint inhibitors that have been approved by the FDA or are involved in clinical trial studies. Any one or any combination of the immune checkpoint inhibitors in Table 1 may be used in the methods described herein, using the same or different administration routes, and / or dosages, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1.Table 1. Examples of Systemic Administration of Exemplary Immune Checkpoint InhibitorChemotherapeutic Agents

[0179] In some embodiments, the methods described herein comprise administration of a chemotherapeutic agent in combination with intravesical administration of an oncolytic virus.Chemotherapeutic agents that may be administered in the methods describe herein include, for example, gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), and the like.

[0180] In some embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In certain embodiments, the chemotherapeutic agent comprises cisplatin. In certain embodiments, the chemotherapeutic agent comprises carboplatin. In certain embodiments, the chemotherapeutic agent comprises paclitaxel. In certain embodiments, the chemotherapeutic agent comprises docetaxel. In certain embodiments, the chemotherapeutic agent comprises ifosfamide. In certain embodiments, the chemotherapeutic agent comprises doxorubicin. In certain embodiments, the chemotherapeutic agent comprises methotrexate. In certain embodiments, the chemotherapeutic agent comprises vinblastine. In certain embodiments, the chemotherapeutic agent comprises mitomycin (e.g, mitomycin C). In certain embodiments, the chemotherapeutic agent comprises 5 -fluorouracil (5-FU). In certain embodiments, the chemotherapeutic comprises a combination of gemcitabine and cisplatin. In certain embodiments, the chemotherapeutic agent comprises a combination of dose-dense methotrexate, vinblastine, doxorubicin (Adriamycin), and cisplatin (DDMVAC). In certain embodiments, the chemotherapeutic agent comprises a combination of gemcitabine and paclitaxel. In some embodiments, the chemotherapeutic agent comprises interferon (such as interferon-a). In some embodiments, the chemotherapeutic agent comprises platinum-based agents, for example, cisplatin, carboplatin, oxaliplatin, or any combination thereof. In some embodiments, the chemotherapeutic agent comprises mitomycin (e.g, mitomycin C) and thiotepa. In some embodiments, the chemotherapeutic agent comprises cisplatin, doxorubicin, gemcitabine, and valrubicin.

[0181] The chemotherapeutic agents described herein can be used singly or in combination. For example, any number (such as any of 1, 2, 3, 4, 5, 6, or more) of chemotherapeutic agents can be administered simultaneously or sequentially. Sequential administration chemotherapeutic agents can be separated by hours, days or weeks. The administration route(s) for two or more chemotherapeutic agents can be the same or different. For example, one chemotherapeutic agents can be administered locally (e.g, intravesically or intratumorally), and a chemotherapeutic agents can be administered systemically (e.g, intravenously); two chemotherapeutic agents can both be administered locally (e.g,intravesically or intratumorally); or two chemotherapeutic agents can both be administered systemically (e.g, intravenously). In some embodiments, two or more chemotherapeutic agents are administered simultaneously in the same composition. In some embodiments, two or more chemotherapeutic agents are administered simultaneously in separate compositions.Gemcitabine

[0182] In some embodiments, the chemotherapeutic agent is gemcitabine. Accordingly, in some embodiments, provided herein is a method of treating bladder cancer comprising intravesically administering an oncolytic virus and intravesically administering cretostimogene. In some embodiments, the bladder cancer is NMIBC. In certain embodiments, the bladder cancer is high-risk NMIBC.

[0183] In some embodiments, provided here is a method of treating high-risk NMIBC in an individual comprising intravesically administering an oncolytic adenovirus to the individual and intravesically administering gemcitabine to the individual. In some embodiments, the oncolytic adenovirus comprises a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule. In some embodiments, the oncolytic adenovirus preferentially replicates in a cancer cell. In certain embodiments, the cancer cell is defective in the Rb pathway. In some embodiments, the tumor cell-specific promoter is an E2F-1 promoter (e.g, an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1). In some embodiments, the immune-related molecule is GM-CSF. In some embodiments, the heterologous gene is operably linked to a viral promoter. In certain embodiments, the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of El A, E1B, and E4. In certain embodiments, the heterologous gene is operably linked to an El promoter or an E3 promoter. In certain embodiments, the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic adenovirus is cretostimogene.

[0184] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising intravesically administering cretostimogene to the individual and intravesically administering gemcitabine to the individual. In someembodiments, the bladder cancer is NMIBC. In certain embodiments, the bladder cancer is high-risk NMIBC. In some embodiments, the individual has had at least one diagnosis of high-risk NMIBC. In certain embodiments, the individual has high-risk high-grade BCG- unresponsive NMIBC or high-risk NMIBC after prior therapy with BCG. In some embodiments, the gemcitabine is administered concurrently with the cretostimogene. In some embodiment, the gemcitabine and the cretostimogene are administered sequentially.

[0185] In some embodiments, provided herein is a method of treating high-risk NMIBC in an individual, the method comprising intravesically administering cretostimogene to the individual and intravesically administering gemcitabine to the individual. In some embodiments, the individual has had at least one diagnosis of high-risk NMIBC and, prior to the administration of the oncolytic adenovirus and gemcitabine, the individual has: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of highgrade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; d) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3- month evaluation) following the BCG induction course; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or g) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.

[0186] In some embodiments, provided herein is a method of treating bladder cancer (e.g. , high-risk NMIBC) in an individual comprising intravesically administering an oncolytic virusand gemcitabine to the individual, wherein the individual: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; d) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent highgrade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or g) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. Incertain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of the oncolytic virus. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the method comprises administration of one or more additional therapeutic agents (e.g, an immune checkpoint modulator or chemotherapeutic agent described herein, e.g, gemcitabine). In some embodiments, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In certain embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual weekly for three weeks every three or six months. In some embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles).

[0187] In some embodiments, provided herein is a method of treating high-risk NMIBC in an individual comprising intravesically administering cretostimogene and gemcitabine to the individual. In some embodiments, the individual: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at a first evaluation (e.g, a 3- month evaluation) following the BCG induction course; d) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation (e.g, a 3-month evaluation) following the BCG induction course; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; I) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose ofBCG; or g) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG. In some embodiments, the BCG induction course comprises 5 or 6 weekly intravesical instillations of BCG. In some embodiments, the BCG maintenance course comprises 2 or 3 weekly intravesical instillations of BCG. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering cretostimogene. In some embodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of cretostimogene. In certain embodiments, the method does not comprise administering a saline bladder wash before or after the administration of the DDM and before the administration of cretostimogene. In some embodiments, cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, the method is according to Example 3, Cohort CX.

[0188] In some embodiments of the foregoing methods, the method comprises intravesical administration of cretostimogene followed by intravesical administration of gemcitabine on the same day of treatment. In some embodiments, the method comprises intravesical administration of cretostimogene followed immediately by intravesical administration of gemcitabine. In some embodiments, wherein the method comprises at least a first 6-week induction phase comprising administering cretostimogene and additional therapeutic agent to the individual on weeks 1, 2, 3, 4, 5, and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering cretostimogene and additional therapeutic agent to the individual every three or six months. In certain embodiments, the 3- week treatment comprises administering cretostimogene and additional therapeutic agent weekly on weeks 1, 2, and 3. In certain embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months. In in some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In certain the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In other embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-weekinduction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months. In some embodiments, cretostimogene is administered at a dose of between 1 x 108and 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, gemcitabine is administered at a dose of between 0.1 g and 5 g (e.g, between 0.1 and 2 g or between 0.5 g and 1.5 g). In certain embodiments, gemcitabine is administered at a dose of around 1 g. In some embodiments, the method is according to Example 3, Cohort CX, Arm 1.

[0189] In some embodiments of the foregoing methods, gemcitabine and cretostimogene are administered on different days or different weeks of a treatment course. In some embodiments the method comprises at least a first 6-week induction phase comprising: i) administering cretostimogene to the individual on weeks 1, 2, 4 and 5; and ii) administering additional therapeutic agent to the individual on weeks 3 and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering cretostimogene and additional therapeutic agent to the individual every three or six months. In certain embodiments, the 3-week treatment comprises administering cretostimogene weekly on weeks 1 and 2 followed by administering additional therapeutic agent in week 3. In some embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months. In some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In other embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months. In some embodiments, cretostimogene is administered at a dose of between 1 x 108and 1 x 1014viral particles (e.g, about 1 x 1012viral particles). In some embodiments, gemcitabine is administered at a dose of between 0.1 g and 5 g (e.g, between 1 g and 3 g or between 1.5 g and 2.5 g). In certain embodiments, gemcitabine is administered at a dose of around 2 g. In some embodiments, the method is according to Example 3, Cohort CX, Arm 2.

[0190] In some embodiments of the foregoing methods, gemcitabine is administered at a dose between 0.1 g and 5 g. In some embodiments, gemcitabine is administered at a dose of about 0.1 g, about 0.5 g, about 1 g, about 1.5 g, about 2 g, about 2.5 g, about 3 g, about 3.5 g, about 4 g, about 4.5 g, or about 5 g. In certain embodiments, gemcitabine is administered at a dose of about 1 g. In certain embodiments, gemcitabine is administered at a dose of about 2 g. In some embodiments, gemcitabine is administered at a dose of between 0.1 g and 0.5 g, between 0.1 g and 1 g, between 0.1 g and 1.5 g, between 0.1 g and 2 g, between 0.1 g and 2.5 g, between 0.1 g and 3 g, between 0.1 g and 3.5 g, between 0.1 g and 4 g, between 0.1 g and 4.5 g, between 0.1 g and 5 g, between 0.5 g and 1 g, between 0.5 g and 1.5 g, between 0.5 g and 2 g, between 0.5 g and 2.5 g, between 0.5 g and 3 g, between 0.5 g and 3.5 g, between 0.5 g and 4 g, between 0.5 g and 4.5 g, between 0.5 g and 5 g, between 1 g and 1.5 g, between 1 g and 2 g, between 1 g and 2.5 g, between 1 g and 3 g, between 1 g and 3.5 g, between 1 g and 4 g, between 1 g and 4.5 g, between 1 g and 5 g, between 1.5 g and 2 g, between 1.5 g and 2.5 g, between 1.5 g and 3 g, between 1.5 g and 3.5 g, between 1.5 g and 4 g, between 1.5 g and 4.5 g, between 1.5 g and 5 g, between 2 g and 2.5 g, between 2 g and 3 g, between 2 g and 3.5 g, between 2 g and 4 g, between 2 g and 4.5 g, between 2 g and 5 g, between 2.5 g and 3 g, between 2.5 g and 3.5 g, between 2.5 g and 4 g, between 2.5 g and 4.5 g, between 2.5 g and 5 g, between 3 g and 3.5 g, between 3 g and 4 g, between 3 g and 4.5 g, between 3 g and 5 g, between 3.5 g and 4 g, between 3.5 g and 4.5 g, between 3.5 g and 5 g, between 4 g and 4.5 g, between 4 g and 5 g, or between 4.5 g and 5 g. In certain embodiments, gemcitabine is administered at a dose of between 0.5 g and 2.5 g. In certain embodiments, gemcitabine is administered at a dose of between 0.5 g and 1.5 g. In certain embodiments, gemcitabine is administered at a dose of between 1 g and 3 g. In certain embodiments, gemcitabine is administered at a dose of between 1.5 g and 2.5 g.

[0191] In some embodiments, each dose of gemcitabine is administered by intravesical instillation of between 0.1 g and 5 g (e.g, about 1 g or about 2 g) in between 50 and 100 mL normal saline (e g, in about 50 mL, about 60 mL, about 70 mL, about 80 mL, about 90 mL, or about 100 mL normal saline). In some embodiments, each instillation of gemcitabine is maintained in the bladder for a dwell time of around 60 minutes (e.g, between 50 and 70 minutes or between 55 and 65 minutes) before draining.Immunomodulatory Agents

[0192] In some embodiments, the methods described herein comprise administering animmunomodulatory agent.

[0193] In some embodiments, the immunomodulatory agent is an immune-stimulating agent. In some embodiments, the immune-stimulating agent is a natural or engineered ligand of an immune stimulatory molecule, including, for example, ligands of 0X40 (e.g., OX40L), ligands of CD-28 (e.g., CD80, CD86), ligands of ICOS (e.g., B7RP1), ligands of 4-1BB (e.g., 4-1 BBL, Ultra4-1BBL), ligands of CD27 (e.g., CD70), ligands of CD40 (e.g., CD40L), and ligands of TCR (e.g., MHC class I or class II molecules, IMCgplOO). In some embodiments, the immune-stimulating agent is an antibody selected from the group consisting of anti-CD28 (e.g., TGN-1412), anti-OX40 (e.g., MEDI6469, MEDI-0562), anti-ICOS (e.g., MEDI-570), anti-GITR (e.g., TRX518, INBRX-110, NOV-120301), anti-41-BB (e.g., BMS-663513, PF- 05082566), anti-CD27 (e.g., BION-1402, Varlilumab and hCD27.15), anti-CD40 (e.g., CP870,893, BI-655064, BMS-986090, APX005, APX005M), anti-CD3 (e.g., blinatumomab, muromonab), and anti-HVEM. In some embodiments, the antibody is an agonistic antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full length antibody. In some embodiments, the antibody is a human, humanized, or chimeric antibody. In some embodiments, the antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other functional variants or derivatives thereof.

[0194] In some embodiments, the immune-stimulating agent is an activator of CD40. In some embodiments, the activator of CD40 is an agonistic anti-CD40 antibody. Any of the known anti-CD40 antibodies may be used in the present invention, including, but not limited to, CP-870,893, Dacetuzumab (also known as SGN-40), ChiLob 7 / 4, APX005, and APX005M, BI-655064, and BMS-986090. In some embodiments, the agonistic anti-CD40 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the agonistic anti-CD40 antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full- length anti-CD40 antibody. In some embodiments, the agonistic anti-CD40 antibody is a human, humanized, or chimeric antibody. In some embodiments, the agonistic anti-CD40 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other variants or derivatives thereof. In some embodiments, the activator of CD40 is a natural or engineered CD40 ligand, such as CD40L. In some embodiments, the activator of CD40 is an inhibitor of the interaction between CD40and CD40L. In some embodiments, the activator of CD40 increases the signaling of CD40.

[0195] In some embodiments, the immune-stimulating agent is an activator of 0X40. In some embodiments, the activator of 0X40 is an agonistic anti-OX40 antibody. Any of the known anti- 0X40 antibodies may be used in the present invention, including, but not limited to, MEDI6469, MEDI0562, MEDI6383, GSK3174998, KHK4083 and InVivoMAb clone OX-86. In some embodiments, the agonistic anti-OX40 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the agonistic anti-OX40 antibody is an antigenbinding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full-length anti-OX40 antibody. In some embodiments, the agonistic anti-OX40 antibody is a human, humanized, or chimeric antibody. In some embodiments, the agonistic anti-OX40 antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other variants or derivatives thereof. In some embodiments, the activator of 0X40 is a natural or engineered 0X40 ligand, such as OX40L. In some embodiments, the activator of 0X40 is an inhibitor of the interaction between 0X40 and OX40L. Any of the inhibitors of interaction between 0X40 and OX40L may be used in the present invention, see, for example, U.S Patent No. US8283450, US11867621, US7547438, US7063845, ?: US7537763 and US5801227. In some embodiments, the activator of 0X40 increases the signaling of 0X40.Targeted Therapy Agents

[0196] In some embodiments, the methods described herein comprise administering a targeted therapy agent. Targeted therapy agents are a class of drugs specifically designed to interfere with molecular targets that drive cancer progression. Unlike traditional chemotherapy, which broadly attacks rapidly dividing cells, targeted therapies aim to disrupt cancer-specific pathways, offering improved precision, reduced toxicity, and often enhanced efficacy. These agents work by modulating distinct cancer hallmarks — biological capabilities acquired during tumor development — through inhibition or modulation of key signaling pathways, receptors, or genetic mutations (Wilkes. Targeted Therapy: Attacking Cancer with Molecular and Immunological Targeted Agents. Asia Pac J Oncol Nurs. 2018 Apr- Jun;5(2): 137-155). The methods described herein can comprise administering any targeted therapy agent known in the art or described herein.

[0197] Table 2 below summarizes examples of targeted therapy agents based on the cancermechanism that they target. Any one or any combination of the targeted therapy agents in Table 2 may be used in the methods described herein, using any administration routes, and / or dosage, and / or dosing frequency, and / or duration, and / or maintenance schedule described herein.Table 2. Exemplary Targeted Therapy Agents

[0198] In some embodiments, the targeted therapy agent is a tyrosine kinase inhibitor. Insome embodiments, the tyrosine kinase inhibitor targets a BCR-ABL fusion protein. Tyrosine kinase inhibitors that target a BCR-ABL fusion protein include, for example, Imatinib (Gleevec®), also known as imatinib mesylate. In some embodiments, the tyrosine kinase inhibitor targets EGFR. Tyrosine kinase inhibitors that target EGFR include, for example, Erlotinib (Tarceva®), Gefitinib (Iressa®), Afatinib (Gilotrif®), Osimertinib (Tagrisso®), and Lapatinib (Tykerb®). In some embodiments, the tyrosine kinase inhibitor targets HER2. Tyrosine kinase inhibitors that target HER2 include, for example, Lapatinib (Tykerb®). In some embodiments, the tyrosine kinase inhibitor targets VEGFR. Tyrosine kinase inhibitors that target VEGFR include, for example, Sunitinib (Sutent®), Sorafenib (Nexavar®), Pazopanib (Votrient®), and Axitinib (Inlyta®). In some embodiments, the tyrosine kinase inhibitor targets ALK and / or ROS1. Tyrosine kinase inhibitors that target ALK and / or ROS1 include, for example, Crizotinib (Xalkori®), Ceritinib (Zykadia®), and Alectinib (Alecensa®). In some embodiments, the tyrosine kinase inhibitor targets TRK and / or ROSE Tyrosine kinase inhibitors that target TRK and / or ROS1 include, for example, Larotrectinib (Vitrakvi®) and Entrectinib (Rozlytrek®).

[0199] In some embodiments, the targeted therapy agent is a monoclonal antibody. In some embodiments, the monoclonal antibody is an anti-HER2 antibody, such as Trastuzumab (Herceptin®) or Pertuzumab (P eq eta®). In some embodiments, the monoclonal antibody is an anti-EGFR antibody, such as Cetuximab (Erbitux®) or Panitumumab (Vectibix®). In some embodiments, the monoclonal antibody is an anti-VEGF antibody, such as Bevacizumab (Avastin®). In some embodiments, the monoclonal antibody is an anti-CD38 antibody, such as Daratumumab (Darzalex®). In some embodiments, the monoclonal antibody is an anti- CD20 antibody, such as Rituximab (Rituxan®) or Obinutuzumab (Gazyva®).

[0200] In some embodiments, the targeted therapy agent is an mTOR and PI3K / AKT pathway inhibitor. In some embodiments, the mTOR and PI3K / AKT pathway inhibitor targets mTOR. mTOR and PI3K / AKT pathway inhibitors that target mTOR include, for example, Everolimus (Afinitor®) and Temsirolimus (Torisel®). In some embodiments, the mTOR and PI3K / AKT pathway inhibitor targets PI3Ka. mTOR and PI3K / AKT pathway inhibitors that target PI3Ka include, for example, Alpelisib (Piqray®).

[0201] In some embodiments, the targeted therapy agent is a PARP inhibitor. PARP inhibitors include, for example, Olaparib (Lynparza®), Rucaparib (Rubraca®), Niraparib (Zejula®), and Talazoparib (Talzenna®).

[0202] In some embodiments, the targeted therapy agent comprises a BRAF inhibitor and / or a MEK inhibitor. In some embodiments, the targeted therapy agent comprises a BRAFinhibitor, such as an agent that targets a BRAF V600 mutant (e.g, V600E). BRAF inhibitors include, for example, Vemurafenib (Zelboraf®), Dabrafenib (Tafmlar®), and Encorafenib (Braftovi®). In some embodiments, the targeted therapy agent comprises a MEK inhibitor. MEK inhibitors include, for example, Trametinib (Mekinist®), Cobimetinib (Cotellic®), and Binimetinib (Mektovi®). In some embodiments, the targeted therapy agent comprises a BRAF inhibitor and MEK inhibitor. In certain embodiments, the targeted therapy agent comprises Encorafenib (Braftovi®) and Binimetinib (Mektovi®).

[0203] In some embodiments, the targeted therapy agent targets a hormonal or endocrine target. In some embodiments, the targeted therapy agent is an estrogen receptor modulator, such as tamoxifen. In some embodiments, the targeted therapy agent is an aromatase inhibitor, such as letrozole, anastrozole, or exemestane. In some embodiments, the targeted therapy agent is a CYP17 inhibitor, such as Abiraterone (Zytiga®). In some embodiments, the targeted therapy agent is an androgen receptor antagonist, such as Enzalutamide (Xtandi®).

[0204] In some embodiments, the targeted therapy agent is an agent that targets mutated isocitrate dehydrogenase- 1 (IDH1), such as Ivosidenib (Tibsovo®). In some embodiments, the targeted therapy agent is an agent that targets mutated isocitrate dehydrogenase- 1 (IDH1), such as Enasidenib (Idhifa®). In some embodiments, the targeted therapy agent is an agent that targets FGFR (e.g, FGFR-mutated urothelial carcinoma), such as Erdafitinib (Balversa®). In some embodiments, the targeted therapy agent is an agent that targets HER2, such as Tucatinib (Tukysa®). In some embodiments, the targeted therapy agent is an agent that targets RET, such as Selpercatinib (Retevmo®).Pretreatment Compositions and Methods

[0205] In some embodiments, the individual has been subject to tumor site preparation prior to administration of the oncolytic virus, using one or more (such as 1, 2, 3, 4, 5, or more) treatment modalities, including, but are not limited to radiation therapy, administration of one or more immune-related molecules, administration of other therapeutic agents, and combinations thereof. It is believed that adding other pre-treatment preparations can increase the chance of success for the methods described above. Without being bound by any theory or hypothesis, for example, local radiation, with or without lymphodepletion effects, or chemotherapy, may increase the chance of the transfection of the oncolytic virus, and may deplete the more sensitive Treg cells at the tumor sites, thereby reviving the exhausted or telorized T memory cells. Similarly, tumor site preparations prior to or in concomitant withthe administration of the invention combination at the tumor site can involve cytokines, chemokines, small molecules and other well-known beneficial immunomodulators, such as IL2, IL 12, 0X40, CD40 and 4- IBB agonist. These tumor site preparation modalities can be given in conjunction with or in sequence depending on needs.

[0206] The methods described herein may further comprise a step of intravesically administering to the site of the tumor a pretreatment composition prior to the administration of the oncolytic virus. In some embodiments, the pretreatment composition comprises a transduction enhancing agent, such as N-Dodecyl-P-D-maltoside (DDM).

[0207] In some embodiments, the pretreatment composition comprises a solution of the transduction enhancing agent (such as DDM). Suitable concentration of the pretreatment composition (such as DDM solution) include, but are not limited to, about any one of 0.01%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, or 5% of the transducing enchanting agent (such as DDM). In some embodiments, the pretreatment composition comprises any of about 0.01% to about 0.05%, about 0.05% to about 0.1%, about 0.1% to about 0.5%, about 0.5% to about 1%, about 1% to about 2%, about 2% to about 3%, about 3% to about 4%, about 4% to about 5%, about 0.01% to about 1%, about 0.05% to about 2%, about 1% to about 5%, or about 0.1% to about 5% of the transduction enhancing agent (such as DDM).

[0208] In some embodiments, the pretreatment (such as DDM) is administered immediately (such as no more than 5 minutes) prior to the administration of the oncolytic virus. In some embodiments, the pretreatment (such as DDM) is administered no more than about any of 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 45 minutes, 1 hour, 90 minutes, 2 hours, 3 hours or 4 hours before the administration of the oncolytic virus. In some embodiments, the pretreatment (such as DDM) is administered no more than about 2 hours before the administration of the oncolytic virus.

[0209] Suitable dosages for the pretreatment composition (such as DDM) include, but are not limited to, about any of 0.1 mg / kg, 0.5 mg / kg, 1 mg / kg, 1.5mg / kg, 2 mg / kg, 2.5 mg / kg, 5mg / kg, 10 mg / kg, 25 mg / kg, 50 mg / kg, 100 mg / kg, 150 mg / kg, 200 mg / kg, 250 mg / kg, 300 mg / kg, 400 mg / kg, 500 mg / kg, 0.1 mg / kg to 0.5 mg / kg, 0.5 mg / kg to 1 mg / kg, 1 mg / kg to 2 mg / kg, 2 mg / kg to 5mg / kg, 5mg / kg to 10 mg / kg, 10 mg / kg to 25 mg / kg, 25 mg / kg to 50 mg / kg, 50 mg / kg to 100 mg / kg, 100 mg / kg to 150 mg / kg, 150 mg / kg to 200 mg / kg, 200 mg / kg to 250 mg / kg, 250 mg / kg to 500 mg / kg, or 0.5 mg / kg to about 5 mg / kg. In some embodiments, a suitable dosage for the pretreatment composition is about any one of 0.1 g, 0.2 g, 0.5g, 0.75 g, 1 g, 1.5 g, 2 g, 2.5 g, 5 g, or 10 g of the transduction enhancing agent(such as PPM).PPM

[0210] In some embodiments, the pretreatment composition comprises a transduction enhancing agent, such as N-Podecyl-P-P-maltoside (PPM). PPM is a nonionic surfactant comprised of a maltose derivatized with a single twelve-carbon chain, and acts as a mild detergent and solubilizing agent. It has been used as a food additive and is known to enhance mucosal surface permeation in rodents, probably due to its effect on membrane associated GAG and tight junctions.

[0211] In some embodiments of the methods described herein, the method comprises one or more intravesical instillations of PPM. In some embodiments, the intravesical instillation of PPM comprises administering the PPM into the bladder and allowing the PPM to dwell in the bladder for a dwell time of at least about 5 minutes before draining the bladder. In some embodiments, the intravesical instillation of PPM comprises allowing the PPM to dwell in the bladder for a dwell time of about 5, 10, 15, 20, 25, or 30 minutes. In certain embodiments, the intravesical instillation of PPM comprises allowing the PPM to dwell in the bladder for a dwell time of about 15 minutes, or between about 10 minutes and about 20 minutes. In certain embodiments, the intravesical instillation comprises allowing the PPM to dwell in the bladder for a dwell time of between 5 and 10 minutes, between 5 and 15 minutes, between 5 and 20 minutes, between 5 and 25 minutes, between 5 and 30 minutes, between 10 and 15 minutes, between 10 and 20 minutes, between 10 and 25 minutes, between 10 and 30 minutes, between 15 and 20 minutes, between 15 and 25 minutes, between 15 and 30 minutes, between 20 and 25 minutes, or between 25 and 30 minutes. In some embodiments of the methods described herein, each dose of PPM is administered as an intravesical instillation of PPM comprising allowing the PPM to dwell in the bladder for a dwell time of at least about 5 minutes (e.g, about 15 minutes, or between about 10 minutes and about 20 minutes).

[0212] In some embodiments of the methods described herein, the method comprises one or more bladder washes with PPM or saline. In some embodiments, the bladder wash comprises administering the PPM or saline into the bladder and then draining the bladder shortly thereafter, e.g, immediately after or within about 5, 4, 3, 2 or 1 minute or less after administration.

[0213] In some embodiments, the methods described herein comprise administering one or more doses (e.g, instillations and / or washes) of PPM to the individual prior to administeringthe oncolytic virus. In some embodiments, the methods described herein comprises administering a single dose (e.g, a single instillation) of DDM prior to administering the oncolytic virus. In some embodiments, the methods described herein comprise a single bladder wash with DDM and a single instillation of DDM prior to administering the oncolytic virus. In certain embodiments, the method comprises one or more saline washes before or after instillation of DDM and prior to administering the oncolytic virus. In certain embodiments, the method does not comprise any saline washes in between instillation of DDM and the administration of the oncolytic virus.

[0214] In some embodiments, provided herein is a method of treating bladder cancer comprising administering DDM and an oncolytic virus (e.g, cretostimogene), wherein the method comprises a five-step instillation regimen. In some embodiments, provided herein is a method of treating bladder cancer comprising administering DDM and an oncolytic virus (e.g, cretostimogene), wherein the method comprises administering: 1) a first bladder wash with normal saline; 2) a second bladder wash with DDM; 3) instillation of DDM; 4) a third bladder was with normal saline; and 5) instillation of cretostimogene. In certain embodiments, the first and third bladder washes are with between 50 mL and 100 mL normal saline (e.g, about 100 mL normal saline). In certain embodiments, the second bladder wash is with between 50 mL and 100 mL (e.g, about 75 mL) of a solution of DDM. In certain embodiments, the instillation of DDM is instillation is with between 50 mL and 100 mL (e.g, about 85 mL to 100 mL, or about 100 mL) of a solution of DDM. In certain embodiments, the instillation of cretostimogene is with between 50 mL and 100 mL (e.g, about 85 mL to 100 mL, or about 100 mL) of a solution of cretostimogene. In some variations, the solution of DDM is 0.1% w / w DDM in normal saline. In some variations, the solution of cretostimogene comprises between 1 x 108and 1 x 1014viral particles (e.g, around 1 x 1012viral particles). In some embodiments, the instillation of cretostimogene is administered no later than 60 minutes (e.g, no later than 60 minutes, 50 minutes, 40 minutes, 30 minutes, or 20 minutes) after the first bladder wash. In certain embodiments, the instillation of cretostimogene is administered no later than about 30 minutes (e.g, 25 minutes to 35 minutes) after the first bladder wash.

[0215] In some embodiments, provided herein is a method of treating bladder cancer comprising administering DDM and an oncolytic virus (e.g, cretostimogene), wherein the method comprises a two-step instillation regimen. In some embodiments, the two-step instillation regimen does not comprise bladder washes with saline. In some embodiments, provided herein is a method of treating bladder cancer comprising administering DDM andan oncolytic virus (e.g, cretostimogene), wherein the method comprises administering: 1) a single instillation of DDM; and 2) instillation of cretostimogene, wherein the method does not comprise a bladder wash with saline. In certain embodiments, the method does not comprise a bladder wash with DDM. In certain embodiments, the instillation of DDM is instillation is with between 50 mL and 100 mL (e.g, about 85 mL to 100 mL, or about 100 mL) of a solution of DDM. In certain embodiments, the instillation of cretostimogene is with between 50 mL and 100 mL (e.g, about 85 mL to 100 mL, or about 100 mL) of a solution of cretostimogene. In some variations, the solution of DDM is 0.1% w / w DDM in normal saline. In some variations, the solution of cretostimogene comprises between 1 x 108and 1 x 1014viral particles (e.g, around 1 x 1012viral particles). In some embodiments, the instillation of cretostimogene is administered no later than 60 minutes (e.g, no later than 60 minutes, 50 minutes, 40 minutes, 30 minutes, or 20 minutes) after the instillation of DDM. In certain embodiments, the instillation of cretostimogene is administered no later than about 30 minutes (e.g, 25 minutes to 35 minutes) after the instillation of DDM.

[0216] In some embodiments of the methods described herein, the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic virus. In some embodiments, the oncolytic virus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash. In some embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a saline wash after only the first DDM wash. In certain embodiments, the oncolytic virus is administered directly after the second dose of DDM, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus. In some embodiments, the DDM is administered at a concentration of about any one of 0.01%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 1%, 2%, 3%, 4%, or 5%. In certain embodiments, the DDM is administered at a volume of between about 50 mL and about 100 mL.

[0217] In some embodiments, the methods described herein comprise administering a first and second dose of DDM to the individual prior to administering an oncolytic virus, wherein the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule. In some embodiments, the method comprises intravesically administering a saline wash after only the first DDM wash. In some embodiments, the oncolytic virus is administered directly after the second dose of DDM,without intravesical administration of a saline wash after the second dose of DDM and administration of the oncolytic virus. In some embodiments, the oncolytic virus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash. In some embodiments, the DDM is administered at a concentration of about 0.1%. In some embodiments, the DDM is administered at a volume of between about 50 mL and about 100 mL.Instillation Regimens

[0218] In some embodiments, provided herein is a method of treating bladder cancer in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times. Such two-step instillation regimen can be administered to any individual described in the Patient Population section above. In some embodiments, each two-step instillation regimen comprises or consists of: a) intravesically administering a pretreatment composition comprising a transduction-enhancing agent to the individual; and subsequently b) intravesically administering an oncolytic virus to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the oncolytic virus. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the transduction-enhanding agent is N-Dodecyl-P-D-maltoside (DDM).

[0219] In some embodiments, the method further comprises one or more bladder washes with saline prior to the two-step instillation regimen (e.g, prior to each two-step instillation regimen). In some embodiments, the method further comprises one or more bladder washes with the pretreatment composition prior to the two-step instillation regimen (e.g, prior to each two-step instillation regimen).

[0220] In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5%. In certain embodiments, the pretreatment composition comprises DDM at a concentration of about 0.05% to about 0.2%. IN certain embodiments, the pretreatment composition comprises DDM at a concentration of about 0.1%. In certain embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.05%, about 0.01% to about 0.1%, about 0.01% to about 0.15%, about 0.01% to about 0.2%, about 0.01% to about 0.3%, about 0.01% to about0.4%, about 0.01% to about 0.5%, about 0.05% to about 0.1%, about 0.05% to about 0.15%, about 0.05% to about 0.2%, about 0.05% to about 0.3%, about 0.05% to about 0.4%, about 0.05% to about 0.5%, about 0.1% to about 0.15%, about 0.1% to about 0.2%, about 0.1% to about 0.3%, about 0.1% to about 0.4%, about 0.1% to about 0.5%, about 0.15% to about 0.2%, about 0.15% to about 0.3%, about 0.15% to about 0.4%, about 0.15% to about 0.5%, about 0.2% to about 0.3%, about 0.2% to about 0.4%, about 0.2% to about 0.5%, about 0.3% to about 0.4%, about 0.3% to about 0.5%, or about 0.4 to about 0.5%.

[0221] In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL. In certain embodiments, the pretreatment composition is administered at a volume of between about 85 mL and about 100 mL. In certain embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 60 mL, between about 50 mL and about 70 mL, between about 50 mL and about 80 mL, between about 50 mL and about 90 mL, between about 50 mL and about 100 mL, between about 60 mL and about 70 mL, between about 60 mL and about 80 mL, between about 60 mL and about 90 mL, between about 60 mL and about 100 mL, between about 70 mL and about 80 mL, between about 70 mL and about 90 mL, between about 70 mL and about 100 mL, between about 80 mL and about 90 mL, between about 80 mL and about 100 mL, between about 85 mL and about 95 mL, between about 85 mL and about 100 mL, or between about 90 mL and 100 mL.

[0222] In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes after completion of the administration of the full volume of the pretreatment composition into the bladder. In certain embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 minutes after completion of the administration of the full volume of the pretreatment composition into the bladder. In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for between about 10 minutes and about 20 minutes after completion of the administration of the full volume of the pretreatment composition into the bladder. In certain embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes after completion of the administration of the full volume of the pretreatment composition into the bladder. In certain embodiments, the administration of the pretreatment composition comprises allowing thepretreatment composition to dwell in the bladder for about 15 minutes after completion of the administration of the full volume of the pretreatment composition into the bladder.

[0223] In some embodiments, the administration of the oncolytic virus comprises allowing the oncolytic virus to dwell in the bladder for between about 55 minutes and about 65 minutes after completion of the administration of the full volume of the oncolytic virus into the bladder. In certain embodiments, the administration of the oncolytic virus comprises allowing the oncolytic virus to dwell in the bladder for about 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65 minutes after completion of the administration of the full volume of the oncolytic virus into the bladder. In certain embodiments, the administration of the oncolytic virus comprises allowing the oncolytic virus to dwell in the bladder for about 60 minutes after completion of the administration of the full volume of the oncolytic virus into the bladder.

[0224] In some embodiments, the administration of the full volume of the oncolytic virus into the bladder is completed within about 60 minutes after the administration of the full volume of the pretreatment composition into the bladder is completed. In certain embodiments, the administration of the full volume of the oncolytic virus into the bladder is completed within about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 minutes after the administration of the full volume of the pretreatment composition into the bladder is completed. In certain embodiments, the administration of the full volume of the oncolytic virus into the bladder is completed within about 30 minutes after the administration of the full volume of the pretreatment composition into the bladder is completed. In certain embodiments, the administration of the full volume of the oncolytic virus into the bladder is completed within about 35 minutes after the administration of the full volume of the pretreatment composition into the bladder is completed.

[0225] In some embodiments, the full volume of the pretreatment composition and the full volume of the oncolytic virus are both administered into the bladder within about 60 minutes. In certain embodiments, he full volume of the pretreatment composition and the full volume of the oncolytic virus are both administered into the bladder within about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 minutes. In certain embodiments, the full volume of the pretreatment composition and the full volume of the oncolytic virus are both administered into the bladder within about 35 minutes. In certain embodiments, the full volume of the pretreatment composition and the full volume of the oncolytic virus are both administered into the bladder within about 30 minutes.

[0226] In some embodiments, the administration of the oncolytic virus is initiated withinabout 60 minutes after the initiation of the administration of the pretreatment composition. In certain embodiments, the administration of the oncolytic virus is initiated within about 60, 55, 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5 minutes after the initiation of the administration of the pretreatment composition. In some embodiments, the administration of the oncolytic virus is initiated within about 30 minutes after the initiation of the administration of the pretreatment composition. In some embodiments, the administration of the oncolytic virus is initiated within about 20 minutes after the initiation of the administration of the pretreatment composition. In some embodiments, the administration of the oncolytic virus is initiated within about 15 minutes after the initiation of the administration of the pretreatment composition.

[0227] In some embodiments, provided herein is a method of treating bladder cancer in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising a transduction-enhancing agent to the individual; and subsequently b) intravesically administering an oncolytic virus to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the oncolytic virus, wherein the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule. In some embodiments, each administration of the two-step instillation regiment consists of a) intravesically administering a pretreatment composition comprising a transduction-enhancing agent to the individual; and subsequently b) intravesically administering an oncolytic virus to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the oncolytic virus. In some embodiments, the oncolytic virus is an oncolytic adenovirus. In certain embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the oncolytic virus is administered in a volume of betweenabout 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the oncolytic virus comprises allowing the oncolytic virus to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the oncolytic virus into the bladder. In some embodiments, the transduction-enhancing agent is N-Dodecyl-P-D-maltoside (DDM). In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer. In certain embodiments, the individual has a Ta or T1 papillary carcinoma without concurrent carcinoma in situ. In certain embodiments, the individual has carcinoma in situ, with or without concurrent Ta or T1 papillary carcinoma. In some embodiments, the individual is BCG-unresponsive.

[0228] In some embodiments, provided herein is a method of treating bladder cancer in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N- Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering an oncolytic adenovirus to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the oncolytic adenovirus. In some embodiment, the oncolytic adenovirus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic adenovirus is cretostimogene. In some embodiments, each administration of the two-step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering the oncolytic adenovirus to the individual directly after administering thepretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the oncolytic adenovirus. In some embodiments, the oncolytic adenovirus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the oncolytic adenovirus is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the oncolytic adenovirus comprises allowing the oncolytic adenovirus to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the oncolytic adenovirus into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer. In certain embodiments, the individual has a Ta or T1 papillary carcinoma without concurrent carcinoma in situ. In certain embodiments, the individual has carcinoma in situ, with or without concurrent Ta or T1 papillary carcinoma. In some embodiments, the individual is BCG-unresponsive.

[0229] In some embodiments, provided herein is a method of treating bladder cancer in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N- Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering an oncolytic adenovirus to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the oncolytic adenovirus, and wherein the oncolytic adenovirus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolyticadenovirus is cretostimogene. In some embodiments, each administration of the two-step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering the oncolytic adenovirus to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the oncolytic adenovirus. In some embodiments, the oncolytic adenovirus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the oncolytic adenovirus is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the oncolytic adenovirus comprises allowing the oncolytic adenovirus to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the oncolytic adenovirus into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer. In certain embodiments, the individual has a Ta or T1 papillary carcinoma without concurrent carcinoma in situ. In certain embodiments, the individual has carcinoma in situ, with or without concurrent Ta or T1 papillary carcinoma. In some embodiments, the individual is BCG-unresponsive.

[0230] In some embodiments, provided herein is a method of treating bladder cancer in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N- Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In someembodiments, each administration of the two-step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the cretostimogene is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the cretostimogene comprises allowing the cretostimogene to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the cretostimogene into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder. In some embodiments, the bladder cancer is non-muscle invasive bladder cancer. In certain embodiments, the individual has a Ta or T1 papillary carcinoma without concurrent carcinoma in situ. In certain embodiments, the individual has carcinoma in situ, with or without concurrent Ta or T1 papillary carcinoma. In some embodiments, the individual is BCG-unresponsive.

[0231] In some embodiments, provided herein is a method of treating non-muscle invasive bladder cancer (NMIBC) in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N-Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, each administration of the two-step instillationregiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the cretostimogene is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the cretostimogene comprises allowing the cretostimogene to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the cretostimogene into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder. In some embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has a Ta or T1 papillary carcinoma without concurrent carcinoma in situ. In certain embodiments, the individual has high-grade Ta or T1 disease without CIS, wherein the individual has: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of one course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; or b) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at the first evaluation following the BCG induction course. In some embodiments, the individual: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy; b) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC; or c) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC. In certain embodiments, the individual has: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ(CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of highgrade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; or c) received at least 5 of 6 doses of a BCG induction course and experienced high-grade Tl disease at the first evaluation following the BCG induction course. In some embodiments, the individual has: a) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or carcinoma in situ (CIS) at a first evaluation following the BCG induction course; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or d) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG. In some embodiments, the individual has intermediate-risk NMIBC. In certain embodiments, the intermediate-risk NMIBC comprises: a) a low-grade tumor of Ta stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low-grade tumor of Ta stage or solitary high-grade tumor of Ta stage having a diameter of 3 cm or smaller; b) a solitary low-grade tumor of Ta stage having a diameter of greater than 3 cm; c) two or more low-grade tumors of Ta stage; d) a primary and solitary high-grade tumor of Ta stage having a diameter of less than 3 cm; e) a low-grade tumor of Tl stage; or I) any combination of (a), (c), and (e).

[0232] In some embodiments, provided herein is a method of treating non-muscle invasive bladder cancer (NMIBC) in an individual having a Ta or Tl papillary carcinoma without concurrent carcinoma in situ, the method comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N-Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder washbetween the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, each administration of the two-step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the cretostimogene is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the cretostimogene comprises allowing the cretostimogene to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the cretostimogene into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder. In certain embodiments, the individual has highgrade Ta or T1 disease without CIS, wherein the individual has: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of one course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; or b) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at the first evaluation following the BCG induction course.

[0233] In some embodiments, provided herein is a method of treating non-muscle invasive bladder cancer (NMIBC) in an individual having had at least one diagnosis of high-risk NMIBC, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N- Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesicallyadministering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene, wherein the individual i) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy; ii) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC; or iii) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC. In some embodiments, each administration of the two-step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the cretostimogene is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the cretostimogene comprises allowing the cretostimogene to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the cretostimogene into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder.

[0234] In some embodiments, provided herein is a method of treating non-muscle invasive bladder cancer (NMIBC) in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N-Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly afteradministering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene, wherein the individual has: i) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or T1 disease, within 12 months following the last dose of BCG; ii) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of high-grade papillary-only Ta or T1 stage disease within 6 months following the last dose of BCG; or iii) received at least 5 of 6 doses of a BCG induction course and experienced high-grade T1 disease at the first evaluation following the BCG induction course. In some embodiments, each administration of the two- step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the cretostimogene is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the cretostimogene comprises allowing the cretostimogene to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the cretostimogene into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder.

[0235] In some embodiments, provided herein is a method of treating non-muscle invasive bladder cancer (NMIBC) in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration ofthe two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N-Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene, wherein the individual the individual has: i) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or carcinoma in situ (CIS) at a first evaluation following the BCG induction course; ii) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than 6 months after and within 24 months after the last dose of BCG; iii) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or iv) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG. In some embodiments, each administration of the two-step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the cretostimogene is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the cretostimogene comprises allowing the cretostimogene to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the cretostimogene into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder.

[0236] In some embodiments, provided herein is a method of treating intermediate-risk non-muscle invasive bladder cancer (NMIBC) in an individual, comprising intravesically administering to the individual a two-step instillation regimen one or more times, wherein each administration of the two-step instillation regimen comprises: a) intravesically administering a pretreatment composition comprising N-Dodecyl-P-D-maltoside (DDM) to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, each administration of the two- step instillation regiment consists of a) intravesically administering the pretreatment composition comprising DDM to the individual; and subsequently b) intravesically administering cretostimogene to the individual directly after administering the pretreatment composition, wherein there is no intervening bladder wash between the administration of the pretreatment composition and the administration of the cretostimogene. In some embodiments, the cretostimogene is administered at a dose of about 1 x 108to about 1 x 1014viral particles (e.g, at a dose of about 1 x 1012viral particles). In some embodiments, the cretostimogene is administered in a volume of between about 50 mL and about 100 mL (e.g, in a volume of between about 85 mL and about 100 mL). In some embodiments, the administration of the cretostimogene comprises allowing the cretostimogene to dwell in the bladder for between about 55 minutes and about 65 minutes (e.g, for about 60 minutes) after completion of the administration of the full volume of the cretostimogene into the bladder. In some embodiments, the pretreatment composition comprises DDM at a concentration of about 0.01% to about 0.5% (e.g, about 0.05% to about 0.2%, or about 0.1%). In some embodiments, the pretreatment composition is administered at a volume of between about 50 mL and about 100 mL (e.g, between about 85 mL and about 100 mL). In some embodiments, the administration of the pretreatment composition comprises allowing the pretreatment composition to dwell in the bladder for more than 5 minutes (e.g, for between about 10 minutes and about 20 minutes, or for about 15 minutes) after completion of the administration of the full volume of the pretreatment composition into the bladder. In someembodiments, the intermediate-risk NMIBC comprises: a) a low-grade tumor of Ta stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low- grade tumor of Ta stage or solitary high-grade tumor of Ta stage having a diameter of 3 cm or smaller; b) a solitary low-grade tumor of Ta stage having a diameter of greater than 3 cm; c) two or more low-grade tumors of Ta stage; d) a primary and solitary high-grade tumor of Ta stage having a diameter of less than 3 cm; e) a low-grade tumor of T1 stage; or 1) any combination of (a), (c), and (e).Endpoints

[0237] In some embodiments of the methods described herein, the method prevents progression of the bladder cancer (e.g, NMIBC, e.g, high-risk NMIBC) in the individual. For example, in some embodiments, the method prevents progression of NMIBC to muscle invasive bladder cancer by at least about any one of 3, 6, 9, 12, 18, 24, 30, 36, 42, 48, 54, 60 or more months. In some embodiments of the methods described herein, the method inhibits growth or reduces the size of one or more bladder tumors (e.g, one or more bladder tumors associated with NMIBC, such as high-risk NMIBC). In some embodiments, the size of the bladder tumor is reduced for at least about 10% (including for example at least about any of 20%, 30%, 40%, 60%, 70%, 80%, 90%, or 100%). In some embodiments of the methods described herein, the method causes bladder cancer remission (partial or complete) in the individual. In some embodiments, the individual has bladder cancer remission for at least about any one of 2, 3, 4, 5, 6, 12, 24, or more months. In some embodiments of the methods described herein, the method inhibits metastasis of bladder tumors in the individual. In some embodiments of the methods described herein, at least about 10% (including for example at least about any of 20%, 30%, 40%, 60%, 70%, 80%, 90%, or 100%) metastasis is inhibited. In some embodiments, a method of inhibiting metastasis of bladder tumors to lymph nodes or other organs is provided. Metastasis can be assessed by any known methods in the art, such as by blood tests, bone scans, x-ray scans, CT scans, PET scans, and biopsy.

[0238] In some embodiments of the methods described herein, the method prolongs survival (such as disease-free survival, progression-free survival, recurrence-free survival, or cystectomy -free survival) in the individual. In some embodiments, the survival is prolonged for at least about 2, 3, 4, 5, 6, 9, 12, 15, 18, 24, 30, 36 or more months.

[0239] In some embodiments, the method improves quality of life in the individual. In some embodiments, the individual does not need a cystectomy (such as partial cystectomy orradical cystectomy) after receiving the therapies described herein for at least about any one of 3, 6, 9, 12, 18, 24, 30, 36, 42, 48, 54, 60 or more months. In some embodiments, because the method of the present application delays or obviates the need for radical cystectomy in the individual, the individual enjoys improved quality of life compared to other bladder cancer patients because the individual does not suffer from undesirable side effects due to reconstructive surgery after radical cystectomy. In some embodiments, the methods described herein are performed without subjecting the individual to cystectomy (such as radical cystectomy). In some embodiments, the methods described herein are bladder-sparing (e.g, prevent the need for a cystectomy for at least about any one of 3, 6, 9, 12, 18, 24, 30, 36, 42, 48, 54, 60 or more months).Treatment regimens

[0240] The intravesical administration of the oncolytic virus in the methods described herein provide a unique opportunity of a relatively convenient yet effective intravesical tumor exposure to the oncolytic virus, as well as a potentially reduced toxicity to other tissues. Suitable dosages for the oncolytic virus depend on factors such as the nature of the oncolytic virus, type of the bladder carcinoma in situ being treated, and routes of administration. As used herein, “particles” as related to an oncolytic virus mean the collective number of physical singular units of the oncolytic virus. This number can be converted to, or is equivalent to, another number meaning infectious titer units, e.g., plaque forming unit (pfu) or international unit, by infectivity assays as known in the art. In some embodiments, the oncolytic virus is administered at a dose of about any one of IxlO5particles, IxlO6particles, IxlO7particles, IxlO8particles, IxlO9particles, IxlO10particles, 2xlO10particles, 5xl010particles, IxlO11particles, 2xlOnparticles, 5xl0nparticles, IxlO12particles, 2xl012particles, 5xl012particles, IxlO13particles, 2xl013particles, 5xl013particles, IxlO14particles, or IxlO15particles. In some embodiments, the oncolytic virus is administered at a dose of any one of about IxlO5particles to about IxlO6particles, about IxlO6particles to about IxlO7particles, about IxlO7particles to about IxlO8particles, about IxlO8particles to about IxlO9particles, about IxlO9particles to about IxlO10particles, about IxlO10particles to about IxlO11particles, about IxlO11particles to about 5xl0nparticles, about 5x 10" particles to about IxlO12particles, about IxlO12particles to about 2xl012particles, about 2xl012particles to about 5xl012particles, about 5xl012particles to about IxlO13particles, about IxlO13particles to about IxlO14particles, or about IxlO14particles to about IxlO15particles.

[0241] In some embodiments, the oncolytic virus is administered daily. In some embodiments, the oncolytic virus is administered is administered at least about any one of lx, 2x, 3x, 4x, 5x, 6x, or 7x (i.e., daily) a week. In some embodiments, the oncolytic virus is administered weekly. In some embodiments, the oncolytic virus is administered weekly without break; weekly, two out of three weeks; weekly three out of four weeks; once every two weeks; once every 3 weeks; once every 4 weeks; once every 6 weeks; once every 8 weeks, monthly, or every two to 12 months. In some embodiments, the intervals between each administration are less than about any one of 6 months, 3 months, 1 month, 20 days, 15, days, 12 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day. In some embodiments, the intervals between each administration are more than about any one of 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, or 12 months. In some embodiments, there is no break in the dosing schedule. In some embodiments, the interval between each administration is no more than about a week.

[0242] The administration of the oncolytic virus can be over an extended period of time, such as from about a month up to about seven years. In some embodiments, the oncolytic virus is administered over a period of at least about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, 36, 48, 60, 72, or 84 months. In some embodiments, the oncolytic virus is administered over a period of between 1 and 6 weeks. In some embodiments, the oncolytic virus is administered weekly for 6 weeks. In some embodiments, the oncolytic virus is administered weekly for 3 weeks every 3 or 6 months.

[0243] In some embodiments, the oncolytic virus is administered in two or more treatment courses, for example, one or more induction courses and / or one or more maintenance courses. In some embodiments, each treatment course comprises weekly administration of the oncolytic virus for about 1 to 6 weeks. In some embodiments, each treatment course comprises weekly administration of the oncolytic virus for about 3 weeks or about 6 weeks. In some embodiments, the interval between each treatment course about any one of 1, 2, 3, 4, 5, 6, or more months (e.g, about 3 months or 6 months). In some embodiments, the same treatment course (e.g, the induction course or the maintenance course) is repeated at least once, such as about any of 1, 2, 3, 4, 5, 6, 7, 8, or more times. In some embodiments, the individual is treated with an induction course of the oncolytic virus, followed by a maintenance course. In some embodiments, the induction course and the maintenance course have the same dose and schedule. In some embodiments, the initial course and the maintenance course have different doses and / or schedules.

[0244] In some embodiments, the individual receives no more than 21 doses of an oncolytic virus. In some embodiments, the individual receives no more than 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, or 6 doses of an oncolytic virus.

[0245] In some embodiments, the oncolytic virus is administered during an induction phase and a maintenance phase. In some embodiments, the induction phase comprises administering the oncolytic virus once per week for six weeks. In some embodiments, the maintenance phase comprises administering the oncolytic virus once per week for three weeks every three or six months. In some embodiments, the oncolytic virus is administered once per week for six weeks, followed by once per week for three weeks every three or six months. In some embodiments, administering the oncolytic virus comprises administering the oncolytic virus once per week for six weeks, followed by administering the oncolytic virus once per week for one or three weeks every three or six months.

[0246] In some embodiments, the induction phase comprises intravesical administration of the oncolytic virus on...

Claims

CLAIMSWhat is claimed is:

1. A method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic adenovirus to the individual, wherein the oncolytic adenovirus comprises a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule, wherein the individual has had at least one diagnosis of high-risk NMIBC, and wherein, prior to the administration of the oncolytic adenovirus, the individual: a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy; b) has not received intravesical BCG therapy within 24 months prior to the most recent diagnosis of high-risk NMIBC; or c) has received a maximum of 1 or 2 doses of BCG within 24 months prior to the most recent diagnosis of high-risk NMIBC.

2. A method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic adenovirus to the individual, wherein the oncolytic adenovirus comprises a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule, wherein the individual has had at least one diagnosis of high-risk NMIBC, and wherein, prior to the administration of the oncolytic adenovirus, the individual has: a) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or carcinoma in situ (CIS) at a first evaluation following the BCG induction course; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or T1 disease more than6 months after and within 24 months after the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response,and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or d) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.

3. A method of treating high-risk non-muscle invasive bladder cancer (NMIBC) in an individual comprising intravesically administering an oncolytic adenovirus and gemcitabine to the individual, wherein the oncolytic adenovirus comprises a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule, wherein the individual has had at least one diagnosis of high-risk NMIBC, and wherein, prior to the administration of the oncolytic adenovirus, the individual has: a) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced persistent or recurrent carcinoma in situ (CIS), with or without concomitant Ta or Tl disease, within 12 months following the last dose of BCG; b) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG and experienced recurrence of highgrade papillary-only Ta or Tl stage disease within 6 months following the last dose of BCG; c) received at least 5 of 6 doses of a BCG induction course and experienced highgrade Tl disease at the first evaluation following the BCG induction course; d) received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or CIS at a first evaluation following the BCG induction course; e) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or Tl disease more than6 months after and within 24 months after the last dose of BCG;I) received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response,and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG; or g) received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.

4. The method of claim 2 or 3, wherein, prior to the administration of the oncolytic adenovirus, the individual has received at least 5 of 6 doses of a BCG induction course and experienced persistent or recurrent high-grade papillary carcinoma of Ta stage or carcinoma in situ (CIS) at a first evaluation following the BCG induction course.

5. The method of claim 2 or 3, wherein, prior to the administration of the oncolytic adenovirus, the individual has received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of a high-grade Ta or Tl disease more than 6 months after and within 24 months after the last dose of BCG.

6. The method of claim 2 or 3, wherein, prior to the administration of the oncolytic adenovirus, the individual has received at least 5 of 6 doses of a BCG induction course and at least 2 doses of 1 course of either reinduction or maintenance BCG, achieved an initial complete response, and subsequently experienced recurrence of CIS more than 12 months after and within 24 months after the last dose of BCG.

7. The method of claim 2 or 3, wherein, prior to the administration of the oncolytic adenovirus, the individual has received 3 to 6 doses of a BCG induction course and no BCG reinduction or maintenance course, achieved an initial complete response, and subsequently experienced recurrence of high-grade Ta, Tl, or CIS within 24 months after the final dose of BCG.

8. The method of any one of claims 1-7, wherein the doses of BCG are administered weekly.

9. The method of any one of claims 1-8, wherein the doses of BCG are administered intravesically.

10. The method of any one of claims 3-9, wherein the gemcitabine is administered concurrently with the oncolytic adenovirus.

11. The method of any one of claims 3-9, wherein the gemcitabine and oncolytic adenovirus are administered sequentially.

12. The method of any one of claims 3-9 and 11, wherein the method comprises intravesical administration of the oncolytic adenovirus followed by intravesical administration of gemcitabine on the same day of treatment.

13. The method of any one of claims 3-9, 11, and 12, wherein the method comprises intravesical administration of the oncolytic adenovirus followed immediately by intravesical administration of gemcitabine.

14. The method of any one of claims 3-9 and 11-13, wherein the gemcitabine and the oncolytic adenovirus on different days or different weeks of a treatment course.

15. The method of any one of claims 1-14, wherein the method comprises one or more treatment courses each comprising administering the oncolytic adenovirus weekly.

16. The method of claim 15, wherein each treatment courses comprises administering the oncolytic adenovirus weekly for about 1 week to about 6 weeks.

17. The method of any one of claims 1-16, wherein the method comprises at least a first induction phase comprising administering the oncolytic adenovirus to the individual once per week for six weeks.

18. The method of claim 17, wherein the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic adenovirus to the individual every three or six months.

19. The method of claim 18, wherein the maintenance phase comprises administering the oncolytic adenovirus weekly for three weeks every three or six months.

20. The method of claim 18 or 19, wherein the start of the first induction phase and the start of the maintenance phase are separated by about three months or about six months.

21. The method of any one of claims 18-20, wherein the oncolytic adenovirus is administered to the individual once per week for six weeks on month zero during the first induction phase and is reevaluated at month three or around week 11 following the start of the first induction phase.

22. The method of claim 21, wherein the individual begins the maintenance phase at month three or around week 13 following the start of the first induction phase.

23. The method of claim 22, wherein the maintenance phase comprises administering the oncolytic adenovirus once per week for three weeks every three months for nine months and subsequently administering the oncolytic adenovirus once per week for three weeks every six months.

24. The method of claim 21, wherein the individual receives a second induction phase comprising administration of the oncolytic adenovirus once per week for six weeks at month three or around week 13 following the start of the first induction phase.

25. The method of claim 24, wherein the maintenance phase comprises administering the oncolytic adenovirus once per week for three weeks every three months for six months and subsequently administering the oncolytic adenovirus once per week for three weeks every six months.

26. The method of any one of claims 18-25, wherein the maintenance phase comprises: (i) administering the oncolytic adenovirus once per week for three weeks every three months for six to nine months, and subsequently (ii) administering the oncolytic adenovirus once per week for three weeks every six months.

27. The method of any one of claims 3-26, wherein the gemcitabine is administered in combination with the oncolytic adenovirus, wherein the method comprises at least a first 6- week induction phase comprising administering the oncolytic adenovirus and gemcitabine to the individual on weeks 1, 2, 3, 4, 5, and 6.

28. The method of claim 27, wherein the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering the oncolytic adenovirus and gemcitabine to the individual every three or six months.

29. The method of claim 28, wherein the 3-week treatment comprises administering the oncolytic adenovirus and gemcitabine weekly on weeks 1, 2, and 3.

30. The method of claim 28 or 29, wherein the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months.

31. The method of any one of claims 27-30, wherein the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase.

32. The method of claim 31, wherein the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase.

33. The method of claim 32, wherein the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months.

34. The method of claim 31, wherein the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase.

35. The method of claim 34, wherein the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.

36. The method of any one of claims 3-26, wherein the method comprises at least a first 6-week induction phase comprising: i) administering the oncolytic adenovirus to the individual on weeks 1, 2, 4 and 5; and ii) administering gemcitabine to the individual on weeks 3 and 6.

37. The method of claim 36, wherein the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering the oncolytic adenovirus and gemcitabine to the individual every three or six months.

38. The method of claim 37, wherein the 3-week treatment comprises administering the oncolytic adenovirus weekly on weeks 1 and 2 followed by administering gemcitabine in week 3.

39. The method of claim 37 or 38, wherein the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months.

40. The method of any one of claims 36-39, wherein the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase.

41. The method of claim 40, wherein the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase.

42. The method of any one of claims 41, wherein the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months.

43. The method of claim 41, wherein the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase.

44. The method of claim 43, wherein the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.

45. The method of any one of claims 3-44, wherein the gemcitabine is administered at a dose of between 0.1 g and 5 g, optionally at a dose of about 1g or about 2g.

46. The method of claim 45, wherein the gemcitabine is administered in 50 to 100 mL saline.

47. The method of any one of claims 1-46, wherein the oncolytic adenovirus is administered at a dose of about 1 x 108to about 1 x 1014viral particles.

48. The method of claim 47, wherein the oncolytic adenovirus is administered at a dose of about 1 x 1012viral particles.

49. The method of any one of claims 1-48, wherein the oncolytic adenovirus is administered in a volume of between about 50 mL and about 100 mL.

50. The method of any one of claims 1-49, further comprising intravesically administering to the individual a transduction enhancing agent prior to the administration of the oncolytic adenovirus.

51. The method of claim 50, wherein the transduction enhancing agent is N-Dodecyl-P- D-maltoside (DDM).

52. The method of any one of claims 1-49, wherein the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic adenovirus.

53. The method of claim 52, wherein the oncolytic adenovirus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash.

54. The method of claim 52, wherein the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic adenovirus.

55. The method of claim 54, wherein the oncolytic adenovirus is administered directly after the single dose of DDM, without intravesical administration of a saline wash.

56. The method of claim 52, wherein the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic adenovirus.

57. The method of claim 56, wherein the method comprises intravesically administering a saline wash before administering a first and second dose of DDM to the individual.

58. The method of claim 56 or 57, wherein the method comprises intravesically administering a saline wash after administering a first and second dose of DDM to the individual, prior to administering the oncolytic adenovirus.

59. The method of any one of claims 51-58, wherein the DDM is administered at a concentration of about 0.1%.

60. The method of any one of claims 51-59, wherein the DDM is administered at a volume of between about 50 mL and about 100 mL.

61. The method of any one of claims 1-60, wherein the individual has carcinoma in situ.

62. The method of claim 61, wherein the individual has a concurrent papillary carcinoma of high-grade Ta or T1 stage.

63. The method of claim 61, wherein the individual does not have a concurrent papillary carcinoma of high-grade Ta or T1 stage.

64. The method of any one of claims 1-60, wherein the individual has a papillary carcinoma of high-grade Ta or T1 stage.

65. The method of claim 64, wherein the individual does not have concurrent carcinoma in situ.

66. The method of any one of claims 1-65, wherein the individual has received transurethral resection of bladder tumor (TURBT) prior to administration of the oncolytic adenovirus.

67. The method of claim 66, wherein the bladder cancer has been completely resected by TURBT prior to administration of the oncolytic adenovirus.

68. The method of claim 66 or 67, wherein the bladder cancer is recurrent after complete resection of one or more prior bladder tumors by TURBT.

69. The method of any one of claims 1-68, wherein the oncolytic adenovirus preferentially replicates in a cancer cell.

70. The method of claim 69, wherein the cancer cell is defective in the Rb pathway.

71. The method of any one of claims 1-70, wherein the tumor cell-specific promoter is an E2F-1 promoter.

72. The method of claim 71, wherein the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO: 1.

73. The method of any one of claims 1-72, wherein the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTa .

74. The method of claim 73, wherein the immune-related molecule is GM-CSF.

75. The method of any one of claims 1-74, wherein the heterologous gene is operably linked to a viral promoter.

76. The method of claim 75, wherein the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of El A, E1B, and E4.

77. The method of claim 75 or 76, wherein the heterologous gene is operably linked to an El promoter or an E3 promoter.

78. The method of any one of claims 1-77, wherein the oncolytic adenovirus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF.

79. The method of any one of claims 1-78, wherein the oncolytic adenovirus is cretostimogene.

80. The method of any one of claims 1-79, wherein the individual is human.

81. A kit for treating high-risk non-muscle invasive bladder cancer (HR-NMIBC) in an individual, the kit comprising: a) an oncolytic adenovirus; b) gemcitabine; and c) a device for intravesically administering the oncolytic adenovirus, gemcitabine, or both the oncolytic adenovirus and gemcitabine; wherein the oncolytic adenovirus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule.

82. The kit of claim 81, wherein the oncolytic adenovirus preferentially replicates in a cancer cell.

83. The kit of claim 82, wherein the cancer cell is defective in the Rb pathway.

84. The kit of any one of claims 81-83, wherein the tumor cell-specific promoter is an E2F-1 promoter.

85. The kit of claim 84, wherein the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO: 1.

86. The kit of any one of claims 81-85, wherein the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTa .

87. The kit of claim 86, wherein the immune-related molecule is GM-CSF.

88. The kit of any one of claims 81-87, wherein the heterologous gene is operably linked to a viral promoter.

89. The kit of any one of claims 81-88, wherein the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of El A, E1B, and E4.

90. The kit of any one of claims 81-89, wherein the heterologous gene is operably linked to an El promoter or an E3 promoter.

91. The kit of any one of claims 81-90, wherein the oncolytic adenovirus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 isreplaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF.

92. The kit of any one of claims 81-91, wherein the oncolytic adenovirus is cretostimogene.

93. The kit of any one of claims 81-92, comprising a dosage unit of gemcitabine in an amount of between 0.1 g and 5 g, optionally around 1 g or around 2 g.

94. The kit of any one of claims 81-93, comprising a dosage unit of the oncolytic adenovirus in an amount of between about 1 x 108and about 1 x 1014viral particles, optionally around 1 x 1012viral particles.

Citation Information

Patent Citations

  • Pharmaceutical kit and method for treating cancer

    US20130084263A1

  • Methods of treating bladder cancer

    US20220331384A1

  • Methods of treating solid or lymphatic tumors by combination therapy

    US20230052537A1